WorldWideScience

Sample records for aluminum tolerance genes

  1. Prospecting sugarcane genes involved in aluminum tolerance

    Directory of Open Access Journals (Sweden)

    Rodrigo D. Drummond

    2001-12-01

    Full Text Available Aluminum is one of the major factors that affect plant development in acid soils, causing a substantial reduction in yield in many crops. In South America, about 66% of the land surface is made up of acid soils where high aluminum saturation is one of the main limiting factors for agriculture. The biochemical and molecular basis of aluminum tolerance in plants is far from being completely understood despite a growing number of studies, and in the specific case of sugarcane there are virtually no reports on the effects of gene regulation on aluminum stress. The objective of the work presented in this paper was to prospect the sugarcane expressed sequence tag (SUCEST data bank for sugarcane genes related to several biochemical pathways known to be involved in the responses to aluminum toxicity in other plant species and yeast. Sugarcane genes similar to most of these genes were found, including those coding for enzymes that alleviate oxidative stress or combat infection by pathogens and those which code for proteins responsible for the release of organic acids and signal transducers. The role of these genes in aluminum tolerance mechanisms is reviewed. Due to the high level of genomic conservation in related grasses such as maize, barley, sorghum and sugarcane, these genes may be valuable tools which will help us to better understand and to manipulate aluminum tolerance in these species.Alumínio (Al é um dos principais fatores que afetam o desenvolvimento de plantas em solos ácidos, reduzindo substancialmente a produtividade agrícola. Na América do Sul, cerca de 66% da superfície do solo apresenta acidez, onde a alta saturação de alumínio é uma das maiores limitações à prática agrícola. Apesar do crescente número de estudos, uma compreensão completa das bases bioquímicas e moleculares da tolerância ao alumínio em plantas está longe de ser alcançada. No caso da cana-de-açúcar, não há nada publicado sobre a regulação g

  2. Association and linkage analysis of aluminum tolerance genes in maize.

    Directory of Open Access Journals (Sweden)

    Allison M Krill

    Full Text Available BACKGROUND: Aluminum (Al toxicity is a major worldwide constraint to crop productivity on acidic soils. Al becomes soluble at low pH, inhibiting root growth and severely reducing yields. Maize is an important staple food and commodity crop in acidic soil regions, especially in South America and Africa where these soils are very common. Al exclusion and intracellular tolerance have been suggested as two important mechanisms for Al tolerance in maize, but little is known about the underlying genetics. METHODOLOGY: An association panel of 282 diverse maize inbred lines and three F2 linkage populations with approximately 200 individuals each were used to study genetic variation in this complex trait. Al tolerance was measured as net root growth in nutrient solution under Al stress, which exhibited a wide range of variation between lines. Comparative and physiological genomics-based approaches were used to select 21 candidate genes for evaluation by association analysis. CONCLUSIONS: Six candidate genes had significant results from association analysis, but only four were confirmed by linkage analysis as putatively contributing to Al tolerance: Zea mays AltSB like (ZmASL, Zea mays aluminum-activated malate transporter2 (ALMT2, S-adenosyl-L-homocysteinase (SAHH, and Malic Enzyme (ME. These four candidate genes are high priority subjects for follow-up biochemical and physiological studies on the mechanisms of Al tolerance in maize. Immediately, elite haplotype-specific molecular markers can be developed for these four genes and used for efficient marker-assisted selection of superior alleles in Al tolerance maize breeding programs.

  3. Overexpression of a soybean ariadne-like ubiquitin ligase gene GmARI1 enhances aluminum tolerance in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Xiaolian Zhang

    Full Text Available Ariadne (ARI subfamily of RBR (Ring Between Ring fingers proteins have been found as a group of putative E3 ubiquitin ligases containing RING (Really Interesting New Gene finger domains in fruitfly, mouse, human and Arabidopsis. Recent studies showed several RING-type E3 ubiquitin ligases play important roles in plant response to abiotic stresses, but the function of ARI in plants is largely unknown. In this study, an ariadne-like E3 ubiquitin ligase gene was isolated from soybean, Glycine max (L. Merr., and designated as GmARI1. It encodes a predicted protein of 586 amino acids with a RBR supra-domain. Subcellular localization studies using Arabidopsis protoplast cells indicated GmARI protein was located in nucleus. The expression of GmARI1 in soybean roots was induced as early as 2-4 h after simulated stress treatments such as aluminum, which coincided with the fact of aluminum toxicity firstly and mainly acting on plant roots. In vitro ubiquitination assay showed GmARI1 protein has E3 ligase activity. Overexpression of GmARI1 significantly enhanced the aluminum tolerance of transgenic Arabidopsis. These findings suggest that GmARI1 encodes a RBR type E3 ligase, which may play important roles in plant tolerance to aluminum stress.

  4. Engineering high-level aluminum tolerance in barley with the ALMT1 gene.

    Science.gov (United States)

    Delhaize, Emmanuel; Ryan, Peter R; Hebb, Diane M; Yamamoto, Yoko; Sasaki, Takayuki; Matsumoto, Hideaki

    2004-10-19

    Acidity is a serious limitation to plant production on many of the world's agricultural soils. Toxic aluminium (Al) cations solubilized by the acidity rapidly inhibit root growth and limit subsequent uptake of water and nutrients. Recent work has shown that the ALMT1 gene of wheat (Triticum aestivum) encodes a malate transporter that is associated with malate efflux and Al tolerance. We generated transgenic barley (Hordeum vulgare) plants expressing ALMT1 and assessed their ability to exude malate and withstand Al stress. ALMT1 expression in barley conferred an Al-activated efflux of malate with properties similar to those of Al-tolerant wheat. The transgenic barley showed a high level of Al tolerance when grown in both hydroponic culture and on acid soils. These findings provide additional evidence that ALMT1 is a major Al-tolerance gene and demonstrate its ability to confer effective tolerance to acid soils through a transgenic approach in an important crop species. PMID:15471989

  5. Engineering high-level aluminum tolerance in barley with the ALMT1 gene

    OpenAIRE

    Delhaize, Emmanuel; Ryan, Peter R.; Hebb, Diane M.; Yamamoto, Yoko; Sasaki, Takayuki; Matsumoto, Hideaki

    2004-01-01

    Acidity is a serious limitation to plant production on many of the world's agricultural soils. Toxic aluminium (Al) cations solubilized by the acidity rapidly inhibit root growth and limit subsequent uptake of water and nutrients. Recent work has shown that the ALMT1 gene of wheat (Triticum aestivum) encodes a malate transporter that is associated with malate efflux and Al tolerance. We generated transgenic barley (Hordeum vulgare) plants expressing ALMT1 and assessed their ability to exude m...

  6. An ALMT1 gene cluster controlling aluminium (aluminum) tolerance at the Alt4 locus of rye (Secale cereale L.)

    Science.gov (United States)

    Aluminium toxicity is a major problem in agriculture worldwide. Among the cultivated triticeae, rye (Secale cereale L.) is one of the most Al-tolerant and represents an important potential source of Al-tolerance for improvement of wheat. The Alt4 Al-tolerance locus of rye contains a cluster of genes...

  7. Aluminum tolerance association mapping in triticale

    Directory of Open Access Journals (Sweden)

    Niedziela Agnieszka

    2012-02-01

    Full Text Available Abstract Background Crop production practices and industrialization processes result in increasing acidification of arable soils. At lower pH levels (below 5.0, aluminum (Al remains in a cationic form that is toxic to plants, reducing growth and yield. The effect of aluminum on agronomic performance is particularly important in cereals like wheat, which has promoted the development of programs directed towards selection of tolerant forms. Even in intermediately tolerant cereals (i.e., triticale, the decrease in yield may be significant. In triticale, Al tolerance seems to be influenced by both wheat and rye genomes. However, little is known about the precise chromosomal location of tolerance-related genes, and whether wheat or rye genomes are crucial for the expression of that trait in the hybrid. Results A mapping population consisting of 232 advanced breeding triticale forms was developed and phenotyped for Al tolerance using physiological tests. AFLP, SSR and DArT marker platforms were applied to obtain a sufficiently large set of molecular markers (over 3000. Associations between the markers and the trait were tested using General (GLM and Multiple (MLM Linear Models, as well as the Statistical Machine Learning (SML approach. The chromosomal locations of candidate markers were verified based on known assignments of SSRs and DArTs or by using genetic maps of rye and triticale. Two candidate markers on chromosome 3R and 9, 15 and 11 on chromosomes 4R, 6R and 7R, respectively, were identified. The r2 values were between 0.066 and 0.220 in most cases, indicating a good fit of the data, with better results obtained with the GML than the MLM approach. Several QTLs on rye chromosomes appeared to be involved in the phenotypic expression of the trait, suggesting that rye genome factors are predominantly responsible for Al tolerance in triticale. Conclusions The Diversity Arrays Technology was applied successfully to association mapping studies

  8. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes

    2002-01-01

    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  9. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) activated root malate and citrate exudation play an important role in Al tolerance in many plant species. AtALMT1, an Al-activated malate transporter, is a major contributor to Arabidopsis Al tolerance. Here, we demonstrate that a second, unrelated gene, AtMATE, encodes an Arabidopsi...

  10. Positional Cloning and Characterization of AltSB, a Major Aluminum Tolerance Gene in Sorghum: Toward the Identification of the Molecular and Physiological basis of Allelic effects

    Science.gov (United States)

    Aluminum toxicity is a major constraint for agriculture on acid soils, which comprise over half of the world’s potentially arable lands. However, the molecular basis underlying the most accepted tolerance mechanism based on Al-induced organic acid release by root apices, is only now being elucidate...

  11. Proteomics of aluminum tolerance in plants.

    Science.gov (United States)

    Zheng, Lu; Lan, Ping; Shen, Ren Fang; Li, Wen Feng

    2014-03-01

    Aluminum (Al) toxicity is a major constraint for plant root development and growth as well as crop yield in acidic soils, which constitute approximately 40% of the potentially arable lands worldwide. The mechanisms of Al tolerance in plants are not well understood. As a whole systems approach, proteomic techniques have proven to be crucial as a complementary strategy to explore the mechanism in Al toxicity. Review here focuses on the potential of proteomics to unravel the common and plant species-specific changes at proteome level under Al stress, via comparative analysis of the Al-responsive proteins uncovered by recent proteomic studies using 2DE. Understanding the mechanisms of Al tolerance in plants is critical to generate Al resistance crops for developing sustainable agriculture practices, thereby contributing to food security worldwide.

  12. Enhancement of aluminum tolerance in wheat by addition of chromosomes from the wild relative Leymus racemosus

    OpenAIRE

    Mohammed, Yasir Serag Alnor; Eltayeb, Amin Elsadig; Tsujimoto, Hisashi

    2013-01-01

    Aluminum (Al) toxicity is the key factor limiting wheat production in acid soils. Soil liming has been used widely to increase the soil pH, but due to its high cost, breeding tolerant cultivars is more cost-effective mean to mitigate the problem. Tolerant cultivars could be developed by traditional breeding, genetic transformation or introgression of genes from wild relatives. We used 30 wheat alien chromosome addition lines to identify new genetic resources to improve wheat tolerance to Al a...

  13. Natural variation underlies alterations in Nramp aluminum transporter (NRAT1) expression and function that play a key role in rice aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) toxicity is a major constraint for crop production on acid soils that comprise approximately 50% of arable land in the tropics and subtropics. Rice is the most Al tolerant cereal crop, and offers a good model for identifying Al tolerance genes and mechanisms. Here we investigated natur...

  14. Comparative Proteomic Analysis of Aluminum Tolerance in Tibetan Wild and Cultivated Barleys

    OpenAIRE

    Dai, Huaxin; Cao, Fangbin; Chen, Xianhong; Zhang, Mian; Ahmed, Imrul Mosaddek; Chen, Zhong-Hua; Li, Chengdao; Zhang, Guoping; Wu, Feibo

    2013-01-01

    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation t...

  15. Aluminum exclusion and aluminum tolerance in woody plants

    OpenAIRE

    Brunner, Ivano; Sperisen, Christoph

    2013-01-01

    The aluminum (Al) cation Al3 + is highly rhizotoxic and is a major stress factor to plants on acid soils, which cover large areas of tropical and boreal regions. Many woody plant species are native to acid soils and are well adapted to high Al3 + conditions. In tropical regions, both woody Al accumulator and non-Al accumulator plants occur, whereas in boreal regions woody plants are non-Al accumulators. The mechanisms of these adaptations can be divided into those that facilitate the exclusio...

  16. 40 CFR 180.415 - Aluminum tris (O-ethylphosphonate); tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Aluminum tris (O-ethylphosphonate... Tolerances § 180.415 Aluminum tris (O-ethylphosphonate); tolerances for residues. (a) General. Tolerances are established for residues of the fungicide aluminum tris(O-ethylphosphonate) in or on the following...

  17. Enhancement of aluminum tolerance in wheat by addition of chromosomes from the wild relative Leymus racemosus.

    Science.gov (United States)

    Mohammed, Yasir Serag Alnor; Eltayeb, Amin Elsadig; Tsujimoto, Hisashi

    2013-12-01

    Aluminum (Al) toxicity is the key factor limiting wheat production in acid soils. Soil liming has been used widely to increase the soil pH, but due to its high cost, breeding tolerant cultivars is more cost-effective mean to mitigate the problem. Tolerant cultivars could be developed by traditional breeding, genetic transformation or introgression of genes from wild relatives. We used 30 wheat alien chromosome addition lines to identify new genetic resources to improve wheat tolerance to Al and to identify the chromosomes harboring the tolerance genes. We evaluated these lines and their wheat background Chinese Spring for Al tolerance in hydroponic culture at various Al concentrations. We also investigated Al uptake, oxidative stress and cell membrane integrity. The L. racemosus chromosomes A and E significantly enhanced the Al tolerance of the wheat in term of relative root growth. At the highest Al concentration tested (200 μM), line E had the greatest tolerance. The introgressed chromosomes did not affect Al uptake of the tolerant lines. We attribute the improved tolerance conferred by chromosome E to improved cell membrane integrity. Chromosome engineering with these two lines could produce Al-tolerant wheat cultivars. PMID:24399913

  18. Toxicity and tolerance of aluminum in plants: tailoring plants to suit to acid soils.

    Science.gov (United States)

    Sade, Hemalatha; Meriga, Balaji; Surapu, Varalakshmi; Gadi, Jogeswar; Sunita, M S L; Suravajhala, Prashanth; Kavi Kishor, P B

    2016-04-01

    Aluminum (Al) stress is one of the serious limiting factors in plant productivity in acidic soils, which constitute about 50 % of the world's potentially arable lands and causes anywhere between 25 and 80 % of yield losses depending upon the species. The mechanism of Al toxicity and tolerance has been examined in plants, which is vital for crop improvement and enhanced food production in the future. Two mechanisms that facilitate Al tolerance in plants are Al exclusion from the roots and the ability to tolerate Al in the symplast or both. Although efforts have been made to unravel Al-resistant factors, many aspects remain unclear. Certain gene families such as MATE, ALMT, ASR, and ABC transporters have been implicated in some plants for resistance to Al which would enhance the opportunities for creating crop plants suitable to grow in acidic soils. Though QTLs have been identified related to Al-tolerance, no crop plant that is tolerant to Al has been evolved so far using breeding or molecular approaches. The remarkable changes that plants experience at the physiological, biochemical and molecular level under Al stress, the vast array of genes involved in Al toxicity-tolerance, the underlying signaling events and the holistic image of the molecular regulation, and the possibility of creating transgenics for Al tolerance are discussed in this review. PMID:26796895

  19. Rice's Salt Tolerance Gene Cloned

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    @@ In cooperation with US colleagues, CAS researchers have made significant progress in their studies into functional genes for key agronomic traits by cloning SKC1, a salt-tolerant functional gene of rice and making clear its biological functions and mechanisms. This pioneering work,which was reported in the Oct. issue of Nature Genetics (37:1141-1146), is believed to hold promise to increase the output of the crop plant in this country.

  20. Radiation Tolerance of Aluminum Microwave Kinetic Inductance Detector

    Science.gov (United States)

    Karatsu, K.; Dominjon, A.; Fujino, T.; Funaki, T.; Hazumi, M.; Irie, F.; Ishino, H.; Kida, Y.; Matsumura, T.; Mizukami, K.; Naruse, M.; Nitta, T.; Noguchi, T.; Oka, N.; Sekiguchi, S.; Sekimoto, Y.; Sekine, M.; Shu, S.; Yamada, Y.; Yamashita, T.

    2016-08-01

    Microwave kinetic inductance detector (MKID) is one of the candidates of focal plane detector for future satellite missions such as LiteBIRD. For the space use of MKIDs, the radiation tolerance is one of the challenges to be characterized prior to the launch. Aluminum (Al) MKIDs with 50 nm thickness on silicon substrate and on sapphire substrate were irradiated with a proton beam of 160 MeV at the heavy ion medical accelerator in Chiba. The total water-equivalent absorbed dose was ˜ 10 krad which should simulate the worst radiation absorption of 5 years observation at the Lagrange point L2. We measured characteristics of these MKIDs before and after the irradiation. We found no significant changes on resonator quality factor, responsivity, and recombination time of quasi-particles. The change on electrical noise equivalent power was also evaluated, and no significant increase was found at the noise level of O(10^{-18}) W/√{ Hz }.

  1. Brassica oleracea MATE encodes a citrate transporter and enhances aluminum tolerance in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Xinxin; Li, Ren; Shi, Jin; Wang, Jinfang; Sun, Qianqian; Zhang, Haijun; Xing, Yanxia; Qi, Yan; Zhang, Na; Guo, Yang-Dong

    2014-08-01

    The secretion of organic acid anions from roots is an important mechanism for plant aluminum (Al) tolerance. Here we report cloning and characterizing BoMATE (KF031944), a multidrug and toxic compound extrusion (MATE) family gene from cabbage (Brassica oleracea). The expression of BoMATE was more abundant in roots than in shoots, and it was highly induced by Al treatment. The (14)C-citrate efflux experiments in oocytes demonstrated that BoMATE is a citrate transporter. Electrophysiological analysis and SIET analysis of Xenopus oocytes expressing BoMATE indicated BoMATE is activated by Al. Transient expression of BoMATE in onion epidermal cells demonstrated that it localized to the plasma membrane. Compared with the wild-type Arabidopsis, the transgenic lines constitutively overexpressing BoMATE enhanced Al tolerance and increased citrate secretion. In addition, Arabidopsis transgenic lines had a lower K(+) efflux and higher H(+) efflux, in the presence of Al, than control wild type in the distal elongation zone (DEZ). This is the first direct evidence that MATE protein is involved in the K(+) and H(+) flux in response to Al treatment. Taken together, our results show that BoMATE is an Al-induced citrate transporter and enhances aluminum tolerance in Arabidopsis thaliana.

  2. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.

    Science.gov (United States)

    Dai, Huaxin; Cao, Fangbin; Chen, Xianhong; Zhang, Mian; Ahmed, Imrul Mosaddek; Chen, Zhong-Hua; Li, Chengdao; Zhang, Guoping; Wu, Feibo

    2013-01-01

    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A) specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance. PMID:23691047

  3. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.

    Directory of Open Access Journals (Sweden)

    Huaxin Dai

    Full Text Available Aluminum (Al toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance.

  4. The role of mycorrhizal symbiosis in aluminum and phosphorus interactions in relation to aluminum tolerance in soybean.

    Science.gov (United States)

    Zhang, Shuang; Zhou, Jia; Wang, Guihua; Wang, Xiurong; Liao, Hong

    2015-12-01

    Arbuscular mycorrhizal (AM) fungi protect plants against aluminum (Al) toxicity, but the mechanisms of Al and phosphorus (P) interactions in relation to Al tolerance in mycorrhizal plants are only poorly understood. In this study, varying Al and P treatments were applied to soybean plants cultivated in the presence or absence of three different AM fungi. The results showed that plants in symbiotic association with Gigaspora margarita displayed higher Al tolerance than Rhizophagus irregularis or Glomus claroideum. The effectiveness of G. margarita appeared to be associated with more abundant arbuscules and less affected intraradical hyphae compared to no Al controls. The highest levels of Al toxicity mitigation were observed with the combination of high P availability and AM fungal inoculation, which was associated with a concomitant increase in the expression of the AM-inducible phosphate (Pi) transporter gene GmPT9 in soybean. Taken together, these results suggest that AM symbiosis can alleviate Al toxicity in soybean through enhanced P nutrition, as well as, the alteration of the abundance of mycorrhizal infection structures. These findings highlight the importance of P nutrition status in ameliorating Al toxicity in mycorrhizal plants. PMID:26278539

  5. Rapid screening for aluminum tolerance in maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Carlos Daniel Giaveno

    2000-12-01

    Full Text Available A significant decrease in maize grain yield due to aluminum toxicity is considered to be one of the most important agricultural problems for tropical regions. Genetic improvement is a useful approach to increase maize yield in acid soils, but this requires a rapid and reliable method to discriminate between genotypes. In our work we investigated the feasibility of using hematoxylin staining (HS to detect Al-tolerant plants at the seedling stage. The original population along with two populations obtained after one cycle of divergent selection were evaluated by net root growth (NRG and HS after 7 days in nutrient solution. Results showed a negative correlation between NRG and HS in all populations, in which sensitive plants, characterized by low NRG, exhibited more intense staining than tolerant plants. These results indicate that HS is a useful procedure for selecting Al-tolerant maize seedlings.A importante diminuição nos rendimentos de milho causados pela toxidez produzida pelo alumínio é considerada um dos mais importantes problemas nas regiões tropicais. O melhoramento genético é uma metodologia útil para aumentar os rendimentos do milho em solos ácidos, requerendo um método rápido e seguro que permita diferenciar os diferentes genótipos. O objetivo deste trabalho foi avaliar a possibilidade de utilizar a técnica da coloração com hematoxilina (HS na detecção de plântulas tolerantes ao alumínio. Duas populações obtidas de um ciclo de seleção divergente e a original, foram avaliadas depois de sete dias em solução nutritiva utilizando os parâmetros NRG (crescimento líquido da raiz principal e HS. Os resultados apresentaram uma correlação negativa entre NRG e HS em todas as populações devido ao fato de que as plântulas suscetíveis, caracterizadas por um baixo NRG, apresentaram uma coloração mais intensa do que as tolerantes. Nossos resultados permitem concluir que a técnica de coloração com hematoxilina

  6. An Aluminum-Inducible IREG Gene is Required for Internal Detoxification of Aluminum in Buckwheat.

    Science.gov (United States)

    Yokosho, Kengo; Yamaji, Naoki; Mitani-Ueno, Namiki; Shen, Ren Fang; Ma, Jian Feng

    2016-06-01

    Buckwheat (Fagopyrum esculentum Moench) is able to detoxify aluminum (Al) both externally and internally, but the molecular mechanisms underlying its high Al tolerance are not understood. We functionally characterized a gene (FeIREG1) belonging to IRON REGULATED/ferroportin in buckwheat, which showed high expression in our previous genome-wide transcriptome analysis. FeIREG1 was mainly expressed in the roots, and its expression was up-regulated by Al, but not by other metals and low pH. Furthermore, in contrast to AtIREG1 and AtIREG2 in Arabidopsis, the expression of FeIREG1 was not induced by Fe deficiency. Spatial expression analysis showed that the Al-induced expression of FeIREG1 was found in the root tips and higher expression was detected in the outer layers of this part. Immunostaining also showed that FeIREG1 was localized at the outer cell layers in the root tip. A FeIREG1-green fluorescent protein (GFP) fusion protein was localized to the tonoplast when transiently expressed in onion epidermal cells. Overexpression of FeIREG1 in Arabidopsis resulted in increased Al tolerance, but did not alter the tolerance to Cd, Co and Fe. The tolerance to Ni was slightly enhanced in the overexpression lines. Mineral analysis showed that the accumulation of total root Al and other essential mineral elements was hardly altered in the overexpression lines. Taken together, our results suggest that FeIREG1 localized at the tonoplast plays an important role in internal Al detoxification by sequestering Al into the root vacuoles in buckwheat. PMID:27053033

  7. Genetic architecture of aluminum tolerance in rice (Oryza sativa determined through genome-wide association analysis and QTL mapping.

    Directory of Open Access Journals (Sweden)

    Adam N Famoso

    2011-08-01

    Full Text Available Aluminum (Al toxicity is a primary limitation to crop productivity on acid soils, and rice has been demonstrated to be significantly more Al tolerant than other cereal crops. However, the mechanisms of rice Al tolerance are largely unknown, and no genes underlying natural variation have been reported. We screened 383 diverse rice accessions, conducted a genome-wide association (GWA study, and conducted QTL mapping in two bi-parental populations using three estimates of Al tolerance based on root growth. Subpopulation structure explained 57% of the phenotypic variation, and the mean Al tolerance in Japonica was twice that of Indica. Forty-eight regions associated with Al tolerance were identified by GWA analysis, most of which were subpopulation-specific. Four of these regions co-localized with a priori candidate genes, and two highly significant regions co-localized with previously identified QTLs. Three regions corresponding to induced Al-sensitive rice mutants (ART1, STAR2, Nrat1 were identified through bi-parental QTL mapping or GWA to be involved in natural variation for Al tolerance. Haplotype analysis around the Nrat1 gene identified susceptible and tolerant haplotypes explaining 40% of the Al tolerance variation within the aus subpopulation, and sequence analysis of Nrat1 identified a trio of non-synonymous mutations predictive of Al sensitivity in our diversity panel. GWA analysis discovered more phenotype-genotype associations and provided higher resolution, but QTL mapping identified critical rare and/or subpopulation-specific alleles not detected by GWA analysis. Mapping using Indica/Japonica populations identified QTLs associated with transgressive variation where alleles from a susceptible aus or indica parent enhanced Al tolerance in a tolerant Japonica background. This work supports the hypothesis that selectively introgressing alleles across subpopulations is an efficient approach for trait enhancement in plant breeding programs

  8. Melhoramento do trigo: I. Hereditariedade da tolerância à toxicidade do alumínio Wheat breeding: I - Inheritance of tolerance to aluminum toxicity in wheat

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1981-01-01

    áveis pela tolerância a essas concentrações mostrou uma quebra gradual da dominância à medida que a concentração de alumínio foi aumentada.Four wheat cultivars showing different reactions to Al toxicity under field conditions and presenting a great variation in plant height were screened in nutrient solution with different concentrations of aluminum. The tall Brazilian cultivar, 'BH-1146' was tolerant to 10 ppm of Al; 'Atlas-66' developed in North Carolina was tolerant to 6 ppm but moderately tolerant to 10 ppm of aluminum. The dwarf cultivar Tordo, a Tom Thumb source of dwarfism, was tolerant to 2 ppm but totally sensitive at 6 ppm. The Mexican semidwarf cultivar Siete Cerros, a Niorin-10 derivative, was sensitive to 2 ppm of Al. Parents, F1 and F2 generations from the crosses between tolerant ('BH-1146' and 'Atlas-66' and sensitive ('Tordo' and 'Siete Cerros' cultivars to 6 ppm were screened under 3 ppm and the same genotypes plus the backcrosses to both types of parents (BCª and BCb were screened at 6 ppm. Parents, F1 and F2 progenies from BCª and BCb involving the cross BH-1146/Siete Cerros were retested under 3 and 6 ppm of Al. Parents, F1 and F2 for the cross between 'BH-1146' and 'Atlas-66' were screened under 6 and 10 ppm of Al. At 2 and 3 ppm of Al, parents, F1 and F2 from the cross Tordo/Siete Cerros were studied. The results obtained suggest that 'BH-1146' differs from Atlas-66, Siete Cerros and Tordo by one pair of dominant gene. This pair of gene was efficient even at 10 ppm of aluminum, so should be used in a breeding program towards aluminum tolerance when high levels of this element are involved. The cultivar Atlas-66 showed to have two pairs of dominant genes for Al tolerance but when the aluminum concentration increased from 3 and 6 to 10 ppm these pairs of genes became less efficient. 'Tordo' differs from 'Siete Cerros' by a pair of dominant gene for tolerance at 2 ppm of Al. So 'Tordo' would be useful as a source of tolerance when low levels of

  9. Interactions between nitric oxide and plant hormones in aluminum tolerance

    OpenAIRE

    He, Huyi; He, Longfei; Gu, Minghua

    2012-01-01

    Nitric oxide (NO) is involved, together with plant hormones, in the adaptation to Al stress in plants. However, the mechanism by which NO and plant hormones interplay to improve Al tolerance are still unclear. We have recently shown that patterns of plant hormones alteration differ between rye and wheat under Al stress. NO may enhance Al tolerance by regulating hormonal equilibrium in plants, as a regulator of plant hormones signaling. In this paper, some unsolved issues are discussed based o...

  10. Effects of exogenous salicylic acid on cell wall polysaccharides and aluminum tolerance of trichosanthes kirilowii

    International Nuclear Information System (INIS)

    A hydroponic experiment was conducted to study the effects of exogenous salicylic acid (SA) on root length, relative aluminum content in the apical cell wall, acid phosphatase (APA) and pectin methyl esterase (PME) activity, root pectin, hemicellulose 1(HC1), and hemicellulose 2 (HC2) contents of Anguo Trichosanthes kirilowii (Al-tolerant genotype) and Pujiang T. kirilowii (Al-sensitive genotype) under 800 micro mol/L of aluminum stress. The results showed that the growth of Al-tolerant Anguo T. kirilowii and Al-sensitive Pujiang T. kirilowii was inhibited when exposed to 800 micro mol/L of aluminum solution. APA and PME activities were also enhanced for both genotypes. The contents of relative aluminum, pectin, HC1, and HC2, as well as Al accumulation in the root tips were increased under aluminum toxicity. Pujiang T. kirilowii showed higher enzyme activity and cell wall polysaccharide contents than Anguo T. kirilowii. In addition, the root cell wall pectin, HC1, and HC2 contents of Pujiang T. kirilowii were increased by a large margin, showing its greater sensitivity to aluminum toxicity. Root length is an important indicator of aluminum toxicity, and has an important relationship with cell wall polysaccharide content. Aluminum toxicity led to the accumulation of pectin and high PME activity, and also increased the number of free carboxyl groups, which have more aluminum binding sites. Membrane skim increased extensively with the increase in APA activity, damaging membrane structure and function. Different SA concentrations can decrease enzyme activity and cell wall polysaccharide content to some extent. With the addition of different SA concentrations, the root relative aluminum content, cell wall polysaccharide content, APA and PME activities decreased. Aluminum toxicity to both genotypes of T. kirilowii was relieved in different degrees as exogenous SA concentration increased. Inter-simple sequence repeat (ISSR) marker was used to examine the genetic distance

  11. Molecular Characterization of Aluminium (aluminum) Tolerance in Rye

    Science.gov (United States)

    Aluminium (Al) toxicity, affecting around half of the world’s arable land, severely hinders the ability of crop plants to utilize moisture and nutrients by restricting root growth and function. Among the cultivated cereals, rye is the most Al-tolerant and represents an important potential source of ...

  12. Polyphenol-aluminum complex formation: Implications for aluminum tolerance in plants

    Science.gov (United States)

    Natural polyphenols may play an important role in aluminum detoxification in some plants. We examined the interaction between Al3+ and the purified high molecular weight polyphenols pentagalloyl glucose (940 Da) and oenothein B (1568 Da), and the related compound methyl gallate (184 Da) at pH 4 and ...

  13. Differences in physiological features associated with aluminum tolerance in Tibetan wild and cultivated barleys.

    Science.gov (United States)

    Dai, Huaxin; Zhao, Jing; Ahmed, Imrul Mosaddek; Cao, Fangbin; Chen, Zhong-Hua; Zhang, Guoping; Li, Chengdao; Wu, Feibo

    2014-02-01

    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is a treasure trove of useful genes and offers rich sources of genetic variation for crop improvement. Al-stress-hydroponic-experiments were performed, and the physiochemical characteristic of two contrasting Tibetan wild barley genotypes (Al-resistant XZ16 and Al-sensitive XZ61) and Al-resistant cv. Dayton were compared. Ultrastructure of chloroplasts and root cells in XZ16 was less injured than that in Dayton and XZ61. Moreover, XZ16 secreted significantly more malate besides citrate and exhibited less Al uptake and distribution than both of XZ61 and Dayton in response to Al stress, simultaneously maintained higher H⁺-, Ca²⁺Mg²⁺- and total-ATPase activities over XZ61. The protein synthesis inhibitor cycloheximide reduced citrate secretion from XZ16, but not from Dayton. In Tibetan wild barley, our findings highlight the significant correlations between Al tolerance, ATPase activity and citrate secretion, providing some insights into the physiological basis for Al-detoxification. PMID:24361508

  14. Molecular Characterization of Atlas 66-Derived Wheat Near-Isogenic Lines Contrasting in Aluminum (Al) Tolerance

    Institute of Scientific and Technical Information of China (English)

    GUO Pei-guo; BAI Gui-hua; LI Rong-hua; Brett Carver; Michael Baum

    2007-01-01

    Aluminum (Al) toxicity is the major limiting factor for wheat growth in acidic soils. Genetic improvement of Al tolerance is one of the most cost-effective solutions to improve wheat productivity. The objective of this study was to characterize near isogenic lines (NILs) contrasting in Al tolerance derived from Atlas 66 in the backgrounds of Al-sensitive cultivars Chisholm and Century using amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR). A total of 200 AFLP and 88 SSR primer pairs were screened and 12 markers (11 AFLPs and one SSR) were associated with Altolerance in NILs of at least one recurrent parental background. Among them, nine were linked to Al tolerance in the Chisholm-derived NILs, seven were associated with Al-tolerance in the Century-derived NILs, and three AFLPs derived from the primer combinations of pAG/mGCAG, pCAG/mAGC and pGTG/mGCG, and one SSR, Xwmc331 on chromosome4D, associated with Al tolerance in NILs of both recurrent parental backgrounds. Those common markers across two backgrounds may be the major marker loci associated with Al-tolerance in Atlas 66 and could be useful for marker-assisted breeding to improve Al tolerance in wheat. In addition, evaluation of Al tolerance among different genotypes using hematoxylin stain and relative root growth revealed that Atlas 66 was more tolerant to Al stress than the NILs, therefore suggested that the Al-tolerant NILs might not carry all Al-tolerance loci from Atlas 66 and inheritance of Al tolerance in Atlas 66 is more likely multigenic.

  15. Damage Tolerance Behavior of Friction Stir Welds in Aluminum Alloys

    Science.gov (United States)

    McGill, Preston; Burkholder, Jonathan

    2012-01-01

    Friction stir welding is a solid state welding process used in the fabrication of various aerospace structures. Self-reacting and conventional friction stir welding are variations of the friction stir weld process employed in the fabrication of cryogenic propellant tanks which are classified as pressurized structure in many spaceflight vehicle architectures. In order to address damage tolerance behavior associated with friction stir welds in these safety critical structures, nondestructive inspection and proof testing may be required to screen hardware for mission critical defects. The efficacy of the nondestructive evaluation or the proof test is based on an assessment of the critical flaw size. Test data describing fracture behavior, residual strength capability, and cyclic mission life capability of friction stir welds at ambient and cryogenic temperatures have been generated and will be presented in this paper. Fracture behavior will include fracture toughness and tearing (R-curve) response of the friction stir welds. Residual strength behavior will include an evaluation of the effects of lack of penetration on conventional friction stir welds, the effects of internal defects (wormholes) on self-reacting friction stir welds, and an evaluation of the effects of fatigue cycled surface cracks on both conventional and selfreacting welds. Cyclic mission life capability will demonstrate the effects of surface crack defects on service load cycle capability. The fracture data will be used to evaluate nondestructive inspection and proof test requirements for the welds.

  16. Nuclear Radiation Tolerance of Single Crystal Aluminum Nitride Ultrasonic Transducer

    Science.gov (United States)

    Reinhard, Brian; Tittmann, Bernhard R.; Suprock, Andrew

    Ultrasonic technologies offer the potential for high accuracy and resolution in-pile measurement of a range of parameters, including geometry changes, temperature, crack initiation and growth, gas pressure and composition, and microstructural changes. Many Department of Energy-Office of Nuclear Energy (DOE-NE) programs are exploring the use of ultrasonic technologies to provide enhanced sensors for in-pile instrumentation during irradiation testing. For example, the ability of small diameter ultrasonic thermometers (UTs) to provide a temperature profile in candidate metallic and oxide fuel would provide much needed data for validating new fuel performance models, (Rempe et al., 2011; Kazys et al., 2005). These efforts are limited by the lack of identified ultrasonic transducer materials capable of long term performance under irradiation test conditions. To address this need, the Pennsylvania State University (PSU) was awarded an Advanced Test Reactor National Scientific User Facility (ATR NSUF) project to evaluate the performance of promising magnetostrictive and piezoelectric transducers in the Massachusetts Institute of Technology Research Reactor (MITR) up to a fast fluence of at least 1021 n/cm2. The irradiation is also supported by a multi-National Laboratory collaboration funded by the Nuclear Energy Enabling Technologies Advanced Sensors and Instrumentation (NEET ASI) program. The results from this irradiation, which started in February 2014, offer the potential to enable the development of novel radiation tolerant ultrasonic sensors for use in Material Testing Reactors (MTRs). As such, this test is an instrumented lead test and real-time transducer performance data is collected along with temperature and neutron and gamma flux data. Hence, results from this irradiation offer the potential to bridge the gap between proven out-of-pile ultrasonic techniques and in-pile deployment of ultrasonic sensors by acquiring the data necessary to demonstrate the

  17. 大豆耐铝毒候选基因 GmSTOP1的克隆与表达分析%Cloning and Expression Analysis of Tolerance to Aluminum-toxicity Candidate Gene GmSTOP1 in Soybean

    Institute of Scientific and Technical Information of China (English)

    丛亚辉; 王婷婷; 柳聚阁; 王宁; 高萌萌; 李艳; 盖钧镒

    2015-01-01

    酸性土壤中的铝毒害是限制作物生长和产量的主要因素之一。拟南芥中的 AtSTOP1(Arabidopsis thaliana sensitive to proton rhizotoxicity 1)是一个调控多种铝毒耐受机制相关基因表达的转录因子,在拟南芥耐铝毒中发挥重要作用。为研究大豆中 STOP1-like 基因的表达特性,本研究利用 RT-PCR 从耐铝毒大豆品种科丰1号中克隆了一个位于第16染色体的 STOP1-like 基因,命名为 GmSTOP1。该基因的编码区(coding DNA sequence, CDS)序列长度为1566 bp,编码521个氨基酸。在 GmSTOP1起始密码子上游1500 bp 的核苷酸序列区间预测到多种顺式作用元件,包括与激素、热、逆境响应等相关的应答元件,如 ABRE、HSE、TC-rich 重复序列等。蛋白质结构预测表明 GmSTOP1不具有跨膜结构和信号肽,含有4个保守的 Cys-2-His-2锌指蛋白结构域。系统进化分析显示 GmSTOP1与菜豆(Phaseolus vulgaris)中的 STOP1-like 蛋白亲缘关系较近。亚细胞定位结果显示 GmSTOP1定位于细胞核,说明GmSTOP1蛋白可能在细胞核中发挥其功能。GmSTOP1基因在种子中的相对表达量最高,在根、茎尖分生组织、茎、叶、花、荚等多种组织中也均有表达。用25μmol L–1 AlCl3溶液处理大豆幼苗, GmSTOP1基因在根中上调表达,24 h达到最高相对表达量,约为对照(0μmol L–1 AlCl3)的9.2倍,表明该基因的表达受铝离子的诱导。此外, ABA、NaCl和 PEG 等胁迫也能诱导大豆根和叶中 GmSTOP1基因的上调表达。由此推测 GmSTOP1基因可能参与大豆对铝毒、高盐和渗透等非生物胁迫的应答过程。%Aluminum toxicity is one of the major factors that limits the growth and production of crops in acid soils. AtSTOP1 transcription factor can regulate the expression of genes related to aluminum-toxicity tolerance mechanisms, which plays an im-portant role in aluminum-toxicity tolerance in Arabidopsis. To study the expression features of the

  18. Association mapping provides insights into the origin and the fine structure of the sorghum aluminum tolerance locus, AltSB

    Science.gov (United States)

    Root damage caused by aluminum (Al) toxicity is a major cause of grain yield reduction on acid soils, which are prevalent in tropical and subtropical regions of the world where food security is most tenuous. In sorghum, Al tolerance is conferred by SbMATE, an Al-activated root citrate efflux transpo...

  19. Cowpea symbiotic efficiency, pH and aluminum tolerance in nitrogen-fixing bacteria

    Directory of Open Access Journals (Sweden)

    Bruno Lima Soares

    2014-06-01

    Full Text Available Cowpea (Vigna unguiculata cultivation in northern and northeastern Brazil provides an excellent source of nutrients and carbohydrates for the poor and underprivileged. Production surplus leads to its consumption in other regions of Brazil and also as an export commodity. Its capacity to establish relationships with atmospheric nitrogen-fixing bacteria is crucial to the reduction of production costs and the environmental impact of nitrogen fertilizers. This study assessed the symbiotic efficiency of new strains of symbiotic nitrogen-fixing bacteria with cowpea and their tolerance to pH and aluminum. Twenty-seven strains of bacteria from different soils were evaluated under axenic conditions. These strains were compared to the following inoculant strains: INPA03-11B, UFLA03-84 and BR3267 and two controls that were not inoculated (with and without mineral nitrogen. Six strains and the three strains approved as inoculants were selected to increase the dry weight production of the aerial part (DWAP and were tested in pots with soil that had a high-density of nitrogen-fixing native rhizobia. In this experiment, three strains (UFLA03-164, UFLA03-153, and UFLA03-154 yielded higher DWAP values. These strains grow at pH levels of 5.0, 6.0, 6.8 and at high aluminum concentration levels, reaching 10(9 CFU mL-1. In particular UFLA03-84, UFLA03-153, and UFLA03-164 tolerate up to 20 mmol c dm-3 of Al+3. Inoculation with rhizobial strains, that had been carefully selected according to their ability to nodulate and fix N2, combined with their ability to compete in soils that are acidic and contain high levels of Al, is a cheaper and more sustainable alternative that can be made available to farmers than mineral fertilizers.

  20. Response and tolerance of root border cells to aluminum toxicity in soybean seedlings.

    Science.gov (United States)

    Cai, Miao-Zhen; Wang, Fang-Mei; Li, Rong-Feng; Zhang, Shu-Na; Wang, Ning; Xu, Gen-Di

    2011-07-01

    Root border cells (RBCs) and their secreted mucilage are suggested to participate in the resistance against toxic metal cations, including aluminum (Al), in the rhizosphere. However, the mechanisms by which the individual cell populations respond to Al and their role in Al resistance still remain unclear. In this research, the response and tolerance of RBCs to Al toxicity were investigated in the root tips of two soybean cultivars [Zhechun No. 2 (Al-tolerant cultivar) and Huachun No. 18 (Al-sensitive cultivar)]. Al inhibited root elongation and increased pectin methylesterase (PME) activity in the root tip. Removal of RBCs from the root tips resulted in a more severe inhibition of root elongation, especially in Huachun No. 18. Increasing Al levels and treatment time decreased the relative percent viability of RBCs in situ and in vitro in both soybean cultivars. Al application significantly increased mucilage layer thickness around the detached RBCs of both cultivars. Additionally, a significantly higher relative percent cell viability of attached and detached RBCs and thicker mucilage layers were observed in Zhechun No. 2. The higher viability of attached and detached RBCs, as well as the thickening of the mucilage layer in separated RBCs, suggest that RBCs play an important role in protecting root apices from Al toxicity.

  1. Tagging Salt Tolerant Gene Using PCR Markers in Soybean

    Institute of Scientific and Technical Information of China (English)

    GUO Bei; QIU Li-juan; SHAO Gui-hua; CHANG Ru-zhen; LIU Li-hong; XU Zhan-you; LI Xiang-hua; SUN Jian-ying

    2001-01-01

    The purpose of this study was to screen and identify PCR markers associated with salt tolerant gene in soybean( Glycine soja L. ) so that salt tolerance can be identified efficiently and accurately. Between these tolerant and sensitivity to salt and three crosses were tested in this experiment. By BSA method, two codominant PCR markers were identified through the salt tolerant (sensitive) cuitivars bulks and the salt tolerant (sensitive) individual bulks of a F2 population. There was a 600bp band in the sensitive individuals and a 700bp band or two 700bp/600bp bands in the tolerant individuals. The markers were closely linked with salt tolerant/sensitive alleles. Moreover the markers were tested in the other two F2 populations from "salt tolerant cultivar × sensitive cuitivar" and confirmed by 12 salt tolerance cultivars and 13 salt sensitive cultivars with different genetic background. It indicated that the markers (700bp and 600bp) could be applied in salt tolerant identification of the soybean germplasm resources, and markers-assisted selection in salt tolerant breeding of soybean. The markers, its obtained method and application were patented for invention in 1998.

  2. Genes related to high temperature tolerance during maize seed germination.

    Science.gov (United States)

    Dutra, S M F; Von Pinho, E V R; Santos, H O; Lima, A C; Von Pinho, R G; Carvalho, M L M

    2015-01-01

    The identification of genes related to heat tolerance is fundamental for the development of high-quality seeds that are tolerant to heat stress condition. The objective of this study was to evaluate maize lineages and the gene expression involved in high temperature tolerance during germination using physiological tests, proteomics, and transcriptome analysis. Seeds from six maize lineages (30, 44, 54, 63, 64, and 91) with different levels of tolerance to high temperatures were used. Lineages 54 and 91 were observed to be more tolerant to high temperature conditions. The highest expression of α-amylase was observed in maize seeds from lineages 30 and 91 that were subjected to controlled deterioration. The highest expression of α-amylase was observed in maize seeds from lineages 30 and 91 that were subjected to controlled deterioration; with the controlled deterioration, the highest level of gene expression did not occur in the most tolerant materials; the association of lower expression of genes involved in heat-resistant protein systems was observed in seeds from lineage 44, which were more susceptible to high temperatures, and the highest gene expression of LEA D-34, ZmAN13, and AOX-1 was observed in seeds from lineage 64 when submitted to controlled deterioration. PMID:26782452

  3. Wheat genotypes differing in aluminum tolerance differ in their growth response to CO2 enrichment in acid soils

    OpenAIRE

    Tian, Qiuying; Zhang, Xinxin; Gao, Yan; Bai, Wenming; Ge,Feng; Ma, Yibing; Zhang, Wen-Hao

    2013-01-01

    Aluminum (Al) toxicity is a major factor limiting plant growth in acid soils. Elevated atmospheric CO2 [CO2] enhances plant growth. However, there is no report on the effect of elevated [CO2] on growth of plant genotypes differing in Al tolerance grown in acid soils. We investigated the effect of short-term elevated [CO2] on growth of Al-tolerant (ET8) and Al-sensitive (ES8) wheat plants and malate exudation from root apices by growing them in acid soils under ambient [CO2] and elevated [CO2]...

  4. Damage Tolerance Assessment of Friction Pull Plug Welds in an Aluminum Alloy

    Science.gov (United States)

    McGill, Preston; Burkholder, Jonathan

    2012-01-01

    Friction stir welding is a solid state welding process used in the fabrication of cryogenic propellant tanks. Self-reacting friction stir welding is one variation of the friction stir weld process being developed for manufacturing tanks. Friction pull plug welding is used to seal the exit hole that remains in a circumferential self-reacting friction stir weld. A friction plug weld placed in a self-reacting friction stir weld results in a non-homogenous weld joint where the initial weld, plug weld, their respective heat affected zones and the base metal all interact. The welded joint is a composite plastically deformed material system with a complex residual stress field. In order to address damage tolerance concerns associated with friction plug welds in safety critical structures, such as propellant tanks, nondestructive inspection and proof testing may be required to screen hardware for mission critical defects. The efficacy of the nondestructive evaluation or the proof test is based on an assessment of the critical flaw size. Test data relating residual strength capability to flaw size in an aluminum alloy friction plug weld will be presented.

  5. Isolation, Identification and Characterization of Two Aluminum-Tolerant Fungi from Acidic Red Soil.

    Science.gov (United States)

    He, Genhe; Wang, Xiaodong; Liao, Genhong; Huang, Shoucheng; Wu, Jichun

    2016-09-01

    Acidic red soil from a forest in Jiangxi Province was selected to isolate aluminum (Al)-resistant microbes, from which eight fungi were isolated. Two strains (S4 and S7) were found to be extremely tolerant to Al concentrations of up to 550 mmol L(-1) and could grow at low pH levels (3.20-3.11). Morphological and 26S rDNA sequence analyses indicated that strain S4 belonged to Eupenicillium, while strain S7 was an unclassified Trichocomaceae. Further investigation showed that both strains were endowed with the ability to resist Al; strain S4 accumulated such a substantial amount of Al that its growth was limited to a larger extent than strain S7. The lower amounts of Al adsorbed in the mycelium and the much larger amounts of Al retained in the medium, in addition to the color change of the culture solution, implied that these two strains may resist Al by preventing Al from entering the cell and by chelating Al by secreting unique metabolites outside of the cell. PMID:27407299

  6. Physiological characterization of aluminum tolerance and accumulation in tartary and wild buckwheat.

    Science.gov (United States)

    Wang, Hua; Chen, Rong Fu; Iwashita, Takashi; Shen, Ren Fang; Ma, Jian Feng

    2015-01-01

    Ionic aluminum (Al) is toxic for plant growth, but some plant species are able to accumulate Al at high concentrations without showing toxicity symptoms. In order to determine whether other species in the genus Fagopyrum are able to accumulate Al like common buckwheat (Fagopyrum esculentum), we investigated the external and internal detoxification mechanisms of Al in two self-compatible species: tartary (Fagopyrum tataricum) and wild buckwheat (Fagopyrum homotropicum). Both tartary and wild buckwheat showed high Al tolerance comparable to common buckwheat. Furthermore, these two species also secreted oxalate rapidly from the roots in response to Al in a time-dependent manner. Both tartary and wild buckwheat accumulated > 1 mg g(-1) Al in the leaves after short-term exposure to Al. Analysis with (27) Al-nuclear magnetic resonance (NMR) revealed that Al was present in the form of Al-oxalate (1 : 3 ratio) in the roots and leaves, but in the form of Al-citrate (1 : 1 ratio) in the xylem sap in both species. These results indicate that similar to common buckwheat, both tartary and wild buckwheat detoxify Al externally and internally, respectively, by secreting oxalate from the roots and by forming the Al-oxalate complex, which is a nonphytotoxic form. These features of Al response and accumulation may be conserved in genus Fagopyrum. PMID:25195800

  7. Physiological characterization of aluminum tolerance and accumulation in tartary and wild buckwheat.

    Science.gov (United States)

    Wang, Hua; Chen, Rong Fu; Iwashita, Takashi; Shen, Ren Fang; Ma, Jian Feng

    2015-01-01

    Ionic aluminum (Al) is toxic for plant growth, but some plant species are able to accumulate Al at high concentrations without showing toxicity symptoms. In order to determine whether other species in the genus Fagopyrum are able to accumulate Al like common buckwheat (Fagopyrum esculentum), we investigated the external and internal detoxification mechanisms of Al in two self-compatible species: tartary (Fagopyrum tataricum) and wild buckwheat (Fagopyrum homotropicum). Both tartary and wild buckwheat showed high Al tolerance comparable to common buckwheat. Furthermore, these two species also secreted oxalate rapidly from the roots in response to Al in a time-dependent manner. Both tartary and wild buckwheat accumulated > 1 mg g(-1) Al in the leaves after short-term exposure to Al. Analysis with (27) Al-nuclear magnetic resonance (NMR) revealed that Al was present in the form of Al-oxalate (1 : 3 ratio) in the roots and leaves, but in the form of Al-citrate (1 : 1 ratio) in the xylem sap in both species. These results indicate that similar to common buckwheat, both tartary and wild buckwheat detoxify Al externally and internally, respectively, by secreting oxalate from the roots and by forming the Al-oxalate complex, which is a nonphytotoxic form. These features of Al response and accumulation may be conserved in genus Fagopyrum.

  8. Trichoderma genes in plants for stress tolerance- status and prospects.

    Science.gov (United States)

    Nicolás, Carlos; Hermosa, Rosa; Rubio, Belén; Mukherjee, Prasun K; Monte, Enrique

    2014-11-01

    Many filamentous fungi from the genus Trichoderma are well known for their anti-microbial properties. Certain genes from Trichoderma spp. have been identified and transferred to plants for improving biotic and abiotic stress tolerance, as well for applications in bioremediation. Several Trichoderma genomes have been sequenced and many are in the pipeline, facilitating high throughput gene analysis and increasing the availability of candidate transgenes. This, coupled with improved plant transformation systems, is expected to usher in a new era in plant biotechnology where several genes from these antagonistic fungi can be transferred into plants to achieve enhanced stress tolerance, bioremediation activity, herbicide tolerance, and reduction of phytotoxins. In this review, we illustrate the major achievements made by transforming plants with Trichoderma genes as well as their possible mode of action. Moreover, examples of efficient application of genetically modified plants as biofactories to produce active Trichoderma enzymes are indicated.

  9. Tolerant Mechanism and Chromosome Location of Gene Controlling Sprouting Tolerance in Aegilops Tauschii Cosson

    Institute of Scientific and Technical Information of China (English)

    LAN Xiu-jin; ZHENG You-liang; LIU Deng-cai; WEI Yu-ming; YAN Ze-hong; ZHOU Yong-hong

    2002-01-01

    An artificial amphiploid RSP (2n = 42, AABBDD) between tetraploid landrace Ailanmai(Triticum turgidum L., 2n= 28, AABB) and Aegilops tauschii (DD, 2n = 14) expressed high tolerance to preharvest sprouting which derived from Ae. tauschii. Tolerance to preharvest sprouting of RSP was examined by four ways in six varying periods after anthesis. The germination percentages of preharvest intact spikes were only 6.06 % in its high peak period of germination. Its tolerance was mainly decided by the seed a recessive trait which was controlled by one gene, located on chromosome 2D.

  10. Herança da tolerância ao alumínio em populações híbridas de trigo Inheritance of aluminum tolerance in wheat hybrid populations

    Directory of Open Access Journals (Sweden)

    CARLOS EDUARDO DE OLIVEIRA CAMARGO

    2000-03-01

    Full Text Available Plântulas originárias de populações híbridas, em geração F2, de 26 cruzamentos entre cultivares de trigo tolerantes (BH-1146, IAC-227, IAC-24, IAC-60, C-3, IAC-5, IAC-18 e IAC-21 e sensíveis (Anahuac 75, IAC-287, IAC-289, Siete Cerros e Veery "S" à toxicidade de alumínio e de 18 cruzamentos entre cultivares tolerantes (BH-1146, IAC-227, IAC-24, IAC-60, C-3, IAC-5, IAC-21, C-17, IAC-74 e IAC-18 foram avaliadas em relação à tolerância a 3 mg/L de Al3+, empregando soluções nutritivas. A tolerância à toxicidade de alumínio foi medida pela capacidade de crescimento da raiz primária central em solução nutritiva completa, após um tratamento de 48 horas em solução contendo 3 mg/L de Al3+. Avaliando-se as plântulas das populações F2 provindas de cruzamentos entre cultivares tolerantes e sensíveis, verificou-se que a tolerância à toxicidade de Al3+ foi dominante, e que em 24 dos cruzamentos, as cultivares tolerantes diferiram das sensíveis por um par de genes. Não foi detectada diferença entre as cultivares tolerantes em relação ao par de genes dominantes em relação à tolerância. Qualquer uma dessas cultivares poderá ser utilizada como fonte de tolerância num programa de cruzamentos em que essa característica for desejada.Seedlings originated from hybrid populations, in F2 generation, from 26 crosses between tolerant wheat cultivars (BH-1146, IAC-227, IAC-24, IAC-60, C-3, IAC-5, IAC-18 and IAC-21 and sensitive cultivars (Anahuac 75, IAC-287, IAC-289, Siete Cerros and Veery "S" to aluminum toxicity and from 18 crosses between tolerant cultivars (BH-1146, IAC-227, IAC-24, IAC-60, C-3, IAC-5, IAC-21, C-17, IAC-74 and IAC-18 were evaluated for tolerance to 3 mg/L of Al3+, using nutrient solutions. It was considered tolerant the plant that was able to show root regrowth of the central primary root in the complete nutrient solution after a treatment of 48 hours in solution containing 3 mg/L of Al3+. The evaluation of

  11. Evaluation on Chinese Bread Wheat Landraces for Low pH and Aluminum Tolerance Using Hydroponic Screening

    Institute of Scientific and Technical Information of China (English)

    DAI Shou-fen; YAN Ze-hong; LIU Deng-cai; ZHANG Lian-quan; WEI Yu-ming; ZHENG You-liang

    2009-01-01

    Aluminum (A1) toxicity often takes place in acidic soils with a pH of 5.5 or lower. Breeding and cultivation of A1 tolerance wheat can partially protect wheat escaping from AI toxicity. The scarcity of the tolerant sources impedes the wheat breeding.In order to find new AI tolerance sources, we screened 173 bread wheat landraces from Tibet of China using hydroponic screening. It was indicated that: (1) There were diversities on the root regenerate length (RRL). The RRL of a large of landraces were longer than 7.00 cm in pH 7 (58.38%) and pH 4.5 (66.47%), but shorter than 5.00 cm in pH 4.5 +50 μM Al3+(80.93%). The low pH showed either promotion or restraining effects depend on landraces, but AI toxicity under low pH only showed restraining effects on the root elongation. (2) There were also diversities on root tolerance index of low pH (RTI 1) or root aluminum tolerance index (RTI2) among cultivars. The RTI1 varied from a narrow range but with relatively high value (0.8722-1.2953) in comparison with that of RTI2 (0.3829-1.0058), and the RTI1 of approximately 60% landraces was higher than 1.0000, the RTI2 of only 19.07% landraces was higher than 0.7000, suggesting that A1 toxicity acted as an important factor for the reduction of the root elongation under acidic soils. (3) The RTI 1 of many wheats was higher than 1.0000, and As2256 and As2295 were the most tolerant for low pH, with RTI1 1.2953 and 1.2925, respectively. (4) Based on RTI2, seven wheats showed similar or higher tolerance to AI toxicity than Chinese Spring (CS), a known tolerance wheat. Much better tolerance existed in landraces of As1543 and As1242, which can be used as the new parents for AI tolerant breeding.

  12. Comparative mapping of QTLs for Al tolerance in rice and identification of positional Al-induced genes

    Institute of Scientific and Technical Information of China (English)

    毛传澡; 杨玲; 郑炳松; 吴运荣; 刘非燕; 易可可; 吴平

    2004-01-01

    Aluminum (Al) toxicity is the major factor limiting crop productivity in acid soils. In this study, a recombinant inbreed line (RIL) population derived from a cross between an A1 sensitive lowland indica rice variety IR1552 and an Al tolerant upland japonica rice variety Azucena, was used for mapping quantitative trait loci (QTLs) for A1 tolerance. Three QTLs for relative root length (RRL) were detected on chromosome 1, 9, 12, respectively, and I QTL for root length under Al stress is identical on chromosome I after one week and two weeks stress. Comparison of QTLs on chromosome 1 from different studies indicated an identical interval between C86 and RZ801 with gene(s) for Al tolerance. This interval provides an important start point for isolating genes responsible for A1 tolerance and understanding the genetic nature of Al tolerance in rice. Four Al induced ESTs located in this interval were screened by reverse Northern analysis and confirmed by Northern analysis. They would be candidate genes for the QTL.

  13. Comparative mapping of QTLs for AI tolerance in rice and identification of positional Al-induced genes

    Institute of Scientific and Technical Information of China (English)

    毛传澡; 杨玲; 郑炳松; 吴运荣; 刘非燕; 易可可; 吴平

    2004-01-01

    Aluminum (A1) toxicity is the major factor limiting crop productivity in acid soils. In this study, a recombinant inbreed line (RIL) population derived from a cross between an A1 sensitive lowland indica rice variety IR1552 and an A1 tolerant upland japonica rice variety Azucena, was used for mapping quantitative trait loci (QTLs) for A1 tolerance. Three QTLs for relative root length (RRL) were detected on chromosome 1,9, 12, respectively, and 1 QTL for root length under A1 stress is identical on chromosome 1 after one week and two weeks stress. Comparison of QTLs on chromosome 1 from different studies indicated an identical interval between C86 and RZ801 with gene(s) for A1 tolerance. This interval provides an important start point for isolating genes responsible for A1 tolerance and understanding the genetic nature of Al tolerance in rice. Four A1 induced ESTs located in this interval were screened by reverse Northern analysis and confirmed by Northern analysis. They would be candidate genes for the QTL.

  14. The PSE1 gene modulates lead tolerance in Arabidopsis

    Science.gov (United States)

    Fan, Tingting; Yang, Libo; Wu, Xi; Ni, Jiaojiao; Jiang, Haikun; Zhang, Qi’an; Fang, Ling; Sheng, Yibao; Ren, Yongbing; Cao, Shuqing

    2016-01-01

    Lead (Pb) is a dangerous heavy metal contaminant with high toxicity to plants. However, the regulatory mechanism of plant Pb tolerance is poorly understood. Here, we showed that the PSE1 gene confers Pb tolerance in Arabidopsis. A novel Pb-sensitive mutant pse1-1 (Pb-sensitive1) was isolated by screening T-DNA insertion mutants. PSE1 encodes an unknown protein with an NC domain and was localized in the cytoplasm. PSE1 was induced by Pb stress, and the pse1-1 loss-of-function mutant showed enhanced Pb sensitivity; overexpression of PSE1 resulted in increased Pb tolerance. PSE1-overexpressing plants showed increased Pb accumulation, which was accompanied by the activation of phytochelatin (PC) synthesis and related gene expression. In contrast, the pse1-1 mutant showed reduced Pb accumulation, which was associated with decreased PC synthesis and related gene expression. In addition, the expression of PDR12 was also increased in PSE1-overexpressing plants subjected to Pb stress. Our results suggest that PSE1 regulates Pb tolerance mainly through glutathione-dependent PC synthesis by activating the expression of the genes involved in PC synthesis and at least partially through activating the expression of the ABC transporter PDR12/ABCG40. PMID:27335453

  15. Aluminum-Tolerant Pisolithus Ectomycorrhizas Confer Increased Growth, Mineral Nutrition, and Metal Tolerance to Eucalyptus in Acidic Mine Spoil

    Directory of Open Access Journals (Sweden)

    Louise Egerton-Warburton

    2015-01-01

    Full Text Available Ectomycorrhizal fungi (ECM may increase the tolerance of their host plants to Al toxicity by immobilizing Al in fungal tissues and/or improving plant mineral nutrition. Although these benefits have been demonstrated in in vitro (pure culture or short-term nutrient solution (hydroponic experiments, fewer studies have examined these benefits in the field. This study examined the growth, mineral nutrition, and Al levels in two Eucalyptus species inoculated with three Pisolithus ecotypes that varied in Al tolerance (in vitro and grown in mine spoil in the greenhouse and field. All three ecotypes of Pisolithus improved Eucalyptus growth and increased host plant tolerance to Al in comparison to noninoculated plants. However, large variations in plant growth and mineral nutrition were detected among the Pisolithus-inoculated plants; these differences were largely explained by the functional properties of the Pisolithus inoculum. Seedlings inoculated with the most Al-tolerant Pisolithus inoculum showed significantly higher levels of N, P, Ca, Mg, and K and lower levels of Al than seedlings inoculated with Al-sensitive ecotypes of Pisolithus. These findings indicate an agreement between the fungal tolerance to Al in vitro and performance in symbiosis, indicating that both ECM-mediated mineral nutrient acquisition and Al accumulation are important in increasing the host plant Al tolerance.

  16. High Aluminum Tolerance of Rhodotorula sp.RS1 is Associated with Thickening of the Cell Wall Rather than Chelation of Aluminum Ions*1

    Institute of Scientific and Technical Information of China (English)

    WANG Chao; ZHAO Xue-Qiang; T.AIZAWA; M.SUNAIRI; SHEN Ren-Fang

    2013-01-01

    Aluminum (Al) is very toxic to many living organisms,including plants,animals and microorganisms.However,despite many studies on Al tolerance in plants,little has been reported concerning these mechanisms in microorganisms.In this study,a red yeast,which could tolerate Al3+ concentrations as high as 200 mmol L-1,was isolated from acidic soils,identified as Rhodotorula sp.and designated as RS1.As the medium compositions can greatly affect the responses of microorganisms to Al,two culture mediums,glucose medium (GM) and lysogeny broth medium containing soil extract (S-LBM),were used.During growth of RS1,the pH of medium decreased in GM but increased in S-LBM.These changes in the pH of the media were not induced by Al addition.No or little secretion of organic acids was observed in RS1 growth media.Importantly,the thickness of the cell walls and the ratio of cell wall to biomass of RS1 significantly increased in GM with high Al3+ concentrations.In the presence of 100 mmol Al L-1,78.0% of the total Al of whole cells was present in the thickened cell walls.The Al in cell walls was mostly bound to OH,amide and CO groups of polysaccharides.These results suggest that thickening of the cell wall in response to the high Al3+ concentrations may play an important role in the high tolerance of RS1 to Al and that pH increase of the medium and chelation of Al ions are not involved in Al tolerance of this organism.

  17. Intragraft gene expression profile associated with the induction of tolerance

    Directory of Open Access Journals (Sweden)

    Evans Jacqueline M

    2008-02-01

    Full Text Available Abstract Background Xenotransplantation holds the promise of providing an unlimited supply of donor organs for terminal patients with organ failure. Pre-existing natural antibodies to the Galα1,3Galβ1,4GlcNac-R (αGal carbohydrate xenoantigen, however, bind rapidly to the graft endothelium and initiate hyperacute rejection of wild type pig grafts in humans. Experimental procedures designed to prevent xenoantibody-mediated rejection have been tested in gal knockout mice. These mice produce anti-gal xenoantibodies and are widely used as small animal models for xenotransplantation research. In this model, chimerism for cells expressing the gal carbohydrate can be achieved by transplantation of mixed cells or by transduction of bone marrow cells with viral vectors expressing a functional α1,3 galactosyltransferase gene. Chimerism induces tolerance to heart grafts expressing αGal. The mechanisms by which tolerance is achieved include systemic changes such as clonal deletion and/or anergy. Intragraft changes that occur during the early stages of tolerance induction have not been characterized. Results Cytoprotective genes heme oxygenase-1 (HO-1, Bcl2, and A20 that have been reported to contribute to long-term graft survival in various models of accommodation were not expressed at high levels in tolerant heart grafts. Intragraft gene expression at both early (Day 10 and late (>2 month time points after heart transplant were examined by real-time PCR and microarray analysis was used to identify changes associated with the induction of tolerance. Intragraft gene expression profiling using microarray analysis demonstrated that genes identified in the functional categories of stress and immunity and signal transduction were significantly up-regulated in early tolerant grafts compared with syngeneic control grafts. Biological process classification showed lower binomial p-values in the categories of "response to biotic stimulus, defense response, and

  18. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  19. Gene mining in halophytes: functional identification of stress tolerance genes in Lepidium crassifolium.

    Science.gov (United States)

    Rigó, Gábor; Valkai, Ildikó; Faragó, Dóra; Kiss, Edina; Van Houdt, Sara; Van de Steene, Nancy; Hannah, Matthew A; Szabados, László

    2016-09-01

    Extremophile plants are valuable sources of genes conferring tolerance traits, which can be explored to improve stress tolerance of crops. Lepidium crassifolium is a halophytic relative of the model plant Arabidopsis thaliana, and displays tolerance to salt, osmotic and oxidative stresses. We have employed the modified Conditional cDNA Overexpression System to transfer a cDNA library from L. crassifolium to the glycophyte A. thaliana. By screening for salt, osmotic and oxidative stress tolerance through in vitro growth assays and non-destructive chlorophyll fluorescence imaging, 20 Arabidopsis lines were identified with superior performance under restrictive conditions. Several cDNA inserts were cloned and confirmed to be responsible for the enhanced tolerance by analysing independent transgenic lines. Examples include full-length cDNAs encoding proteins with high homologies to GDSL-lipase/esterase or acyl CoA-binding protein or proteins without known function, which could confer tolerance to one or several stress conditions. Our results confirm that random gene transfer from stress tolerant to sensitive plant species is a valuable tool to discover novel genes with potential for biotechnological applications. PMID:27343166

  20. The relationship between population structure and aluminum tolerance in cultivated sorghum

    Science.gov (United States)

    Acid soils comprise up to 50% of the world’s arable lands and in these areas aluminum (Al) toxicity impairs root growth, strongly limiting crop yield. Food security is thereby compromised in many developing countries that are located in tropical and subtropical regions worldwide. In sorghum, SbMATE,...

  1. Associated mechanisms of aluminum tolerance in plants/ Mecanismos associados à tolerância ao alumínio em plantas

    Directory of Open Access Journals (Sweden)

    Cecília Estima Sacramento dos Reis

    2007-10-01

    Full Text Available Aluminum toxicity is one of the major limiting factor regarding plant development in acid soils. The use of liming for correcting soil pH is not viable for some of acid soil areas (technique or economic reasons, making the development of Al tolerant genotypes the best alternative. Thus, the tolerance mechanisms as well as the genetic basis of Al tolerance has deserved special attention in the scientific community. In the last years, a significant progress has been achieved towards these goals, as well as in developing cultivars adapted to acid soils. The Al tolerance mechanisms are divided basically in two classes: the exclusion mechanisms that act after absorption or blocking its entry in the root system and those involved in detoxification, complexing the Al in specific organelles, mainly in the vacuoles. In many species, physiological mechanisms have been reported as responsible for the activation of organic acids (mainly citrate and malate that act as Al quelating agents, however many process are not yet understood and cleared. Currently, the basis for the internal detoxification is becoming clear through organic acid complexes and there sequestering by the vacuoles. Other potential mechanisms are the target for discussions.A toxicidade do alumínio é um dos principais fatores limitantes do desenvolvimento das plantas em solos ácidos. Pelo fato da utilização de corretivos da acidez do solo não ser a estratégia mais viável em muitas situações com solos ácidos (por razões técnicas e econômicas, o desenvolvimento de genótipos tolerantes ao Al tem sido o caminho mais focado, assim a investigação dos mecanismos de tolerância bem como as bases genéticas da tolerância ao Al têm merecido atenção especial pela pesquisa científica. Nos últimos anos, foi gerado um significativo progresso no entendimento das bases dos mecanismos de tolerância ao Al, assim como no desenvolvimento de cultivares mais adaptados as condições de

  2. Cold tolerance of potato plants transformed with yeast invertase gene

    Directory of Open Access Journals (Sweden)

    Alexander N. Deryaabin

    2013-12-01

    Full Text Available Our study was carried out with potato plants (Solanum tuberosun L.,cv. Désirée transformed with the yeast invertase gene under the control of the B33 class I patatin promoter and with the proteinase inhibitor II leader peptide sequence providing for the apoplastic enzyme localization (B33-inv plants and with the plants transformed with the reporter gene encoding bb-glucuronidase under the control of the 35S CaMV promoter (control plants. Exposure to 5°C during 6 days caused an increase in invertase activity and sugar content in B33-inv leaves in comparison with the control plants. Cell membranes of B33-inv plant cells showed greater cold tolerance under low temperature conditions than control plants that was recorded by electrolyte release. We supposed that higher cold tolerance of B33-inv plants was caused by stabilizing effect of sugar on the membranes, because B33-inv plants differ from the control plants in higher invertase activity, induced by expression of yeast invertase gene, and high content of sugars.

  3. Functional Identification and Characterization of Genes Cloned from Halophyte Seashore Paspalum Conferring Salinity and Cadmium Tolerance

    Directory of Open Access Journals (Sweden)

    Yu eChen

    2016-02-01

    Full Text Available Salinity-affected and heavy metal-contaminated soils limit the growth of glycophytic plants. Identifying genes responsible for superior tolerance to salinity and heavy metals in halophytes has great potential for use in developing salinity- and Cd-tolerant glycophytes. The objective of this study was to identify salinity- and Cd-tolerance related genes in seashore paspalum (Paspalum vaginatum, a halophytic perennial grass species, using the yeast cDNA expression library screening method. Based on the Gateway-compatible vector system, a high quality entry library was constructed, which contained 9.9×106 clones with an average inserted fragments length of 1.48 kb representing a 100% full-length rate. The yeast expression libraries were screened in a salinity-sensitive and a Cd-sensitive yeast mutant. The screening yielded 32 salinity-tolerant clones harboring 18 salinity-tolerance genes and 20 Cd-tolerant clones, including 5 Cd-tolerance genes. qPCR analysis confirmed that most of the 18 salinity-tolerance and 5 Cd-tolerance genes were up-regulated at the transcript level in response to salinity or Cd stress in seashore paspalum. Functional analysis indicated that salinity-tolerance genes from seashore paspalum could be mainly involved in photosynthetic metabolism, antioxidant systems, protein modification, iron transport, vesicle traffic, and phospholipid biosynthesis. Cd-tolerance genes from seashore paspalum could be associated with regulating pathways involved in phytochelatin synthesis, HSFA4-relsted stress protection, CYP450 complex and sugar metabolism. The 18 salinity-tolerance genes and 5 Cd-tolerance genes could be potentially used as candidate genes for genetic modification of glycophytic grass species to improve salinity and Cd tolerance and for further analysis of molecular mechanisms regulating salinity and Cd tolerance.

  4. Functional Identification and Characterization of Genes Cloned from Halophyte Seashore Paspalum Conferring Salinity and Cadmium Tolerance

    Science.gov (United States)

    Chen, Yu; Chen, Chuanming; Tan, Zhiqun; Liu, Jun; Zhuang, Lili; Yang, Zhimin; Huang, Bingru

    2016-01-01

    Salinity-affected and heavy metal-contaminated soils limit the growth of glycophytic plants. Identifying genes responsible for superior tolerance to salinity and heavy metals in halophytes has great potential for use in developing salinity- and Cd-tolerant glycophytes. The objective of this study was to identify salinity- and Cd-tolerance related genes in seashore paspalum (Paspalum vaginatum), a halophytic perennial grass species, using yeast cDNA expression library screening method. Based on the Gateway-compatible vector system, a high-quality entry library was constructed, which contained 9.9 × 106 clones with an average inserted fragment length of 1.48 kb representing a 100% full-length rate. The yeast expression libraries were screened in a salinity-sensitive and a Cd-sensitive yeast mutant. The screening yielded 32 salinity-tolerant clones harboring 18 salinity-tolerance genes and 20 Cd-tolerant clones, including five Cd-tolerance genes. qPCR analysis confirmed that most of the 18 salinity-tolerance and five Cd-tolerance genes were up-regulated at the transcript level in response to salinity or Cd stress in seashore paspalum. Functional analysis indicated that salinity-tolerance genes from seashore paspalum could be involved mainly in photosynthetic metabolism, antioxidant systems, protein modification, iron transport, vesicle traffic, and phospholipid biosynthesis. Cd-tolerance genes could be associated with regulating pathways that are involved in phytochelatin synthesis, HSFA4-related stress protection, CYP450 complex, and sugar metabolism. The 18 salinity-tolerance genes and five Cd-tolerance genes could be potentially used as candidate genes for genetic modification of glycophytic grass species to improve salinity and Cd tolerance and for further analysis of molecular mechanisms regulating salinity and Cd tolerance. PMID:26904068

  5. Rice-arsenate interactions in hydroponics: a three-gene model for tolerance.

    Science.gov (United States)

    Norton, Gareth J; Nigar, Meher; Williams, Paul N; Dasgupta, Tapash; Meharg, Andrew A; Price, Adam H

    2008-01-01

    In this study, the genetic mapping of the tolerance of root growth to 13.3 muM arsenate [As(V)] using the BalaxAzucena population is improved, and candidate genes for further study are identified. A remarkable three-gene model of tolerance is advanced, which appears to involve epistatic interaction between three major genes, two on chromosome 6 and one on chromosome 10. Any combination of two of these genes inherited from the tolerant parent leads to the plant having tolerance. Lists of potential positional candidate genes are presented. These are then refined using whole genome transcriptomics data and bioinformatics. Physiological evidence is also provided that genes related to phosphate transport are unlikely to be behind the genetic loci conferring tolerance. These results offer testable hypotheses for genes related to As(V) tolerance that might offer strategies for mitigating arsenic (As) accumulation in consumed rice.

  6. Regeneration of transgenic loblolly pine expressing genes for salt tolerance

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Salinity stress is one of the most serious factors limiting the distribution and productivity of crops and forest trees. The detrimental effects of salt on plants are a consequence of both a water deficit resulting in osmotic stress and the effects of excess sodium ions on critical biochemical process. A novel approach to improve salt tolerance has been established by using the technology of plant genetic transformation and using loblolly pine (Pinus taeda L.) as a model plant. Mature zygotic embryos of loblolly pine were infected with Agrobacterium tumefaciens strain LBA 4404 harbouring the plasmid pBIGM which carrying the mannitol-1-phosphate dehydrogenase (Mt1D) and glucitol-6-phosphate dehydrogenase (GutD). Organogenic transgenic calli and transgenic regenerated plantlets were produced on selection medium containing 15mg/L kanamycin and confirmed by Southern blot analysis of genomic DNA. Salt tolerance assays demonstrated that the salt tolerance of transgenic calli and regenerated plantlets were increased. These results suggested that an efficient Agrobacterium tumefaciens-mediated transformation protocol for stable integration of foreign genes into loblolly pine has been developed and this could be useful for the future studies on engineering breeding of conifers.

  7. Paenibacillus yonginensis DCY84(T) induces changes in Arabidopsis thaliana gene expression against aluminum, drought, and salt stress.

    Science.gov (United States)

    Sukweenadhi, Johan; Kim, Yeon-Ju; Choi, Eul-Su; Koh, Sung-Cheol; Lee, Sang-Won; Kim, Yu-Jin; Yang, Deok Chun

    2015-03-01

    Current agricultural production methods, for example the improper use of chemical fertilizers and pesticides, create many health and environmental problems. Use of plant growth-promoting bacteria (PGPB) for agricultural benefits is increasing worldwide and also appears to be a trend for the future. There is possibility to develop microbial inoculants for use in agricultural biotechnology, based on these beneficial plant-microbe interactions. For this study, ten bacterial strains were isolated from Yongin forest soil for which in vitro plant-growth promoting trait screenings, such as indole acetic acid (IAA) production, a phosphate solubilization test, and a siderophore production test were used to select two PGPB candidates. Arabidopsis thaliana plants were inoculated with Paenibacillus yonginensis DCY84(T) and Micrococcus yunnanensis PGPB7. Salt stress, drought stress and heavy metal (aluminum) stress challenges indicated that P. yonginensis DCY84(T)-inoculated plants were more resistant than control plants. AtRSA1, AtVQ9 and AtWRKY8 were used as the salinity responsive genes. The AtERD15, AtRAB18, and AtLT178 were selected to check A. thaliana responses to drought stress. Aluminum stress response was checked using AtAIP, AtALS3 and AtALMT1. The qRT-PCR results indicated that P. yonginensis DCY84(T) can promote plant tolerance against salt, drought, and aluminum stress. P. yonginensis DCY84(T) also showed positive results during in vitro compatibility testing and virulence assay against X. oryzae pv. oryzae Philippine race 6 (PXO99). Better germination rates and growth parameters were also recorded for the P. yonginensis DCY84(T) Chuchung cultivar rice seed which was grown on coastal soil collected from Suncheon. Based on these results, P. yonginensis DCY84(T) can be used as a promising PGPB isolate for crop improvement. PMID:25721473

  8. Gene Networks in Plant Ozone Stress Response and Tolerance

    Institute of Scientific and Technical Information of China (English)

    Agnieszka Ludwikow; Jan Sadowski

    2008-01-01

    For many plant species ozone stress has become much more severe in the last decade. The accumulating evidence for the significant effects of ozone pollutant on crop and forest yield situate ozone as one of the most important environmental stress factors that limits plant productivity woddwide. Today, transcdptomic approaches seem to give the best coverage of genome level responses. Therefore, microarray serves as an invaluable tool for global gene expression analyses, unravelling new information about gene pathways, in-species and crose-species gene expression comparison, and for the characterization of unknown relationships between genes. In this review we summadze the recent progress in the transcdptomics of ozone to demonstrate the benefits that can be harvested from the application of integrative and systematic analytical approaches to study ozone stress response. We focused our consideration on microarray analyses identifying gene networks responsible for response and tolerance to elevated ozone concentration. From these analyses it is now possible to notice how plant ozone defense responses depend on the interplay between many complex signaling pathways and metabolite signals.

  9. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases. PMID:23378635

  10. big bang gene modulates gut immune tolerance in Drosophila

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y.; Boulianne, Gabrielle L.; Hoffmann, Jules A.; Matt, Nicolas; Reichhart, Jean-Marc

    2013-01-01

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases. PMID:23378635

  11. Increased Drought Tolerance through the Suppression of ESKMO1 Gene and Overexpression of CBF-Related Genes in Arabidopsis

    OpenAIRE

    Fuhui Xu; Zhixue Liu; Hongyan Xie; Jian Zhu; Juren Zhang; Josef Kraus; Tasja Blaschnig; Reinhard Nehls; Hong Wang

    2014-01-01

    Improved drought tolerance is always a highly desired trait for agricultural plants. Significantly increased drought tolerance in Arabidopsis thaliana (Columbia-0) has been achieved in our work through the suppression of ESKMO1 (ESK1) gene expression with small-interfering RNA (siRNA) and overexpression of CBF genes with constitutive gene expression. ESK1 has been identified as a gene linked to normal development of the plant vascular system, which is assumed directly related to plant drought...

  12. CONTROLE GENÉTICO DA TOLERÂNCIA DO TRIGO À TOXICIDADE DE ALUMÍNIO EM SOLUÇÕES NUTRITIVAS GENETIC CONTROL OF ALUMINUM TOXICITY TOLERANCE IN WHEAT IN NUTRIENT SOLUTIONS

    Directory of Open Access Journals (Sweden)

    CARLOS EDUARDO DE OLIVEIRA CAMARGO

    1998-01-01

    Full Text Available O cultivar IAC-227 (P1, de porte alto e tolerante à toxicidade de alumínio, foi cruzado com os genótipos mexicanos de porte semi-anão: CMH 79.481/CMH 77A.917 (P2, sensível à toxicidade de alumínio, e CMH 80A.747 (P3, tolerante. Plântulas dos parentais e da geração F1, bem como das gerações F2 e F3 dos cruzamentos P1 x P2 e P1 x P3 , e da geração F2 dos retrocruzamentos (P1 x P2 x P1, (P1 x P2 x P2, (P1 x P3 x P1 e (P1 x P3 x P3, foram avaliadas em soluções nutritivas de tratamento contendo 3 mg.L-1 de Al3+. A tolerância à toxicidade de alumínio foi medida pela capacidade de crescimento da raiz primária central em solução nutritiva completa, após um tratamento de 48 horas em solução contendo 3 mg.L-1 de Al3+. O cultivar IAC-227 diferiu do genótipo CMH 79.481/CMH 77A.917 por um par de alelos dominantes para tolerância à presença dessa concentração de alumínio nas soluções nutritivas. Os genótipos IAC-227 e CMH 80A.747 não diferiram quanto ao número de pares de alelos para tolerância. O CMH 80A.747 pode ser utilizado como fonte genética dessa tolerância, além de outras características agronômicas em programas de melhoramento.The tall cultivar IAC-227 (P1, tolerant to aluminum toxicity was crossed with the semidwarf Mexican genotypes: CMH 79.481/CMH 77A.917 (P2, sensitive to aluminum toxicity and CMH 80A.747 (P3, tolerant. Parents and F1 seedlings as well as F2 and F3 generations from the crosses P1 x P2 and P1 x P3 and F2 generation from the backcrosses (P1 x P2 x P1, (P1 x P2 x P2, (P1 x P3 x P1 and (P1 x P3 x P3 were evaluated in nutrient solutions containing 3 mg.L-1 of Al3+. It was considered tolerant the plant that showed root regrowth of the central primary root in the complete nutrient solution after a treatment of 48 hours in a solution containing 3 mg.L-1 of Al3+. The cultivar IAC-227 differed from the genotype CMH 79.481/CMH 77A.917 by one pair of dominant genes for the tolerance to the presence

  13. TrgI, toluene repressed gene I, a novel gene involved in toluene-tolerance in Pseudomonas putida S12

    NARCIS (Netherlands)

    Volkers, R.J.M.; Ballerstedt, H.; Ruijssenaars, H.; Bont, J.A.M. de; Winde, J.H. de; Wery, J.

    2009-01-01

    Pseudomonas putida S12 is well known for its remarkable solvent tolerance. Transcriptomics analysis of this bacterium grown in toluene-containing chemostats revealed the differential expression of 253 genes. As expected, the genes encoding one of the major solvent tolerance mechanisms, the solvent e

  14. Overexpression of malate dehydrogenase in transgenic alfalfa enhances organic acid synthesis and confers tolerance to aluminum.

    Science.gov (United States)

    Tesfaye, M; Temple, S J; Allan, D L; Vance, C P; Samac, D A

    2001-12-01

    Al toxicity is a severe impediment to production of many crops in acid soil. Toxicity can be reduced through lime application to raise soil pH, however this amendment does not remedy subsoil acidity, and liming may not always be practical or cost-effective. Addition of organic acids to plant nutrient solutions alleviates phytotoxic Al effects, presumably by chelating Al and rendering it less toxic. In an effort to increase organic acid secretion and thereby enhance Al tolerance in alfalfa (Medicago sativa), we produced transgenic plants using nodule-enhanced forms of malate dehydrogenase and phosphoenolpyruvate carboxylase cDNAs under the control of the constitutive cauliflower mosaic virus 35S promoter. We report that a 1.6-fold increase in malate dehydrogenase enzyme specific activity in root tips of selected transgenic alfalfa led to a 4.2-fold increase in root concentration as well as a 7.1-fold increase in root exudation of citrate, oxalate, malate, succinate, and acetate compared with untransformed control alfalfa plants. Overexpression of phosphoenolpyruvate carboxylase enzyme specific activity in transgenic alfalfa did not result in increased root exudation of organic acids. The degree of Al tolerance by transformed plants in hydroponic solutions and in naturally acid soil corresponded with their patterns of organic acid exudation and supports the concept that enhancing organic acid synthesis in plants may be an effective strategy to cope with soil acidity and Al toxicity. PMID:11743127

  15. Melhoramento do trigo: VI. hereditariedade da tolerância a três concentrações de alumínio em solução nutritiva Wheat breeding: VI. inheritance of tolerance to three different aluminum concentrations in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1984-01-01

    Cerros. Com grandes populações F2, seria interessante selecionar as plantas em altas concentrações de Al3+ (10mg/litro na solução, pois seriam eliminadas as sensíveis (homozigotas recessivas e heterozigotas e selecionadas as tolerantes homozigotas. Por outro lado, seria de interesse utilizar baixas concentrações de alumínio (3mg/litro na solução quando pequenas populações F2 forem disponíveis, eliminando somente as plantas sensíveis (homozigotas recessivas e selecionando as tolerantes (homozigotas e heterozigotas.Four wheat cultivars: BH-1146, C-3, Siete Cerros and Brevor were tested in nutrient solution with 0, 1, 2, 3, 4, 5, 6 and 10mg/l of Al3+. It was demonstrated that B-1146 and C-3 presented tolerance to 10mg/l of Al3+ whereas Brevor and Siete Cerros were sensitive to 1mg/l of Al3+. It was considered tolerant the plant that was able to show root regrowth of the central primary root in the complete nutrient solution after a treatment in a solution containing a particular amount of aluminum. Seeds of C-3 and Siete Cerros, considered parental lines, and the F1 and F2 populations from the crosses between them, were tested in nutrient solutions where 3, 6 and 10mg/l of aluminum were applied. The results showed that C-3 differed from Siete Cerros by one pair of dominant genes for tolerance at 3mg/l of aluminum. There was a gradual decrease of dominance of the gene pair responsable for the tolerance reaction when it was used 6mg/l of aluminum in the solution. The cultivar Siete Cerros differed from C-3 by one pair of dominant genes for susceptibility at 10mg/l of aluminum or C-3 differed from Siete Cerros by one dominant gene even at 10mg/l of Al3+ if it was considered that the heterozygous individuals from the F1 and F2 populations showed reaction of susceptibility. Heterozygous seedlings of F1 and F2, populations from the cross C-3/Siete Cerros, considered tolerant at 3mg/l of Al3+, showed a decrease in tolerance at 6mg/l and susceptibility at 10mg

  16. Transcriptome Sequencing Identified Genes and Gene Ontologies Associated with Early Freezing Tolerance in Maize

    Science.gov (United States)

    Li, Zhao; Hu, Guanghui; Liu, Xiangfeng; Zhou, Yao; Li, Yu; Zhang, Xu; Yuan, Xiaohui; Zhang, Qian; Yang, Deguang; Wang, Tianyu; Zhang, Zhiwu

    2016-01-01

    Originating in a tropical climate, maize has faced great challenges as cultivation has expanded to the majority of the world's temperate zones. In these zones, frost and cold temperatures are major factors that prevent maize from reaching its full yield potential. Among 30 elite maize inbred lines adapted to northern China, we identified two lines of extreme, but opposite, freezing tolerance levels—highly tolerant and highly sensitive. During the seedling stage of these two lines, we used RNA-seq to measure changes in maize whole genome transcriptome before and after freezing treatment. In total, 19,794 genes were expressed, of which 4550 exhibited differential expression due to either treatment (before or after freezing) or line type (tolerant or sensitive). Of the 4550 differently expressed genes, 948 exhibited differential expression due to treatment within line or lines under freezing condition. Analysis of gene ontology found that these 948 genes were significantly enriched for binding functions (DNA binding, ATP binding, and metal ion binding), protein kinase activity, and peptidase activity. Based on their enrichment, literature support, and significant levels of differential expression, 30 of these 948 genes were selected for quantitative real-time PCR (qRT-PCR) validation. The validation confirmed our RNA-Seq-based findings, with squared correlation coefficients of 80% and 50% in the tolerance and sensitive lines, respectively. This study provided valuable resources for further studies to enhance understanding of the molecular mechanisms underlying maize early freezing response and enable targeted breeding strategies for developing varieties with superior frost resistance to achieve yield potential. PMID:27774095

  17. A new allele of acid soil tolerance gene from a malting barley variety

    OpenAIRE

    Bian, Miao; Jin, Xiaoli; Broughton, Sue; Zhang, Xiao-Qi; Zhou, Gaofeng; Zhou, Meixue; Zhang, Guoping; Sun, Dongfa; Li, Chengdao

    2015-01-01

    Background Acid soil is a serious limitation to crop production all over the world. Toxic aluminium (Al) cations in acid soil inhibit root growth and reduce yield. Although a gene tolerant to acid soil has been identified, it has not been used in malting barley breeding, which is partly due to the acid soil tolerance gene being linked to unfavorable malting quality traits. Results A Brazilian malting barley variety Br2 was identified as tolerant to acid soil. A doubled haploid (DH) population...

  18. Physiological and molecular characterization of drought responses and identification of candidate tolerance genes in cassava

    OpenAIRE

    Turyagyenda, Laban F.; Kizito, Elizabeth B.; Ferguson, Morag; Baguma, Yona; Agaba, Morris; Jagger J W Harvey; Osiru, David S. O.

    2013-01-01

    Cassava is an important root crop to resource-poor farmers in marginal areas, where its production faces drought stress constraints. Given the difficulties associated with cassava breeding, a molecular understanding of drought tolerance in cassava will help in the identification of markers for use in marker-assisted selection and genes for transgenic improvement of drought tolerance. This study was carried out to identify candidate drought-tolerance genes and expression-based markers of droug...

  19. Identification of Genes Conferring Tolerance to Lignocellulose-Derived Inhibitors by Functional Selections in Soil Metagenomes

    OpenAIRE

    Kevin J. Forsberg; Patel, Sanket; Witt, Evan; Wang, Bin; Ellison, Tyler D.; Dantas, Gautam

    2016-01-01

    The production of fuels or chemicals from lignocellulose currently requires thermochemical pretreatment to release fermentable sugars. These harsh conditions also generate numerous small-molecule inhibitors of microbial growth and fermentation, limiting production. We applied small-insert functional metagenomic selections to discover genes that confer microbial tolerance to these inhibitors, identifying both individual genes and general biological processes associated with tolerance to multip...

  20. Alcohol-induced histone acetylation reveals a gene network involved in alcohol tolerance.

    Directory of Open Access Journals (Sweden)

    Alfredo Ghezzi

    Full Text Available Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol.

  1. Tolerance

    NARCIS (Netherlands)

    Doorn, van M.

    2012-01-01

    Tolerance entails acceptance of the very things one disagrees with, disapproves of or dislikes. Tolerance can be seen as ‘a flawed virtue’ (Schuyt, 2001), because it concerns acceptance of the differences between others and ourselves we would rather fight, ignore or overcome. Although tolerance carr

  2. Mapping Quantitative Trait Loci Associated with Aluminum Toxin Tolerance in NJRIKY Recombinant Inbred Line Population of Soybean(Glycine max)

    Institute of Scientific and Technical Information of China (English)

    Bo Qi; Paul Korir; Tuanjie Zhao; Deyue Yu; Shouyi Chen; Junyi Gai

    2008-01-01

    To investigate the genetic mechanism of AI-tolerance in soybean,a recombinant inbred line population (RIL) with 184 F2:7:11 lines derived from the cross of Kefeng No.1 x Nannong 1138-2 (AI-tolerant x AI-sensitive) were tested in pot experimentwith sand culture medium in net room in Nanjing.Four traits,i.e.plant height,number of leaves,shoot dry weight and root dry weight at seedling stage,were evaluated and used to calculate the average membership index (FAi) as the indicator of AI-tolerance.The composite interval mapping (ClM) under WinQTL Cartographer v.2.5 detected five QTLs (i.e.qFAiol,qFAi-2,qFAi-3,qFAi-4 and qFAi-5),explaining 5.20%-9.07% of the total phenotypic variation individually.While with the multiple interval mapping (MIM) of the same software,five QTLs (qFAi-1,qFAi-5,qFAi-6,qFAi-7,and qFAi-8) explaining 5.7%-24.60% of the total phenotypic variation individually were mapped.Here qFAi-1 and qFAi-5 were detected by both CIM and MIM with the locations in a same flanking marker region,GMKF046-GMKF080 on B1 and satt278-sat_95 on L,respectively.While qFAi-2 under CIM and qFAi-6 under MIM both on D1b2 were located in neighboring regions with their confidence intervals overlapped and might be the same locus.Segregation analysis under major gene plus polygene inheritance model showed that Al-tolerance was controlled by two major genes (h2mg =33.05%) plus polygenes (h2pg=52.73%).Both QTL mapping and segregation analysis confirmed two QTLs responsible for Al-tolerance with relatively low heritability,and there might be a third QTL,confounded with the polygenes in segregation analysis.

  3. In vitro selection of induced mutants to salt-tolerance: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    A selection protocol to obtain salt tolerant calli, followed by regeneration and progeny-test of the regenerated plants for salt tolerance in rice was investigated. Callus cultures were initiated from salt-sensitive US elite rice lines and cv. 'Pokkali'. Salt-tolerant cell lines were selected from these by a single step selection procedure. The selected salt-tolerant lines grew well on medium with ± 0.5% or 1% NaCl, while the parent lines occasionally survived, but did not grow at these salt concentrations. Plants were regenerated from these cell lines through different passages on medium containing salt. Seed was collected from the regenerated plants and salt tolerance of R2 seedlings was compared with those regenerated without salt selection. Salt-tolerance was measured by survival and productive growth of newly germinated seedlings in Hoagland solution with 0.3% and 0.5% NaCl for 4 weeks. Heritable improvement in salt tolerance was obtained in R2 seedlings from one plant regenerated after 5 months selection. Survival and growth of these seedlings was equivalent to that from 'Pokkali' seedlings. These results show that cellular tolerance can provide salt-tolerance in rice plants. (author). 6 refs, 2 tabs

  4. Tolerância ao alumínio em cultivares de aveia branca sob cultivo hidropônico Tolerance to the aluminum in oat cultivars under hydroponic culture

    Directory of Open Access Journals (Sweden)

    José Antonio Gonzalez da Silva

    2007-01-01

    Full Text Available O emprego do cultivo hidropônico para avaliar a tolerância à toxicidade pelo alumínio em genótipos de aveia pode ser feito por meio da medida da retomada do crescimento de raiz. Avaliaram-se 12 cultivares de aveia branca indicadas para o cultivo no Sul do Brasil com o intuito de caracterizar a tolerância ao alumínio, de maneira a ser estrategicamente recomendadas e/ou incluídas em blocos de cruzamento na obtenção de constituições genéticas de elevado potencial produtivo e tolerante ao íon metálico. Foram utilizadas doses de 10, 15 e 20 mg L-1 de alumínio na solução hidropônica e o delineamento experimental adotado foi o completamente casualizado, com três repetições, seguindo o esquema fatorial (12 x 3. As doses empregadas são altamente eficientes na identificação de genótipos de aveia tolerantes e sensíveis ao alumínio tóxico. As cultivares UPF 16, URS 21, UFRGS 14, UPF 19 e UFRGS 17 expressam tolerância.The use of hidroponic culture to evaluate tolerance to aluminum toxicity in oat genotypes can be performed by measuring root regrowth, allowing phenotypically to discriminate tolerant genetic constitutions sensitivity. Twelve white oat cultivars indicated for cultivation in Southern Brazil were evaluated aiming at to characterize their aluminum tolerance, in order to use them as parents in crosses or to recommend them for in cultivation regions. Aluminum concentration of 10, 15 and 20 mg L-1 were used in the hydroponic solution arranged in complete randomized blocks with three replications in 12 x 3 factorial designs. Concentrations of 10, 15 and 20 mg L-1 were highly efficient for the identification of tolerant and sensitive oat genotypes. Cultivars UPF 16, URS 21, UFRGS 14, UPF 19 and UFRGS 17 showed aluminum.

  5. Quantitative transcription dynamic analysis reveals candidate genes and key regulators for ethanol tolerance in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Ma Menggen

    2010-06-01

    Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance

  6. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    OpenAIRE

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

    2015-01-01

    Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

  7. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  8. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated by the d...... these alternatives by returning to the notion of tolerance as the endurance of pain, linking this notion to exemplars and theories relevant to the politics of multiculturalism, religious freedom, and free speech.......Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated...... by the desire to experiment and to become otherwise. The objective is to discuss what gets lost, conceptually as well as politically, when we neglect the subsistence of active tolerance within other practices of tolerance, and to develop a theory of active tolerance in which tolerance's mobilizing character...

  9. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

    Directory of Open Access Journals (Sweden)

    Yoshiki eNakahara

    2015-10-01

    Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  10. Transformation of japonica rice with RHL gene and salt tolerance of the transgenic rice plant

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Overexpression of the yeast HAL2 gene increases salt tolerance of yeast and plant. Rice HAL2-like (RHL) gene was introduced into a japonica rice cultivar HJ19 with Agrobacterium tumefaciens-mediated transformation. Transgenic plants in R0 generation were selected on the principle of GUS-positive, RHL gene PCR-positive and normal growth. Hygromycin-resistant plants of some transgenic lines in R1 generation increased salt tolerance during the seedling and booting stage, being less damaged in the cytomembrane and stronger in leaf tissue viability under salt stress during booting period. Southern analysis of transgenic lines tolerant to salt in R1 generation showed that the RHL gene expression cassette had been successfully integrated into rice genome. Moreover, gene engineering breeding methodology and really salt-tolerant rice cultivar were discussed.

  11. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    Science.gov (United States)

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. PMID:26919127

  12. The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms

    DEFF Research Database (Denmark)

    Nilsson, Martin; Rybtke, Morten; Givskov, Michael;

    2016-01-01

    Microbial biofilms are tolerant to antibiotic treatment and therefore cause problematic infections. Knowledge about the molecular mechanisms underlying biofilm-associated antimicrobial tolerance will aid the development of antibiofilm drugs. Screening of a Streptococcus mutans transposon mutant...... library for genes that are important for biofilm-associated antimicrobial tolerance provided evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The minimum bactericidal concentration for biofilm cells (MBC-B) for a dltA transposon mutant was eight-fold lower...... and complemented strain confirmed that the dlt genes in S. mutans play a role in biofilm-associated tolerance to gentamicin. Confocal laser scanning microscopy analyses of biofilms grown on glass slides showed that the dltA mutant produced roughly the same amount of biofilm as the wild-type, indicating...

  13. Detection of drought tolerant genes within seedling apple rootstocks in Syria

    Science.gov (United States)

    This investigation was conducted to detect the drought tolerant genes (four genes) within seedling apple rootstocks derived from five apple genotypes, including Syrian apple cultivars. The results showed that the gene MdPepPro (a cyclophilin) was found in all studied genotypes and their progenies e...

  14. Cloning of genes and developing transgenic crops with enhanced tolerance to salinity and drought (abstract)

    International Nuclear Information System (INIS)

    Abiotic stresses represent the most limiting factors affecting agricultural productivity. In India more than 60% of total cultivated land is still rainfed and crops experience frequent droughts. Thus, we need to develop transgenic crops tolerant to drought, and other related abiotic stress factors such as salinity, low and high temperature stresses. At the National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (ICAR), we have initiated a programme on developing transgenic crops tolerant to a range of abiotic stresses. The major emphasis is on developing transgenic potato, tomato, mustard, rice and wheat. While, transgenic plants of potato. tomato and mustard have already been generated with osmotin gene and are at different stages of testing, other key genes imparting tolerance to abiotic stresses are being isolated from different species for producing transgenic rice and wheat cultivars tolerant to multiple stresses. Genes that have been isolated in our laboratory include ascorbate peroxidase gene (TaApx) and genes encoding transcription factor, CBFs (TaCBF2 and TaCBP3) from a drought tolerant wheat cultivar (C306), Lea1 cDNA from Brassica species, codA from Arthrobacter globiformis, and otsBA operon from E. coli. Apart from these stress-related genes, we have isolated a few stress-inducible promoters for deploying them in gene stacking in developing transgenic crops with enhanced tolerance to multiple abiotic stresses. The results will be presented. (author)

  15. Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.

    Science.gov (United States)

    An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja

    2015-03-01

    Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid.

  16. Differentially Expressed Genes between Two Barley Cultivars Contrasting in Drought Tolerance

    Institute of Scientific and Technical Information of China (English)

    P.G. Guo; M. Baum; R.H. Li; S. Grando; R.K. Varshney; J. Valkoun; S. Ceccarelli; A. Grane

    2007-01-01

    @@ Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas. A number of genes have been described that respond to drought at the transcriptional level (Seki et al., 2002; Cheong et al.,2003).

  17. Identification of Genes Conferring Tolerance to Lignocellulose-Derived Inhibitors by Functional Selections in Soil Metagenomes.

    Science.gov (United States)

    Forsberg, Kevin J; Patel, Sanket; Witt, Evan; Wang, Bin; Ellison, Tyler D; Dantas, Gautam

    2016-01-01

    The production of fuels or chemicals from lignocellulose currently requires thermochemical pretreatment to release fermentable sugars. These harsh conditions also generate numerous small-molecule inhibitors of microbial growth and fermentation, limiting production. We applied small-insert functional metagenomic selections to discover genes that confer microbial tolerance to these inhibitors, identifying both individual genes and general biological processes associated with tolerance to multiple inhibitory compounds. Having screened over 248 Gb of DNA cloned from 16 diverse soil metagenomes, we describe gain-of-function tolerance against acid, alcohol, and aldehyde inhibitors derived from hemicellulose and lignin, demonstrating that uncultured soil microbial communities hold tremendous genetic potential to address the toxicity of pretreated lignocellulose. We recovered genes previously known to confer tolerance to lignocellulosic inhibitors as well as novel genes that confer tolerance via unknown functions. For instance, we implicated galactose metabolism in overcoming the toxicity of lignin monomers and identified a decarboxylase that confers tolerance to ferulic acid; this enzyme has been shown to catalyze the production of 4-vinyl guaiacol, a valuable precursor to vanillin production. These metagenomic tolerance genes can enable the flexible design of hardy microbial catalysts, customized to withstand inhibitors abundant in specific bioprocessing applications. PMID:26546427

  18. Ectopic Expression of the Chinese Cabbage Malate Dehydrogenase Gene Promotes Growth and Aluminum Resistance in Arabidopsis.

    Science.gov (United States)

    Li, Qing-Fei; Zhao, Jing; Zhang, Jing; Dai, Zi-Hui; Zhang, Lu-Gang

    2016-01-01

    Malate dehydrogenases (MDHs) are key metabolic enzymes that play important roles in plant growth and development. In the present study, we isolated the full-length and coding sequences of BraMDH from Chinese cabbage [Brassica campestris L. ssp. pekinensis (Lour) Olsson]. We conducted bioinformatics analysis and a subcellular localization assay, which revealed that the BraMDH gene sequence contained no introns and that BraMDH is localized to the chloroplast. In addition, the expression pattern of BraMDH in Chinese cabbage was investigated, which revealed that BraMDH was heavily expressed in inflorescence apical meristems, as well as the effect of BraMDH overexpression in two homozygous transgenic Arabidopsis lines, which resulted in early bolting and taller inflorescence stems. Furthermore, the fresh and dry weights of aerial tissue from the transgenic Arabidopsis plants were significantly higher than those from the corresponding wild-type plants, as were plant height, the number of rosette leaves, and the number of siliques produced, and the transgenic plants also exhibited stronger aluminum resistance when treated with AlCl3. Therefore, our results suggest that BraMDH has a dramatic effect on plant growth and that the gene is involved in both plant growth and aluminum resistance. PMID:27536317

  19. Aluminum tolerance of two wheat cultivars (Brevor and Atlas66) in relation to their rhizosphere pH and organic acids exuded from roots.

    Science.gov (United States)

    Wang, Ping; Bi, Shuping; Ma, Liping; Han, Weiying

    2006-12-27

    Phytotoxicity of aluminum (Al) has become a serious problem in inhibiting plant growth on acid soils. Under Al stress, the changes of rhizosphere pH, root elongation, absorption of Al by wheat roots, organic acids exuded from roots, and some main factors related to Al-tolerant mechanisms have been studied using hydroponics, fluorescence spectrophotometry, and high performance liquid chromatography (HPLC). Two wheat cultivars, Brevor and Atlas66, differing in Al tolerance are chosen in the study. Accordingly, the rhizosphere pH has a positive effect on Al tolerance. Atlas66 (Al-tolerant) has higher capability to maintain high rhizosphere pH than Brevor (Al-sensitive) does. High pH can reduce Al3+ activity and toxicity, and increase the efficiency of exuding organic acids from the roots. More inhibition of root elongation has been found in Brevor because of the exposure of roots to Al3+ solution at low pH. Brevor accumulate more Al in roots than Atlas66 even at higher pH. Al-induced exudation of malic and citric acids has been found in Atlas66 roots, while no Al-induced organic acids have been found in Brevor. These results indicate that the Al-induced secretion of organic acids from Atlas66 roots has a positive correlation with Al tolerance. Comprehensive treatment of Al3+ and H+ indicates that wheat is adversely influenced by excess Al3+, rather than low pH. PMID:17177538

  20. Investigations of Aluminum-Doped Self-Healing Zircaloy Surfaces in Context of Accident-Tolerant Fuel Cladding Research

    Science.gov (United States)

    Carr, James; Vasudevamurthy, Gokul; Snead, Lance; Hinderliter, Brian; Massey, Caleb

    2016-06-01

    We present here some important results investigating aluminum as an effective surface dopant for increased oxidation resistance of zircaloy nuclear fuel cladding. At first, the transport behavior of aluminum into reactor grade zircaloy was studied using simple diffusion couples at temperatures greater than 770 K. The experiments revealed the formation of tens of microns thick graded Zr-Al layers. The activation energy of aluminum in zircaloy was found to be ~175 kJ/mol (~1.8 eV), indicating the high mobility of aluminum in zircaloy. Subsequently, aluminum sputter-coated zircaloy coupons were heat-treated to achieve surface doping and form compositionally graded layers. These coupons were then tested in steam environments at 1073 and 1273 K. The microstructure of the as-fabricated and steam-corroded specimens was compared to those of pure zircaloy control specimens. Analysis of data revealed that aluminum effectively competed with zircaloy for oxygen up until 1073 K blocking oxygen penetration, with no traces of large scale spalling, indicating mechanically stable interfaces and surfaces. At the highest steam test temperatures, aluminum was observed to segregate from the Zr-Al alloy under layers and migrate to the surface forming discrete clusters. Although this is perceived as an extremely desirable phenomenon, in the current experiments, oxygen was observed to penetrate into the zirconium-rich under layers, which could be attributed to formation of surface defects such as cracks in the surface alumina layers.

  1. Meta-analysis and candidate gene mining of low-phosphorus tolerance in maize

    Institute of Scientific and Technical Information of China (English)

    Hongwei Zhang; Mohammed Shalim Uddin; Cheng Zou; Chuanxiao Xie; Yunbi Xu; WenXue Li

    2014-01-01

    Plants with tolerance to low-phosphorus (P) can grow better under low-P conditions, and understanding of genetic mechanisms of low-P tolerance can not only facilitate identifying relevant genes but also help to develop low-P tolerant cultivars. QTL meta-analysis was conducted after a comprehensive review of the reports on QTL mapping for low-P tolerance-related traits in maize. Meta-analysis pro-duced 23 consensus QTL (cQTL), 17 of which located in similar chromosome regions to those previously reported to influence root traits. Meanwhile, candidate gene mining yielded 215 genes, 22 of which located in the cQTL regions. These 22 genes are homologous to 14 functionally character-ized genes that were found to participate in plant low-P tolerance, including genes encoding miR399s, Pi transporters and purple acid phosphatases. Four cQTL loci (cQTL2-1, cQTL5-3, cQTL6-2, and cQTL10-2) may play important roles for low-P tolerance because each contains more original QTL and has better consistency across previous reports.

  2. Comparison of genome-wide selection strategies to identify furfural tolerance genes in Escherichia coli.

    Science.gov (United States)

    Glebes, Tirzah Y; Sandoval, Nicholas R; Gillis, Jacob H; Gill, Ryan T

    2015-01-01

    Engineering both feedstock and product tolerance is important for transitioning towards next-generation biofuels derived from renewable sources. Tolerance to chemical inhibitors typically results in complex phenotypes, for which multiple genetic changes must often be made to confer tolerance. Here, we performed a genome-wide search for furfural-tolerant alleles using the TRackable Multiplex Recombineering (TRMR) method (Warner et al. (2010), Nature Biotechnology), which uses chromosomally integrated mutations directed towards increased or decreased expression of virtually every gene in Escherichia coli. We employed various growth selection strategies to assess the role of selection design towards growth enrichments. We also compared genes with increased fitness from our TRMR selection to those from a previously reported genome-wide identification study of furfural tolerance genes using a plasmid-based genomic library approach (Glebes et al. (2014) PLOS ONE). In several cases, growth improvements were observed for the chromosomally integrated promoter/RBS mutations but not for the plasmid-based overexpression constructs. Through this assessment, four novel tolerance genes, ahpC, yhjH, rna, and dicA, were identified and confirmed for their effect on improving growth in the presence of furfural.

  3. Tolerância de cultivares de arroz a diferentes níveis de alumínio em solução nutritiva Rice cultivars tolerance to different levels of aluminum in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1983-01-01

    relation to their tolerance to aluminum toxicity, at temperature of 25 ± 1°C and 30 ± 1°C using five different aluminum levels in 8.3 liter pots with 330 seedlings/pot, under controlled growth conditions. The tolerance was measured taking into account the root growth in an aluminum-free complete nutrient solution after a previous aluminum treatment. With an excessive amount of Al3+, the primary roots did not grow at all and remained thickened at the tip, showing a typical aluminum injury. In nutrient solutions at a temperature of 25 ± 1°C the rice cultivars IAC-899 and IR-841 were sensitive to the Al3+ concentration of 10mg/l of Al3+; IR-43, IR-45 and IR-8 were sensitive to 20mg/l and the cultivars IR-42 and CICA-4 were sensitive to 40mg/l; IAC-435, IAC-164, Pérola, Batatais, Pratão Precoce, Blue Bonnet, IAC-120, IAC-47, IAC-1246, IAC-25, IAC-165, Pratão, Dou-ado Precoce and CICA-8 showed tolerance to 40mg/l. In nutrient solutions at a temperature of 30 ± 1°C all cultivars presented tolerance to the Al3+ concentrations of 5, 10 and 20mg/l of Al+3. The cultivars Dourado Precoce, CICA-4, IR-42, IR-43, IR-45, IR-8, IAC-899, IR-665-4-5-5 and IR-841 were sensitive to 40mg/l of Al3+. Under the same conditions the following cultivars were considered tolerant to aluminum concentration of 40mg/l: IAC-47, Blue Bonnet, IAC-1246, IAC-164, Pratão, Pratão Precoce, CICA-8, IAC-435, IAC-120, IAC-25, IAC-165, Pérola and Batatais. The rice cultivars under study were ranked into classes of aluminum tolerance: tolerant: IAC-435, IAC-120, IAC-47, IAC-1246, IAC-25, IAC-165, IAC-164, Pérola, Batatais, Pratão Precoce, Blue Bonnet; moderately tolerant: Pratão, Dourado Precoce and CICA-8; and sensitive: CICA-4, IR-42, IR-43, IR-45, IR-8, IAC-899, IR-665-4-5-5 and IR-841.

  4. Network Candidate Genes in Breeding for Drought Tolerant Crops

    OpenAIRE

    Christoph Tim Krannich; Lisa Maletzki; Christina Kurowsky; Renate Horn

    2015-01-01

    Climate change leading to increased periods of low water availability as well as increasing demands for food in the coming years makes breeding for drought tolerant crops a high priority. Plants have developed diverse strategies and mechanisms to survive drought stress. However, most of these represent drought escape or avoidance strategies like early flowering or low stomatal conductance that are not applicable in breeding for crops with high yields under drought conditions. Even though a gr...

  5. Identification of Listeria monocytogenes Genes Involved in Salt and Alkaline-pH Tolerance

    OpenAIRE

    Gardan, Rozenn; Cossart, Pascale; Labadie, Jean

    2003-01-01

    The capacity of Listeria monocytogenes to tolerate salt and alkaline stresses is of particular importance, as this pathogen is often exposed to such environments during food processing and food preservation. We screened a library of Tn917-lacZ insertional mutants in order to identify genes involved in salt and/or alkaline tolerance. We isolated six mutants sensitive to salt stress and 12 mutants sensitive to salt and alkaline stresses. The position of the insertion of the transposon was locat...

  6. Transcriptome profiling of genes and pathways associated with arsenic toxicity and tolerance in Arabidopsis

    Science.gov (United States)

    2014-01-01

    Background Arsenic (As) is a toxic metalloid found ubiquitously in the environment and widely considered an acute poison and carcinogen. However, the molecular mechanisms of the plant response to As and ensuing tolerance have not been extensively characterized. Here, we report on transcriptional changes with As treatment in two Arabidopsis accessions, Col-0 and Ws-2. Results The root elongation rate was greater for Col-0 than Ws-2 with As exposure. Accumulation of As was lower in the more tolerant accession Col-0 than in Ws-2. We compared the effect of As exposure on genome-wide gene expression in the two accessions by comparative microarray assay. The genes related to heat response and oxidative stresses were common to both accessions, which indicates conserved As stress-associated responses for the two accessions. Most of the specific response genes encoded heat shock proteins, heat shock factors, ubiquitin and aquaporin transporters. Genes coding for ethylene-signalling components were enriched in As-tolerant Col-0 with As exposure. A tolerance-associated gene candidate encoding Leucine-Rich Repeat receptor-like kinase VIII (LRR-RLK VIII) was selected for functional characterization. Genetic loss-of-function analysis of the LRR-RLK VIII gene revealed altered As sensitivity and the metal accumulation in roots. Conclusions Thus, ethylene-related pathways, maintenance of protein structure and LRR-RLK VIII-mediated signalling may be important mechanisms for toxicity and tolerance to As in the species. Here, we provide a comprehensive survey of global transcriptional regulation for As and identify stress- and tolerance-associated genes responding to As. PMID:24734953

  7. Abiotic Stress Tolerance: From Gene Discovery in Model Organisms to Crop Improvement

    Institute of Scientific and Technical Information of China (English)

    Ray Bressan; Hans Bohnert; Jian-Kang Zhu

    2009-01-01

    Productive and sustainable agriculture necessitates growing plants in sub-optimal environments with less input of precious resources such as fresh water. For a better understanding and rapid improvement of abiotic stress tolerance, it is important to link physiological and biochemical work to molecular studies in genetically tractable model organisms. With the use of several technologies for the discovery of stress tolerance genes and their appropriate alleles,transgenic approaches to improving stress tolerance in crops remarkably parallels breeding principles with a greatly expanded germplasm base and will succeed eventually.

  8. Genome-wide mapping of furfural tolerance genes in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Tirzah Y Glebes

    Full Text Available Advances in genomics have improved the ability to map complex genotype-to-phenotype relationships, like those required for engineering chemical tolerance. Here, we have applied the multiSCale Analysis of Library Enrichments (SCALEs; Lynch et al. (2007 Nat. Method. approach to map, in parallel, the effect of increased dosage for >10(5 different fragments of the Escherichia coli genome onto furfural tolerance (furfural is a key toxin of lignocellulosic hydrolysate. Only 268 of >4,000 E. coli genes (∼ 6% were enriched after growth selections in the presence of furfural. Several of the enriched genes were cloned and tested individually for their effect on furfural tolerance. Overexpression of thyA, lpcA, or groESL individually increased growth in the presence of furfural. Overexpression of lpcA, but not groESL or thyA, resulted in increased furfural reduction rate, a previously identified mechanism underlying furfural tolerance. We additionally show that plasmid-based expression of functional LpcA or GroESL is required to confer furfural tolerance. This study identifies new furfural tolerant genes, which can be applied in future strain design efforts focused on the production of fuels and chemicals from lignocellulosic hydrolysate.

  9. Genome-wide mapping of furfural tolerance genes in Escherichia coli.

    Science.gov (United States)

    Glebes, Tirzah Y; Sandoval, Nicholas R; Reeder, Philippa J; Schilling, Katherine D; Zhang, Min; Gill, Ryan T

    2014-01-01

    Advances in genomics have improved the ability to map complex genotype-to-phenotype relationships, like those required for engineering chemical tolerance. Here, we have applied the multiSCale Analysis of Library Enrichments (SCALEs; Lynch et al. (2007) Nat. Method.) approach to map, in parallel, the effect of increased dosage for >10(5) different fragments of the Escherichia coli genome onto furfural tolerance (furfural is a key toxin of lignocellulosic hydrolysate). Only 268 of >4,000 E. coli genes (∼ 6%) were enriched after growth selections in the presence of furfural. Several of the enriched genes were cloned and tested individually for their effect on furfural tolerance. Overexpression of thyA, lpcA, or groESL individually increased growth in the presence of furfural. Overexpression of lpcA, but not groESL or thyA, resulted in increased furfural reduction rate, a previously identified mechanism underlying furfural tolerance. We additionally show that plasmid-based expression of functional LpcA or GroESL is required to confer furfural tolerance. This study identifies new furfural tolerant genes, which can be applied in future strain design efforts focused on the production of fuels and chemicals from lignocellulosic hydrolysate.

  10. Barley Genes as Tools to Confer Abiotic Stress Tolerance in Crops.

    Science.gov (United States)

    Gürel, Filiz; Öztürk, Zahide N; Uçarlı, Cüneyt; Rosellini, Daniele

    2016-01-01

    Barley is one of the oldest cultivated crops in the world with a high adaptive capacity. The natural tolerance of barley to stress has led to increasing interest in identification of stress responsive genes through small/large-scale omics studies, comparative genomics, and overexpression of some of these genes by genetic transformation. Two major categories of proteins involved in stress tolerance are transcription factors (TFs) responsible from the re-programming of the metabolism in stress environment, and genes encoding Late Embryogenesis Abundant (LEA) proteins, antioxidant enzymes, osmolytes, and transporters. Constitutive overexpression of several barley TFs, such as C-repeat binding factors (HvCBF4), dehydration-responsive element-binding factors (HvDREB1), and WRKYs (HvWRKY38), in transgenic plants resulted in higher tolerance to drought and salinity, possibly by effectively altering the expression levels of stress tolerance genes due to their higher DNA binding affinity. Na(+)/H(+) antiporters, channel proteins, and lipid transporters can also be the strong candidates for engineering plants for tolerance to salinity and low temperatures. PMID:27536305

  11. Key genes involved in desiccation tolerance and dormancy across life forms.

    Science.gov (United States)

    Costa, Maria Cecília D; Farrant, Jill M; Oliver, Melvin J; Ligterink, Wilco; Buitink, Julia; Hilhorst, Henk M W

    2016-10-01

    Desiccation tolerance (DT, the ability of certain organisms to survive severe dehydration) was a key trait in the evolution of life in terrestrial environments. Likely, the development of desiccation-tolerant life forms was accompanied by the acquisition of dormancy or a dormancy-like stage as a second powerful adaptation to cope with variations in the terrestrial environment. These naturally stress tolerant life forms may be a good source of genetic information to generate stress tolerant crops to face a future with predicted higher occurrence of drought. By mining for key genes and mechanisms related to DT and dormancy conserved across different species and life forms, unique candidate key genes may be identified. Here we identify several of these putative key genes, shared among multiple organisms, encoding for proteins involved in protection, growth and energy metabolism. Mutating a selection of these genes in the model plant Arabidopsis thaliana resulted in clear DT-, dormancy- and other seed-associated phenotypes, showing the efficiency and power of our approach and paves the way for the development of drought-stress tolerant crops. Our analysis supports a co-evolution of DT and dormancy by shared mechanisms that favour survival and adaptation to ever-changing environments with strong seasonal fluctuations. PMID:27593474

  12. 40 CFR 180.1091 - Aluminum isopropoxide and aluminum secondary butoxide; exemption from the requirement of a...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Aluminum isopropoxide and aluminum... PESTICIDE CHEMICAL RESIDUES IN FOOD Exemptions From Tolerances § 180.1091 Aluminum isopropoxide and aluminum secondary butoxide; exemption from the requirement of a tolerance. Aluminum isopropoxide (CAS Reg. No....

  13. Tolerância de cultivares de trigo a diferentes níveis de alumínio em solução nutritiva e no solo Tolerance op wheat cultivars to different levels of aluminum toxicity

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1981-01-01

    Full Text Available Foram estudados dez cultivares de trigo em soluções nutritivas contendo cinco diferentes níveis de alumínio tóxico. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após um período prévio de 48 horas em solução contendo uma concentração conhecida de alumínio. Os cultivares Siete Cerros e Tobari-66 foram sensíveis, respectivamente, a 1 e 3 ppm de alumínio. 'Alondra-S-46', 'Alondra-S-45' e 'IAC-17' foram sensíveis a 6 ppm; 'BH-1146', 'IAC-5', 'IAC-18', 'IAC-13' e 'Londrina' foram tolerantes a 10 ppm, porém 'BH-1146', 'IAC-18' e 'IAC-13' foram mais tolerantes que 'IAC-5' e 'Londrina'. Os cultivares BH-1146, IAC-17, Alondra-S-46, Tobari-66 e Siete Cerros foram cultivados em vasos contendo solo ácido mostrando a presença de alumínio. Metade do número de vasos recebeu uma aplicação de calcário. Os resultados desse experimento mostraram que o cultivar BH-1146 diferiu significativamente em produção de grãos por planta de 'Tobari-66', 'Alondra-S-46', 'IAC-17' e 'Siete Cerros'. Esse resultado confirmou a tolerância ao alumínio do cultivar BH-1146, observada quando se empregou solução nutritiva com a presença desse elemento.Ten wheat cultivars were studied to aluminum toxicity using five different levels of this element. The tolerance was measured taking into account the root growth in a aluminum-free complete nutrient solution after a previous Al treatment. With toxic amounts of Al, the primary roots did not grow at all and remained thickned at the tip as a typical Al injury. The wheat cultivars Siete Cerros and Tobari-66 were sensitive to 1 and 3 ppm of aluminum, respectively. The cultivars Alondra-S-46, Alondra-S-45 and IAC-17 were sensitive to 6 ppm. The cultivars BH-1146, IAC-5, IAC-18, IAC-13 and Londrina showed tolerance to 10 ppm but BH-1146, IAC-18 and IAC-13 were more tolerant than IAC-5 and Londrina. The cultivars BH-1146, IAC-17, Alondra-S-46

  14. Overexpression of SOS (Salt Overly Sensitive)Genes Increases Salt Tolerance in Transgenic Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Qing Yang; Zhi-Zhong Chen; Xiao-Feng Zhoua; Hai-Bo Yin; Xia Li; Xiu-Fang Xin; Xu-Hui Hong; Jian-Kang Zhu; Zhizhong Gong

    2009-01-01

    Soil salinity is a major abiotic stress that decreases plant growth and productivity. Recently, it was reported that plants overexpressing AtNHX1 or SOS1 have significantly increased salt tolerance. To test whether overexpression of multiple genes can improve plant salt tolerance even more, we produced six different transgenic Arabidopsis plants that overexpress AtNHX1, SOS3, AtNHXl + SOS3, SOS1, SOS2 + SOS3, or SOS1 + SOS2 + SOS3. Northern blot analyses confirmed the presence of high levels of the relevant gene transcripts in transgenic plants. Transgenic Arabidopsis plants overexpressing AtNHX1 alone did not present any significant increase in salt tolerance, contrary to earlier reports. We found that transgenic plants overexpressing SOS3 exhibit increased salt tolerance similar to plants overexpressing SOS1. Moreover, salt tolerance of transgenic plants overexpressing AtNHXl + SOS3, 50S2 + SOS3, or SOS1 + SOS2 +SOS3, respectively, appeared similar to the tolerance of transgenic plants overexpressing either SOS1 or SOS3 alone.

  15. Identification and characterization of two functionally unknown genes involved in butanol tolerance of Clostridium acetobutylicum.

    Science.gov (United States)

    Jia, Kaizhi; Zhang, Yanping; Li, Yin

    2012-01-01

    Solvents toxicity is a major limiting factor hampering the cost-effective biotechnological production of chemicals. In Clostridium acetobutylicum, a functionally unknown protein (encoded by SMB_G1518) with a hypothetical alcohol interacting domain was identified. Disruption of SMB_G1518 and/or its downstream gene SMB_G1519 resulted in increased butanol tolerance, while overexpression of SMB_G1518-1519 decreased butanol tolerance. In addition, SMB_G1518-1519 also influences the production of pyruvate:ferredoxin oxidoreductase (PFOR) and flagellar protein hag, the maintenance of cell motility. We conclude that the system of SMB_G1518-1519 protein plays a role in the butanol sensitivity/tolerance phenotype of C. acetobutylicum, and can be considered as potential targets for engineering alcohol tolerance. PMID:22768047

  16. Identification and characterization of two functionally unknown genes involved in butanol tolerance of Clostridium acetobutylicum.

    Directory of Open Access Journals (Sweden)

    Kaizhi Jia

    Full Text Available Solvents toxicity is a major limiting factor hampering the cost-effective biotechnological production of chemicals. In Clostridium acetobutylicum, a functionally unknown protein (encoded by SMB_G1518 with a hypothetical alcohol interacting domain was identified. Disruption of SMB_G1518 and/or its downstream gene SMB_G1519 resulted in increased butanol tolerance, while overexpression of SMB_G1518-1519 decreased butanol tolerance. In addition, SMB_G1518-1519 also influences the production of pyruvate:ferredoxin oxidoreductase (PFOR and flagellar protein hag, the maintenance of cell motility. We conclude that the system of SMB_G1518-1519 protein plays a role in the butanol sensitivity/tolerance phenotype of C. acetobutylicum, and can be considered as potential targets for engineering alcohol tolerance.

  17. Developing transgenic maize (Zea mays L.) with insect resistance and glyphosate tolerance by fusion gene transformation

    Institute of Scientific and Technical Information of China (English)

    SUN He; LANG Zhi-hong; LU Wei; ZHANG Jie; HE Kang-lai; ZHU Li; LIN Min; HUANG Da-fang

    2015-01-01

    Using linker peptide LP4/2A for multiple gene transformation is considered to be an effective method to stack or pyramid several traits in plants. Bacil us thuringiensis (Bt) cry gene and epsps (5-enolpyruvylshikimate-3-phosphate synthase) gene are two important genes for culturing pest-resistant and glyphosate-tolerant crops. We used linker peptide LP4/2A to connect the Bt cry1Ah gene with the 2mG2-epsps gene and combined the wide-used manA gene as a selective marker to construct one coordinated expression vector cal ed p2EPUHLAGN. The expression vector was transferred into maize by Agrobacterium tumefaciens-mediated transformation, and 60 plants were obtained, 40%of which were positive transformants. Molecular detection demonstrated that the two genes in the fusion vector were expressed simultaneously and spliced correctly in translation processing;meanwhile bioassay detection proved the transgenic maize had preferable pest resistance and glyphosate tolerance. Therefore, linker peptide LP4/2A provided a simple and reliable strategy for producing gene stacking in maize and the result showed that the fusion gene transformation system of LP4/2A was feasible in monocot plants.

  18. Phytohormones enabled endophytic fungal symbiosis improve aluminum phytoextraction in tolerant Solanum lycopersicum: An examples of Penicillium janthinellum LK5 and comparison with exogenous GA3.

    Science.gov (United States)

    Khan, Abdul Latif; Waqas, Muhammad; Hussain, Javid; Al-Harrasi, Ahmed; Hamayun, Muhammad; Lee, In-Jung

    2015-09-15

    This work investigates the potentials of fungal-endophyte Penicillium janthinellum LK5 (PjLK5) and its inherent gibberellic acid (GA3) as reference to enhance aluminum (Al) induced toxicity in tolerant tomato (Solanum lycopersicum) plants. Initial screening showed significantly higher uptake of Al by PjLK5. Aluminum stress (100 μM) significantly retarted plant growth in control plants. Conversely PjLK5 and GA3 application significantly increased morphological attributes of Al-tolerant tomato plants with or without Al-stress. PjLK5 inoculation with and without Al-stress maintained the plant growth whilst extracting and translocating higher Al in shoot (∼ 1 92 mg/kg) and root (∼ 296 mg/kg). This was almost similar in GA3 treatments as well. In addition, PjLK5 inoculation extended protective effects to tomato plants by maintaining reduced cellular superoxide anions in Al stress. Al-induced oxidative stress was further reduced due to significantly higher activity of metal-responsive reduced glutathione. The functional membrane was less damaged in PjLK5 and GA3 treatments because the plants synthesized reduced levels of malondialdhyde, lenolenic and linoleic acids. Defense-related endogenous phytohormone salicylic acid was significantly up-regulated to counteract the adverse effects of Al-stress. In conclusion, the PjLK5 possess a similar bio-prospective potential as of GA3. Application of such biochemically active endophyte could increase metal phytoextraction whilst maintaining crop physiological homeostasis. PMID:25885165

  19. Differential expression of salt tolerance related genes in Brassica campestris L. ssp. chinensis (L.) Makino var. communis Tsen et Lee

    Institute of Scientific and Technical Information of China (English)

    Yang QIU; Xi-xiang LI; Hai-ying ZHI; Di SHEN; Peng LU

    2009-01-01

    We examined salt tolerance responsive genes in Pak-choi under salt stress and analyze their potential function. The mRNA differential display was used to screen the transcript derived fragments (TDFs) related to salinity tolerance in tolerant and moderately tolerant Pak-choi germplasm. Seventy-eight primer combinations generated 101 differential cDNA fragments, which were divided into 10 expression types. Seven cDNA sequences (GenBank accession Nos. DQ006915-DQ006921) obtained and sequenced were highly homologous to some known expression genes or the genes related to the signaling pathways in plants under different abiotic stress.

  20. Identification of a novel gene (Hsdr4) involved in water-stress tolerance in wild barley.

    Science.gov (United States)

    Suprunova, Tatiana; Krugman, Tamar; Distelfeld, Assaf; Fahima, Tzion; Nevo, Eviatar; Korol, Abraham

    2007-05-01

    Drought is one of the most severe stresses limiting plant growth and yield. Genes involved in water stress tolerance of wild barley (Hordeum spontaneoum), the progenitor of cultivated barley, were investigated using genotypes contrasting in their response to water stress. Gene expression profiles of water-stress tolerant vs. water-stress sensitive wild barley genotypes, under severe dehydration stress applied at the seedling stage, were compared using cDNA-AFLP analysis. Of the 1100 transcript-derived fragments (TDFs) amplified about 70 displayed differential expression between control and stress conditions. Eleven of them showed clear difference (up- or down-regulation) between tolerant and susceptible genotypes. These TDFs were isolated, sequenced and tested by RT-PCR. The differential expression of seven TDFs was confirmed by RT-PCR, and TDF-4 was selected as a promising candidate gene for water-stress tolerance. The corresponding gene, designated Hsdr4 (Hordeum spontaneum dehydration-responsive), was sequenced and the transcribed and flanking regions were determined. The deduced amino acid sequence has similarity to the rice Rho-GTPase-activating protein-like with a Sec14 p-like lipid-binding domain. Analysis of Hsdr4 promoter region that was isolated by screening a barley BAC library, revealed a new putative miniature inverted-repeat transposable element (MITE), and several potential stress-related binding sites for transcription factors (MYC, MYB, LTRE, and GT-1), suggesting a role of the Hsdr4 gene in plant tolerance to dehydration stress. Furthermore, the Hsdr4 gene was mapped using wild barley mapping population to the long arm of chromosome 3H between markers EBmac541 and EBmag705, within a region that previously was shown to affect osmotic adaptation in barley. PMID:17238046

  1. Genetically engineered Rice with transcription factor DREB genes for abiotic stress tolerance(abstract)

    International Nuclear Information System (INIS)

    Water stress (drought and Salinity) is the most severe limitation to rice productivity. Several breeding approaches (MAS, QTL) applied to suitable genotypes are in place at IRRI and elsewhere. Phenotyping of water stress tolerance is in progress with potential predictability. Dr. Shinozaki's group has cloned a number of transcription factor genes, which have been shown to work in Arabidopsis to achieve drought, cold, and salinity tolerant plants. None of these genes have as yet displayed their potential functioning in rice. Genetic engineering aims at cross talk between different stress signaling pathways leading to stress tolerance. Osmotic Adjustment (OA) is an effective component of abiotic stress (drought and salinity) tolerance in many plants including rice. When plant experiences water stress, OA contributes to turgor maintenance of both shoots and roots. Conventional breeding could not achieve the OA in rice excepting a few rice cultivars, which are partially adapted to water-stress conditions. Several stress-related genes have now been cloned and transferred in to enhance the osmolytes and some transgenic lines showed increased tolerance to osmotic stress. A few strategies could be effectively deployed for a better understanding of water-stress tolerance in rice and to develop transgenic rice, which can survive for a critical period of water-stress conditions: 1) Switching on of transcription factor regulating the expression of several genes related to abiotic stress, 2) Use of a suitable stress inducible promoter driving the target gene for an efficient and directed expression in plants, 3) Understanding of phenotyping and GxE in a given environment, 4) Selection of a few adaptive rice cultivars suitable in drought/salinity prone areas, 5) Microarray, proteomics, QTL and MAS may expedite the cloning and characterizing the stress induced genes, and 6) Finally, the efficient transformation system for generating a large number of transgenic rice of different

  2. Towards a tolerance toolkit: Gene expression signatures enabling the emergence of resistant bacterial strains

    Science.gov (United States)

    Erickson, Keesha; Chatterjee, Anushree

    2014-03-01

    Microbial pathogens are able to rapidly acquire tolerance to chemical toxins. Developing next-generation antibiotics that impede the emergence of resistance will help avoid a world-wide health crisis. Conversely, the ability to induce rapid tolerance gains could lead to high-yielding strains for sustainable production of biofuels and commodity chemicals. Achieving these goals requires an understanding of the general mechanisms allowing microbes to become resistant to diverse toxins. We apply top-down and bottom-up methodologies to identify biological network changes leading to adaptation and tolerance. Using a top-down approach, we perform evolution experiments to isolate resistant strains, collect samples for transcriptomic and proteomic analysis, and use the omics data to inform mathematical gene regulatory models. Using a bottom-up approach, we build and test synthetic genetic devices that enable increased or decreased expression of selected genes. Unique patterns in gene expression are identified in cultures actively gaining resistance, especially in pathways known to be involved with stress response, efflux, and mutagenesis. Genes correlated with tolerance could potentially allow the design of resistance-free antibiotics or robust chemical production strains.

  3. Tolerância de genótipos de cereais de inverno ao alumínio em cultivo hidropônico e em campo Tolerance of small graine cereal genotypes to aluminum on hydroponic and field cultivation

    Directory of Open Access Journals (Sweden)

    Roberto Portaluppi

    2010-02-01

    Full Text Available O objetivo deste trabalho foi determinar a capacidade de crescimento radicular de 75 genótipos de cereais de inverno em cultivo hidropônico, em diferentes concentrações de alumínio, avaliar a relação entre o grau de tolerância/sensibilidade, em solução hidropônica, e a resistência/suscetibilidade ao crestamento em campo. Os cereais cevada, triticale, centeio, trigo e Aegilops tauschii foram avaliados em hidroponia, com concentrações de Al3+ que variaram entre 0,5 (cevada, 2 e 6 (triticale, 6 e 10 (centeio e 2 mg L-1 (trigo e Ae. tauschii. Os delineamentos experimentais foram inteiramente casualizados. Em campo, foram avaliados os mesmos genótipos, exceto Ae. tauschii, em solo com pH 4,4 e 4,85, corrigido a 1/2 e 1/4 do índice SMP. Utilizou-se uma escala de notas com variação de escores de 0,5 (altamente resistente a 5 (altamente suscetível. Foi observada elevada relação entre a tolerância ao alumínio em hidroponia e a resistência ao crestamento em campo. A seleção de cereais em meio hidropônico pode ser considerada eficiente como ferramenta de apoio aos programas de melhoramento genético para essa característica.The objective of this work was to determine the root growth capacity of 75 genotypes of small graine cereals in hydroponic culture under different aluminum concentrations, and to assess the relationship betwen the level of tolerance/sensitivity in hydroponic solution and the resistance/susceptibility index in the field. Barley, triticale, rye, wheat and Aegilops tauschii were evaluated in hydroponics, with Al3+ concentrations that varied between 0.5 (barley, 2 and 6 (triticale, 6 and 10 (rye and 2 mg L-1 (wheat and Ae. tauschii. The experiments' designs were completely randomized. In the field trial, the same genotypes were assessed, except for Ae. tauschii, in soil with pH 4.4 and 4.85 adjusted to 1/2 and 1/4 of the SMP index. A score scale ranging from 0.5 (highly resistant to 5 (highly susceptible was used

  4. Discovery and Characterization of Two Novel Salt-Tolerance Genes in Puccinellia tenuiflora

    Directory of Open Access Journals (Sweden)

    Ying Li

    2014-09-01

    Full Text Available Puccinellia tenuiflora is a monocotyledonous halophyte that is able to survive in extreme saline soil environments at an alkaline pH range of 9–10. In this study, we transformed full-length cDNAs of P. tenuiflora into Saccharomyces cerevisiae by using the full-length cDNA over-expressing gene-hunting system to identify novel salt-tolerance genes. In all, 32 yeast clones overexpressing P. tenuiflora cDNA were obtained by screening under NaCl stress conditions; of these, 31 clones showed stronger tolerance to NaCl and were amplified using polymerase chain reaction (PCR and sequenced. Four novel genes encoding proteins with unknown function were identified; these genes had no homology with genes from higher plants. Of the four isolated genes, two that encoded proteins with two transmembrane domains showed the strongest resistance to 1.3 M NaCl. RT-PCR and northern blot analysis of P. tenuiflora cultured cells confirmed the endogenous NaCl-induced expression of the two proteins. Both of the proteins conferred better tolerance in yeasts to high salt, alkaline and osmotic conditions, some heavy metals and H2O2 stress. Thus, we inferred that the two novel proteins might alleviate oxidative and other stresses in P. tenuiflora.

  5. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    Directory of Open Access Journals (Sweden)

    Bingfu eGuo

    2015-10-01

    Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

  6. Creation of the herbicide tolerant rice plants via T-DNA mediated gene targeting

    International Nuclear Information System (INIS)

    Precise modification of the plant genome is important both for the study of gene function in vivo and for producing publicly acceptable transgenic plants. Thus establishment of an efficient gene targeting (GT) system in plant is a significant goal. Here, we report a successful introduction of point mutations into an endogenous rice gene by T-DNA mediated GT. ALS is the primary target for at least four structurally distinct classes of herbicides. Recently, Shimizu et al. screened an ALS-inhibiting herbicide, bispyribac-sodium (BS) tolerant rice cells. BS tolerance was linked to two point mutations in ALS gene: a tryptophan (TGG) to leucine (TTG) change at amino acid 548 (W548L), and serine (AGT) to isoleucine (ATT) change at amino acide 627 (S627I). However, no plants could be recovered from the BS-tolerant rice cells due to prolonged tissue culture. Then we tried to produce BS tolerant rice plants containing these double mutations in ALS by T-DNA mediated GT. We obtained 70 GT plants from 1500 rice scutellum-derived calli infected with Agrobacterium horboring GT vector. GT rice homozygous for the modified ALS locus showed hyper tolerance to BS as compared to BS tolerant plants, which overexpressed W548L/S627I mutating ALS produced by a conventional transgenic system. This result indicates that exclusion of the BS sensitive wild-type ALS allele is important to confer high levels of BS tolerance. Not only selectable two point mutations, which confer BS tolerance but also non-selectable silent mutations on the targeting vector were incorporated into the GT plants. This result indicates that T-DNA mediated GT system is available for introduction of several point mutations to the target gene. Furthermore, point mutations on the targeting vector were incorporated into the genome with a mosaic manner in 3 plants out of 70 GT plants, suggesting the involvement of DNA mismatch repair system in the course of T-DNA mediated GT in these plants. (author)

  7. Salt tolerance of transgenic rice (Oryza sativa L.) with mtlD gene and gutD gene

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Southern blot analysis indicated that mtlD gene (encoding mannitol-1-phosphate dehydrogenase) and gutD gene (encoding glucitol-6-phosphate dehydrogenase) had been integrated into the rice genome mediated by Agrobacterium tumefaciens LBA4404(pBIGM). The expression of the above two genes in transgenic rice plants was demonstrated by Northern blot analysis and enzymatic activity assay. Analysis of sugar alcohol showed that transgenic rice plants could produce and accumulate mannitol and sorbitol. The salt tolerance of transgenic plants was much higher than that of their controls.

  8. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xiaojuan, E-mail: xiaojuanwang@lzu.edu.cn [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Song, Yu [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Environment Management College of China, Qinhuangdao 066004 (China); Ma Yanhua [Hebei Normal University of Science and Technology, Qinhuangdao 066004 (China); Zhuo Renying [Key Lab of Tree Genomics, Research Institute of Subtropical of Forest, Chinese Academy of Forest, Fuyang 311400 (China); Jin Liang [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China)

    2011-12-15

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: > Evaluate Cd tolerance in wide sources of alfalfa accessions. > Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. > Cloned differentially expressed metallothionein (MT) genes. > Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. > MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  9. New Genes Involved in Osmotic Stress Tolerance in Saccharomyces cerevisiae

    Science.gov (United States)

    Gonzalez, Ramon; Morales, Pilar; Tronchoni, Jordi; Cordero-Bueso, Gustavo; Vaudano, Enrico; Quirós, Manuel; Novo, Maite; Torres-Pérez, Rafael; Valero, Eva

    2016-01-01

    Adaptation to changes in osmolarity is fundamental for the survival of living cells, and has implications in food and industrial biotechnology. It has been extensively studied in the yeast Saccharomyces cerevisiae, where the Hog1 stress activated protein kinase was discovered about 20 years ago. Hog1 is the core of the intracellular signaling pathway that governs the adaptive response to osmotic stress in this species. The main endpoint of this program is synthesis and intracellular retention of glycerol, as a compatible osmolyte. Despite many details of the signaling pathways and yeast responses to osmotic challenges have already been described, genome-wide approaches are contributing to refine our knowledge of yeast adaptation to hypertonic media. In this work, we used a quantitative fitness analysis approach in order to deepen our understanding of the interplay between yeast cells and the osmotic environment. Genetic requirements for proper growth under osmotic stress showed both common and specific features when hypertonic conditions were induced by either glucose or sorbitol. Tolerance to high-glucose content requires mitochondrial function, while defective protein targeting to peroxisome, GID-complex function (involved in negative regulation of gluconeogenesis), or chromatin dynamics, result in poor survival to sorbitol-induced osmotic stress. On the other side, the competitive disadvantage of yeast strains defective in the endomembrane system is relieved by hypertonic conditions. This finding points to the Golgi-endosome system as one of the main cell components negatively affected by hyperosmolarity. Most of the biological processes highlighted in this analysis had not been previously related to osmotic stress but are probably relevant in an ecological and evolutionary context. PMID:27733850

  10. Engineering Clostridium beijerinckii with the Cbei_4693 gene knockout for enhanced ferulic acid tolerance.

    Science.gov (United States)

    Liu, Jun; Guo, Ting; Shen, Xiaoning; Xu, Jiahui; Wang, Junzhi; Wang, Yanyan; Liu, Dong; Niu, Huanqing; Liang, Lei; Ying, Hanjie

    2016-07-10

    A mutant strain of Clostridium beijerinckii NCIMB 8052, C. beijerinckii M11, which exhibited ferulic acid tolerance up to 0.9g/L, was generated using atmospheric pressure glow discharge and high-throughput screening. Comparative genomic analysis revealed that this strain harbored a mutation of the Cbei_4693 gene, which encodes a hypothetical protein suspected to be an NADPH-dependent FMN reductase. After disrupting the Cbei_4693 gene in C. beijerinckii NCIMB 8052 using the ClosTron group II intron-based gene inactivation system, we obtained the Cbei_4693 gene inactivated mutant strain, C. beijerinckii 4693::int. Compared with C. beijerinckii NCIMB 8052, 6.23g/L of butanol was produced in P2 medium containing 0.5g/L of ferulic acid by 4693::int, and the ferulic acid tolerance was also significantly increased up to 0.8g/L. These data showed, for the first time, that the Cbei_4693 gene plays an important role in regulating ferulic acid tolerance in ABE fermentation by C. beijerinckii. PMID:27164255

  11. Identification of Molecular Marker Linked to Salt Tolerance Gene in Alfalfa

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The study has established the F2 offspring obtained by crossing salt-tolerant with salt-sensitive alfalfa, and appraised the salt-tolerant F2 offspring seedling was evaluated in pot culture. With the F2 segregated population, the research has obtained a molecular marker linked with salt-tolerant genes of alfalfa using the improved BSA combined with RAPD. The RAPD PCR products were excised from the agarose gel and purified using a kit, then were mixed with pMD-18T vector and sequenced. Sequencing result indicated the RAPD marker was 1 438 bp in length. Similarity researches using blast in Genbank indicated that the nucleotide sequence of the RAPD marker showed 93% and 91% similarity with mth2-6el8 gene fragment (347 bp) and mth2-33122 gene fragment (334 bp) of Medicago truncatula respectively. Medicago truncatula is a close relative of alfalfa and Mth2-6e18 is a molecular marker of the gene coding for a cysteine protease which was salt inducible in some plants. These results indicated the RAPD marker was possibly related to cysteine protease genes in alfalfa.

  12. Field tolerance to fungal pathogens of Brassica napus constitutively expressing a chimeric chitinase gene

    Energy Technology Data Exchange (ETDEWEB)

    Grison, R.; Grezes-Besset, B.; Lucante, N. [Rustica Prograin Genetique, Mondonville (France)] [and others

    1996-05-01

    Constitutive overexpression of a protein involved in plant defense mechanisms to disease is one of the strategies proposed to increase plant tolerance to fungal pathogens. A hybrid endochitinase gene under a constitutive promoter was introduced by Agrobacterium-mediated transformation into a winter-type oilseed rape (Brassica napus var. oleifera) inbred line. Progeny from transformed plants was challenged using three different fungal pathogens (Cylindrosporium concentricum, Phoma lingam, Sclerotinia sclerotiorum) in field trials at two different geographical locations. These plants exhibited an increased tolerance to disease as compared with the nontransgenic parental plants. 31 refs., 1 fig., 2 tabs.

  13. Effects of short-term acid and aluminum exposure on the parr-smolt transformation in Atlantic salmon (Salmo salar): Disruption of seawater tolerance and endocrine status

    Science.gov (United States)

    Monette, M.Y.; Bjornsson, Bjorn Thrandur; McCormick, S.D.

    2008-01-01

    Episodic acidification resulting in increased acidity and inorganic aluminum (Ali) is known to interfere with the parr-smolt transformation of Atlantic salmon (Salmo salar), and has been implicated as a possible cause of population decline. To determine the extent and mechanism(s) by which short-term acid/Al exposure compromises smolt development, Atlantic salmon smolts were exposed to either control (pH 6.7-6.9) or acid/Al (pH 5.4-6.3, 28-64 ??g l-1 Ali) conditions for 2 and 5 days, and impacts on freshwater (FW) ion regulation, seawater (SW) tolerance, plasma hormone levels and stress response were examined. Gill Al concentrations were elevated in all smolts exposed to acid/Al relative to controls confirming exposure to increased Ali. There was no effect of acid/Al on plasma ion concentrations in FW however, smolts exposed to acid/Al followed by a 24 h SW challenge exhibited greater plasma Cl- levels than controls, indicating reduced SW tolerance. Loss of SW tolerance was accompanied by reductions in gill Na+,K+-ATPase (NKA) activity and Na+,K+,2Cl- (NKCC) cotransporter protein abundance. Acid/Al exposure resulted in decreased plasma insulin-like growth factor (IGF-I) and 3,3???,5???-triiodo-l-thyronine (T3) levels, whereas no effect of treatment was seen on plasma cortisol, growth hormone (GH), or thyroxine (T4) levels. Acid/Al exposure resulted in increased hematocrit and plasma glucose levels in FW, but both returned to control levels after 24 h in SW. The results indicate that smolt development and SW tolerance are compromised by short-term exposure to acid/Al in the absence of detectable impacts on FW ion regulation. Loss of SW tolerance during short-term acid/Al exposure likely results from reductions in gill NKA and NKCC, possibly mediated by decreases in plasma IGF-I and T3. ?? 2008 Elsevier Inc.

  14. Conditioning of Roots with Hypoxia Increases Aluminum and Acid Stress Tolerance by Mitigating Activation of K+ Efflux Channels by ROS in Barley: Insights into Cross-Tolerance Mechanisms.

    Science.gov (United States)

    Ma, Yanling; Zhu, Min; Shabala, Lana; Zhou, Meixue; Shabala, Sergey

    2016-01-01

    Aluminum (Al) is prevalent in soils, but Al toxicity is manifested only under acid conditions. It causes severe damages to the root system. Short-term waterlogging stress can occur simultaneously with Al toxicity in areas with high rainfall or an inappropriate irrigation pattern. Barley (Hordeum vulgare L.) is one of the most Al-sensitive small-grained cereals. In this work, we have investigated effects of short-term treatments with hypoxia and phenolic acid (two major constraints in waterlogged soils) on root sensitivity to low-pH and Al stresses. We showed that hypoxia-primed roots maintained higher cell viability when exposed to low-pH/Al stress, in both elongation and mature root zones, and possessed superior ability to retain K(+) in response to low-pH/Al stresses. These priming effects were not related to higher H(+)-ATPase activity and better membrane potential maintenance, and could not be explained by the increased expression levels of HvHAK1, which mediates high-affinity K(+) uptake in roots. Instead, hypoxia-conditioned roots were significantly less sensitive to H2O2 treatment, indicated by the 10-fold reduction in the magnitude of K(+) efflux changes. This suggested that roots pre-treated with hypoxia desensitized reactive oxygen species (ROS)-inducible K(+) efflux channels in root epidermis, most probably via enhanced antioxidative capacity. A possible role for Ca(2+) in stress-induced ROS signaling pathways is also discussed. Overall, our results report, for the first time, the phenomenon of cross-protection between hypoxia and low-pH/Al stresses, and causally link it to the cell's ability to maintain cytosolic K(+) homeostasis. PMID:26581863

  15. Functional genomics of maize submergence tolerance and cloning of the related gene Sicyp51

    Institute of Scientific and Technical Information of China (English)

    TANG; Wanhu; ZHANG; Zuxin; ZOU; Xiling; ZHENG; Yonglian

    2005-01-01

    In this study, SSH (Suppression Subtractive Hybridization) and cDNA microarray were used to identify genes associated with waterlogging response of maize roots. Mo17 and Hz32 are two maize inbred lines with differential tolerance to hypoxia. Seedlings of the inbred lines with two leaves were submerged in hypoxia buffer. SSH libraries were constructed with cDNA samples from roots. Both forward and reverse subtractions were performed for each inbred line, and 105 positive clones induced by hypoxia were selected by differential screening. The treated and control message RNA were hybridized with the cDNA microarray of Mo17, sequentially, 57 of 3-fold differentially expressed clones were obtained. A total of 162 positive clones were all sequenced. Bioinformatics analysis showed these positive clones represent 85 TUGs, including genes involved in several biochemistry pathways, such as glycolysis, protection, signal transduction, cell construction and energy metabolism and 41 EST with unknown function. Comparison between Mo17 and Hz32 indicates that genes related to hypoxia tolerance have different expression patterns in submerged roots. Several positive clones' expression patterns were revealed by Northern or RT-PCR, and a new gene (Sicyp51), which may contribute to hypoxia tolerance, was identified.

  16. Cadmium induces cadmium-tolerant gene expression in the filamentous fungus Trichoderma harzianum.

    Science.gov (United States)

    Cacciola, Santa O; Puglisi, Ivana; Faedda, Roberto; Sanzaro, Vincenzo; Pane, Antonella; Lo Piero, Angela R; Evoli, Maria; Petrone, Goffredo

    2015-11-01

    The filamentous fungus Trichoderma harzianum, strain IMI 393899, was able to grow in the presence of the heavy metals cadmium and mercury. The main objective of this research was to study the molecular mechanisms underlying the tolerance of the fungus T. harzianum to cadmium. The suppression subtractive hybridization (SSH) method was used for the characterization of the genes of T. harzianum implicated in cadmium tolerance compared with those expressed in the response to the stress induced by mercury. Finally, the effects of cadmium exposure were also validated by measuring the expression levels of the putative genes coding for a glucose transporter, a plasma membrane ATPase, a Cd(2+)/Zn(2+) transporter protein and a two-component system sensor histidine kinase YcbA, by real-time-PCR. By using the aforementioned SSH strategy, it was possible to identify 108 differentially expressed genes of the strain IMI 393899 of T. harzianum grown in a mineral substrate with the addition of cadmium. The expressed sequence tags identified by SSH technique were encoding different genes that may be involved in different biological processes, including those associated to primary and secondary metabolism, intracellular transport, transcription factors, cell defence, signal transduction, DNA metabolism, cell growth and protein synthesis. Finally, the results show that in the mechanism of tolerance to cadmium a possible signal transduction pathway could activate a Cd(2+)/Zn(2+) transporter protein and/or a plasma membrane ATPase that could be involved in the compartmentalization of cadmium inside the cell. PMID:26349455

  17. Overexpression of phospholipase Dα gene enhances drought and salt tolerance of Populus tomentosa

    Institute of Scientific and Technical Information of China (English)

    ZHANG TingTing; SONG YunZhi; LIU YuDong; GUO XingQi; ZHU ChangXiang; WEN FuJiang

    2008-01-01

    The cDNA of AtPLDα (Arabidopsis thaliana Phospholipase Da) gene was introduced into P. tomentosa (Populus tomentosa) under the control of the Cauliflower mosaic virus 35S promoter. Southern and Northern blot analyses suggested that the AtPLDα gene has been transferred into the P. tomentosa genome. No obvious morphological or developmental difference was observed between the transgenic and wild-type (WT) plants. Drought and salt tolerance and gene expression of seedlings of several transgenic lines and WT plants (control) were studied. The results showed that the rhizogenesis rate and the average root-length of transgenic lines were significantly higher than WT plants after mannitol and NaCl treatment under the same growth conditions. Northern blot analysis indicated that the higher the PLDα expression in the transgenic plants, the more tolerant the transgenic plants are to drought and salt treatment. Meanwhile, another group of these transgenic lines and WT plants (control) were treated with PEG6000 and NaCI separately. The contents of chlorophylls and the activities of some antioxidant enzymes (superoxide dismutase, guaiacol peroxidase and catalase) as well as malondialdehyde and relative electrical conductivity were analyzed. Altogether, our results demonstrated that overexpression of the PLDα gene can enhance the drought and salt tolerance in transgenic P. tomentosa plants.

  18. Identification of Quantitative Trait Loci (QTL) and Candidate Genes for Cadmium Tolerance in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Gancho [West Virginia University; Yin, Tongming [ORNL; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Stephen P [West Virginia University

    2012-01-01

    Knowledge of genetic variation in response of Populus to heavy metals like cadmium (Cd) is an important step in understanding the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa and Populus deltoides was characterized for Cd exposure. The pedigree showed significant variation for Cd tolerance thus enabling the identification of relatively tolerant and susceptible genotypes for intensive characterization. A total of 16 QTLs at logarithm of odds (LOD) ratio > 2.5, were found to be associated with total dry weight, its components, and root volume. Four major QTLs for total dry weight were mapped to different linkage groups in control (LG III) and Cd conditions (LG XVI) and had opposite allelic effects on Cd tolerance, suggesting that these genomic regions were differentially controlled. The phenotypic variation explained by Cd QTL for all traits under study varied from 5.9% to 11.6% and averaged 8.2% across all QTL. Leaf Cd contents also showed significant variation suggesting the phytoextraction potential of Populus genotypes, though heritability of this trait was low (0.22). A whole-genome microarray study was conducted by using two genotypes with extreme responses for Cd tolerance in the above study and differentially expressed genes were identified. Candidate genes including CAD2 (CADMIUM SENSITIVE 2), HMA5 (HEAVY METAL ATPase5), ATGTST1 (Arabidopsis thaliana Glutathione S-Transferase1), ATGPX6 (Glutathione peroxidase 6), and ATMRP 14 (Arabidopsis thaliana Multidrug Resistance associated Protein 14) were identified from QTL intervals and microarray study. Functional characterization of these candidate genes could enhance phytoremediation capabilities of Populus.

  19. Expression of genes related to tolerance to low temperature for maize seed germination.

    Science.gov (United States)

    Silva-Neta, I C; Pinho, E V; Veiga, A D; Pìnho, R G; Guimarães, R M; Caixeta, F; Santos, H O; Marques, T L

    2015-01-01

    The aim of this study was to characterize maize lines tolerant to cold temperatures during the germination process. Seeds from lines with different levels of tolerance to low temperatures were used; 3 lines were classified as tolerant and 3 as susceptible to low germination temperatures. A field was set up to multiply seeds from selected lines. After the seeds were harvested and classified, we conducted physiological tests and analyzed fatty acid content of palmitic, stearic, oleic, linoleic, linolenic, and eicosenoic acids. In proteomic analysis, the expression of heat-resistant proteins, including catalase, peroxidase, esterase, superoxide dismutase, and α-amylase, were evaluated. Transcript analysis was used to measure the expression of the genes AOX1, AOX2, ZmMPK-17, and ZmAN-13. The material showing the highest susceptibility to low germination temperatures contained high saturated fatty acid content. Expression of α-amylase in seeds soaked for 72 h at a temperature of 10°C was lower than expression of α-amylase when soaked at 25°C for the same amount of time. We observed variation in the expression of heat-resistant proteins in seeds of the lines evaluated. The genes AOX and Zm-AN13 were promising for use in identifying maize materials that are tolerant to low germination temperatures. PMID:25867416

  20. Water-deficit inducible expression of a cytokinin biosynthetic gene IPT improves drought tolerance in cotton.

    Directory of Open Access Journals (Sweden)

    Sundaram Kuppu

    Full Text Available Water-deficit stress is a major environmental factor that limits agricultural productivity worldwide. Recent episodes of extreme drought have severely affected cotton production in the Southwestern USA. There is a pressing need to develop cotton varieties with improved tolerance to water-deficit stress for sustainable production in water-limited regions. One approach to engineer drought tolerance is by delaying drought-induced senescence via up-regulation of cytokinin biosynthesis. The isopentenyltransferase gene (IPT that encodes a rate limiting enzyme in cytokinin biosynthesis, under the control of a water-deficit responsive and maturation specific promoter P(SARK was introduced into cotton and the performance of the P(SARK::IPT transgenic cotton plants was analyzed in the greenhouse and growth chamber conditions. The data indicate that P(SARK::IPT-transgenic cotton plants displayed delayed senescence under water deficit conditions in the greenhouse. These plants produced more root and shoot biomass, dropped fewer flowers, maintained higher chlorophyll content, and higher photosynthetic rates under reduced irrigation conditions in comparison to wild-type and segregated non-transgenic lines. Furthermore, P(SARK::IPT-transgenic cotton plants grown in growth chamber condition also displayed greater drought tolerance. These results indicate that water-deficit induced expression of an isopentenyltransferase gene in cotton could significantly improve drought tolerance.

  1. Expression of genes related to tolerance to low temperature for maize seed germination.

    Science.gov (United States)

    Silva-Neta, I C; Pinho, E V; Veiga, A D; Pìnho, R G; Guimarães, R M; Caixeta, F; Santos, H O; Marques, T L

    2015-01-01

    The aim of this study was to characterize maize lines tolerant to cold temperatures during the germination process. Seeds from lines with different levels of tolerance to low temperatures were used; 3 lines were classified as tolerant and 3 as susceptible to low germination temperatures. A field was set up to multiply seeds from selected lines. After the seeds were harvested and classified, we conducted physiological tests and analyzed fatty acid content of palmitic, stearic, oleic, linoleic, linolenic, and eicosenoic acids. In proteomic analysis, the expression of heat-resistant proteins, including catalase, peroxidase, esterase, superoxide dismutase, and α-amylase, were evaluated. Transcript analysis was used to measure the expression of the genes AOX1, AOX2, ZmMPK-17, and ZmAN-13. The material showing the highest susceptibility to low germination temperatures contained high saturated fatty acid content. Expression of α-amylase in seeds soaked for 72 h at a temperature of 10°C was lower than expression of α-amylase when soaked at 25°C for the same amount of time. We observed variation in the expression of heat-resistant proteins in seeds of the lines evaluated. The genes AOX and Zm-AN13 were promising for use in identifying maize materials that are tolerant to low germination temperatures.

  2. Enhancing the aluminium tolerance of barley by expressing the citrate transporter genes SbMATE and FRD3.

    Science.gov (United States)

    Zhou, Gaofeng; Pereira, Jorge F; Delhaize, Emmanuel; Zhou, Meixue; Magalhaes, Jurandir V; Ryan, Peter R

    2014-06-01

    Malate and citrate efflux from root apices is a mechanism of Al(3+) tolerance in many plant species. Citrate efflux is facilitated by members of the MATE (multidrug and toxic compound exudation) family localized to the plasma membrane of root cells. Barley (Hordeum vulgare) is among the most Al(3+)-sensitive cereal species but the small genotypic variation in tolerance that is present is correlated with citrate efflux via a MATE transporter named HvAACT1. This study used a biotechnological approach to increase the Al(3+) tolerance of barley by transforming it with two MATE genes that encode citrate transporters: SbMATE is the major Al(3+)-tolerance gene from sorghum whereas FRD3 is involved with Fe nutrition in Arabidopsis. Independent transgenic and null T3 lines were generated for both transgenes. Lines expressing SbMATE showed Al(3+)-activated citrate efflux from root apices and greater tolerance to Al(3+) toxicity than nulls in hydroponic and short-term soil trials. Transgenic lines expressing FRD3 exhibited similar phenotypes except citrate release from roots occurred constitutively. The Al(3+) tolerance of these lines was compared with previously generated transgenic barley lines overexpressing the endogenous HvAACT1 gene and the TaALMT1 gene from wheat. Barley lines expressing TaALMT1 showed significantly greater Al(3+) tolerance than all lines expressing MATE genes. This study highlights the relative efficacy of different organic anion transport proteins for increasing the Al(3+) tolerance of an important crop species.

  3. Gene array analysis of a rat model of liver transplant tolerance identifies increased complement C3 and the STAT-1/IRF-1 pathway during tolerance induction.

    Science.gov (United States)

    Cordoba, Shaun P; Wang, Chuanmin; Williams, Rohan; Li, Jian; Smit, Lynn; Sharland, Alexandra; Allen, Richard; McCaughan, Geoffrey; Bishop, Alex

    2006-04-01

    This study aimed to define the molecular mechanism during induction of spontaneous liver transplant tolerance using microarrays and to focus on molecular pathways associated with tolerance by meta-analysis with published studies. The differences in the early immune response between PVG to DA liver transplant recipients that are spontaneously tolerant (TOL) and PVG to Lewis liver transplants that reject (REJ) were examined. Spleens from TOL and REJ on days 1 and 3 were compared by 2 color microarray. Forty-six of 199 genes differentially expressed between TOL and REJ had an immunological function. More immune genes were increased in TOL vs. REJ on day 1, including STAT-1, IRF-1 and complement C3. Differential expression of selected genes was confirmed by quantitative RT-PCR. The results were compared to two published high-throughput studies of rat liver transplant tolerance and showed that C3 was increased in all three models, while STAT-1 and IRF-1 were increased in two models. The early increases in immune genes in TOL confirmed previous reports of an active early immune response in TOL. In conclusion, the increase in STAT-1, IRF-1 and complement component C3 in several models of liver transplant tolerance suggests that the STAT-1/IRF-1 apoptotic pathway and C3 may be involved in the tolerogenic mechanism.

  4. Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

    Science.gov (United States)

    Monette, M.Y.; Yada, T.; Matey, V.; McCormick, S.D.

    2010-01-01

    We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4??gl-1 Al), acid and low Al (LAl: pH 5.4, 11??gl-1 Al), acid and moderate Al (MAl: pH 5.3, 42??gl-1 Al), and acid and high Al (HAl: pH 5.4, 56??gl-1 Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na+/K+-ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl- channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time-course and severity of Al exposure. We propose that when smolts are

  5. Genomewide analysis of MATE-type gene family in maize reveals microsynteny and their expression patterns under aluminum treatment

    Indian Academy of Sciences (India)

    HUASHENG ZHU; JIANDONG WU; YINGLI JIANG; JING JIN; WEI ZHOU; YU WANG; GUOMIN HAN; YANG ZHAO; BEIJIU CHENG

    2016-09-01

    Multidrug and toxic compound extrusion (MATE) proteins are a group of secondary active transporters, which widely exist in all living organisms and play important role in the detoxication of endogenous secondary metabolites and exogenous agents. However, to date, no systematic and comprehensive study of this family is reported in maize. Here, a total of 49 MATE genes (ZmMATE) were identified and divided into seven groups by phylogenetic analysis. Conserved intro–exon structures and motif compositions were investigated in these genes. Results by gene locations indicated that these genes were unevenly distributed among all 10 chromosomes. Tandem and segmental duplications appeared to contribute to the expansion and evolution of this gene family. The Ka / Ks ratios suggested that the ZmMATE has undergone large-scale purifying selection on the maize genome. Interspecies microsynteny analysis revealed that there were independent gene duplication events of 10 ZmMATE. In addition, most maize MATE genes exhibited different expression profiles in diverse tissues and developmental stages. Sixteen MATE genes were chosen for further quantitative real-time polymerase chain reaction analysis showed differential expression patterns in response to aluminum treatment. These results provide a useful clue for future studies on the identification of MATE genes and functional analysis of MATE proteins in maize

  6. Genomewide analysis of MATE-type gene family in maize reveals microsynteny and their expression patterns under aluminum treatment.

    Science.gov (United States)

    Zhu, Huasheng; Wu, Jiandong; Jiang, Yingli; Jin, Jing; Zhou, Wei; Wang, Yu; Han, Guomin; Zhao, Yang; Cheng, Beijiu

    2016-09-01

    Multidrug and toxic compound extrusion (MATE) proteins are a group of secondary active transporters, which widely exist in all living organisms and play important role in the detoxication of endogenous secondary metabolites and exogenous agents. However, to date, no systematic and comprehensive study of this family is reported in maize. Here, a total of 49 MATE genes (ZmMATE) were identified and divided into seven groups by phylogenetic analysis. Conserved intro-exon structures and motif compositions were investigated in these genes. Results by gene locations indicated that these genes were unevenly distributed among all 10 chromosomes. Tandem and segmental duplications appeared to contribute to the expansion and evolution of this gene family. The Ka/Ks ratios suggested that the ZmMATE has undergone large-scale purifying selection on the maize genome. Interspecies microsynteny analysis revealed that there were independent gene duplication events of 10 ZmMATE. In addition, most maize MATE genes exhibited different expression profiles in diverse tissues and developmental stages. Sixteen MATE genes were chosen for further quantitative real-time polymerase chain reaction analysis showed differential expression patterns in response to aluminum treatment. These results provide a useful clue for future studies on the identification of MATE genes and functional analysis of MATE proteins in maize. PMID:27659341

  7. A novel gene OsAHL1 improves both drought avoidance and drought tolerance in rice.

    Science.gov (United States)

    Zhou, Liguo; Liu, Zaochang; Liu, Yunhua; Kong, Deyan; Li, Tianfei; Yu, Shunwu; Mei, Hanwei; Xu, Xiaoyan; Liu, Hongyan; Chen, Liang; Luo, Lijun

    2016-01-01

    A novel gene, OsAHL1, containing an AT-hook motif and a PPC domain was identified through genome-wide profiling and analysis of mRNAs by comparing the microarray of drought-challenged versus normally watered rice. The results indicated OsAHL1 has both drought avoidance and drought tolerance that could greatly improve drought resistance of the rice plant. Overexpression of OsAHL1 enhanced multiple stress tolerances in rice plants during both seedling and panicle development stages. Functional studies revealed that OsAHL1 regulates root development under drought condition to enhance drought avoidance, participates in oxidative stress response and also regulates the content of chlorophyll in rice leaves. OsAHL1 specifically binds to the A/T rich sequence region of promoters or introns, and hence directly regulates the expression of many stress related downstream genes. PMID:27453463

  8. Acquiring transgenic tobacco plants with insect resistance and glyphosate tolerance by fusion gene transformation.

    Science.gov (United States)

    Sun, He; Lang, Zhihong; Zhu, Li; Huang, Dafang

    2012-10-01

    The advantages of gene 'stacking' or 'pyramiding' are obvious in genetically modified (GM) crops, and several different multi-transgene-stacking methods are available. Using linker peptides for multiple gene transformation is considered to be a good method to meet a variety of needs. In our experiment, the Bt cry1Ah gene, which encodes the insect-resistance protein, and the mG ( 2 ) -epsps gene, which encodes the glyphosate-tolerance protein, were connected by a 2A or LP4/2A linker. Linker 2A is a peptide from the foot-and-mouth disease virus (FMDV) that has self-cleavage activity. LP4 is a peptide from Raphanus sativus seeds that has a recognition site and is cleaved by a protease. LP4/2A is a hybrid peptide that contains the first 9 amino acids of LP4 and 20 amino acids from 2A. We used the linker peptide to construct four coordinated expression vectors: pHAG, pHLAG, pGAH and pGLAH. Two single gene expression vectors, pSAh and pSmG(2), were used as controls. The six expression vectors and the pCAMBIA2301 vector were transferred into tobacco by Agrobacterium tumefaciens-mediated transformation, and 529 transformants were obtained. Molecular detection and bioassay detection data demonstrated that the transgenic tobaccos possessed good pest resistance and glyphosate tolerance. The two genes in the fusion vector were expressed simultaneously. The plants with the genes linked by the LP4/2A peptide showed better pest resistance and glyphosate tolerance than the plants with the genes linked by 2A. The expression level of the two genes linked by LP4/2A was not significantly different from the single gene vector. Key message The expression level of the two genes linked by LP4/2A was higher than those linked by 2A and was not significantly different from the single gene vector.

  9. Characterization of gene expression associated with drought avoidance and tolerance traits in a perennial grass species.

    Directory of Open Access Journals (Sweden)

    Peng Zhou

    Full Text Available To understand molecular mechanisms of perennial grass adaptation to drought stress, genes associated with drought avoidance or tolerance traits were identified and their expression patterns were characterized in C4 hybrid bermudagrass [Cynodon dactylon (L. Pers.×C. transvaalensis Burtt Davy, cv. Tifway] and common bermudagrass (C. dactylon, cv. C299. Plants of drought-tolerant 'Tifway' and drought-sensitive 'C299' were exposed to drought for 5 d (mild stress and 10 d (severe stress by withholding irrigation in a growth chamber. 'Tifway' maintained significantly lower electrolyte leakage and higher relative water content than 'C299' at both 5 and 10 d of drought stress. Four cDNA libraries via suppression subtractive hybridization analysis were constructed and identified 277 drought-responsive genes in the two genotypes at 5 and 10 d of drought stress, which were mainly classified into the functional categories of stress defense, metabolism, osmoregulation, membrane system, signal and regulator, structural protein, protein synthesis and degradation, and energy metabolism. Quantitative-PCR analysis confirmed the expression of 36 drought up-regulated genes that were more highly expressed in drought-tolerant 'Tifway' than drought-sensitive 'C299', including those for drought avoidance traits, such as cuticle wax formation (CER1 and sterol desaturase, for drought tolerance traits, such as dehydration-protective proteins (dehydrins, HVA-22-like protein and oxidative stress defense (superoxide dismutase, dehydroascorbate reductase, 2-Cys peroxiredoxins, and for stress signaling (EREBP-4 like protein and WRKY transcription factor. The results suggest that the expression of genes for stress signaling, cuticle wax accumulation, antioxidant defense, and dehydration-protective protein accumulation could be critically important for warm-season perennial grass adaptation to long-term drought stress.

  10. De novo transcriptome characterization and gene expression profiling of the desiccation tolerant moss Bryum argenteum following rehydration

    OpenAIRE

    Gao, Bei; Zhang, Daoyuan; Li, Xiaoshuang; Yang, Honglan; Zhang, Yuanming; Wood, Andrew J.

    2015-01-01

    Background The desiccation-tolerant moss Bryum argenteum is an important component of the Biological Soil Crusts (BSCs) found in the Gurbantunggut desert. Desiccation tolerance is defined as the ability to revive from the air dried state. To elucidate the molecular mechanisms related to desiccation tolerance, we employed RNA-Seq and digital gene expression (DGE) technologies to study the genome-wide expression profiles of the dehydration and rehydration processes in this important desert plan...

  11. Low cadmium (LCD), a novel gene related to cadmium tolerance and accumulation in rice.

    Science.gov (United States)

    Shimo, Hugo; Ishimaru, Yasuhiro; An, Gynheung; Yamakawa, Takashi; Nakanishi, Hiromi; Nishizawa, Naoko K

    2011-11-01

    The contamination of food crops by cadmium (Cd) is a major concern in food production because it can reduce crop yields and threaten human health. In this study, knockout rice plants (Oryza sativa) tagged with the gene trap vector pGA2707 were screened for Cd tolerance, and the tolerant line lcd was obtained. The lcd mutant showed tolerance to Cd on agar plates and in hydroponic culture during early plant development. Metal concentration measurements in hydroponically grown plants revealed significantly less Cd in the shoots of lcd plants compared with wild-type (WT) shoots. When cultured in the field in soil artificially contaminated with low levels of Cd, lcd showed no significant difference in the Cd content of its leaf blades; however, the Cd concentration in the grains was 55% lower in 2009 and 43% lower in 2010. There were no significant differences in plant dry weight or seed yield between lcd and wild-type plants. LCD, a novel gene, is not homologous to any other known gene. LCD localized to the cytoplasm and nucleus, and was expressed mainly in the vascular tissues in the roots and phloem companion cells in the leaves. These data indicate that lcd may be useful for understanding Cd transport mechanisms and is a promising candidate rice line for use in combating the threat of Cd to human health.

  12. Oral Tolerance: A New Tool for the Treatment of Gastrointestinal Inflammatory Disorders and Liver-Directed Gene Therapy

    Directory of Open Access Journals (Sweden)

    Yaron Ilan

    1999-01-01

    Full Text Available Oral tolerance is a method of downregulating an immune response by feeding antigens. The use of oral tolerance toward adenoviruses and colitis-extracted proteins for long term gene therapy and alleviation of experimental colitis, and the mechanisms of tolerance induction are presented. Adenoviruses are efficient vectors in liver-directed gene therapy; however, the antiviral immune response precludes the ability to achieve long term gene expression and prohibits the ability to reinject the recombinant virus. Oral tolerance induction via feeding of viral-extracted proteins prevented the antiadenoviral humoral and cellular immune responses, thus enabling long term gene therapy using these viruses. Moreover, pre-existing immune response to the virus was overcome by tolerance induction, enabling prolonged gene expression in a presensitized host. Inflammatory bowel diseases are immune-mediated disorders where an imbalance between proinflammatory (T helper cell type 1 and anti-inflammatory (T helper cell type 2 cytokines are thought to play a role in the pathogenesis. In the experimental colitis model, the feeding of colitis-extracted proteins downregulated the anticolon immune response. Tolerance induction toward colitis-extracted proteins ameliorated colonic inflammation as shown by decreased diarrhea and reduction of colonic ulcerations, intestinal and peritoneal adhesions, wall thickness and edema. Histological parameters for colitis were markedly improved in tolerized animals. In both models, tolerized animals developed an increase in transforming growth factor-beta, interleukin-4 and interleukin-10, and a decrease in the mRNA of interferon-gamma lymphocytes and serum levels. Adoptive transfer of tolerized lymphocytes enabled the transfer of tolerance toward adenoviruses and colon-extracted proteins. Thus, oral tolerance induces suppressor lymphocytes that mediate immune response downregulation by induction of a shift from a proinflammatory T

  13. The BnALMT1 and BnALMT2 genes from rape encode aluminum-activated malate transporters that enhance the aluminum resistance of plant cells.

    Science.gov (United States)

    Ligaba, Ayalew; Katsuhara, Maki; Ryan, Peter R; Shibasaka, Mineo; Matsumoto, Hideaki

    2006-11-01

    The release of organic anions from roots can protect plants from aluminum (Al) toxicity and help them overcome phosphorus (P) deficiency. Our previous findings showed that Al treatment induced malate and citrate efflux from rape (Brassica napus) roots, and that P deficiency did not induce the efflux. Since this response is similar to the malate efflux from wheat (Triticum aestivum) that is controlled by the TaALMT1 gene, we investigated whether homologs of TaALMT1 are present in rape and whether they are involved in the release of organic anions. We isolated two TaALMT1 homologs from rape designated BnALMT1 and BnALMT2 (B. napus Al-activated malate transporter). The expression of these genes was induced in roots, but not shoots, by Al treatment but P deficiency had no effect. Several other cations (lanthanum, ytterbium, and erbium) also increased BnALMT1 and BnALMT2 expression in the roots. The function of the BnALMT1 and BnALMT2 proteins was investigated by heterologous expression in cultured tobacco (Nicotiana tabacum) cells and in Xenopus laevis oocytes. Both transfection systems showed an enhanced capacity for malate efflux but not citrate efflux, when exposed to Al. Smaller malate fluxes were also activated by ytterbium and erbium treatment. Transgenic tobacco cells grew significantly better than control cells following an 18 h treatment with Al, indicating that the expression of BnALMT1 and BnALMT2 increased the resistance of these plant cells to Al stress. This report demonstrates that homologs of the TaALMT1 gene from wheat perform similar functions in other species.

  14. Stress Responsive Zinc-finger Protein Gene of Populus euphratica in Tobacco Enhances Salt Tolerance

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The Populus euphratica stress responsive zinc-finger protein gene PSTZ, which encodes a protein including typical Cys2/His2 zinc finger structure, was isolated by reverse transcription-polymerase chain reaction from P. euphratica.Northern hybridization revealed that its expression was induced under drought and salt stress conditions. To examine its function, cDNA of the PSTZ gene, driven by the cauliflower mosaic virus 35S promoter, was cloned into a plant expression vector pBin438 and introduced into tobacco plants. Transgenic tobacco showed an enhanced salt tolerance, suggesting that PSTZ may play a role in plant responsiveness to salt stress.

  15. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress.

    Science.gov (United States)

    Deshnium, P; Los, D A; Hayashi, H; Mustardy, L; Murata, N

    1995-12-01

    Choline oxidase, isolated from the soil bacterium Arthrobacter globiformis, converts choline to glycinebetaine (N-trimethylglycine) without a requirement for any cofactors. The gene for this enzyme, designated codA, was cloned and introduced into the cyanobacterium Synechococcus sp. PCC 7942. The codA gene was expressed under the control of a strong constitutive promoter, and the transformed cells accumulated glycinebetaine at intracellular levels of 60-80 mM. Consequently the cells acquired tolerance to salt stress, as evaluated in terms of growth, accumulation of chlorophyll and photosynthetic activity. PMID:8555454

  16. Plastid-expressed 5-enolpyruvylshikimate-3-phosphate synthase genes provide high level glyphosate tolerance in tobacco.

    Science.gov (United States)

    Ye, G N; Hajdukiewicz, P T; Broyles, D; Rodriguez, D; Xu, C W; Nehra, N; Staub, J M

    2001-02-01

    Plastid transformation (transplastomic) technology has several potential advantages for biotechnological applications including the use of unmodified prokaryotic genes for engineering, potential high-level gene expression and gene containment due to maternal inheritance in most crop plants. However, the efficacy of a plastid-encoded trait may change depending on plastid number and tissue type. We report a feasibility study in tobacco plastids to achieve high-level herbicide resistance in both vegetative tissues and reproductive organs. We chose to test glyphosate resistance via over-expression in plastids of tolerant forms of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Immunological, enzymatic and whole-plant assays were used to prove the efficacy of three different prokaryotic (Achromobacter, Agrobacterium and Bacillus) EPSPS genes. Using the Agrobacterium strain CP4 EPSPS as a model we identified translational control sequences that direct a 10,000-fold range of protein accumulation (to >10% total soluble protein in leaves). Plastid-expressed EPSPS could provide very high levels of glyphosate resistance, although levels of resistance in vegetative and reproductive tissues differed depending on EPSPS accumulation levels, and correlated to the plastid abundance in these tissues. Paradoxically, higher levels of plastid-expressed EPSPS protein accumulation were apparently required for efficacy than from a similar nuclear-encoded gene. Nevertheless, the demonstration of high-level glyphosate tolerance in vegetative and reproductive organs using transplastomic technology provides a necessary step for transfer of this technology to other crop species.

  17. Disruption of the CAR1 gene encoding arginase enhances freeze tolerance of the commercial baker's yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Shima, Jun; Sakata-Tsuda, Yuko; Suzuki, Yasuo; Nakajima, Ryouichi; Watanabe, Hajime; Kawamoto, Shinichi; Takano, Hiroyuki

    2003-01-01

    The effect of intracellular charged amino acids on freeze tolerance in dough was determined by constructing homozygous diploid arginase-deficient mutants of commercial baker's yeast. An arginase mutant accumulated higher levels of arginine and/or glutamate and showed increased leavening ability during the frozen-dough baking process, suggesting that disruption of the CAR1 gene enhances freeze tolerance. PMID:12514069

  18. Experimental evolution and gene knockout studies reveal AcrA-mediated isobutanol tolerance in Ralstonia eutropha.

    Science.gov (United States)

    Bernardi, Amanda C; Gai, Claudia S; Lu, Jingnan; Sinskey, Anthony J; Brigham, Christopher J

    2016-07-01

    Isobutanol (IBT) has attracted much attention from researchers as a next generation drop-in biofuel. Ralstonia eutropha is a gram-negative bacterium which naturally produces polyhydroxybutyrate (PHB), and has been reported to produce IBT after metabolic engineering. Similar to other microbes, R. eutropha experiences toxicity from branched-chain alcohols and is unable to grow in the presence of IBT concentrations higher than 0.5% (v v(-1)). Such low tolerance greatly limits the ability of R. eutropha to grow and produce IBT. In order to study toxicity to the cells, IBT-tolerant strains were developed by experimental evolution, revealing that two genes, previously described as being related to IBT tolerance in Escherichia coli (acrA and acrA6), also presented mutations in R. eutropha evolved strains. The effect on the physiology of the cells of in-frame deletions of each of these genes was assessed in wild type and engineered IBT-producing strains in an attempt to reproduce a tolerant phenotype. The mutant strains' ability to tolerate, consume, and produce IBT were also analyzed. Although deletions of acrA6 and acrA did not significantly improve R. eutropha growth in the presence of IBT, these deletions improved cell survival in the presence of high concentrations of IBT in the extracellular milieu. Moreover, an in-frame acrA deletion in an engineered IBT-producing R. eutropha enhanced the strain's ability to produce IBT, which could potentially be associated with enhanced survival at high IBT concentrations. PMID:26811221

  19. Mechanisms of Salt Tolerance in Transgenic Arabidopsis thaliana Carrying a Peroxisomal Ascorbate Peroxidase Gene from Barley

    Institute of Scientific and Technical Information of China (English)

    XU Wei-Feng; SHI Wei-Ming; A. UEDA; T. TAKABE

    2008-01-01

    Ascorbate peroxidases (APX), localized in the cytosol, peroxisome, mitochondria, and chloroplasts of plant cells,catalyze the reduction of H2O2 to water by using ascorbic acid as the specific electron donor. To determine the role of peroxisomal type ascorbate peroxidasc (pAPX), an antioxidant enzyme, in protection against salt-induced oxidative stress, transgenic Arabidopsis thaliana plant carrying a pAPX gene (HvAPX1) from barley (Hordeum vulgare L.) was analyzed. The transgenic line pAPX3 was found to be more tolerant to salt stress than the wild type. Irrespective of salt stress, there were no significant differences in Na+, K+, Ca2+, and Mg2+ contents and the ratio of K+ to Na+ between pAPX3 and the wild type. Clearly, the salt tolerance in pAPX3 was not due to the maintenance and reestablishment of cellular ion homeostasis. However, the degree of H2O2 and lipid peroxidation (measured as the levels of malondialdehyde)accumulation under salt stress was higher in the wild type than in pAPX3. The mechanism of salt tolerance in transgenic pAPX3 can thus be explained by reduction of oxidative stress injury. Under all conditions tested, activities of superoxide,glutathionc reductase, and catalase were not significantly different between pAPX3 and the wild type. In contrast, the activity of APX was significantly higher in the transgcnic plant than in wild type under salt stress. These results suggested that in higher plants, HvAPX1 played an important role in salt tolerance and was a candidate gene for developing salt-tolerant crop plants.

  20. OsDREB1 Gene from Rice Enhances Cold Tolerance in Tobacco

    Institute of Scientific and Technical Information of China (English)

    LI Ping; CHEN Feng; QUAN Chao; ZHANG Guiyou

    2005-01-01

    The OsDREB1 gene from rice encodes a transcription factor belonging to the DREBP transcription factor subfamily. Many DREBP transcription factors regulate gene expression in response to drought, high-salt, and cold stresses by binding specifically to the dehydration-responsive element (DRE). DRE-binding proteins, such as CBF1, DREB1A, and DREB2A, have been cloned from Arabidopsis thaliana and have been proved to play an important role in stress response of Arabidopsis and several other plants. In this study, the OsDREB1 gene was transferred to tobacco plants by the Agrobacterium-mediated transfer method, and 16 transgenic plants were identified. PCR analysis demonstrates that the foreign genes have been integrated into the tobacco genome. Results of freezing stress experiments indicate that the transgenic plants have enhanced cold tolerance.

  1. Tracking the evolution of a cold stress associated gene family in cold tolerant grasses

    Directory of Open Access Journals (Sweden)

    Asp Torben

    2008-09-01

    Full Text Available Abstract Background Grasses are adapted to a wide range of climatic conditions. Species of the subfamily Pooideae, which includes wheat, barley and important forage grasses, have evolved extreme frost tolerance. A class of ice binding proteins that inhibit ice re-crystallisation, specific to the Pooideae subfamily lineage, have been identified in perennial ryegrass and wheat, and these proteins are thought to have evolved from a leucine-rich repeat phytosulfokine receptor kinase (LRR-PSR-like ancestor gene. Even though the ice re-crystallisation inhibition function of these proteins has been studied extensively in vitro, little is known about the evolution of these genes on the molecular level. Results We identified 15 putative novel ice re-crystallisation inhibition (IRI-like protein coding genes in perennial ryegrass, barley, and wheat. Using synonymous divergence estimates we reconstructed the evolution of the IRI-like gene family. We also explored the hypothesis that the IRI-domain has evolved through repeated motif expansion and investigated the evolutionary relationship between a LRR-domain containing IRI coding gene in carrot and the Pooideae IRI-like genes. Our analysis showed that the main expansion of the IRI-gene family happened ~36 million years ago (Mya. In addition to IRI-like paralogs, wheat contained several sequences that likely were products of polyploidisation events (homoeologs. Through sequence analysis we identified two short motifs in the rice LRR-PSR gene highly similar to the repeat motifs of the IRI-domain in cold tolerant grasses. Finally we show that the LRR-domain of carrot and grass IRI proteins both share homology to an Arabidopsis thaliana LRR-trans membrane protein kinase (LRR-TPK. Conclusion The diverse IRI-like genes identified in this study tell a tale of a complex evolutionary history including birth of an ice binding domain, a burst of gene duplication events after cold tolerant grasses radiated from rice

  2. Gene expression programs during Brassica oleracea seed maturation, osmopriming and germination process and the stress tolerance level

    NARCIS (Netherlands)

    Soeda, Y.; Konings, M.C.J.M.; Vorst, O.F.J.; Houwelingen, van A.M.M.L.; Stoopen, G.M.; Maliepaard, C.A.; Kodde, J.; Bino, R.J.; Groot, S.P.C.; Geest, van der A.H.M.

    2005-01-01

    During seed maturation and germination, major changes in physiological status, gene expression, and metabolic events take place. Using chlorophyll sorting, osmopriming, and different drying regimes, Brassica oleracea seed lots of different maturity, stress tolerance, and germination behavior were cr

  3. The autophagy associated gene, ULK1, promotes tolerance to chronic and acute hypoxia

    International Nuclear Information System (INIS)

    Background and purpose: Tumor hypoxia is associated with therapy resistance and malignancy. Previously we demonstrated that activation of autophagy and the unfolded protein response (UPR) promote hypoxia tolerance. Here we explored the importance of ULK1 in hypoxia tolerance, autophagy induction and its prognostic value for recurrence after treatment. Material and methods: Hypoxic regulation of ULK1 mRNA and protein was assessed in vitro and in primary human head and neck squamous cell carcinoma (HNSCC) xenografts. Its importance in autophagy induction, mitochondrial homeostasis and tolerance to chronic and acute hypoxia was evaluated in ULK1 knockdown cells. The prognostic value of ULK1 mRNA expression was assessed in 82 HNSCC patients. Results: ULK1 enrichment was observed in hypoxic tumor regions. High enrichment was associated with a high hypoxic fraction. In line with these findings, high ULK1 expression in HNSCC patients appeared associated with poor local control. Exposure of cells to hypoxia induced ULK1 mRNA in a UPR and HIF1α dependent manner. ULK1 knockdown decreased autophagy activation, increased mitochondrial mass and ROS exposure and sensitized cells to acute and chronic hypoxia. Conclusions: We demonstrate that ULK1 is a hypoxia regulated gene and is associated with hypoxia tolerance and a worse clinical outcome

  4. Identification of a novel drought tolerance gene in Gossypium hirsutum L. cv KC3

    Directory of Open Access Journals (Sweden)

    Jagadeesh N. Selvam

    2009-02-01

    Full Text Available Development of drought resistant cotton cultivars has long been a major breeding objective, since water stress limits fiber production and productivity. Recent advances in functional genomics can increase the efficiency of conventional breeding for genetic improvement of crop plants for improved abiotic stress resistance. To this end, a novel drought resistance gene was identified by comparing the gene expression profile of Gossypium hirsutum cv KC3 and MCU12 by employing a cDNA-RAPD approach. Physiological and biochemical studies showed that KC3 has relatively better drought tolerance than MCU12. Among 25 random primers, OPA15 has identified differentially expressed cDNA in KC3. Results of BLASTP algorithm have shown that this cDNA has significant homology with P-Glycoprotein, ACC oxidase2 and ABC transporter which are involved either directly, or indirectly, in stress tolerance in animals and plants. Hence, the cDNA sequence identified in this study may be a novel gene that confers drought resistance in cotton as KC3 is well adapted and is widely cultivated in rain-fed tracts of Tamil Nadu, India. Further characterization of this gene may show it has potential application for development of cotton with improved drought resistance, through genetic engineering and/or marker aided selection (MAS

  5. Isolation and characterization of maize PMP3 genes involved in salt stress tolerance.

    Directory of Open Access Journals (Sweden)

    Jing Fu

    Full Text Available Plasma membrane protein 3 (PMP3, a class of small hydrophobic polypeptides with high sequence similarity, is responsible for salt, drought, cold, and abscisic acid. These small hydrophobic ploypeptides play important roles in maintenance of ion homeostasis. In this study, eight ZmPMP3 genes were cloned from maize and responsive to salt, drought, cold and abscisic acid. The eight ZmPMP3s were membrane proteins and their sequences in trans-membrane regions were highly conserved. Phylogenetic analysis showed that they were categorized into three groups. All members of group II were responsive to ABA. Functional complementation showed that with the exception of ZmPMP3-6, all were capable of maintaining membrane potential, which in turn allows for regulation of intracellular ion homeostasis. This process was independent of the presence of Ca(2+. Lastly, over-expression of ZmPMP3-1 enhanced growth of transgenic Arabidopsis under salt condition. Through expression analysis of deduced downstream genes in transgenic plants, expression levels of three ion transporter genes and four important antioxidant genes in ROS scavenging system were increased significantly in transgenic plants during salt stress. This tolerance was likely achieved through diminishing oxidative stress due to the possibility of ZmPMP3-1's involvement in regulation of ion homeostasis, and suggests that the modulation of these conserved small hydrophobic polypeptides could be an effective way to improve salt tolerance in plants.

  6. Overexpression of Bacterial mtlD Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol

    Directory of Open Access Journals (Sweden)

    Tengale Dipak Bhauso

    2014-01-01

    Full Text Available In the changing global environmental scenarios, water scarcity and recurrent drought impose huge reductions to the peanut (Arachis hypogaea L. crop yield. In plants, osmotic adjustments associated with efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms. Mannitol, a compatible solute, is known to scavenge hydroxyl radicals generated during various abiotic stresses, thereby conferring tolerance to water-deficit stress in many plant species. However, peanut plant is not known to synthesize mannitol. Therefore, bacterial mtlD gene coding for mannitol 1-phosphate dehydrogenase under the control of constitutive promoter CaMV35S was introduced and overexpressed in the peanut cv. GG 20 using Agrobacterium tumefaciens-mediated transformation. A total of eight independent transgenic events were confirmed at molecular level by PCR, Southern blotting, and RT-PCR. Transgenic lines had increased amount of mannitol and exhibited enhanced tolerance in response to water-deficit stress. Improved performance of the mtlD transgenics was indicated by excised-leaf water loss assay and relative water content under water-deficit stress. Better performance of transgenics was due to the ability of the plants to synthesize mannitol. However, regulation of mtlD gene expression in transgenic plants remains to be elucidated.

  7. Sugar beet M14 glyoxalase I gene can enhance plant tolerance to abiotic stresses.

    Science.gov (United States)

    Wu, Chuan; Ma, Chunquan; Pan, Yu; Gong, Shilong; Zhao, Chenxi; Chen, Sixue; Li, Haiying

    2013-05-01

    Glyoxalase I is the first enzyme of the glyoxalase system that can detoxify methylglyoxal, a cytotoxic compound increased rapidly under stress conditions. Here we report cloning and characterization of a glyoxalase I from sugar beet M14 line (an interspecific hybrid between a wild species Beta corolliflora Zoss and a cultivated species B. vulgaris L). The full-length gene BvM14-glyoxalase I has 1,449 bp in length with an open reading frame of 1,065 bp encoding 354 amino acids. Sequence analysis shows the conserved glyoxalase I domains, metal and glutathione binding sites and secondary structure (α-helixes and β-sheets). The BvM14-glyoxalase I gene was ubiquitously expressed in different tissues of sugar beet M14 line and up-regulated in response to salt, mannitol and oxidative stresses. Heterologous expression of BvM14-glyoxalase I could increase E. coli tolerance to methylglyoxal. Transgenic tobacco plants constitutively expressing BvM14-glyoxalase I were generated. Both leaf discs and seedlings showed significant tolerance to methylglyoxal, salt, mannitol and H2O2. These results suggest an important role of BvM14-glyoxalase I in cellular detoxification and tolerance to abiotic stresses.

  8. Sugar beet M14 glyoxalase I gene can enhance plant tolerance to abiotic stresses.

    Science.gov (United States)

    Wu, Chuan; Ma, Chunquan; Pan, Yu; Gong, Shilong; Zhao, Chenxi; Chen, Sixue; Li, Haiying

    2013-05-01

    Glyoxalase I is the first enzyme of the glyoxalase system that can detoxify methylglyoxal, a cytotoxic compound increased rapidly under stress conditions. Here we report cloning and characterization of a glyoxalase I from sugar beet M14 line (an interspecific hybrid between a wild species Beta corolliflora Zoss and a cultivated species B. vulgaris L). The full-length gene BvM14-glyoxalase I has 1,449 bp in length with an open reading frame of 1,065 bp encoding 354 amino acids. Sequence analysis shows the conserved glyoxalase I domains, metal and glutathione binding sites and secondary structure (α-helixes and β-sheets). The BvM14-glyoxalase I gene was ubiquitously expressed in different tissues of sugar beet M14 line and up-regulated in response to salt, mannitol and oxidative stresses. Heterologous expression of BvM14-glyoxalase I could increase E. coli tolerance to methylglyoxal. Transgenic tobacco plants constitutively expressing BvM14-glyoxalase I were generated. Both leaf discs and seedlings showed significant tolerance to methylglyoxal, salt, mannitol and H2O2. These results suggest an important role of BvM14-glyoxalase I in cellular detoxification and tolerance to abiotic stresses. PMID:23203352

  9. Pharmacokinetic genes do not influence response or tolerance to citalopram in the STAR*D sample.

    Directory of Open Access Journals (Sweden)

    Eric J Peters

    Full Text Available BACKGROUND: We sought to determine whether clinical response or tolerance to the Selective Serotonin Reuptake Inhibitor (SSRI citalopram is associated with genetic polymorphisms in potentially relevant pharmacokinetic enzymes. METHODOLOGY: We used a two-stage case-control study design in which we split the sample of 1,953 subjects from the Sequenced Treatment Alternatives to Relieve Depression (STAR*D trial into a discovery (n = 831 and validation set (n = 1,046. Fifteen polymorphisms from five (CYP2D6, ABCB1, CYP2C19, CYP3A4, and CYP3A5 pharmacokinetic genes were genotyped. We examined the associations between these polymorphisms and citalopram response and tolerance. Significant associations were validated in the second stage for those polymorphism found to be statistically significant in the first stage. CONCLUSIONS: No genetic polymorphism in the pharmacokinetic genes examined was significantly associated with our response or tolerance phenotypes in both stages. For managing pharmacological treatment with citalopram, routine screening of the common pharmacokinetic DNA variants that we examined appears to be of limited clinical utility.

  10. Enhanced water stress tolerance of transgenic maize plants over-expressing LEA Rab28 gene.

    Science.gov (United States)

    Amara, Imen; Capellades, Montserrat; Ludevid, M Dolors; Pagès, Montserrat; Goday, Adela

    2013-06-15

    Late Embryogenesis Abundant (LEA) proteins participate in plant stress responses and contribute to the acquisition of desiccation tolerance. In this report Rab28 LEA gene has been over-expressed in maize plants under a constitutive maize promoter. The expression of Rab28 transcripts led to the accumulation and stability of Rab28 protein in the transgenic plants. Native Rab28 protein is localized to nucleoli in wild type maize embryo cells; here we find by whole-mount immunocytochemistry that in root cells of Rab28 transgenic and wild-type plants the protein is also associated to nucleolar structures. Transgenic plants were tested for stress tolerance and resulted in sustained growth under polyethyleneglycol (PEG)-mediated dehydration compared to wild-type controls. Under osmotic stress transgenic seedlings showed increased leaf and root areas, higher relative water content (RWC), reduced chlorophyll loss and lower Malondialdehyde (MDA) production in relation to wild-type plants. Moreover, transgenic seeds exhibited higher germination rates than wild-type seeds under water deficit. Overall, our results highlight the presence of transgenic Rab28 protein in nucleolar structures and point to the potential of group 5 LEA Rab28 gene as candidate to enhance stress tolerance in maize plants. PMID:23384757

  11. Chilling Tolerance of Cucumber During Germination is Related to Expression of Lysine Decarboxylase Gene

    Institute of Scientific and Technical Information of China (English)

    LU Ming-hui; LI Xiao-ming; CHEN Jin-feng; CHEN Long-zheng; QIAN Chun-tao

    2005-01-01

    Using cDNA-AFLP technique, a specific fragment was isolated from cucumber cultivar Changchun mici possessing chilling tolerance induced at low temperature (15℃). This fragment, named cctr 132, could not be induced in the chilling sensitive cucumber cultivar Beijing jietou. After recovering the fragment, sequencing and translating, the results of blastx and blastp in GenBank of NCBI indicated that CCTR132 had 88.37% identities and 100% positives with Oryza sativa putative lysine decarboxylase-like protein respectively, and PGGXGTXXE, the putative conserved domain of lysine decarboxylase family, was detected from CCTR132, suggesting the cucumber chilling tolerance during germination is related to the expression of the lysine decarboxylase gene.

  12. Down-Regulated Expression of RACK1 Gene by RNA Interference Enhances Drought Tolerance in Rice

    Institute of Scientific and Technical Information of China (English)

    LI Da-hong; LIU Hui; YANG Yan-li; ZHEN Ping-ping; LIANG Jian-sheng

    2009-01-01

    The receptor for activated C-kinase 1 (RACK1) is a highly conserved scaffold protein with versatile functions, and plays important roles in the regulation of plant growth and development. Transgenic rice plants, in which the expression of RACK1 gene was inhibited by RNA interference (RNAi), were studied to elucidate the possible functions of RACK1 in responses to drought stress in rice. Real-time PCR analysis showed that the expression of RACK1 in transgenic rice plants was inhibited by more than 50%. The tolerance to drought stress of the transgenic rice plants was higher as compared with the non-transgenic rice plants. The peroxidation of membrane and the production of malondialdehyde were significantly lower, and the superoxide dismutase activity in transgenic rice plants was significantly higher than those in non-trangenic rice plants. It is suggested that RACK1 negatively regulated the redox system-related tolerance to drought stress of rice plants.

  13. Tracking the evolution of a cold stress associated gene family in cold tolerant grasses

    DEFF Research Database (Denmark)

    Sandve, Simen R; Rudi, Heidi; Asp, Torben;

    2008-01-01

    Background Grasses are adapted to a wide range of climatic conditions. Species of the subfamily Pooideae, which includes wheat, barley and important forage grasses, have evolved extreme frost tolerance. A class of ice binding proteins that inhibit ice re-crystallisation, specific to the Pooideae...... subfamily lineage, have been identified in perennial ryegrass and wheat, and these proteins are thought to have evolved from a leucine-rich repeat phytosulfokine receptor kinase (LRR-PSR)-like ancestor gene. Even though the ice re-crystallisation inhibition function of these proteins has been studied...... extensively in vitro, little is known about the evolution of these genes on the molecular level. Results We identified 15 putative novel ice re-crystallisation inhibition (IRI)-like protein coding genes in perennial ryegrass, barley, and wheat. Using synonymous divergence estimates we reconstructed...

  14. Physiological performance, secondary metabolite and expression profiling of genes associated with drought tolerance in Withania somnifera.

    Science.gov (United States)

    Sanchita; Singh, Ruchi; Mishra, Anand; Dhawan, Sunita S; Shirke, Pramod A; Gupta, Madan M; Sharma, Ashok

    2015-11-01

    Physiological, biochemical, and gene expression responses under drought stress were studied in Withania somnifera. Photosynthesis rate, stomatal conductance, transpiration rate, relative water content, chlorophyll content, and quantum yield of photosystems I and II (PSI and PSII) decreased in response to drought stress. Comparative expression of genes involved in osmoregulation, detoxification, signal transduction, metabolism, and transcription factor was analyzed through quantitative RT-PCR. The genes encoding 1-pyrroline-5-carboxylate synthetase (P5CS), glutathione S-transferase (GST), superoxide dismutase (SOD), serine threonine-protein kinase (STK), serine threonine protein phosphatase (PSP), aldehyde dehydrogenase (AD), leucoanthocyanidin dioxygenase/anthocyanin synthase (LD/AS), HSP, MYB, and WRKY have shown upregulation in response to drought stress condition in leaf tissues. Enhanced detoxification and osmoregulation along with increased withanolides production were also observed under drought stress. The results of this study will be helpful in developing stress-tolerant and high secondary metabolite yielding genotypes.

  15. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    Energy Technology Data Exchange (ETDEWEB)

    Dixit, Prachy; Mukherjee, Prasun K.; Sherkhane, Pramod D.; Kale, Sharad P. [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Eapen, Susan, E-mail: eapenhome@yahoo.com [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2011-08-15

    Highlights: {yields} Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. {yields} Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. {yields} Using in vitro T{sub 1} seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. {yields} This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of {sup 14}C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T{sub 0} and T{sub 1}) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  16. Differential activation of genes related to aluminium tolerance in two contrasting rice cultivars.

    Science.gov (United States)

    Roselló, Maite; Poschenrieder, Charlotte; Gunsé, Benet; Barceló, Juan; Llugany, Mercè

    2015-11-01

    Rice (Oryza sativa) is a highly Al-tolerant crop. Among other mechanisms, a higher expression of STAR1/STAR2 (sensitive to Al rhizotoxicity1/2) genes and of Nrat1 (NRAMP Aluminium Transporter 1), and ALS1 (Aluminium sensitive 1) can at least in part be responsible for the inducible Al tolerance in this species. Here we analysed the responses to Al in two contrasting rice varieties. All analysed toxicity/tolerance markers (root elongation, Evans blue, morin and haematoxylin staining) indicated higher Al-tolerance in variety Nipponbare, than in variety Modan. Nipponbare accumulated much less Al in the roots than Modan. Aluminium supply caused stronger expression of STAR1 in Nipponbare than in Modan. A distinctively higher increase of Al-induced abscisic acid (ABA) accumulation was found in the roots of Nipponbare than in Modan. Highest ABA levels were observed in Nipponbare after 48 h exposure to Al. This ABA peak was coincident in time with the highest expression level of STAR1. It is proposed that ABA may be required for cell wall remodulation facilitated by the enhanced UDP-glucose transport to the walls through STAR1/STAR2. Contrastingly, in the roots of Modan the expression of both Nrat1 coding for a plasma membrane Al-transporter and of ALS1 coding for a tonoplast-localized Al transporter was considerably enhanced. Moreover, Modan had a higher Al-induced expression of ASR1 a gene that has been proposed to code for a reactive oxygen scavenging protein. In conclusion, the Al-exclusion strategy of Nipponbare, at least in part mediated by STAR1 and probably regulated by ABA, provided better protection against Al toxicity than the accumulation and internal detoxification strategy of Modan mediated by Nrat1, ALS1 and ARS1.

  17. CrGNAT gene regulates excess copper accumulation and tolerance in Chlamydomonas reinhardtii.

    Science.gov (United States)

    Wang, Ye; Cheng, Zhen Zhen; Chen, Xi; Zheng, Qi; Yang, Zhi Min

    2015-11-01

    Excess copper (Cu) in environment affects the growth and metabolism of plants and green algae. However, the molecular mechanism for regulating plant tolerance to excess Cu is not fully understood. Here, we report a gene CrGNAT enconding an acetyltransferase in Chlamydomonas reinhardtii and identified its role in regulating tolerance to Cu toxicity. Expression of CrGNAT was significantly induced by 75-400μM Cu. The top induction occurred at 100μM. Transgenic algae overexpressing CrGNAT (35S::CrGNAT) in C. reinhardtii showed high tolerance to excess Cu, with improved cell population, chlorophyll accumulation and photosynthesis efficiency, but with low degree of oxidation with regard to reduced hydrogen peroxide, lipid peroxides and non-protein thiol compounds. In contrast, CrGNAT knock-down lines with antisense led to sensitivity to Cu stress. 35S::CrGNAT algae accumulated more Cu and other metals (Zn, Fe, Cu, Mn and Mg) than wild-type, whereas the CrGNAT down-regulated algae (35S::AntiCrGNAT) had moderate levels of Cu and Mn, but no effects on Zn, Fe and Mg accumulation as compared to wild-type. The elevated metal absorption in CrGNAT overexpression algae implies that the metals can be removed from water media. Quantitative RT-PCR analysis revealed that expression of two genes encoding N-lysine histone methyltransferases was repressed in 35S::CrGNAT algae, suggesting that CrGNAT-regulated algal tolerance to Cu toxicity is likely associated with histone methylation and chromatin remodeling. The present work provided an example a basis to develop techniques for environmental restoration of metal-contaminated aquatic ecosystems. PMID:26475193

  18. Improvement of acetic acid tolerance of Saccharomyces cerevisiae using a zinc-finger-based artificial transcription factor and identification of novel genes involved in acetic acid tolerance.

    Science.gov (United States)

    Ma, Cui; Wei, Xiaowen; Sun, Cuihuan; Zhang, Fei; Xu, Jianren; Zhao, Xinqing; Bai, Fengwu

    2015-03-01

    Acetic acid is present in cellulosic hydrolysate as a potent inhibitor, and the superior acetic acid tolerance of Saccharomyces cerevisiae ensures good cell viability and efficient ethanol production when cellulosic raw materials are used as substrates. In this study, a mutant strain of S. cerevisiae ATCC4126 (Sc4126-M01) with improved acetic acid tolerance was obtained through screening strains transformed with an artificial zinc finger protein transcription factor (ZFP-TF) library. Further analysis indicated that improved acetic acid tolerance was associated with improved catalase (CAT) activity. The ZFP coding sequence associated with the improved phenotype was identified, and real-time RT-PCR analysis revealed that three of the possible genes involved in the enhanced acetic acid tolerance regulated by this ZFP-TF, namely YFL040W, QDR3, and IKS1, showed decreased transcription levels in Sc4126-M01 in the presence of acetic acid, compared to those in the control strain. Sc4126-M01 mutants having QDR3 and IKS1 deletion (ΔQDR3 and ΔIKS1) exhibited higher acetic acid tolerance than the wild-type strain under acetic acid treatment. Glucose consumption rate and ethanol productivity in the presence of 5 g/L acetic acid were improved in the ΔQDR3 mutant compared to the wild-type strain. Our studies demonstrated that the synthetic ZFP-TF library can be used to improve acetic acid tolerance of S. cerevisiae and that the employment of an artificial transcription factor can facilitate the exploration of novel functional genes involved in stress tolerance of S. cerevisiae. PMID:25698512

  19. Statistical methods in detecting differential expressed genes, analyzing insertion tolerance for genes and group selection for survival data

    Science.gov (United States)

    Liu, Fangfang

    The thesis is composed of three independent projects: (i) analyzing transposon-sequencing data to infer functions of genes on bacteria growth (chapter 2), (ii) developing semi-parametric Bayesian method for differential gene expression analysis with RNA-sequencing data (chapter 3), (iii) solving group selection problem for survival data (chapter 4). All projects are motivated by statistical challenges raised in biological research. The first project is motivated by the need to develop statistical models to accommodate the transposon insertion sequencing (Tn-Seq) data, Tn-Seq data consist of sequence reads around each transposon insertion site. The detection of transposon insertion at a given site indicates that the disruption of genomic sequence at this site does not cause essential function loss and the bacteria can still grow. Hence, such measurements have been used to infer the functions of each gene on bacteria growth. We propose a zero-inflated Poisson regression method for analyzing the Tn-Seq count data, and derive an Expectation-Maximization (EM) algorithm to obtain parameter estimates. We also propose a multiple testing procedure that categorizes genes into each of the three states, hypo-tolerant, tolerant, and hyper-tolerant, while controlling false discovery rate. Simulation studies show our method provides good estimation of model parameters and inference on gene functions. In the second project, we model the count data from RNA-sequencing experiment for each gene using a Poisson-Gamma hierarchical model, or equivalently, a negative binomial (NB) model. We derive a full semi-parametric Bayesian approach with Dirichlet process as the prior for the fold changes between two treatment means. An inference strategy using Gibbs algorithm is developed for differential expression analysis. We evaluate our method with several simulation studies, and the results demonstrate that our method outperforms other methods including the popularly applied ones such as edge

  20. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  1. O pH das soluções nutritivas no comportamento de cultivares de trigo à toxicidade de alumínio Effect of pH in nutrient solution on tolerance to aluminum toxicity in wheat cultivars

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1984-01-01

    Full Text Available Foram estudados nove cultivares de trigo em soluções nutritivas contendo quatro níveis de alumínio (0, 5, 10 e 20mg/litro combinados com três níveis de pH (4,0, 5,0 e 6,0. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após um período de permanência de 48 horas em solução contendo determinados níveis de pH e de alumínio. Os cultivares BH-1146, IAC-18, IAC-13 e C-3 foram tolerantes; IAC-17 e Alondra-4546 foram moderadamente tolerantes, e Síete Cerros, Super-x e CNT-8 foram sensíveis à presença de quantidades crescentes de Al3+ nas soluções de tratamentos quando foi mantido o pH 4,0. Todos os cultivares foram tolerantes às dosagens de alumínio estudadas quando foram mantidos os níveis de pH 5,0 ou 6,0. Ficou confirmado que um controle rigoroso do pH da solução tratamento é um fator de grande importância no estudo da toxicidade do alumínio a diferentes cultivares de trigo.The aluminum tolerance of nine wheat cultivars was studied in nutrient solutions using three different levels of pH combined with four different concentrations of this element. The tolerance was evaluated by measuring the root growth in an aluminum-free complete nutrient solution after a previous treatment in aluminum added solutions (0, 5, 10 and 20mg/l under a particular pH (4.0, 5.0 and 6.0. The wheat cultivars BH-1146, IAC-18, IAC-13 and C-3 presented tolerance, IAC-17 and Alondra-4546 showed moderate tolerance and Siete Cerros, Super-x and CNT-8 were sensitive to the presence of increasing concentrations of Al3+ in the treatment solution under pH 4.0. All cultivars were tolerant to the different concentrations of aluminum under pH 5.0 and 6.0. The aluminum toxicity symptom (inhibition of root growth was dependent on the pH and the amount of aluminum in the treatment solution. For the same level of aluminum, toxicity symptoms increased, when the pH decreased in the solution from 6

  2. [Involvement of PHO80 and PHO85 genes in Saccharomyces cerevisiae ion tolerance].

    Science.gov (United States)

    Mao, Xi-Cheng; Xia, Yu-Lei; Hu, Ya-Fang; Lu, Chang-De

    2003-01-01

    PHO85 is a versatile gene in Saccharomyces cerevisiae, which is involved in metabolism of inorganic phosphate and usage of carbon source, accumulation of glycogen, regulation of protein stability and cell cycle control. The viability of wild type budding yeast strain YPH499 and its derivative pho85Delta mutant, pho80 mutant, and pap1(pcl-7)Delta mutant in different cations were investigated and their tolerance to the cations(LC(50)) was measured. The results showed that the deletion of PHO85 or PHO80 gene both increased sensibility of Sacchromyces cerevisiae to ions K(+), Mg(2+), Zn(2+), Ca(2+) and Mn(2+), while the deletion of pap1(pcl-7) gene did not lead to such phenotype. The difference between the patterns of relative growth curve of the mutants and wild type strain in the above ions also implied that PHO80 was the unique PCLs in complex with PHO85 CDK, that were contributed to K(+) and Mg(2+) ion homeostasis control and there were some other PCLs besides PHO80 that were involved in Zn(2+), Ca(2+) and Mn(2+) tolerance regulation as cyclin of PHO85 CDK. Furthermore, the amount of the total cellular calcium of pho85Delta mutant, pho80Delta mutant and YPH499 indicated that the ability of calcium accumulation of pho85 mutant and pho80Delta mutant was impaired. PMID:12518234

  3. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene confers drought tolerance in maize (Zea mays L..

    Directory of Open Access Journals (Sweden)

    Yao Lu

    Full Text Available Abscisic acid (ABA is a key component of the signaling system that integrates plant adaptive responses to abiotic stress. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene (LOS5 in maize markedly enhanced the expression of ZmAO and aldehyde oxidase (AO activity, leading to ABA accumulation and increased drought tolerance. Transgenic maize (Zea mays L. exhibited the expected reductions in stomatal aperture, which led to decreased water loss and maintenance of higher relative water content (RWC and leaf water potential. Also, transgenic maize subjected to drought treatment exhibited lower leaf wilting, electrolyte leakage, malondialdehyde (MDA and H(2O(2 content, and higher activities of antioxidative enzymes and proline content compared to wild-type (WT maize. Moreover, overexpression of LOS5 enhanced the expression of stress-regulated genes such as Rad 17, NCED1, CAT1, and ZmP5CS1 under drought stress conditions, and increased root system development and biomass yield after re-watering. The increased drought tolerance in transgenic plants was associated with ABA accumulation via activated AO and expression of stress-related gene via ABA induction, which sequentially induced a set of favorable stress-related physiological and biochemical responses.

  4. [Cloning and expression of organic solvent tolerant lipase gene from Staphylococcus saprophyticus M36].

    Science.gov (United States)

    Tang, Yanchong; Lu, Yaping; Lü, Fengxia; Bie, Xiaomei; Guo, Yao; Lu, Zhaoxin

    2009-12-01

    Lipases are important biocatalysts that are widely used in food processing and bio-diesel production. However, organic solvents could inactivate some lipases during applications. Therefore, the efficient cloning and expression of the organic solvent-tolerant lipase is important to its application. In this work, we first found out an organic solvent-tolerant lipase from Staphylococcus saprophyticus M36 and amplified the 741 bp Lipase gene lip3 (GenBank Accession No. FJ979867), by PCR, which encoded a 31.6 kD polypeptide of 247 amino acid residues. But the lipase shared 83% identity with tentative lip3 gene of Staphylococcus saprophyticus (GenBank Accession No. AP008934). We connected the gene with expression vector pET-DsbA, transformed it into Escherichia coli BL21 (DE3), and obtained the recombinant pET-DsbA-lip3. With the induction by 0.4 mmol/L of isopropyl beta-D-thiogalactopyranoside at pH 8.0, OD600 1.0, 25 degrees C for 12 h, the lipase activity reached up to 25.8 U/mL. The lipase expressed was stable in the presence of methanol, n-hexane, and isooctane, n-heptane.

  5. Improvement of Drought Tolerance in Transgenic Tobacco Plants by aDehydrin-Like Gene Transfer

    Institute of Scientific and Technical Information of China (English)

    SHENYe; JIAWei-long; ZHANGYan-qin; HUYuan-lei; WUQi; LINZhongping

    2004-01-01

    A full-length cDNA of dehydrin BcDh2 from Boea crassifolia and its antisense nucleotide sequence have been transferred into tobacco (Nicotiana tabacum) NC89 under the control of a caulifower mosaic virus 35S promoter. Under a progressive water stress, photosynthetic rate, transpiration rate and stomatal conductance of the sense and antisense plants reduced, and those of the control reduced much more. Photosynthetic rate, transpiration rate and stomatal conductance of all plants tested increased significantly 24 hours later after recoveried water supply, and those of the sense and antisense plants were higher than control. These indicated that overexpression of a dehydrin gene in tobacco may improve tolerance to water stress for plants, however, antisense BcDh2 gene in transgenic plant did not influence physiological conditions. The results of germination experiment of the transgenic seeds showed that on MS medium with different concentration PEG (8000), sense seed could more endure drought than control, while antisense seed was sensitive to drought. The results suggested that the overexpression of a dehydrin gene in tobacco might improve the tolerance to water stress for plants.

  6. Improvement of Drought Tolerance in Transgenic Tobacco Plants by a Dehydrin-Like Gene Transfer

    Institute of Scientific and Technical Information of China (English)

    SHEN Ye; JIA Wei-long; ZHANG Yan-qin; HU Yuan-lei; WU Qi; LIN Zhong-ping

    2004-01-01

    A full-length cDNA of dehydrin BcDh2 from Boea crassifolia and its antisense nucleotide sequence have been transferred into tobacco (Nicotiana tabacum) NC89 under the control of a caulifower mosaic virus 35S promoter. Under a progressive water stress, photosynthetic rate, transpiration rate and stomatal conductance of the sense and antisense plants reduced, and those of the control reduced much more. Photosynthetic rate, transpiration rate and stomatal conductance of all plants tested increased significantly 24 hours later after recoveried water supply, and those of the sense and antisense plants were higher than control. These indicated that overexpression of a dehydrin gene in tobacco may improve tolerance to water stress for plants, however, antisense BcDh2 gene in transgenic plant did not influence physiological conditions. The results of germination experiment of the transgenic seeds showed that on MS medium with different concentration PEG (8000), sense seed could more endure drought than control, while antisense seed was sensitive to drought. The results suggested that the overexpression of a dehydrin gene in tobacco might improve the tolerance to water stress for plants.

  7. Mapping and validation of a dominant salt tolerance gene in the cultivated soybean(Glycine max) variety Tiefeng 8

    Institute of Scientific and Technical Information of China (English)

    Rongxia; Guan; Jiangang; Chen; Jinghan; Jiang; Guangyu; Liu; Ying; Liu; Lei; Tian; Lili; Yu; Ruzhen; Chang; Li-juan; Qiu

    2014-01-01

    Salt is an abiotic stress factor that strongly affects soybean growth and production. A single dominant gene has been shown to confer salt tolerance in the soybean cultivar Tiefeng 8.The objective of the present study was to genetically map the salt-tolerance gene in an F2:3population and a recombinant inbred line(RIL) population derived from a cross between two cultivated soybeans, Tiefeng 8(tolerant) and 85-140(sensitive). The F2:3families and RILs were treated with 200 mmol L-1Na Cl to evaluate salt tolerance. The F2:3population showed 1(42 tolerant): 2(132 segregating): 1(65 sensitive) segregation, indicating a single dominant gene for salt tolerance in Tiefeng 8. A sequence-characterized amplified region(SCAR) marker from a previously identified random amplified polymorphic DNA(RAPD)marker and four insertion/deletion polymorphism(In Del) markers were developed within the mapping region. Using these markers along with SSR markers, the salt-tolerance gene was mapped within 209 kb flanked by SCAR marker QS08064 and SSR marker Barcsoyssr31301 on chromosome 3. Three markers that cosegregated with the salt tolerance gene and SCAR marker QS08064 were used to genotype 35 tolerant and 23 sensitive soybean accessions. These markers showed selection efficiencies of 76.2% to94.2%. The results indicate that these markers will be useful for marker-assisted breeding and facilitating map-based cloning of the salt tolerance gene in soybean.

  8. Stable expression of mtlD gene imparts multiple stress tolerance in finger millet.

    Directory of Open Access Journals (Sweden)

    Ramanna Hema

    Full Text Available Finger millet is susceptible to abiotic stresses, especially drought and salinity stress, in the field during seed germination and early stages of seedling development. Therefore developing stress tolerant finger millet plants combating drought, salinity and associated oxidative stress in these two growth stages is important. Cellular protection through osmotic adjustment and efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms in plants. Mannitol, an osmolyte, is known to scavenge hydroxyl radicals generated during various abiotic stresses and thereby minimize stress damage in several plant species. In this study transgenic finger millet plants expressing the mannitol biosynthetic pathway gene from bacteria, mannitol-1-phosphate dehydrogenase (mtlD, were developed through Agrobacterium tumefaciens-mediated genetic transformation. mtlD gene integration in the putative transgenic plants was confirmed by Southern blot. Further, performance of transgenic finger millet under drought, salinity and oxidative stress was studied at plant level in T1 generation and in T1 and T2 generation seedlings. Results from these experiments showed that transgenic finger millet had better growth under drought and salinity stress compared to wild-type. At plant level, transgenic plants showed better osmotic adjustment and chlorophyll retention under drought stress compared to the wild-type. However, the overall increase in stress tolerance of transgenics for the three stresses, especially for oxidative stress, was only marginal compared to other mtlD gene expressing plant species reported in the literature. Moreover, the Agrobacterium-mediated genetic transformation protocol developed for finger millet in this study can be used to introduce diverse traits of agronomic importance in finger millet.

  9. Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

    Energy Technology Data Exchange (ETDEWEB)

    Monette, Michelle Y., E-mail: michelle.monette@yale.edu [Organismic and Evolutionary Biology Program, University of Massachusetts, Amherst, MA 01003 (United States); USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376 (United States); Yada, Takashi [Freshwater Fisheries Research Department, National Research Institute of Fisheries Science, Nikko (Japan); Matey, Victoria [Department of Biology, San Diego State University, San Diego, CA 92182 (United States); McCormick, Stephen D. [Organismic and Evolutionary Biology Program, University of Massachusetts, Amherst, MA 01003 (United States); USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376 (United States)

    2010-08-01

    We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4 {mu}g l{sup -1} Al), acid and low Al (LAl: pH 5.4, 11 {mu}g l{sup -1} Al), acid and moderate Al (MAl: pH 5.3, 42 {mu}g l{sup -1} Al), and acid and high Al (HAl: pH 5.4, 56 {mu}g l{sup -1} Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24 h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na{sup +}/K{sup +}-ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl{sup -} channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time

  10. Overexpression of Rab16A gene in indica rice variety for generating enhanced salt tolerance

    OpenAIRE

    Ganguly, Moumita; Datta, Karabi; Roychoudhury, Aryadeep; Gayen, Dipak; Sengupta, Dibyendu N; Datta, Swapan K.

    2012-01-01

    We report here the overexpression of Rab16A full length gene (promoter + ORF), from the salt-tolerant indica rice Pokkali, in the salt-susceptible indica rice variety Khitish, via particle bombardment. Molecular analysis of the transgenics revealed stable integration of the transgene upto T2 generation. High level of expression of the transgene (driven by its own stress-inducible promoter), as well as the protein, was detectable in the leaves under simulated salinity stress (250 mM NaCl, 24 h...

  11. SELEÇÃO PARA TOLERÂNCIA AO ALUMÍNIO EM SOJA TROPICAL SELECTION FOR ALUMINUM TOLERANCE IN TROPICAL SOYBEANS

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Spehar

    2007-09-01

    Full Text Available

    A acidez do solo é fator limitante para a maioria das plantas cultivadas no Cerrado Brasileiro. A toxidez causada por alumínio (Al é especialmente séria na subsuperfície, que permanece ácida após o uso de corretivos, por impedir o crescimento radicular e causar suscetibilidade à seca e desbalanceamento nutricional. Aqui objetivou-se a seleção de genótipos de soja com maior tolerância ao Al, pela associação de experimentos em hidroponia e no campo. Cruzamentos incluindo genótipos selecionados no Cerrado foram realizados. Sementes de indivíduos contrastantes, selecionados em hidroponia na geração F2 pelo crescimento radicular, foram obtidas para avaliação de progênies em F3, no campo, e em F4, novamente em hidroponia. Rendimento de grãos e de biomassa das progênies selecionadas foram superiores aos genitores, no experimento em solo ácido. Esses resultados foram confirmados pelo desempenho em hidroponia, indicando que o método de seleção pode ser empregado com êxito em programas de melhoramento para adaptação de cultivos a condições de acidez subsuperficial do solo.

    PALAVRAS-CHAVE: Acidez sub-superficial; Glycine max; estresse; genótipo; melhoramento de plantas.

    Soil acidity is a limiting factor for most of the cultivated plants in the Brazilian Savannah. Toxicity caused by aluminum (Al is especially serious in the acid subsurface, which remains acidic after soil has been amended, by hindering root growth and causing drought susceptibility and nutritional unbalance. This research aimed at selecting soybean with increased tolerance to Al through association of hydroponics and field experiments. Crosses including savannah adapted genotypes were obtained. Seeds of contrasting individuals, selected in hydroponics at F2 generation for root

  12. Dynamic QTL analysis and candidate gene mapping for waterlogging tolerance at maize seedling stage.

    Directory of Open Access Journals (Sweden)

    Khalid A Osman

    Full Text Available Soil waterlogging is one of the major abiotic stresses adversely affecting maize growth and yield. To identify dynamic expression of genes or quantitative trait loci (QTL, QTL associated with plant height, root length, root dry weight, shoot dry weight and total dry weight were identified via conditional analysis in a mixed linear model and inclusive composite interval mapping method at three respective periods under waterlogging and control conditions. A total of 13, 19 and 23 QTL were detected at stages 3D|0D (the period during 0-3 d of waterlogging, 6D|3D and 9D|6D, respectively. The effects of each QTL were moderate and distributed over nine chromosomes, singly explaining 4.14-18.88% of the phenotypic variation. Six QTL (ph6-1, rl1-2, sdw4-1, sdw7-1, tdw4-1 and tdw7-1 were identified at two consistent stages of seedling development, which could reflect a continuous expression of genes; the remaining QTL were detected at only one stage. Thus, expression of most QTL was influenced by the developmental status. In order to provide additional evidence regarding the role of corresponding genes in waterlogging tolerance, mapping of Expressed Sequence Tags markers and microRNAs were conducted. Seven candidate genes were observed to co-localize with the identified QTL on chromosomes 1, 4, 6, 7 and 9, and may be important candidate genes for waterlogging tolerance. These results are a good starting point for understanding the genetic basis for selectively expressing of QTL in different stress periods and the common genetic control mechanism of the co-localized traits.

  13. Melhoramento do trigo: III. Evidência de controle genético na tolerância ao manganês e alumínio tóxico em trigo Wheat breeding: III. Evidence of genetic control in the tolerance to manganese and aluminum toxicity in wheat

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1983-01-01

    Full Text Available Os cultivares Siete Cerros, tolerante, e BH-1146, sensível a elevadas doses de manganês, foram cruzados, obtendo-se sementes em gerações F1 e F2 desse cruzamento. As plantas dos cultivares pais e das gerações F1 e F2 foram cultivadas em soluções nutritivas contendo doses variadas de manganês (0,11; 300; 600 e 1.200mg/litro e testadas em outra solução nutritiva contendo 3mg/litro de alumínio. O comprimento das raízes primárias centrais das plantas dos genótipos estudados, após quinze dias de cultivo em soluções nutritivas contendo diferentes concentrações de manganês, serviu de base para avaliar a tolerância a esse elemento. Esse comprimento, após 72 horas de crescimento em solução nutritiva normal seguidas de 48 horas de crescimento em solução nutritiva contendo 3mg/litro de alumínio, foi utilizado para a avaliação da tolerância ao alumínio. Os valores da herdabilidade em sentido amplo para a tolerância a concentrações crescentes de manganês e para 3mg/litro de alumínio foram altos, indicando que grande parte da variabilidade encontrada nas populações segregantes para tolerância ao manganês e ao alumínio foram de origem genética, sugerindo que as seleções para estas características seriam efetivas a partir das gerações F2 e F3. Os dados mostraram que seria possível transferir, por meio de cruzamento entre os cultivares BH-1146 e Siete Cerros, a tolerância ao manganês do 'Siete Cerros' para o 'BH-1146' ou a tolerância ao alumínio deste para o 'Siete Cerros'.The cultivar Siete Cerros (P1 with tolerance to manganese toxicity and the cultivar BH-1146 (P2 showing sensitivity to manganese, were crossed. It was obtained the F1 and F2 generations of this cross. P1, P2, F1 and F2, where cultivated in nutrient solutions containing 0.11, 300, 600 and 1,200mg/l of manganese and they also were tested in other nutrient solution with 3mg/l of aluminum. The length of the central primary root of plants of each

  14. Over-expression of poplar transcription factor ERF76 gene confers salt tolerance in transgenic tobacco.

    Science.gov (United States)

    Yao, Wenjing; Wang, Lei; Zhou, Boru; Wang, Shengji; Li, Renhua; Jiang, Tingbo

    2016-07-01

    Ethylene response factors (ERFs) belong to a large plant-specific transcription factor family, which play a significant role in plant development and stress responses. Poplar ERF76 gene, a member of ERF TF family, can be up-regulated in response to salt stress, osmotic stress, and ABA treatment. The ERF76 protein was confirmed to be targeted preferentially in the nucleus of onion cell by particle bombardment. In order to understand the functions of ERF76 gene in salt stress response, we conducted temporal and spatial expression analysis of ERF76 gene in poplar. Then the ERF76 cDNA fragment containing an ORF was cloned from di-haploid Populus simonii×P. nigra and transferred into tobacco (Nicotiana tobacum) genome by Agrobacterium-mediated leaf disc method. Under salt stress, transgenic tobacco over-expressing ERF76 gene showed a significant increase in seed germination rate, plant height, root length, and fresh weight, as well as in relative water content (RWC), superoxide dismutase (SOD) activity, peroxidase (POD) activity, and proline content, compared to control tobacco lines. In contrast, transgenic tobacco lines displayed a decrease in malondialdehyde (MDA) accumulation, relative electrical conductivity (REC) and reactive oxygen species (ROS) accumulation in response to salt stress, compared to control tobacco lines. Over all, the results indicated that ERF76 gene plays a critical role in salt tolerance in transgenic tobacco. PMID:27123829

  15. An Na+/H+ antiporter gene from wheat plays an important role in stress tolerance

    Indian Academy of Sciences (India)

    Jia Ning Yu; Jian Huang; Zi Ning Wang; Jin Song Zhang; Shou Yi Chen

    2007-09-01

    A vacuole Na+/H+ antiporter gene TaNHX2 was obtained by screening the wheat cDNA library and by the 5′-RACE method. The expression of TaNHX2 was induced in roots and leaves by treatment with NaCl, polyethylene glycol (PEG), cold and abscisic acid (ABA). When expressed in a yeast mutant (nhx1), TaNHX2 suppressed the salt sensitivity of the mutant, which was deficient in vacuolar Na+/H+ antiporter, and caused partial recovery of growth of nhx1 in NaCl and LiCl media. The survival rate of yeast cells was improved by overexpressing the TaNHX2 gene under NaCl, KCl, sorbitol and freezing stresses when compared with the control. The results imply that TaNHX2 might play an important role in salt and osmotic stress tolerance in plant cells.

  16. Expression of betaine aldehyde dehydrogenase gene and salinity tolerance in rice transgenic plants

    Institute of Scientific and Technical Information of China (English)

    郭岩; 张莉; 肖岗; 曹守云; 谷冬梅; 田文忠; 陈受宜

    1997-01-01

    Betaine as one of osmolytes plays an important role in osmoregulation of most high plants. Betaine aldehyde dehydrogenase C BADH) is the second enzyme involved in betaine biosynthesis. The BADH gene from a halophite, Atriplex hortensis, was transformed into rice cultivars by bombarment method. Totally 192 transgenic rice plants were obtained and most of them had higher salt tolerance than controls. Among transgenic plants transplanted in the saline pool containing 0.5% NaCl in a greenhouse, 22 survived, 13 of which set seeds, and the frequency of seed setting was very low, only 10% . But the controls could not grow under the same condition. The results of BADH ac-tivity assay and Northern blot showed that the BADH gene was integrated into chromosomes of transgenic plants and expressed.

  17. Identification of quantitative trait loci and candidate genes for cadmium tolerance in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Goncho T. [West Virginia University; Yin, Tongming [ORNL; Zhang, Xinye [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Steven P [West Virginia University

    2012-01-01

    Understanding genetic variation for the response of Populus to heavy metals like cadmium (Cd) is an important step in elucidating the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa Torr. & Gray and Populus deltoides Bart. was characterized for growth and performance traits after Cd exposure. A total of 16 quantitative trait loci (QTL) at logarithm of odds (LOD) ratio 2.5 were detected for total dry weight, its components and root volume. Major QTL for Cd responses were mapped to two different linkage groups and the relative allelic effects were in opposing directions on the two chromosomes, suggesting differential mechanisms at these two loci. The phenotypic variance explained by Cd QTL ranged from 5.9 to 11.6% and averaged 8.2% across all QTL. A whole-genome microarray study led to the identification of nine Cd-responsive genes from these QTL. Promising candidates for Cd tolerance include an NHL repeat membrane-spanning protein, a metal transporter and a putative transcription factor. Additional candidates in the QTL intervals include a putative homolog of a glutamate cysteine ligase, and a glutathione-S-transferase. Functional characterization of these candidate genes should enhance our understanding of Cd metabolism and transport and phytoremediation capabilities of Populus.

  18. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    DEFF Research Database (Denmark)

    Bouchabke-Coussa, O.; Quashie, M.L.; Seoane, Jose Miguel;

    2008-01-01

    Background: Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying...... as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results: All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant......'s improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE), which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis...

  19. Determination of drought tolerance using root activities in Robinia pseudoacacia 'Idaho' transformed with mtl-D gene

    Institute of Scientific and Technical Information of China (English)

    Wang Hua-fang; Zhu Yi-hong; Sun Hai-jun

    2006-01-01

    Idaho locust (Robinia pseudoacacia 'Idaho') is an exotic multi-purpose tree used in landscaping, soil and water conservation, fodder sources and others. To improve its drought tolerance for reclaiming arid land, five lines of transformed mtl-D gene, as osmotic regulator in plant cells, have been selected and managed to determine their drought tolerance under experimental conditions.Qualitative and quantitative variables of transformed plants were studied. The critical value of drought tolerance was determined by detecting the 2,3,5-triphenyl tetrazolium chloride (TTC) reductants in roots and soil water content (SWC). The critical value for drought tolerance was SWC 6% while for the control plants the critical SWC was 8%; a moderate level of SWC is 13% and the highest SWC for plant endurance was 18%. The method proved to be reliable and sensitive in the evaluation of drought tolerance for forest trees.

  20. Overexpression of a Cytosolic Ascorbate Peroxidase Gene, OsAPX2, Increases Salt Tolerance in Transgenic Alfalfa

    Institute of Scientific and Technical Information of China (English)

    ZHANG Qian; MA Cui; XUE Xin; XU Ming; LI Jing; WU Jin-xia

    2014-01-01

    Alfalfa (Medicago sativa L.) is an important forage crop in the world and it is of great signiifcance for the improvement of its salt tolerance. To improve salt tolerance in alfalfa, a rice ascorbate peroxidase gene (OsAPX2) was introduced into alfalfa using Agrobacterium tumefaciens-mediated transformation with marker gene bar. The different T-DNA insertions in T1 transgenic alfalfa were identiifed by Southern hybridization. Three independent T2 transgenic lines were selected for stress analysis and the results showed that all of them were salt tolerant compared with wild-type plants. The transgenic plants had low levels of H2O2, malondialdehyde and relative electrical conductivity under salt and drought stresses. Moreover, the contents of chlorophyll and proline, and APX activity were high in transgenic plants under salt and drought stresses. Taken together, the overexpression of OsAPX2 enhances salt tolerance in alfalfa through scavenging reactive oxygen species.

  1. Arabidopsis Vacuolar Pyrophosphatase gene (AVP1) induces drought and salt tolerance in Nicotiana tabacum plants (abstract)

    International Nuclear Information System (INIS)

    Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na

  2. Mapping of STS markers developed from drought tolerance candidate genes and preliminary analysis of their association with yield-related traits in common wheat (Triticum aestivum)

    Science.gov (United States)

    Drought is a severe abiotic stress that affects wheat production worldwide. In order to identify candidate genes for tolerance to water stress in wheat, sequences of 11 genes that have function of drought tolerance in other plant species were used to identify the wheat ortholog genes via homology se...

  3. Gene expression analysis of copper tolerance and wood decay in the brown rot fungus Fibroporia radiculosa.

    Science.gov (United States)

    Tang, Juliet D; Parker, Leslie A; Perkins, Andy D; Sonstegard, Tad S; Schroeder, Steven G; Nicholas, Darrel D; Diehl, Susan V

    2013-03-01

    High-throughput transcriptomics was used to identify Fibroporia radiculosa genes that were differentially regulated during colonization of wood treated with a copper-based preservative. The transcriptome was profiled at two time points while the fungus was growing on wood treated with micronized copper quat (MCQ). A total of 917 transcripts were differentially expressed. Fifty-eight of these genes were more highly expressed when the MCQ was protecting the wood from strength loss and had putative functions related to oxalate production/degradation, laccase activity, quinone biosynthesis, pectin degradation, ATP production, cytochrome P450 activity, signal transduction, and transcriptional regulation. Sixty-one genes were more highly expressed when the MCQ lost its effectiveness (>50% strength loss) and had functions related to oxalate degradation; cytochrome P450 activity; H(2)O(2) production and degradation; degradation of cellulose, hemicellulose, and pectin; hexose transport; membrane glycerophospholipid metabolism; and cell wall chemistry. Ten of these differentially regulated genes were quantified by reverse transcriptase PCR for a more in-depth study (4 time points on wood with or without MCQ treatment). Our results showed that MCQ induced higher than normal levels of expression for four genes (putative annotations for isocitrate lyase, glyoxylate dehydrogenase, laccase, and oxalate decarboxylase 1), while four other genes (putative annotations for oxalate decarboxylase 2, aryl alcohol oxidase, glycoside hydrolase 5, and glycoside hydrolase 10) were repressed. The significance of these results is that we have identified several genes that appear to be coregulated, with putative functions related to copper tolerance and/or wood decay. PMID:23263965

  4. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum) Seedlings and Identification of Salt Tolerance Genes

    OpenAIRE

    Liu, Jiangtao; Zhou, Yuelong; Luo, Changxin; Xiang, Yun; An, Lizhe

    2016-01-01

    Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS) technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf...

  5. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage

    OpenAIRE

    Guo, P; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R; Von Korff, M; Varshney, R.,; Graner, A.; Valkoun, V.

    2009-01-01

    Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas worldwide. Identification of the genes responsible for drought tolerance in barley (Hordeum vulgare L.) will facilitate understanding of the molecular mechanisms of drought tolerance, and also facilitate the genetic improvement of barley through marker-assisted selection or gene transformation. To monitor the changes in gene expression at the transcriptional level in barley leaves during the repro...

  6. The essential role of the Deinococcus radiodurans ssb gene in cell survival and radiation tolerance.

    Directory of Open Access Journals (Sweden)

    J Scott Lockhart

    Full Text Available Recent evidence has implicated single-stranded DNA-binding protein (SSB expression level as an important factor in microbial radiation resistance. The genome of the extremely radiation resistant bacterium Deinococcus radiodurans contains genes for two SSB homologs: the homodimeric, canonical Ssb, encoded by the gene ssb, and a novel pentameric protein encoded by the gene ddrB. ddrB is highly induced upon exposure to radiation, and deletions result in decreased radiation-resistance, suggesting an integral role of the protein in the extreme resistance exhibited by this organism. Although expression of ssb is also induced after irradiation, Ssb is thought to be involved primarily in replication. In this study, we demonstrate that Ssb in D. radiodurans is essential for cell survival. The lethality of an ssb deletion cannot be complemented by providing ddrB in trans. In addition, the radiation-sensitive phenotype conferred by a ddrB deletion is not alleviated by providing ssb in trans. By altering expression of the ssb gene, we also show that lower levels of transcription are required for optimal growth than are necessary for high radiation resistance. When expression is reduced to that of E. coli, ionizing radiation resistance is similarly reduced. UV resistance is also decreased under low ssb transcript levels where growth is unimpaired. These results indicate that the expression of ssb is a key component of both normal cellular metabolism as well as pathways responsible for the high radiation tolerance of D. radiodurans.

  7. Differential gene expression in salt-tolerant rice mutant and its parental variety

    Institute of Scientific and Technical Information of China (English)

    张劲松; 周骏马; 张驰; 陈受宜

    1996-01-01

    The differential expressions of three genes rbcL, salT and rab!6 in response to ABA, NaCl, PEG and heat shock were investigated in seedlings of a salt-tolerant rice mutant 20 (mutant 20) and its parental variety Oryza sativa var. japonica 77-170(170). By Northern blot analysis it was found that ABA induced the expression of all three genes of rbcL, salT and rab16 in shoots and roots of both 170 and mutant 20 with the exceptions of rab16 in shoots of mutant 20 and rbcL in roots of 170. Lower concentrations of NaCl induced rbcL expression in shoots of mutant 20 but not 170. Higher concentrations of NaCl decreased rbcL expression but induced expressions of salT and rab16 in shoots of both 170 and mutant 20. PEG(15%) and 37℃ heat shock showed almost no effects on the expression of the three genes in mutant 20. However, they caused a decrease in rbcL expression and slight induction of the rab16 gene in 170, with salT expression unaffected. These results indicated that mutant 20 was relatively less responsiv

  8. Molecular approaches unravel the mechanism of acid soil tolerance in plants

    Institute of Scientific and Technical Information of China (English)

    Miao; Bian; Meixue; Zhou; Dongfa; Sun; Chengdao; Li

    2013-01-01

    Acid soil is a worldwide problem to plant production. Acid toxicity is mainly caused by a lack of essential nutrients in the soil and excessive toxic metals in the plant root zone. Of the toxic metals, aluminum(Al) is the most prevalent and most toxic. Plant species have evolved to variable levels of tolerance to aluminum enabling breeding of high Al-tolerant cultivars.Physiological and molecular approaches have revealed some mechanisms of Al toxicity in higher plants. Mechanisms of plant tolerance to Al stress include: 1) exclusion of Al from the root tips, and 2) absorbance, but tolerance of Al in root cells. Organic acid exudation to chelate Al is a feature shared by many higher plants. The future challenge for Al tolerance studies is the identification of novel tolerance mechanisms and the combination of different mechanisms to achieve higher tolerance. Molecular approaches have led to significant progress in explaining mechanisms and detection of genes responsible for Al tolerance.Gene-specific molecular markers offer better options for marker-assisted selection in breeding programs than linked marker strategies. This paper mainly focuses on recent progress in the use of molecular approaches in Al tolerance research.

  9. Genome-wide screening of Saccharomyces cerevisiae genes required to foster tolerance towards industrial wheat straw hydrolysates.

    Science.gov (United States)

    Pereira, Francisco B; Teixeira, Miguel C; Mira, Nuno P; Sá-Correia, Isabel; Domingues, Lucília

    2014-12-01

    The presence of toxic compounds derived from biomass pre-treatment in fermentation media represents an important drawback in second-generation bio-ethanol production technology and overcoming this inhibitory effect is one of the fundamental challenges to its industrial production. The aim of this study was to systematically identify, in industrial medium and at a genomic scale, the Saccharomyces cerevisiae genes required for simultaneous and maximal tolerance to key inhibitors of lignocellulosic fermentations. Based on the screening of EUROSCARF haploid mutant collection, 242 and 216 determinants of tolerance to inhibitory compounds present in industrial wheat straw hydrolysate (WSH) and in inhibitor-supplemented synthetic hydrolysate were identified, respectively. Genes associated to vitamin metabolism, mitochondrial and peroxisomal functions, ribosome biogenesis and microtubule biogenesis and dynamics are among the newly found determinants of WSH resistance. Moreover, PRS3, VMA8, ERG2, RAV1 and RPB4 were confirmed as key genes on yeast tolerance and fermentation of industrial WSH. PMID:25287021

  10. PpCBF3 from Cold-Tolerant Kentucky Bluegrass Involved in Freezing Tolerance Associated with Up-Regulation of Cold-Related Genes in Transgenic Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Lili Zhuang

    Full Text Available Dehydration-Responsive Element Binding proteins (DREB/C-repeat (CRT Binding Factors (CBF have been identified as transcriptional activators during plant responses to cold stress. The objective of this study was to determine the physiological roles of a CBF gene isolated from a cold-tolerant perennial grass species, Kentucky bluegrass (Poa pratensis L., which designated as PpCBF3, in regulating plant tolerance to freezing stress. Transient transformation of Arabidopsis thaliana mesophyll protoplast with PpCBF3-eGFP fused protein showed that PpCBF3 was localized to the nucleus. RT-PCR analysis showed that PpCBF3 was specifically induced by cold stress (4°C but not by drought stress [induced by 20% polyethylene glycol 6000 solution (PEG-6000] or salt stress (150 mM NaCl. Transgenic Arabidopsis overexpressing PpCBF3 showed significant improvement in freezing (-20°C tolerance demonstrated by a lower percentage of chlorotic leaves, lower cellular electrolyte leakage (EL and H2O2 and O2.- content, and higher chlorophyll content and photochemical efficiency compared to the wild type. Relative mRNA expression level analysis by qRT-PCR indicated that the improved freezing tolerance of transgenic Arabidopsis plants overexpressing PpCBF3 was conferred by sustained activation of downstream cold responsive (COR genes. Other interesting phenotypic changes in the PpCBF3-transgenic Arabidopsis plants included late flowering and slow growth or 'dwarfism', both of which are desirable phenotypic traits for perennial turfgrasses. Therefore, PpCBF3 has potential to be used in genetic engineering for improvement of turfgrass freezing tolerance and other desirable traits.

  11. A pepper MSRB2 gene confers drought tolerance in rice through the protection of chloroplast-targeted genes.

    Directory of Open Access Journals (Sweden)

    Joung Sug Kim

    Full Text Available The perturbation of the steady state of reactive oxygen species (ROS due to biotic and abiotic stresses in a plant could lead to protein denaturation through the modification of amino acid residues, including the oxidation of methionine residues. Methionine sulfoxide reductases (MSRs catalyze the reduction of methionine sulfoxide back to the methionine residue. To assess the role of this enzyme, we generated transgenic rice using a pepper CaMSRB2 gene under the control of the rice Rab21 (responsive to ABA protein 21 promoter with/without a selection marker, the bar gene.A drought resistance test on transgenic plants showed that CaMSRB2 confers drought tolerance to rice, as evidenced by less oxidative stress symptoms and a strengthened PSII quantum yield under stress conditions, and increased survival rate and chlorophyll index after the re-watering. The results from immunoblotting using a methionine sulfoxide antibody and nano-LC-MS/MS spectrometry suggest that porphobilinogen deaminase (PBGD, which is involved in chlorophyll synthesis, is a putative target of CaMSRB2. The oxidized methionine content of PBGD expressed in E. coli increased in the presence of H2O2, and the Met-95 and Met-227 residues of PBGD were reduced by CaMSRB2 in the presence of dithiothreitol (DTT. An expression profiling analysis of the overexpression lines also suggested that photosystems are less severely affected by drought stress.Our results indicate that CaMSRB2 might play an important functional role in chloroplasts for conferring drought stress tolerance in rice.

  12. Systems biology analysis of gene expression during in vivo Mycobacterium avium paratuberculosis enteric colonization reveals role for immune tolerance.

    Directory of Open Access Journals (Sweden)

    Sangeeta Khare

    Full Text Available Survival and persistence of Mycobacterium avium subsp. paratuberculosis (MAP in the intestinal mucosa is associated with host immune tolerance. However, the initial events during MAP interaction with its host that lead to pathogen survival, granulomatous inflammation, and clinical disease progression are poorly defined. We hypothesize that immune tolerance is initiated upon initial contact of MAP with the intestinal Peyer's patch. To test our hypothesis, ligated ileal loops in neonatal calves were infected with MAP. Intestinal tissue RNAs were collected (0.5, 1, 2, 4, 8 and 12 hrs post-infection, processed, and hybridized to bovine gene expression microarrays. By comparing the gene transcription responses of calves infected with the MAP, informative complex patterns of expression were clearly visible. To interpret these complex data, changes in the gene expression were further analyzed by dynamic Bayesian analysis, and genes were grouped into the specific pathways and gene ontology categories to create a holistic model. This model revealed three different phases of responses: i early (30 min and 1 hr post-infection, ii intermediate (2, 4 and 8 hrs post-infection, and iii late (12 hrs post-infection. We describe here the data that include expression profiles for perturbed pathways, as well as, mechanistic genes (genes predicted to have regulatory influence that are associated with immune tolerance. In the Early Phase of MAP infection, multiple pathways were initiated in response to MAP invasion via receptor mediated endocytosis and changes in intestinal permeability. During the Intermediate Phase, perturbed pathways involved the inflammatory responses, cytokine-cytokine receptor interaction, and cell-cell signaling. During the Late Phase of infection, gene responses associated with immune tolerance were initiated at the level of T-cell signaling. Our study provides evidence that MAP infection resulted in differentially regulated genes, perturbed

  13. Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene.

    Science.gov (United States)

    Zhao, Qi-chao; Liu, Ming-hong; Zhang, Xian-wen; Lin, Chao-yang; Zhang, Qing; Shen, Zhi-cheng

    2015-10-01

    Insect resistance and glyphosate tolerance have been two of the most important traits in the genetic improvement of various crops. In this study, two Bacillus thuringiensis (Bt) insecticidal genes, Cry1Ac and Cry1Ig, and a modified glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene (G10) were combined into a single transferred DNA (T-DNA) fragment and introduced into rice by Agrobacterium-mediated transformation. A transgenic line with single-copy T-DNA insertion named GAI-14 was found to be highly resistant to striped stem borer and rice leaf roller, and tolerant to glyphosate. Analysis of T-DNA border sequence suggested that the transgenes were inserted at the chromosome 3 and appeared to have not interrupted any known or putative genes. A field trial observed no significant difference in the basic agronomic traits between GAI-14 and the recipient rice.

  14. Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Shiyi Zhou

    Full Text Available Aquaporin (AQP proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high water channel activity in Xenopus laevis oocytes and TaAQP7 transcript was induced by dehydration, and treatments with polyethylene glycol (PEG, abscisic acid (ABA and H(2O(2. Further, TaAQP7 was upregulated after PEG treatment and was blocked by inhibitors of ABA biosynthesis, implying that ABA signaling was involved in the upregulation of TaAQP7 after PEG treatment. Overexpression of TaAQP7 increased drought tolerance in tobacco. The transgenic tobacco lines had lower levels of malondialdehyde (MDA and H(2O(2, and less ion leakage (IL, but higher relative water content (RWC and superoxide dismutase (SOD and catalase (CAT activities when compared with the wild type (WT under drought stress. Taken together, our results show that TaAQP7 confers drought stress tolerance in transgenic tobacco by increasing the ability to retain water, reduce ROS accumulation and membrane damage, and enhance the activities of antioxidants.

  15. Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco.

    Science.gov (United States)

    Zhou, Shiyi; Hu, Wei; Deng, Xiaomin; Ma, Zhanbing; Chen, Lihong; Huang, Chao; Wang, Chen; Wang, Jie; He, Yanzhen; Yang, Guangxiao; He, Guangyuan

    2012-01-01

    Aquaporin (AQP) proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high water channel activity in Xenopus laevis oocytes and TaAQP7 transcript was induced by dehydration, and treatments with polyethylene glycol (PEG), abscisic acid (ABA) and H(2)O(2). Further, TaAQP7 was upregulated after PEG treatment and was blocked by inhibitors of ABA biosynthesis, implying that ABA signaling was involved in the upregulation of TaAQP7 after PEG treatment. Overexpression of TaAQP7 increased drought tolerance in tobacco. The transgenic tobacco lines had lower levels of malondialdehyde (MDA) and H(2)O(2), and less ion leakage (IL), but higher relative water content (RWC) and superoxide dismutase (SOD) and catalase (CAT) activities when compared with the wild type (WT) under drought stress. Taken together, our results show that TaAQP7 confers drought stress tolerance in transgenic tobacco by increasing the ability to retain water, reduce ROS accumulation and membrane damage, and enhance the activities of antioxidants. PMID:23285044

  16. Transgenic barley overexpressing a cytokinin dehydrogenase gene shows greater tolerance to drought stress.

    Science.gov (United States)

    Pospíšilová, Hana; Jiskrová, Eva; Vojta, Petr; Mrízová, Katarína; Kokáš, Filip; Čudejková, Mária Majeská; Bergougnoux, Veronique; Plíhal, Ondřej; Klimešová, Jana; Novák, Ondřej; Dzurová, Lenka; Frébort, Ivo; Galuszka, Petr

    2016-09-25

    Together with auxins, cytokinins are the main plant hormones involved in many different physiological processes. Given this knowledge, cytokinin levels can be manipulated by genetic modification in order to improve agronomic parameters of cereals in relation to, for example, morphology, yield, and tolerance to various stresses. The barley (Hordeum vulgare) cultivar Golden Promise was transformed using the cytokinin dehydrogenase 1 gene from Arabidopsis thaliana (AtCKX1) under the control of mild root-specific β-glucosidase promoter from maize. Increased cytokinin degradation activity was observed positively to affect the number and length of lateral roots. The impact on morphology depended upon the recombinant protein's subcellular compartmentation. While assumed cytosolic and vacuolar targeting of AtCKX1 had negligible effect on shoot growth, secretion of AtCKX1 protein to the apoplast had a negative effect on development of the aerial part and yield. Upon the application of severe drought stress, all transgenic genotypes maintained higher water content and showed better growth and yield parameters during revitalization. Higher tolerance to drought stress was most caused by altered root morphology resulting in better dehydration avoidance. PMID:26773738

  17. Arabidopsis LOS5 Gene Enhances Chilling and Salt Stress Tolerance in Cucumber

    Institute of Scientific and Technical Information of China (English)

    LIU Li-ying; DUAN Liu-sheng; ZHANG Jia-chang; MI Guo-quan; ZHANG Xiao-lan; ZHANG Zhen-xian; REN Hua-zhong

    2013-01-01

    Low temperature and high salinity are the major abiotic stresses that restrict cucumber growth and production, breeding materials with multiple abiotic resistance are in greatly need. Here we investigated the effect of introducing the LOS5 gene, a key regulator of ABA biosynthesis in Arabidopsis thaliana, under the stress-responsive RD29A promoter into cucumber (Cucumis sativus L. cv. S516). We found that T1 RD29A-LOS5 transgenic lines have enhanced tolerance to cold and salt stresses. Specifically, transgenic lines exhibited dwarf phenotypes with reduced leaf number, shorter internode, decreased length of the biggest leaf, fewer female flowers, shorter fruit neck and lower vitamin C (Vc). The increased cold tolerance can be reflected from the significantly decreased cold index, the reduced electrolyte leakage index and the MDA content upon cold treatment as compared to those in the control. This may result from the accumulation of internal ABA, soluble sugars and proline, and the enhanced activities of protective enzymes superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) in the transgenic lines. Under salt treatment, the transgenic lines exhibited increased germination index, vigor index, more lateral roots and increased root fresh weight. Moreover, RD29A-LOS5 transgenic plants displayed quicker responses in salt stress than that in low-temperature stress.

  18. Genome-wide functional profiling reveals genes required for tolerance to benzene metabolites in yeast.

    Directory of Open Access Journals (Sweden)

    Matthew North

    Full Text Available Benzene is a ubiquitous environmental contaminant and is widely used in industry. Exposure to benzene causes a number of serious health problems, including blood disorders and leukemia. Benzene undergoes complex metabolism in humans, making mechanistic determination of benzene toxicity difficult. We used a functional genomics approach to identify the genes that modulate the cellular toxicity of three of the phenolic metabolites of benzene, hydroquinone (HQ, catechol (CAT and 1,2,4-benzenetriol (BT, in the model eukaryote Saccharomyces cerevisiae. Benzene metabolites generate oxidative and cytoskeletal stress, and tolerance requires correct regulation of iron homeostasis and the vacuolar ATPase. We have identified a conserved bZIP transcription factor, Yap3p, as important for a HQ-specific response pathway, as well as two genes that encode putative NAD(PH:quinone oxidoreductases, PST2 and YCP4. Many of the yeast genes identified have human orthologs that may modulate human benzene toxicity in a similar manner and could play a role in benzene exposure-related disease.

  19. Use of Heat Stress Responsive Gene Expression Levels for Early Selection of Heat Tolerant Cabbage (Brassica oleracea L.

    Directory of Open Access Journals (Sweden)

    Jun Cheul Ahn

    2013-06-01

    Full Text Available Cabbage is a relatively robust vegetable at low temperatures. However, at high temperatures, cabbage has disadvantages, such as reduced disease tolerance and lower yields. Thus, selection of heat-tolerant cabbage is an important goal in cabbage breeding. Easier or faster selection of superior varieties of cabbage, which are tolerant to heat and disease and have improved taste and quality, can be achieved with molecular and biological methods. We compared heat-responsive gene expression between a heat-tolerant cabbage line (HTCL, “HO”, and a heat-sensitive cabbage line (HSCL, “JK”, by Genechip assay. Expression levels of specific heat stress-related genes were increased in response to high-temperature stress, according to Genechip assays. We performed quantitative RT-PCR (qRT-PCR to compare expression levels of these heat stress-related genes in four HTCLs and four HSCLs. Transcript levels for heat shock protein BoHsp70 and transcription factor BoGRAS (SCL13 were more strongly expressed only in all HTCLs compared to all HSCLs, showing much lower level expressions at the young plant stage under heat stress (HS. Thus, we suggest that expression levels of these genes may be early selection markers for HTCLs in cabbage breeding. In addition, several genes that are involved in the secondary metabolite pathway were differentially regulated in HTCL and HSCL exposed to heat stress.

  20. Protein-protein interaction studies revealed genes associated with plant disease resistance and drought tolerance (abstract)

    International Nuclear Information System (INIS)

    Under natural conditions, plants are frequently subjected to biotic and abiotic constraints that cause considerable damage and limit plant productivity worldwide. Biotic and abiotic stresses results in the accumulation of Reactive Oxygen Species, ROS (H/sub 2/O/sub 2/, O/sub 2/), Nitric oxide (NO) and cytosolic calcium (Ca/sup 2), indicating that plant responses to diseases and drought may operate, at least in part, through common molecular pathways. Additionally, stress-inducible genes have been categorized in two different groups: (a) genes that directly protect against environmental stresses and (b) genes that encode protein kinases intriguingly, protein kinases are also involved in disease resistance since many resistance genes (R genes) are in fact kinases. Here, we describe an interactor hunt using the bacterial virulent gene, VirPphA as a bait to screen an Arabidopsis thaliana cDNA prey library. VirPpha shares sequence similarity with another type III effector protein. AvrPtoB. The screen, originally designed to search for key signaling components involved in disease resistance, identified several putative and promising interactors (2-cys peroxiredoxin-like protein, kinase-like protein and ER6 protein, which is a universal stress protein) that might be involved in both biotic and abiotic stress responses. Simultaneously, another screen using AvrPtoB as a bait was conducted searching the same library for common interactors. Fibrillin (Fibri, At4g04020) was identified in both screens indicating a possible involvement in plant disease resistance through its influence on the plant cytoskeleton, which has been implicated in localized defence response. Furthermore, At4g04020 is 82% similar to the Rice fibrillin, At4g22240, which was recently shown to interact the, rice SGT1 (OsSGT1). SGT1 is a gene that is required for multiple R-gene function. Using the yeast two-hybrid system, fibrillin was found to interact strongly with all VirPphA homologues identified in

  1. Saturation mapping of QTL regions and identification of putative candidate genes for drought tolerance in rice.

    Science.gov (United States)

    Nguyen, T T T; Klueva, N; Chamareck, V; Aarti, A; Magpantay, G; Millena, A C M; Pathan, M S; Nguyen, H T

    2004-08-01

    We have developed 85 new markers (50 RFLPs, 5 SSRs, 12 DD cDNAs, 9 ESTs, 8 HSP-encoding cDNAs and one BSA-derived AFLP marker) for saturation mapping of QTL regions for drought tolerance in rice, in our efforts to identify putative candidate genes. Thirteen of the markers were localized in the close vicinity of the targeted QTL regions. Fifteen of the additional markers mapped, respectively, inside one QTL region controlling osmotic adjustment on chromosome 3 ( oa3.1) and 14 regions that affect root traits on chromosomes 1, 2, 4, 5, 6, 7, 8, 9, 10 and 12. Differential display was used to identify more putative candidate genes and to saturate the QTL regions of the genetic map. Eleven of the isolated cDNA clones were found to be derived from drought-inducible genes. Two of them were unique and did not match any genes in the GenBank, while nine were highly similar to cDNAs encoding known proteins, including a DnaJ-related protein, a zinc-finger protein, a protease inhibitor, a glutathione-S-transferase, a DNA recombinase, and a protease. Twelve new cDNA fragments were mapped onto the genetic linkage map; seven of these mapped inside, or in close proximity to, the targeted QTL regions determining root thickness and osmotic adjustment capacity. The gene I12A1, which codes for a UDP-glucose 4-epimerase homolog, was identified as a putative target gene within the prt7.1/brt7.1 QTL region, as it is involved in the cell wall biogenesis pathway and hence may be implicated in modulating the ability of rice roots to penetrate further into the substratum when exposed to drought conditions. RNAs encoding elongation factor 1beta, a DnaJ-related protein, and a homolog of wheat zinc-finger protein were more prominently induced in the leaves of IR62266 (the lowland rice parent of the mapping materials used) than in those of CT9993 (the upland rice parent) under drought conditions. Homologs of 18S ribosomal RNA, and mRNAs for a multiple-stress induced zinc-finger protein, a protease

  2. Transient B cell depletion or improved transgene expression by codon optimization promote tolerance to factor VIII in gene therapy.

    Directory of Open Access Journals (Sweden)

    Brandon K Sack

    Full Text Available The major complication in the treatment of hemophilia A is the development of neutralizing antibodies (inhibitors against factor VIII (FVIII. The current method for eradicating inhibitors, termed immune tolerance induction (ITI, is costly and protracted. Clinical protocols that prevent rather than treat inhibitors are not yet established. Liver-directed gene therapy hopes to achieve long-term correction of the disease while also inducing immune tolerance. We sought to investigate the use of adeno-associated viral (serotype 8 gene transfer to induce tolerance to human B domain deleted FVIII in hemophilia A mice. We administered an AAV8 vector with either human B domain deleted FVIII or a codon-optimized transgene, both under a liver-specific promoter to two strains of hemophilia A mice. Protein therapy or gene therapy was given either alone or in conjunction with anti-CD20 antibody-mediated B cell depletion. Gene therapy with a low-expressing vector resulted in sustained near-therapeutic expression. However, supplementary protein therapy revealed that gene transfer had sensitized mice to hFVIII in a high-responder strain but not in mice of a low-responding strain. This heightened response was ameliorated when gene therapy was delivered with anti-murine CD20 treatment. Transient B cell depletion prevented inhibitor formation in protein therapy, but failed to achieve a sustained hypo-responsiveness. Importantly, use of a codon-optimized hFVIII transgene resulted in sustained therapeutic expression and tolerance without a need for B cell depletion. Therefore, anti-CD20 may be beneficial in preventing vector-induced immune priming to FVIII, but higher levels of liver-restricted expression are preferred for tolerance.

  3. bHLH106 Integrates Functions of Multiple Genes through Their G-Box to Confer Salt Tolerance on Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Aftab Ahmad

    Full Text Available An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8 as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'. The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.

  4. Tolerância de genótipos de trigo comum, trigo duro e triticale à toxicidade de alumínio em soluções nutritivas Tolerance of bread wheat, durum wheat and triticale genotypes to aluminum toxicity in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    2006-01-01

    Full Text Available Foi estudado o comportamento diferencial de 12 genótipos de trigo comum (Triticum aestivum L., um genótipo de trigo duro (Triticum durum L., e um de triticale (Triticosecale sp em soluções nutritivas de tratamento contendo duas concentrações salinas (1/5 e 1/10 da completa e seis concentrações de alumínio ( 0, 2, 4, 6, 8 e 10 mg L-1, à temperatura de 25 ± 1ºC e pH 4,0. Foram utilizadas dez plântulas por parcela e quatro repetições. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após permanecer 48 horas em solução nutritiva completa, contendo uma concentração conhecida de alumínio combinada com cada uma das concentrações salinas. Os genótipos de trigo comum IAC-289, IAC-350 e IAC-370 e a cultivar controle Anahuac, e os genótipos de trigo duro IAC-1003 e de triticale IAC-5 foram os mais sensíveis a níveis crescentes de Al3+nas soluções nutritivas de tratamento e, portanto, somente seriam indicados para cultivo em solos corrigidos. Os genótipos de trigo comum IAC-24 e IAC-378 e a cultivar controle BH-1146 destacaram-se pela tolerância à toxicidade de Al3+, com potencial para uso em solos ácidos e como fontes genéticas de tolerância nos futuros cruzamentos. Os sintomas de toxicidade de alumínio foram maiores com a elevação da concentração de alumínio e da diminuição das concentrações de sais da solução nutritiva para todos os genótipos estudados.Twelve bread wheat (Triticum aestivum L., one durum wheat (Triticum durum L. and one triticale (Triticosecale sp genotypes were studied in nutrient solutions with a high salt concentration in experiment 1 and a weak salt concentration in experiment 2, for aluminum tolerance at six levels: 0, 2, 4, 6, 8 and 10 mg L-1, under temperature 25 ± 1ºC and pH 4,0. Four replications were used per experiment. Aluminum tolerance was evaluated by measuring root growth in an aluminum-free complete

  5. A novel gene, lstC, of Listeria monocytogenes is implicated in high salt tolerance.

    Science.gov (United States)

    Burall, Laurel S; Simpson, Alexandra C; Chou, Luoth; Laksanalamai, Pongpan; Datta, Atin R

    2015-06-01

    Listeria monocytogenes, causative agent of human listeriosis, has been isolated from a wide variety of foods including deli meats, soft cheeses, cantaloupes, sprouts and canned mushrooms. Standard control measures for restricting microbial growth such as refrigeration and high salt are often inadequate as L. monocytogenes grows quite well in these environments. In an effort to better understand the genetic and physiological basis by which L. monocytogenes circumvents these controls, a transposon library of L. monocytogenes was screened for changes in their ability to grow in 7% NaCl and/ or at 5 °C. This work identified a transposon insertion upstream of an operon, here named lstABC, that led to a reduction in growth in 7% NaCl. In-frame deletion studies identified lstC which codes for a GNAT-acetyltransferase being responsible for the phenotype. Transcriptomic and RT-PCR analyses identified nine genes that were upregulated in the presence of high salt in the ΔlstC mutant. Further analysis of lstC and the genes affected by ΔlstC is needed to understand LstC's role in salt tolerance. PMID:25790994

  6. Overexpression of WsSGTL1 gene of Withania somnifera enhances salt tolerance, heat tolerance and cold acclimation ability in transgenic Arabidopsis plants.

    Directory of Open Access Journals (Sweden)

    Manoj K Mishra

    Full Text Available BACKGROUND: Sterol glycosyltrnasferases (SGT are enzymes that glycosylate sterols which play important role in plant adaptation to stress and are medicinally important in plants like Withania somnifera. The present study aims to find the role of WsSGTL1 which is a sterol glycosyltransferase from W. somnifera, in plant's adaptation to abiotic stress. METHODOLOGY: The WsSGTL1 gene was transformed in Arabidopsis thaliana through Agrobacterium mediated transformation, using the binary vector pBI121, by floral dip method. The phenotypic and physiological parameters like germination, root length, shoot weight, relative electrolyte conductivity, MDA content, SOD levels, relative electrolyte leakage and chlorophyll measurements were compared between transgenic and wild type Arabidopsis plants under different abiotic stresses--salt, heat and cold. Biochemical analysis was done by HPLC-TLC and radiolabelled enzyme assay. The promoter of the WsSGTL1 gene was cloned by using Genome Walker kit (Clontech, USA and the 3D structures were predicted by using Discovery Studio Ver. 2.5. RESULTS: The WsSGTL1 transgenic plants were confirmed to be single copy by Southern and homozygous by segregation analysis. As compared to WT, the transgenic plants showed better germination, salt tolerance, heat and cold tolerance. The level of the transgene WsSGTL1 was elevated in heat, cold and salt stress along with other marker genes such as HSP70, HSP90, RD29, SOS3 and LEA4-5. Biochemical analysis showed the formation of sterol glycosides and increase in enzyme activity. When the promoter of WsSGTL1 gene was cloned from W. somnifera and sequenced, it contained stress responsive elements. Bioinformatics analysis of the 3D structure of the WsSGTL1 protein showed functional similarity with sterol glycosyltransferase AtSGT of A. thaliana. CONCLUSIONS: Transformation of WsSGTL1 gene in A. thaliana conferred abiotic stress tolerance. The promoter of the gene in W.somnifera was found

  7. The hangover gene defines a stress pathway required for ethanol tolerance development

    OpenAIRE

    Scholz, Henrike; Franz, Mirjam; Heberlein, Ulrike

    2005-01-01

    Repeated alcohol consumption leads to the development of tolerance, simply defined as an acquired resistance to the physiological and behavioral effects of the drug. This tolerance allows increased alcohol consumption, which over time leads to physical dependence and possibly addiction1–3. Previous studies showed that Drosophila develop ethanol tolerance with kinetics of acquisition and dissipation that mimic those seen in mammals. This tolerance requires the catecholamine octopamine, the fun...

  8. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    Directory of Open Access Journals (Sweden)

    Yu Agnes

    2008-12-01

    Full Text Available Abstract Background Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying potential targets for plant breeding. Drought tolerance in the field was successfully conferred to crops by transferring genes from this model species. While involved in a plant genomics programme, which aims to identify new genes responsible for plant response to abiotic stress, we identified ESKIMO1 as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE, which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis of one mutant line and its wild-type background was carried out. Under control watering conditions a number of genes were differentially expressed between the mutant and the wild type whereas under mild drought stress this list of genes was reduced. Among the genes that were differentially expressed between the wild type and mutant, two functional categories related to the response to stress or biotic and abiotic stimulus were over-represented. Under salt stress conditions, all gene functional categories were represented equally in both the mutant and wild type. Based on this transcriptome analysis we hypothesise that in control conditions the esk1 mutant behaves as if it was exposed to drought stress. Conclusion Overall our findings suggest that the

  9. Gene expression and functional analyses in brassinosteroid-mediated stress tolerance.

    Science.gov (United States)

    Divi, Uday K; Rahman, Tawhidur; Krishna, Priti

    2016-01-01

    The plant hormone brassinosteroid (BR) plays essential roles in plant growth and development, while also controlling plant stress responses. This dual ability of BR is intriguing from a mechanistic point of view and as a viable solution for stabilizing crop yields under the changing climatic conditions. Here we report a time course analysis of BR responses under both stress and no-stress conditions, the results of which establish that BR incorporates many stress-related features even under no-stress conditions, which are then accompanied by a dynamic stress response under unfavourable conditions. Found within the BR transcriptome were distinct molecular signatures of two stress hormones, abscisic acid and jasmonic acid, which were correlated with enhanced endogenous levels of the two hormones in BR-treated seedlings. The marked presence of genes related to protein metabolism and modification, defence responses and calcium signalling highlights the significance of their associated mechanisms and roles in BR processes. Functional analysis of loss-of-function mutants of a subset of genes selected from the BR transcriptome identified abiotic stress-related roles for ACID PHOSPHATASE5 (ACP5), WRKY33, JACALIN-RELATED LECTIN1-3 (JAC-LEC1-3) and a BR-RESPONSIVE-RECEPTOR-LIKE KINASE (BRRLK). Overall, the results of this study provide a clear link between the molecular changes impacted by BR and its ability to confer broad-range stress tolerance, emphasize the importance of post-translational modification and protein turnover as BR regulatory mechanisms and demonstrate the BR transcriptome as a repertoire of new stress-related regulatory and structural genes.

  10. A single gene all3940 (Dps) overexpression in Anabaena sp. PCC 7120 confers multiple abiotic stress tolerance via proteomic alterations.

    Science.gov (United States)

    Narayan, Om Prakash; Kumari, Nidhi; Bhargava, Poonam; Rajaram, Hema; Rai, Lal Chand

    2016-01-01

    DNA-binding proteins (Dps) induced during starvation play an important role in gene regulation and maintaining homeostasis in bacteria. The nitrogen-fixing cyanobacterium, Anabaena PCC7120, has four genes annotated as coding for Dps; however, the information on their physiological roles is limiting. One of the genes coding for Dps, 'all3940' was found to be induced under different abiotic stresses in Anabaena and upon overexpression enhanced the tolerance of Anabaena to a multitude of stresses, which included salinity, heat, heavy metals, pesticide, and nutrient starvation. On the other hand, mutation in the gene resulted in decreased growth of Anabaena. The modulation in the levels of All3940 in Anabaena, achieved either by overexpression of the protein or mutation of the gene, resulted in changes in the proteome, which correlated well with the physiological changes observed. Proteins required for varied physiological activities, such as photosynthesis, carbon-metabolism, oxidative stress alleviation, exhibited change in protein profile upon modulation of All3940 levels in Anabaena. This suggested a direct or an indirect effect of All3940 on the expression of the above stress-responsive proteins, thereby enhancing tolerance in Anabaena PCC7120. Thus, All3940, though categorized as a Dps, is possibly a general stress protein having a global role in regulating tolerance to multitude of stresses in Anabaena.

  11. Characterization of two genes encoding metal tolerance proteins from Beta vulgaris subspecies maritima that confers manganese tolerance in yeast

    DEFF Research Database (Denmark)

    Erbasol, Isil; Bozdag, Gonensin Ozan; Koc, Ahmet;

    2013-01-01

    analyses of these proteins indicated that they are specific to Mn with a role in reducing excess cellular Mn levels when expressed in yeast. GFP-fusion constructs of both proteins localized to the Golgi apparatus as a punctuated pattern. Finally, Q-RT-PCR results showed that BmMTP10 expression was induced......Manganese (Mn) is an essential micronutrient in plants. However increased Mn levels are toxic to plant cells. Metal tolerance proteins (MTPs), member of cation diffusion facilitator protein (CDF) family, have important roles in metal homeostatis in different plant species and catalyse efflux...... threefold in response to the excess Mn treatment. On the other hand BmMTP11 expression was not affected in response to excess Mn levels. Thus, our results suggest that the BmMTP10 and BmMTP11 proteins from B. v. ssp. maritima have non-redundant functions in terms of Mn detoxification with a similar...

  12. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum Seedlings and Identification of Salt Tolerance Genes

    Directory of Open Access Journals (Sweden)

    Jiangtao Liu

    2016-03-01

    Full Text Available Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf transcriptome of A. splendens obtained using an Illumina HiSeq 2500. Over 35 million clean reads were obtained from the leaf and root libraries. All of the RNA sequencing (RNA-seq reads were assembled de novo into a total of 126,235 unigenes and 36,511 coding DNA sequences (CDS. We further identified 1663 differentially-expressed genes (DEGs between the salt stress treatment and control. Functional annotation of the DEGs by gene ontology (GO, using Arabidopsis and rice as references, revealed enrichment of salt stress-related GO categories, including “oxidation reduction”, “transcription factor activity”, and “ion channel transporter”. Thus, this global transcriptome analysis of A. splendens has provided an important genetic resource for the study of salt tolerance in this halophyte. The identified sequences and their putative functional data will facilitate future investigations of the tolerance of Achnatherum species to various types of abiotic stress.

  13. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum) Seedlings and Identification of Salt Tolerance Genes.

    Science.gov (United States)

    Liu, Jiangtao; Zhou, Yuelong; Luo, Changxin; Xiang, Yun; An, Lizhe

    2016-01-01

    Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS) technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf transcriptome of A. splendens obtained using an Illumina HiSeq 2500. Over 35 million clean reads were obtained from the leaf and root libraries. All of the RNA sequencing (RNA-seq) reads were assembled de novo into a total of 126,235 unigenes and 36,511 coding DNA sequences (CDS). We further identified 1663 differentially-expressed genes (DEGs) between the salt stress treatment and control. Functional annotation of the DEGs by gene ontology (GO), using Arabidopsis and rice as references, revealed enrichment of salt stress-related GO categories, including "oxidation reduction", "transcription factor activity", and "ion channel transporter". Thus, this global transcriptome analysis of A. splendens has provided an important genetic resource for the study of salt tolerance in this halophyte. The identified sequences and their putative functional data will facilitate future investigations of the tolerance of Achnatherum species to various types of abiotic stress.

  14. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum) Seedlings and Identification of Salt Tolerance Genes.

    Science.gov (United States)

    Liu, Jiangtao; Zhou, Yuelong; Luo, Changxin; Xiang, Yun; An, Lizhe

    2016-01-01

    Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS) technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf transcriptome of A. splendens obtained using an Illumina HiSeq 2500. Over 35 million clean reads were obtained from the leaf and root libraries. All of the RNA sequencing (RNA-seq) reads were assembled de novo into a total of 126,235 unigenes and 36,511 coding DNA sequences (CDS). We further identified 1663 differentially-expressed genes (DEGs) between the salt stress treatment and control. Functional annotation of the DEGs by gene ontology (GO), using Arabidopsis and rice as references, revealed enrichment of salt stress-related GO categories, including "oxidation reduction", "transcription factor activity", and "ion channel transporter". Thus, this global transcriptome analysis of A. splendens has provided an important genetic resource for the study of salt tolerance in this halophyte. The identified sequences and their putative functional data will facilitate future investigations of the tolerance of Achnatherum species to various types of abiotic stress. PMID:27023614

  15. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    Science.gov (United States)

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast. PMID:24951963

  16. Cloning and expression pattern of a dehydrin-like BDN1 gene from drought-tolerant Boea crassifolia Hemsl.

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A 500-bp cDNA fragment was amplified via RT-PCR from drought-induced total RNA of the drought-tolerant B. crassifolia Hemsl. using primers based on the sequence of published dehydrin conserved region. By using 5′RACE, full-length coding region (1 148 bp) of BDN1 gene was produced. It is a new member of the dehydrin gene family. Southern analysis indicated that BDN1 is present in the B. crassifolia genome as a single-copy gene. Northern analysis revealed that its expression is inducible by drought and cold stresses as well as ABA application.

  17. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  18. Phosphate-induced-1 gene from Eucalyptus (EgPHI-1) enhances osmotic stress tolerance in transgenic tobacco.

    Science.gov (United States)

    Sousa, A O; Assis, E T C M; Pirovani, C P; Alvim, F C; Costa, M G C

    2014-03-12

    Environmental stresses such as drought, freezing, and high salinity induce osmotic stress in plant cells. The plant response to osmotic stress involves a number of physiological and developmental changes, which are made possible, in part, by the modulation of the expression of specific genes. Phosphate-induced-1 gene (PHI-1) was first isolated from phosphate-treated phosphate-starved tobacco cell cultures as a stress-inducible gene, which is presumably related to intracellular pH maintenance; however, the role of the PHI-1 gene product has not yet been clarified. A gene encoding a predicted protein with high similarity to tobacco PHI-1, named EgPHI-1, was previously identified in Eucalyptus by comparative transcriptome analysis of xylem cells from species of contrasting phenotypes for wood quality and growth traits. Here, we show that the overexpression of EgPHI-1 in transgenic tobacco enhances tolerance to osmotic stress. In comparison with wild-type plants, EgPHI-1 transgenic plants showed a significant increase in root length and biomass dry weight under NaCl-, polyethylene glycol, and mannitol-induced osmotic stresses. The enhanced stress tolerance of transgenic plants was correlated with increased endogenous protein levels of the molecular chaperone binding protein BiP, which in turn was correlated with the EgPHI-1 expression level in the different transgenic lines. These results provide evidence about the involvement of EgPHI-1 in osmotic stress tolerance via modulation of BiP expression, and pave the way for its future use as a candidate gene for engineering tolerance to environmental stresses in crop plants.

  19. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    International Nuclear Information System (INIS)

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance

  20. Over-expression of histone H3K4 demethylase gene JMJ15 enhances salt tolerance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Yuan eShen

    2014-06-01

    Full Text Available Histone H3 lysine 4 trimethylation (H3K4me3 has been shown to be involved in stress-responsive gene expression and gene priming in plants. However, the role of H3K4me3 resetting in the processes is not clear. In this work we studied the expression and function of Arabidopsis H3K4 demethylase gene JMJ15. We show that the expression of JMJ15 was relatively low and was limited to a number of tissues during vegetative growth but was higher in young floral organs. Over-expression of the gene in gain-of-function mutants reduced the plant height with accumulation of lignin in stems, while the loss-of-function mutation did not produce any visible phenotype. The gain-of-function mutants showed enhanced salt tolerance, whereas the loss-of-function mutant was more sensitive to salt compared to the wild type. Transcriptomic analysis revealed that over-expression of JMJ15 down-regulated many genes which are preferentially marked by H3K4me3 and H3K4me2. Many of the down-regulated genes encode transcription regulators involved in stress responses. The data suggest that increased JMJ15 levels may regulate the gene expression program that enhances stress tolerance.

  1. Purine biosynthetic genes are required for cadmium tolerance in Schizosaccharomyces pombe

    Energy Technology Data Exchange (ETDEWEB)

    Speiser, D.M.; Ortiz, D.F.; Kreppel, L.; Scheel, G.; McDonald, G.; Ow, D.W. (Dept. of Agriculture, Albany, CA (United States) Univ. of California, Berkeley (United States))

    1992-12-01

    Phytochelatins (PCs) are metal-chelating peptides produced in plants and some fungi in response to heavy metal exposure. A Cd-sensitive mutant of the fission yeast Schizosaccharomyces pombe, defective in production of a PC-Cd-sulfide complex essential for metal tolerance, was found to harbor mutations in specific genes of the purine biosynthetic pathway. Genetic analysis of the link between metal complex accumulation and purine biosynthesis enzymes revealed that genetic lesions blocking two segments of the pathway, before and after the IMP branchpoint, are required to produce the Cd-sensitive phenotype. The biochemical functions of these two segments of the pathway are similar, and a model based on the alternate use of a sulfur analog substrate is presented. The novel participation of purine biosynthesis enzymes in the conversion of the PC-Cd complex to the PC-Cd-sulfide complex in the fission yeast raises an intriguing possibility that these same enzymes might have a role in sulfur metabolism in the fission yeast S. pombe, and perhaps in other biological systems. 41 refs., 8 figs., 2 tabs.

  2. Expression of the hygromycin B phosphotransferase gene confers tolerance to the herbicide glyphosate.

    Science.gov (United States)

    Peñaloza-Vázquez, A; Oropeza, A; Mena, G L; Bailey, A M

    1995-05-01

    Escherichia coli cells and tobacco (cv. Xanthi) plants transformed with the hygromycin B phosphotransferase gene were able to grow in culture medium containing glyphosate at 2.0 mM. The growth of tobacco calli in media containing increasing glyphosate concentrations was measured. The ID50 for glyphosate was 1.70±0.03 mM for hygromycin-B resistant plants, and 0.45±0.02 mM for control plants. Regenerated plants and progeny selected for resistance to hygromycin B were tested for glyphosate tolerance by spraying them with Faena herbicide (formulated glyphosate with surfactant) at a dose equal to 0.24 kg/ha. This was two times the dose required to kill 100 percent of the control plants. Phosphotransferase activity was measured in the extracts of the transformed leaves by the incorporation of (32)P from [γ(-32)P]ATP and it was observed that hygromycin B phosphotransferase was able to recognize the molecule of glyphosate as substrate. PMID:24185516

  3. Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance.

    Science.gov (United States)

    Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming

    2012-09-21

    Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.

  4. Improving freeze-tolerance of baker's yeast through seamless gene deletion of NTH1 and PUT1.

    Science.gov (United States)

    Dong, Jian; Chen, Didi; Wang, Guanglu; Zhang, Cuiying; Du, Liping; Liu, Shanshan; Zhao, Yu; Xiao, Dongguang

    2016-06-01

    Baker's yeast strains with freeze-tolerance are highly desirable to maintain high leavening ability after freezing. Enhanced intracellular concentration of trehalose and proline in yeast is linked with freeze-tolerance. In this study, we constructed baker's yeast with enhanced freeze-tolerance by simultaneous deletion of the neutral trehalase-encoded gene NTH1 and the proline oxidase-encoded gene PUT1. We first used the two-step integration-based seamless gene deletion method to separately delete NTH1 and PUT1 in haploid yeast. Subsequently, through two rounds of hybridization and sporulation-based allelic exchange and colony PCR-mediated tetrad analysis, we obtained strains with restored URA3 and deletion of NTH1 and/or PUT1. The resulting strain showed higher cell survival and dough-leavening ability after freezing compared to the wild-type strain due to enhanced accumulation of trehalose and/or proline. Moreover, mutant with simultaneous deletion of NTH1 and PUT1 exhibits the highest relative dough-leavening ability after freezing compared to mutants with single-gene deletion perhaps due to elevated levels of both trehalose and proline. These results verified that it is applicable to construct frozen dough baker's yeast using the method proposed in this paper. PMID:26965428

  5. Transgenic tobacco plants overexpressing a grass PpEXP1 gene exhibit enhanced tolerance to heat stress.

    Directory of Open Access Journals (Sweden)

    Qian Xu

    Full Text Available Heat stress is a detrimental abiotic stress limiting the growth of many plant species and is associated with various cellular and physiological damages. Expansins are a family of proteins which are known to play roles in regulating cell wall elongation and expansion, as well as other growth and developmental processes. The in vitro roles of expansins regulating plant heat tolerance are not well understood. The objectives of this study were to isolate and clone an expansin gene in a perennial grass species (Poa pratensis and to determine whether over-expression of expansin may improve plant heat tolerance. Tobacco (Nicotiana tabacum was used as the model plant for gene transformation and an expansin gene PpEXP1 from Poa pratensis was cloned. Sequence analysis showed PpEXP1 belonged to α-expansins and was closely related to two expansin genes in other perennial grass species (Festuca pratensis and Agrostis stolonifera as well as Triticum aestivum, Oryza sativa, and Brachypodium distachyon. Transgenic tobacco plants over-expressing PpEXP1 were generated through Agrobacterium-mediated transformation. Under heat stress (42°C in growth chambers, transgenic tobacco plants over-expressing the PpEXP1 gene exhibited a less structural damage to cells, lower electrolyte leakage, lower levels of membrane lipid peroxidation, and lower content of hydrogen peroxide, as well as higher chlorophyll content, net photosynthetic rate, relative water content, activity of antioxidant enzyme, and seed germination rates, compared to the wild-type plants. These results demonstrated the positive roles of PpEXP1 in enhancing plant tolerance to heat stress and the possibility of using expansins for genetic modification of cool-season perennial grasses in the development of heat-tolerant germplasm and cultivars.

  6. Evaluation of potential candidate genes involved in salinity tolerance in striped catfish (Pangasianodon hypophthalmus) using an RNA-Seq approach.

    Science.gov (United States)

    Nguyen, Tuan Viet; Jung, Hyungtaek; Nguyen, Thanh Minh; Hurwood, David; Mather, Peter

    2016-02-01

    Increasing salinity levels in freshwater and coastal environments caused by sea level rise linked to climate change is now recognized to be a major factor that can impact fish growth negatively, especially for freshwater teleost species. Striped catfish (Pangasianodon hypophthalmus) is an important freshwater teleost that is now widely farmed across the Mekong River Delta in Vietnam. Understanding the basis for tolerance and adaptation to raised environmental salinity conditions can assist the regional culture industry to mitigate predicted impacts of climate change across this region. Attempt of next generation sequencing using the ion proton platform results in more than 174 million raw reads from three tissue libraries (gill, kidney and intestine). Reads were filtered and de novo assembled using a variety of assemblers and then clustered together to generate a combined reference transcriptome. Downstream analysis resulted in a final reference transcriptome that contained 60,585 transcripts with an N50 of 683 bp. This resource was further annotated using a variety of bioinformatics databases, followed by differential gene expression analysis that resulted in 3062 transcripts that were differentially expressed in catfish samples raised under two experimental conditions (0 and 15 ppt). A number of transcripts with a potential role in salinity tolerance were then classified into six different functional gene categories based on their gene ontology assignments. These included; energy metabolism, ion transportation, detoxification, signal transduction, structural organization and detoxification. Finally, we combined the data on functional salinity tolerance genes into a hypothetical schematic model that attempted to describe potential relationships and interactions among target genes to explain the molecular pathways that control adaptive salinity responses in P. hypophthalmus. Our results indicate that P. hypophthalmus exhibit predictable plastic regulatory responses

  7. Down-regulation of CBP80 gene expression as a strategy to engineer a drought-tolerant potato.

    Science.gov (United States)

    Pieczynski, Marcin; Marczewski, Waldemar; Hennig, Jacek; Dolata, Jakub; Bielewicz, Dawid; Piontek, Paulina; Wyrzykowska, Anna; Krusiewicz, Dominika; Strzelczyk-Zyta, Danuta; Konopka-Postupolska, Dorota; Krzeslowska, Magdalena; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

    2013-05-01

    Developing new strategies for crop plants to respond to drought is crucial for their innovative breeding. The down-regulation of nuclear cap-binding proteins in Arabidopsis renders plants drought tolerant. The CBP80 gene in the potato cultivar Desiree was silenced using artificial microRNAs. Transgenic plants displayed a higher tolerance to drought, ABA-hypersensitive stomatal closing, an increase in leaf stomata and trichome density, and compact cuticle structures with a lower number of microchannels. These findings were correlated with a higher tolerance to water stress. The level of miR159 was decreased, and the levels of its target mRNAs MYB33 and MYB101 increased in the transgenic plants subjected to drought. Similar trends were observed in an Arabidopsis cbp80 mutant. The evolutionary conservation of CBP80, a gene that plays a role in the response to drought, suggests that it is a candidate for genetic manipulations that aim to obtain improved water-deficit tolerance of crop plants. PMID:23231480

  8. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  9. Tolerância de cultivares de trigo, triticale e centeio em diferentes níveis de alumínio em solução nutritiva Tolerance of wheat, triticale and rye cultivars to different levels of aluminum in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1984-01-01

    Full Text Available Foram estudados sete cultivares de trigo (Triticum aestivum L. , um de trigo duro (Triticum durum L., sete de triticale e dois de centeio (Secale cereale L., em soluções nutritivas contendo quatro níveis de alumínio tóxico. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em soluçâo sem alumínio após um período de 48 horas em solução contendo uma concentração conhecida de alumínio. A temperatura de 28 ± 1 °C foi mantida constante nas soluções durante o experimento. Os cultivares de centeio, Goyarowo e Branco, foram tolerantes a 20mg/ litro de Al3+; os de trigo, Siete Cerros, Tobari-66 e Cocorit, foram sensíveis a 5mg/lítro de alumínio, porém BH-1146, IAC-5, BR-1 e IAC-18 foram tolerantes e, IAC-17, moderadamente tolerante a essa concentração de alumínio; os cultivares de triticale, PFT-763, TCEP-77142, PFT-764, TCEP-75709, Cynamon, TCEP-77138 e TCEP-77136, foram tolerantes a 5mg/litro de Al3+. Todos os cultivares de trigo e triticale foram sensíveis a 10mg/litro de Al3+.Seven bread wheat (Triticum aestivum L. cultivars, one durum wheat (Triticum durum L. cultivar, seven triticale cultivars and two rye cultivars (Secale cereale L. were studied to aluminum toxicity using four different levels of this element in nutrient solutions at constant temperature (28 °C ± 1 °C. The tolerance was measured taking into account the root growth in an aluminum-free complete nutrient solution after a previous Al3+ treatment. With a toxic concentration of aluminum, the primary roots did not grow at all and remained thickned at the tip as a typical aluminum injury. The rye cultivars: Goyarowo and Branco were tolerant to 20 ppm of Al3+; the bread wheat cultivars Siete Cerros and Tobari and the durum wheat Cocorit were sensitive to 5 ppm of Al3+, BH-1146. IAC-5, BR-1 and IAC-18 were tolerant while the cultivar IAC-17 showed moderate tolerance to 5 ppm of Al3+; the triticale cultivars, PET-763, TCEP

  10. Expression responses of five cold tolerant related genes to two temperature dropping treatments in sea cucumber Apostichopus japonicus

    Science.gov (United States)

    Li, Chengze; Chang, Yaqing; Pang, Zhenguo; Ding, Jun; Ji, Nanjing

    2015-03-01

    Environmental conditions, including ambient temperature, play important roles in survival, growth development, and reproduction of the Japanese sea cucumber, Apostichopus japonicus. Low temperatures result in slowed growth and skin ulceration disease. In a previous study, we investigated the effect of low temperature on gene expression profiles in A. japonicus by suppression subtractive hybridization (SSH). Genes encoding Ferritin, Lysozyme, Hsp70, gp96, and AjToll were selected from a subtracted cDNA library of A. japonicus under acute cold stress. The transcriptional expression profiles of these genes were investigated in different tissues (coelomocyte, respiratory tree, intestine, longitudinal muscle) after exposure to acute and mild temperature dropping treatments. The results show that (1) the five cold-tolerance-related genes were found in all four tissues and the highest mRNA levels were observed in coelomocyte and respiratory tree; (2) under the temperature dropping treatments, three types of transcriptional regulation patterns were observed: primary suppression followed by up-regulation at -2°C, suppressed expression throughout the two treatments, and more rarely an initial stimulation followed by suppression; and (3) gene expression suppression was more severe under acute temperature dropping than under mild temperature dropping treatment. The five cold-tolerance-related genes that were distributed mainly in coelomocyte and respiratory tissues were generally down-regulated by low temperature stress but an inverse up-regulation event was found at the extreme temperature (-2°C).

  11. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions.

  12. Expression of the Autoimmune Regulator Gene and Its Relevance to the Mechanisms of Central and Peripheral Tolerance

    Directory of Open Access Journals (Sweden)

    Roberto Perniola

    2012-01-01

    Full Text Available The autoimmune polyendocrine syndrome type 1 (APS-1 is a monogenic disease due to pathogenic variants occurring in the autoimmune regulator (AIRE gene. Its related protein, AIRE, activates the transcription of genes encoding for tissue-specific antigens (TsAgs in a subset of medullary thymic epithelial cells: the presentation of TsAgs to the maturating thymocytes induces the apoptosis of the autoreactive clones and constitutes the main form of central tolerance. Dysregulation of thymic AIRE expression in genetically transmitted and acquired diseases other than APS-1 may contribute to further forms of autoimmunity. As AIRE and its murine homolog are also expressed in the secondary lymphoid organs, the extent and relevance of AIRE participation in the mechanisms of peripheral tolerance need to be thoroughly defined.

  13. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  14. Differences in salinity tolerance and gene expression between two populations of Atlantic cod (Gadus morhua) in response to salinity stress

    DEFF Research Database (Denmark)

    Larsen, Peter Foged; Eg Nielsen, Einar; Meier, Kristian;

    2012-01-01

    in salinity tolerance and gene expression among Atlantic cod (Gadus morhua) from two populations distributed across a steep salinity gradient, we observed high mortality (45% North Sea cod and 80% Baltic Sea cod) in a reciprocal common garden setup. Quantitative RT-PCR assays for expression of hsp70 and Na....... The findings strongly suggest that Atlantic cod are adapted to local saline conditions, despite relatively low levels of neutral genetic divergence between populations...

  15. Genome-wide screening of Saccharomyces cerevisiae genes required to foster tolerance towards industrial wheat straw hydrolysates

    OpenAIRE

    Pereira, Francisco B.; Teixeira, Miguel C.; Mira, Nuno P.; Correia, Isabel Sá; Domingues, Lucília

    2014-01-01

    The presence of toxic compounds derived from biomass pre-treatment in fermentation media represents an important drawback in second-generation bio-ethanol production technology and overcoming this inhibitory effect is one of the fundamental challenges to its industrial production. The aim of this study was to systematically identify, in industrial medium and at a genomic scale, the Saccharomyces cerevisiae genes required for simultaneous and maximal tolerance to key inhibitors of lignocellulo...

  16. DAF-16 and Δ9 desaturase genes promote cold tolerance in long-lived Caenorhabditis elegans age-1 mutants.

    Directory of Open Access Journals (Sweden)

    Fiona R Savory

    Full Text Available In Caenorhabditis elegans, mutants of the conserved insulin/IGF-1 signalling (IIS pathway are long-lived and stress resistant due to the altered expression of DAF-16 target genes such as those involved in cellular defence and metabolism. The three Δ(9 desaturase genes, fat-5, fat-6 and fat-7, are included amongst these DAF-16 targets, and it is well established that Δ(9 desaturase enzymes play an important role in survival at low temperatures. However, no assessment of cold tolerance has previously been reported for IIS mutants. We demonstrate that long-lived age-1(hx546 mutants are remarkably resilient to low temperature stress relative to wild type worms, and that this is dependent upon daf-16. We also show that cold tolerance following direct transfer to low temperatures is increased in wild type worms during the facultative, daf-16 dependent, dauer stage. Although the cold tolerant phenotype of age-1(hx546 mutants is predominantly due to the Δ(9 desaturase genes, additional transcriptional targets of DAF-16 are also involved. Surprisingly, survival of wild type adults following a rapid temperature decline is not dependent upon functional daf-16, and cellular distributions of a DAF-16::GFP fusion protein indicate that DAF-16 is not activated during low temperature stress. This suggests that cold-induced physiological defences are not specifically regulated by the IIS pathway and DAF-16, but expression of DAF-16 target genes in IIS mutants and dauers is sufficient to promote cross tolerance to low temperatures in addition to other forms of stress.

  17. Molecular Cloning and Functional Characterization of a Salt Tolerance-Associated Gene IbNFU1 from Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    WANG Lian-jun; HE Shao-zhen; ZHAI Hong; LIU De-gao; WANG Yan-nan; LIU Qing-chang

    2013-01-01

    Iron-sulfur cluster biosynthesis involving the nitrogen fixation (Nif) proteins has been proposed as a general mechanism acting in various organisms. NifU-like protein may play an important role in protecting plants against abiotic and biotic stresses. Based on the EST sequence selected from salt-stressed suppression subtractive hybridization (SSH) cDNA library constructed with a salt-tolerant mutant LM79, a NFU gene, termed IbNFU1, was cloned from sweetpotato (Ipomoea batatas (L.) Lam.) via rapid amplification of cDNA ends (RACE). The cDNA sequence of 1 117 bp contained an 846 bp open reading frame encoding a 281 amino acids polypeptide with a molecular weight of 30.5 kDa and an isoelectric point (pI) of 5.12. IbNFU1 gene contained a conserved Cys-X-X-Cys motif in C-terminal of the iron-sulfur cluster domain. The deduced amino acid sequence had 66.08 to 71.99%sequence identity to NFU genes reported in Arabidopsis thaliana, Eucalyptus grandis and Vitis vinifera. Real-time quantitative PCR analysis revealed that the expression level of IbNFU1 gene was significantly higher in the roots of the mutant LM79 compared to the wild-type Lizixiang. Transgenic tobacco (cv. Wisconsin 38) plants expressing IbNFU1 gene exhibited significantly higher salt tolerance compared to the untransformed control plants. It is proposed that IbNFU1 gene has an important function for salt tolerance of plants.

  18. Genetic transformation and expression of transgenic lines of Populus x euramericana with insect-resistance and salt-tolerance genes.

    Science.gov (United States)

    Yang, R L; Wang, A X; Zhang, J; Dong, Y; Yang, M S; Wang, J M

    2016-01-01

    We characterized new transgenic varieties of poplar with multiple insect-resistant and salt stress tolerant genes. Two insect-resistant Bacillus thuringiensis (Bt) genes, Cry1Ac and Cry3A, and a salt-tolerant gene, Betaine aldehyde dehydrogenase (BADH) were inserted into a vector, p209-Cry1Ac-Cry3A-BADH. The clone of Populus x euramericana was transformed by the vector using the Agrobacterium-mediated method. Three transgenic lines were assessed using genetic detection and resistance expression analysis. PCR revealed that exogenous genes Cry1Ac, Cry3A, BADH and selective marker gene NPTII were present in three transgenic lines. Quantitative real-time PCR (qPCR) showed significant differences in the transcriptional abundance of three exogenous genes in different lines. Results of assays for Bt toxic proteins showed that the Cry1Ac and Cry3A toxic protein content of each line was 12.83-26.32 and 2108.91-2724.79 ng/g, respectively. The Cry1Ac toxic protein content of different lines was significantly different; the Cry3A toxic protein content was about 100 times higher than that of the Cry1Ac toxic protein. The insect-resistance test revealed the mortality rate of transgenic lines to Hyphantria cunea L1 larvae varied by 42.2-66.7%, which was significantly higher than non-transgenic lines. The mortality rate of L1 and L2 Plagiodera versicolora larvae was 100%. The insecticidal effect of transgenic lines to P. versicolora larvae was higher than that to H. cunea larvae. NaCl stress tolerance of three transgenic lines under 3-6% NaCl concentration was significantly higher than that of non-transgenic lines. PMID:27173305

  19. A novel stress-induced sugarcane gene confers tolerance to drought, salt and oxidative stress in transgenic tobacco plants.

    Directory of Open Access Journals (Sweden)

    Kevin Begcy

    Full Text Available BACKGROUND: Drought is a major abiotic stress that affects crop productivity worldwide. Sugarcane can withstand periods of water scarcity during the final stage of culm maturation, during which sucrose accumulation occurs. Meanwhile, prolonged periods of drought can cause severe plant losses. METHODOLOGY/PRINCIPAL FINDINGS: In a previous study, we evaluated the transcriptome of drought-stressed plants to better understand sugarcane responses to drought. Among the up-regulated genes was Scdr1 (sugarcane drought-responsive 1. The aim of the research reported here was to characterize this gene. Scdr1 encodes a putative protein containing 248 amino acids with a large number of proline (19% and cysteine (13% residues. Phylogenetic analysis showed that ScDR1is in a clade with homologs from other monocotyledonous plants, separate from those of dicotyledonous plants. The expression of Scdr1 in different varieties of sugarcane plants has not shown a clear association with drought tolerance. CONCLUSIONS/SIGNIFICANCE: The overexpression of Scdr1 in transgenic tobacco plants increased their tolerance to drought, salinity and oxidative stress, as demonstrated by increased photosynthesis, water content, biomass, germination rate, chlorophyll content and reduced accumulation of ROS. Physiological parameters, such as transpiration rate (E, net photosynthesis (A, stomatal conductance (gs and internal leaf CO(2 concentration, were less affected by abiotic stresses in transgenic Scdr1 plants compared with wild-type plants. Overall, our results indicated that Scdr1 conferred tolerance to multiple abiotic stresses, highlighting the potential of this gene for biotechnological applications.

  20. Over-Expression of SlSHN1 Gene Improves Drought Tolerance by Increasing Cuticular Wax Accumulation in Tomato

    Directory of Open Access Journals (Sweden)

    Ayed M. Al-Abdallat

    2014-10-01

    Full Text Available Increasing cuticular wax accumulation in plants has been associated with improving drought tolerance in plants. In this study, a cDNA clone encoding the SlSHN1 transcription factor, the closest ortholog to WIN/SHN1 gene in Arabidopsis, was isolated from tomato plant. Expression analysis of SlSHN1 indicated that it is induced in response to drought conditions. The over-expression of SlSHN1 in tomato under the control of the constitutive CaMV 35S promoter produced plants that showed mild growth retardation phenotype with shiny and dark green leaves. Scanning electron microscopy showed that the over-expression of SlSHN1 in tomato resulted in higher cuticular wax deposition on leaf epidermial tissue when compared to non-transformed plants. Expression analysis in transgenic lines over-expressing SlSHN1 indicated that several wax-related synthesis genes were induced. Transgenic tomato plants over-expressing SlSHN1 showed higher drought tolerance when compared with wild type plants; this was reflected in delayed wilting of transgenic lines, improved water status and reduced water loss rate when compared with wild type plants. In conclusion, the SlSHN1 gene can modulate wax accumulation and could be utilized to enhance drought tolerance in tomato plant.

  1. Expression of a Carrot 36 kD Antifreeze Protein Gene Improves Cold Stress Tolerance in Transgenic Tobacco

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Antifreeze proteins (AFPs) enable organisms to survive under cold conditions, and have great potential in improving cold tolerance of cold-sensitive plants. In order to determine whether expression of the carrot 36 kD antifreeze protein gene confers improved cold-resistant properties to plant tissues, we tried to obtain transgenic tobacco plants which expressed the antifreeze protein. Cold, salt, and drought induced promoter Prd29A was cloned using PCR from Arabidopsis. Two plant expression vectors based on pBI121 were constructed with CaMV35S:AFP and Prd29A:AFP. Tobacco plantlets were transformed by Agrobacterium-medicated transformation. PCR and Southern blotting demonstrated that the carrot 36 kD afp gene was successfully integrated into the genomes of transformed plantlets. The expression of the afp gene in transgenic plants led to improved tolerance to cold stress.However, the use of the strong constitutive 35S cauliflower mosaic virus (CaMV) promoter to drive expression of afp also resulted in growth retardation under normal growing conditions. In contrast, the expression of afp driven by the stress-inducible Prd29A promoter from Arabidopsis gave rise to minimal effects on plant growth while providing an increased tolerance to cold stress condition (2℃). The results demonstrated the prospect of using Prd29A-AFP transgenic plants in cold-stressed conditions that will in turn benefit agriculture.

  2. Transfer of E. coli gutD gene into maize and regeneration of salt-tolerant transgenic plants

    Institute of Scientific and Technical Information of China (English)

    刘岩; 王国英; 刘俊君; 彭学贤; 谢友菊; 戴景瑞; 郭世伟; 张福锁

    1999-01-01

    GutD gene, encoding a key enzyme (glucitol-6-phosphate dehydrogenase) of sugar alcohol metabolic pathway in E. coli, was transferred into maize. Results of Southern and Western blotting analysis certified that this gene had integrated and been expressed in transgenic maize plants and their progeny. The synthesis and accumulation of sorbitol were detected in transgenic maize plants and a preliminary nutrient solution culture experiment showed that gutD transgenic maize plants had an increased tolerance to salt stress compared with nontransgenic ones.

  3. Genome-wide analysis of ZmDREB genes and their association with natural variation in drought tolerance at seedling stage of Zea mays L.

    Directory of Open Access Journals (Sweden)

    Shengxue Liu

    Full Text Available The worldwide production of maize (Zea mays L. is frequently impacted by water scarcity and as a result, increased drought tolerance is a priority target in maize breeding programs. While DREB transcription factors have been demonstrated to play a central role in desiccation tolerance, whether or not natural sequence variations in these genes are associated with the phenotypic variability of this trait is largely unknown. In the present study, eighteen ZmDREB genes present in the maize B73 genome were cloned and systematically analyzed to determine their phylogenetic relationship, synteny with rice, maize and sorghum genomes; pattern of drought-responsive gene expression, and protein transactivation activity. Importantly, the association between the nucleic acid variation of each ZmDREB gene with drought tolerance was evaluated using a diverse population of maize consisting of 368 varieties from tropical and temperate regions. A significant association between the genetic variation of ZmDREB2.7 and drought tolerance at seedling stage was identified. Further analysis found that the DNA polymorphisms in the promoter region of ZmDREB2.7, but not the protein coding region itself, was associated with different levels of drought tolerance among maize varieties, likely due to distinct patterns of gene expression in response to drought stress. In vitro, protein-DNA binding assay demonstrated that ZmDREB2.7 protein could specifically interact with the target DNA sequences. The transgenic Arabidopsis overexpressing ZmDREB2.7 displayed enhanced tolerance to drought stress. Moreover, a favorable allele of ZmDREB2.7, identified in the drought-tolerant maize varieties, was effective in imparting plant tolerance to drought stress. Based upon these findings, we conclude that natural variation in the promoter of ZmDREB2.7 contributes to maize drought tolerance, and that the gene and its favorable allele may be an important genetic resource for the genetic

  4. High prevalence of multidrug-tolerant bacteria and associated antimicrobial resistance genes isolated from ornamental fish and their carriage water.

    Directory of Open Access Journals (Sweden)

    David W Verner-Jeffreys

    Full Text Available BACKGROUND: Antimicrobials are used to directly control bacterial infections in pet (ornamental fish and are routinely added to the water these fish are shipped in to suppress the growth of potential pathogens during transport. METHODOLOGY/PRINCIPAL FINDINGS: To assess the potential effects of this sustained selection pressure, 127 Aeromonas spp. isolated from warm and cold water ornamental fish species were screened for tolerance to 34 antimicrobials. Representative isolates were also examined for the presence of 54 resistance genes by a combination of miniaturized microarray and conventional PCR. Forty-seven of 94 Aeromonas spp. isolates recovered from tropical ornamental fish and their carriage water were tolerant to > or =15 antibiotics, representing seven or more different classes of antimicrobial. The quinolone and fluoroquinolone resistance gene, qnrS2, was detected at high frequency (37% tested recent isolates were positive by PCR. Class 1 integrons, IncA/C broad host range plasmids and a range of other antibiotic resistance genes, including floR, bla(TEM-1, tet(A, tet(D, tet(E, qacE2, sul1, and a number of different dihydrofolate reductase and aminoglycoside transferase coding genes were also detected in carriage water samples and bacterial isolates. CONCLUSIONS: These data suggest that ornamental fish and their carriage water act as a reservoir for both multi-resistant bacteria and resistance genes.

  5. Coordinated Regulation of miR-155 and miR-146a Genes during Induction of Endotoxin Tolerance in Macrophages

    DEFF Research Database (Denmark)

    Doxaki, Christina; Kampranis, Sotirios C; Eliopoulos, Aristides G;

    2015-01-01

    Endotoxin tolerance occurs to protect the organism from hyperactivation of innate immune responses, primarily mediated by macrophages. Regulation of endotoxin tolerance occurs at multiple levels of cell responses and requires significant changes in gene expression. In the process of macrophage ac...

  6. Proteomic Analyses Reveal the Mechanism of Dunaliella salina Ds-26-16 Gene Enhancing Salt Tolerance in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Yanlong Wang

    Full Text Available We previously screened the novel gene Ds-26-16 from a 4 M salt-stressed Dunaliella salina cDNA library and discovered that this gene conferred salt tolerance to broad-spectrum organisms, including E. coli (Escherichia coli, Haematococcus pluvialis and tobacco. To determine the mechanism of this gene conferring salt tolerance, we studied the proteome of E. coli overexpressing the full-length cDNA of Ds-26-16 using the iTRAQ (isobaric tags for relative and absolute quantification approach. A total of 1,610 proteins were identified, which comprised 39.4% of the whole proteome. Of the 559 differential proteins, 259 were up-regulated and 300 were down-regulated. GO (gene ontology and KEGG (Kyoto encyclopedia of genes and genomes enrichment analyses identified 202 major proteins, including those involved in amino acid and organic acid metabolism, energy metabolism, carbon metabolism, ROS (reactive oxygen species scavenging, membrane proteins and ABC (ATP binding cassette transporters, and peptidoglycan synthesis, as well as 5 up-regulated transcription factors. Our iTRAQ data suggest that Ds-26-16 up-regulates the transcription factors in E. coli to enhance salt resistance through osmotic balance, energy metabolism, and oxidative stress protection. Changes in the proteome were also observed in E. coli overexpressing the ORF (open reading frame of Ds-26-16. Furthermore, pH, nitric oxide and glycerol content analyses indicated that Ds-26-16 overexpression increases nitric oxide content but has no effect on glycerol content, thus confirming that enhanced nitric oxide synthesis via lower intercellular pH was one of the mechanisms by which Ds-26-16 confers salt tolerance to E. coli.

  7. Proteomic Analyses Reveal the Mechanism of Dunaliella salina Ds-26-16 Gene Enhancing Salt Tolerance in Escherichia coli.

    Science.gov (United States)

    Wang, Yanlong; Hu, Bin; Du, Shipeng; Gao, Shan; Chen, Xiwen; Chen, Defu

    2016-01-01

    We previously screened the novel gene Ds-26-16 from a 4 M salt-stressed Dunaliella salina cDNA library and discovered that this gene conferred salt tolerance to broad-spectrum organisms, including E. coli (Escherichia coli), Haematococcus pluvialis and tobacco. To determine the mechanism of this gene conferring salt tolerance, we studied the proteome of E. coli overexpressing the full-length cDNA of Ds-26-16 using the iTRAQ (isobaric tags for relative and absolute quantification) approach. A total of 1,610 proteins were identified, which comprised 39.4% of the whole proteome. Of the 559 differential proteins, 259 were up-regulated and 300 were down-regulated. GO (gene ontology) and KEGG (Kyoto encyclopedia of genes and genomes) enrichment analyses identified 202 major proteins, including those involved in amino acid and organic acid metabolism, energy metabolism, carbon metabolism, ROS (reactive oxygen species) scavenging, membrane proteins and ABC (ATP binding cassette) transporters, and peptidoglycan synthesis, as well as 5 up-regulated transcription factors. Our iTRAQ data suggest that Ds-26-16 up-regulates the transcription factors in E. coli to enhance salt resistance through osmotic balance, energy metabolism, and oxidative stress protection. Changes in the proteome were also observed in E. coli overexpressing the ORF (open reading frame) of Ds-26-16. Furthermore, pH, nitric oxide and glycerol content analyses indicated that Ds-26-16 overexpression increases nitric oxide content but has no effect on glycerol content, thus confirming that enhanced nitric oxide synthesis via lower intercellular pH was one of the mechanisms by which Ds-26-16 confers salt tolerance to E. coli. PMID:27135411

  8. Crescimento radicular e produção de ácidos orgânicos em cultivares de soja com diferentes tolerâncias ao alumínio Root growth and production of organic acids by soybean cultivars with different tolerance to aluminum

    Directory of Open Access Journals (Sweden)

    Orival Gastão Menosso

    2001-11-01

    Full Text Available A elucidação dos mecanismos que definem o comportamento diferencial entre genótipos de soja quanto à toxidez de Al facilita a utilização da variabilidade genética existente ou produzida. O objetivo deste trabalho foi avaliar a influência do Al no crescimento radicular, na modificação do pH da solução e no conteúdo de ácidos orgânicos em extratos de raízes de cultivares de soja tolerantes ao Al, FT-1 e FT-6 (Veneza e sensíveis, IAC-13 e Paraná. As plantas cresceram por nove dias em solução contendo 50 mg L-1 de Ca e 0,0 e 0,2 mg L-1 de Al, com pH inicial de 4,76. Houve maior crescimento de raízes nas cultivares tolerantes e não houve alterações do pH da solução relacionadas à tolerância das cultivares ao alumínio. A presença do Al reduziu o conteúdo dos ácidos cítrico, lático, succínico, oxálico e málico, em ambos os grupos de cultivares avaliados, porém com maior redução no grupo das cultivares sensíveis. O ácido cítrico foi encontrado em maior quantidade nas cultivares tolerantes. A capacidade das cultivares de soja FT-1 e FT-6 (Veneza de alterar o conteúdo de ácidos orgânicos não-voláteis, principalmente o ácido cítrico, que pode complexar o Al, indica que este mecanismo pode ser muito importante para a tolerância a esse elemento.The understanding of the mechanisms for the differential performance of soybean genotypes in relation to Al toxicity is important to explore the existing or produced genetic variability. The objective of this study was to determine the Al influence on root growth, solution pH modifications and organic acid content in root extracts of Al tolerant, FT-1 and FT-6 (Veneza and sensitive, IAC-13 and Paraná, soybean cultivars. Plants were grown during nine days in a solution containing 50 mg L-1 of calcium and 0.0 and 0.2 mg L-1 of aluminum. The solution pH at the beginning was 4.76. Root growth in Al solutions of the tolerant soybean cultivars was higher than that of the

  9. Trigo, triticale e centeio: avaliação da eficiência ao fósforo e tolerância à toxicidade ao alumínio Evaluation of wheat, triticale and rye cultivars for phosphorus efficiency and tolerance to aluminum toxicity in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1987-01-01

    Full Text Available Com o objetivo de estudar a eficiência da utilização de fósforo e a tolerância à toxicidade ao alumínio, instalou-se um experimento empregando os cultivares de trigo BH-1146, Anahuac, IAC-5, IAC-24 e IAC-21; o de triticale TCEP 77138 e o de centeio Branco, em soluções nutritivas contendo cinco níveis de fósforo (0; 3,1; 6,2; 12,4 e 31 mg/litro combinados com cinco níveis de alumínio (0, 1, 3, 6 e 10 mg/litro. A eficiência ao fósforo foi avaliada levando-se em consideração a produção de matéria seca e a quantidade de P nela presente, e a tolerância ao alumínio, com base no comprimento máximo das raízes após doze dias de crescimento em soluções nutritivas. O cultivar de centeio e o de triticale mostraram maior tolerância ao alumínio. Os cultivares de trigo BH-1146, IAC-21, IAC-5 e IAC-24 apresentaram-se como tolerantes e Anahuac, como sensível. O sintoma da toxicidade de alumínio ficou acentuado pelo aumento das concentrações de alumínio e fósforo para todos esses cultivares. 'IAC-5' foi considerado eficiente na utilização de fósforo; 'IAC-21' e 'IAC-24', moderadamente eficientes, e 'Anahuac', Ineficiente, em soluções contendo baixos níveis de fósforo na presença de Al3+.Five wheat cultivars, one triticale and one rye cultivar were studied in aerated nutrient solution with one tenth of the salt concentration of a complete nutrient solution, pH = 4.0 with five levels of aluminum (0, 1, 3, 6 and 10 mg/l combined with five levels of phosphorus (0; 3.1; 6.2; 12.4 and 31 mg/l. As controls, it was used a complete nutrient solution and distilled water. The aluminum tolerance was evaluated by measuring the primary root lenght of the seedlings after a 12-days growth period in the different treatment solutions. The rye cultivar (Branco and the triticale cultivar (TCEP 77138 were the most tolerant as far as aluminum toxicity is concerned, independently of the phosphorus concentrations into the solutions. The wheat

  10. Heterologous expression of the AtDREB1A gene in chrysanthemum increases drought and salt stress tolerance

    Institute of Scientific and Technical Information of China (English)

    HONG; Bo; TONG; Zheng; MA; Nan; LI; Jianke; KASUGA; Mie; YAMAGUCHI-SHINOZAKI; Kazuko; GAO; Junping

    2006-01-01

    DNA cassette containing an AtDREB1A cDNA and a nos terminator, driven by a cauliflower mosaic 35S promoter, or a stress-inducible rd29A promoter, was transformed into the ground cover chrysanthemum (Dendranthema grandiflorum) 'Fall Color' genome. Compared with wild type plants, severe growth retardation was observed in 35S:DREB1A plants, but not in rd29A:DREB1A plants. RT-PCR analysis revealed that, under stress conditions, the DREB1A gene was over-expressed constitutively in 35S:DREB1A plants, but was over-expressed inductively in rd29A:DREB1A plants. The transgenic plants exhibited tolerance to drought and salt stress, and the tolerance was significantly stronger in rd29A:DREB1A plants than tn 35S:DREB1A plants. Proline content and SOD activity were increased inductively in rd29A:DREB1A plants than in 35S:DREB1A plants under stress conditions. These results indicate that heterologous AtDREB1A can confer drought and salt tolerance in transgenic chrysanthemum, and improvement of the stress tolerance may be related to enhancement of proline content and SOD activity.

  11. Overexpression of MuHSP70 gene from Macrotyloma uniflorum confers multiple abiotic stress tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Masand, Shikha; Yadav, Sudesh Kumar

    2016-02-01

    A 70-KD heat shock protein (HSP70) is one of the most conserved chaperones. It is involved in de novo protein folding and prevents the aggregation of unfolded proteins under lethal environmental factors. The purpose of this study is to characterise a MuHSP70 from horsegram (Macrotyloma uniflorum) and elucidating its role in stress tolerance of plants. A MuHSP70 was cloned and characterised from a natural drought stress tolerant HPK4 variety of horsegram (M. uniflorum). For functional characterization, MuHSP70 was overexpressed in transgenic Arabidopsis. Overexpression of MuHSP70 was found to provide tolerance to the transgenic Arabidopsis against various stresses such as heat, cold, drought, salinity and oxidative stress. MuHSP70 transgenics were observed to maintain the shoot biomass, root length, relative water content, and chlorophyll content during exposure to multi-stresses relative to non-transgenic control. Transgenic lines have further shown the reduced levels of MDA, H2O2, and proteolytic activity. Together, these findings suggest that overexpression of MuHSP70 plays an important role in improving abiotic stress tolerance and could be a crucial candidate gene for exploration in crop improvement program. PMID:26694324

  12. Genome-Wide Mapping of Furfural Tolerance Genes in Escherichia coli

    OpenAIRE

    Glebes, Tirzah Y.; Sandoval, Nicholas R.; Philippa J Reeder; Schilling, Katherine D.; Min ZHANG; Ryan T Gill

    2014-01-01

    Advances in genomics have improved the ability to map complex genotype-to-phenotype relationships, like those required for engineering chemical tolerance. Here, we have applied the multiSCale Analysis of Library Enrichments (SCALEs; Lynch et al. (2007) Nat. Method.) approach to map, in parallel, the effect of increased dosage for >105 different fragments of the Escherichia coli genome onto furfural tolerance (furfural is a key toxin of lignocellulosic hydrolysate). Only 268 of >4,000 E. coli ...

  13. Comparative study of Saccharomyces cerevisiae wine strains to identify potential marker genes correlated to desiccation stress tolerance.

    Science.gov (United States)

    Capece, Angela; Votta, Sonia; Guaragnella, Nicoletta; Zambuto, Marianna; Romaniello, Rossana; Romano, Patrizia

    2016-05-01

    The most diffused formulation of starter for winemaking is active dry yeast (ADY). ADYs production process is essentially characterized by air-drying stress, a combination of several stresses, including thermal, hyperosmotic and oxidative and cell capacity to counteract such multiple stresses will determine its survival. The molecular mechanisms underlying cell stress response to desiccation have been mostly studied in laboratory and commercial yeast strains, but a growing interest is currently developing for indigenous yeast strains which represent a valuable and alternative source of genetic and molecular biodiversity to be exploited. In this work, a comparative study of different Saccharomyces cerevisiae indigenous wine strains, previously selected for their technological traits, has been carried out to identify potentially relevant genes involved in desiccation stress tolerance. Cell viability was evaluated along desiccation treatment and gene expression was analyzed by real-time PCR before and during the stress. Our data show that the observed differences in individual strain sensitivity to desiccation stress could be associated to specific gene expression over time. In particular, either the basal or the stress-induced mRNA levels of certain genes, such as HSP12, SSA3, TPS1, TPS2, CTT1 and SOD1, result tightly correlated to the strain survival advantage. This study provides a reliable and sensitive method to predict desiccation stress tolerance of indigenous wine yeast strains which could be preliminary to biotechnological applications. PMID:26882930

  14. The expression of the Saccharomyces cerevisiae HAL1 gene increases salt tolerance in transgenic watermelon [Citrullus lanatus (Thunb.) Matsun. & Nakai.].

    Science.gov (United States)

    Ellul, P; Ríos, G; Atarés, A; Roig, L A; Serrano, R; Moreno, V

    2003-08-01

    An optimised Agrobacterium-mediated gene transfer protocol was developed in order to obtain watermelon transgenic plants [Citrullus lanatus (Thunb.) Matsun. & Nakai.]. Transformation efficiencies ranged from 2.8% to 5.3%, depending on the cultivar. The method was applied to obtain genetically engineered watermelon plants expressing the Saccharomyces cerevisiae HAL1 gene related to salt tolerance. In order to enhance its constitutive expression in plants, the HAL1 gene was cloned in a pBiN19 plasmid under control of the 35S promoter with a double enhancer sequence from the cauliflower mosaic virus and the RNA4 leader sequence of the alfalfa mosaic virus. This vector was introduced into Agrobacterium tumefaciens strain LBA4404 for further inoculation of watermelon half-cotyledon explants. The introduction of both the neomycin phosphotransferase II and HAL1 genes was assessed in primary transformants (TG1) by polymerase chain reaction analysis and Southern hybridisation. The expression of the HAL1 gene was determined by Northern analysis, and the diploid level of transgenic plants was confirmed by flow cytometry. The presence of the selectable marker gene in the expected Mendelian ratios was demonstrated in TG2 progenies. The TG2 kanamycin-resistant plantlets elongated better and produced new roots and leaves in culture media supplemented with NaCl compared with the control. Salt tolerance was confirmed in a semi-hydroponic system (EC=6 dS m(-1)) on the basis of the higher growth performance of homozygous TG3 lines with respect to their respective azygous control lines without the transgene. The halotolerance observed confirmed the inheritance of the trait and supports the potential usefulness of the HAL1 gene of S. cerevisiae as a molecular tool for genetic engineering of salt-stress protection in other crop species. PMID:12783167

  15. Functional roles of the pepper RING finger protein gene, CaRING1, in abscisic acid signaling and dehydration tolerance.

    Science.gov (United States)

    Lim, Chae Woo; Hwang, Byung Kook; Lee, Sung Chul

    2015-09-01

    Plants are constantly exposed to a variety of biotic and abiotic stresses, which include pathogens and conditions of high salinity, low temperature, and drought. Abscisic acid (ABA) is a major plant hormone involved in signal transduction pathways that mediate the defense response of plants to abiotic stress. Previously, we isolated Ring finger protein gene (CaRING1) from pepper (Capsicum annuum), which is associated with resistance to bacterial pathogens, accompanied by hypersensitive cell death. Here, we report a new function of the CaRING1 gene product in the ABA-mediated defense responses of plants to dehydration stress. The expression of the CaRING1 gene was induced in pepper leaves treated with ABA or exposed to dehydration or NaCl. Virus-induced gene silencing of CaRING1 in pepper plants exhibited low degree of ABA-induced stomatal closure and high levels of transpirational water loss in dehydrated leaves. These led to be more vulnerable to dehydration stress in CaRING1-silenced pepper than in the control pepper, accompanied by reduction of ABA-regulated gene expression and low accumulation of ABA and H2O2. In contrast, CaRING1-overexpressing transgenic plants showed enhanced sensitivity to ABA during the seedling growth and establishment. These plants were also more tolerant to dehydration stress than the wild-type plants because of high ABA accumulation, enhanced stomatal closure and increased expression of stress-responsive genes. Together, these results suggest that the CaRING1 acts as positive factor for dehydration tolerance in Arabidopsis by modulating ABA biosynthesis and ABA-mediated stomatal closing and gene expression. PMID:26249046

  16. Overexpression of the brassinosteroid biosynthetic gene DWF4 in Brassica napus simultaneously increases seed yield and stress tolerance.

    Science.gov (United States)

    Sahni, Sangita; Prasad, Bishun D; Liu, Qing; Grbic, Vojislava; Sharpe, Andrew; Singh, Surinder P; Krishna, Priti

    2016-01-01

    As a resource allocation strategy, plant growth and defense responses are generally mutually antagonistic. Brassinosteroid (BR) regulates many aspects of plant development and stress responses, however, genetic evidence of its integrated effects on plant growth and stress tolerance is lacking. We overexpressed the Arabidopsis BR biosynthetic gene AtDWF4 in the oilseed plant Brassica napus and scored growth and stress response phenotypes. The transgenic B. napus plants, in comparison to wild type, displayed increased seed yield leading to increased overall oil content per plant, higher root biomass and root length, significantly better tolerance to dehydration and heat stress, and enhanced resistance to necrotrophic fungal pathogens Leptosphaeria maculans and Sclerotinia sclerotiorum. Transcriptome analysis supported the integrated effects of BR on growth and stress responses; in addition to BR responses associated with growth, a predominant plant defense signature, likely mediated by BES1/BZR1, was evident in the transgenic plants. These results establish that BR can interactively and simultaneously enhance abiotic and biotic stress tolerance and plant productivity. The ability to confer pleiotropic beneficial effects that are associated with different agronomic traits suggests that BR-related genes may be important targets for simultaneously increasing plant productivity and performance under stress conditions. PMID:27324083

  17. Transgenic tobacco plants expressing BoRS1 gene from Brassica oleracea var. acephala show enhanced tolerance to water stress

    Indian Academy of Sciences (India)

    Dongqin Tang; Hongmei Qian; Lingxia Zhao; Danfeng Huang; Kexuan Tang

    2005-12-01

    Water stress is by far the leading environmental stress limiting crop yields worldwide. Genetic engineering techniques hold great promise for developing crop cultivars with high tolerance to water stress. In this study, the Brassica oleracea var. acephala BoRS1 gene was transferred into tobacco through Agrobacterium-mediated leaf disc transformation. The transgenic status and transgene expression of the transgenic plants was confirmed by polymerase chain reaction (PCR) analysis, Southern hybridization and semi-quantitative one step RT-PCR analysis respectively. Subsequently, the growth status under water stress, and physiological responses to water stress of transgenic tobacco were studied. The results showed that the transgenic plants exhibited better growth status under water stress condition compared to the untransformed control plants. In physiological assessment of water tolerance, transgenic plants showed more dry matter accumulation and maintained significantly higher levels of leaf chlorophyll content along with increasing levels of water stress than the untransformed control plants. This study shows that BoRS1 is a candidate gene in the engineering of crops for enhanced water stress tolerance.

  18. Expression of Echmr gene from Eichhornia offers multiple stress tolerance to Cd sensitive Escherichia coli Δgsh mutants.

    Science.gov (United States)

    Thapa, G; Das, D; Gunupuru, L R

    2016-09-01

    The detoxification of heavy metals frequently involves conjugation to glutathione prior to compartmentalization and eflux in higher plants. We have expressed a heavy metal stress responsive (Echmr) gene from water hyacinth, which conferred tolerance to Cd sensitive Escherichia coli Δgsh mutants against heavy metals and abiotic stresses. The recombinant E. coli Δgsh mutant cells showed better growth recovery and survival than control cells under Cd (200 μM), Pb(200 μM), heat shock (50 °C), cold stress at 4 °C for 4 h, and UV-B (20 min) exposure. The enhanced expression of Echmr gene revealed by northern analysis during above stresses further advocates its role in multi-stress tolerance. Heterologous expression of EcHMR from Eichhornia rescued Cd(2+) sensitive E. coli mutants from Cd(2+) toxicity and induced better recovery post abiotic stresses. This may suggests a possible role of Echmr in Cd(II) and desiccation tolerance in plants for enhanced stress response. PMID:27457806

  19. Seleção de genótipos de Brachiaria Ruziziensis quanto ao alumínio em solução nutritiva: II: Avaliação da tolerância ao alumínio Brachiaria Ruziziensis genotypes selection: II: Evaluation of the aluminum tolerance

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Balbino Miguel

    2011-01-01

    Full Text Available O alumínio, em solos ácidos, é um dos principais responsáveis pela baixa produtividade de culturas. O objetivo deste trabalho foi avaliar a variabilidade genética da Brachiaria ruziziensis para a tolerância ao alumínio. Foram utilizados 10 genótipos da espécie referida, crescidas em vasos com 0, 30 e 60 mg/L de alumínio em solução nutritiva. Foi utilizado o delineamento inteiramente casualizado em esquema fatorial, com seis repetições e parcelas de uma planta por vaso. Foram avaliados: a produção de massa verde da parte aérea e raízes (MVPA e MVR, a produção de matéria seca da parte aérea e raízes (MSPA e MSR, o incremento no crescimento da parte aérea e das raízes (IPA e IR, expresso pela diferença entre o crescimento final e o inicial, e o incremento no número de perfilhos (INP. O aumento nas concentrações de alumínio provocou decréscimos para as médias de todas as características avaliadas, excetuando o IR. A ausência de diferenças do genótipo 8 para seis das sete características analisadas, com exceção da MVPA, demonstra ser ela a mais promissora para estudos posteriores em melhoramento, visando maior produtividade em solos ácidos. Os resultados evidenciaram a existência de variabilidade genética entre os genótipos avaliados para a tolerância ao alumínio tóxico, sendo possível identificar materiais mais produtivos na presença desse metal.In acid soils, the aluminum is responsible for the low cultures productivity. The objective of this work was to evaluate the Brachiaria ruziziensis genetic variability for the aluminum tolerance.10 genotypes of that species were used, grown in vases with 0, 30 and 60 mg/L of aluminum in nutritious solution. A completely randomized design under 10 x 3 factorial, with six replicates. The following variables were evaluated: the green mass production of the aerial part and roots (MVPA and MVR, the dry matter production of the aerial part and roots (MSPA and MSR

  20. Tolerance and responsive gene expression of Sogatella furcifera under extreme temperature stresses are altered by its vectored plant virus.

    Science.gov (United States)

    Xu, Donglin; Zhong, Ting; Feng, Wendi; Zhou, Guohui

    2016-01-01

    Southern rice black-streaked dwarf virus (SRBSDV), a newly emerged fijivirus causing great loss to rice production in eastern and southeastern Asian countries in recent years, is efficiently transmitted by a rice pest, white-backed planthopper (WBPH, Sogatella furcifera) in a persistent, circulative propagative manner and can be considered as an insect virus. In this study, SRBSDV infection in WBPH was found to increase the vector's death rate under extreme cold stress but improve its survival rate under extreme heat stress. Digital gene expression profiling based on RNA-Seq revealed different gene regulation patterns in WBPH under viral and/or temperature stress. Under cold stress, the virus infection upregulated 1540 genes and downregulated 131 genes in the insect, most of which were related to membrane properties and biological processes of actin and cytoskeleton; whereas under heat stress, it upregulated 363 genes and downregulated 548 genes, most of which were associated to metabolism and intracellular organelles. Several types of stress-responsive genes involving intestinal mucin, cuticle protein, ubiquitin protease, immune response, RNA interference and heat shock response, were largely upregulated under cold stress, but largely downregulated under heat stress, by SRBSDV infection. Our results suggest two distinct mechanisms of virus-altered vector insect tolerance to temperature stress. PMID:27531640

  1. Overexpression of a multiple stress-responsive gene, ZmMPK4, enhances tolerance to low temperature in transgenic tobacco.

    Science.gov (United States)

    Zhou, Yan; Zhang, Dan; Pan, Jiaowen; Kong, Xiangpei; Liu, Yukun; Sun, Liping; Wang, Li; Li, Dequan

    2012-09-01

    Mitogen-activated protein kinase (MAPK) cascades play important roles in mediating biotic and abiotic stress responses. In this study, we found that ZmMPK4 protein was predominantly localized in the nucleus. Semi-quantitative RT-PCR analysis revealed that the ZmMPK4 transcription in maize leaves was up-regulated by low temperature, high temperature and exogenous signaling molecules such as hydrogen peroxide, methyl jasmonate and ethephon. Hydrogen peroxide acted as second messenger to mediate 4°C-induced up-regulation of ZmMPK4 mRNA. Transgenic tobacco of overexpressing ZmMPK4 accumulated less reactive oxygen species (ROS), more peroxidase and catalase activities, more proline and soluble sugar contents, and more stress-responsive genes expression, leading to enhancing low temperature stress tolerance compared to the control plants. Taken together, these results strongly suggest that ZmMPK4 positively regulates low temperature stress tolerance in plants.

  2. Over-Expression of ScMnSOD, a SOD Gene Derived from Jojoba, Improve Drought Tolerance in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    LIU Xiao-fei; ZHANG Gen-fa; SUN Wei-min; LI Ze-qin; BAI Rui-xue; LI Jing-xiao; SHI Zi-han; GENG Hong-wei; ZHENG Ying; ZHANG Jun

    2013-01-01

    Jojoba (Simmondsia chinensis) is mainly distributed in desert, and the molecular mechanisms of jojoba in response to abiotic stress still remain elusive. In this paper, we cloned and characterized a SOD gene from jojoba named as ScMnSOD, and introduced into Arabidopsis to investigate its functions of responding to drought stress. The transgenic Arabidopsis showed an improvement in drought tolerance. Moreover, under a water deifcit condition, the accumulation of reactive oxygen species (ROS) was remarkably decreased in the transgenic lines compared to the WT. Furthermore, the ScMnSOD promoter was cloned to the 5´-upstream of GUS coding region in a binary vector, and introduced into Arabidopsis. And results showed that ScMnSOD expression can be induced by drought, salt, ABA, and low temperature. In conclusion, ScMnSOD plays an important role in drought tolerance which is, at least partially, attributed to its role in ROS detoxiifcation.

  3. Salt tolerance conferred by over-expression of OsNHX1 gene in Poplar 84K

    Institute of Scientific and Technical Information of China (English)

    WANG Shuyao; CHEN Qijun; WANG Wenlong; WANG Xuechen; LU Mengzhu

    2005-01-01

    OsNHX1 gene (Na+/H+ antiporter gene of Oryza sativa L.) was introduced into Poplar 84K with Agrobacterium tumefaciens-mediated transformation. PCR, Southern and Northern blot analysis showed that OsNHX1 gene was incorporated successfully into the genome of Poplar 84K and expressed in these transgenic plants. Salt tolerance test showed that three lines of transgenic plants grew normally in the presence of 200 mmol/L NaCl, while the Na+ content in the leaves of the transgenic plants grown at 200 mmol/L NaCl was significantly higher than that in plants grown at 0 mmol/L NaCl. The osmotic potential in the transgenic plants with high salinity treatment was lower than that of control plants. Our results demonstrate the potential use of these transgenic plants for agricultural use in saline soils.

  4. Enhanced cadmium accumulation and tolerance in transgenic tobacco overexpressing rice metal tolerance protein gene OsMTP1 is promising for phytoremediation.

    Science.gov (United States)

    Das, Natasha; Bhattacharya, Surajit; Maiti, Mrinal K

    2016-08-01

    One of the most grievous heavy metal pollutants in the environment is cadmium (Cd), which is not only responsible for the crop yield loss owing to its phytotoxicity, but also for the human health hazards as the toxic elements usually accumulate in the consumable parts of crop plants. In the present study, we aimed to isolate and functionally characterize the OsMTP1 gene from indica rice (Oryza sativa L. cv. IR64) to study its potential application for efficient phytoremediation of Cd. The 1257 bp coding DNA sequence (CDS) of OsMTP1 encodes a ∼46 kDa protein belonging to the cation diffusion facilitator (CDF) or metal tolerance/transport protein (MTP) family. The OsMTP1 transcript in rice plant was found to respond during external Cd stress. Heterologous expression of OsMTP1 in tobacco resulted in the reduction of Cd stress-induced phytotoxic effects, including growth inhibition, lipid peroxidation, and cell death. Compared to untransformed control, the transgenic tobacco plants showed enhanced vacuolar thiol content, indicating vacuolar localization of the sequestered Cd. The transgenic tobacco plants exhibited significantly higher biomass growth (2.2-2.8-folds) and hyperaccumulation of Cd (1.96-2.22-folds) compared to untransformed control under Cd exposure. The transgenic plants also showed moderate tolerance and accumulation of arsenic (As) upon exogenous As stress, signifying broad substrate specificity of OsMTP1. Together, findings of our research suggest that the transgenic tobacco plants overexpressing OsMTP1 with its hyperaccumulating activity and increased growth rate could be useful for future phytoremediation applications to clean up the Cd-contaminated soil. PMID:27214086

  5. 21 CFR 182.2122 - Aluminum calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Aluminum calcium silicate. 182.2122 Section 182.2122 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED....2122 Aluminum calcium silicate. (a) Product. Aluminum calcium silicate. (b) Tolerance. 2 percent....

  6. 21 CFR 582.2122 - Aluminum calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aluminum calcium silicate. 582.2122 Section 582.2122 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED....2122 Aluminum calcium silicate. (a) Product. Aluminum calcium silicate. (b) Tolerance. 2 percent....

  7. Superantigen-induced CD4+ T cell tolerance is associated with DNA methylation and histone hypo-acetylation at cytokine gene loci.

    Science.gov (United States)

    Thomas, R M; Saouaf, S J; Wells, A D

    2007-10-01

    Anergy is an important mechanism of peripheral tolerance in which T cells lose the capacity to produce proinflammatory cytokines such as interleukin-2 (IL-2) and interferon-gamma (IFNgamma). To determine whether the induction of T-cell anergy in vivo is associated with epigenetic changes that oppose cytokine gene expression, we measured DNA methylation and histone acetylation at the IL2 and IFNgamma loci in CD4+ T cells from mice tolerant to a viral superantigen. Tolerant T cells exhibited more DNA methylation and less histone acetylation at the regulatory regions of the IL2 and IFNgamma genes than effector T cells, which are able to produce IL-2 and IFNgamma. These data show that T-cell anergy in this model is associated with epigenetic modifications that oppose gene expression, and suggest that these mechanisms may be important in the maintenance of tolerance. PMID:17671507

  8. Overexpression of a zinc-finger protein gene from rice confers tolerance to cold, dehydration, and salt stress in transgenic tobacco

    OpenAIRE

    Mukhopadhyay, Arnab; Vij, Shubha; Tyagi, Akhilesh K

    2004-01-01

    Stress perception and signal transduction leading to tolerance involve a complex interplay of different gene products. We describe here the isolation and characterization of an intronless gene (OSISAP1) from rice encoding a zinc-finger protein that is induced after different types of stresses, namely cold, desiccation, salt, submergence, and heavy metals as well as injury. The gene is also induced by stress hormone abscisic acid. Overexpression of the gene in transgenic tobacco conferred tole...

  9. Transcriptome analysis of acetic-acid-treated yeast cells identifies a large set of genes whose overexpression or deletion enhances acetic acid tolerance.

    Science.gov (United States)

    Lee, Yeji; Nasution, Olviyani; Choi, Eunyong; Choi, In-Geol; Kim, Wankee; Choi, Wonja

    2015-08-01

    Acetic acid inhibits the metabolic activities of Saccharomyces cerevisiae. Therefore, a better understanding of how S. cerevisiae cells acquire the tolerance to acetic acid is of importance to develop robust yeast strains to be used in industry. To do this, we examined the transcriptional changes that occur at 12 h post-exposure to acetic acid, revealing that 56 and 58 genes were upregulated and downregulated, respectively. Functional categorization of them revealed that 22 protein synthesis genes and 14 stress response genes constituted the largest portion of the upregulated and downregulated genes, respectively. To evaluate the association of the regulated genes with acetic acid tolerance, 3 upregulated genes (DBP2, ASC1, and GND1) were selected among 34 non-protein synthesis genes, and 54 viable mutants individually deleted for the downregulated genes were retrieved from the non-essential haploid deletion library. Strains overexpressing ASC1 and GND1 displayed enhanced tolerance to acetic acid, whereas a strain overexpressing DBP2 was sensitive. Fifty of 54 deletion mutants displayed enhanced acetic acid tolerance. Three chosen deletion mutants (hsps82Δ, ato2Δ, and ssa3Δ) were also tolerant to benzoic acid but not propionic and sorbic acids. Moreover, all those five (two overexpressing and three deleted) strains were more efficient in proton efflux and lower in membrane permeability and internal hydrogen peroxide content than controls. Individually or in combination, those physiological changes are likely to contribute at least in part to enhanced acetic acid tolerance. Overall, information of our transcriptional profile was very useful to identify molecular factors associated with acetic acid tolerance.

  10. HyPRP1 Gene Suppressed by Multiple Stresses Plays a Negative Role in Abiotic Stress Tolerance in Tomato.

    Science.gov (United States)

    Li, Jinhua; Ouyang, Bo; Wang, Taotao; Luo, Zhidan; Yang, Changxian; Li, Hanxia; Sima, Wei; Zhang, Junhong; Ye, Zhibiao

    2016-01-01

    Many hybrid proline-rich protein (HyPRP) genes respond to biotic and abiotic stresses in plants, but little is known about their roles other than as putative cell-wall structural proteins. A HyPRP1 gene encodes a protein with proline-rich domain, and an eight-cysteine motif was identified from our previous microarray experiments on drought-tolerant tomato. In this study, the expression of the HyPRP1 gene in tomato was suppressed under various abiotic stresses, such as drought, high salinity, cold, heat, and oxidative stress. Transgenic functional analysis showed no obvious changes in phenotypes, but enhanced tolerance to various abiotic stresses (e.g., oxidative stress, dehydration, and salinity) was observed in RNAi transgenic plants. Interestingly, several SO2 detoxification-related enzymes, including sulfite oxidase, ferredoxins (Fds), and methionine sulfoxide reductase A (Msr A), were revealed in HyPRP1-interacting proteins identified by Yeast Two-Hybrid screening. More sulfates and transcripts of Msr A and Fds were accumulated in HyPRP1 knockdown lines when wild-type plants were exposed to SO2 gas. Our findings illustrate that the tomato HyPRP1 is a negative regulator of salt and oxidative stresses and is probably involved in sulfite metabolism. PMID:27446190

  11. HyPRP1 Gene Suppressed by Multiple Stresses Plays a Negative Role in Abiotic Stress Tolerance in Tomato

    Science.gov (United States)

    Li, Jinhua; Ouyang, Bo; Wang, Taotao; Luo, Zhidan; Yang, Changxian; Li, Hanxia; Sima, Wei; Zhang, Junhong; Ye, Zhibiao

    2016-01-01

    Many hybrid proline-rich protein (HyPRP) genes respond to biotic and abiotic stresses in plants, but little is known about their roles other than as putative cell-wall structural proteins. A HyPRP1 gene encodes a protein with proline-rich domain, and an eight-cysteine motif was identified from our previous microarray experiments on drought-tolerant tomato. In this study, the expression of the HyPRP1 gene in tomato was suppressed under various abiotic stresses, such as drought, high salinity, cold, heat, and oxidative stress. Transgenic functional analysis showed no obvious changes in phenotypes, but enhanced tolerance to various abiotic stresses (e.g., oxidative stress, dehydration, and salinity) was observed in RNAi transgenic plants. Interestingly, several SO2 detoxification-related enzymes, including sulfite oxidase, ferredoxins (Fds), and methionine sulfoxide reductase A (Msr A), were revealed in HyPRP1-interacting proteins identified by Yeast Two-Hybrid screening. More sulfates and transcripts of Msr A and Fds were accumulated in HyPRP1 knockdown lines when wild-type plants were exposed to SO2 gas. Our findings illustrate that the tomato HyPRP1 is a negative regulator of salt and oxidative stresses and is probably involved in sulfite metabolism. PMID:27446190

  12. Cloning of the Lycopene β-cyclase Gene in Nicotiana tabacum and Its Overexpression Confers Salt and Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yanmei Shi

    2015-12-01

    Full Text Available Carotenoids are important pigments in plants that play crucial roles in plant growth and in plant responses to environmental stress. Lycopene β cyclase (β-LCY functions at the branch point of the carotenoid biosynthesis pathway, catalyzing the cyclization of lycopene. Here, a β-LCY gene from Nicotiana tabacum, designated as Ntβ-LCY1, was cloned and functionally characterized. Robust expression of Ntβ-LCY1 was found in leaves, and Ntβ-LCY1 expression was obviously induced by salt, drought, and exogenous abscisic acid treatments. Strong accumulation of carotenoids and expression of carotenoid biosynthesis genes resulted from Ntβ-LCY1 overexpression. Additionally, compared to wild-type plants, transgenic plants with overexpression showed enhanced tolerance to salt and drought stress with higher abscisic acid levels and lower levels of malondialdehyde and reactive oxygen species. Conversely, transgenic RNA interference plants had a clear albino phenotype in leaves, and some plants did not survive beyond the early developmental stages. The suppression of Ntβ-LCY1 expression led to lower expression levels of genes in the carotenoid biosynthesis pathway and to reduced accumulation of carotenoids, chlorophyll, and abscisic acid. These results indicate that Ntβ-LCY1 is not only a likely cyclization enzyme involved in carotenoid accumulation but also confers salt and drought stress tolerance in Nicotiana tabacum.

  13. Tolerance of Deregulated G1/S Transcription Depends on Critical G1/S Regulon Genes to Prevent Catastrophic Genome Instability

    Directory of Open Access Journals (Sweden)

    Catia Caetano

    2014-12-01

    Full Text Available Expression of a G1/S regulon of genes that are required for DNA replication is a ubiquitous mechanism for controlling cell proliferation; moreover, the pathological deregulated expression of E2F-regulated G1/S genes is found in every type of cancer. Cellular tolerance of deregulated G1/S transcription is surprising because this regulon includes many dosage-sensitive proteins. Here, we used the fission yeast Schizosaccharomyces pombe to investigate this issue. We report that deregulating the MBF G1/S regulon by eliminating the Nrm1 corepressor increases replication errors. Homology-directed repair proteins, including MBF-regulated Ctp1CtIP, are essential to prevent catastrophic genome instability. Surprisingly, the normally inconsequential MBF-regulated S-phase cyclin Cig2 also becomes essential in the absence of Nrm1. This requirement was traced to cyclin-dependent kinase inhibition of the MBF-regulated Cdc18Cdc6 replication origin-licensing factor. Collectively, these results establish that, although deregulation of G1/S transcription is well tolerated by cells, nonessential G1/S target genes become crucial for preventing catastrophic genome instability.

  14. Overexpression of a Stress-Responsive NAC Transcription Factor Gene ONAC022 Improves Drought and Salt Tolerance in Rice.

    Science.gov (United States)

    Hong, Yongbo; Zhang, Huijuan; Huang, Lei; Li, Dayong; Song, Fengming

    2016-01-01

    The NAC transcription factors play critical roles in regulating stress responses in plants. However, the functions for many of the NAC family members in rice are yet to be identified. In the present study, a novel stress-responsive rice NAC gene, ONAC022, was identified. Expression of ONAC022 was induced by drought, high salinity, and abscisic acid (ABA). The ONAC022 protein was found to bind specifically to a canonical NAC recognition cis-element sequence and showed transactivation activity at its C-terminus in yeast. The ONAC022 protein was localized to nucleus when transiently expressed in Nicotiana benthamiana. Three independent transgenic rice lines with overexpression of ONAC022 were generated and used to explore the function of ONAC022 in drought and salt stress tolerance. Under drought stress condition in greenhouse, soil-grown ONAC022-overexpressing (N22oe) transgenic rice plants showed an increased drought tolerance, leading to higher survival ratios and better growth than wild-type (WT) plants. When grown hydroponically in Hogland solution supplemented with 150 mM NaCl, the N22oe plants displayed an enhanced salt tolerance and accumulated less Na(+) in roots and shoots as compared to WT plants. Under drought stress condition, the N22oe plants exhibited decreased rates of water loss and transpiration, reduced percentage of open stomata and increased contents of proline and soluble sugars. However, the N22oe lines showed increased sensitivity to exogenous ABA at seed germination and seedling growth stages but contained higher level of endogenous ABA. Expression of some ABA biosynthetic genes (OsNCEDs and OsPSY), signaling and regulatory genes (OsPP2C02, OsPP2C49, OsPP2C68, OsbZIP23, OsAP37, OsDREB2a, and OsMYB2), and late stress-responsive genes (OsRAB21, OsLEA3, and OsP5CS1) was upregulated in N22oe plants. Our data demonstrate that ONAC022 functions as a stress-responsive NAC with transcriptional activator activity and plays a positive role in drought

  15. Overexpression of a stress-responsive NAC transcription factor gene ONAC022 improves drought and salt tolerance in rice

    Directory of Open Access Journals (Sweden)

    Yongbo eHong

    2016-01-01

    Full Text Available The NAC transcription factors play critical roles in regulating stress responses in plants. However, the functions for many of the NAC family members in rice are yet to be identified. In the present study, a novel stress-responsive rice NAC gene, ONAC022, was identified. Expression of ONAC022 was induced by drought, high salinity and abscisic acid (ABA. The ONAC022 protein was found to bind specifically to a canonical NAC recognition cis-element sequence and showed transactivation activity at its C-terminus in yeast. The ONAC022 protein was localized to nucleus when transiently expressed in Nicotiana benthamiana. Three independent transgenic rice lines with overexpression of ONAC022 were generated and used to explore the function of ONAC022 in drought and salt stress tolerance. Under drought stress condition in greenhouse, soil-grown ONAC022-overexpressing (N22oe transgenic rice plants showed an increased drought tolerance, leading to higher survival ratios and better growth than wild type plants. When grown hydroponically in Hogland solution supplemented with 150 mM NaCl, the N22oe plants displayed an enhanced salt tolerance and accumulated less Na+ in roots and shoots as compared to the wild type plants. Under drought stress condition, the N22oe plants exhibited decreased rates of water loss and transpiration, reduced percentage of open stomata and increased contents of proline and soluble sugars. However, the N22oe lines showed increased sensitivity to exogenous ABA at seed germination and seedling growth stages but contained higher level of endogenous ABA. Expression of some ABA biosynthetic genes (OsNCEDs and OsPSY, signaling and regulatory genes (OsPP2C02, OsPP2C49, OsPP2C68, OsbZIP23, OsAP37, OsDREB2a and OsMYB2 and late stress-responsive genes (OsRAB21, OsLEA3 and OsP5CS1 was upregulated in the N22oe plants. Our data demonstrate that ONAC022 functions as a stress-responsive NAC with transcriptional activator activity and plays a positive

  16. Seleção de populações de Lotus corniculatus L. com maior tolerância ao alumínio em solução nutritiva Selection of populations of Lotus corniculatus L. with increased tolerance to aluminum in nutrient solution

    Directory of Open Access Journals (Sweden)

    Aline Janke

    2010-11-01

    Full Text Available O experimento foi realizado com o objetivo de selecionar genótipos de Lotus corniculatus L. (Draco, São Gabriel e UFRGS mais tolerantes ao alumínio, utilizando-se a técnica de seleção em solução nutritiva. A solução continha 200 µmol/L de cálcio (CaCl2, 100 µmol/L de alumínio (AlCl3 e pH controlado na faixa de 4,1 a 4,3. Realizaram-se dois ciclos de seleção, nos quais as plântulas foram selecionadas pelo comprimento final das radículas. Posteriormente, avaliou-se o ganho genético alcançado nos ciclos de seleção, tanto nas populações originais como nas melhoradas, em um experimento com solução nutritiva com quatro concentrações de alumínio (0, 50, 100 e 150 µmol/L (AlCl3, por meio do crescimento radicular líquido. O uso de solução nutritiva foi eficiente na seleção de plântulas de cornichão tolerantes ao alumínio. Os materiais analisados apresentam diferenças em relação a esta característica, destacando-se o genótipo UFRGS F2, proveniente de dois ciclos de seleção, como o material com maior tolerância ao alumínio.The experiment was carried out to select genotypes of Lotus corniculatus L. (Draco, São Gabriel and UFRGS more tolerant to aluminum, using the technique of selection in nutrient solution. The solution contained 200 µmol/L calcium (CaCl2 and 100 µmol/L aluminum (AlCl3 and a pH controlled in the range from 4.1 to 4.3. It was performed two cycles of selection, in which the seedlings were selected by the root final length. Subsequently, the genetic gain achieved in the cycles of selection was tested, in original and improved populations in an experiment in nutrient solution with four concentrations of aluminum (0, 50, 100 and 150 µmol/L (AlCl3, by liquid root growth. Use of nutritional solution was efficient in the selection of seedlings of birdsfoot trefoil tolerant to aluminum. The materials analyzed differ for this characteristic, with the genotype UFRGS F2, being the most tolerant.

  17. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata”) and Their Interspecific Inbred Line “Maxchata”

    OpenAIRE

    Neelam Ara; Korakot Nakkanong; Wenhui Lv; Jinghua Yang; Zhongyuan Hu; Mingfang Zhang

    2013-01-01

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant inte...

  18. On a quest for stress tolerance genes: membrane transporters in sensing and adapting to hostile soils.

    Science.gov (United States)

    Shabala, Sergey; Bose, Jayakumar; Fuglsang, Anja Thoe; Pottosin, Igor

    2016-02-01

    Abiotic stresses such as salinity, drought, and flooding severely limit food and fibre production and result in penalties of in excess of US$100 billion per annum to the agricultural sector. Improved abiotic stress tolerance to these environmental constraints via traditional or molecular breeding practices requires a good understanding of the physiological and molecular mechanisms behind roots sensing of hostile soils, as well as downstream signalling cascades to effectors mediating plant adaptive responses to the environment. In this review, we discuss some common mechanisms conferring plant tolerance to these three major abiotic stresses. Central to our discussion are: (i) the essentiality of membrane potential maintenance and ATP production/availability and its use for metabolic versus adaptive responses; (ii) reactive oxygen species and Ca(2+) 'signatures' mediating stress signalling; and (iii) cytosolic K(+) as the common denominator of plant adaptive responses. We discuss in detail how key plasma membrane and tonoplast transporters are regulated by various signalling molecules and processes observed in plants under stress conditions (e.g. changes in membrane potential; cytosolic pH and Ca(2+); reactive oxygen species; polyamines; abscisic acid) and how these stress-induced changes are related to expression and activity of specific ion transporters. The reported results are then discussed in the context of strategies for breeding crops with improved abiotic stress tolerance. We also discuss a classical trade-off between tolerance and yield, and possible avenues for resolving this dilemma. PMID:26507891

  19. Integration of gene-based markers in a pearl millet genetic map for identification of candidate genes underlying drought tolerance quantitative trait loci

    Directory of Open Access Journals (Sweden)

    Sehgal Deepmala

    2012-01-01

    Full Text Available Abstract Background Identification of genes underlying drought tolerance (DT quantitative trait loci (QTLs will facilitate understanding of molecular mechanisms of drought tolerance, and also will accelerate genetic improvement of pearl millet through marker-assisted selection. We report a map based on genes with assigned functional roles in plant adaptation to drought and other abiotic stresses and demonstrate its use in identifying candidate genes underlying a major DT-QTL. Results Seventy five single nucleotide polymorphism (SNP and conserved intron spanning primer (CISP markers were developed from available expressed sequence tags (ESTs using four genotypes, H 77/833-2, PRLT 2/89-33, ICMR 01029 and ICMR 01004, representing parents of two mapping populations. A total of 228 SNPs were obtained from 30.5 kb sequenced region resulting in a SNP frequency of 1/134 bp. The positions of major pearl millet linkage group (LG 2 DT-QTLs (reported from crosses H 77/833-2 × PRLT 2/89-33 and 841B × 863B were added to the present consensus function map which identified 18 genes, coding for PSI reaction center subunit III, PHYC, actin, alanine glyoxylate aminotransferase, uridylate kinase, acyl-CoA oxidase, dipeptidyl peptidase IV, MADS-box, serine/threonine protein kinase, ubiquitin conjugating enzyme, zinc finger C- × 8-C × 5-C × 3-H type, Hd3, acetyl CoA carboxylase, chlorophyll a/b binding protein, photolyase, protein phosphatase1 regulatory subunit SDS22 and two hypothetical proteins, co-mapping in this DT-QTL interval. Many of these candidate genes were found to have significant association with QTLs of grain yield, flowering time and leaf rolling under drought stress conditions. Conclusions We have exploited available pearl millet EST sequences to generate a mapped resource of seventy five new gene-based markers for pearl millet and demonstrated its use in identifying candidate genes underlying a major DT-QTL in this species. The reported gene

  20. A versatile and efficient markerless gene disruption system for Acidithiobacillus thiooxidans: application for characterizing a copper tolerance related multicopper oxidase gene.

    Science.gov (United States)

    Wen, Qing; Liu, Xiangmei; Wang, Huiyan; Lin, Jianqun

    2014-11-01

    The acidophilic bioleaching bacteria can usually survive in high concentrations of copper ions because of their special living environment. However, little is known about the copper homeostatic mechanisms of Acidithiobacillus thiooxidans, an important member of bioleaching bacteria. Here, a putative multicopper oxidase gene (cueO) was detected from the draft genome of A. thiooxidans ATCC 19377. The transcriptional level of cueO in response to 10 mM CuSO₄was upregulated 25.01 ± 2.59 folds. The response of P(cueO) to copper was also detected and might be stimulated by a putative CueR protein. Then, by using the counter-selectable marker lacZ and enhancing the expression of endonuclease I-SceI with tac promoter, a modified markerless gene disruption system was developed and the cueO gene disruption mutant (ΔcueO) of A. thiooxidans was successfully constructed with a markedly improved second homologous recombination frequency of 0.28 ± 0.048. The ΔcueO mutant was more sensitive to external copper and nearly completely lost the phenoloxidase activity; however, the activity could be restored after complementing the cueO gene. All results suggest the close relation of cueO gene to copper tolerance in A. thiooxidans. In addition, the developed efficient markerless gene knockout method can also be introduced into other Acidithiobacillus strains.

  1. Variation in Dehydration Tolerance, ABA Sensitivity and Related Gene Expression Patterns in D-Genome Progenitor and Synthetic Hexaploid Wheat Lines

    Directory of Open Access Journals (Sweden)

    Yumeto Kurahashi

    2009-06-01

    Full Text Available The wild wheat Aegilops tauschii Coss. has extensive natural variation available for breeding of common wheat. Drought stress tolerance is closely related to abscisic acid (ABA sensitivity. In this study, 17 synthetic hexaploid wheat lines, produced by crossing the tetraploid wheat cultivar Langdon with 17 accessions of Ae. tauschii, were used for comparative analysis of natural variation in drought tolerance and ABA sensitivity. Ae. tauschii showed wide natural variation, with weak association between the traits. Drought-sensitive accessions of Ae. tauschii exhibited significantly less ABA sensitivity. D-genome variations observed at the diploid genome level were not necessarily reflected in synthetic wheats. However, synthetic wheats derived from the parental Ae. tauschii accessions with high drought tolerance were significantly more tolerant to drought stress than those from drought-sensitive accessions. Moreover, synthetic wheats with high drought tolerance showed significantly higher ABA sensitivity than drought-sensitive synthetic lines. In the hexaploid genetic background, therefore, weak association of ABA sensitivity with drought tolerance wasobserved. To study differences in gene expression patterns between stress-tolerant and -sensitive lines, levels of two Cor/Lea and three transcription factor gene transcripts were compared. The more tolerant accession of Ae. tauschii tended to accumulate more abundant transcripts of the examined genes than the sensitive accession under stress conditions. The expression patterns in the synthetic wheats seemed to be additive for parental lines exposed to drought and ABA treatments. However, the transcript levels of transcription factor genes in the synthetic wheats did not necessarily correspond to the postulated levels based on expression in parental lines. Allopolyploidization altered the expression levels of the stress-responsive genes in synthetic wheats.

  2. Bistable expression of virulence genes in salmonella leads to the formation of an antibiotic-tolerant subpopulation.

    Directory of Open Access Journals (Sweden)

    Markus Arnoldini

    2014-08-01

    Full Text Available Phenotypic heterogeneity can confer clonal groups of organisms with new functionality. A paradigmatic example is the bistable expression of virulence genes in Salmonella typhimurium, which leads to phenotypically virulent and phenotypically avirulent subpopulations. The two subpopulations have been shown to divide labor during S. typhimurium infections. Here, we show that heterogeneous virulence gene expression in this organism also promotes survival against exposure to antibiotics through a bet-hedging mechanism. Using microfluidic devices in combination with fluorescence time-lapse microscopy and quantitative image analysis, we analyzed the expression of virulence genes at the single cell level and related it to survival when exposed to antibiotics. We found that, across different types of antibiotics and under concentrations that are clinically relevant, the subpopulation of bacterial cells that express virulence genes shows increased survival after exposure to antibiotics. Intriguingly, there is an interplay between the two consequences of phenotypic heterogeneity. The bet-hedging effect that arises through heterogeneity in virulence gene expression can protect clonal populations against avirulent mutants that exploit and subvert the division of labor within these populations. We conclude that bet-hedging and the division of labor can arise through variation in a single trait and interact with each other. This reveals a new degree of functional complexity of phenotypic heterogeneity. In addition, our results suggest a general principle of how pathogens can evade antibiotics: Expression of virulence factors often entails metabolic costs and the resulting growth retardation could generally increase tolerance against antibiotics and thus compromise treatment.

  3. Analysis of Stress-Responsive Gene Expression in Cultivated and Weedy Rice Differing in Cold Stress Tolerance.

    Science.gov (United States)

    Bevilacqua, Caroline Borges; Basu, Supratim; Pereira, Andy; Tseng, Te-Ming; Zimmer, Paulo Dejalma; Burgos, Nilda Roma

    2015-01-01

    Rice (Oryza sativa L.) cultivars show impairment of growth in response to environmental stresses such as cold at the early seedling stage. Locally adapted weedy rice is able to survive under adverse environmental conditions, and can emerge in fields from greater soil depth. Cold-tolerant weedy rice can be a good genetic source for developing cold-tolerant, weed-competitive rice cultivars. An in-depth analysis is presented here of diverse indica and japonica rice genotypes, mostly weedy rice, for cold stress response to provide an understanding of different stress adaptive mechanisms towards improvement of the rice crop performance in the field. We have tested a collection of weedy rice genotypes to: 1) classify the subspecies (ssp.) grouping (japonica or indica) of 21 accessions; 2) evaluate their sensitivity to cold stress; and 3) analyze the expression of stress-responsive genes under cold stress and a combination of cold and depth stress. Seeds were germinated at 25°C at 1.5- and 10-cm sowing depth for 10d. Seedlings were then exposed to cold stress at 10°C for 6, 24 and 96h, and the expression of cold-, anoxia-, and submergence-inducible genes was analyzed. Control plants were seeded at 1.5cm depth and kept at 25°C. The analysis revealed that cold stress signaling in indica genotypes is more complex than that of japonica as it operates via both the CBF-dependent and CBF-independent pathways, implicated through induction of transcription factors including OsNAC2, OsMYB46 and OsF-BOX28. When plants were exposed to cold + sowing depth stress, a complex signaling network was induced that involved cross talk between stresses mediated by CBF-dependent and CBF-independent pathways to circumvent the detrimental effects of stresses. The experiments revealed the importance of the CBF regulon for tolerance to both stresses in japonica and indica ssp. The mechanisms for cold tolerance differed among weedy indica genotypes and also between weedy indica and cultivated

  4. Analysis of Stress-Responsive Gene Expression in Cultivated and Weedy Rice Differing in Cold Stress Tolerance.

    Directory of Open Access Journals (Sweden)

    Caroline Borges Bevilacqua

    Full Text Available Rice (Oryza sativa L. cultivars show impairment of growth in response to environmental stresses such as cold at the early seedling stage. Locally adapted weedy rice is able to survive under adverse environmental conditions, and can emerge in fields from greater soil depth. Cold-tolerant weedy rice can be a good genetic source for developing cold-tolerant, weed-competitive rice cultivars. An in-depth analysis is presented here of diverse indica and japonica rice genotypes, mostly weedy rice, for cold stress response to provide an understanding of different stress adaptive mechanisms towards improvement of the rice crop performance in the field. We have tested a collection of weedy rice genotypes to: 1 classify the subspecies (ssp. grouping (japonica or indica of 21 accessions; 2 evaluate their sensitivity to cold stress; and 3 analyze the expression of stress-responsive genes under cold stress and a combination of cold and depth stress. Seeds were germinated at 25°C at 1.5- and 10-cm sowing depth for 10d. Seedlings were then exposed to cold stress at 10°C for 6, 24 and 96h, and the expression of cold-, anoxia-, and submergence-inducible genes was analyzed. Control plants were seeded at 1.5cm depth and kept at 25°C. The analysis revealed that cold stress signaling in indica genotypes is more complex than that of japonica as it operates via both the CBF-dependent and CBF-independent pathways, implicated through induction of transcription factors including OsNAC2, OsMYB46 and OsF-BOX28. When plants were exposed to cold + sowing depth stress, a complex signaling network was induced that involved cross talk between stresses mediated by CBF-dependent and CBF-independent pathways to circumvent the detrimental effects of stresses. The experiments revealed the importance of the CBF regulon for tolerance to both stresses in japonica and indica ssp. The mechanisms for cold tolerance differed among weedy indica genotypes and also between weedy indica and

  5. Linhagens diaplóides de trigo: produção de grãos, características agronômicas e tolerância à toxicidade de alumínio Dihaploid wheat lines: grain yield, agronomic characteristics and tolerance to aluminum toxicity

    Directory of Open Access Journals (Sweden)

    CARLOS EDUARDO DE OLIVEIRA CAMARGO

    1999-01-01

    spike. All of them were tolerant to aluminum toxicity except IAC-287 (sensitive control.

  6. Aluminum Hydroxide

    Science.gov (United States)

    ... penicillamine (Cuprimine, Depen), prednisone (Deltasone, Orasone), products containing iron, tetracycline (Sumycin, Tetracap, and others), ticlopidine (Ticlid), and vitamins.be aware that aluminum hydroxide may interfere with other medicines, making them less ...

  7. Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum

    Indian Academy of Sciences (India)

    Xiuhong Yang; Chao Sun; Yuanlei Hun; Zhongping Lin

    2008-03-01

    A RING zinc finger ankyrin protein gene, designated AdZFP1, was isolated from drought-tolerant Artemisia desertorum Spreng by mRNA differential display and RACE. Its cDNA was 1723 bp and encoded a putative protein of 445 amino acids with a predicted molecular mass of 47.9 kDa and an isoelectric point (pI) of 7.49. A typical C3HC4-type RING finger domain was found at the C-terminal region of the AdZFP1 protein, and several groups of ankyrin repeats were found at the N-terminal region. Alignments of amino acid sequence showed that AdZFP1 was 66% identical to the Arabidopsis thaliana putative RING zinc finger ankyrin protein AAN31869. Transcriptional analysis showed that AdZFP1 was inducible under drought stress in root, stem and leaf of the plant. Semi-quantitative reverse-transcriptase-polymerase chain reaction (RT-PCR) analysis showed that the transcript of AdZFP1 was strongly induced by exogenous abscisic acid (ABA) and also by salinity, cold and heat to some extent. Overexpression of the AdZFP1 gene in transgenic tobacco enhanced their tolerance to drought stress.

  8. The Cotton WRKY Gene GhWRKY41 Positively Regulates Salt and Drought Stress Tolerance in Transgenic Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Xiaoqian Chu

    Full Text Available WRKY transcription factors constitute a very large family of proteins in plants and participate in modulating plant biological processes, such as growth, development and stress responses. However, the exact roles of WRKY proteins are unclear, particularly in non-model plants. In this study, Gossypium hirsutum WRKY41 (GhWRKY41 was isolated and transformed into Nicotiana benthamiana. Our results showed that overexpression of GhWRKY41 enhanced the drought and salt stress tolerance of transgenic Nicotiana benthamiana. The transgenic plants exhibited lower malondialdehyde content and higher antioxidant enzyme activity, and the expression of antioxidant genes was upregulated in transgenic plants exposed to osmotic stress. A β-glucuronidase (GUS staining assay showed that GhWRKY41 was highly expressed in the stomata when plants were exposed to osmotic stress, and plants overexpressing GhWRKY41 exhibited enhanced stomatal closure when they were exposed to osmotic stress. Taken together, our findings demonstrate that GhWRKY41 may enhance plant tolerance to stress by functioning as a positive regulator of stoma closure and by regulating reactive oxygen species (ROS scavenging and the expression of antioxidant genes.

  9. Comparison of four glyphosate tolerance genes%四个抗草甘膦基因的抗性比较

    Institute of Scientific and Technical Information of China (English)

    刘健; 肖雅文; 芦佳; 吴忠义; 张中保; 徐杰; 姚磊

    2015-01-01

    草甘膦抗性是当代农业重要的农艺性状。为了选择最佳的抗性基因用于植物筛选标记,通过选取 cp4-epsps 、GR79-epsps 、gat4621和 GAT 四个草甘膦抗性基因进行比较,在拟南芥中验证各基因对草甘膦的抗性。4个基因的转化苗经4个浓度的草甘膦喷施检测,结果显示,GAT 类基因的抗性明显高于epsps 类基因,基因间的差异达到了极显著水平。gat4621基因对草甘膦的抗性最好,在各浓度下存活率均表现为最高值,且抗性稳定。国内发掘的 GAT 基因对草甘膦也表现出良好的抗性。GAT 类基因的拟南芥转化苗在喷施高浓度草甘膦条件下出现严重抽苔抑制;但在停施草甘膦后抑制解除,且可以开花结实。转 epsps 类基因可以获得高抗草甘膦植株,但在花期喷施草甘膦将造成败育。从基因大小及抗性强弱考虑,GAT 类基因作为筛选标记基因应该更为适合。%Glyphosate tolerance is an important agronomic trait in modern agriculture.In order to determine the best glyphosate tolerance gene for plant selectable markers we compared four glyphosate tolerance genes,cp4-epsps ,GR79-epsps ,gat4621 and GAT,in Arabidopsis .Four transgenic plants harboring each gene were trea-ted with four different rates of glyphosate.The results showed that the resistance of plants with GAT gene was significantly higher than plants with the epsps gene.Plants with the gat4621 gene had the highest survival rate at all herbicide rates.The plants with the domestic GAT gene also had strong resistance.Reproductive devel-opment of Arabidopsis plants with the GAT gene was suppressed at higher glyphosate application rates.It was concluded that the GAT gene was more suitable as a selectable marker gene.

  10. GENETIC STABILITY ANALYSIS OF RB GENE IN GENETICALLY MODIFIED POTATO LINES TOLERANT TO Phytophthora infestans

    Directory of Open Access Journals (Sweden)

    Edy Listanto

    2016-02-01

    Full Text Available Development of potato cultivars with high levels of broad spectrum resistance is a key long-term management strategy against late blight disease caused by Phytophthora infestans. Six progeny lines of hybridization between transgenic potato Katahdin SP951 with non-transgenic Granola and Atlantic were selected based on agronomical characteristics and resistance to late blight disease. The study aimed to analyze the number of insertions and stability of inserted RB gene in the transgenic potato lines. The research was carried out through plant DNA extraction, southern blot analysis and polymerase chain reaction (PCR. Southern blot analysis was used to detect the number of inserts integrated into potato genome, while PCR analysis was used to detect stability of RB gene from generation to generation. The results showed that the progenies obtained from hybridization between Atlantic and transgenic Katahdin SP951 (lines No. 20 and 27 and between Granola and transgenic Katahdin SP951 (line No. 69 contained one copy number of RB gene, according to the probing of nptII. The result is similar to that of inserted RB gene found in the parental transgenic Katahdin SP951. The presence of RB gene in four different generations (G0, G1, G2 and G3 showed stable integration of the gene into the plant genome. The single copy number of RB gene will repress the occurrence of silencing gene expression. The stability analysis of RB gene can determine that the gene is still present in plant genome after several generations.

  11. A tandem array of CBF/DREB1 genes is located in a major freezing tolerance QTL region on Medicago truncatula chromosome 6

    OpenAIRE

    Tayeh, Nadim; Bahrman, Nasser; Sellier, Hélène; Bluteau, Aurélie; Blassiau, Christelle; Fourment, Joelle; Bellec, Arnaud; Debellé, Frederic; Lejeune-Henaut, Isabelle; Delbreil, Bruno

    2013-01-01

    Background Freezing provokes severe yield losses to different fall-sown annual legumes. Understanding the molecular bases of freezing tolerance is of great interest for breeding programs. Medicago truncatula Gaertn. is an annual temperate forage legume that has been chosen as a model species for agronomically and economically important legume crops. The present study aimed to identify positional candidate genes for a major freezing tolerance quantitative trait locus that was previously mapped...

  12. Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress.

    Science.gov (United States)

    Checker, Vibha G; Chhibbar, Anju K; Khurana, Paramjit

    2012-10-01

    Coping with different kinds of biotic and abiotic stresses is the foundation of sustainable agriculture. Although conventional breeding and marker-assisted selection are being employed in mulberry (Morus indica L.) to develop better varieties, nonetheless the longer time periods required for these approaches necessitates the use of precise biotechnological approaches for sustainable agriculture. In an attempt to improve stress tolerance of mulberry, an important plant of the sericulture industry, an encoding late embryogenesis abundant gene from barley (HVA1) was introduced into mulberry plants by Agrobacterium-mediated transformation. Transgenic mulberry with barley Hva1 under a constitutive promoter actin1 was shown to enhance drought and salinity tolerance. Here, we report that overexpression of barley Hva1 also confers cold tolerance in transgenic mulberry. Further, barley Hva1 gene under control of a stress-inducible promoter rd29A can effectively negate growth retardation under non-stress conditions and confer stress tolerance in transgenic mulberry. Transgenic lines display normal morphology to enhanced growth and an increased tolerance against drought, salt and cold conditions as measured by free proline, membrane stability index and PSII activity. Protein accumulation was detected under stress conditions confirming inductive expression of HVA1 in transgenics. Investigations to assess stress tolerance of these plants under field conditions revealed an overall better performance than the non-transgenic plants. Enhanced expression of stress responsive genes such as Mi dnaJ and Mi 2-cysperoxidin suggests that Hva1 can regulate downstream genes associated with providing abiotic stress tolerance. The investigation of transgenic lines presented here demonstrates the acquisition of tolerance against drought, salt and cold stress in plants overexpressing barley Hva1, indicating that Arabidopsis rd29A promoter can function in mulberry.

  13. Genome-wide RNAi screen reveals the E3 SUMO-protein ligase gene SIZ1 as a novel determinant of furfural tolerance in Saccharomyces cerevisiae

    OpenAIRE

    Xiao, Han; Zhao, Huimin

    2014-01-01

    Background Furfural is a major growth inhibitor in lignocellulosic hydrolysates and improving furfural tolerance of microorganisms is critical for rapid and efficient fermentation of lignocellulosic biomass. In this study, we used the RNAi-Assisted Genome Evolution (RAGE) method to select for furfural resistant mutants of Saccharomyces cerevisiae, and identified a new determinant of furfural tolerance. Results By using a genome-wide RNAi (RNA-interference) screen in S. cerevisiae for genes in...

  14. 外源水杨酸对铝胁迫下栝楼光合特性及耐铝性的影响%Effect of Exogenous SA on Photosynthesis and Al Tolerance of Trichosanthes kirilowii Maxim Under Aluminum Stress

    Institute of Scientific and Technical Information of China (English)

    高培培; 章艺; 吴玉环; 徐根娣; 郑人卫; 罗虹; 陈果果; 周桑桑; 刘鹏

    2012-01-01

    以耐铝品种安国栝楼和铝敏感品种浦江栝楼为试验材料,采用溶液培养法研究800μmol/L铝胁迫下,不同浓度水杨酸对2个栝楼品种的生长特性、光合特性及抗氧化酶活性、MDA和紫外吸收物含量的影响。结果表明,经过800μmol/L铝处理15d后,安国栝楼和浦江栝楼的相对根长、株高及地上部鲜重、叶绿素含量、最大光能转化效率(Fv/Fm)、最大荧光产量(Fm)及电子传递速率(ETR)明显下降,SOD、CAT活性却出现2种相反的变化趋势,显示出2个栝楼品种的耐铝性差异,POD活性和紫外吸收物含量降低,MDA含量及初始荧光(F0)升高。10,30,50μmol/L外源SA可不同程度地降低铝在根尖细胞壁中的积累、MDA含量及初始荧光(F0),提高栝楼的相对根长、株高、地上部鲜重、叶绿素含量及叶绿素荧光的相关指标和抗氧化酶活性。由此可知,外源SA通过提高栝楼抗氧化酶活性及光合作用能力增强栝楼抗铝毒能力。由隶属函数分析得出,SA具有缓解铝胁迫的效果,但并不能消除铝胁迫对栝楼生长的抑制作用。%A solution culture experiment was conducted to study the effects of different SA concentration on growth characteristics,photosynthesis,oxidation resistance,UV-B absorbing compounds and MDA content of two Trichosanthes kirilowii cultivars,Anguo(Al-tolerant genotype) and Pujiang(Al-sensitive genotype),under 800 μmol/L aluminum stress.The results showed that 800 μmol/L Al treated for 15 days,the relative root length,plant height and fresh shoot weight,chlorophyll content,the maximum energy conversion efficiency(Fv/Fm),maximum fluorescence yield(Fm) and electron transport rate(ETR) were significantly lower of the two T.kirilowii cultivars.SOD,CAT activity changed in the opposite trend,indicating the differences of the two T.kirilowii cultivars in aluminum tolerance,POD activity and UV-B absorbing compounds decreased,MDA content and initial

  15. Discovery of error-tolerant biclusters from noisy gene expression data

    OpenAIRE

    Gupta Rohit; Rao Navneet; Kumar Vipin

    2011-01-01

    Abstract Background An important analysis performed on microarray gene-expression data is to discover biclusters, which denote groups of genes that are coherently expressed for a subset of conditions. Various biclustering algorithms have been proposed to find different types of biclusters from these real-valued gene-expression data sets. However, these algorithms suffer from several limitations such as inability to explicitly handle errors/noise in the data; difficulty in discovering small bi...

  16. Field Supervisory Test of DREB-Transgenic Populus: Salt Tolerance, Long-Term Gene Stability and Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Nan Lu

    2014-05-01

    Full Text Available Improving saline resistance may be useful for reducing environmental susceptibility and improving yields in poplar plantations. However, the instability of genetically engineered traits and gene transfer reduce their usefulness and commercial value. To investigate whether the foreign gene is still present in the genome of receptor plants after seven years (i.e., long-term foreign gene stability and gene transfer, we randomly analyzed ten field-grown transgenic hybrid Populus ((Populus tomentosa × Populus bolleana × P. tomentosa carrying the DREB1 gene from Atriplex hortensis. The results of PCR and tissue culture experiments showed that AhDREB1 was present in the transgenic trees and was still expressed. However, the transcriptional expression level had decreased compared with that four years earlier. The PCR results also indicated no foreign gene in the genomic DNA of microorganisms in the soil near the transgenic poplars, indicating that no significant gene transfer had occurred from the transgenic poplars to the microorganisms at seven years after planting.

  17. Candidate genes for drought tolerance and improved productivity in rice (Oryza sativa L.)

    Indian Academy of Sciences (India)

    M S Vinod; Naveen Sharma; K Manjunatha; Adnan Kanbar; N B Prakash; H E Shashidhar

    2006-03-01

    Candidate genes are sequenced genes of known biological action involved in the development or physiology of a trait. Twenty-one putative candidate genes were designed after an exhaustive search in the public databases along with an elaborate literature survey for candidate gene products and/or regulatory sequences associated with enhanced drought resistance. The downloaded sequences were then used to design primers considering the flanking sequences as well. Polymerase chain reaction (PCR) performed on 10 diverse cultivars that involved Japonica, Indica and local accessions, revealed 12 polymorphic candidate genes. Seven polymorphic candidate genes were then utilized to genotype 148 individuals of CT9993 × IR62266 doubled haploid (DH) mapping population. The segregation data were tested for deviation from the expected Mendelian ratio (1:1) using a Chi-square test (<1%). Based on this, four candidate genes were assessed to be significant and the remaining three, as non-significant. All the significant candidate genes were biased towards CT9993, the female parent in the DH mapping population. Single-marker analysis strongly associated ( < 1%) them to different traits under both well-watered and low-moisture stress conditions. Two candidate genes, EXP15 and EXP13, were found to be associated with root number and silicon content in the stem respectively, under both well-watered and low-moisture stress conditions.

  18. Development of highly glyphosate-tolerant tobacco by coexpression of glyphosate acetyltransferase gat and EPSPS G2-aroA genes

    Institute of Scientific and Technical Information of China (English)

    Baoqing; Dun; Xujing; Wang; Wei; Lu; Ming; Chen; Wei; Zhang; Shuzhen; Ping; Zhixing; Wang; Baoming; Zhang; Min; Lin

    2014-01-01

    The widely used herbicide glyphosate targets 5-enolpyruvylshikimate-3-phosphate synthase(EPSPS).Glyphosate acetyltransferase(GAT)effectively detoxifies glyphosate by N-acetylation.With the aim of identifying a new strategy for development of glyphosate-tolerant crops,the plant expression vector pG2-GAT harboring gat and G2-aroA(encoding EPSPS)has been transformed into tobacco(Nicotiana tabacum)to develop novel plants with higher tolerance to glyphosate.Results from Southern and Western blotting analyses indicated that the target genes were integrated into tobacco chromosomes and expressed effectively at the protein level.Glyphosate tolerance was compared among transgenic tobacco plants containing gat,G2-aroA,or both genes.Plants containing both gat and G2-aroA genes were the most glyphosate-tolerant.This study has shown that a combination of different strategies may result in higher tolerance in transgenic crops,providing a new approach for development of glyphosate-tolerant crops.

  19. Overexpression of calmodulin-like (ShCML44) stress-responsive gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses.

    Science.gov (United States)

    Munir, Shoaib; Liu, Hui; Xing, Yali; Hussain, Saddam; Ouyang, Bo; Zhang, Yuyang; Li, Hanxia; Ye, Zhibiao

    2016-01-01

    Calmodulin-like (CML) proteins are important Ca(2+) sensors, which play significant role in mediating plant stress tolerance. In the present study, cold responsive calmodulin-like (ShCML44) gene was isolated from cold tolerant wild tomato (Solanum habrochaites), and functionally characterized. The ShCML44 was differentially expressed in all plant tissues including root, stem, leaf, flower and fruit, and was strongly up-regulated under cold, drought and salinity stresses along with plant growth hormones. Under cold stress, progressive increase in the expression of ShCML44 was observed particularly in cold-tolerant S. habrochaites. The ShCML44-overexpressed plants showed greater tolerance to cold, drought, and salinity stresses, and recorded higher germination and better seedling growth. Transgenic tomato plants demonstrated higher antioxidant enzymes activity, gas exchange and water retention capacity with lower malondialdehyde accumulation and membrane damage under cold and drought stresses compared to wild-type. Moreover, transgenic plants exhibited reduced reactive oxygen species and higher relative water contents under cold and drought stress, respectively. Greater stress tolerance of transgenic plants was further reflected by the up-/down-regulation of stress-related genes including SOD, GST, CAT, POD, LOX, PR and ERD. In crux, these results strengthen the molecular understanding of ShCML44 gene to improve the abiotic stress tolerance in tomato. PMID:27546315

  20. Expression in Escherichia coli of Three Different Soybean Late Embryogenesis Abundant (LEA) Genes to Investigate Enhanced Stress Tolerance

    Institute of Scientific and Technical Information of China (English)

    Ying LAN; Dan CAI; Yi-Zhi ZHENG

    2005-01-01

    In order to identify the function of late embryogenesis abundant (LEA) genes, in vitro functional analyses were perfo rmed using an Escherichia coli heterologous expression system. Three soybean late embryogenesis abundant (LEA) genes, PM11 (GenBank accession No. AF004805; group 1), PM30 (AF1 17884; group 3), and ZLDE-2 (AY351918; group 2), were cloned and expressed in a pET-28a system.The gene products were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and identified by mass spectrometry. E. coli cells containing the recombinant plasmids or empty vector as controls were treated by salt and low temperature stress. Compared with control cells, the E. coli cells expressing either PM11 or PM30 showed a shorter lag period and improved growth when transferred to LB (Luria-Bertani) liquid media containing 800 mmol/L NaCl or 700 mmol/L KCl or after 4 ℃ treatment. E. coli cells expressing ZLDE-2 did not show obvious growth improvement both in either high KCl medium or after 4 ℃ treatment. The results indicate that the E. coli expression system is a simple, useful method to identify the functions of some stress-tolerant genes from plants.

  1. Potassium sensitivity differs among strains of the harmful cyanobacterium Microcystis and correlates with the presence of salt tolerance genes.

    Science.gov (United States)

    Sandrini, Giovanni; Huisman, Jef; Matthijs, Hans C P

    2015-08-01

    Microcystis aeruginosa is a ubiquitous harmful cyanobacterium that causes problems in eutrophic lakes. Potassium ion (K(+)) addition is one of the suggested methods to combat harmful cyanobacterial blooms. To investigate the effectiveness of this method, we compared the potassium ion sensitivity of four Microcystis strains. Microcystis strains PCC 7005 and NIES-843 were very susceptible to potassium ion concentrations of ∼ 12 mmol L(-1), whereas strain PCC 7806 and its non-toxic mutant PCC 7806 ΔmcyB were not affected by added potassium ions. The origin of the strain appears to be of importance. Strain PCC 7806 originates from brackish water and possesses genes for the synthesis of the compatible solute sucrose, the water channel protein gene aqpZ and the sodium influx gene nhaS2, whereas strains PCC 7005 and NIES-843 have a freshwater origin and lack these genes. We conclude that potassium ion addition will not be a successful mitigation strategy in brackish waters, but may temporarily suppress Microcystis blooms in freshwater lakes. However, in the long run other Microcystis strains or other cyanobacteria with a higher salt tolerance will likely take over. In addition, our results also have implications for the potassium ion concentrations of mineral media used in laboratory studies with cyanobacteria. PMID:26208527

  2. 油菜苗期耐铝基因型筛选和鉴定指标的研究%Screening of Rapeseed Genotypes with Aluminum Tolerance at Seedling Stage and Evaluation of Selecting Indices

    Institute of Scientific and Technical Information of China (English)

    熊洁; 邹小云; 陈伦林; 李书宇; 邹晓芬; 宋来强

    2015-01-01

    得到最优回归方程,23个品种苗期的耐铝性预测值与D值极显著相关。并且筛选出株高、根长、叶中可溶性糖含量、叶中脯氨酸含量等4项对耐铝性有显著影响的指标,可作为油菜苗期耐铝性的鉴定指标。【结论】采用主成分分析、聚类分析和逐步回归分析的方法进行油菜苗期耐铝性的综合评价较为可靠,既避免了单一指标的片面性和不稳定性,又揭示了油菜耐铝相关性状与耐铝性的关系。%[Objective]Rapeseed is the most important oil crop in China, and it is mainly grown in south of the Yangtze River, that is heavily contaminated with aluminum (Al). Al toxicity is one of the important factors that limit rapeseed production in south China. In order to reduce and avoid the harms of Al toxicity to rapeseed, breeding Al-tolerant varieties is a cost-effective and practical way. Therefore, screening and identifying of Al-tolerant genotypes in rapeseed is significant. The main purpose of this paper was to explore the methods of Al tolerance evaluation, and to screen rapeseed genotypes with Al tolerance at seedling stage.[Method]The Al tolerance of 23 rapeseed genotypes which are cultivated in large areas of Jiangxi Province was investigated by a pot culture. Principal component analysis, subordinate function analysis, clustering analysis and step regression analysis were used to evaluate the Al tolerance of rapeseed based on the Al-tolerance coefficients of morphological and physiological traits under the condition of Al stress and control. These traits included plant height (PH), root length (RL), rhizome thickness (RT), root dry weight (RDW), shoot dry weight (SDW), soluble sugar content in leaf (SSCL), soluble sugar content in root (SSCR), praline content in leaf (PCL), praline content in root (PCR) and SPAD. [Result]There were significantly different responses of morphological and physiological indexes among genotypes under Al stress. Correlation analysis showed that Al

  3. Overexpression of Heat Shock Factor Gene HsfA3 Increases Galactinol Levels and Oxidative Stress Tolerance in Arabidopsis.

    Science.gov (United States)

    Song, Chieun; Chung, Woo Sik; Lim, Chae Oh

    2016-06-30

    Heat shock factors (Hsfs) are central regulators of abiotic stress responses, especially heat stress responses, in plants. In the current study, we characterized the activity of the Hsf gene HsfA3 in Arabidopsis under oxidative stress conditions. HsfA3 transcription in seedlings was induced by reactive oxygen species (ROS), exogenous hydrogen peroxide (H2O2), and an endogenous H2O2 propagator, 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB). HsfA3-overexpressing transgenic plants exhibited increased oxidative stress tolerance compared to untransformed wild-type plants (WT), as revealed by changes in fresh weight, chlorophyll fluorescence, and ion leakage under light conditions. The expression of several genes encoding galactinol synthase (GolS), a key enzyme in the biosynthesis of raffinose family oligosaccharides (RFOs), which function as antioxidants in plant cells, was induced in HsfA3 overexpressors. In addition, galactinol levels were higher in HsfA3 overexpressors than in WT under unstressed conditions. In transient transactivation assays using Arabidopsis leaf protoplasts, HsfA3 activated the transcription of a reporter gene driven by the GolS1 or GolS2 promoter. Electrophoretic mobility shift assays showed that GolS1 and GolS2 are directly regulated by HsfA3. Taken together, these findings provide evidence that GolS1 and GolS2 are directly regulated by HsfA3 and that GolS enzymes play an important role in improving oxidative stress tolerance by increasing galactinol biosynthesis in Arabidopsis. PMID:27109422

  4. The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Amit Kumar Chaturvedi

    Full Text Available Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13 showed significantly enhanced salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

  5. Identification and characterization of a salt tolerance-responsive gene( AtGRP9) of Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Soil salinity is one of the important limiting factors for plant growth and development. A cDNA clone encoding a glycine-rich protein (designated AtGRP9) was identified from Arabidopsis by functional expression of the plant cDNA library in the fission yeast S. pombe. Yeast cells overexpressing AtGRP9 displayed significantly enhanced salt tolerance. Northern analysis showed that expression of AtGRP9 in Arabidopsis was induced by NaCl and plant hormone abscisic acid (ABA). These results suggest that AtGRP9 may be involved in the salt stress response in Arabidopsis.

  6. Nylon Filter Arrays Reveal Differential Expression of Expressed Sequence Tags in Wheat Roots Under Aluminum Stress

    Institute of Scientific and Technical Information of China (English)

    Kai XIAO; Gui-Hua BAI; Brett F CARVER

    2005-01-01

    To enrich differentially expressed sequence tags (ESTs) for aluminum (Al) tolerance, cDNA subtraction libraries were generated from Al-stressed roots of two wheat (Triticum aestivum L.) nearisogenic lines (NILs) contrasting in Al-tolerance gene(s) from the Al-tolerant cultivar Atlas 66, using suppression subtractive hybridization (SSH). Expression patterns of the ESTs were investigated with nylon filter arrays containing 614 cDNA clones from the subtraction library. Gene expression profiles from macroarray analysis indicated that 25 ESTs were upregulated in the tolerant NIL in response to Al stress. The result from Northern analysis of selected upregulated ESTs was similar to that from macroarray analysis. These highly expressed ESTs showed high homology with genes involved in signal transduction, oxidative stress alleviation, membrane structure, Mg2+ transportation, and other functions. Under Al stress, the Al-tolerant NIL may possess altered structure or function of the cell wall, plasma membrane, and mitochondrion. The wheat response to Al stress may involve complicated defense-related signaling and metabolic pathways.The present experiment did not detect any induced or activated genes involved in the synthesis of malate and other organic acids in wheat under Al-stress.

  7. Analysis of changes in hepatic gene expression in a murine model of tolerance to acetaminophen hepatotoxicity (autoprotection)

    Energy Technology Data Exchange (ETDEWEB)

    O' Connor, Meeghan A., E-mail: meeghan.oconnor@boehringer-ingelheim.com [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Boehringer Ingelheim Pharmaceuticals Inc., 900 Ridgebury Road, Ridgefield, CT 06877-0368 (United States); Koza-Taylor, Petra, E-mail: petra.h.koza-taylor@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Campion, Sarah N., E-mail: sarah.campion@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Aleksunes, Lauren M., E-mail: aleksunes@eohsi.rutgers.edu [Rutgers University, Department of Pharmacology and Toxicology, Environmental and Occupational Health Sciences Institute, Piscataway, NJ 08854 (United States); Gu, Xinsheng, E-mail: xinsheng.gu@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Enayetallah, Ahmed E., E-mail: ahmed.enayetallah@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Lawton, Michael P., E-mail: michael.lawton@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Manautou, José E., E-mail: jose.manautou@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States)

    2014-01-01

    Pretreatment of mice with a low hepatotoxic dose of acetaminophen (APAP) results in resistance to a subsequent, higher dose of APAP. This mouse model, termed APAP autoprotection was used here to identify differentially expressed genes and cellular pathways that could contribute to this development of resistance to hepatotoxicity. Male C57BL/6J mice were pretreated with APAP (400 mg/kg) and then challenged 48 h later with 600 mg APAP/kg. Livers were obtained 4 or 24 h later and total hepatic RNA was isolated and hybridized to Affymetrix Mouse Genome MU430{sub 2} GeneChip. Statistically significant genes were determined and gene expression changes were also interrogated using the Causal Reasoning Engine (CRE). Extensive literature review narrowed our focus to methionine adenosyl transferase-1 alpha (MAT1A), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), flavin-containing monooxygenase 3 (Fmo3) and galectin-3 (Lgals3). Down-regulation of MAT1A could lead to decreases in S-adenosylmethionine (SAMe), which is known to protect against APAP toxicity. Nrf2 activation is expected to play a role in protective adaptation. Up-regulation of Lgals3, one of the genes supporting the Nrf2 hypothesis, can lead to suppression of apoptosis and reduced mitochondrial dysfunction. Fmo3 induction suggests the involvement of an enzyme not known to metabolize APAP in the development of tolerance to APAP toxicity. Subsequent quantitative RT-PCR and immunochemical analysis confirmed the differential expression of some of these genes in the APAP autoprotection model. In conclusion, our genomics strategy identified cellular pathways that might further explain the molecular basis for APAP autoprotection. - Highlights: • Differential expression of genes in mice resistant to acetaminophen hepatotoxicity. • Increased gene expression of Flavin-containing monooxygenase 3 and Galectin-3. • Decrease in MAT1A expression and compensatory hepatocellular regeneration. • Two distinct gene

  8. Cloning of a cystatin gene from sugar beet M14 that can enhance plant salt tolerance.

    Science.gov (United States)

    Wang, Yuguang; Zhan, Yanan; Wu, Chuan; Gong, Shilong; Zhu, Ning; Chen, Sixue; Li, Haiying

    2012-08-01

    An open reading frame encoding a cysteine protease inhibitor, cystatin was isolated from the buds of sugar beet monosomic addition line M14 (BvM14) using 5'-/3'-RACE method. It encoded a polypeptide of 104 amino acids with conserved G and PW motifs, the consensus phytocystatin sequence LARFAV and the active site QVVAG. The protein showed significant homology to other plant cystatins. BvM14-cystatin was expressed ubiquitously in roots, stems, leaves and flower tissues with relatively high abundance in developing stems and roots. It was found to be localized in the nucleus, cytoplasm and plasma membrane. Recombinant BvM14-cystatin expressed in Escherichia coli was purified and it exhibited cysteine protease inhibitor activity. Salt-stress treatment induced BvM14-cystatin transcript levels in the M14 seedlings. Homozygous Arabidopsis plants over-expressing BvM14-cystatin showed enhanced salt tolerance. Taken together, these data improved understanding of the functions of BvM14-cystatin and highlighted the possibility of employing the cystatin in engineering plants for enhanced salt tolerance.

  9. Cloning and Characterisation of Two H+ Translocating Organic Pyrophos-phatase Genes in Salix and Their Expression Differences in Two Willow Varieties with Different Salt Tolerances.

    Science.gov (United States)

    Li, Min; Yu, Chunmei; Wang, Yaoyi; Li, Wentao; Wang, Ying; Yang, Yun; Liu, Huihui; Li, Yujuan; Tan, Feng; Zhang, Jian

    2014-10-01

    Willows are one of the most important tree species for landscaping, biofuel and raw timber. Screening salt-tolerant willow varieties is an effective approach to balance wood supply and demand. However, more salt-tolerant willow varieties are required and little is known regarding the mechanism of salt tolerance at the gene expression level. In this paper, two willow varieties were studies in terms of their differences in salt-tolerances and mechanism of salt tolerance at the level of VP1 gene expression. The results showed that Salix L0911 (L0911) had higher biomass than Salix matsudana (SM), and salt injuries were less severe in L0911 than in SM. The activities of peroxidase and superoxide dismutase, as well as the contents of soluble protein and proline, were higher in L0911 than in SM, whereas the contents of Na(+) and K(+), as well as the Na(+)/K(+) ratio, were lower in L0911 than in SM. Two VP1 genes (VP1.1 and VP1.2) cloned in L0911 and SM had similar sequences and structures. VP1.1 and VP1.2 belonged to different subgroups. Total expression levels of the VP1.1 gene in both roots and leaves of L0911 were higher than that in SM under normal conditions. Under salt stress, expression of VP1 in SM roots initially increased and then decreased, whereas the expression of VP1 in leaves of L0911 and SM, as well as in roots of L0911, decreased with increasing salt concentrations. This study increased our understanding of the salt-tolerance mechanism of willow and may facilitate the selection of salt-tolerant willow resources. PMID:25435797

  10. Discrete dynamical system modelling for gene regulatory networks of 5-hydroxymethylfural tolerance for ethanologenic yeast

    Science.gov (United States)

    Composed of linear difference equations, a discrete dynamic system model was designed to reconstruct transcriptional regulations in gene regulatory networks in response to 5-hydroxymethylfurfural, a bioethanol conversion inhibitor for ethanologenic yeast Saccharomyces cerevisiae. The modeling aims ...

  11. Disease-tolerance of transgenic tobacco plants expressing Ah-AMP gene of Amaranthus hypochondriacus

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    An antimicrobial peptide gene from Amaranthus hypochondriacus, Ah-AMP, was amplified by PCR and cloned. Sequence analysis results revealed that this gene is 261 bp in length encoding a precursor polypeptide of 87 amino acid residues. Ah-AMP gene was inserted in the binary vector pBin438 to construct a plant expression vector pBinAH916. Leave explants of Nicotiana tabacum var. SR1 were transformed with Agrobacterium tumefaciens LBA4404 harboring the above expression vector. Results from PCR, Southern and Northern blot analyses confirmed that the Ah-AMP gene had been integrated into the tobacco genome and was transcribed at mRNA level. Two bacterial-resistant transgenic plants were selected by inoculating the plants with Pseudomonas solanacearum and statistic analysis of two T1 lines showed that the resistance increased by 2.24 and 1.62 grade and the disease index decreased by 49.6% and 37.3% respectively when compared with the non-transformed control plants SR1. The results from challenging the plants with inoculums of Phytophthora parasitica showed that the symptom development was delayed and disease index was significantly reduced. These results suggest that Ah-AMP gene may be a potentially valuable gene for genetic engineering of plant for disease-resistance.

  12. Overexpression of Arachis hypogaea AREB1 Gene Enhances Drought Tolerance by Modulating ROS Scavenging and Maintaining Endogenous ABA Content

    Directory of Open Access Journals (Sweden)

    Ling Li

    2013-06-01

    Full Text Available AhAREB1 (Arachis hypogaea Abscisic-acid Response Element Binding Protein 1 is a member of the basic domain leucine zipper (bZIP-type transcription factor in peanut. Previously, we found that expression of AhAREB1 was specifically induced by abscisic acid (ABA, dehydration and drought. To understand the drought defense mechanism regulated by AhAREB1, transgenic Arabidopsis overexpressing AhAREB1 was conducted in wild-type (WT, and a complementation experiment was employed to ABA non-sensitivity mutant abi5 (abscisic acid-insensitive 5. Constitutive expression of AhAREB1 confers water stress tolerance and is highly sensitive to exogenous ABA. Microarray and further real-time PCR analysis revealed that drought stress, reactive oxygen species (ROS scavenging, ABA synthesis/metabolism-related genes and others were regulated in transgenic Arabidopsis overexpressing AhAREB1. Accordingly, low level of ROS, but higher ABA content was detected in the transgenic Arabidopsis plants’ overexpression of AhAREB1. Taken together, it was concluded that AhAREB1 modulates ROS accumulation and endogenous ABA level to improve drought tolerance in transgenic Arabidopsis.

  13. Zinc up-regulated the expression of the rice metallonthionein gene family and enhanced the zinc tolerance of yeast cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Northern blot and functional complementation assay were employed to analyze the effects of zinc on expression of ten rice metallothionein genes (OsMT-Is) in rice seedlings and the growth of yeast cells transformed with OsMT-Is. Northern blot revealed that in shoots of the rice seedlings treated with different Zn2+ concentrations, expression of most members of OsMT-I family was increased, except the type 4 OsMT-Is (OsMT-I-4a, 4b and 4c). In roots, Zn2+ significantly increased the transcription of OsMT-I-1b and OsMT-I-2c, but reduced the trascription of OsMT-I-1a and OsMT-I-3a. When these ten cDNAs were heterologously expressed in zinc sensitive yeast mutant, all transgenic yeasts showed increased tolerance to Zn2+, and zinc accumulation in these yeast cells also increased.These indicated that OsMT-I family members might respond to extra Zn2+, and they could enhance Zn2+ tolerance of cells by direct binding Zn2+.

  14. A Rice Immunophilin Gene, OsFKBP16-3, Confers Tolerance to Environmental Stress in Arabidopsis and Rice

    Directory of Open Access Journals (Sweden)

    Jun Cheul Ahn

    2013-03-01

    Full Text Available The putative thylakoid lumen immunophilin, FKBP16-3, has not yet been characterized, although this protein is known to be regulated by thioredoxin and possesses a well-conserved CxxxC motif in photosynthetic organisms. Here, we characterized rice OsFKBP16-3 and examined the role of this gene in the regulation of abiotic stress in plants. FKBP16-3s are well conserved in eukaryotic photosynthetic organisms, including the presence of a unique disulfide-forming CxxxC motif in their N-terminal regions. OsFKBP16-3 was mainly expressed in rice leaf tissues and was upregulated by various abiotic stresses, including salt, drought, high light, hydrogen peroxide, heat and methyl viologen. The chloroplast localization of OsFKBP16-3-GFP was confirmed through the transient expression of OsFKBP16-3 in Nicotiana benthamiana leaves. Transgenic Arabidopsis and transgenic rice plants that constitutively expressed OsFKBP16-3 exhibited increased tolerance to salinity, drought and oxidative stresses, but showed no change in growth or phenotype, compared with vector control plants, when grown under non-stressed conditions. This is the first report to demonstrate the potential role of FKBP16-3 in the environmental stress response, which may be regulated by a redox relay process in the thylakoid lumen, suggesting that artificial regulation of FKBP16-3 expression is a candidate for stress-tolerant crop breeding.

  15. A Rice Immunophilin Gene, OsFKBP16-3, Confers Tolerance to Environmental Stress in Arabidopsis and Rice

    Science.gov (United States)

    Park, Hyun Ji; Lee, Sang Sook; You, Young Nim; Yoon, Dae Hwa; Kim, Beom-Gi; Ahn, Jun Cheul; Cho, Hye Sun

    2013-01-01

    The putative thylakoid lumen immunophilin, FKBP16-3, has not yet been characterized, although this protein is known to be regulated by thioredoxin and possesses a well-conserved CxxxC motif in photosynthetic organisms. Here, we characterized rice OsFKBP16-3 and examined the role of this gene in the regulation of abiotic stress in plants. FKBP16-3s are well conserved in eukaryotic photosynthetic organisms, including the presence of a unique disulfide-forming CxxxC motif in their N-terminal regions. OsFKBP16-3 was mainly expressed in rice leaf tissues and was upregulated by various abiotic stresses, including salt, drought, high light, hydrogen peroxide, heat and methyl viologen. The chloroplast localization of OsFKBP16-3-GFP was confirmed through the transient expression of OsFKBP16-3 in Nicotiana benthamiana leaves. Transgenic Arabidopsis and transgenic rice plants that constitutively expressed OsFKBP16-3 exhibited increased tolerance to salinity, drought and oxidative stresses, but showed no change in growth or phenotype, compared with vector control plants, when grown under non-stressed conditions. This is the first report to demonstrate the potential role of FKBP16-3 in the environmental stress response, which may be regulated by a redox relay process in the thylakoid lumen, suggesting that artificial regulation of FKBP16-3 expression is a candidate for stress-tolerant crop breeding. PMID:23485991

  16. In planta transformation of sorghum (Sorghum bicolor (L.) Moench) using TPS1 gene for enhancing tolerance to abiotic stresses

    Indian Academy of Sciences (India)

    Varalaxmi Yellisetty; L. A. Reddy; Maheswari Mandapaka

    2015-09-01

    An in planta transformation protocol for sorghum (Sorghum bicolor (L.) Moench) using shoot apical meristem of germinating seedlings is reported in this study. Agrobacterium tumefaciens strain, LBA4404 with pCAMBIA1303 vector and construct pCAMBIA1303TPS1 were individually used for transformation. Since, the transgene is integrated into the cells of already differentiated tissues, the T0 plants were chimeric and stable integration was observed in T1 generation. -Glucuronidase (GUS) expression in the seedlings and spikelets of emerging cob was the first indication of transformability in T0 generation which was further confirmed by PCR analysis using hpt and TPS1 gene-specific primers. Screening on 25 mg/L hygromycin combined with PCR analysis was used for selection of transformants in the T1 generation. Transformation efficiencies ranged between 34–38% and 26–34% using pCAMBIA1303 vector and construct pCAMBIA1303TPS1, respectively. Molecular characterization of the T2 transgenics using PCR, RT-PCR and Southern blot analyses further revealed the integration, expression and inheritance of the transgene. These results indicate the feasibility of the method to generate transgenics with pCAM-BIA1303 vector and construct pCAMBIA1303TPS1. The abiotic stress tolerance of TPS1 transgenics developed in the present study was evident by the ability of the transformants to tolerate 200 mM NaCl as well as higher root growth and biomass.

  17. Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances

    Directory of Open Access Journals (Sweden)

    Xiatian eWang

    2015-08-01

    Full Text Available The WRKY transcription factors have been reported to be involved in various plant physiological and biochemical processes. In this study, we successfully assembled ten unigenes from expressed sequence tags (ESTs of wheat and designated them as TaWRKY44–TaWRKY53, respectively. Among these genes, a subgroup I gene, TaWRKY44, was found to be upregulated by treatments with PEG6000, NaCl, 4°C, abscisic acid (ABA, H2O2 and gibberellin (GA. The TaWRKY44-GFP fusion protein was localized to the nucleus of onion epidermal cells, and TaWRKY44 was able to bind to the core DNA sequences of TTGACC and TTAACC in yeast. The N-terminal of TaWRKY44 showed transcriptional activation activity. Expression of TaWRKY44 in tobacco plants conferred drought and salt tolerance and transgenic tobacco exhibited a higher survival rate, relative water content (RWC, soluble sugar, proline and superoxide dismutase (SOD content, as well as higher activities of catalase (CAT and peroxidase (POD, but less ion leakage (IL, lower contents of malondialdehyde (MDA, and H2O2. In addition, expression of TaWRKY44 also increased the seed germination rate in the transgenic lines under osmotic stress conditions while exhibiting a lower H2O2 content and higher SOD, CAT and POD activities. Expression of TaWRKY44 upregulated the expression of some reactive oxygen species (ROS-related genes and stress-responsive genes in tobacco under osmotic stresses. These data demonstrate that TaWRKY44 may act as a positive regulator in drought/salt/osmotic stress responses by either efficient ROS elimination through direct or indirect activation of the cellular antioxidant systems or activation of stress-associated gene expression.

  18. Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances.

    Science.gov (United States)

    Wang, Xiatian; Zeng, Jian; Li, Ying; Rong, Xiaoli; Sun, Jiutong; Sun, Tao; Li, Miao; Wang, Lianzhe; Feng, Ying; Chai, Ruihong; Chen, Mingjie; Chang, Junli; Li, Kexiu; Yang, Guangxiao; He, Guangyuan

    2015-01-01

    The WRKY transcription factors have been reported to be involved in various plant physiological and biochemical processes. In this study, we successfully assembled 10 unigenes from expressed sequence tags (ESTs) of wheat and designated them as TaWRKY44-TaWRKY53, respectively. Among these genes, a subgroup I gene, TaWRKY44, was found to be upregulated by treatments with PEG6000, NaCl, 4°C, abscisic acid (ABA), H2O2 and gibberellin (GA). The TaWRKY44-GFP fusion protein was localized to the nucleus of onion epidermal cells, and TaWRKY44 was able to bind to the core DNA sequences of TTGACC and TTAACC in yeast. The N-terminal of TaWRKY44 showed transcriptional activation activity. Expression of TaWRKY44 in tobacco plants conferred drought and salt tolerance and transgenic tobacco exhibited a higher survival rate, relative water content (RWC), soluble sugar, proline and superoxide dismutase (SOD) content, as well as higher activities of catalase (CAT) and peroxidase (POD), but less ion leakage (IL), lower contents of malondialdehyde (MDA), and H2O2. In addition, expression of TaWRKY44 also increased the seed germination rate in the transgenic lines under osmotic stress conditions while exhibiting a lower H2O2 content and higher SOD, CAT, and POD activities. Expression of TaWRKY44 upregulated the expression of some reactive oxygen species (ROS)-related genes and stress-responsive genes in tobacco under osmotic stresses. These data demonstrate that TaWRKY44 may act as a positive regulator in drought/salt/osmotic stress responses by either efficient ROS elimination through direct or indirect activation of the cellular antioxidant systems or activation of stress-associated gene expression. PMID:26322057

  19. Neurospora crassa tox-1 Gene Encodes a pH- and Temperature-Tolerant Mini-Cellulase.

    Science.gov (United States)

    Xiao, Yue; Zhang, Qiongsi; Luo, Yiquan; Zhang, Ying; Luo, Xi; Wang, Yuchuan; Cao, Weiguo; Pinto, Vito De; Liu, Qiuyun; Li, Gang

    2016-06-15

    Cellulases that endure extreme conditions are essential in various industrial sectors. This study reports a mini-cellulase gene tox-1 from Neurospora crassa. The gene tox-1 was cloned in Escherichia coli after chimerization with the YebF gene and substitutions of certain isoleucine and valine with leucine residues. The yeast transformants could grow on rice straw-agar medium. The 44-amino acid peptide and its two mutant variants displayed potent cellulase activities in Congo Red assay and enzymatic assays. Conservative replacements with leucine have substantially increased the stabilities and half-lives of the peptides at alkaline pH and low and high temperatures and also the tolerance to organic solvents and surfactants, on the basis of activities toward cellose. The small size of the mini-cellulase would allow for commercially viable automatic chemical peptide synthesis. This work suggests that conservative leucine replacements may serve as a general strategy in the engineering of more robust enzymes with special features with little loss of activities. PMID:27229865

  20. ABI-like transcription factor gene TaABL1 from wheat improves multiple abiotic stress tolerances in transgenic plants.

    Science.gov (United States)

    Xu, Dong-Bei; Gao, Shi-Qing; Ma, You-Zhi; Xu, Zhao-Shi; Zhao, Chang-Ping; Tang, Yi-Miao; Li, Xue-Yin; Li, Lian-Cheng; Chen, Yao-Feng; Chen, Ming

    2014-12-01

    The phytohormone abscisic acid (ABA) plays crucial roles in adaptive responses of plants to abiotic stresses. ABA-responsive element binding proteins (AREBs) are basic leucine zipper transcription factors that regulate the expression of downstream genes containing ABA-responsive elements (ABREs) in promoter regions. A novel ABI-like (ABA-insensitive) transcription factor gene, named TaABL1, containing a conserved basic leucine zipper (bZIP) domain was cloned from wheat. Southern blotting showed that three copies were present in the wheat genome. Phylogenetic analyses indicated that TaABL1 belonged to the AREB subfamily of the bZIP transcription factor family and was most closely related to ZmABI5 in maize and OsAREB2 in rice. Expression of TaABL1 was highly induced in wheat roots, stems, and leaves by ABA, drought, high salt, and low temperature stresses. TaABL1 was localized inside the nuclei of transformed wheat mesophyll protoplast. Overexpression of TaABL1 enhanced responses of transgenic plants to ABA and hastened stomatal closure under stress, thereby improving tolerance to multiple abiotic stresses. Furthermore, overexpression of TaABL1 upregulated or downregulated the expression of some stress-related genes controlling stomatal closure in transgenic plants under ABA and drought stress conditions, suggesting that TaABL1 might be a valuable genetic resource for transgenic molecular breeding.

  1. Trigo duro: tolerância à toxicidade de alumínio, manganês e ferro em soluções nutritivas Durum wheat: tolerance to aluminum, manganese and iron toxicities in nutrient solutions

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1995-01-01

    Full Text Available Avaliou-se o comportamento diferencial de 23 linhagens de trigo duro (Triticum durum L. em compraração com os seguintes cultivares de trigo (T. aestivum L.: IAC-24, BH-1146, Siete Cerros e IAC-60, quanto aos níveis de Al3+ (0;0,2;0,4; 0,6; 0,8 e 1,0 mg/L, de Mn2+ (0,11; 300; 600 c 1.200 mg/L e de Fe2+ (0,56; 5; 10 e 20 mg/L em solução nutritiva. Os cultivares de trigo Siete Cerros (sensível à toxicidade de Al3+, BH-1146, IAC-60 e IAC-24 (tolerantes à toxicidade de Al3+, exibiram crescimento das raízes na presença de 1 mg/L de Al3+, e todas as linhagens de trigo duro avaliadas foram totalmente sensíveis a 0,4 mg/L de Al3+, com paralisação irreversível do crescimento das raízes. O aumento das concentrações de Mn2+(0,11 a 1.200 mg/L e de Fe2+ (0,56 a 20 mg/L nas soluções causou uma redução significativa no comprimento das raízes dos genótipos em estudo. As linhagens de trigo duro I (Avetoro "S" x Anhinga "S" - Purcell "S"/D.67.2, 2 (Cando - Yavaros "S", 6 (Chen "S" e 8 (Carcomum "S" apresentaram-se muito tolerantes à toxicidade de Mn2+ em relação ao controle 'Siete Cerros'. O 'Siete Cerros' e as linhagens de trigo duro 1, 6, 12 (CI 14955 x Yavaros "S"- Gediz "S"/Tropic Bird, 16 e 21 (Swan "S" c 20 (Boyeros "S"/Cocorit-71/5/Crane/Ganso//Marte "S"/3/Tildillo "S"/4/ Memo "S" exibiram tolerância à presença de elevadas quantidades de Fe2+ nas soluções nutritivas.Twenty three durum wheat inbred lines were evaluated with four bread wheat cultivars (IAC-24, BH-1146, Siete Cerros and IAC-60 in three experiments, using nutrient solutions. In the first experiment, the following levels of Al3+ were used: 0; 0.2; 0.4; 0.6; 0.8 and 1.0 mg/L; in the second experiment, the following levels of Mn2+ were used: 0.11; 300; 600 and 1.200 mg/L; and in the third experiment, Fe2+ was used at: 0.56; 5; 10 and 1.200 mg/L. The wheat cultivars Siete Cerros (sensitive to Al3+ toxicity and BH-1146, IAC-24 and IAC-60 (tolerant to Al3+ toxicity

  2. Rice Yellow Mottle Virus stress responsive genes from susceptible and tolerant rice genotypes

    Directory of Open Access Journals (Sweden)

    Siré Christelle

    2008-03-01

    Full Text Available Abstract Background The effects of viral infection involve concomitant plant gene variations and cellular changes. A simple system is required to assess the complexity of host responses to viral infection. The genome of the Rice yellow mottle virus (RYMV is a single-stranded RNA with a simple organisation. It is the most well-known monocotyledon virus model. Several studies on its biology, structure and phylogeography have provided a suitable background for further genetic studies. 12 rice chromosome sequences are now available and provide strong support for genomic studies, particularly physical mapping and gene identification. Results The present data, obtained through the cDNA-AFLP technique, demonstrate differential responses to RYMV of two different rice cultivars, i.e. susceptible IR64 (Oryza sativa indica, and partially resistant Azucena (O. s. japonica. This RNA profiling provides a new original dataset that will enable us to gain greater insight into the RYMV/rice interaction and the specificity of the host response. Using the SIM4 subroutine, we took the intron/exon structure of the gene into account and mapped 281 RYMV stress responsive (RSR transcripts on 12 rice chromosomes corresponding to 234 RSR genes. We also mapped previously identified deregulated proteins and genes involved in partial resistance and thus constructed the first global physical map of the RYMV/rice interaction. RSR transcripts on rice chromosomes 4 and 10 were found to be not randomly distributed. Seven genes were identified in the susceptible and partially resistant cultivars, and transcripts were colocalized for these seven genes in both cultivars. During virus infection, many concomitant plant gene expression changes may be associated with host changes caused by the infection process, general stress or defence responses. We noted that some genes (e.g. ABC transporters were regulated throughout the kinetics of infection and differentiated susceptible and

  3. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra.

    Directory of Open Access Journals (Sweden)

    Weidong Gao

    Full Text Available Late embryogenesis abundant (LEA genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA was transformed into Xiaohei poplar (Populussimonii × P. nigra via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR and ribonucleic acid (RNA gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11 showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  4. Characteristics of Three Thioredoxin Genes and Their Role in Chilling Tolerance of Harvested Banana Fruit.

    Science.gov (United States)

    Wu, Fuwang; Li, Qing; Yan, Huiling; Zhang, Dandan; Jiang, Guoxiang; Jiang, Yueming; Duan, Xuewu

    2016-01-01

    Thioredoxins (Trxs) are small proteins with a conserved redox active site WCGPC and are involved in a wide range of cellular redox processes. However, little information on the role of Trx in regulating low-temperature stress of harvested fruit is available. In this study, three full-length Trx cDNAs, designated MaTrx6, MaTrx9 and MaTrx12, were cloned from banana (Musa acuminata) fruit. Phylogenetic analysis and protein sequence alignments showed that MaTrx6 was grouped to h2 type with a typical active site of WCGPC, whereas MaTrx9 and MaTrx12 were assigned to atypical cys his-rich Trxs (ACHT) and h3 type with atypical active sites of GCAGC and WCSPC, respectively. Subcellular localization indicated that MaTrx6 and MaTrx12 were located in the plasma membrane and cytoplasm, respectively, whereas MaTrx9 showed a dual cytoplasmic and chloroplast localization. Application of ethylene induced chilling tolerance of harvested banana fruit, whereas 1-MCP, an inhibitor of ethylene perception, aggravated the development of chilling injury. RT-qPCR analysis showed that expression of MaTrx12 was up-regulated and down-regulated in ethylene- and 1-MCP-treated banana fruit at low temperature, respectively. Furthermore, heterologous expression of MaTrx12 in cytoplasmic Trx-deficient Saccharomyces cerevisiae strain increased the viability of the strain under H₂O₂. These results suggest that MaTrx12 plays an important role in the chilling tolerance of harvested banana fruit, possibly by regulating redox homeostasis. PMID:27618038

  5. Characteristics of Three Thioredoxin Genes and Their Role in Chilling Tolerance of Harvested Banana Fruit

    Science.gov (United States)

    Wu, Fuwang; Li, Qing; Yan, Huiling; Zhang, Dandan; Jiang, Guoxiang; Jiang, Yueming; Duan, Xuewu

    2016-01-01

    Thioredoxins (Trxs) are small proteins with a conserved redox active site WCGPC and are involved in a wide range of cellular redox processes. However, little information on the role of Trx in regulating low-temperature stress of harvested fruit is available. In this study, three full-length Trx cDNAs, designated MaTrx6, MaTrx9 and MaTrx12, were cloned from banana (Musa acuminata) fruit. Phylogenetic analysis and protein sequence alignments showed that MaTrx6 was grouped to h2 type with a typical active site of WCGPC, whereas MaTrx9 and MaTrx12 were assigned to atypical cys his-rich Trxs (ACHT) and h3 type with atypical active sites of GCAGC and WCSPC, respectively. Subcellular localization indicated that MaTrx6 and MaTrx12 were located in the plasma membrane and cytoplasm, respectively, whereas MaTrx9 showed a dual cytoplasmic and chloroplast localization. Application of ethylene induced chilling tolerance of harvested banana fruit, whereas 1-MCP, an inhibitor of ethylene perception, aggravated the development of chilling injury. RT-qPCR analysis showed that expression of MaTrx12 was up-regulated and down-regulated in ethylene- and 1-MCP-treated banana fruit at low temperature, respectively. Furthermore, heterologous expression of MaTrx12 in cytoplasmic Trx-deficient Saccharomyces cerevisiae strain increased the viability of the strain under H2O2. These results suggest that MaTrx12 plays an important role in the chilling tolerance of harvested banana fruit, possibly by regulating redox homeostasis. PMID:27618038

  6. Characteristics of Three Thioredoxin Genes and Their Role in Chilling Tolerance of Harvested Banana Fruit

    Directory of Open Access Journals (Sweden)

    Fuwang Wu

    2016-09-01

    Full Text Available Thioredoxins (Trxs are small proteins with a conserved redox active site WCGPC and are involved in a wide range of cellular redox processes. However, little information on the role of Trx in regulating low-temperature stress of harvested fruit is available. In this study, three full-length Trx cDNAs, designated MaTrx6, MaTrx9 and MaTrx12, were cloned from banana (Musa acuminata fruit. Phylogenetic analysis and protein sequence alignments showed that MaTrx6 was grouped to h2 type with a typical active site of WCGPC, whereas MaTrx9 and MaTrx12 were assigned to atypical cys his-rich Trxs (ACHT and h3 type with atypical active sites of GCAGC and WCSPC, respectively. Subcellular localization indicated that MaTrx6 and MaTrx12 were located in the plasma membrane and cytoplasm, respectively, whereas MaTrx9 showed a dual cytoplasmic and chloroplast localization. Application of ethylene induced chilling tolerance of harvested banana fruit, whereas 1-MCP, an inhibitor of ethylene perception, aggravated the development of chilling injury. RT-qPCR analysis showed that expression of MaTrx12 was up-regulated and down-regulated in ethylene- and 1-MCP-treated banana fruit at low temperature, respectively. Furthermore, heterologous expression of MaTrx12 in cytoplasmic Trx-deficient Saccharomyces cerevisiae strain increased the viability of the strain under H2O2. These results suggest that MaTrx12 plays an important role in the chilling tolerance of harvested banana fruit, possibly by regulating redox homeostasis.

  7. Introduction of Pea DNA Helicase 45 Into Sugarcane (Saccharum spp. Hybrid) Enhances Cell Membrane Thermostability And Upregulation Of Stress-responsive Genes Leads To Abiotic Stress Tolerance.

    Science.gov (United States)

    Augustine, Sruthy Maria; Ashwin Narayan, J; Syamaladevi, Divya P; Appunu, C; Chakravarthi, M; Ravichandran, V; Tuteja, Narendra; Subramonian, N

    2015-05-01

    DNA helicases are motor proteins that play an essential role in nucleic acid metabolism, by providing a duplex-unwinding function. To improve the drought and salinity tolerance of sugarcane, a DEAD-box helicase gene isolated from pea with a constitutive promoter, Port Ubi 2.3 was transformed into the commercial sugarcane variety Co 86032 through Agrobacterium-mediated transformation, and the transgenics were screened for tolerance to soil moisture stress and salinity. The transgene integration was confirmed through polymerase chain reaction, and the V 0 transgenic events showed significantly higher cell membrane thermostability under normal irrigated conditions. The V 1 transgenic events were screened for tolerance to soil moisture stress and exhibited significantly higher cell membrane thermostability, transgene expression, relative water content, gas exchange parameters, chlorophyll content, and photosynthetic efficiency under soil moisture stress compared to wild-type (WT). The overexpression of PDH45 transgenic sugarcane also led to the upregulation of DREB2-induced downstream stress-related genes. The transgenic events demonstrated higher germination ability and better chlorophyll retention than WT under salinity stress. Our results suggest the possibility for development of increased abiotic stress tolerant sugarcane cultivars through overexpression of PDH45 gene. Perhaps this is the first report, which provides evidence for increased drought and salinity tolerance in sugarcane through overexpression of PDH45.

  8. Physiological performance and differential expression profiling of genes associated with drought tolerance in root tissue of four contrasting varieties of two Gossypium species.

    Science.gov (United States)

    Singh, Ruchi; Pandey, Neha; Kumar, Anil; Shirke, Pramod A

    2016-01-01

    Root growth in drying soil is generally limited by a combination of mechanical impedance and water stress. As the major function of root tissue is water and nutrient uptake, so it imparts an important role in plant growth and stress management. Previously, we have studied physiological performance and expression profiling of gene associated with drought tolerance in leaf tissue of four cotton varieties. Here, we have further continued our studies with the root tissue of these varieties. The Gossypium hirsutum species JKC-770 is drought-tolerant and KC-2 is drought-sensitive, while Gossypium herbaceum species JKC-717 is drought-tolerant and RAHS-187 is drought-sensitive. JKC-770 and JKC-717 the drought-tolerant varieties showed a comparatively high glutathione-S-transferase, superoxide dismutase, proline along with their gene expression, and low malondialdehyde content indicating low membrane damage and better antioxidative defense under drought condition. The expression levels of cellulose synthase, xyloglucan:xyloglucosyl transferase, and glycosyl hydrolases suggest modulation in cell wall structure and partitioning of sugars towards osmoprotectants instead of cell wall biosynthesis in tolerant varieties. Heat shock proteins and serine/threonine protein phosphotases show upregulation under drought condition, which are responsible for temperature tolerance and protein phosphorylation, respectively. These effects many metabolic processes and may be playing a key role in drought tolerance and adaptability of JKC-770 towards drought tolerance. The long-term water use efficiency (WUE) estimated in terms of carbon isotope discrimination (∆(13)C) in the root tissues showed maximum depletion in the ∆(13)C values in JKC-770 variety, while minimum in RAHS-187 under drought stress with reference to their respective control, suggesting a high WUE in JKC-770 variety.

  9. The Drosophila melanogaster Muc68E Mucin Gene Influences Adult Size, Starvation Tolerance, and Cold Recovery

    Directory of Open Access Journals (Sweden)

    Micael Reis

    2016-07-01

    Full Text Available Mucins have been implicated in many different biological processes, such as protection from mechanical damage, microorganisms, and toxic molecules, as well as providing a luminal scaffold during development. Nevertheless, it is conceivable that mucins have the potential to modulate food absorption as well, and thus contribute to the definition of several important phenotypic traits. Here we show that the Drosophila melanogaster Muc68E gene is 40- to 60-million-yr old, and is present in Drosophila species of the subgenus Sophophora only. The central repeat region of this gene is fast evolving, and shows evidence for repeated expansions/contractions. This and/or frequent gene conversion events lead to the homogenization of its repeats. The amino acid pattern P[ED][ED][ST][ST][ST] is found in the repeat region of Muc68E proteins from all Drosophila species studied, and can occur multiple times within a single conserved repeat block, and thus may have functional significance. Muc68E is a nonessential gene under laboratory conditions, but Muc68E mutant flies are smaller and lighter than controls at birth. However, at 4 d of age, Muc68E mutants are heavier, recover faster from chill-coma, and are more resistant to starvation than control flies, although they have the same percentage of lipids as controls. Mutant flies have enlarged abdominal size 1 d after chill-coma recovery, which is associated with higher lipid content. These results suggest that Muc68E has a role in metabolism modulation, food absorption, and/or feeding patterns in larvae and adults, and under normal and stress conditions. Such biological function is novel for mucin genes.

  10. The Drosophila melanogaster Muc68E Mucin Gene Influences Adult Size, Starvation Tolerance, and Cold Recovery.

    Science.gov (United States)

    Reis, Micael; Silva, Ana C; Vieira, Cristina P; Vieira, Jorge

    2016-01-01

    Mucins have been implicated in many different biological processes, such as protection from mechanical damage, microorganisms, and toxic molecules, as well as providing a luminal scaffold during development. Nevertheless, it is conceivable that mucins have the potential to modulate food absorption as well, and thus contribute to the definition of several important phenotypic traits. Here we show that the Drosophila melanogaster Muc68E gene is 40- to 60-million-yr old, and is present in Drosophila species of the subgenus Sophophora only. The central repeat region of this gene is fast evolving, and shows evidence for repeated expansions/contractions. This and/or frequent gene conversion events lead to the homogenization of its repeats. The amino acid pattern P[ED][ED][ST][ST][ST] is found in the repeat region of Muc68E proteins from all Drosophila species studied, and can occur multiple times within a single conserved repeat block, and thus may have functional significance. Muc68E is a nonessential gene under laboratory conditions, but Muc68E mutant flies are smaller and lighter than controls at birth. However, at 4 d of age, Muc68E mutants are heavier, recover faster from chill-coma, and are more resistant to starvation than control flies, although they have the same percentage of lipids as controls. Mutant flies have enlarged abdominal size 1 d after chill-coma recovery, which is associated with higher lipid content. These results suggest that Muc68E has a role in metabolism modulation, food absorption, and/or feeding patterns in larvae and adults, and under normal and stress conditions. Such biological function is novel for mucin genes. PMID:27172221

  11. Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes

    OpenAIRE

    Avishek Dey; Milan Kumar Samanta; Srimonta Gayen; Sen, Soumitra K; Maiti, Mrinal K.

    2016-01-01

    Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selec...

  12. Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Tokuyasu Ken

    2008-04-01

    Full Text Available Abstract Background Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Results Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Conclusion Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

  13. Detection of genes providing salinity-tolerance in rice - doi: 10.4025/actascibiolsci.v36i1.15437

    Directory of Open Access Journals (Sweden)

    Maria da Graça de Souza Lima

    2013-09-01

    Full Text Available The present study aimed to identify salinity-tolerant genes in three cultivars (BRS-7 Taim, BRS Querência and BRS Atalanta of Oryza sativa L. ssp. indica S. Kato and in three cultivars (BRS Bojurú, IAS 12-9 Formosa and Goyakuman of Oryza sativa L. ssp. japonica S. Kato. Ten days after emergence seedlings were transferred to a greenhouse and placed in a 15L vessel with half strength Hoagland nutrient solution, which was changed every four days, under controlled temperature and humidity. Plants were harvested 56 days after transfer. DNA extraction was carried out by CTAB method and salinity-tolerant genes SOS and CK1 were identified by in silico research. Amplification of gene sequence was performed with in silico primers. Bands were detected by agar gel electrophoresis and visualized under ultraviolet light after staining with ethidium bromide. Gene SOS1 fragments were present in all cultivars, except in BRS Atalanta, whereas CK1 gene was present in all evaluated cultivars. Results show that salinity-tolerant genes under analysis were identified in the two sub-species.

  14. Characterization of a Type 1 Metallothionein Gene from the Stresses-Tolerant Plant Ziziphus jujuba

    Directory of Open Access Journals (Sweden)

    Mingxia Yang

    2015-07-01

    Full Text Available Plant metallothioneins (MTs are a family of low molecular weight, cysteine-rich, and metal-binding proteins, which play an important role in the detoxification of heavy metal ions, osmotic stresses, and hormone treatment. Sequence analysis revealed that the open-reading frame (ORF of ZjMT was 225 bp, which encodes a protein composed of 75 amino acid residues with a calculated molecular mass of 7.376 kDa and a predicated isoelectric point (pI of 4.83. ZjMT belongs to the type I MT, which consists of two highly conserved cysteine-rich terminal domains linked by a cysteine free region. Our studies showed that ZjMT was primarily localized in the cytoplasm and the nucleus of cells and ZjMT expression was up-regulated by NaCl, CdCl2 and polyethylene glycol (PEG treatments. Constitutive expression of ZjMT in wild type Arabidopsis plants enhanced their tolerance to NaCl stress during the germination stage. Compared with the wild type, transgenic plants accumulate more Cd2+ in root, but less in leaf, suggesting that ZjMT may have a function in Cd2+ retension in roots and, therefore, decrease the toxicity of Cd2+.

  15. Over-expression of an Arabidopsis δ-OAT gene enhances salt and drought tolerance in transgenic rice

    Institute of Scientific and Technical Information of China (English)

    WU Liangqi; FAN Zhanmin; GUO Lei; LI Yongqing; ZHANG Wenjing; QU Li-Jia; CHEN Zhangliang

    2003-01-01

    δ-OAT, ornithine-δ-aminotransferase, is the key enzyme involved in proline biosynthesis. In this study the Arabidopsisδ-OAT gene was transferred into rice (Oryza sativa L. ssp japonica cv. Zhongzuo 321), whose successful integration was demonstrated by PCR and Southern blot analysis. The over-expression of the gene in transgenic rice was also confirmed. Biochemical analysis showed that, under salt or drought stress conditions, proline contents in the leaves and roots in transgenic rice plants were 5- to 15-fold of those in non-transgenic controls. Under stress conditions, germinating rate of transgenic lines is higher than that of controls. Although the growth of rice plants tested were more and more retarded with the increasing of NaCl concentration, the transgenic plants grow faster compared to the controls under the same stress condition. Meanwhile, the resistance to KCl and MgSO4 stresses was also found enhanced in transgenic rice. Furthermore, the over-expression ofδ-OAT also improved the yield of transgenic plants under stress conditions. The average yield per plant of transgenic lines increases about 12%-41% more than that of control lines under 0.1 mol/L NaCl stress. These data indicated that the over-expression of δ-OAT, with the accumulation of proline, resulted in the enhancement of salt and drought tolerance and an increase of rice yield, which is of significance in agriculture.

  16. CmWRKY1 Enhances the Dehydration Tolerance of Chrysanthemum through the Regulation of ABA-Associated Genes.

    Directory of Open Access Journals (Sweden)

    Qingqing Fan

    Full Text Available WRKY transcription factors serve as antagonistic or synergistic regulators in a variety of abiotic stress responses in plants. Here, we show that CmWRKY1, a member of the group IIb WRKY family isolated from Chrysanthemum morifolium, exhibits no transcriptional activation in yeast cells. The subcellular localization examination showed that CmWRKY1 localizes to the nucleus in vivo. Furthermore, CmWRKY1-overexpressing transgenic lines exhibit enhanced dehydration tolerance in response to polyethylene glycol (PEG treatment compared with wild-type plants. We further confirmed that the transgenic plants exhibit suppressed expression levels of genes negatively regulated by ABA, such as PP2C, ABI1 and ABI2, and activated expression levels of genes positively regulated by ABA, such as PYL2, SnRK2.2, ABF4, MYB2, RAB18, and DREB1A. Taken together, our results indicate that CmWRKY1 plays an important role in the response to drought in chrysanthemum through an ABA-mediated pathway.

  17. Thellungiella halophilaThPIP1 gene enhances the tolerance of the transgenic rice to salt stress

    Institute of Scientific and Technical Information of China (English)

    QIANG Xiao-jing; YU Guo-hong; JIANG Lin-lin; SUN Lin-lin; ZHANG Shu-hui; LI Wei; CHENG Xian-guo

    2015-01-01

    Aquaporin proteins were demonstrated to play an important regulatory role in transporting water and other smal mole-cules. To better understand physiological functions of aquaporins in extremophile plants, a novelThPIP1 gene from the Thelungiela halophila was isolated and functionaly characterized in the transgenic rice. Data showed that the ThPIP1 protein encoded 284 amino acids, and was identiifed to be located on the plasma membrane. The expression ofThPIP1 genein the shoots and roots ofT. halophilaseedlings were induced by high salinity. The transgenic rice overexpressing ThPIP1 gene signiifcantly increased plants tolerance to salt stress through the pathway regulating the osmotic potentials, accumulation of organic smal molecules substances and the ratio of K+/Na+ in the plant cels. Moreover, split-ubiquitin yeast two-hybrid assay showed that ThPIP1 protein speciifcaly interacted with ThPIP2 and a non-speciifc lipid-transfer protein 2, suggesting thatThPIP1 probably play a key role in responding to the reactions of multiple external stimulus and in participating in different physiological processes of plants exposed to salt stress.

  18. A concentração de fósforo na tolerância de cultivares de trigo à toxicidade de alumínio em soluções nutritivas Effect of phosphorus in nutrient solution on the tolerance to aluminum toxicity in wheat cultivars

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1985-01-01

    +. Houve aumento mais acentuado nos teores de P na matéria seca das raízes em relação ao das partes aéreas quando se elevaram as concentrações de P das soluções. Esse aumento foi mais intenso no 'Siete Cerros' e 'IAC-17' do que no 'BH-1146'. Os teores de Al aumentaram nas raízes para todos os cultivares, à medida que cresceram as concentrações de P das soluções. Os resultados evidenciaram que, com o aumento da concentração de P, acentuou-se o efeito da toxicidade do Al3+, indicando que o Al e o P ficaram acumulados interna ou externamente nas raízes.Two experiments were conducted with the objective of studying the tolerance of wheat cultivars to 5 mg/l of Al3+ in nutrient solutions. The tolerance was evaluated by measuring the root growth in an aluminum-free complete nutrient solution after a treatment of 48 hours, in aluminum solution with different levels of phosphorus, and with controlled pH and temperature (25 ± 1ºC. In the first experiment eight cultivars were studied in treatment solutions with four levels of phosphorus (0; 15.5; 31.0 and 62.0 mg/l combined with three levels of pH (4.0; 5.0 and 6.0. The cultivars CNT-8 and Siete Cerros were sensitive and 'BH-1146', 'IAC-18', 'IAC-13', 'C-3', 'IAC-17 and 'Alondra- 4546' were tolerant to 5 mg/l of Al3+ in the solutions with pH 4.0 and in absence of P. All cultivars were sensitive to Al3+ when it was applied 15.5 mg/l of P and they were tolerant when was used 62 mg/l of P in the solutions, considering constant the pH 4.0. In solutions with the level of 31 mg/l of P and pH 4.0, the cultivars IAC-18, BH-1146, IAC-13 and C-3 showed tolerance and IAC-17, Alondra-4546, CNT-8 and Siete Cerros showed sensitivity to Al3+ when it was used solution with pH 5.0 or 6.0 the cultivars presented tolerance being non dependent of P concentration, in consequence of the low activity of Al3+ ions under these pH levels. The data demonstrated that tolerance to 5 m/l of Al3+, besides the pH level was dependent on the P

  19. Long-Term Boron-Excess-Induced Alterations of Gene Profiles in Roots of Two Citrus Species Differing in Boron-Tolerance Revealed by cDNA-AFLP

    Science.gov (United States)

    Guo, Peng; Qi, Yi-Ping; Yang, Lin-Tong; Ye, Xin; Huang, Jing-Hao; Chen, Li-Song

    2016-01-01

    Boron (B) toxicity is observed in some citrus orchards in China. However, limited data are available on the molecular mechanisms of citrus B-toxicity and B-tolerance. Using cDNA-AFLP, we identified 20 up- and 52 down-regulated genes, and 44 up- and 66 down-regulated genes from excess B-treated Citrus sinensis and Citrus grandis roots, respectively, thereby demonstrating that gene expression profiles were more affected in the latter. In addition, phosphorus and total soluble protein concentrations were lowered only in excess B-treated C. grandis roots. Apparently, C. sinensis had higher B-tolerance than C. grandis. Our results suggested that the following several aspects were responsible for the difference in the B-tolerance between the two citrus species including: (a) B-excess induced Root Hair Defective 3 expression in C. sinensis roots, and repressed villin4 expression in C. grandis roots; accordingly, root growth was less inhibited by B-excess in the former; (b) antioxidant systems were impaired in excess B-treated C. grandis roots, hence accelerating root senescence; (c) genes related to Ca2+ signals were inhibited (induced) by B-excess in C. grandis (C. sinensis) roots. B-excess-responsive genes related to energy (i.e., alternative oxidase and cytochrome P450), lipid (i.e., Glycerol-3-phosphate acyltransferase 9 and citrus dioxygenase), and nucleic acid (i.e., HDA19, histone 4, and ribonucleotide reductase RNR1 like protein) metabolisms also possibly accounted for the difference in the B-tolerance between the two citrus species. These data increased our understanding of the mechanisms on citrus B-toxicity and B-tolerance at transcriptional level. PMID:27446128

  20. Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes.

    Science.gov (United States)

    Dey, Avishek; Samanta, Milan Kumar; Gayen, Srimonta; Sen, Soumitra K; Maiti, Mrinal K

    2016-01-01

    Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE) and gene-silencing (RNAi). Analyses of the coding DNA sequence (CDS) of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5'-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS) of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene expression rather than

  1. Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes.

    Directory of Open Access Journals (Sweden)

    Avishek Dey

    Full Text Available Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.. Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE and gene-silencing (RNAi. Analyses of the coding DNA sequence (CDS of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5'-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene

  2. Transgenic petunia with the iron(III-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments.

    Directory of Open Access Journals (Sweden)

    Yoshiko Murata

    Full Text Available Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III to iron(II and the uptake of iron(II by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III. Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems

  3. Comprehensive analysis of SET domain gene family in foxtail millet identifies the putative role of SiSET14 in abiotic stress tolerance

    Science.gov (United States)

    Yadav, Chandra Bhan; Muthamilarasan, Mehanathan; Dangi, Anand; Shweta, Shweta; Prasad, Manoj

    2016-01-01

    SET domain-containing genes catalyse histone lysine methylation, which alters chromatin structure and regulates the transcription of genes that are involved in various developmental and physiological processes. The present study identified 53 SET domain-containing genes in C4 panicoid model, foxtail millet (Setaria italica) and the genes were physically mapped onto nine chromosomes. Phylogenetic and structural analyses classified SiSET proteins into five classes (I–V). RNA-seq derived expression profiling showed that SiSET genes were differentially expressed in four tissues namely, leaf, root, stem and spica. Expression analyses using qRT-PCR was performed for 21 SiSET genes under different abiotic stress and hormonal treatments, which showed differential expression of these genes during late phase of stress and hormonal treatments. Significant upregulation of SiSET gene was observed during cold stress, which has been confirmed by over-expressing a candidate gene, SiSET14 in yeast. Interestingly, hypermethylation was observed in gene body of highly differentially expressed genes, whereas methylation event was completely absent in their transcription start sites. This suggested the occurrence of demethylation events during various abiotic stresses, which enhance the gene expression. Altogether, the present study would serve as a base for further functional characterization of SiSET genes towards understanding their molecular roles in conferring stress tolerance. PMID:27585852

  4. Overexpression of the Wheat Aquaporin Gene, TaAQP7, Enhances Drought Tolerance in Transgenic Tobacco

    OpenAIRE

    Shiyi Zhou; Wei Hu; Xiaomin Deng; Zhanbing Ma; Lihong Chen; Chao Huang; Chen Wang,; Jie Wang; Yanzhen He; Guangxiao Yang; Guangyuan He

    2012-01-01

    Aquaporin (AQP) proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high ...

  5. Combination of CTLA4-FasL gene transfer and allogeneic bone marrow transplantation led to durable macrochimerism and donor-specific tolerance in mouse model

    Institute of Scientific and Technical Information of China (English)

    FENG Yougang; WANG Guangming; HAO Jie; LI Ailing; YUAN Guohong; LI Chong; ZENG Fuqing; XIE Shusheng

    2005-01-01

    Mixed hemopoietic chimerism is capable of inducing donor specific tolerance, thus eliminating the chronic immunosuppressive therapy following organ transplantation. As yet no safe and effective tolerance protocol is available for clinical implementation. Here we describe an alternative nonmyeloablative based strategy of using a single injection of recombination adenovirus vector encoding CTLA4-FasL fusing gene and donor bone marrow cells to promote durable mixed macrochimerism (>20% on 140 d). Chimeras exhibited robust donor-specific tolerance, as evidenced by acceptance of fully allogeneic skin grafts (the mean survival time (MST)>200 d) and rejection of third- party skin grafts in a normal manner (MST<10 d). In this model, the frequencies of helper T lymphocyte precursor (HTLp) and cytotoxic T lymphocyte precursor (CTLp) were greatly reduced on day 14 after transplantation, suggesting that CTLA4-FasL led to rapid systemic peripheral tolerance to facilitate the bone marrow engraftment, while both HTLp and CTLp remained at low level only in recipient mice with mixed chimerism on day 140 after transplantation, demonstrating that long-term skin grafts tolerance was associated with stable mixed chimerism, and central deletion of donor specific T cell may be the main mechanism for tolerance maintenance.

  6. Allergenicity assessment of genetically-modified tobacco expressing salt tolerance cbl gene.

    Science.gov (United States)

    Verma, Alok Kumar; Kumar, Sandeep; Chaudhari, Bhushan P; Tuteja, Narendra; Das, Mukul; Dwivedi, Premendra D

    2014-09-01

    It is mandatory to assess the allergenic potential of genetically modified (GM) crops before their commercialization. Recently, a transgene [Calcineurin B-like (CBL) protein] has been introduced into tobacco plant to make the crop salt resistance. Therefore, it was felt necessary to assess the allergenic potential of the cbl gene product, which was introduced and expressed in Nicotiana tabacum (tobacco) plant and compared the allergenic effects with the wild-type (WT) counterpart. Bioinformatic analysis revealed that there was no significant sequence homology with known allergens. Also, no difference between the protein digestibility profiles of GM and WT tobacco was found. Rapid digestion of CBL protein (Mol Wt 35 kDa) by simulated gastric fluid (SGF) indicated reduced chances of this protein to induce allergenicity. In addition, BALB/c mice sensitized by intraperitoneal administration of WT and GM tobacco protein showed comparable levels of clinical score, specific IgE, IgG1, histamine level, similar effect on different organs as well as IgE binding proteins. These findings indicate that insertion of cbl gene in tobacco did not cause any additional allergic risk to consumer and the GM and native tobacco proteins behave similarly in both in vitro and in vivo situations even after genetic modification.

  7. Antigen-specific tolerance induced by IL-10 gene modified immature dendritic cells in experimental autoimmune myocarditis in rats

    Institute of Scientific and Technical Information of China (English)

    LI Wei-min; LI Yue; LIU Wei; GAO Cheng; ZHOU Bao-guo; YANG Shu-sen; WANG Zheng; ZHANG Rui-hong; GAN Run-tao; KONG Yi-hui

    2006-01-01

    underwent maturation induced by in vitro exposure to LPS. IL-10 gene modified iDC inhibited the antigen specific T cell responses towards cardiac myosin. IκB protein was up-regulated significantly in the IL-10 gene modified iDC group.Conclusions IL-10 gene modified iDC induced antigen-specific tolerance in EAM. The underlying mechanisms may be related to costimulatory molecules down-regulation and NF-κB pathway inhibition.

  8. Melhoramento do trigo: XXVII. Estimativas de variância, herdabilidade e correlações em populações híbridas para produção de grãos, tolerância a toxicidade de alumínio e altura das plantas Wheat breeding: XXVII. Variance, heritability and correlations in hybrid populations for grain yield, tolerance to aluminum toxicity and plant height

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1992-01-01

    éticas.Crosses were made involving the cultivars: BH-1146, tall and aluminum tolerant, IAC-24, semidwarf and aluminum tolerant and Anahuac, semidwarf and aluminum sensitive. Parents, F1's, F2's and reciprocal backcrosses were tested for their seedling reaction to 6mg/l of Al3+ in nutrient solution, in laboratory condition, and evaluated for grain yield and plant height at maturity in an experiment using pots, under a screen house in 1988 conditions at Experimental Center of Campinas, State of São Paulo, Brazil. Narrow sense heritabilities estimates were moderate to high for plant height (0.432-0.799 and for aluminum tolerance (0.425-0.922 and low for grain yield (0.037-0.195. Phenotypic correlations between grain yield and plant height were positive and significant for all populations under study. Phenotypic correlations between grain yield and aluminum tolerance were non significant (except for the population BH-1146 x IAC-24. The phenotypic correlation between plant height and aluminum tolerance was only positive and significant for the population BH-1146 x IAC-24. Results suggest it would be possible to select semidwarf plants, with aluminum tolerance and with high yield potential if large segregating populations were used to identify desired genotypes originated from eventual recombinations.

  9. Characterization of two poplar homologs of the GRAS/SCL gene, which encodes a transcription factor putatively associated with salt tolerance

    Directory of Open Access Journals (Sweden)

    Galovic V

    2015-12-01

    Full Text Available To cope with soil salinity, which is one of the most severe forms of abiotic stress, efforts are being undertaken to enhance the salt tolerance of economically important poplar clones in the Vojvodina region of Serbia. One approach is to screen nucleotide diversity in candidate genes (CG in several poplar clones of high economic importance to Serbia to search for associations with salt stress tolerance. As plant-specific GRAS/SCL transcription factors (TFs play diverse roles in abiotic stress resistance, two poplar homologs of GRAS/SCL TFs were chosen to differentiate the species background with respect to salt tolerance. A BLAST search of the Populus trichocarpa genome using the P. euphratica gene GRAS/SCL TF_GH611858 sequence identified two putative orthologs, Scaf_5 and Scaf_7, with identities of 100% and 94%, respectively. Primers were designed in identical sequences of Scaf_5 and Scaf_7 to amplify fragments of GRAS/SCL TF orthologs in four poplar clones that are economically important to Serbia. The primers spanned regions where, at least in P. trichocarpa, single nucleotide polymorphisms (SNPs are present, thereby increasing the probability of distinguishing Scaf_5 and Scaf_7 orthologs in the four clones. Alignments and analyses of the gene fragments revealed that both orthologs were representative of the genetic diversity between different poplar clones, and the identified SNP markers differentiated the four poplar clones with respect to salt tolerance.

  10. Association of the ACTN3 R557X polymorphism with glucose tolerance and gene expression of sarcomeric proteins in human skeletal muscle

    OpenAIRE

    Riedl, Isabelle; Osler, Megan E.; Benziane, Boubacar; Chibalin, Alexander V; Juleen R. Zierath

    2015-01-01

    A common polymorphism (R577X) in the α-actinin (ACTN) 3 gene, which leads to complete deficiency of a functional protein in skeletal muscle, could directly influence metabolism in the context of health and disease. Therefore, we tested the hypothesis that states of glucose tolerance are associated with the ACTN3 R577X genotype. We analyzed the prevalence of the ACTN3 R577X polymorphism in people with normal glucose tolerance (NGT) and type 2 diabetes (T2D) and measured muscle-specific α-actin...

  11. Differential Expression Analysis of a Subset of Drought-Responsive GmNAC Genes in Two Soybean Cultivars Differing in Drought Tolerance

    OpenAIRE

    Nguyen Phuong Thao; Nguyen Binh Anh Thu; Xuan Lan Thi Hoang; Chien Van Ha; Lam-Son Phan Tran

    2013-01-01

    The plant-specific NAC transcription factors play important roles in plant response to drought stress. Here, we have compared the expression levels of a subset of GmNAC genes in drought-tolerant DT51 and drought-sensitive MTD720 under both normal and drought stress conditions aimed at identifying correlation between GmNAC expression levels and drought tolerance degree, as well as potential GmNAC candidates for genetic engineering. The expression of 23 selected dehydration-responsive GmNACs wa...

  12. Expression Profiling of Abiotic Stress-Inducible Genes in response to Multiple Stresses in Rice (Oryza sativa L. Varieties with Contrasting Level of Stress Tolerance

    Directory of Open Access Journals (Sweden)

    Supratim Basu

    2014-01-01

    Full Text Available The present study considered transcriptional profiles and protein expression analyses from shoot and/or root tissues under three abiotic stress conditions, namely, salinity, dehydration, and cold, as well as following exogenous abscisic acid treatment, at different time points of stress exposure in three indica rice varieties, IR-29 (salt sensitive, Pokkali, and Nonabokra (both salt tolerant. The candidate genes chosen for expression studies were HKT-1, SOS-3, NHX-1, SAPK5, SAPK7, NAC-1, Rab16A, OSBZ8, DREBP2, CRT/DREBP, WRKY24, and WRKY71, along with the candidate proteins OSBZ8, SAMDC, and GST. Gene expression profile revealed considerable differences between the salt-sensitive and salt-tolerant rice varieties, as the expression in the latter was higher even at the constitutive level, whereas it was inducible only by corresponding stress signals in IR-29. Whether in roots or shoots, the transcriptional responses to different stressors peaked following 24 h of stress/ABA exposure, and the transcript levels enhanced gradually with the period of exposure. The generality of stress responses at the transcriptional level was therefore time dependent. Heat map data also showed differential transcript abundance in the three varieties, correlating the observation with transcript profiling. In silico analysis of the upstream regions of all the genes represented the existence of conserved sequence motifs in single or multiple copies that are indispensable to abiotic stress response. Overall, the transcriptome and proteome analysis undertaken in the present study indicated that genes/proteins conferring tolerance, belonging to different functional classes, were overrepresented, thus providing novel insight into the functional basis of multiple stress tolerance in indica rice varieties. The present work will pave the way in future to select gene(s for overexpression, so as to generate broad spectrum resistance to multiple stresses simultaneously.

  13. Allelic variation at a single gene increases food value in a drought-tolerant staple cereal.

    Science.gov (United States)

    Gilding, Edward K; Frère, Celine H; Cruickshank, Alan; Rada, Anna K; Prentis, Peter J; Mudge, Agnieszka M; Mace, Emma S; Jordan, David R; Godwin, Ian D

    2013-01-01

    The production of adequate agricultural outputs to support the growing human population places great demands on agriculture, especially in light of ever-greater restrictions on input resources. Sorghum is a drought-adapted cereal capable of reliable production where other cereals fail, and thus represents a good candidate to address food security as agricultural inputs of water and arable land grow scarce. A long-standing issue with sorghum grain is that it has an inherently lower digestibility. Here we show that a low-frequency allele type in the starch metabolic gene, pullulanase, is associated with increased digestibility, regardless of genotypic background. We also provide evidence that the beneficial allele type is not associated with deleterious pleiotropic effects in the modern field environment. We argue that increasing the digestibility of an adapted crop is a viable way forward towards addressing food security while maximizing water and land-use efficiency. PMID:23403584

  14. Overexpression of glycerol-3-phosphate acyltransferase gene improves chilling tolerance in tomato.

    Science.gov (United States)

    Sui, Na; Li, Meng; Zhao, Shi-Jie; Li, Feng; Liang, Hui; Meng, Qing-Wei

    2007-10-01

    A tomato (Lycopersicon esculentum Mill.) glycerol-3-phosphate acyltransferase gene (LeGPAT) was isolated. The deduced amino acid sequence revealed that LeGPAT contained four acyltransferase domains, showing high identities with GPAT in other plant species. A GFP fusion protein of LeGPAT was targeted to chloroplast in cowpea mesophyll protoplast. RNA gel blot showed that the mRNA accumulation of LeGPAT in the wild type (WT) was induced by chilling temperature. Higher expression levels were observed when tomato leaves were exposed to 4 degrees C for 4 h. RNA gel and western blot analysis confirmed that the sense gene LeGPAT was transferred into the tomato genome and overexpressed under the control of 35S-CaMV. Although tomato is classified as a chilling-sensitive plant, LeGPAT exhibited selectivity to 18:1 over 16:0. Overexpression of LeGPAT increased total activity of LeGPAT and cis-unsaturated fatty acids in PG in thylakoid membrane. Chilling treatment induced less ion leakage from the transgenic plants than from the WT. The photosynthetic rate and the maximal photochemical efficiency of PS II (Fv/Fm) in transgenic plants decreased more slowly during chilling stress and recovered faster than in WT under optimal conditions. The oxidizable P700 in both WT and transgenic plants decreased obviously at chilling temperature under low irradiance, but the oxidizable P700 recovered faster in transgenic plants than in the WT. These results indicate that overexpression of LeGPAT increased the levels of PG cis-unsaturated fatty acids in thylakoid membrane, which was beneficial for the recovery of chilling-induced PS I photoinhibition in tomato.

  15. A novel gene SbSI-2 encoding nuclear protein from a halophyte confers abiotic stress tolerance in E. coli and tobacco.

    Directory of Open Access Journals (Sweden)

    Narendra Singh Yadav

    Full Text Available Salicornia brachiata is an extreme halophyte that grows luxuriantly in coastal marshes. Previously, we have reported isolation and characterization of ESTs from Salicornia with large number of novel/unknown salt-responsive gene sequences. In this study, we have selected a novel salt-inducible gene SbSI-2 (Salicornia brachiata salt-inducible-2 for functional characterization. Bioinformatics analysis revealed that SbSI-2 protein has predicted nuclear localization signals and a strong protein-protein interaction domain. Transient expression of the RFP:SbSI2 fusion protein confirmed that SbSI-2 is a nuclear-localized protein. Genomic organization study showed that SbSI-2 is intronless and has a single copy in Salicornia genome. Quantitative RT-PCR analysis revealed higher SbSI-2 expression under salt stress and desiccation conditions. The SbSI-2 gene was transformed in E. coli and tobacco for functional characterization. pET28a-SbSI-2 recombinant E. coli cells showed higher tolerance to desiccation and salinity compared to vector alone. Transgenic tobacco plants overexpressing SbSI-2 have improved salt- and osmotic tolerance, accompanied by better growth parameters, higher relative water content, elevated accumulation of compatible osmolytes, lower Na+ and ROS accumulation and lesser electrolyte leakage than the wild-type. Overexpression of the SbSI-2 also enhanced transcript levels of ROS-scavenging genes and some stress-related transcription factors under salt and osmotic stresses. Taken together, these results demonstrate that SbSI-2 might play an important positive modulation role in abiotic stress tolerance. This identifies SbSI-2 as a novel determinant of salt/osmotic tolerance and suggests that it could be a potential bioresource for engineering abiotic stress tolerance in crop plants.

  16. Characterization of AtSTOP1 orthologous genes in tobacco and other plant species.

    Science.gov (United States)

    Ohyama, Yoshinao; Ito, Hiroki; Kobayashi, Yuriko; Ikka, Takashi; Morita, Akio; Kobayashi, Masatomo; Imaizumi, Ryujiro; Aoki, Toshio; Komatsu, Kenji; Sakata, Yoichi; Iuchi, Satoshi; Koyama, Hiroyuki

    2013-08-01

    Aluminum (Al) and proton (H⁺) tolerances are essential traits for plants to adapt to acid soil environments. In Arabidopsis (Arabidopsis thaliana), these tolerances are mediated by a zinc-finger transcription factor, SENSITIVE TO PROTON RHIZOTOXICITY1 (AtSTOP1), which regulates the transcription of multiple genes critical for tolerance to both stressors. Here, the functions of orthologous proteins (STOP1-like proteins) in other plant species were characterized by reverse genetics analyses and in planta complementation assays. RNA interference of a gene for NtSTOP1 repressed Al and H⁺ tolerances of tobacco (Nicotiana tabacum) roots. Tobacco roots released citrate in response to Al, concomitant with the up-regulated transcription of an ortholog of an Al tolerance gene encoding a citrate-transporting multidrug and toxic compound extrusion protein. The RNA interference repression of NtSTOP1 blocked this process and also repressed the transcription of another orthologous gene for Al tolerance, ALUMINUM SENSITIVE3, which encodes a prokaryote-type transporter. These results demonstrated that NtSTOP1 regulates Al tolerance in tobacco through the transcriptional regulation of these genes. The in planta complementation assays revealed that other plant species, including woody plants, a legume, and a moss (Physcomitrella patens), possess functional STOP1-like proteins that can activate several H⁺ and Al-tolerance genes in Arabidopsis. Knocking out the gene encoding the STOP1-like protein decreased the Al tolerance of P. patens. Together, our results strongly suggest that transcriptional regulation by STOP1-like proteins is evolutionarily conserved among land plants and that it confers the ability to survive in acid soils through the transcriptional regulation of Al- and H⁺-tolerance genes.

  17. Identification of stress-induced genes from the drought-tolerant plant Prosopis juliflora (Swartz) DC. through analysis of expressed sequence tags.

    Science.gov (United States)

    George, Suja; Venkataraman, Gayatri; Parida, Ajay

    2007-05-01

    Abiotic stresses such as cold, salinity, drought, wounding, and heavy metal contamination adversely affect crop productivity throughout the world. Prosopis juliflora is a phreatophyte that can tolerate severe adverse environmental conditions such as drought, salinity, and heavy metal contamination. As a first step towards the characterization of genes that contribute to combating abiotic stress, construction and analysis of a cDNA library of P. juliflora genes is reported here. Random expressed sequence tag (EST) sequencing of 1750 clones produced 1467 high-quality reads. These clones were classified into functional categories, and BLAST comparisons revealed that 114 clones were homologous to genes implicated in stress response(s) and included heat shock proteins, metallothioneins, lipid transfer proteins, and late embryogenesis abundant proteins. Of the ESTs analyzed, 26% showed homology to previously uncharacterized genes in the databases. Fifty-two clones from this category were selected for reverse Northern analysis: 21 were shown to be upregulated and 16 downregulated. The results obtained by reverse Northern analysis were confirmed by Northern analysis. Clustering of the 1467 ESTs produced a total of 295 contigs encompassing 790 ESTs, resulting in a 54.2% redundancy. Two of the abundant genes coding for a nonspecific lipid transfer protein and late embryogenesis abundant protein were sequenced completely. Northern analysis (after polyethylene glycol stress) of the 2 genes was carried out. The implications of the analyzed genes in abiotic stress tolerance are also discussed.

  18. Two P5CS genes from common bean exhibiting different tolerance to salt stress in transgenic Arabidopsis

    Indian Academy of Sciences (India)

    Ji Bao Chen; Jian Wei Yang; Zhao Yuan Zhang; Xiao Fan Feng; Shu Min Wang

    2013-12-01

    Many plants accumulate proline in response to salt stress. -pyrroline-5-carboxylate synthetase (P5CS) is the rate-limiting enzyme in proline biosynthesis in plants. Plasmid DNA (pCHF3-PvP5CS1 and pCHF3-PvP5CS2) containing the selectable neomycin phosphotransferase gene for kanamycin resistance and Phaseolus vulgaris P5CS (PvP5CS1 and PvP5CS2) cDNA was introduced into Arabidopsis plants using Agrobacterium-mediated gene transfer. Southern blot, northern blot and RT-PCR analyses demonstrated that the foreign genes were integrated into Arabidopsis chromosomal DNA and expressed. Single-gene transformants were analysed in this study. Transgenic plants expressed higher levels of PvP5CS1 and PvP5CS2 transcripts under salt stress conditions than under normal conditions. When treated with 0, 100 and 200 mM NaCl, the average proline content in leaves of transgenic plants was significantly higher $(P \\lt 0.01)$ than control plants. The average relative electrical conductivity (REC) of transgenic lines was significantly lower $(P \\lt 0.01)$ than control plants under salt stress condition. Biomass production of transgenic lines was significantly higher $(P \\lt 0.05)$ than control plants under 200 mM NaCl stress treatment. These results indicated that introducing PvP5CS1 and PvP5CS2 cDNA into transgenic Arabidopsis caused proline overproduction, increasing salt tolerance. Although the expression of PvP5CS1 in L4 lines and PvP5CS2 in S4 lines was the same under salt stress condition, the S4 lines accumulated 1.6 and 1.9 times more proline than the L4 lines under 100 and 200 mM NaCl treatments, respectively. The REC of S4 plants was 0.5 (100 mM NaCl) and 0.6 times (200 mM NaCl) that of L4 plants. The biomass production of S4 plants was 1.6 times (200 mM NaCl) more than in L4 plants. Total P5CS enzyme activity of S4 was significantly higher than that of L4. These results implied that the PvP5CS2 protein had stronger capacity to catalyze proline synthesis than PvP5CS1 under salt

  19. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava.

    Science.gov (United States)

    Han, Bingying; Fu, Lili; Zhang, Dan; He, Xiuquan; Chen, Qiang; Peng, Ming; Zhang, Jiaming

    2016-01-01

    Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz) is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD). Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis). All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g(-1) fresh weight (FW), and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3-5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS), 10 trehalose-6-phosphate phosphatases (TPP), and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1-4) that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1) in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose under normal

  20. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

    Directory of Open Access Journals (Sweden)

    Bingying Han

    2016-07-01

    Full Text Available Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD. Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis. All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g−1 fresh weight (FW, and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3–5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS, 10 trehalose-6-phosphate phosphatases (TPP, and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1–4 that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1 in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose

  1. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

    Science.gov (United States)

    Han, Bingying; Fu, Lili; Zhang, Dan; He, Xiuquan; Chen, Qiang; Peng, Ming; Zhang, Jiaming

    2016-01-01

    Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz) is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD). Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis). All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g−1 fresh weight (FW), and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3–5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS), 10 trehalose-6-phosphate phosphatases (TPP), and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1–4) that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1) in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose under

  2. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava.

    Science.gov (United States)

    Han, Bingying; Fu, Lili; Zhang, Dan; He, Xiuquan; Chen, Qiang; Peng, Ming; Zhang, Jiaming

    2016-01-01

    Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz) is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD). Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis). All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g(-1) fresh weight (FW), and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3-5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS), 10 trehalose-6-phosphate phosphatases (TPP), and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1-4) that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1) in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose under normal

  3. Tn-seq of Caulobacter crescentus under uranium stress reveals genes essential for detoxification and stress tolerance

    International Nuclear Information System (INIS)

    Ubiquitous aquatic bacterium Caulobacter crescentus is highly resistant to uranium (U) and facilitates U biomineralization and thus holds promise as an agent of U bioremediation. In order to gain an understanding of how C. crescentus tolerates U, we employed transposon (Tn) mutagenesis paired with deep sequencing (Tn-seq) in a global screen for genomic elements required for U resistance. Of the 3,879 annotated genes in the C. crescentus genome, 37 were found to be specifically associated with fitness under U stress, 15 of which were subsequently tested through mutational analysis. Systematic deletion analysis revealed that mutants lacking outer membrane transporters (rsaFa and rsaFb), a stress-responsive transcription factor (cztR), or a ppGpp synthetase/hydrolase (spoT) exhibited a significantly lower survival rate under U stress. RsaFa and RsaFb, which are homologues of TolC in Escherichia coli, have previously been shown to mediate S-layer export. Transcriptional analysis revealed upregulation of rsaFa and rsaFb by 4- and 10-fold, respectively, in the presence of U. We additionally show that rsaFa mutants accumulated higher levels of U than the wild type, with no significant increase in oxidative stress levels. These results suggest a function for RsaFa and RsaFb in U efflux and/or maintenance of membrane integrity during U stress. In addition, we present data implicating CztR and SpoT in resistance to U stress. Together, our findings reveal novel gene targets that are key to understanding the molecular mechanisms of U resistance in C. crescentus

  4. Estabelecimento de critérios para selecionar porta-enxertos de macieira tolerantes ao alumínio em solução nutritiva Establishment of criteria to select apple tree rootstocks tolerant to the aluminum in nutritious solution

    Directory of Open Access Journals (Sweden)

    Elaine Cristina Stolf

    2008-06-01

    Full Text Available Dentre todas as fruteiras de clima temperado, a macieira é a que mais atenção tem recebido no sentido de se obterem porta-enxertos com características de boa adaptação, resistência ou sanidade. O desenvolvimento de um método eficiente para caracterizar genótipos com tolerância ao alumínio é o primeiro passo para a realização de estudos de mecanismos genéticos envolvidos na herança desse caráter. Assim, o presente trabalho teve por objetivo avaliar a tolerância ao alumínio dos porta-enxertos de macieira M.9 e Marubakaido em cinco concentrações (0; 50;150; 250 e 350 µM L-1 em solução nutritiva. As estacas de Marubakaido, na concentração intermediária de alumínio apresentaram menor crescimento radicular e aéreo. O M.9 mostrou menor crescimento radicular nas concentrações de 250 e 350 mM de alumínio. As características de crescimento avaliadas permitiram discriminar o porta-enxerto Marubakaido como mais tolerante que o M.9, e a concentração de 350 µM L-1 é a mais eficiente para a discriminação da tolerância ao alumínio aos 15 dias de cultivo em solução nutritiva.Among all of the temperate fruit trees, the apple tree is the one that has attracted more attention when it comes to obtaining rootstocks with characteristics of good adaptation, resistance or sanity. The development of an efficient method to characterize genotypes with tolerance to the aluminum is the first step for the accomplishment of genetic mechanisms studies involved in the inheritance of this character. Thus, the present work aimed to evaluate the tolerance to aluminum of the apple tree rootstocks M.9 and Marubakaido in five concentrations (0, 50, 150, 250 and 350 µM L-1 in nutritious solution. The cuttings of Marubakaido, in the intermediate concentration of aluminum presented smaller root and aerial growth. M.9 showed smaller root growth in the concentrations of 250 and 350 µM of aluminum. The evaluated growth characteristics permitted

  5. A subchronic feeding study of dicamba-tolerant soybean with the dmo gene in Sprague-Dawley rats.

    Science.gov (United States)

    Wang, Xiaoyun; He, Xiaoyun; Zou, Shiyin; Xu, Wentao; Jia, Xin; Zhao, Bo; Zhao, Changhui; Huang, Kunlun; Liang, Zhihong

    2016-06-01

    The dicamba-tolerant soybean MON87708 expresses the dicamba mono-oxygenase (DMO) enzyme that is encoded by the dmo gene. In order to evaluate the safety of this soybean, a 90-day subchronic feeding toxicity study (13 weeks) was conducted on Sprague-Dawley rats. A total of 140 rats were divided into 7 groups (10/sex/group), including a standard commercial diet control group. The genetically modified (GM) soybean MON87708 and the near isogenic non-GM soybean A3525 were respectively processed to unhulled, full-fat, and heat-treated powder, then mixed into the diet at levels of 7.5%, 15%, and 30% (wt/wt) with the main nutrients of the various diets balanced and then fed to 6 groups. The remaining group of rats fed with a commercial rat diet served as blank control. Some isolated parameters indicated statistically significant differences in body weight, feed consumption/utilization, hematology, serum biochemistry, and relative organ weights. These differences were not consistent across gender or test-diet dose, which were attributed to incidental and biological variability. In conclusion, the results demonstrated that the transgenic soybean MON87708 containing DMO was as safe as non-transgenic isogenic counterpart with historical safe use. PMID:26850684

  6. Heterology expression of the sweet pepper CBF3 gene confers elevated tolerance to chilling stress in transgenic tobacco.

    Science.gov (United States)

    Yang, Sha; Tang, Xian-Feng; Ma, Na-Na; Wang, Li-Yan; Meng, Qing-Wei

    2011-10-15

    Various studies have confirmed that the CBF (C-repeat binding factor) family of transcription factors has a key role in regulating many plants' responses to cold stress. Here we isolated CBF3 from sweet pepper (Capsicum frutescens). Green fluorescent protein (GFP) fusion protein of CfCBF3 was targeted to the nucleus of the onion epidermis cell. RNA gel blot analysis indicated that CfCBF3 was expressed in leaves of sweet pepper and the expression was induced by low temperature, drought and salinity stresses but not by ABA. Overexpression of CfCBF3 under the control of the CaMV35S promoter in tobacco induced expression of orthologs of CBF3-targeted genes and increased chilling tolerance without a dwarf phenotype. Indeed it also led to multiple biochemical and physiological changes associated with chilling stress. Higher levels of proline (Pro) and soluble sugars and lower content of reactive oxygen species (ROS) were observed in transgenic plants. Our results demonstrated that the increase in total unsaturated fatty acids, especially in phosphatidylglycerol (PG) was detected by overexpression of CfCBF3. During exposure to chilling stress, the transgenic lines were less susceptible to chilling-induced photoinhibition than wild-type (WT) plants. These results suggest that overexpression of CfCBF3 led to modification of the fatty acid unsaturation and alleviated the injuries under chilling stress.

  7. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Wei Chen

    Full Text Available Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS, named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG. Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD in transgenic seedlings. In addition, the level of malondialdehyde (MDA was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress.

  8. Aluminum tolerance in sorghum and maize

    Science.gov (United States)

    The soils of the tropics and subtropics are highly weathered, leading to poor soil fertility and low soil pH. Root growth and function on these acid soils is impaired by aluminium (Al) toxicity, leading to yield instability that jeopardizes food security worldwide. A wealth of physiological evidence...

  9. Tolerating Zero Tolerance?

    Science.gov (United States)

    Moore, Brian N.

    2010-01-01

    The concept of zero tolerance dates back to the mid-1990s when New Jersey was creating laws to address nuisance crimes in communities. The main goal of these neighborhood crime policies was to have zero tolerance for petty crime such as graffiti or littering so as to keep more serious crimes from occurring. Next came the war on drugs. In federal…

  10. Genetic dissection of drought and heat tolerance in chickpea through genome-wide and candidate gene-based association mapping approaches.

    Science.gov (United States)

    Thudi, Mahendar; Upadhyaya, Hari D; Rathore, Abhishek; Gaur, Pooran Mal; Krishnamurthy, Lakshmanan; Roorkiwal, Manish; Nayak, Spurthi N; Chaturvedi, Sushil Kumar; Basu, Partha Sarathi; Gangarao, N V P R; Fikre, Asnake; Kimurto, Paul; Sharma, Prakash C; Sheshashayee, M S; Tobita, Satoshi; Kashiwagi, Junichi; Ito, Osamu; Killian, Andrzej; Varshney, Rajeev Kumar

    2014-01-01

    To understand the genetic basis of tolerance to drought and heat stresses in chickpea, a comprehensive association mapping approach has been undertaken. Phenotypic data were generated on the reference set (300 accessions, including 211 mini-core collection accessions) for drought tolerance related root traits, heat tolerance, yield and yield component traits from 1-7 seasons and 1-3 locations in India (Patancheru, Kanpur, Bangalore) and three locations in Africa (Nairobi, Egerton in Kenya and Debre Zeit in Ethiopia). Diversity Array Technology (DArT) markers equally distributed across chickpea genome were used to determine population structure and three sub-populations were identified using admixture model in STRUCTURE. The pairwise linkage disequilibrium (LD) estimated using the squared-allele frequency correlations (r2; when r2<0.20) was found to decay rapidly with the genetic distance of 5 cM. For establishing marker-trait associations (MTAs), both genome-wide and candidate gene-sequencing based association mapping approaches were conducted using 1,872 markers (1,072 DArTs, 651 single nucleotide polymorphisms [SNPs], 113 gene-based SNPs and 36 simple sequence repeats [SSRs]) and phenotyping data mentioned above employing mixed linear model (MLM) analysis with optimum compression with P3D method and kinship matrix. As a result, 312 significant MTAs were identified and a maximum number of MTAs (70) was identified for 100-seed weight. A total of 18 SNPs from 5 genes (ERECTA, 11 SNPs; ASR, 4 SNPs; DREB, 1 SNP; CAP2 promoter, 1 SNP and AMDH, 1SNP) were significantly associated with different traits. This study provides significant MTAs for drought and heat tolerance in chickpea that can be used, after validation, in molecular breeding for developing superior varieties with enhanced drought and heat tolerance. PMID:24801366

  11. HsfA1d, a Protein Identified via FOX Hunting Using Thellungiella salsuginea cDNAs Improves Heat Tolerance by Regulating Heat-Stress-Responsive Gene Expression

    Institute of Scientific and Technical Information of China (English)

    Yukari Higashi; Naohiko Ohama; Tomoko Ishikawa; Taku Katori; Ayaka Shimura; Kazuya Kusakabe; Kazuko Yamaguchi-Shinozaki

    2013-01-01

    Theilungiella salsuginea (formerly T.halophila),a species closely related to Arabidopsis (Arabidopsis thaliana),is tolerant not only to high salt levels,but also to chilling,freezing,and ozone.Here,we report that T.salsuginea also shows greater heat tolerance than Arabidopsis.We identified T.salsuginea HsfAld (TsHsfAld) as a gene that can confer marked heat tolerance on Arabidopsis.TsHsfAld was identified via Full-length cDNA Over-eXpressing gene (FOX) hunting from among a collection of heat-stress-related T.salsuginea cDNAs.Transgenic Arabidopsis overexpressing TsHsfAld showed constitutive up-regulation of many genes in the Arabidopsis AtHsfA1 regulon under normal growth temperature.In Arabidopsis mesophyll protoplasts,TsHsfAld was localized in both the nucleus and the cytoplasm.TsHsfAld also interacted with AtHSP90,which negatively regulates AtHsfAls by forming HsfA1-HSP90 complexes in the cytoplasm.It is likely that the partial nuclear localization of TsHsfAld induced the expression of the AtHsfAld regulon in the transgenic plants at normal temperature.We also discovered that transgenic Arabidopsis plants overexpressing AtHsfAld were more heat-tolerant than wild-type plants and up-regulated the expression of the HsfAld regulon,as was observed in TsHsfAld-overexpressing plants.We propose that the products of both TsHsfAld and AtHsfAld function as positive regulators of Arabidopsis heat-stress response and would be useful for the improvement of heat-stress tolerance in other plants.

  12. Enhancing heat tolerance of the little dogwood Cornus canadensis L. f. with introduction of a superoxide reductase gene from the hyperthermophilic archaeon Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Xinmin eGeng

    2016-01-01

    Full Text Available Production of reactive oxygen species (ROS can be accelerated under various biotic and abiotic stresses causing lipid peroxidation, protein degradation, enzyme inactivation, and DNA damage. Superoxide reductase (SOR is a novel antioxidant enzyme from Pyrococcus furiosus and is employed by this anaerobic hyperthermophilic archaeon for efficient detoxification of ROS. In this study, SOR was introduced into a flowering plant Cornus canadensis to enhance its heat tolerance and reduce heat induced damage. A fusion construct of the SOR gene and Green Fluorescent Protein gene (GFP was introduced into C. canadensis using Agrobacterium-mediated transformation. Heat tolerance of the GFP-SOR expressing transgenic plants was investigated by observing morphological symptoms of heat injury and by examining changes in photosynthesis, malondialdehyde (MDA, and proline levels in the plants. Our results indicate that the expression of the P. furiosus SOR gene in the transgenic plants alleviated lipid peroxidation of cell membranes and photoinhibition of PS II, and decreased the accumulation of proline at 40°C. After a series of exposures to increasing temperatures, the SOR transgenic plants remained healthy and green whereas most of the non-transgenic plants dried up and were unable to recover. While it had previously been reported that expression of SOR in Arabidopsis enhanced heat tolerance, this is the first report of the successful demonstration of improved heat tolerance in a non-model plant resulting from the introduction of P. furiosus SOR. The study demonstrates the potential of SOR for crop improvement and that inherent limitations of plant heat tolerance can be ameliorated with P. furiosus SOR.

  13. Enhancing Heat Tolerance of the Little Dogwood Cornus canadensis L. f. with Introduction of a Superoxide Reductase Gene from the Hyperthermophilic Archaeon Pyrococcus furiosus.

    Science.gov (United States)

    Geng, Xing-Min; Liu, Xiang; Ji, Mikyoung; Hoffmann, William A; Grunden, Amy; Xiang, Qiu-Yun J

    2016-01-01

    Production of reactive oxygen species (ROS) can be accelerated under various biotic and abiotic stresses causing lipid peroxidation, protein degradation, enzyme inactivation, and DNA damage. Superoxide reductase (SOR) is a novel antioxidant enzyme from Pyrococcus furiosus and is employed by this anaerobic hyperthermophilic archaeon for efficient detoxification of ROS. In this study, SOR was introduced into a flowering plant Cornus canadensis to enhance its heat tolerance and reduce heat induced damage. A fusion construct of the SOR gene and Green Fluorescent Protein gene (GFP) was introduced into C. canadensis using Agrobacterium-mediated transformation. Heat tolerance of the GFP-SOR expressing transgenic plants was investigated by observing morphological symptoms of heat injury and by examining changes in photosynthesis, malondialdehyde (MDA), and proline levels in the plants. Our results indicate that the expression of the P. furiosus SOR gene in the transgenic plants alleviated lipid peroxidation of cell membranes and photoinhibition of PS II, and decreased the accumulation of proline at 40°C. After a series of exposures to increasing temperatures, the SOR transgenic plants remained healthy and green whereas most of the non-transgenic plants dried up and were unable to recover. While it had previously been reported that expression of SOR in Arabidopsis enhanced heat tolerance, this is the first report of the successful demonstration of improved heat tolerance in a non-model plant resulting from the introduction of P. furiosus SOR. The study demonstrates the potential of SOR for crop improvement and that inherent limitations of plant heat tolerance can be ameliorated with P. furiosus SOR.

  14. Genetic dissection of drought and heat tolerance in chickpea through genome-wide and candidate gene-based association mapping approaches.

    Directory of Open Access Journals (Sweden)

    Mahendar Thudi

    Full Text Available To understand the genetic basis of tolerance to drought and heat stresses in chickpea, a comprehensive association mapping approach has been undertaken. Phenotypic data were generated on the reference set (300 accessions, including 211 mini-core collection accessions for drought tolerance related root traits, heat tolerance, yield and yield component traits from 1-7 seasons and 1-3 locations in India (Patancheru, Kanpur, Bangalore and three locations in Africa (Nairobi, Egerton in Kenya and Debre Zeit in Ethiopia. Diversity Array Technology (DArT markers equally distributed across chickpea genome were used to determine population structure and three sub-populations were identified using admixture model in STRUCTURE. The pairwise linkage disequilibrium (LD estimated using the squared-allele frequency correlations (r2; when r2<0.20 was found to decay rapidly with the genetic distance of 5 cM. For establishing marker-trait associations (MTAs, both genome-wide and candidate gene-sequencing based association mapping approaches were conducted using 1,872 markers (1,072 DArTs, 651 single nucleotide polymorphisms [SNPs], 113 gene-based SNPs and 36 simple sequence repeats [SSRs] and phenotyping data mentioned above employing mixed linear model (MLM analysis with optimum compression with P3D method and kinship matrix. As a result, 312 significant MTAs were identified and a maximum number of MTAs (70 was identified for 100-seed weight. A total of 18 SNPs from 5 genes (ERECTA, 11 SNPs; ASR, 4 SNPs; DREB, 1 SNP; CAP2 promoter, 1 SNP and AMDH, 1SNP were significantly associated with different traits. This study provides significant MTAs for drought and heat tolerance in chickpea that can be used, after validation, in molecular breeding for developing superior varieties with enhanced drought and heat tolerance.

  15. AtHsfA2 modulates expression of stress responsive genes and enhances tolerance to heat and oxidative stress in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    LI Chunguang; CHEN Qijun; GAO Xinqi; QI Bishu; CHEN Naizhi; XU Shouming; CHEN Jia; WANG Xuechen

    2005-01-01

    There is increasing evidence for considerable interlinking between the responses to heat stress and oxidative stress, and recent researches suggest heat shock transcription factors (Hsfs) play an important role in linking heat shock with oxidative stress signals. In this paper, we present evidence that AtHsfA2 modulated expression of stress responsive genes and enhanced tolerance to heat and oxidative stress in Arabidopsis. Using Northern blot and quantitative RT-PCR analysis, we demonstrated that the expression of AtHsfA2 was induced by not only HS but also oxidative stress. By functional analysis of AtHsfA2 knockout mutants and AtHsfA2 overexpressing transgenic plants, we also demonstrated that the mutants displayed reduced the basal and acquired thermotolerance as well as oxidative stress tolerance but the overexpression lines displayed increased tolerance to these stress. The phenotypes correlated with the expression of some Hsps and APX1, ion leakage, H2O2 level and degree of oxidative injuries. These results showed that, by modulated expression of stress responsive genes, AtHsfA2 enhanced tolerance to heat and oxidative stress in Arabidopsis. So we suggest that AtHsfA2 plays an important role in linking heat shock with oxidative stress signals.

  16. Genome-wide analysis of AP2/ERF family genes from Lotus corniculatus shows LcERF054 enhances salt tolerance.

    Science.gov (United States)

    Sun, Zhan-Min; Zhou, Mei-Liang; Xiao, Xing-Guo; Tang, Yi-Xiong; Wu, Yan-Min

    2014-09-01

    Lotus corniculatus is used in agriculture as a main forage plant. Members of the Apetala2/ethylene response factor (AP2/ERF) family play important roles in regulating gene expression in response to many forms of stress, including drought and salt. Here, starting from database of the L. corniculatus var. japonicus genome, we identified 127 AP2/ERF genes by insilico cloning method. The phylogeny, gene structures, and putative conserved motifs in L. corniculatus var. japonicus ERF proteins were analyzed. Based on the number of AP2/ERF domains and the function of the genes, 127 AP2/ERF genes from L. corniculatus var. japonicus were classified into five subfamilies named the AP2, dehydration-responsive element binding factor (DREB), ERF, RAV, and a soloist. Outside the AP2/ERF domain, many L. corniculatus var. japonicus-specific conserved motifs were detected. Expression profile analysis of AP2/ERF genes by quantitative real-time PCR revealed that 19 LcERF genes, including LcERF054 (KJ004728), were significantly induced by salt stress. The results showed that the LcERF054 gene encodes a nuclear transcription activator. Overexpression of LcERF054 in Arabidopsis enhanced the tolerances to salt stress, showed higher germination ratio of seeds, and had elevated levels of relative moisture contents, soluble sugars, proline, and lower levels of malondialdehyde under stress conditions compared to wild-type plants. The expression of hyperosmotic salinity response genes COR15A, LEA4-5, P5CS1, and RD29A was found to be elevated in the LcERF054-overexpressing Arabidopsis plants compared to wild type. These results revealed that the LcERF genes play important roles in L. corniculatus cv Leo under salt stress and that LcERFs are attractive engineering targets in applied efforts to improve abiotic stress tolerances in L. corniculatus cv Leo or other crops.

  17. Identification and classification of genes required for tolerance to freeze-thaw stress revealed by genome-wide screening of Saccharomyces cerevisiae deletion strains.

    Science.gov (United States)

    Ando, Akira; Nakamura, Toshihide; Murata, Yoshinori; Takagi, Hiroshi; Shima, Jun

    2007-03-01

    Yeasts used in bread making are exposed to freeze-thaw stress during frozen-dough baking. To clarify the genes required for freeze-thaw tolerance, genome-wide screening was performed using the complete deletion strain collection of diploid Saccharomyces cerevisiae. The screening identified 58 gene deletions that conferred freeze-thaw sensitivity. These genes were then classified based on their cellular function and on the localization of their products. The results showed that the genes required for freeze-thaw tolerance were frequently involved in vacuole functions and cell wall biogenesis. The highest numbers of gene products were components of vacuolar H(+)-ATPase. Next, the cross-sensitivity of the freeze-thaw-sensitive mutants to oxidative stress and to cell wall stress was studied; both of these are environmental stresses closely related to freeze-thaw stress. The results showed that defects in the functions of vacuolar H(+)-ATPase conferred sensitivity to oxidative stress and to cell wall stress. In contrast, defects in gene products involved in cell wall assembly conferred sensitivity to cell wall stress but not to oxidative stress. Our results suggest the presence of at least two different mechanisms of freeze-thaw injury: oxidative stress generated during the freeze-thaw process, and defects in cell wall assembly. PMID:16989656

  18. Expression of multiple resistance genes enhances tolerance to environmental stressors in transgenic poplar (Populus × euramericana 'Guariento'.

    Directory of Open Access Journals (Sweden)

    Xiaohua Su

    Full Text Available Commercial and non-commercial plants face a variety of environmental stressors that often cannot be controlled. In this study, transgenic hybrid poplar (Populus × euramericana 'Guariento' harboring five effector genes (vgb, SacB, JERF36, BtCry3A and OC-I were subjected to drought, salinity, waterlogging and insect stressors in greenhouse or laboratory conditions. Field trials were also conducted to investigate long-term effects of transgenic trees on insects and salt tolerance in the transformants. In greenhouse studies, two transgenic lines D5-20 and D5-21 showed improved growth, as evidenced by greater height and basal diameter increments and total biomass relative to the control plants after drought or salt stress treatments. The improved tolerance to drought and salt was primarily attributed to greater instantaneous water use efficiency (WUEi in the transgenic trees. The chlorophyll concentrations tended to be higher in the transgenic lines under drought or saline conditions. Transformed trees in drought conditions accumulated more fructan and proline and had increased Fv/Fm ratios (maximum quantum yield of photosystem II under waterlogging stress. Insect-feeding assays in the laboratory revealed a higher total mortality rate and lower exuviation index of leaf beetle [Plagiodera versicolora (Laicharting] larvae fed with D5-21 leaves, suggesting enhanced insect resistance in the transgenic poplar. In field trials, the dominance of targeted insects on 2-year-old D5-21 transgenic trees was substantially lower than that of the controls, indicating enhanced resistance to Coleoptera. The average height and DBH (diameter at breast height of 2.5-year-old transgenic trees growing in naturally saline soil were 3.80% and 4.12% greater than those of the control trees, but these increases were not significant. These results suggested that multiple stress-resistance properties in important crop tree species could be simultaneously improved, although

  19. The Relationship between Hydroxamates Cyclic Secretion from Maize and Its Tolerance to Aluminum%玉米异羟肟酸类物质的分泌与其耐铝性的关系

    Institute of Scientific and Technical Information of China (English)

    唐新莲; 郭添香; 高小凤; 黎晓峰; 顾明华

    2015-01-01

    Aluminum (Al) toxicity is a major limiting factor for plant growth on acid soils; plants have evolved different strategies to detoxify Al stress due to different growth environments. Elucidation of these strategies will help us generate crops with enhanced Al tolerance. Most land plants use secretion of organic acid anions, such as oxalate, citrate and malate in response to Al stress. However, little work has so far been reported on relationship between Al resistance and Al-induced exudation of hydroxamates cyclic from roots ofZea MaysL. varieties. In this study, fifty-six varieties of maize were used to study the relationship between hydroxamates cyclic and Al tolerance based on the root elongation, Al content, callose content and hydroxamates cyclic measured among these 56 varieties. Al could induce secretion of hydroxamates cyclic from roots of different maize varieties, and callose, Al content of root tips were also significantly increased after Al treatment. Furthermore, there was significantly positive correlation between the root elon-gation and Al-induced secretion of hydroxamates cyclic(rDIMBOA=0.4550**,rMBOA=0.6008**),whereas there was significantly negative correlation between the Al content and hydroxamates cyclic(rDIMBOA=-0.3542**,rMBOA=-0.4841**), and callose was also significantly positively related to hydroxamates cyclic (rDIMBOA=-0.3651**,rMBOA=-0.1351). Cluster analysis showed that Al-induced secretion of hydroxamates cyclic from 30 Al-tolerance varieties such as Taiyu No.11, Feiyu No.3 and so on were higher than those of 7 Al-sensitive varieties such as Zhengdan No.958, Beiyu No.2883 and so on. Our results suggested that the secretion of hydroxamates cyclic in roots could be a novel mechanism for some tolerance varieties to resist the toxicity of Al.%铝毒是植物在酸性土壤中生长的主要限制因子,由于生长环境的差异,植物进化出不同的策略来抵抗铝毒害。阐明这些机理,将有助于开发抗铝毒农作

  20. Adenoviral-mediated localized CTLA-4Ig gene expression induces long-term allograft pancreas survival and donor-specific immune tolerance in rats

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    T cell activation following alloantigen recognition plays a critical role in the development of the rejection in all solid organ, tissue and cell transplantation. A recombinant molecule, cytotoxic T lymphocyte antigen 4 antibody (CTLA-4Ig), is known to induce to T-cell into "anergy" by blocking the costimulatory B7-CD28 interaction. Either systemic or localized administration of CTLA-Ig has been shown to prolong allograft survival and induce donor-specific tolerance in some transplant models. In this study, we characterized the expression and immunosuppressive effectiveness of adenoviral-mediated CTLA-4Ig gene transfer. We demonstrated transduction of the allografts with AdCTLA-41g resulted in localized expression, permanent graft survival and stable donor-specific tolerance. In addition, by performing simultaneous dual-organ transplantation, we targeted on immunosuppression through a local expression of CTLA-4Ig via adenoviral-mediated gene transfer into pancreatic allografts.

  1. Over-expression of a glutathione S-transferase gene, GsGST, from wild soybean (Glycine soja) enhances drought and salt tolerance in transgenic tobacco.

    Science.gov (United States)

    Ji, Wei; Zhu, Yanming; Li, Yong; Yang, Liang; Zhao, Xiaowen; Cai, Hua; Bai, Xi

    2010-08-01

    Glycine soja is a species of soybean that survives in adverse environments including high salt and drought conditions. We constructed a cDNA library from G. soja seedlings treated with NaCl and isolated a glutathione S-transferase gene (GsGST: GQ265911) from the library. The cDNA encoding GsGST contains an open reading frame of 660 bp and the predicted protein belongs to the tau class of GST family proteins. Tobacco plants over-expressing the GsGST gene showed sixfold higher GST activity than wild-type plants. Transgenic tobacco plants exhibited enhanced dehydration tolerance. T(2) transgenic tobacco plants showed higher tolerance at the seedling stage than wild-type plants to salt and mannitol as demonstrated by longer root length and less growth retardation.

  2. ADH enzyme activity and Adh gene expression in Drosophila melanogaster lines differentially selected for increased alcohol tolerance

    NARCIS (Netherlands)

    Malherbe, Y.; Kamping, Albert; van Delden, W.; van de Zande, L.

    2005-01-01

    In Drosophila melanogaster, alcohol dehydrogenase (ADH) activity is essential for ethanol tolerance, but its role may not be restricted to alcohol metabolism alone. Here we describe ADH activity and Adh expression level upon selection for increased alcohol tolerance in different life-stages of D. me

  3. Soybean GmMYB76,GmMYB92,and GmMYB177 genes confer stress tolerance in transgenic Arabidopsis plants

    Institute of Scientific and Technical Information of China (English)

    Yong Liao; Hong-Feng Zou; Hui-Wen Wang; Wan-Ke Zhang; Biao Ma; Jin-Song Zhang; Shou-Yi Chen

    2008-01-01

    MYB-type transcription factors contain the conserved MYB DNA-binding domain of approximately 50 amino acids and are involved in the regulation of many aspects of plant growth,development,metabolism and stress responses.From soybean plants,we identified 156 GmMYB genes using our previously obtained 206 MYB unigenes,and 48 were found to have full-length open-reading frames.Expressions of all these identified genes were examined,and we found that expressions of 43 genes were changed upon treatment with ABA,salt,drought and/or cold stress.Three GmMYB genes,GmMYB76,GmMYB92 and GmMYB177,were chosen for further analysis.Using the yeast assay system,GmMYB76 and GmMYB92 were found to have transactivation activity and can form homodimers.GmMYBI77 did not appear to have transactivation activity but can form heterodimers with GmMYB76.Yeast onehybrid assay revealed that all the three GmMYBs could bind to cis-elements TAT AAC GGT TTT TT and CCG GAA AAAAGG AT,but with different affinity,and GmMYB92 could also bind to TCT CAC CTA CC.The transgenic Arabidopsis plants overexpressing GmMYB76 or GmMYB177 showed better performance than the GmMYB92-transgenic plants in salt and freezing tolerance.However,these transgenic plants exhibited reduced sensitivity to ABA treatment at germination stage in comparison with the wild-type plants.The three GmMYB genes differentially affected a subset of stress-responsive genes in addition to their regulation of a common subset of stress-responsive genes.These results indicate that the three GmMYB genes may play differential roles in stress tolerance,possibly through regulation of stress-responsive genes.

  4. Protein Phosphatase 2A Catalytic Subunit α Plays a MyD88-Dependent, Central Role in the Gene-Specific Regulation of Endotoxin Tolerance

    Directory of Open Access Journals (Sweden)

    Ling Xie

    2013-03-01

    Full Text Available MyD88, the intracellular adaptor of most TLRs, mediates either proinflammatory or immunosuppressive signaling that contributes to chronic inflammation-associated diseases. Although gene-specific chromatin modifications regulate inflammation, the role of MyD88 signaling in establishing such epigenetic landscapes under different inflammatory states remains elusive. Using quantitative proteomics to enumerate the inflammation-phenotypic constituents of the MyD88 interactome, we found that in endotoxin-tolerant macrophages, protein phosphatase 2A catalytic subunit α (PP2Ac enhances its association with MyD88 and is constitutively activated. Knockdown of PP2Ac prevents suppression of proinflammatory genes and resistance to apoptosis. Through site-specific dephosphorylation, constitutively active PP2Ac disrupts the signal-promoting TLR4-MyD88 complex and broadly suppresses the activities of multiple proinflammatory/proapoptotic pathways as well, shifting proinflammatory MyD88 signaling to a prosurvival mode. Constitutively active PP2Ac translocated with MyD88 into the nuclei of tolerant macrophages establishes the immunosuppressive pattern of chromatin modifications and represses chromatin remodeling to selectively silence proinflammatory genes, coordinating the MyD88-dependent inflammation control at both signaling and epigenetic levels under endotoxin-tolerant conditions.

  5. Cytosolic expression of synthetic phytochelatin and bacterial metallothionein genes in Deinococcus radiodurans R1 for enhanced tolerance and bioaccumulation of cadmium.

    Science.gov (United States)

    Chaturvedi, Ruchi; Archana, G

    2014-06-01

    Due to its exemplary resistance to ionising radiation, oxidative stress, desiccation and several DNA damaging agents, Deinococcus radiodurans R1 (DR1) is considered as one of the most appropriate candidates for the bioremediation of the nuclear waste sites. However, the high sensitivity of this bacterium to heavy metals, which are usually preponderant at nuclear waste dump sites, precludes its application for bioremediation. This study deals with the expression two metal binding peptides in DR1 as an attractive strategy for developing metal tolerance in this bacterium. A synthetic gene (EC20) encoding a phytochelatin analogue with twenty repeating units of glutamate and cysteine was constructed by overlap extension and expressed in DR1. The cyanobacterial metallothionein (MT) gene, smtA was cloned for intracellular expression in DR1. Both the genes were expressed under the native groESL promoter. DR1 strain carrying the recombinant EC20 demonstrated 2.5-fold higher tolerance to Cd(2+) and accumulated 1.21-fold greater Cd(2+) as opposed to the control while the heterologous expression of MT SmtA in DR1 imparted the transformant superior tolerance to Cd(2+) amassing 2.5-fold greater Cd(2+) than DR1 expressing EC20.

  6. A novel Glycine soja tonoplast intrinsic protein gene responds to abiotic stress and depresses salt and dehydration tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Wang, Xi; Li, Yong; Ji, Wei; Bai, Xi; Cai, Hua; Zhu, Dan; Sun, Xiao-Li; Chen, Lian-Jiang; Zhu, Yan-Ming

    2011-07-15

    Tonoplast intrinsic protein (TIP) is a subfamily of the aquaporin (AQP), also known as major intrinsic protein (MIP) family, and regulates water movement across vacuolar membranes. Some reports have implied that TIP genes are associated with plant tolerance to some abiotic stresses that cause water loss, such as drought and high salinity. In our previous work, we found that an expressed sequence tag (EST) representing a TIP gene in our Glycine soja EST library was inducible by abiotic stresses. This TIP was subsequently isolated from G. soja with cDNA library screening, EST assembly and PCR, and named as GsTIP2;1. The expression patterns of GsTIP2;1 in G. soja under low temperature, salt and dehydration stress were different in leaves and roots. Though GsTIP2;1 is a stress-induced gene, overexpression of GsTIP2;1 in Arabidopsis thaliana depressed tolerance to salt and dehydration stress, but did not affect seedling growth under cold or favorable conditions. Higher dehydration speed was detected in Arabidopsis plants overexpressing GsTIP2;1, implying GsTIP2;1 might mediate stress sensitivity by enhancing water loss in the plant. Such a result is not identical to previous reports, providing some new information about the relationship between TIP and plant abiotic stress tolerance.

  7. Over-expression of PsGPD, a mushroom glyceraldehyde-3-phosphate dehydrogenase gene, enhances salt tolerance in rice plants.

    Science.gov (United States)

    Cho, Jung-Il; Lim, Hye-Min; Siddiqui, Zamin Shaheed; Park, Sung-Han; Kim, A-Ram; Kwon, Taek-Ryoun; Lee, Seong-Kon; Park, Soo-Chul; Jeong, Mi-Jeong; Lee, Gang-Seob

    2014-08-01

    Transgenic potatoes expressing glyceraldehyde-3-phosphate dehydrogenase (GPD), isolated from the oyster mushroom, Pleurotus sajor-caju, had increased tolerance to salt stress (Jeong et al. Biochem Biophys Res Commun 278:192-196, 2000). To examine the physiological mechanisms enhancing salt tolerance in GPD-transgenic rice plants, the salt tolerance of five GPD transgenic rice lines (T1-T5) derived from Dongjin rice cultivar were evaluated in a fixed 150 mM saline environment in comparison to two known wild-type rice cultivars, Dongjin (salt sensitive) and Pokali (salt tolerant). Transgenic lines, T2, T3, and T5, had a substantial increase in biomass and relative water content compared to Dongjin. Stomatal conductance and osmotic potential were higher in the GPD transgenic lines and were similar to those in Pokali. The results are discussed based on the comparative physiological response of GPD transgenic lines with those of the salt-sensitive and salt-tolerant rice cultivars.

  8. Transcriptional analysis of cell wall and cuticle related genes during fruit development of two sweet cherry cultivars with contrasting levels of cracking tolerance

    Directory of Open Access Journals (Sweden)

    Cristián Balbontín

    2014-04-01

    Full Text Available Rain-induced cracking before harvest is the major cause of crop loss in sweet cherry (Prunus avium [L.] L. In order to better understand the relationship between cherry fruit cracking and gene expression, the transcriptional patterns of six genes related to cell wall modification and cuticular wax biosynthesis were analyzed during fruit setting (FS, fruit color change (FC and fruit ripening (FR, employing two contrasting cultivars: the cracking resistant 'Kordia' and the cracking susceptible 'Bing'. The transcription levels of AP2/EREBP-type transcription factor (PaWINB, wax synthase (WS, ß-ketoacyl-CoA synthase (PaKCS6, and ß-galactosidase (ß-Gal showed higher levels in 'Kordia' than in 'Bing' during the FS stage, while similar values were observed in both cultivars at FR stage. In contrast to that pattern, transcription levels of expansin (PaEXPl were higher at FR stage in 'Kordia' than in 'Bing'. Transcript profile of lipid transport protein gene (PaLTPGl decreased during fruit development, with higher levels in 'Bing' than in 'Kordia' at FC and FR stages suggesting no relation with cracking tolerance. The expression profiles of PaWINB, WS, PaKCS6, and ß-Gal suggest that they are genes involved in conferring cracking tolerance, likely due to their function in cuticle deposition during early stages of fruit development. In addition, a greater expression level of expansin gene would allow for a faster growth rate in 'Kordia' at FR stage.

  9. Differential Expression Analysis of a Subset of Drought-Responsive GmNAC Genes in Two Soybean Cultivars Differing in Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Nguyen Phuong Thao

    2013-12-01

    Full Text Available The plant-specific NAC transcription factors play important roles in plant response to drought stress. Here, we have compared the expression levels of a subset of GmNAC genes in drought-tolerant DT51 and drought-sensitive MTD720 under both normal and drought stress conditions aimed at identifying correlation between GmNAC expression levels and drought tolerance degree, as well as potential GmNAC candidates for genetic engineering. The expression of 23 selected dehydration-responsive GmNACs was assessed in both stressed and unstressed root tissues of DT51 and MTD720 using real-time quantitative PCR. The results indicated that expression of GmNACs was genotype-dependent. Seven and 13 of 23 tested GmNACs showed higher expression levels in roots of DT51 in comparison with MTD720 under normal and drought stress conditions, respectively, whereas none of them displayed lower transcript levels under any conditions. This finding suggests that the higher drought tolerance of DT51 might be positively correlated with the higher induction of the GmNAC genes during water deficit. The drought-inducible GmNAC011 needs to be mentioned as its transcript accumulation was more than 76-fold higher in drought-stressed DT51 roots relative to MTD720 roots. Additionally, among the GmNAC genes examined, GmNAC085, 092, 095, 101 and 109 were not only drought-inducible but also more highly up-regulated in DT51 roots than in that of MTD720 under both treatment conditions. These data together suggest that GmNAC011, 085, 092, 095, 101 and 109 might be promising candidates for improvement of drought tolerance in soybean by biotechnological approaches.

  10. Transgenic rice expressing a cassava (Manihot esculenta Crantz) plasma membrane gene MePMP3-2 exhibits enhanced tolerance to salt and drought stresses.

    Science.gov (United States)

    Yu, Y; Cui, Y C; Ren, C; Rocha, P S C F; Peng, M; Xu, G Y; Wang, M L; Xia, X J

    2016-01-01

    Plasma membrane proteolipid 3 (PMP3) is a class of small hydrophobic proteins found in many organisms including higher plants. Some plant PMP3 genes have been shown to respond to abiotic stresses and to participate in the processes of plant stress tolerance. In this study, we isolated the cassava (Manihot esculenta Crantz) MePMP3-2 gene and functionally characterized its role in tolerance to abiotic stress by expressing it in rice (Oryza sativa L.). MePMP3-2 encodes a 77-amino acid protein belonging to a subgroup of plant PMP3s that have long hydrophylic C-terminal tails of unknown function. In silico analysis and co-localization studies indicated that MePMP3-2 is a plasma membrane protein with two transmembrane domains, similar to other PMP3s. In cassava leaves, MePMP3-2 expression was up-regulated by salt and drought stresses. Heterologous constitutive expression of MePMP3-2 in rice did not alter plant growth and development but increased tolerance to salt and drought stresses. In addition, under stress conditions MePMP3-2 transgenic plants accumulated less malondialdehyde, had increased levels of proline, and exhibited greater up-regulation of the stress-related genes OsProT and OsP5CS, but led to only minor changes in OsDREB2A and OsLEA3 expression. These findings indicate that MePMP3-2 may play an important role in salt and drought stress tolerance in transgenic rice.

  11. Transgenic rice expressing a cassava (Manihot esculenta Crantz) plasma membrane gene MePMP3-2 exhibits enhanced tolerance to salt and drought stresses.

    Science.gov (United States)

    Yu, Y; Cui, Y C; Ren, C; Rocha, P S C F; Peng, M; Xu, G Y; Wang, M L; Xia, X J

    2016-01-01

    Plasma membrane proteolipid 3 (PMP3) is a class of small hydrophobic proteins found in many organisms including higher plants. Some plant PMP3 genes have been shown to respond to abiotic stresses and to participate in the processes of plant stress tolerance. In this study, we isolated the cassava (Manihot esculenta Crantz) MePMP3-2 gene and functionally characterized its role in tolerance to abiotic stress by expressing it in rice (Oryza sativa L.). MePMP3-2 encodes a 77-amino acid protein belonging to a subgroup of plant PMP3s that have long hydrophylic C-terminal tails of unknown function. In silico analysis and co-localization studies indicated that MePMP3-2 is a plasma membrane protein with two transmembrane domains, similar to other PMP3s. In cassava leaves, MePMP3-2 expression was up-regulated by salt and drought stresses. Heterologous constitutive expression of MePMP3-2 in rice did not alter plant growth and development but increased tolerance to salt and drought stresses. In addition, under stress conditions MePMP3-2 transgenic plants accumulated less malondialdehyde, had increased levels of proline, and exhibited greater up-regulation of the stress-related genes OsProT and OsP5CS, but led to only minor changes in OsDREB2A and OsLEA3 expression. These findings indicate that MePMP3-2 may play an important role in salt and drought stress tolerance in transgenic rice. PMID:26909954

  12. Over-expression of BvMTSH, a fusion gene for maltooligosyltrehalose synthase and maltooligosyltrehalose trehalohydrolase, enhances drought tolerance in transgenic rice.

    Science.gov (United States)

    Joo, Joungsu; Choi, Hae Jong; Lee, Youn Hab; Lee, Sarah; Lee, Choong Hwan; Kim, Chung Ho; Cheong, Jong-Joo; Choi, Yang Do; Song, Sang Ik

    2014-01-01

    Plant abiotic stress tolerance has been modulated by engineering the trehalose synthesis pathway. However, many stress-tolerant plants that have been genetically engineered for the trehalose synthesis pathway also show abnormal development. The metabolic intermediate trehalose 6-phosphate has the potential to cause aberrations in growth. To avoid growth inhibition by trehalose 6-phosphate, we used a gene that encodes a bifunctional in-frame fusion (BvMTSH) of maltooligosyltrehalose synthase (BvMTS) and maltooligosyltrehalose trehalohydrolase (BvMTH) from the nonpathogenic bacterium Brevibacterium helvolum. BvMTS converts maltooligosaccharides into maltooligosyltrehalose and BvMTH releases trehalose. Transgenic rice plants that over-express BvMTSH under the control of the constitutive rice cytochrome c promoter (101MTSH) or the ABA-inducible Ai promoter (105MTSH) show enhanced drought tolerance without growth inhibition. Moreover, 101MTSH and 105MTSH showed an ABA-hyposensitive phenotype in the roots. Our results suggest that over-expression of BvMTSH enhances drought-stress tolerance without any abnormal growth and showes ABA hyposensitive phenotype in the roots. PMID:24209631

  13. Effect of the C.-1 388 A>G polymorphism in chicken heat shock transcription factor 3 gene on heat tolerance

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-wu; KONG Li-na; ZHANG De-xiang; JI Cong-liang; ZHANG Xi-quan; LUO Qing-bin

    2015-01-01

    Heat stress is one of the main factors that inlfuence poultry production. Heat shock proteins (HSPs) are known to affect heat tolerance. The formation of HSPs is regulated by heat shock transcription factor 3 (HSF3) in chicken. A DNA pool was established for identifying single nucleotide polymorphisms (SNPs) of the chicken HSF3, and 13 SNPs were detected. The bioinformatic analysis showed that 8 SNPs had the capacity to alter the transcription activity of HSF3. The dual luciferase report gene assay showed that there was a signiifcant difference (PG (S1) and C.–1 388 A>G (S4) sites at the 5´-untranslated region (UTR) of chicken HSF3. The elec-trophoretic mobility shift assay showed that the S4 site was a transcription binding factor. The analysis of the association of the S1 and S4 sites with heat tolerance index revealed that the S4 site was signiifcantly correlated with the CD3+T cel , corticosterone, and T3 levels in Lingshan chickens and with the heterophil/lymphocyte value in White Recessive Rock. These results showed that the S4 site at the 5´ UTR of chicken HSF3 might have an impact on heat tolerance in summer and could be used as a potential marker for the selection of chicken with heat tolerance in the future.

  14. Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene

    Institute of Scientific and Technical Information of China (English)

    Qi-chao ZHAO; Ming-hong LIU; Xian-wen ZHANG; Chao-yang LIN; Qing ZHANG; Zhi-cheng SHEN‡

    2015-01-01

    题目:转Cry1Ac、Cry1Ig和EPSPS基因水稻及其抗虫、抗草甘膦活性鉴定  目的:获得具有高水平表达 Cry1Ac、Cry1Ig和 EPSPS基因并且具有抗虫、抗草甘膦活性的转基因水稻株。  创新点:Cry1Ig为新发现的苏云金杆菌(Bt)杀虫基因;Cry1Ig与 Cry1Ac共同使用有利于延缓害虫产生对Bt杀虫蛋白抗性。  方法:将Cry1Ac、Cry1Ig和EPSPS(G10)基因的表达框依次插入到同一转移 DNA(T-DNA)中,再将此 T-DNA 利用农杆菌介导法转化到水稻中。从转基因后代中,利用蛋白质印迹法(Western blot)、DNA印迹法(Southern blot)和热不对称交错聚合酶链式反应(TAIL-PCR)技术,筛选出能够高水平表达上述三个基因以及 T-DNA 单拷贝插入并且未发生明显插入突变的转化株。对于筛选到的转化株,利用 Western blot进一步分析 Cry1Ac、Cry1Ig和 G10基因的表达水平;使用酶联免疫吸附测定(ELISA)检测Cry1Ac的表达量;使用棉铃虫、二化螟和稻纵卷叶螟为对象,测定转基因水稻的抗虫活性;使用草甘膦喷施法,测定转基因水稻的抗草甘膦活性。最后,在大田试验中,考察转基因水稻与非转基因水稻的基本农艺性状,观察 T-DNA 的插入是否对转基因水稻的生长产生明显的影响。  结论:本实验最终获得具有高水平表达Cry1Ac、Cry1Ig和G10基因以及T-DNA单拷贝插入并且未引起明显变化的转化株 GAI-14。GAI-14对棉铃虫、二化螟、稻纵卷叶螟以及草甘膦均具有明显的抗性。田间试验表明 GAI-14在基本农艺性状上与非转基因水稻无明显差异。%Insect resistance and glyphosate tolerance have been two of the most important traits in the genetic improvement of various crops. In this study, two Bacil us thuringiensis (Bt) insecticidal genes, Cry1Ac and Cry1Ig, and a modified glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate

  15. Enhancing the aluminium tolerance of barley by expressing the citrate transporter genes SbMATE and FRD3

    OpenAIRE

    Zhou, Gaofeng; Pereira, Jorge F.; Delhaize, Emmanuel; Zhou, Meixue; Magalhaes, Jurandir V.; Ryan, Peter R.

    2014-01-01

    Malate and citrate efflux from root apices is a mechanism of Al3+ tolerance in many plant species. Citrate efflux is facilitated by members of the MATE (multidrug and toxic compound exudation) family localized to the plasma membrane of root cells. Barley (Hordeum vulgare) is among the most Al3+-sensitive cereal species but the small genotypic variation in tolerance that is present is correlated with citrate efflux via a MATE transporter named HvAACT1. This study used a biotechnological approa...

  16. Physiological basis of tolerance to complete submergence in rice involves genetic factors in addition to the SUB1 gene

    OpenAIRE

    Singh, Sudhanshu; Mackill, David J.; Ismail, Abdelbagi M.

    2014-01-01

    Recurring floods in Asia cause poor crop establishment. Yields decline drastically when plants are completely submerged for a few days. Traditional rice cultivars predominate because they have acquired moderate tolerance to flooding but they carry the penalty of inherently lower grain yields. In contrast, modern high-yielding varieties are highly susceptible to flooding. Cultivars with tolerance to complete submergence were recently developed in the background of popular varieties by transfer...

  17. Overexpression of the Jatropha curcas JcERF1 gene coding an AP2/ERF-type transcription factor increases tolerance to salt in transgenic tobacco.

    Science.gov (United States)

    Yang, Hua; Yu, Chuan; Yan, Jun; Wang, Xuehua; Chen, Fang; Zhao, Yun; Wei, Wei

    2014-11-01

    The JcERF1 gene, which is related to the ERF family (ethylene responsive factor coding genes), was isolated and characterized from the oil tree Jatropha curcas. The JcERF1 protein contains conserved an AP2/EREBP DNA-binding domain of 58 amino acid residues. The JcERF1 gene could be induced by abscisic acid, high salinity, hormones, and osmotic stress, suggesting that JcERF1 is regulated by certain components of the stress-signaling pathway. The full-length and C-terminus of JcERF1 driven by the GAL4 promoter functioned effectively as a transactivator in yeast, while its N-terminus was completely inactive. Transient expression analysis using a JcERF1-mGFP fusion gene in onion epidermal cells revealed that the JcERF1 protein is targeted to the nucleus. Transgenic tobacco plants carrying CaMV35S::JcERF1 fragments were shown to be much more salt tolerant compared to wild-type plants. Our results indicate that JcERF1 is a new member of the ERF transcription factors family that may play an important role in tolerance to environmental stress. PMID:25540008

  18. Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

  19. Heterologous expression of the wheat aquaporin gene TaTIP2;2 compromises the abiotic stress tolerance of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Chunhui Xu

    Full Text Available Aquaporins are channel proteins which transport water across cell membranes. We show that the bread wheat aquaporin gene TaTIP2;2 maps to the long arm of chromosome 7b and that its product localizes to the endomembrane system. The gene is expressed constitutively in both the root and the leaf, and is down-regulated by salinity and drought stress. Salinity stress induced an increased level of C-methylation within the CNG trinucleotides in the TaTIP2;2 promoter region. The heterologous expression of TaTIP2;2 in Arabidopsis thaliana compromised its drought and salinity tolerance, suggesting that TaTIP2;2 may be a negative regulator of abiotic stress. The proline content of transgenic A. thaliana plants fell, consistent with the down-regulation of P5CS1, while the expression of SOS1, SOS2, SOS3, CBF3 and DREB2A, which are all stress tolerance-related genes acting in an ABA-independent fashion, was also down-regulated. The supply of exogenous ABA had little effect either on TaTIP2;2 expression in wheat or on the phenotype of transgenic A. thaliana. The expression level of the ABA signalling genes ABI1, ABI2 and ABF3 remained unaltered in the transgenic A. thaliana plants. Thus TaTIP2;2 probably regulates the response to stress via an ABA-independent pathway(s.

  20. A 90-day feeding study of glyphosate-tolerant maize with the G2-aroA gene in Sprague-Dawley rats.

    Science.gov (United States)

    Zhu, Yaxi; He, Xiaoyun; Luo, Yunbo; Zou, Shiying; Zhou, Xin; Huang, Kunlun; Xu, Wentao

    2013-01-01

    Maize is not only a staple food crop but also an important raw material for feed and industry; however, the threat of weeds leads to a serious decline in its output and quality. The G2-aroA gene confers glyphosate herbicide tolerance to crops. In this study, the food safety of genetically modified (GM), glyphosate-tolerant maize with the G2-aroA gene was evaluated in a 90-day feeding study in Sprague-Dawley (SD) rats. Maize grain from GM or non-GM isogenic control lines were separately formulated into rodent diets at concentrations of 12.5% (low level), 25% (middle level), and 50% (high level). An additional group of rats were fed a commercialized diet as a control. The toxicological response variables, including body weights, food consumption, serum biochemistry, hematology, and absolute and relative organ weights, were compared between rats fed GM maize and those fed non-GM maize after consumption of test diets for 90days. In addition, gross and microscopic pathology were conducted among treatment groups. No adverse effects related to the consumption of GM maize were detected in the subchronic feeding study. These results indicated that the GM glyphosate-tolerant maize was as safe and nutritious as conventional maize.

  1. De Novo Transcriptome Assembly and Identification of Gene Candidates for Rapid Evolution of Soil Al Tolerance in Anthoxanthum odoratum at the Long-Term Park Grass Experiment.

    Directory of Open Access Journals (Sweden)

    Billie Gould

    Full Text Available Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE, cell wall modification (OsSTAR1, and internal Al detoxification (OsNRAT1 in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE.

  2. De Novo Transcriptome Assembly and Identification of Gene Candidates for Rapid Evolution of Soil Al Tolerance in Anthoxanthum odoratum at the Long-Term Park Grass Experiment.

    Science.gov (United States)

    Gould, Billie; McCouch, Susan; Geber, Monica

    2015-01-01

    Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE) provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE), cell wall modification (OsSTAR1), and internal Al detoxification (OsNRAT1) in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE. PMID:26148203

  3. Drought tolerance established by enhanced expression of the CC-NBS-LRR gene, ADR1, requires salicylic acid, EDS1 and ABI1.

    Science.gov (United States)

    Chini, Andrea; Grant, John J; Seki, Motoaki; Shinozaki, Kazuo; Loake, Gary J

    2004-06-01

    An activation-tagged allele of activated disease resistance 1 (ADR1) has previously been shown to convey broad spectrum disease resistance. ADR1 was found to encode a coiled-coil (CC)-nucleotide-binding site (NBS)-leucine-rich repeat (LRR) protein, which possessed domains of homology with serine/threonine protein kinases. Here, we show that either constitutive or conditional enhanced expression of ADR1 conferred significant drought tolerance. This was not a general feature of defence-related mutants because cir (constitutive induced resistance)1, cir2 and cpr (constitutive expressor of PR genes)1, which constitutively express systemic acquired resistance (SAR), failed to exhibit this phenotype. Cross-tolerance was not a characteristic of adr1 plants, rather they showed increased sensitivity to thermal and salinity stress. Hence, adr1-activated signalling may antagonise some stress responses. Northern analysis of abiotic marker genes revealed that dehydration-responsive element (DRE)B2A but not DREB1A, RD (response to dehydration)29A or RD22 was expressed in adr1 plant lines. Furthermore, DREB2A expression was salicylic acid (SA) dependent but NPR (non-expressor of PR genes)1 independent. In adr1/ADR1 nahG (naphthalene hydroxylase G), adr1/ADR1 eds (enhanced disease susceptibility)1 and adr1/ADR1 abi1 double mutants, drought tolerance was significantly reduced. Microarray analyses of plants containing a conditional adr1 allele demonstrated that a significant number of the upregulated genes had been previously implicated in responses to dehydration. Therefore, biotic and abiotic signalling pathways may share multiple nodes and their outputs may have significant functional overlap.

  4. Identification of candidate genes for drought stress tolerance in rice by the integration of a genetic (QTL) map with the rice genome physical map

    Institute of Scientific and Technical Information of China (English)

    WANG Xu-sheng; ZHU Jun; MANSUETO Locedie; BRUSKIEWICH Richard

    2005-01-01

    Genetic improvement for drought stress tolerance in rice involves the quantitative nature of the trait, which reflects the additive effects of several genetic loci throughout the genome. Yield components and related traits under stressed and well-water conditions were assayed in mapping populations derived from crosses of Azucena×IR64 and Azucena×Bala. To find the candidate rice genes underlying Quantitative Trait Loci (QTL) in these populations, we conducted in silico analysis of a candidate region flanked by the genetic markers RM212 and RM319on chromosome 1, proximal to the semi-dwarf (sd1) locus. A total of 175annotated genes were identified from this region. These included 48 genes annotated by functional homology to known genes, 23pseudogenes, 24 ab initio predicted genes supported by an alignment match to an EST (Expressed sequence tag) of unknown function, and 80 hypothetical genes predicted solely by ab initio means. Among these, 16 candidate genes could potentially be involved in drought stress response.

  5. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions. PMID:17213639

  6. Brassinosteroids-Induced Systemic Stress Tolerance was Associated with Increased Transcripts of Several Defence-Related Genes in the Phloem in Cucumis sativus.

    Directory of Open Access Journals (Sweden)

    Pingfang Li

    Full Text Available Brassinosteroids (BRs, a group of naturally occurring plant steroidal compounds, are essential for plant growth, development and stress tolerance. Recent studies showed that BRs could induce systemic tolerance to biotic and abiotic stresses; however, the molecular mechanisms by which BRs signals lead to responses in the whole plant are largely unknown. In this study, 24-epibrassinosteroid (EBR-induced systemic tolerance in Cucumis sativus L. cv. Jinyan No. 4 was analyzed through the assessment of symptoms of photooxidative stress by chlorophyll fluorescence imaging pulse amplitude modulation. Expression of defense/stress related genes were induced in both treated local leaves and untreated systemic leaves by local EBR application. With the suppressive subtractive hybridization (SSH library using cDNA from the phloem sap of EBR-treated plants as the tester and distilled water (DW-treated plants as the driver, 14 transcripts out of 260 clones were identified. Quantitative Real Time-Polymerase Chain Reaction (RT-qPCR validated the specific up-regulation of these transcripts. Of the differentially expressed transcripts with known functions, transcripts for the selected four cDNAs, which encode an auxin-responsive protein (IAA14, a putative ankyrin-repeat protein, an F-box protein (PP2, and a major latex, pathogenesis-related (MLP-like protein, were induced in local leaves, systemic leaves and roots after foliar application of EBR onto mature leaves. Our results demonstrated that EBR-induced systemic tolerance is accompanied with increased transcript of genes in the defense response in other organs. The potential role of phloem mRNAs as signaling components in mediating BR-regulated systemic resistance is discussed.

  7. The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco

    Directory of Open Access Journals (Sweden)

    Yadav Narendra

    2012-10-01

    Full Text Available Abstract Background Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1 gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. Results The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC, chlorophyll, K+/Na+ ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na+ content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na+ content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na+ loading to xylem from root and leaf tissues. Transgenic lines also showed increased K+ and Ca2+ content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Conclusions Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na+ efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na+ content in different organs and also affect the other

  8. Simultaneous Overexpression of the HhERF2 and PeDREB2a Genes Enhanced Tolerances to Salt and Drought in Transgenic Cotton.

    Science.gov (United States)

    Li, Jin Bo; Ni Dong, Xue; Lei, Zhi; Liang Li, Yong; Yang Yang, Pei; Tao, Fei; Zhao, Liang; Li, Shi-Gang; Du, Lin Feng; Shao, Ji Rong; Wu, Yan Min

    2016-01-01

    A desert-grown Halimodendron halodendron ethylene-responsive element binding factor gene (HhERF2), which encodes a 245 amino acids protein containing a conserved AP2/EREBP domain, was isolated through the rapid amplification cDNA end (RACE) method. Sequence and phylogenetic analysis indicated that HhERF2 was classified into the B-2 group of ERF subfamily. Semiquantitative RT-PCR showed that HhERF2 was greatly induced by treatments with high-salt, drought and low temperature in H. halodendron seedlings. The expression vector containing HhERF2 and Populus euphratica dehydration- responsive element binding protein (PeDREB2a) genes driven by rd29A promoter was constructed and transferred into cotton (Gossypium hirsutum L.) by non-tissue culture Agrobacterium-mediated genetic transformation system. The transformation and expression of HhERF2 and PeDREB2a were identified by PCR and RT-PCR. Analyses of physiological function indicated that transgenic cottons had improved seeds germination, tolerance to drought and highsalt stresses. Agronomic evaluation in the field exhibited that transgenic lines presented a dwarf phenotype and improved further in the yield and characters. These results demonstrated that overexpressed both HhERF2 and PeDREB2a transcription factor genes in cotton induced elevated tolerance to drought and high-salt stresses. PMID:26972971

  9. GpDSR7, a Novel E3 Ubiquitin Ligase Gene in Grimmia pilifera Is Involved in Tolerance to Drought Stress in Arabidopsis.

    Science.gov (United States)

    Li, Mengmeng; Li, Yihao; Zhao, Junyi; Liu, Hai; Jia, Shenghua; Li, Jie; Zhao, Heping; Han, Shengcheng; Wang, Yingdian

    2016-01-01

    The growth and development of plants under drought stress depends mainly on the expression levels of various genes and modification of proteins. To clarify the molecular mechanism of drought-tolerance of plants, suppression subtractive hybridisation cDNA libraries were screened to identify drought-stress-responsive unigenes in Grimmia pilifera, and a novel E3 ubiquitin ligase gene, GpDSR7, was identified among the 240 responsive unigenes. GpDSR7 expression was induced by various abiotic stresses, particularly by drought. GpDSR7 displayed E3 ubiquitin ligase activity in vitro and was exclusively localised on the ER membrane in Arabidopsis mesophyll protoplasts. GpDSR7-overexpressing transgenic Arabidopsis plants showed a high water content and survival ratio under drought stress. Moreover, the expression levels of some marker genes involved in drought stress were higher in the transgenic plants than in wild-type plants. These results suggest that GpDSR7, an E3 ubiquitin ligase, is involved in tolerance to drought stress at the protein modification level. PMID:27228205

  10. Overexpression of Rice Sphingosine-1-Phoshpate Lyase Gene OsSPL1 in Transgenic Tobacco Reduces Salt and Oxidative Stress Tolerance

    Institute of Scientific and Technical Information of China (English)

    Huijuan Zhang; Jing Zhai; Jibo Mo; Dayong Li; Fengming Song

    2012-01-01

    Sphingolipids,including sphingosine-1-phosphate (S1P),have been shown to function as signaling mediators to regulate diverse aspects of plant growth,development,and stress response.In this study,we performed functional analysis of a rice (Oryza sativa) S1P lyase gene OsSPL1 in transgenic tobacco plants and explored its possible involvement in abiotic stress response.Overexpression of OsSPL1 in transgenic tobacco resulted in enhanced sensitivity to exogenous abscisic acid (ABA),and decreased tolerance to salt and oxidative stress,when compared with the wild type.Furthermore,the expression levels of some selected stress-related genes in OsSPL1-overexpressing plants were reduced after application of salt or oxidative stress,indicating that the altered responsiveness of stress-related genes may be responsible for the reduced tolerance in OsSPL1-overexpressing tobacco plants under salt and oxidative stress.Our results suggest that rice OsSPL1 plays an important role in abiotic stress responses.

  11. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang

    2013-11-01

    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  12. Overexpression of a Chloroplast-located Peroxiredoxin Q Gene, SsPrxQ, Increases the Salt and Low-temperature Tolerance of Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Li-Wen Jing; Shi-Hua Chen; Xiao-Li Guo; Hui Zhang; Yan-Xiu Zhao

    2006-01-01

    Abiotic stress, such as salt, drought and extreme temperature,can result in enhanced production of reactive oxygen species (ROS). Plants have developed both enzymatic ROS-scavenging and non-enzymatic ROS-scavenging systems. The major ROS-scavenging enzymes of plants include superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), glutathione peroxidase (GPX) and peroxiredoxins (Prxs). In the present work, we identified a gene encoding chloroplast-located peroxiredoxin Q, SsPrxQ, from Suaeda salsa L. Located at chloroplast. Overexpression of SsPrxQ in Arabidopsis leads to an increase in salt and low-temperature tolerance.

  13. Effects of a healthy Nordic diet on gene expression changes in peripheral blood mononuclear cells in response to an oral glucose tolerance test in subjects with metabolic syndrome

    DEFF Research Database (Denmark)

    Leder, Lena; Kolehmainen, Marjukka; Narverud, Ingunn;

    2016-01-01

    BACKGROUND: Diet has a great impact on the risk of developing features of metabolic syndrome (MetS), type 2 diabetes mellitus (T2DM), and cardiovascular diseases (CVD). We evaluated whether a long-term healthy Nordic diet (ND) can modify the expression of inflammation and lipid metabolism......-related genes in peripheral blood mononuclear cells (PBMCs) during a 2-h oral glucose tolerance test (OGTT) in individuals with MetS. METHODS: A Nordic multicenter randomized dietary study included subjects (n = 213) with MetS, randomized to a ND group or a control diet (CD) group applying an isocaloric study...

  14. Association analysis of frost tolerance in rye using candidate genes and phenotypic data from controlled, semi-controlled, and field phenotyping platforms

    Directory of Open Access Journals (Sweden)

    Li Yongle

    2011-10-01

    Full Text Available Abstract Background Frost is an important abiotic stress that limits cereal production in the temperate zone. As the most frost tolerant small grain cereal, rye (Secale cereale L. is an ideal cereal model for investigating the genetic basis of frost tolerance (FT, a complex trait with polygenic inheritance. Using 201 genotypes from five Eastern and Middle European winter rye populations, this study reports a multi-platform candidate gene-based association analysis in rye using 161 single nucleotide polymorphisms (SNPs and nine insertion-deletion (Indel polymorphisms previously identified from twelve candidate genes with a putative role in the frost responsive network. Results Phenotypic data analyses of FT in three different phenotyping platforms, controlled, semi-controlled and field, revealed significant genetic variations in the plant material under study. Statistically significant (P ScCbf15 and one in ScCbf12, all leading to amino acid exchanges, were significantly associated with FT over all three phenotyping platforms. Distribution of SNP effect sizes expressed as percentage of the genetic variance explained by individual SNPs was highly skewed towards zero with a few SNPs obtaining large effects. Two-way epistasis was found between 14 pairs of candidate genes. Relatively low to medium empirical correlations of SNP-FT associations were observed across the three platforms underlining the need for multi-level experimentation for dissecting complex associations between genotypes and FT in rye. Conclusions Candidate gene based-association studies are a powerful tool for investigating the genetic basis of FT in rye. Results of this study support the findings of bi-parental linkage mapping and expression studies that the Cbf gene family plays an essential role in FT.

  15. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata” and Their Interspecific Inbred Line “Maxchata”

    Directory of Open Access Journals (Sweden)

    Neelam Ara

    2013-12-01

    Full Text Available The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C and severe (42 °C heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2, superoxide (O2− and malondialdehyde (MDA contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD, ascorbate peroxidase (APX, catalase (CAT and peroxidase (POD were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  16. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata”) and Their Interspecific Inbred Line “Maxchata”

    Science.gov (United States)

    Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2013-01-01

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2−) and malondialdehyde (MDA) contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration. PMID:24336062

  17. Antioxidant enzymatic activities and gene expression associated with heat tolerance in the stems and roots of two cucurbit species ("Cucurbita maxima" and "Cucurbita moschata") and their interspecific inbred line "Maxchata".

    Science.gov (United States)

    Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2013-12-10

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant "C. moschata", thermolabile "C. maxima" and moderately heat-tolerant interspecific inbred line "Maxchata" genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. "C. moschata" exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2(-)) and malondialdehyde (MDA) contents in the roots compared to stems, followed by "Maxchata". The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among "C. maxima" and "Maxchata", most of these genes were highly induced under heat stress in "Maxchata", which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  18. Developing herbicide-tolerant crops from mutations

    International Nuclear Information System (INIS)

    Herbicide-tolerant crops in combination with their corresponding herbicides are able to control many weeds that cannot be or are less effectively controlled with other means. Commercial herbicide-tolerant crops developed from herbicide-tolerant mutants include imidazolinone-tolerant maize, rice, wheat, oilseed rape, sunflower, and lentil; sulfonylurea-tolerant soybean and sunflower; cyclohexanedione-tolerant maize; and triazine-tolerant oilseed rape. Most of the herbicide-tolerant mutants were developed through chemical mutagenesis followed by herbicide selection. Several herbicide-tolerant mutants were also discovered through direct herbicide selection of spontaneous mutations. All mutations used in commercial herbicide-tolerant crops are derived from a single nucleotide substitution of genes that encode enzymes or proteins targeted by herbicides. Imidazolinone-tolerant maize, rice, wheat, and oilseed rape have a gene variant encoding an altered acetohydoxyacid synthase (AHAS) with the S653N amino acid substitution. Additionally, imidazolinone-tolerant maize and oilseed rape have an AHAS with the W574L amino acid substitution. Imidazolinone-tolerant sunflower has been developed from the A205V AHAS gene mutation. In contrast, sulfonylurea-tolerant sunflower selected from a farm field has an AHAS enzyme variant with the P197L amino acid substitution. Similarly, sulfonylurea-tolerant soybean has a P197S AHAS gene mutation. Sulfonylurea-tolerant sunflower from seed mutagenesis and imidazolinone-tolerant lentil are also derived from AHAS gene mutations. Cyclohexanedione-tolerant maize has an altered acetyl-CoA carboxylase with the I1781L amino acid substitution. Triazine-tolerant oil seed rape possesses a psbA gene variant that encodes the D1 protein of photosynthesis with the S264G amino acid substitution. The alleles of all commercial herbicide-tolerant mutations are incompletely-dominant and not pleiotropic except for the triazine-tolerant mutation which is

  19. Overexpression of Arabidopsis and rice stress genes' inducible transcription factor confers drought and salinity tolerance to rice.

    Science.gov (United States)

    Datta, Karabi; Baisakh, Niranjan; Ganguly, Moumita; Krishnan, Sellapan; Yamaguchi Shinozaki, Kazuko; Datta, Swapan K

    2012-06-01

    Rice yield is greatly affected by environmental stresses such as drought and salinity. In response to the challenge of producing rice plants tolerant to these stresses, we introduced cDNA encoding the transcription factors DREB1A and DREB1B under the control of the stress inducible rd29 promoter. Two different indica rice cultivars were used, BR29, an improved commercially cultivated variety from Bangladesh and IR68899B, an IRRI bred maintainer line for hybrid rice. Agrobacterium mediated transformation of BR29 was done independently with DREB1A isolated from rice and Arabidopsis and DREB1B isolated from rice, whereas biolistic transformation was done with rice- DREB1B in the case of IR68899B. Initial genetic integration was confirmed by PCR and Southern blot analysis. Salinity tolerance was assayed in very young seedlings. Drought stress tests were found to be more reliable when they were carried out at the pre-flowering booting stage. RNA gel blot analysis as well as quantitative PCR analysis was performed to estimate the transcription level under stressed and unstressed conditions. Agronomic performance studies were done with stressed and unstressed plants to compare the yield losses due to dehydration and salt loading stresses. Noticeably enhanced tolerance to dehydration was observed in the plants transformed with DREB1A isolated from Arabidopsis while DREB1B was found to be more effective for salt tolerance.

  20. Studying the possibility of isolating and characterizing genes responsible for salinity tolerance in some gamma irradiation-induced potato mutants

    International Nuclear Information System (INIS)

    Random Amplified Polymorphic DNA(RAPD) and Inter-Simple Sequence Repeat (ISSR) were deployed to study the genetic relatedness of nineteen different potato lines previously obtained by gamma irradiation and believed to be salt tolerant. The lines which belong to three different cultivars, Spunta, Draga and Diamant were confirmed to be salt tolerant in comparison with their controls. Twenty seven random primers and twenty five ISSR oligonucleotides were utilized to determine the genetic relatedness and to amplify DNA fragments involved in salt tolerance. ISSR clustering and Percent disagreement values (PDV) resembled that of the RAPDs for all studied lines. Consequently, RAPD and ISSR were reliable and could be used to determine the genetic relatedness of potato lines belonging to the same cultivar. Moreover, twenty unique DNA fragments were amplified using RAPD or ISSR in the tolerant mutant lines but not in their respective controls. The fragments were gel excised, reamplified and cloned in a cloning vector using QIAGEN A-addition and PCR cloning Kits. However, Blast data base search with the fragments sequences did not reveal any significant homology indicating the weakness of both the RAPD and ISSR techniques in identifying specific targets.(Authors)

  1. Over-expression of VvWRKY1 in grapevines induces expression of jasmonic acid pathway-related genes and confers higher tolerance to the downy mildew.

    Directory of Open Access Journals (Sweden)

    Chloé Marchive

    Full Text Available Most WRKY transcription factors activate expression of defence genes in a salicylic acid- and/or jasmonic acid-dependent signalling pathway. We previously identified a WRKY gene, VvWRKY1, which is able to enhance tolerance to fungal pathogens when it is overexpressed in tobacco. The present work analyzes the effects of VvWRKY1 overexpression in grapevine. Microarray analysis showed that genes encoding defence-related proteins were up-regulated in the leaves of transgenic 35S::VvWRKY1 grapevines. Quantitative RT-PCR analysis confirmed that three genes putatively involved in jasmonic acid signalling pathway were overexpressed in the transgenic grapes. The ability of VvWRKY1 to trans-activate the promoters of these genes was demonstrated by transient expression in grape protoplasts. The resistance to the causal agent of downy mildew, Plasmopara viticola, was enhanced in the transgenic plants. These results show that VvWRKY1 can increase resistance of grapevine against the downy mildew through transcriptional reprogramming leading to activation of the jasmonic acid signalling pathway.

  2. ALUMINUM BOX BUNDLING PRESS

    Directory of Open Access Journals (Sweden)

    Iosif DUMITRESCU

    2015-05-01

    Full Text Available In municipal solid waste, aluminum is the main nonferrous metal, approximately 80- 85% of the total nonferrous metals. The income per ton gained from aluminum recuperation is 20 times higher than from glass, steel boxes or paper recuperation. The object of this paper is the design of a 300 kN press for aluminum box bundling.

  3. Effect of the C.-1 388 A〉G polymorphism in chicken heat shock transcription factor 3 gene on heat tolerance

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-wu[1,2,3; KONG Li-na[1,2,3; ZHANG De-xian[1,4; JI Cong-liang[4; ZHANG Xi-quan[1,2; LUO Qing-bin[1,2,3

    2015-01-01

    Heat stress is one of the main factors that influence poultry production. Heat shock proteins (HSPs) are known to affect heat tolerance. The formation of HSPs is regulated by heat shock transcription factor 3 (HSF3) in chicken. A DNA pool was established for identifying single nucleotide polymorphisms (SNPs) of the chicken HSF3, and 13 SNPs were detected. The bioinformatic analysis showed that 8 SNPs had the capacity to alter the transcdption activity of HSF3. The dual luciferase report gene assay showed that there was a significant difference (P〈0.01) in the Firefly luciferase/Renilla luciferase ratio (F/R) of C.-1 703 A〉G ($1) and C.-1 388 A〉G (S4) sites at the 5"-untranslated region (UTR) of chicken HSF3. The elec- trophoretic mobility shift assay showed that the S4 site was a transcription binding factor. The analysis of the association of the S1 and S4 sites with heat tolerance index revealed that the $4 site was significantly correlated with the CD3+ T cell, corticosterone, and T3 levels in Lingshan chickens and with the heterophil/lymphocyte value in White Recessive Rock. These results showed that the S4 site at the 5 UTR of chicken HSF3 might have an impact on heat tolerance in summer and could be used as a potential marker for the selection of chicken with heat tolerance in the future.

  4. Construction and Verification of LuxS-negative Mutants of Streptococcus Mutans and the Effect of the Absence of LuxS Gene on the Acid Tolerance

    Institute of Scientific and Technical Information of China (English)

    YU Dan-ni; CHEN Jie; ZHANG Yao-chao; HAN Yu-zhi

    2009-01-01

    Objective: To knock out the entire Luxs gene of Streptococcus mutans(S.mutans) UA159 strain via homologous recombination and construct a Luxs-deleted mutant strain of S. Mutans. To study the difference between the acid resistance of S. Mutans Ingbritt C international standard strain and the acid resistance of LuxS mutant strain. Methods: Two DNA fragments locating in the upper and downstream of Luxs gene were amplified and a erythromycin resistance gene of PJT10 between them were engineered into PUC19 plasmid for constructing the recombination plasmid pUCluxKO. Electrotransformation of S.mutans cells with pUCluxKO-mutant resulted in isolation of erythromycin resistant S. Mutans transformants, which was identified by polymerase chain reaction, V.harveyi BB170 luminescence bioassay and sequencing analysis. Solutions of S. Mutans standard strain and LuxS mutant strain with same density were made and cultured at pH 3.5 to 7.0 BHI liquid for the same period.Terminal growth situation was compared.Firstly acidized in pH 5.5 BHI liquid,the two strains were cultured at pH 3.0 BHI liquid. The acid tolerance responses of the two strains were compared.Results:Restriction endonuclease analyses showed that pUCluxKO-mutant vector had been successfully recombined. The Luxs-deleted status of S.mutans mutants was confirmed by PCR with primers which were specific for the genes of Luxs and Erythromycin resistance. S.mutans mutant can not induce bioluminescence, indiating the mutant had been successfully recombined. After twenty generations of culture, the constructed Chinese S.mutans mutants were confirmed to be stable. Significant difference of aciduricity was observed between S.mutans standard strain and LuxS mutant strain.The acid resistance of standard strain was stronger than that of LuxS mutant strain.The two strains both displayed the capability of acid tolerance responses. Conclusion:The S.mutans gene allelic exchange plasmid is constructed correctively and a Luxs

  5. Expression of the maize ZmGF14-6 gene in rice confers tolerance to drought stress while enhancing susceptibility to pathogen infection.

    Science.gov (United States)

    Campo, Sonia; Peris-Peris, Cristina; Montesinos, Laura; Peñas, Gisela; Messeguer, Joaquima; San Segundo, Blanca

    2012-01-01

    14-3-3 proteins are found in all eukaryotes where they act as regulators of diverse signalling pathways associated with a wide range of biological processes. In this study the functional characterization of the ZmGF14-6 gene encoding a maize 14-3-3 protein is reported. Gene expression analyses indicated that ZmGF14-6 is up-regulated by fungal infection and salt treatment in maize plants, whereas its expression is down-regulated by drought stress. It is reported that rice plants constitutively expressing ZmGF14-6 displayed enhanced tolerance to drought stress which was accompanied by a stronger induction of drought-associated rice genes. However, rice plants expressing ZmGF14-6 either in a constitutive or under a pathogen-inducible regime showed a higher susceptibility to infection by the fungal pathogens Fusarium verticillioides and Magnaporthe oryzae. Under infection conditions, a lower intensity in the expression of defence-related genes occurred in ZmGF14-6 rice plants. These findings support that ZmGF14-6 positively regulates drought tolerance in transgenic rice while negatively modulating the plant defence response to pathogen infection. Transient expression assays of fluorescently labelled ZmGF14-6 protein in onion epidermal cells revealed a widespread distribution of ZmGF14-6 in the cytoplasm and nucleus. Additionally, colocalization experiments of fluorescently labelled ZmGF14-6 with organelle markers, in combination with cell labelling with the endocytic tracer FM4-64, revealed a subcellular localization of ZmGF14-6 in the early endosomes. Taken together, these results improve our understanding of the role of ZmGF14-6 in stress signalling pathways, while indicating that ZmGF14-6 inversely regulates the plant response to biotic and abiotic stresses. PMID:22016430

  6. A myo-inositol-1-phosphate synthase gene, IbMIPS1, enhances salt and drought tolerance and stem nematode resistance in transgenic sweet potato.

    Science.gov (United States)

    Zhai, Hong; Wang, Feibing; Si, Zengzhi; Huo, Jinxi; Xing, Lei; An, Yanyan; He, Shaozhen; Liu, Qingchang

    2016-02-01

    Myo-inositol-1-phosphate synthase (MIPS) is a key rate limiting enzyme in myo-inositol biosynthesis. The MIPS gene has been shown to improve tolerance to abiotic stresses in several plant species. However, its role in resistance to biotic stresses has not been reported. In this study, we found that expression of the sweet potato IbMIPS1 gene was induced by NaCl, polyethylene glycol (PEG), abscisic acid (ABA) and stem nematodes. Its overexpression significantly enhanced stem nematode resistance as well as salt and drought tolerance in transgenic sweet potato under field conditions. Transcriptome and real-time quantitative PCR analyses showed that overexpression of IbMIPS1 up-regulated the genes involved in inositol biosynthesis, phosphatidylinositol (PI) and ABA signalling pathways, stress responses, photosynthesis and ROS-scavenging system under salt, drought and stem nematode stresses. Inositol, inositol-1,4,5-trisphosphate (IP3 ), phosphatidic acid (PA), Ca(2+) , ABA, K(+) , proline and trehalose content was significantly increased, whereas malonaldehyde (MDA), Na(+) and H2 O2 content was significantly decreased in the transgenic plants under salt and drought stresses. After stem nematode infection, the significant increase of inositol, IP3 , PA, Ca(2+) , ABA, callose and lignin content and significant reduction of MDA content were found, and a rapid increase of H2 O2 levels was observed, peaked at 1 to 2 days and thereafter declined in the transgenic plants. This study indicates that the IbMIPS1 gene has the potential to be used to improve the resistance to biotic and abiotic stresses in plants. PMID:26011089

  7. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    Science.gov (United States)

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants.

  8. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Directory of Open Access Journals (Sweden)

    Bianca Lawson

    Full Text Available Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60% over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research

  9. Differential responses of CO2 assimilation, carbohydrate allocation and gene expression to NaCl stress in perennial ryegrass with different salt tolerance.

    Directory of Open Access Journals (Sweden)

    Tao Hu

    Full Text Available Little is known about the effects of NaCl stress on perennial ryegrass (Lolium perenne L. photosynthesis and carbohydrate flux. The objective of this study was to understand the carbohydrate metabolism and identify the gene expression affected by salinity stress. Seventy-four days old seedlings of two perennial ryegrass accessions (salt-sensitive 'PI 538976' and salt-tolerant 'Overdrive' were subjected to three levels of salinity stress for 5 days. Turf quality in all tissues (leaves, stems and roots of both grass accessions negatively and significantly correlated with GFS (Glu+Fru+Suc content, except for 'Overdrive' stems. Relative growth rate (RGR in leaves negatively and significantly correlated with GFS content in 'Overdrive' (P0.05 for turf quality. A greater up-regulation in the expression of SPS, SS, SI, 6-SFT gene was observed in 'Overdrive' than 'PI 538976'. A higher level of SPS and SS expression in leaves was found in 'PI 538976' relative to 'Overdrive'. Accumulation of hexoses in roots, stems and leaves can induce a feedback repression to photosynthesis in salt-stressed perennial ryegrass and the salt tolerance may be changed with the carbohydrate allocation in leaves and stems.

  10. MaJAZ1 Attenuates the MaLBD5-Mediated Transcriptional Activation of Jasmonate Biosynthesis Gene MaAOC2 in Regulating Cold Tolerance of Banana Fruit.

    Science.gov (United States)

    Ba, Liang-jie; Kuang, Jian-fei; Chen, Jian-ye; Lu, Wang-jin

    2016-02-01

    Previous studies indicated that methyl jasmonate (MeJA) treatment could effectively reduce the chilling injury of many fruits, including banana, but the underlying mechanism is poorly understood. In this study, one lateral organ boundaries (LOB) domain (LBD) gene, designated as MaLBD5, was isolated and characterized from banana fruit. Expression analysis revealed that accumulation of MaLBD5 was induced by cold temperature and MeJA treatment. Subcellular localization and transactivation assays showed that MaLBD5 was localized to the nucleus and possessed transcriptional activation activity. Protein-protein interaction analysis demonstrated that MaLBD5 physically interacted with MaJAZ1, a potential repressor of jasmonate signaling. Furthermore, transient expression assays indicated that MaLBD5 transactivated a jasmonate biosynthesis gene, termed MaAOC2, which was also induced by cold and MeJA. More interestingly, MaJAZ1 attenuated the MaLBD5-mediated transactivation of MaAOC2. These results suggest that MaLBD5 and MaJAZ1 might act antagonistically in relation to MeJA-induced cold tolerance of banana fruit, at least partially via affecting jasmonate biosynthesis. Collectively, our findings expand the knowledge of the transcriptional regulatory network of MeJA-mediated cold tolerance of banana fruit.

  11. Regulated expression of an isopentenyltransferase gene (IPT) in peanut significantly improves drought tolerance and increases yield under field conditions.

    Science.gov (United States)

    Qin, Hua; Gu, Qiang; Zhang, Junling; Sun, Li; Kuppu, Sundaram; Zhang, Yizheng; Burow, Mark; Payton, Paxton; Blumwald, Eduardo; Zhang, Hong

    2011-11-01

    Isopentenyltransferase (IPT) is a critical enzyme in the cytokinin biosynthetic pathway. The expression of IPT under the control of a maturation- and stress-induced promoter was shown to delay stress-induced plant senescence that resulted in an enhanced drought tolerance in both monocot and dicot plants. This report extends the earlier findings in tobacco and rice to peanut (Arachis hypogaea L.), an important oil crop and protein source. Regulated expression of IPT in peanut significantly improved drought tolerance in both laboratory and field conditions. Transgenic peanut plants maintained higher photosynthetic rates, higher stomatal conductance and higher transpiration than wild-type control plants under reduced irrigation conditions. More importantly, transgenic peanut plants produced significantly higher yields than wild-type control plants in the field, indicating a great potential for the development of crops with improved performance and yield in water-limited areas of the world.

  12. Disruption of the Arabidopsis Defense Regulator Genes SAG101, EDS1, and PAD4 Confers Enhanced Freezing Tolerance.

    Science.gov (United States)

    Chen, Qin-Fang; Xu, Le; Tan, Wei-Juan; Chen, Liang; Qi, Hua; Xie, Li-Juan; Chen, Mo-Xian; Liu, Bin-Yi; Yu, Lu-Jun; Yao, Nan; Zhang, Jian-Hua; Shu, Wensheng; Xiao, Shi

    2015-10-01

    In Arabidopsis, three lipase-like regulators, SAG101, EDS1, and PAD4, act downstream of resistance protein-associated defense signaling. Although the roles of SAG101, EDS1, and PAD4 in biotic stress have been extensively studied, little is known about their functions in plant responses to abiotic stresses. Here, we show that SAG101, EDS1, and PAD4 are involved in the regulation of freezing tolerance in Arabidopsis. With or without cold acclimation, the sag101, eds1, and pad4 single mutants, as well as their double mutants, exhibited similarly enhanced tolerance to freezing temperatures. Upon cold exposure, the sag101, eds1, and pad4 mutants showed increased transcript levels of C-REPEAT/DRE BINDING FACTORs and their regulons compared with the wild type. Moreover, freezing-induced cell death and accumulation of hydrogen peroxide were ameliorated in sag101, eds1, and pad4 mutants. The sag101, eds1, and pad4 mutants had much lower salicylic acid (SA) and diacylglycerol (DAG) contents than the wild type, and exogenous application of SA and DAG compromised the freezing tolerance of the mutants. Furthermore, SA suppressed the cold-induced expression of DGATs and DGKs in the wild-type leaves. These findings indicate that SAG101, EDS1, and PAD4 are involved in the freezing response in Arabidopsis, at least in part, by modulating the homeostasis of SA and DAG.

  13. Improved shoot regeneration, salinity tolerance and reduced fungal susceptibility in transgenic tobacco constitutively expressing PR-10a gene

    Directory of Open Access Journals (Sweden)

    Parinita eAgarwal

    2016-02-01

    Full Text Available Plants in ecosystems are simultaneously exposed to abiotic and biotic stresses, which restrict plant growth and development. The complex responses to these stresses are largely regulated by plant hormones, which in turn, orchestrate the different biochemical and molecular pathways to manoeuvre stress tolerance. The PR-10 protein family is reported to be involved in defence regulation, stress response and plant growth and development. The JcPR-10a overexpression resulted in increased number of shoot buds in tobacco (Nicotiana tabacum, which could be due to high cytokinin to auxin ratio in the transgenics. The docking analysis shows the binding of three BAP molecules at the active sites of JcPR-10a protein. JcPR-10a transgenics showed enhanced salt tolerance, as was evident by increased germination rate, shoot and root length, relative water content, proline, soluble sugar and amino acid content under salinity. Interestingly, the transgenics also showed enhanced endogenous cytokinin level as compared to WT, which, further increased with salinity. Exposure of gradual salinity resulted in increased stomatal conductance, water use efficiency, photosynthesis rate and reduced transpiration rate. Furthermore, the transgenics also showed enhanced resistance against Macrophomina fungus. Thus, JcPR-10a might be working in co-ordination with cytokinin signalling in mitigating the stress induced damage by regulating different stress signalling pathways, leading to enhanced stress tolerance.

  14. Improved Shoot Regeneration, Salinity Tolerance and Reduced Fungal Susceptibility in Transgenic Tobacco Constitutively Expressing PR-10a Gene.

    Science.gov (United States)

    Agarwal, Parinita; Dabi, Mitali; More, Prashant; Patel, Khantika; Jana, Kalyanashis; Agarwal, Pradeep K

    2016-01-01

    Plants in ecosystems are simultaneously exposed to abiotic and biotic stresses, which restrict plant growth and development. The complex responses to these stresses are largely regulated by plant hormones, which in turn, orchestrate the different biochemical and molecular pathways to maneuver stress tolerance. The PR-10 protein family is reported to be involved in defense regulation, stress response and plant growth and development. The JcPR-10a overexpression resulted in increased number of shoot buds in tobacco (Nicotiana tabacum), which could be due to high cytokinin to auxin ratio in the transgenics. The docking analysis shows the binding of three BAP molecules at the active sites of JcPR-10a protein. JcPR-10a transgenics showed enhanced salt tolerance, as was evident by increased germination rate, shoot and root length, relative water content, proline, soluble sugar and amino acid content under salinity. Interestingly, the transgenics also showed enhanced endogenous cytokinin level as compared to WT, which, further increased with salinity. Exposure of gradual salinity resulted in increased stomatal conductance, water use efficiency, photosynthesis rate and reduced transpiration rate. Furthermore, the transgenics also showed enhanced resistance against Macrophomina fungus. Thus, JcPR-10a might be working in co-ordination with cytokinin signaling in mitigating the stress induced damage by regulating different stress signaling pathways, leading to enhanced stress tolerance. PMID:26973666

  15. Graphene-aluminum nanocomposites

    International Nuclear Information System (INIS)

    Highlights: → We investigated the mechanical properties of aluminum and aluminum nanocomposites. → Graphene composite had lower strength and hardness compared to nanotube reinforcement. → Processing causes aluminum carbide formation at graphene defects. → The carbides in between grains is a source of weakness and lowers tensile strength. - Abstract: Composites of graphene platelets and powdered aluminum were made using ball milling, hot isostatic pressing and extrusion. The mechanical properties and microstructure were studied using hardness and tensile tests, as well as electron microscopy, X-ray diffraction and differential scanning calorimetry. Compared to the pure aluminum and multi-walled carbon nanotube composites, the graphene-aluminum composite showed decreased strength and hardness. This is explained in the context of enhanced aluminum carbide formation with the graphene filler.

  16. Graphene-aluminum nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Bartolucci, Stephen F., E-mail: stephen.bartolucci@us.army.mil [U.S. Army Benet Laboratories, Armaments Research Development and Engineering Center, Watervliet, NY 12189-4000 (United States); Paras, Joseph [U.S. Army Benet Laboratories, Armaments Research Development and Engineering Center, Watervliet, NY 12189-4000 (United States); Rafiee, Mohammad A. [Department of Mechanical Engineering and Materials Science, Rice University, Houston, TX 77005 (United States); Rafiee, Javad [Department of Mechanical, Aerospace and Nuclear Engineering, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Lee, Sabrina; Kapoor, Deepak [U.S. Army Benet Laboratories, Armaments Research Development and Engineering Center, Watervliet, NY 12189-4000 (United States); Koratkar, Nikhil, E-mail: koratn@rpi.edu [Department of Mechanical, Aerospace and Nuclear Engineering, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)

    2011-10-15

    Highlights: {yields} We investigated the mechanical properties of aluminum and aluminum nanocomposites. {yields} Graphene composite had lower strength and hardness compared to nanotube reinforcement. {yields} Processing causes aluminum carbide formation at graphene defects. {yields} The carbides in between grains is a source of weakness and lowers tensile strength. - Abstract: Composites of graphene platelets and powdered aluminum were made using ball milling, hot isostatic pressing and extrusion. The mechanical properties and microstructure were studied using hardness and tensile tests, as well as electron microscopy, X-ray diffraction and differential scanning calorimetry. Compared to the pure aluminum and multi-walled carbon nanotube composites, the graphene-aluminum composite showed decreased strength and hardness. This is explained in the context of enhanced aluminum carbide formation with the graphene filler.

  17. Molecular and physiological strategies to increase aluminum resistance in plants.

    Science.gov (United States)

    Inostroza-Blancheteau, Claudio; Rengel, Zed; Alberdi, Miren; de la Luz Mora, María; Aquea, Felipe; Arce-Johnson, Patricio; Reyes-Díaz, Marjorie

    2012-03-01

    Aluminum (Al) toxicity is a primary limitation to plant growth on acid soils. Root meristems are the first site for toxic Al accumulation, and therefore inhibition of root elongation is the most evident physiological manifestation of Al toxicity. Plants may resist Al toxicity by avoidance (Al exclusion) and/or tolerance mechanisms (detoxification of Al inside the cells). The Al exclusion involves the exudation of organic acid anions from the root apices, whereas tolerance mechanisms comprise internal Al detoxification by organic acid anions and enhanced scavenging of free oxygen radicals. One of the most important advances in understanding the molecular events associated with the Al exclusion mechanism was the identification of the ALMT1 gene (Al-activated malate transporter) in Triticum aestivum root cells, which codes for a plasma membrane anion channel that allows efflux of organic acid anions, such as malate, citrate or oxalate. On the other hand, the scavenging of free radicals is dependent on the expression of genes involved in antioxidant defenses, such as peroxidases (e.g. in Arabidopsis thaliana and Nicotiana tabacum), catalases (e.g. in Capsicum annuum), and the gene WMnSOD1 from T. aestivum. However, other recent findings show that reactive oxygen species (ROS) induced stress may be due to acidic (low pH) conditions rather than to Al stress. In this review, we summarize recent findings regarding molecular and physiological mechanisms of Al toxicity and resistance in higher plants. Advances have been made in understanding some of the underlying strategies that plants use to cope with Al toxicity. Furthermore, we discuss the physiological and molecular responses to Al toxicity, including genes involved in Al resistance that have been identified and characterized in several plant species. The better understanding of these strategies and mechanisms is essential for improving plant performance in acidic, Al-toxic soils.

  18. Expression of a codon-optimized dsdA gene in tobacco plastids and rice nuclear confers D-serine tolerance

    Directory of Open Access Journals (Sweden)

    Yanmei eLi

    2016-05-01

    Full Text Available D-serine is toxic to plants. D-serine ammonia lyase, which is encoded by the dsdA gene, can attenuate this toxicity with high specificity. In the present study, we explored the function of codon-optimized dsdA with tobacco plastids and rice nuclear transformation system. It was shown that the dsdA gene was site-specifically integrated into the tobacco chloroplast genome and displayed a high level of expression. Genetic analysis of the progenies showed that the dsdA gene is maternally inherited and confers sufficient D-serine resistance in tobacco. The effective screening concentrations of D-serine for seed germination, callus regeneration and foliar spray were 10 mM, 30 mM and 75 mM, respectively. In addition, calluses from homozygous transgenic rice lines also showed significant tolerance to D-serine (up to 75 mM. Our study proves the feasibility of using dsdA gene as a selectable marker in both chloroplast and nuclear transformation systems.

  19. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    Science.gov (United States)

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  20. Cloning and Sequence Analysis of a Glucose-6-Phosphate Dehydrogenase Gene PsG6PDH from Freezing-tolerant Populus suaveolens

    Institute of Scientific and Technical Information of China (English)

    Lin Yuan-zhen; Lin Shan-zhi; Zhang Wei; Zhang Qian; Zhang Zhi-yi; Guo Huan

    2005-01-01

    A 1207 hp cDNA fragment (PsG6PDH) was amplified by PT-PCR from cold-induced total Pna of the freexing-tolerant P. Suaveolens, using primers based on the highly comserved region of published plant glucose-6-phosphate dehydrogenase (G6PDH)genes. The sepuence analysis showed that PsG6PDH coding region had 1 101 bp and encoded 367 predicted aminoacid residues. Moreover, the nucleotide sequence of psG6PDH showed 83%,82%,79%,79% and 78% identity, and the derived amino acid sequence shared 44.2%,44.7%,42.0%,40.5% and 43.9% identity with those of the Solanum tuberosum, Nicotiana tabacum, Triticum aestivum, Oryxa sativa and Arabidopsis thaliana, respectively. The results show that PsG6PDH is a new member of G6PDH gene family and belongs to cytosolic G6PDH gene. This is the first report on clonign of the G6PDH gene from woody plants.

  1. Regulation of pepc gene expression in Anabaena sp. PCC 7120 and its effects on cyclic electron flow around photosystem I and tolerances to environmental stresses.

    Science.gov (United States)

    Jia, Xiao-Hui; Zhang, Peng-Peng; Shi, Ding-Ji; Mi, Hua-Ling; Zhu, Jia-Cheng; Huang, Xi-Wen; He, Pei-Min

    2015-05-01

    Since pepc gene encoding phosphoenolpyruvate c