WorldWideScience

Sample records for aluminum tolerance genes

  1. Aluminum-activated citrate and malate transporters encoded by distinct Al tolerance genes function independently in Arabidopsis

    Science.gov (United States)

    Aluminum (Al) -activated malate and citrate exudation from roots plays an important role in conferring Al tolerance to many plant species. Here, we report on the identification and characterization of AtMATE, the gene encoding an Al-activated root citrate efflux transporter that functions in Arabid...

  2. Overexpression of a soybean ariadne-like ubiquitin ligase gene GmARI1 enhances aluminum tolerance in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Xiaolian Zhang

    Full Text Available Ariadne (ARI subfamily of RBR (Ring Between Ring fingers proteins have been found as a group of putative E3 ubiquitin ligases containing RING (Really Interesting New Gene finger domains in fruitfly, mouse, human and Arabidopsis. Recent studies showed several RING-type E3 ubiquitin ligases play important roles in plant response to abiotic stresses, but the function of ARI in plants is largely unknown. In this study, an ariadne-like E3 ubiquitin ligase gene was isolated from soybean, Glycine max (L. Merr., and designated as GmARI1. It encodes a predicted protein of 586 amino acids with a RBR supra-domain. Subcellular localization studies using Arabidopsis protoplast cells indicated GmARI protein was located in nucleus. The expression of GmARI1 in soybean roots was induced as early as 2-4 h after simulated stress treatments such as aluminum, which coincided with the fact of aluminum toxicity firstly and mainly acting on plant roots. In vitro ubiquitination assay showed GmARI1 protein has E3 ligase activity. Overexpression of GmARI1 significantly enhanced the aluminum tolerance of transgenic Arabidopsis. These findings suggest that GmARI1 encodes a RBR type E3 ligase, which may play important roles in plant tolerance to aluminum stress.

  3. Engineering high-level aluminum tolerance in barley with the ALMT1 gene.

    Science.gov (United States)

    Delhaize, Emmanuel; Ryan, Peter R; Hebb, Diane M; Yamamoto, Yoko; Sasaki, Takayuki; Matsumoto, Hideaki

    2004-10-19

    Acidity is a serious limitation to plant production on many of the world's agricultural soils. Toxic aluminium (Al) cations solubilized by the acidity rapidly inhibit root growth and limit subsequent uptake of water and nutrients. Recent work has shown that the ALMT1 gene of wheat (Triticum aestivum) encodes a malate transporter that is associated with malate efflux and Al tolerance. We generated transgenic barley (Hordeum vulgare) plants expressing ALMT1 and assessed their ability to exude malate and withstand Al stress. ALMT1 expression in barley conferred an Al-activated efflux of malate with properties similar to those of Al-tolerant wheat. The transgenic barley showed a high level of Al tolerance when grown in both hydroponic culture and on acid soils. These findings provide additional evidence that ALMT1 is a major Al-tolerance gene and demonstrate its ability to confer effective tolerance to acid soils through a transgenic approach in an important crop species. PMID:15471989

  4. Searching for RFLP markers to identify genes for aluminum tolerance in maize

    International Nuclear Information System (INIS)

    The objective of this study was to identify restriction fragment length polymorphism (RFLP) markers linked to Quantitative Trait Loci (QTL) that control aluminum (Al) tolerance in maize. The strategy used was bulked segregant analysis (BSA) and the genetic materials utilized were the F2, F3 and F4 populations derived from a cross between the Al-susceptible inbred line L53 and Al-tolerant inbred line L1327. The populations were evaluated in a nutrient solution containing a toxic concentration of Al (6 ppm) and relative seminal root length (RSRL) was used as a phenotypic measure of tolerance. Seedlings of the F2 population with the highest and lowest RSRL values were transplanted to the field and subsequently selfed to obtain F3 and F4 families. The efficiency of the phenotypic index for selection was found to be greater when mean values were used instead of individual RSRL values. F3 and F4 families were then evaluated in nutrient solution to identify those that were not segregating. One hundred and thirteen probes, with an average interval of 30 cM, covering the 10 maize chromosomes were tested for their ability to discriminate the parental lines. Fifty four of these probes were polymorphic with 46 showing codominance. These probes were hybridized with DNA from two F3 contrasting, bulks and three probes on chromosome 8 were found to be able distinguish the F3 contrasting bulks on the basis of band position and intensity. DNA of families from the F3 bulks hybridized with these probes showed the presence of heterozygous individuals. These three selected probes were also hybridized with DNA from F2 individuals. Two of them showed a significant regression coefficient with the character. However, each of these probes explained only about 10% of the phenotypic variance observed in 70 F2 individuals. One of the probes UMC 103 was hybridized with DNA from 168 F4 families and the regression analysis of RFLP data showed a significant regression coefficient with a

  5. Engineering high-level aluminum tolerance in barley with the ALMT1 gene

    OpenAIRE

    Delhaize, Emmanuel; Ryan, Peter R.; Hebb, Diane M.; Yamamoto, Yoko; Sasaki, Takayuki; Matsumoto, Hideaki

    2004-01-01

    Acidity is a serious limitation to plant production on many of the world's agricultural soils. Toxic aluminium (Al) cations solubilized by the acidity rapidly inhibit root growth and limit subsequent uptake of water and nutrients. Recent work has shown that the ALMT1 gene of wheat (Triticum aestivum) encodes a malate transporter that is associated with malate efflux and Al tolerance. We generated transgenic barley (Hordeum vulgare) plants expressing ALMT1 and assessed their ability to exude m...

  6. Aluminum tolerance association mapping in triticale

    Directory of Open Access Journals (Sweden)

    Niedziela Agnieszka

    2012-02-01

    Full Text Available Abstract Background Crop production practices and industrialization processes result in increasing acidification of arable soils. At lower pH levels (below 5.0, aluminum (Al remains in a cationic form that is toxic to plants, reducing growth and yield. The effect of aluminum on agronomic performance is particularly important in cereals like wheat, which has promoted the development of programs directed towards selection of tolerant forms. Even in intermediately tolerant cereals (i.e., triticale, the decrease in yield may be significant. In triticale, Al tolerance seems to be influenced by both wheat and rye genomes. However, little is known about the precise chromosomal location of tolerance-related genes, and whether wheat or rye genomes are crucial for the expression of that trait in the hybrid. Results A mapping population consisting of 232 advanced breeding triticale forms was developed and phenotyped for Al tolerance using physiological tests. AFLP, SSR and DArT marker platforms were applied to obtain a sufficiently large set of molecular markers (over 3000. Associations between the markers and the trait were tested using General (GLM and Multiple (MLM Linear Models, as well as the Statistical Machine Learning (SML approach. The chromosomal locations of candidate markers were verified based on known assignments of SSRs and DArTs or by using genetic maps of rye and triticale. Two candidate markers on chromosome 3R and 9, 15 and 11 on chromosomes 4R, 6R and 7R, respectively, were identified. The r2 values were between 0.066 and 0.220 in most cases, indicating a good fit of the data, with better results obtained with the GML than the MLM approach. Several QTLs on rye chromosomes appeared to be involved in the phenotypic expression of the trait, suggesting that rye genome factors are predominantly responsible for Al tolerance in triticale. Conclusions The Diversity Arrays Technology was applied successfully to association mapping studies

  7. Characterization of Aluminum Tolerance in Rye

    International Nuclear Information System (INIS)

    Large insert libraries, cosmid, yeast artificial chromosomes (YACs), bacteriophage P1, bacterial artificial chromosomes (BACs), and P1-derived artificial chromosomes (PACs), have proven to be valuable tools for gene cloning, physical mapping, and comparative genomics. Of all the large insert libraries, BAC libraries are the most widely used, because of their ease of creation, large insert size, and stability. This report describes a simplified method for plant BAC library construction, which involves isolation and partial digestion of intact nuclei, selection of appropriate size of DNA via pulsed-field gel (PFG) electrophoresis, elution of DNA from agarose gels, ligation of DNA into the BAC vector, electroporation of the ligation mix into Escherichia coli cells and estimation of insert sizes. The whole process takes 1-3 months depending on the genome size and coverage required. We used this approach to produce a BAC library from different rye (Secale cereale L.) for utilization in our attempts to clone the gene complex controlling aluminum tolerance. (author)

  8. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes

    2002-01-01

    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  9. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) activated root malate and citrate exudation plays an important role in Al tolerance in many plant species. Here, we report on the identification and characterization of AtMATE, a homolog of the recently discovered sorghum and barley Al tolerance genes, here shown to encode an Al-activ...

  10. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) activated root malate and citrate exudation play an important role in Al tolerance in many plant species. AtALMT1, an Al-activated malate transporter, is a major contributor to Arabidopsis Al tolerance. Here, we demonstrate that a second, unrelated gene, AtMATE, encodes an Arabidopsi...

  11. Positional Cloning and Characterization of AltSB, a Major Aluminum Tolerance Gene in Sorghum: Toward the Identification of the Molecular and Physiological basis of Allelic effects

    Science.gov (United States)

    Aluminum toxicity is a major constraint for agriculture on acid soils, which comprise over half of the world’s potentially arable lands. However, the molecular basis underlying the most accepted tolerance mechanism based on Al-induced organic acid release by root apices, is only now being elucidate...

  12. Proteomics of aluminum tolerance in plants.

    Science.gov (United States)

    Zheng, Lu; Lan, Ping; Shen, Ren Fang; Li, Wen Feng

    2014-03-01

    Aluminum (Al) toxicity is a major constraint for plant root development and growth as well as crop yield in acidic soils, which constitute approximately 40% of the potentially arable lands worldwide. The mechanisms of Al tolerance in plants are not well understood. As a whole systems approach, proteomic techniques have proven to be crucial as a complementary strategy to explore the mechanism in Al toxicity. Review here focuses on the potential of proteomics to unravel the common and plant species-specific changes at proteome level under Al stress, via comparative analysis of the Al-responsive proteins uncovered by recent proteomic studies using 2DE. Understanding the mechanisms of Al tolerance in plants is critical to generate Al resistance crops for developing sustainable agriculture practices, thereby contributing to food security worldwide. PMID:24339160

  13. Enhancement of aluminum tolerance in wheat by addition of chromosomes from the wild relative Leymus racemosus

    OpenAIRE

    Mohammed, Yasir Serag Alnor; Eltayeb, Amin Elsadig; Tsujimoto, Hisashi

    2013-01-01

    Aluminum (Al) toxicity is the key factor limiting wheat production in acid soils. Soil liming has been used widely to increase the soil pH, but due to its high cost, breeding tolerant cultivars is more cost-effective mean to mitigate the problem. Tolerant cultivars could be developed by traditional breeding, genetic transformation or introgression of genes from wild relatives. We used 30 wheat alien chromosome addition lines to identify new genetic resources to improve wheat tolerance to Al a...

  14. Natural variation underlies alterations in Nramp aluminum transporter (NRAT1) expression and function that play a key role in rice aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) toxicity is a major constraint for crop production on acid soils that comprise approximately 50% of arable land in the tropics and subtropics. Rice is the most Al tolerant cereal crop, and offers a good model for identifying Al tolerance genes and mechanisms. Here we investigated natur...

  15. Comparative Proteomic Analysis of Aluminum Tolerance in Tibetan Wild and Cultivated Barleys

    OpenAIRE

    Dai, Huaxin; Cao, Fangbin; Chen, Xianhong; Zhang, Mian; Ahmed, Imrul Mosaddek; Chen, Zhong-Hua; Li, Chengdao; Zhang, Guoping; Wu, Feibo

    2013-01-01

    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation t...

  16. Aluminum exclusion and aluminum tolerance in woody plants

    OpenAIRE

    Brunner, Ivano; Sperisen, Christoph

    2013-01-01

    The aluminum (Al) cation Al3 + is highly rhizotoxic and is a major stress factor to plants on acid soils, which cover large areas of tropical and boreal regions. Many woody plant species are native to acid soils and are well adapted to high Al3 + conditions. In tropical regions, both woody Al accumulator and non-Al accumulator plants occur, whereas in boreal regions woody plants are non-Al accumulators. The mechanisms of these adaptations can be divided into those that facilitate the exclusio...

  17. Genetic architecture of aluminum tolerance in rice (O. sativa) determined through genome-wide association analysis and QTL mapping

    Science.gov (United States)

    Aluminum (Al) toxicity is a primary limitation to crop productivity on acid soils and rice is significantly more Al tolerant than other cereals. However, mechanisms of rice Al tolerance are largely unknown and no genes underlying natural variation have been reported. We screened 383 diverse rice acc...

  18. 40 CFR 180.415 - Aluminum tris (O-ethylphosphonate); tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Aluminum tris (O-ethylphosphonate... Tolerances § 180.415 Aluminum tris (O-ethylphosphonate); tolerances for residues. (a) General. Tolerances are established for residues of the fungicide aluminum tris(O-ethylphosphonate) in or on the following...

  19. Enhancement of aluminum tolerance in wheat by addition of chromosomes from the wild relative Leymus racemosus.

    Science.gov (United States)

    Mohammed, Yasir Serag Alnor; Eltayeb, Amin Elsadig; Tsujimoto, Hisashi

    2013-12-01

    Aluminum (Al) toxicity is the key factor limiting wheat production in acid soils. Soil liming has been used widely to increase the soil pH, but due to its high cost, breeding tolerant cultivars is more cost-effective mean to mitigate the problem. Tolerant cultivars could be developed by traditional breeding, genetic transformation or introgression of genes from wild relatives. We used 30 wheat alien chromosome addition lines to identify new genetic resources to improve wheat tolerance to Al and to identify the chromosomes harboring the tolerance genes. We evaluated these lines and their wheat background Chinese Spring for Al tolerance in hydroponic culture at various Al concentrations. We also investigated Al uptake, oxidative stress and cell membrane integrity. The L. racemosus chromosomes A and E significantly enhanced the Al tolerance of the wheat in term of relative root growth. At the highest Al concentration tested (200 μM), line E had the greatest tolerance. The introgressed chromosomes did not affect Al uptake of the tolerant lines. We attribute the improved tolerance conferred by chromosome E to improved cell membrane integrity. Chromosome engineering with these two lines could produce Al-tolerant wheat cultivars. PMID:24399913

  20. A molecular, genetic and physiological analysis of plant aluminum tolerance (abstract)

    International Nuclear Information System (INIS)

    Aluminum (Al) toxicity is an important agronomic trait, limiting crop production on acid soils that comprise up to 50% of the world's potentially arable lands. A significant genetic variation in Al tolerance exists in both crop plants and Arabidopsis. The exploitation of this genetic variation to breed crops with increased Al tolerance has been a productive and active area of research, however, the underlying molecular, genetic and physiological bases are still not well understood. Only very recently was the first Al tolerance gene, ALMT1, isolated in wheat and shown to be a novel Al-activated malate transporter. Work in our laboratory has focused on using integrated genomic (gene and protein expression profiling), molecular genetic and physiological approaches to identify novel Al tolerance genes and the physiological mechanisms they control in the cereal crops maize and sorghum, and also in arabidopsis. In sorghum we had previously shown that Al tolerance is the result of a single locus, Alt/sub SB/ which maps to the top of sorghum chromosome 3 in a region totally distinct from where the major Al tolerance maps in wheat and other related members of the Triticeae. Very recently, we have used map-based cloning techniques in sorghum to clone Alt/sub SB/ and have found it is a novel Al tolerance gene. Here we will present a molecular characterization of the Alt/sub SB/ gene and also the physiological mechanism of sorghum Al tolerance it controls. In arabidopsis, we have previously shown that Al tolerance is a quantitative trait and have identified two major Al tolerance QTL on chromosomes 1 and 5. These genes function to confer tolerance via Al via activated root malate release. We found that a member of the arabidopsis gene family that is a close homolog to wheat ALMT1 maps near the largest tolerance QTL on chromosome 1 and have also found this gene encodes the Al-activated malate transport involved in arabidopsis Al tolerance. However, we have clear molecular

  1. Rice's Salt Tolerance Gene Cloned

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    @@ In cooperation with US colleagues, CAS researchers have made significant progress in their studies into functional genes for key agronomic traits by cloning SKC1, a salt-tolerant functional gene of rice and making clear its biological functions and mechanisms. This pioneering work,which was reported in the Oct. issue of Nature Genetics (37:1141-1146), is believed to hold promise to increase the output of the crop plant in this country.

  2. Toxicity and tolerance of aluminum in plants: tailoring plants to suit to acid soils.

    Science.gov (United States)

    Sade, Hemalatha; Meriga, Balaji; Surapu, Varalakshmi; Gadi, Jogeswar; Sunita, M S L; Suravajhala, Prashanth; Kavi Kishor, P B

    2016-04-01

    Aluminum (Al) stress is one of the serious limiting factors in plant productivity in acidic soils, which constitute about 50 % of the world's potentially arable lands and causes anywhere between 25 and 80 % of yield losses depending upon the species. The mechanism of Al toxicity and tolerance has been examined in plants, which is vital for crop improvement and enhanced food production in the future. Two mechanisms that facilitate Al tolerance in plants are Al exclusion from the roots and the ability to tolerate Al in the symplast or both. Although efforts have been made to unravel Al-resistant factors, many aspects remain unclear. Certain gene families such as MATE, ALMT, ASR, and ABC transporters have been implicated in some plants for resistance to Al which would enhance the opportunities for creating crop plants suitable to grow in acidic soils. Though QTLs have been identified related to Al-tolerance, no crop plant that is tolerant to Al has been evolved so far using breeding or molecular approaches. The remarkable changes that plants experience at the physiological, biochemical and molecular level under Al stress, the vast array of genes involved in Al toxicity-tolerance, the underlying signaling events and the holistic image of the molecular regulation, and the possibility of creating transgenics for Al tolerance are discussed in this review. PMID:26796895

  3. Radiation Tolerance of Aluminum Microwave Kinetic Inductance Detector

    Science.gov (United States)

    Karatsu, K.; Dominjon, A.; Fujino, T.; Funaki, T.; Hazumi, M.; Irie, F.; Ishino, H.; Kida, Y.; Matsumura, T.; Mizukami, K.; Naruse, M.; Nitta, T.; Noguchi, T.; Oka, N.; Sekiguchi, S.; Sekimoto, Y.; Sekine, M.; Shu, S.; Yamada, Y.; Yamashita, T.

    2016-08-01

    Microwave kinetic inductance detector (MKID) is one of the candidates of focal plane detector for future satellite missions such as LiteBIRD. For the space use of MKIDs, the radiation tolerance is one of the challenges to be characterized prior to the launch. Aluminum (Al) MKIDs with 50 nm thickness on silicon substrate and on sapphire substrate were irradiated with a proton beam of 160 MeV at the heavy ion medical accelerator in Chiba. The total water-equivalent absorbed dose was ˜ 10 krad which should simulate the worst radiation absorption of 5 years observation at the Lagrange point L2. We measured characteristics of these MKIDs before and after the irradiation. We found no significant changes on resonator quality factor, responsivity, and recombination time of quasi-particles. The change on electrical noise equivalent power was also evaluated, and no significant increase was found at the noise level of O(10^{-18}) W/√{ Hz }.

  4. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.

    Science.gov (United States)

    Dai, Huaxin; Cao, Fangbin; Chen, Xianhong; Zhang, Mian; Ahmed, Imrul Mosaddek; Chen, Zhong-Hua; Li, Chengdao; Zhang, Guoping; Wu, Feibo

    2013-01-01

    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A) specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance. PMID:23691047

  5. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.

    Directory of Open Access Journals (Sweden)

    Huaxin Dai

    Full Text Available Aluminum (Al toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance.

  6. Aluminum Tolerance in Wheat (Triticum aestivum L.) (I. Uptake and Distribution of Aluminum in Root Apices).

    Science.gov (United States)

    Delhaize, E.; Craig, S.; Beaton, C. D.; Bennet, R. J.; Jagadish, V. C.; Randall, P. J.

    1993-11-01

    We investigated the uptake and distribution of Al in root apices of near-isogenic wheat (Triticum aestivum L.) lines differing in Al tolerance at a single locus (Alt1: aluminum tolerance). Seedlings were grown in nutrient solution that contained 100 [mu]M Al, and the roots were subsequently stained with hematoxylin, a compound that binds Al in vitro to form a colored complex. Root apices of Al-sensitive genotypes stained after short exposures to Al (10 min and 1 h), whereas apices of Al-tolerant seedlings showed less intense staining after equivalent exposures. Differential staining preceded differences observed in either root elongation or total Al concentrations of root apices (terminal 2-3 mm of root). After 4 h of exposure to 100 [mu]M Al in nutrient solution, Al-sensitive genotypes accumulated more total Al in root apices than Al-tolerant genotypes, and the differences became more marked with time. Analysis of freeze-dried root apices by x-ray microanalysis showed that Al entered root apices of Al-sensitive plants and accumulated in the epidermal layer and in the cortical layer immediately below the epidermis. Long-term exposure of sensitive apices to Al (24 h) resulted in a distribution of Al coinciding with the absence of K. Quantitation of Al in the cortical layer showed that sensitive apices accumulated 5- to 10-fold more Al than tolerant apices exposed to Al solutions for equivalent times. These data are consistent with the hypothesis that Alt1 encodes a mechanism that excludes Al from root apices. PMID:12231972

  7. Melhoramento do trigo: I. Hereditariedade da tolerância à toxicidade do alumínio Wheat breeding: I - Inheritance of tolerance to aluminum toxicity in wheat

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1981-01-01

    áveis pela tolerância a essas concentrações mostrou uma quebra gradual da dominância à medida que a concentração de alumínio foi aumentada.Four wheat cultivars showing different reactions to Al toxicity under field conditions and presenting a great variation in plant height were screened in nutrient solution with different concentrations of aluminum. The tall Brazilian cultivar, 'BH-1146' was tolerant to 10 ppm of Al; 'Atlas-66' developed in North Carolina was tolerant to 6 ppm but moderately tolerant to 10 ppm of aluminum. The dwarf cultivar Tordo, a Tom Thumb source of dwarfism, was tolerant to 2 ppm but totally sensitive at 6 ppm. The Mexican semidwarf cultivar Siete Cerros, a Niorin-10 derivative, was sensitive to 2 ppm of Al. Parents, F1 and F2 generations from the crosses between tolerant ('BH-1146' and 'Atlas-66' and sensitive ('Tordo' and 'Siete Cerros' cultivars to 6 ppm were screened under 3 ppm and the same genotypes plus the backcrosses to both types of parents (BCª and BCb were screened at 6 ppm. Parents, F1 and F2 progenies from BCª and BCb involving the cross BH-1146/Siete Cerros were retested under 3 and 6 ppm of Al. Parents, F1 and F2 for the cross between 'BH-1146' and 'Atlas-66' were screened under 6 and 10 ppm of Al. At 2 and 3 ppm of Al, parents, F1 and F2 from the cross Tordo/Siete Cerros were studied. The results obtained suggest that 'BH-1146' differs from Atlas-66, Siete Cerros and Tordo by one pair of dominant gene. This pair of gene was efficient even at 10 ppm of aluminum, so should be used in a breeding program towards aluminum tolerance when high levels of this element are involved. The cultivar Atlas-66 showed to have two pairs of dominant genes for Al tolerance but when the aluminum concentration increased from 3 and 6 to 10 ppm these pairs of genes became less efficient. 'Tordo' differs from 'Siete Cerros' by a pair of dominant gene for tolerance at 2 ppm of Al. So 'Tordo' would be useful as a source of tolerance when low levels of

  8. Rapid screening for aluminum tolerance in maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Carlos Daniel Giaveno

    2000-12-01

    Full Text Available A significant decrease in maize grain yield due to aluminum toxicity is considered to be one of the most important agricultural problems for tropical regions. Genetic improvement is a useful approach to increase maize yield in acid soils, but this requires a rapid and reliable method to discriminate between genotypes. In our work we investigated the feasibility of using hematoxylin staining (HS to detect Al-tolerant plants at the seedling stage. The original population along with two populations obtained after one cycle of divergent selection were evaluated by net root growth (NRG and HS after 7 days in nutrient solution. Results showed a negative correlation between NRG and HS in all populations, in which sensitive plants, characterized by low NRG, exhibited more intense staining than tolerant plants. These results indicate that HS is a useful procedure for selecting Al-tolerant maize seedlings.A importante diminuição nos rendimentos de milho causados pela toxidez produzida pelo alumínio é considerada um dos mais importantes problemas nas regiões tropicais. O melhoramento genético é uma metodologia útil para aumentar os rendimentos do milho em solos ácidos, requerendo um método rápido e seguro que permita diferenciar os diferentes genótipos. O objetivo deste trabalho foi avaliar a possibilidade de utilizar a técnica da coloração com hematoxilina (HS na detecção de plântulas tolerantes ao alumínio. Duas populações obtidas de um ciclo de seleção divergente e a original, foram avaliadas depois de sete dias em solução nutritiva utilizando os parâmetros NRG (crescimento líquido da raiz principal e HS. Os resultados apresentaram uma correlação negativa entre NRG e HS em todas as populações devido ao fato de que as plântulas suscetíveis, caracterizadas por um baixo NRG, apresentaram uma coloração mais intensa do que as tolerantes. Nossos resultados permitem concluir que a técnica de coloração com hematoxilina

  9. An Aluminum-Inducible IREG Gene is Required for Internal Detoxification of Aluminum in Buckwheat.

    Science.gov (United States)

    Yokosho, Kengo; Yamaji, Naoki; Mitani-Ueno, Namiki; Shen, Ren Fang; Ma, Jian Feng

    2016-06-01

    Buckwheat (Fagopyrum esculentum Moench) is able to detoxify aluminum (Al) both externally and internally, but the molecular mechanisms underlying its high Al tolerance are not understood. We functionally characterized a gene (FeIREG1) belonging to IRON REGULATED/ferroportin in buckwheat, which showed high expression in our previous genome-wide transcriptome analysis. FeIREG1 was mainly expressed in the roots, and its expression was up-regulated by Al, but not by other metals and low pH. Furthermore, in contrast to AtIREG1 and AtIREG2 in Arabidopsis, the expression of FeIREG1 was not induced by Fe deficiency. Spatial expression analysis showed that the Al-induced expression of FeIREG1 was found in the root tips and higher expression was detected in the outer layers of this part. Immunostaining also showed that FeIREG1 was localized at the outer cell layers in the root tip. A FeIREG1-green fluorescent protein (GFP) fusion protein was localized to the tonoplast when transiently expressed in onion epidermal cells. Overexpression of FeIREG1 in Arabidopsis resulted in increased Al tolerance, but did not alter the tolerance to Cd, Co and Fe. The tolerance to Ni was slightly enhanced in the overexpression lines. Mineral analysis showed that the accumulation of total root Al and other essential mineral elements was hardly altered in the overexpression lines. Taken together, our results suggest that FeIREG1 localized at the tonoplast plays an important role in internal Al detoxification by sequestering Al into the root vacuoles in buckwheat. PMID:27053033

  10. Interactions between nitric oxide and plant hormones in aluminum tolerance

    OpenAIRE

    He, Huyi; He, Longfei; Gu, Minghua

    2012-01-01

    Nitric oxide (NO) is involved, together with plant hormones, in the adaptation to Al stress in plants. However, the mechanism by which NO and plant hormones interplay to improve Al tolerance are still unclear. We have recently shown that patterns of plant hormones alteration differ between rye and wheat under Al stress. NO may enhance Al tolerance by regulating hormonal equilibrium in plants, as a regulator of plant hormones signaling. In this paper, some unsolved issues are discussed based o...

  11. Effects of exogenous salicylic acid on cell wall polysaccharides and aluminum tolerance of trichosanthes kirilowii

    International Nuclear Information System (INIS)

    A hydroponic experiment was conducted to study the effects of exogenous salicylic acid (SA) on root length, relative aluminum content in the apical cell wall, acid phosphatase (APA) and pectin methyl esterase (PME) activity, root pectin, hemicellulose 1(HC1), and hemicellulose 2 (HC2) contents of Anguo Trichosanthes kirilowii (Al-tolerant genotype) and Pujiang T. kirilowii (Al-sensitive genotype) under 800 micro mol/L of aluminum stress. The results showed that the growth of Al-tolerant Anguo T. kirilowii and Al-sensitive Pujiang T. kirilowii was inhibited when exposed to 800 micro mol/L of aluminum solution. APA and PME activities were also enhanced for both genotypes. The contents of relative aluminum, pectin, HC1, and HC2, as well as Al accumulation in the root tips were increased under aluminum toxicity. Pujiang T. kirilowii showed higher enzyme activity and cell wall polysaccharide contents than Anguo T. kirilowii. In addition, the root cell wall pectin, HC1, and HC2 contents of Pujiang T. kirilowii were increased by a large margin, showing its greater sensitivity to aluminum toxicity. Root length is an important indicator of aluminum toxicity, and has an important relationship with cell wall polysaccharide content. Aluminum toxicity led to the accumulation of pectin and high PME activity, and also increased the number of free carboxyl groups, which have more aluminum binding sites. Membrane skim increased extensively with the increase in APA activity, damaging membrane structure and function. Different SA concentrations can decrease enzyme activity and cell wall polysaccharide content to some extent. With the addition of different SA concentrations, the root relative aluminum content, cell wall polysaccharide content, APA and PME activities decreased. Aluminum toxicity to both genotypes of T. kirilowii was relieved in different degrees as exogenous SA concentration increased. Inter-simple sequence repeat (ISSR) marker was used to examine the genetic distance

  12. Polyphenol-aluminum complex formation: Implications for aluminum tolerance in plants

    Science.gov (United States)

    Natural polyphenols may play an important role in aluminum detoxification in some plants. We examined the interaction between Al3+ and the purified high molecular weight polyphenols pentagalloyl glucose (940 Da) and oenothein B (1568 Da), and the related compound methyl gallate (184 Da) at pH 4 and ...

  13. Differences in physiological features associated with aluminum tolerance in Tibetan wild and cultivated barleys.

    Science.gov (United States)

    Dai, Huaxin; Zhao, Jing; Ahmed, Imrul Mosaddek; Cao, Fangbin; Chen, Zhong-Hua; Zhang, Guoping; Li, Chengdao; Wu, Feibo

    2014-02-01

    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is a treasure trove of useful genes and offers rich sources of genetic variation for crop improvement. Al-stress-hydroponic-experiments were performed, and the physiochemical characteristic of two contrasting Tibetan wild barley genotypes (Al-resistant XZ16 and Al-sensitive XZ61) and Al-resistant cv. Dayton were compared. Ultrastructure of chloroplasts and root cells in XZ16 was less injured than that in Dayton and XZ61. Moreover, XZ16 secreted significantly more malate besides citrate and exhibited less Al uptake and distribution than both of XZ61 and Dayton in response to Al stress, simultaneously maintained higher H⁺-, Ca²⁺Mg²⁺- and total-ATPase activities over XZ61. The protein synthesis inhibitor cycloheximide reduced citrate secretion from XZ16, but not from Dayton. In Tibetan wild barley, our findings highlight the significant correlations between Al tolerance, ATPase activity and citrate secretion, providing some insights into the physiological basis for Al-detoxification. PMID:24361508

  14. Molecular Characterization of Atlas 66-Derived Wheat Near-Isogenic Lines Contrasting in Aluminum (Al) Tolerance

    Institute of Scientific and Technical Information of China (English)

    GUO Pei-guo; BAI Gui-hua; LI Rong-hua; Brett Carver; Michael Baum

    2007-01-01

    Aluminum (Al) toxicity is the major limiting factor for wheat growth in acidic soils. Genetic improvement of Al tolerance is one of the most cost-effective solutions to improve wheat productivity. The objective of this study was to characterize near isogenic lines (NILs) contrasting in Al tolerance derived from Atlas 66 in the backgrounds of Al-sensitive cultivars Chisholm and Century using amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR). A total of 200 AFLP and 88 SSR primer pairs were screened and 12 markers (11 AFLPs and one SSR) were associated with Altolerance in NILs of at least one recurrent parental background. Among them, nine were linked to Al tolerance in the Chisholm-derived NILs, seven were associated with Al-tolerance in the Century-derived NILs, and three AFLPs derived from the primer combinations of pAG/mGCAG, pCAG/mAGC and pGTG/mGCG, and one SSR, Xwmc331 on chromosome4D, associated with Al tolerance in NILs of both recurrent parental backgrounds. Those common markers across two backgrounds may be the major marker loci associated with Al-tolerance in Atlas 66 and could be useful for marker-assisted breeding to improve Al tolerance in wheat. In addition, evaluation of Al tolerance among different genotypes using hematoxylin stain and relative root growth revealed that Atlas 66 was more tolerant to Al stress than the NILs, therefore suggested that the Al-tolerant NILs might not carry all Al-tolerance loci from Atlas 66 and inheritance of Al tolerance in Atlas 66 is more likely multigenic.

  15. A higher plant delta8 sphingolipid desaturase with a preference for (Z)-isomer formation confers aluminum tolerance to yeast and plants.

    Science.gov (United States)

    Ryan, Peter R; Liu, Qing; Sperling, Petra; Dong, Bei; Franke, Stefan; Delhaize, Emmanuel

    2007-08-01

    Three plant cDNA libraries were expressed in yeast (Saccharomyces cerevisiae) and screened on agar plates containing toxic concentrations of aluminum. Nine cDNAs were isolated that enhanced the aluminum tolerance of yeast. These cDNAs were constitutively expressed in Arabidopsis (Arabidopsis thaliana) and one cDNA from the roots of Stylosanthes hamata, designated S851, conferred greater aluminum tolerance to the transgenic seedlings. The protein predicted to be encoded by S851 showed an equally high similarity to Delta6 fatty acyl lipid desaturases and Delta8 sphingolipid desaturases. We expressed other known Delta6 desaturase and Delta8 desaturase genes in yeast and showed that a Delta6 fatty acyl desaturase from Echium plantagineum did not confer aluminum tolerance, whereas a Delta8 sphingobase desaturase from Arabidopsis did confer aluminum tolerance. Analysis of the fatty acids and sphingobases of the transgenic yeast and plant cells demonstrated that S851 encodes a Delta8 sphingobase desaturase, which leads to the accumulation of 8(Z/E)-C(18)-phytosphingenine and 8(Z/E)-C(20)-phytopshingenine in yeast and to the accumulation of 8(Z/E)-C(18)-phytosphingenine in the leaves and roots of Arabidopsis plants. The newly formed 8(Z/E)-C(18)-phytosphingenine in transgenic yeast accounted for 3 mol% of the total sphingobases with a 8(Z):8(E)-isomer ratio of approximately 4:1. The accumulation of 8(Z)-C(18)-phytosphingenine in transgenic Arabidopsis shifted the ratio of the 8(Z):8(E) isomers from 1:4 in wild-type plants to 1:1 in transgenic plants. These results indicate that S851 encodes the first Delta8 sphingolipid desaturase to be identified in higher plants with a preference for the 8(Z)-isomer. They further demonstrate that changes in the sphingolipid composition of cell membranes can protect plants from aluminum stress. PMID:17600137

  16. A Higher Plant Δ8 Sphingolipid Desaturase with a Preference for (Z)-Isomer Formation Confers Aluminum Tolerance to Yeast and Plants[C][OA

    Science.gov (United States)

    Ryan, Peter R.; Liu, Qing; Sperling, Petra; Dong, Bei; Franke, Stefan; Delhaize, Emmanuel

    2007-01-01

    Three plant cDNA libraries were expressed in yeast (Saccharomyces cerevisiae) and screened on agar plates containing toxic concentrations of aluminum. Nine cDNAs were isolated that enhanced the aluminum tolerance of yeast. These cDNAs were constitutively expressed in Arabidopsis (Arabidopsis thaliana) and one cDNA from the roots of Stylosanthes hamata, designated S851, conferred greater aluminum tolerance to the transgenic seedlings. The protein predicted to be encoded by S851 showed an equally high similarity to Δ6 fatty acyl lipid desaturases and Δ8 sphingolipid desaturases. We expressed other known Δ6 desaturase and Δ8 desaturase genes in yeast and showed that a Δ6 fatty acyl desaturase from Echium plantagineum did not confer aluminum tolerance, whereas a Δ8 sphingobase desaturase from Arabidopsis did confer aluminum tolerance. Analysis of the fatty acids and sphingobases of the transgenic yeast and plant cells demonstrated that S851 encodes a Δ8 sphingobase desaturase, which leads to the accumulation of 8(Z/E)-C18-phytosphingenine and 8(Z/E)-C20-phytopshingenine in yeast and to the accumulation of 8(Z/E)-C18-phytosphingenine in the leaves and roots of Arabidopsis plants. The newly formed 8(Z/E)-C18-phytosphingenine in transgenic yeast accounted for 3 mol% of the total sphingobases with a 8(Z):8(E)-isomer ratio of approximately 4:1. The accumulation of 8(Z)-C18-phytosphingenine in transgenic Arabidopsis shifted the ratio of the 8(Z):8(E) isomers from 1:4 in wild-type plants to 1:1 in transgenic plants. These results indicate that S851 encodes the first Δ8 sphingolipid desaturase to be identified in higher plants with a preference for the 8(Z)-isomer. They further demonstrate that changes in the sphingolipid composition of cell membranes can protect plants from aluminum stress. PMID:17600137

  17. Damage Tolerance Behavior of Friction Stir Welds in Aluminum Alloys

    Science.gov (United States)

    McGill, Preston; Burkholder, Jonathan

    2012-01-01

    Friction stir welding is a solid state welding process used in the fabrication of various aerospace structures. Self-reacting and conventional friction stir welding are variations of the friction stir weld process employed in the fabrication of cryogenic propellant tanks which are classified as pressurized structure in many spaceflight vehicle architectures. In order to address damage tolerance behavior associated with friction stir welds in these safety critical structures, nondestructive inspection and proof testing may be required to screen hardware for mission critical defects. The efficacy of the nondestructive evaluation or the proof test is based on an assessment of the critical flaw size. Test data describing fracture behavior, residual strength capability, and cyclic mission life capability of friction stir welds at ambient and cryogenic temperatures have been generated and will be presented in this paper. Fracture behavior will include fracture toughness and tearing (R-curve) response of the friction stir welds. Residual strength behavior will include an evaluation of the effects of lack of penetration on conventional friction stir welds, the effects of internal defects (wormholes) on self-reacting friction stir welds, and an evaluation of the effects of fatigue cycled surface cracks on both conventional and selfreacting welds. Cyclic mission life capability will demonstrate the effects of surface crack defects on service load cycle capability. The fracture data will be used to evaluate nondestructive inspection and proof test requirements for the welds.

  18. Nuclear Radiation Tolerance of Single Crystal Aluminum Nitride Ultrasonic Transducer

    Science.gov (United States)

    Reinhard, Brian; Tittmann, Bernhard R.; Suprock, Andrew

    Ultrasonic technologies offer the potential for high accuracy and resolution in-pile measurement of a range of parameters, including geometry changes, temperature, crack initiation and growth, gas pressure and composition, and microstructural changes. Many Department of Energy-Office of Nuclear Energy (DOE-NE) programs are exploring the use of ultrasonic technologies to provide enhanced sensors for in-pile instrumentation during irradiation testing. For example, the ability of small diameter ultrasonic thermometers (UTs) to provide a temperature profile in candidate metallic and oxide fuel would provide much needed data for validating new fuel performance models, (Rempe et al., 2011; Kazys et al., 2005). These efforts are limited by the lack of identified ultrasonic transducer materials capable of long term performance under irradiation test conditions. To address this need, the Pennsylvania State University (PSU) was awarded an Advanced Test Reactor National Scientific User Facility (ATR NSUF) project to evaluate the performance of promising magnetostrictive and piezoelectric transducers in the Massachusetts Institute of Technology Research Reactor (MITR) up to a fast fluence of at least 1021 n/cm2. The irradiation is also supported by a multi-National Laboratory collaboration funded by the Nuclear Energy Enabling Technologies Advanced Sensors and Instrumentation (NEET ASI) program. The results from this irradiation, which started in February 2014, offer the potential to enable the development of novel radiation tolerant ultrasonic sensors for use in Material Testing Reactors (MTRs). As such, this test is an instrumented lead test and real-time transducer performance data is collected along with temperature and neutron and gamma flux data. Hence, results from this irradiation offer the potential to bridge the gap between proven out-of-pile ultrasonic techniques and in-pile deployment of ultrasonic sensors by acquiring the data necessary to demonstrate the

  19. 大豆耐铝毒候选基因 GmSTOP1的克隆与表达分析%Cloning and Expression Analysis of Tolerance to Aluminum-toxicity Candidate Gene GmSTOP1 in Soybean

    Institute of Scientific and Technical Information of China (English)

    丛亚辉; 王婷婷; 柳聚阁; 王宁; 高萌萌; 李艳; 盖钧镒

    2015-01-01

    酸性土壤中的铝毒害是限制作物生长和产量的主要因素之一。拟南芥中的 AtSTOP1(Arabidopsis thaliana sensitive to proton rhizotoxicity 1)是一个调控多种铝毒耐受机制相关基因表达的转录因子,在拟南芥耐铝毒中发挥重要作用。为研究大豆中 STOP1-like 基因的表达特性,本研究利用 RT-PCR 从耐铝毒大豆品种科丰1号中克隆了一个位于第16染色体的 STOP1-like 基因,命名为 GmSTOP1。该基因的编码区(coding DNA sequence, CDS)序列长度为1566 bp,编码521个氨基酸。在 GmSTOP1起始密码子上游1500 bp 的核苷酸序列区间预测到多种顺式作用元件,包括与激素、热、逆境响应等相关的应答元件,如 ABRE、HSE、TC-rich 重复序列等。蛋白质结构预测表明 GmSTOP1不具有跨膜结构和信号肽,含有4个保守的 Cys-2-His-2锌指蛋白结构域。系统进化分析显示 GmSTOP1与菜豆(Phaseolus vulgaris)中的 STOP1-like 蛋白亲缘关系较近。亚细胞定位结果显示 GmSTOP1定位于细胞核,说明GmSTOP1蛋白可能在细胞核中发挥其功能。GmSTOP1基因在种子中的相对表达量最高,在根、茎尖分生组织、茎、叶、花、荚等多种组织中也均有表达。用25μmol L–1 AlCl3溶液处理大豆幼苗, GmSTOP1基因在根中上调表达,24 h达到最高相对表达量,约为对照(0μmol L–1 AlCl3)的9.2倍,表明该基因的表达受铝离子的诱导。此外, ABA、NaCl和 PEG 等胁迫也能诱导大豆根和叶中 GmSTOP1基因的上调表达。由此推测 GmSTOP1基因可能参与大豆对铝毒、高盐和渗透等非生物胁迫的应答过程。%Aluminum toxicity is one of the major factors that limits the growth and production of crops in acid soils. AtSTOP1 transcription factor can regulate the expression of genes related to aluminum-toxicity tolerance mechanisms, which plays an im-portant role in aluminum-toxicity tolerance in Arabidopsis. To study the expression features of the

  20. Circadian genes differentially affect tolerance to ethanol in Drosophila

    Science.gov (United States)

    Pohl, Jascha B.; Ghezzi, Alfredo; Lew, Linda K.; Robles, Roseanna B.; Cormack, Lawrence; Atkinson, Nigel S.

    2016-01-01

    Background There is a strong relationship between circadian rhythms and ethanol responses. Ethanol consumption has been shown to disrupt physiological and behavioral circadian rhythms in mammals (Spanagel et al., 2005b). The Drosophila central circadian pacemaker is composed of proteins encoded by the per, tim, cyc, and Clk genes. Using Drosophila mutant analysis we asked whether these central components of the circadian clock make the equivalent contribution towards ethanol tolerance and whether rhythmicity itself is necessary for tolerance. Methods We tested flies carrying mutations in core clock genes for the capacity to acquire ethanol tolerance. Tolerance was assayed by comparing the sedation curves of populations during their first and second sedation. Animals that had acquired tolerance sedated more slowly. Movement was also monitored as the flies breathe the ethanol vapor to determine if other facets of the ethanol response were affected by the mutations. Gas chromatography was used to measure internal ethanol concentration. Constant light was used to non-genetically destabilize the PER and TIM proteins. Results A group of circadian mutations, all of which eliminate circadian rhythms, do not disrupt tolerance identically. Mutations in per, tim, and cyc completely block tolerance. However, a mutation in Clk does not interfere with tolerance. Constant light also disrupts the capacity to acquire tolerance. These lines did not differ in ethanol absorption. Conclusions Mutations affecting different parts of the intracellular circadian clock can block the capacity to acquire rapid ethanol tolerance. However, the role of circadian genes in ethanol tolerance is independent of their role in producing circadian rhythmicity. The interference in the capacity to acquire ethanol tolerance by some circadian mutations is not merely a downstream effect of a nonfunctional circadian clock, instead these circadian genes play an independent role in ethanol tolerance. PMID

  1. Tagging Salt Tolerant Gene Using PCR Markers in Soybean

    Institute of Scientific and Technical Information of China (English)

    GUO Bei; QIU Li-juan; SHAO Gui-hua; CHANG Ru-zhen; LIU Li-hong; XU Zhan-you; LI Xiang-hua; SUN Jian-ying

    2001-01-01

    The purpose of this study was to screen and identify PCR markers associated with salt tolerant gene in soybean( Glycine soja L. ) so that salt tolerance can be identified efficiently and accurately. Between these tolerant and sensitivity to salt and three crosses were tested in this experiment. By BSA method, two codominant PCR markers were identified through the salt tolerant (sensitive) cuitivars bulks and the salt tolerant (sensitive) individual bulks of a F2 population. There was a 600bp band in the sensitive individuals and a 700bp band or two 700bp/600bp bands in the tolerant individuals. The markers were closely linked with salt tolerant/sensitive alleles. Moreover the markers were tested in the other two F2 populations from "salt tolerant cultivar × sensitive cuitivar" and confirmed by 12 salt tolerance cultivars and 13 salt sensitive cultivars with different genetic background. It indicated that the markers (700bp and 600bp) could be applied in salt tolerant identification of the soybean germplasm resources, and markers-assisted selection in salt tolerant breeding of soybean. The markers, its obtained method and application were patented for invention in 1998.

  2. Genes related to high temperature tolerance during maize seed germination.

    Science.gov (United States)

    Dutra, S M F; Von Pinho, E V R; Santos, H O; Lima, A C; Von Pinho, R G; Carvalho, M L M

    2015-01-01

    The identification of genes related to heat tolerance is fundamental for the development of high-quality seeds that are tolerant to heat stress condition. The objective of this study was to evaluate maize lineages and the gene expression involved in high temperature tolerance during germination using physiological tests, proteomics, and transcriptome analysis. Seeds from six maize lineages (30, 44, 54, 63, 64, and 91) with different levels of tolerance to high temperatures were used. Lineages 54 and 91 were observed to be more tolerant to high temperature conditions. The highest expression of α-amylase was observed in maize seeds from lineages 30 and 91 that were subjected to controlled deterioration. The highest expression of α-amylase was observed in maize seeds from lineages 30 and 91 that were subjected to controlled deterioration; with the controlled deterioration, the highest level of gene expression did not occur in the most tolerant materials; the association of lower expression of genes involved in heat-resistant protein systems was observed in seeds from lineage 44, which were more susceptible to high temperatures, and the highest gene expression of LEA D-34, ZmAN13, and AOX-1 was observed in seeds from lineage 64 when submitted to controlled deterioration. PMID:26782452

  3. Cowpea symbiotic efficiency, pH and aluminum tolerance in nitrogen-fixing bacteria

    Directory of Open Access Journals (Sweden)

    Bruno Lima Soares

    2014-06-01

    Full Text Available Cowpea (Vigna unguiculata cultivation in northern and northeastern Brazil provides an excellent source of nutrients and carbohydrates for the poor and underprivileged. Production surplus leads to its consumption in other regions of Brazil and also as an export commodity. Its capacity to establish relationships with atmospheric nitrogen-fixing bacteria is crucial to the reduction of production costs and the environmental impact of nitrogen fertilizers. This study assessed the symbiotic efficiency of new strains of symbiotic nitrogen-fixing bacteria with cowpea and their tolerance to pH and aluminum. Twenty-seven strains of bacteria from different soils were evaluated under axenic conditions. These strains were compared to the following inoculant strains: INPA03-11B, UFLA03-84 and BR3267 and two controls that were not inoculated (with and without mineral nitrogen. Six strains and the three strains approved as inoculants were selected to increase the dry weight production of the aerial part (DWAP and were tested in pots with soil that had a high-density of nitrogen-fixing native rhizobia. In this experiment, three strains (UFLA03-164, UFLA03-153, and UFLA03-154 yielded higher DWAP values. These strains grow at pH levels of 5.0, 6.0, 6.8 and at high aluminum concentration levels, reaching 10(9 CFU mL-1. In particular UFLA03-84, UFLA03-153, and UFLA03-164 tolerate up to 20 mmol c dm-3 of Al+3. Inoculation with rhizobial strains, that had been carefully selected according to their ability to nodulate and fix N2, combined with their ability to compete in soils that are acidic and contain high levels of Al, is a cheaper and more sustainable alternative that can be made available to farmers than mineral fertilizers.

  4. Identification and analysis of differentially expressed genes associated with aluminum response in two soybean cultivars by cdna-rapd

    International Nuclear Information System (INIS)

    Identification of aluminum (Al) responsive genes is of great importance in illuminating the molecular mechanism of plant Al response. In this present study, we preliminarily identified several genes that possibly involved in Al-response by cDNA based random amplified polymorphic DNA (cDNA-RAPD) method from Al tolerant/sensitive soybean cultivars exposed to 0 or 50 microM Al3+ solutions for two days. Totally one hundred random primers were used to identify the differentially expressed genes; however, only two primers generated eight stable PCR products. The eight gene fragments were cloned and sequenced, then compared with NCBI gene bank. We subsequently verified the expression profiles of these eight genes by real time quantitative PCR (RT-qPCR) and found that two genes were significantly up-regulated after Al treatment for 24, 48 and 72h. One gene, encoding nucleotide-diphospho-sugar transferase which is essential for polysaccharide synthesis and another gene, encoding polygalacturonase inhibiting protein which exerts its role in terms of inhibiting polysaccharide hydrolysis, suggesting the possibility that they might cooperate in response to Al stress through the modification of cell wall components. These findings provided valuable candidate genes for further study on the molecular mechanisms in plant Al tolerance. (author)

  5. RAPD tagging of salt tolerance gene in rice

    International Nuclear Information System (INIS)

    Salinity, which is critical in determining the growth and development of plants, is a major problem affecting ever-increasing areas throughout the world. A salt tolerant rice mutant (M-20) was obtained from accession 77-170 (Oryza sativa) through EMS mutagenesis and selection in vitro. The use of 220 10-mer RAPD primers allowed the identification of a new molecular marker, whose genetic distance from a salt tolerance gene is about 16.4 cM. (author)

  6. Herança da tolerância ao alumínio em populações híbridas de trigo Inheritance of aluminum tolerance in wheat hybrid populations

    Directory of Open Access Journals (Sweden)

    CARLOS EDUARDO DE OLIVEIRA CAMARGO

    2000-03-01

    Full Text Available Plântulas originárias de populações híbridas, em geração F2, de 26 cruzamentos entre cultivares de trigo tolerantes (BH-1146, IAC-227, IAC-24, IAC-60, C-3, IAC-5, IAC-18 e IAC-21 e sensíveis (Anahuac 75, IAC-287, IAC-289, Siete Cerros e Veery "S" à toxicidade de alumínio e de 18 cruzamentos entre cultivares tolerantes (BH-1146, IAC-227, IAC-24, IAC-60, C-3, IAC-5, IAC-21, C-17, IAC-74 e IAC-18 foram avaliadas em relação à tolerância a 3 mg/L de Al3+, empregando soluções nutritivas. A tolerância à toxicidade de alumínio foi medida pela capacidade de crescimento da raiz primária central em solução nutritiva completa, após um tratamento de 48 horas em solução contendo 3 mg/L de Al3+. Avaliando-se as plântulas das populações F2 provindas de cruzamentos entre cultivares tolerantes e sensíveis, verificou-se que a tolerância à toxicidade de Al3+ foi dominante, e que em 24 dos cruzamentos, as cultivares tolerantes diferiram das sensíveis por um par de genes. Não foi detectada diferença entre as cultivares tolerantes em relação ao par de genes dominantes em relação à tolerância. Qualquer uma dessas cultivares poderá ser utilizada como fonte de tolerância num programa de cruzamentos em que essa característica for desejada.Seedlings originated from hybrid populations, in F2 generation, from 26 crosses between tolerant wheat cultivars (BH-1146, IAC-227, IAC-24, IAC-60, C-3, IAC-5, IAC-18 and IAC-21 and sensitive cultivars (Anahuac 75, IAC-287, IAC-289, Siete Cerros and Veery "S" to aluminum toxicity and from 18 crosses between tolerant cultivars (BH-1146, IAC-227, IAC-24, IAC-60, C-3, IAC-5, IAC-21, C-17, IAC-74 and IAC-18 were evaluated for tolerance to 3 mg/L of Al3+, using nutrient solutions. It was considered tolerant the plant that was able to show root regrowth of the central primary root in the complete nutrient solution after a treatment of 48 hours in solution containing 3 mg/L of Al3+. The evaluation of

  7. Wheat genotypes differing in aluminum tolerance differ in their growth response to CO2 enrichment in acid soils

    OpenAIRE

    Tian, Qiuying; Zhang, Xinxin; Gao, Yan; Bai, Wenming; Ge,Feng; Ma, Yibing; Zhang, Wen-Hao

    2013-01-01

    Aluminum (Al) toxicity is a major factor limiting plant growth in acid soils. Elevated atmospheric CO2 [CO2] enhances plant growth. However, there is no report on the effect of elevated [CO2] on growth of plant genotypes differing in Al tolerance grown in acid soils. We investigated the effect of short-term elevated [CO2] on growth of Al-tolerant (ET8) and Al-sensitive (ES8) wheat plants and malate exudation from root apices by growing them in acid soils under ambient [CO2] and elevated [CO2]...

  8. Damage Tolerance Assessment of Friction Pull Plug Welds in an Aluminum Alloy

    Science.gov (United States)

    McGill, Preston; Burkholder, Jonathan

    2012-01-01

    Friction stir welding is a solid state welding process used in the fabrication of cryogenic propellant tanks. Self-reacting friction stir welding is one variation of the friction stir weld process being developed for manufacturing tanks. Friction pull plug welding is used to seal the exit hole that remains in a circumferential self-reacting friction stir weld. A friction plug weld placed in a self-reacting friction stir weld results in a non-homogenous weld joint where the initial weld, plug weld, their respective heat affected zones and the base metal all interact. The welded joint is a composite plastically deformed material system with a complex residual stress field. In order to address damage tolerance concerns associated with friction plug welds in safety critical structures, such as propellant tanks, nondestructive inspection and proof testing may be required to screen hardware for mission critical defects. The efficacy of the nondestructive evaluation or the proof test is based on an assessment of the critical flaw size. Test data relating residual strength capability to flaw size in an aluminum alloy friction plug weld will be presented.

  9. Isolation, Identification and Characterization of Two Aluminum-Tolerant Fungi from Acidic Red Soil.

    Science.gov (United States)

    He, Genhe; Wang, Xiaodong; Liao, Genhong; Huang, Shoucheng; Wu, Jichun

    2016-09-01

    Acidic red soil from a forest in Jiangxi Province was selected to isolate aluminum (Al)-resistant microbes, from which eight fungi were isolated. Two strains (S4 and S7) were found to be extremely tolerant to Al concentrations of up to 550 mmol L(-1) and could grow at low pH levels (3.20-3.11). Morphological and 26S rDNA sequence analyses indicated that strain S4 belonged to Eupenicillium, while strain S7 was an unclassified Trichocomaceae. Further investigation showed that both strains were endowed with the ability to resist Al; strain S4 accumulated such a substantial amount of Al that its growth was limited to a larger extent than strain S7. The lower amounts of Al adsorbed in the mycelium and the much larger amounts of Al retained in the medium, in addition to the color change of the culture solution, implied that these two strains may resist Al by preventing Al from entering the cell and by chelating Al by secreting unique metabolites outside of the cell. PMID:27407299

  10. Physiological characterization of aluminum tolerance and accumulation in tartary and wild buckwheat.

    Science.gov (United States)

    Wang, Hua; Chen, Rong Fu; Iwashita, Takashi; Shen, Ren Fang; Ma, Jian Feng

    2015-01-01

    Ionic aluminum (Al) is toxic for plant growth, but some plant species are able to accumulate Al at high concentrations without showing toxicity symptoms. In order to determine whether other species in the genus Fagopyrum are able to accumulate Al like common buckwheat (Fagopyrum esculentum), we investigated the external and internal detoxification mechanisms of Al in two self-compatible species: tartary (Fagopyrum tataricum) and wild buckwheat (Fagopyrum homotropicum). Both tartary and wild buckwheat showed high Al tolerance comparable to common buckwheat. Furthermore, these two species also secreted oxalate rapidly from the roots in response to Al in a time-dependent manner. Both tartary and wild buckwheat accumulated > 1 mg g(-1) Al in the leaves after short-term exposure to Al. Analysis with (27) Al-nuclear magnetic resonance (NMR) revealed that Al was present in the form of Al-oxalate (1 : 3 ratio) in the roots and leaves, but in the form of Al-citrate (1 : 1 ratio) in the xylem sap in both species. These results indicate that similar to common buckwheat, both tartary and wild buckwheat detoxify Al externally and internally, respectively, by secreting oxalate from the roots and by forming the Al-oxalate complex, which is a nonphytotoxic form. These features of Al response and accumulation may be conserved in genus Fagopyrum. PMID:25195800

  11. Intragraft gene expression profile associated with the induction of tolerance

    Directory of Open Access Journals (Sweden)

    Evans Jacqueline M

    2008-02-01

    Full Text Available Abstract Background Xenotransplantation holds the promise of providing an unlimited supply of donor organs for terminal patients with organ failure. Pre-existing natural antibodies to the Galα1,3Galβ1,4GlcNac-R (αGal carbohydrate xenoantigen, however, bind rapidly to the graft endothelium and initiate hyperacute rejection of wild type pig grafts in humans. Experimental procedures designed to prevent xenoantibody-mediated rejection have been tested in gal knockout mice. These mice produce anti-gal xenoantibodies and are widely used as small animal models for xenotransplantation research. In this model, chimerism for cells expressing the gal carbohydrate can be achieved by transplantation of mixed cells or by transduction of bone marrow cells with viral vectors expressing a functional α1,3 galactosyltransferase gene. Chimerism induces tolerance to heart grafts expressing αGal. The mechanisms by which tolerance is achieved include systemic changes such as clonal deletion and/or anergy. Intragraft changes that occur during the early stages of tolerance induction have not been characterized. Results Cytoprotective genes heme oxygenase-1 (HO-1, Bcl2, and A20 that have been reported to contribute to long-term graft survival in various models of accommodation were not expressed at high levels in tolerant heart grafts. Intragraft gene expression at both early (Day 10 and late (>2 month time points after heart transplant were examined by real-time PCR and microarray analysis was used to identify changes associated with the induction of tolerance. Intragraft gene expression profiling using microarray analysis demonstrated that genes identified in the functional categories of stress and immunity and signal transduction were significantly up-regulated in early tolerant grafts compared with syngeneic control grafts. Biological process classification showed lower binomial p-values in the categories of "response to biotic stimulus, defense response, and

  12. Evaluation on Chinese Bread Wheat Landraces for Low pH and Aluminum Tolerance Using Hydroponic Screening

    Institute of Scientific and Technical Information of China (English)

    DAI Shou-fen; YAN Ze-hong; LIU Deng-cai; ZHANG Lian-quan; WEI Yu-ming; ZHENG You-liang

    2009-01-01

    Aluminum (A1) toxicity often takes place in acidic soils with a pH of 5.5 or lower. Breeding and cultivation of A1 tolerance wheat can partially protect wheat escaping from AI toxicity. The scarcity of the tolerant sources impedes the wheat breeding.In order to find new AI tolerance sources, we screened 173 bread wheat landraces from Tibet of China using hydroponic screening. It was indicated that: (1) There were diversities on the root regenerate length (RRL). The RRL of a large of landraces were longer than 7.00 cm in pH 7 (58.38%) and pH 4.5 (66.47%), but shorter than 5.00 cm in pH 4.5 +50 μM Al3+(80.93%). The low pH showed either promotion or restraining effects depend on landraces, but AI toxicity under low pH only showed restraining effects on the root elongation. (2) There were also diversities on root tolerance index of low pH (RTI 1) or root aluminum tolerance index (RTI2) among cultivars. The RTI1 varied from a narrow range but with relatively high value (0.8722-1.2953) in comparison with that of RTI2 (0.3829-1.0058), and the RTI1 of approximately 60% landraces was higher than 1.0000, the RTI2 of only 19.07% landraces was higher than 0.7000, suggesting that A1 toxicity acted as an important factor for the reduction of the root elongation under acidic soils. (3) The RTI 1 of many wheats was higher than 1.0000, and As2256 and As2295 were the most tolerant for low pH, with RTI1 1.2953 and 1.2925, respectively. (4) Based on RTI2, seven wheats showed similar or higher tolerance to AI toxicity than Chinese Spring (CS), a known tolerance wheat. Much better tolerance existed in landraces of As1543 and As1242, which can be used as the new parents for AI tolerant breeding.

  13. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  14. Roles of dehydrin genes in wheat tolerance to drought stress.

    Science.gov (United States)

    Hassan, Nemat M; El-Bastawisy, Zeinab M; El-Sayed, Ahamed K; Ebeed, Heba T; Nemat Alla, Mamdouh M

    2015-03-01

    Physiological parameters and expression levels of drought related genes were analyzed in early vegetative stage of two bread wheat cultivars (Sids and Gmiza) differ in drought tolerance capacity. Both cultivars were imposed to gradual water depletion started on day 17 till day 32 after sowing. Sids, the more tolerant cultivar to drought showed higher fresh and dry weights than the drought sensitive genotype, Gmiza. Under water stress, Sids had higher membrane stability index (MSI), lower accumulated H2O2 and higher activity of the antioxidant enzymes; catalase (CAT), guaiacol peroxidase (GPX), ascorbate peroxidase (APX) and superoxide dismutase (SOD) than Gmiza. On the other hand, the differential expression patterns of the genes dhn, wcor and dreb were observed due to water deficit intensity according to cultivar's tolerance to drought. The DNA sequence alignment of dun showed high similarity of about 80-92% identities with other related plants. The most striking overall observed trend was the highly induction in the expression of dun, wcor and dreb in leaves of the tolerant genotype, Sids under severe water stress. PMID:25750752

  15. Aluminum-Tolerant Pisolithus Ectomycorrhizas Confer Increased Growth, Mineral Nutrition, and Metal Tolerance to Eucalyptus in Acidic Mine Spoil

    Directory of Open Access Journals (Sweden)

    Louise Egerton-Warburton

    2015-01-01

    Full Text Available Ectomycorrhizal fungi (ECM may increase the tolerance of their host plants to Al toxicity by immobilizing Al in fungal tissues and/or improving plant mineral nutrition. Although these benefits have been demonstrated in in vitro (pure culture or short-term nutrient solution (hydroponic experiments, fewer studies have examined these benefits in the field. This study examined the growth, mineral nutrition, and Al levels in two Eucalyptus species inoculated with three Pisolithus ecotypes that varied in Al tolerance (in vitro and grown in mine spoil in the greenhouse and field. All three ecotypes of Pisolithus improved Eucalyptus growth and increased host plant tolerance to Al in comparison to noninoculated plants. However, large variations in plant growth and mineral nutrition were detected among the Pisolithus-inoculated plants; these differences were largely explained by the functional properties of the Pisolithus inoculum. Seedlings inoculated with the most Al-tolerant Pisolithus inoculum showed significantly higher levels of N, P, Ca, Mg, and K and lower levels of Al than seedlings inoculated with Al-sensitive ecotypes of Pisolithus. These findings indicate an agreement between the fungal tolerance to Al in vitro and performance in symbiosis, indicating that both ECM-mediated mineral nutrient acquisition and Al accumulation are important in increasing the host plant Al tolerance.

  16. Gene mining in halophytes: functional identification of stress tolerance genes in Lepidium crassifolium.

    Science.gov (United States)

    Rigó, Gábor; Valkai, Ildikó; Faragó, Dóra; Kiss, Edina; Van Houdt, Sara; Van de Steene, Nancy; Hannah, Matthew A; Szabados, László

    2016-09-01

    Extremophile plants are valuable sources of genes conferring tolerance traits, which can be explored to improve stress tolerance of crops. Lepidium crassifolium is a halophytic relative of the model plant Arabidopsis thaliana, and displays tolerance to salt, osmotic and oxidative stresses. We have employed the modified Conditional cDNA Overexpression System to transfer a cDNA library from L. crassifolium to the glycophyte A. thaliana. By screening for salt, osmotic and oxidative stress tolerance through in vitro growth assays and non-destructive chlorophyll fluorescence imaging, 20 Arabidopsis lines were identified with superior performance under restrictive conditions. Several cDNA inserts were cloned and confirmed to be responsible for the enhanced tolerance by analysing independent transgenic lines. Examples include full-length cDNAs encoding proteins with high homologies to GDSL-lipase/esterase or acyl CoA-binding protein or proteins without known function, which could confer tolerance to one or several stress conditions. Our results confirm that random gene transfer from stress tolerant to sensitive plant species is a valuable tool to discover novel genes with potential for biotechnological applications. PMID:27343166

  17. High Aluminum Tolerance of Rhodotorula sp.RS1 is Associated with Thickening of the Cell Wall Rather than Chelation of Aluminum Ions*1

    Institute of Scientific and Technical Information of China (English)

    WANG Chao; ZHAO Xue-Qiang; T.AIZAWA; M.SUNAIRI; SHEN Ren-Fang

    2013-01-01

    Aluminum (Al) is very toxic to many living organisms,including plants,animals and microorganisms.However,despite many studies on Al tolerance in plants,little has been reported concerning these mechanisms in microorganisms.In this study,a red yeast,which could tolerate Al3+ concentrations as high as 200 mmol L-1,was isolated from acidic soils,identified as Rhodotorula sp.and designated as RS1.As the medium compositions can greatly affect the responses of microorganisms to Al,two culture mediums,glucose medium (GM) and lysogeny broth medium containing soil extract (S-LBM),were used.During growth of RS1,the pH of medium decreased in GM but increased in S-LBM.These changes in the pH of the media were not induced by Al addition.No or little secretion of organic acids was observed in RS1 growth media.Importantly,the thickness of the cell walls and the ratio of cell wall to biomass of RS1 significantly increased in GM with high Al3+ concentrations.In the presence of 100 mmol Al L-1,78.0% of the total Al of whole cells was present in the thickened cell walls.The Al in cell walls was mostly bound to OH,amide and CO groups of polysaccharides.These results suggest that thickening of the cell wall in response to the high Al3+ concentrations may play an important role in the high tolerance of RS1 to Al and that pH increase of the medium and chelation of Al ions are not involved in Al tolerance of this organism.

  18. Cold tolerance of potato plants transformed with yeast invertase gene

    Directory of Open Access Journals (Sweden)

    Alexander N. Deryaabin

    2013-12-01

    Full Text Available Our study was carried out with potato plants (Solanum tuberosun L.,cv. Désirée transformed with the yeast invertase gene under the control of the B33 class I patatin promoter and with the proteinase inhibitor II leader peptide sequence providing for the apoplastic enzyme localization (B33-inv plants and with the plants transformed with the reporter gene encoding bb-glucuronidase under the control of the 35S CaMV promoter (control plants. Exposure to 5°C during 6 days caused an increase in invertase activity and sugar content in B33-inv leaves in comparison with the control plants. Cell membranes of B33-inv plant cells showed greater cold tolerance under low temperature conditions than control plants that was recorded by electrolyte release. We supposed that higher cold tolerance of B33-inv plants was caused by stabilizing effect of sugar on the membranes, because B33-inv plants differ from the control plants in higher invertase activity, induced by expression of yeast invertase gene, and high content of sugars.

  19. Aluminum-Tolerant Pisolithus Ectomycorrhizas Confer Increased Growth, Mineral Nutrition, and Metal Tolerance to Eucalyptus in Acidic Mine Spoil

    OpenAIRE

    Louise Egerton-Warburton

    2015-01-01

    Ectomycorrhizal fungi (ECM) may increase the tolerance of their host plants to Al toxicity by immobilizing Al in fungal tissues and/or improving plant mineral nutrition. Although these benefits have been demonstrated in in vitro (pure culture) or short-term nutrient solution (hydroponic) experiments, fewer studies have examined these benefits in the field. This study examined the growth, mineral nutrition, and Al levels in two Eucalyptus species inoculated with three Pisolithus ecotypes that ...

  20. Functional Identification and Characterization of Genes Cloned from Halophyte Seashore Paspalum Conferring Salinity and Cadmium Tolerance

    Science.gov (United States)

    Chen, Yu; Chen, Chuanming; Tan, Zhiqun; Liu, Jun; Zhuang, Lili; Yang, Zhimin; Huang, Bingru

    2016-01-01

    Salinity-affected and heavy metal-contaminated soils limit the growth of glycophytic plants. Identifying genes responsible for superior tolerance to salinity and heavy metals in halophytes has great potential for use in developing salinity- and Cd-tolerant glycophytes. The objective of this study was to identify salinity- and Cd-tolerance related genes in seashore paspalum (Paspalum vaginatum), a halophytic perennial grass species, using yeast cDNA expression library screening method. Based on the Gateway-compatible vector system, a high-quality entry library was constructed, which contained 9.9 × 106 clones with an average inserted fragment length of 1.48 kb representing a 100% full-length rate. The yeast expression libraries were screened in a salinity-sensitive and a Cd-sensitive yeast mutant. The screening yielded 32 salinity-tolerant clones harboring 18 salinity-tolerance genes and 20 Cd-tolerant clones, including five Cd-tolerance genes. qPCR analysis confirmed that most of the 18 salinity-tolerance and five Cd-tolerance genes were up-regulated at the transcript level in response to salinity or Cd stress in seashore paspalum. Functional analysis indicated that salinity-tolerance genes from seashore paspalum could be involved mainly in photosynthetic metabolism, antioxidant systems, protein modification, iron transport, vesicle traffic, and phospholipid biosynthesis. Cd-tolerance genes could be associated with regulating pathways that are involved in phytochelatin synthesis, HSFA4-related stress protection, CYP450 complex, and sugar metabolism. The 18 salinity-tolerance genes and five Cd-tolerance genes could be potentially used as candidate genes for genetic modification of glycophytic grass species to improve salinity and Cd tolerance and for further analysis of molecular mechanisms regulating salinity and Cd tolerance. PMID:26904068

  1. Identification of wild soybean miRNAs and their target genes responsive to aluminum stress

    Directory of Open Access Journals (Sweden)

    Zeng Qiao-Ying

    2012-10-01

    Full Text Available Abstract Background MicroRNAs (miRNAs play important regulatory roles in development and stress response in plants. Wild soybean (Glycine soja has undergone long-term natural selection and may have evolved special mechanisms to survive stress conditions as a result. However, little information about miRNAs especially miRNAs responsive to aluminum (Al stress is available in wild soybean. Results Two small RNA libraries and two degradome libraries were constructed from the roots of Al-treated and Al-free G. soja seedlings. For miRNA identification, a total of 7,287,655 and 7,035,914 clean reads in Al-treated and Al-free small RNAs libraries, respectively, were generated, and 97 known miRNAs and 31 novel miRNAs were identified. In addition, 49 p3 or p5 strands of known miRNAs were found. Among all the identified miRNAs, the expressions of 30 miRNAs were responsive to Al stress. Through degradome sequencing, 86 genes were identified as targets of the known miRNAs and five genes were found to be the targets of the novel miRNAs obtained in this study. Gene ontology (GO annotations of target transcripts indicated that 52 target genes cleaved by conserved miRNA families might play roles in the regulation of transcription. Additionally, some genes, such as those for the auxin response factor (ARF, domain-containing disease resistance protein (NB-ARC, leucine-rich repeat and toll/interleukin-1 receptor-like protein (LRR-TIR domain protein, cation transporting ATPase, Myb transcription factors, and the no apical meristem (NAM protein, that are known to be responsive to stress, were found to be cleaved under Al stress conditions. Conclusions A number of miRNAs and their targets were detected in wild soybean. Some of them that were responsive to biotic and abiotic stresses were regulated by Al stress. These findings provide valuable information to understand the function of miRNAs in Al tolerance.

  2. Isolation of aluminum-tolerant bacteria capable of nitrogen removal in activated sludge.

    Science.gov (United States)

    Ji, Bin; Chen, Wei; Zhu, Lei; Yang, Kai

    2016-05-15

    Four strains of bacteria capable of withstanding 20mM concentration of aluminum were isolated from activated sludge in a bioreactor. 16S rRNA identification and morphological characteristics indicated that these strains were Chryseobacterium sp. B1, Brevundimonas diminuta B3, Hydrogenophaga sp. B4, and Bacillus cereus B5. Phylogenetic analysis revealed the position and interrelationships of these bacteria. B. diminuta B3 and Hydrogenophaga sp. B4 could achieve nitrate nitrogen removal of 94.0% and 76.8% within 36h of its initial concentration of 148.8 and 151.7mg/L, respectively. Meanwhile, B3 and B4 could degrade ammonia with little nitrite accumulation. Results of this study provide more information about aluminum-resistant bacteria and laid the foundation for aluminum salt when it is simultaneously used for chemical precipitation. PMID:27038879

  3. Gene Networks in Plant Ozone Stress Response and Tolerance

    Institute of Scientific and Technical Information of China (English)

    Agnieszka Ludwikow; Jan Sadowski

    2008-01-01

    For many plant species ozone stress has become much more severe in the last decade. The accumulating evidence for the significant effects of ozone pollutant on crop and forest yield situate ozone as one of the most important environmental stress factors that limits plant productivity woddwide. Today, transcdptomic approaches seem to give the best coverage of genome level responses. Therefore, microarray serves as an invaluable tool for global gene expression analyses, unravelling new information about gene pathways, in-species and crose-species gene expression comparison, and for the characterization of unknown relationships between genes. In this review we summadze the recent progress in the transcdptomics of ozone to demonstrate the benefits that can be harvested from the application of integrative and systematic analytical approaches to study ozone stress response. We focused our consideration on microarray analyses identifying gene networks responsible for response and tolerance to elevated ozone concentration. From these analyses it is now possible to notice how plant ozone defense responses depend on the interplay between many complex signaling pathways and metabolite signals.

  4. The relationship between population structure and aluminum tolerance in cultivated sorghum

    Science.gov (United States)

    Acid soils comprise up to 50% of the world’s arable lands and in these areas aluminum (Al) toxicity impairs root growth, strongly limiting crop yield. Food security is thereby compromised in many developing countries that are located in tropical and subtropical regions worldwide. In sorghum, SbMATE,...

  5. Associated mechanisms of aluminum tolerance in plants/ Mecanismos associados à tolerância ao alumínio em plantas

    Directory of Open Access Journals (Sweden)

    Cecília Estima Sacramento dos Reis

    2007-10-01

    Full Text Available Aluminum toxicity is one of the major limiting factor regarding plant development in acid soils. The use of liming for correcting soil pH is not viable for some of acid soil areas (technique or economic reasons, making the development of Al tolerant genotypes the best alternative. Thus, the tolerance mechanisms as well as the genetic basis of Al tolerance has deserved special attention in the scientific community. In the last years, a significant progress has been achieved towards these goals, as well as in developing cultivars adapted to acid soils. The Al tolerance mechanisms are divided basically in two classes: the exclusion mechanisms that act after absorption or blocking its entry in the root system and those involved in detoxification, complexing the Al in specific organelles, mainly in the vacuoles. In many species, physiological mechanisms have been reported as responsible for the activation of organic acids (mainly citrate and malate that act as Al quelating agents, however many process are not yet understood and cleared. Currently, the basis for the internal detoxification is becoming clear through organic acid complexes and there sequestering by the vacuoles. Other potential mechanisms are the target for discussions.A toxicidade do alumínio é um dos principais fatores limitantes do desenvolvimento das plantas em solos ácidos. Pelo fato da utilização de corretivos da acidez do solo não ser a estratégia mais viável em muitas situações com solos ácidos (por razões técnicas e econômicas, o desenvolvimento de genótipos tolerantes ao Al tem sido o caminho mais focado, assim a investigação dos mecanismos de tolerância bem como as bases genéticas da tolerância ao Al têm merecido atenção especial pela pesquisa científica. Nos últimos anos, foi gerado um significativo progresso no entendimento das bases dos mecanismos de tolerância ao Al, assim como no desenvolvimento de cultivares mais adaptados as condições de

  6. Increased Drought Tolerance through the Suppression of ESKMO1 Gene and Overexpression of CBF-Related Genes in Arabidopsis

    OpenAIRE

    Fuhui Xu; Zhixue Liu; Hongyan Xie; Jian Zhu; Juren Zhang; Josef Kraus; Tasja Blaschnig; Reinhard Nehls; Hong Wang

    2014-01-01

    Improved drought tolerance is always a highly desired trait for agricultural plants. Significantly increased drought tolerance in Arabidopsis thaliana (Columbia-0) has been achieved in our work through the suppression of ESKMO1 (ESK1) gene expression with small-interfering RNA (siRNA) and overexpression of CBF genes with constitutive gene expression. ESK1 has been identified as a gene linked to normal development of the plant vascular system, which is assumed directly related to plant drought...

  7. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases. PMID:23378635

  8. Paenibacillus yonginensis DCY84(T) induces changes in Arabidopsis thaliana gene expression against aluminum, drought, and salt stress.

    Science.gov (United States)

    Sukweenadhi, Johan; Kim, Yeon-Ju; Choi, Eul-Su; Koh, Sung-Cheol; Lee, Sang-Won; Kim, Yu-Jin; Yang, Deok Chun

    2015-03-01

    Current agricultural production methods, for example the improper use of chemical fertilizers and pesticides, create many health and environmental problems. Use of plant growth-promoting bacteria (PGPB) for agricultural benefits is increasing worldwide and also appears to be a trend for the future. There is possibility to develop microbial inoculants for use in agricultural biotechnology, based on these beneficial plant-microbe interactions. For this study, ten bacterial strains were isolated from Yongin forest soil for which in vitro plant-growth promoting trait screenings, such as indole acetic acid (IAA) production, a phosphate solubilization test, and a siderophore production test were used to select two PGPB candidates. Arabidopsis thaliana plants were inoculated with Paenibacillus yonginensis DCY84(T) and Micrococcus yunnanensis PGPB7. Salt stress, drought stress and heavy metal (aluminum) stress challenges indicated that P. yonginensis DCY84(T)-inoculated plants were more resistant than control plants. AtRSA1, AtVQ9 and AtWRKY8 were used as the salinity responsive genes. The AtERD15, AtRAB18, and AtLT178 were selected to check A. thaliana responses to drought stress. Aluminum stress response was checked using AtAIP, AtALS3 and AtALMT1. The qRT-PCR results indicated that P. yonginensis DCY84(T) can promote plant tolerance against salt, drought, and aluminum stress. P. yonginensis DCY84(T) also showed positive results during in vitro compatibility testing and virulence assay against X. oryzae pv. oryzae Philippine race 6 (PXO99). Better germination rates and growth parameters were also recorded for the P. yonginensis DCY84(T) Chuchung cultivar rice seed which was grown on coastal soil collected from Suncheon. Based on these results, P. yonginensis DCY84(T) can be used as a promising PGPB isolate for crop improvement. PMID:25721473

  9. Physiological and molecular characterization of drought responses and identification of candidate tolerance genes in cassava

    OpenAIRE

    Turyagyenda, Laban F.; Kizito, Elizabeth B.; Ferguson, Morag; Baguma, Yona; Agaba, Morris; Jagger J W Harvey; Osiru, David S. O.

    2013-01-01

    Cassava is an important root crop to resource-poor farmers in marginal areas, where its production faces drought stress constraints. Given the difficulties associated with cassava breeding, a molecular understanding of drought tolerance in cassava will help in the identification of markers for use in marker-assisted selection and genes for transgenic improvement of drought tolerance. This study was carried out to identify candidate drought-tolerance genes and expression-based markers of droug...

  10. A new allele of acid soil tolerance gene from a malting barley variety

    OpenAIRE

    Bian, Miao; Jin, Xiaoli; Broughton, Sue; Zhang, Xiao-Qi; Zhou, Gaofeng; Zhou, Meixue; Zhang, Guoping; Sun, Dongfa; Li, Chengdao

    2015-01-01

    Background Acid soil is a serious limitation to crop production all over the world. Toxic aluminium (Al) cations in acid soil inhibit root growth and reduce yield. Although a gene tolerant to acid soil has been identified, it has not been used in malting barley breeding, which is partly due to the acid soil tolerance gene being linked to unfavorable malting quality traits. Results A Brazilian malting barley variety Br2 was identified as tolerant to acid soil. A doubled haploid (DH) population...

  11. Identification of Genes Conferring Tolerance to Lignocellulose-Derived Inhibitors by Functional Selections in Soil Metagenomes

    OpenAIRE

    Kevin J. Forsberg; Patel, Sanket; Witt, Evan; Wang, Bin; Ellison, Tyler D.; Dantas, Gautam

    2016-01-01

    The production of fuels or chemicals from lignocellulose currently requires thermochemical pretreatment to release fermentable sugars. These harsh conditions also generate numerous small-molecule inhibitors of microbial growth and fermentation, limiting production. We applied small-insert functional metagenomic selections to discover genes that confer microbial tolerance to these inhibitors, identifying both individual genes and general biological processes associated with tolerance to multip...

  12. Alcohol-induced histone acetylation reveals a gene network involved in alcohol tolerance.

    Directory of Open Access Journals (Sweden)

    Alfredo Ghezzi

    Full Text Available Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol.

  13. Manipulating Immune Tolerance with micro-RNA Regulated Gene Therapy

    Directory of Open Access Journals (Sweden)

    KevinScottGoudy

    2011-11-01

    Full Text Available The successful use of in vivo gene therapy depends upon controlling the immune response to the therapeutic transgene to allow stable, long-term transgene expression. Over the last decade several vector-based and pharmacological approaches to control the immune-mediated clearance of transgene expressing cells after viral delivery have been explored. One important outcome from these studies is the concept that expression of transgene in tolerance-promoting organs, such as the liver and tolerogenic antigen presenting cells, can help safeguard transgene expressing cells from immune-mediated clearance. With this in mind, gene therapists are specifically targeting these avenues by manipulating their vectors in three main areas: i incorporating tissue/cell specific promoters, ii viral-capsid engineering to alter tropism and avoid pre-existing immunity, and iii including micro-RNA (miR targets into expression cassettes. The combination of these three layers of vector regulation greatly enhances the targeting of “tolerogenic cells” and limits the off-target expression of the transgene, which can lead to the induction of transgene-specific pathogenic effector T cells. In this review, we discuss the application of using miR transgene regulation to generate tolerogenic responses and speculate on possible mechanisms used by the liver to induce the transgene specific regulatory T cells.

  14. Quantitative transcription dynamic analysis reveals candidate genes and key regulators for ethanol tolerance in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Ma Menggen

    2010-06-01

    Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance

  15. Melhoramento do trigo: VI. hereditariedade da tolerância a três concentrações de alumínio em solução nutritiva Wheat breeding: VI. inheritance of tolerance to three different aluminum concentrations in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1984-01-01

    Cerros. Com grandes populações F2, seria interessante selecionar as plantas em altas concentrações de Al3+ (10mg/litro na solução, pois seriam eliminadas as sensíveis (homozigotas recessivas e heterozigotas e selecionadas as tolerantes homozigotas. Por outro lado, seria de interesse utilizar baixas concentrações de alumínio (3mg/litro na solução quando pequenas populações F2 forem disponíveis, eliminando somente as plantas sensíveis (homozigotas recessivas e selecionando as tolerantes (homozigotas e heterozigotas.Four wheat cultivars: BH-1146, C-3, Siete Cerros and Brevor were tested in nutrient solution with 0, 1, 2, 3, 4, 5, 6 and 10mg/l of Al3+. It was demonstrated that B-1146 and C-3 presented tolerance to 10mg/l of Al3+ whereas Brevor and Siete Cerros were sensitive to 1mg/l of Al3+. It was considered tolerant the plant that was able to show root regrowth of the central primary root in the complete nutrient solution after a treatment in a solution containing a particular amount of aluminum. Seeds of C-3 and Siete Cerros, considered parental lines, and the F1 and F2 populations from the crosses between them, were tested in nutrient solutions where 3, 6 and 10mg/l of aluminum were applied. The results showed that C-3 differed from Siete Cerros by one pair of dominant genes for tolerance at 3mg/l of aluminum. There was a gradual decrease of dominance of the gene pair responsable for the tolerance reaction when it was used 6mg/l of aluminum in the solution. The cultivar Siete Cerros differed from C-3 by one pair of dominant genes for susceptibility at 10mg/l of aluminum or C-3 differed from Siete Cerros by one dominant gene even at 10mg/l of Al3+ if it was considered that the heterozygous individuals from the F1 and F2 populations showed reaction of susceptibility. Heterozygous seedlings of F1 and F2, populations from the cross C-3/Siete Cerros, considered tolerant at 3mg/l of Al3+, showed a decrease in tolerance at 6mg/l and susceptibility at 10mg

  16. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    OpenAIRE

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

    2015-01-01

    Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

  17. Overexpression of malate dehydrogenase in transgenic alfalfa enhances organic acid synthesis and confers tolerance to aluminum.

    Science.gov (United States)

    Tesfaye, M; Temple, S J; Allan, D L; Vance, C P; Samac, D A

    2001-12-01

    Al toxicity is a severe impediment to production of many crops in acid soil. Toxicity can be reduced through lime application to raise soil pH, however this amendment does not remedy subsoil acidity, and liming may not always be practical or cost-effective. Addition of organic acids to plant nutrient solutions alleviates phytotoxic Al effects, presumably by chelating Al and rendering it less toxic. In an effort to increase organic acid secretion and thereby enhance Al tolerance in alfalfa (Medicago sativa), we produced transgenic plants using nodule-enhanced forms of malate dehydrogenase and phosphoenolpyruvate carboxylase cDNAs under the control of the constitutive cauliflower mosaic virus 35S promoter. We report that a 1.6-fold increase in malate dehydrogenase enzyme specific activity in root tips of selected transgenic alfalfa led to a 4.2-fold increase in root concentration as well as a 7.1-fold increase in root exudation of citrate, oxalate, malate, succinate, and acetate compared with untransformed control alfalfa plants. Overexpression of phosphoenolpyruvate carboxylase enzyme specific activity in transgenic alfalfa did not result in increased root exudation of organic acids. The degree of Al tolerance by transformed plants in hydroponic solutions and in naturally acid soil corresponded with their patterns of organic acid exudation and supports the concept that enhancing organic acid synthesis in plants may be an effective strategy to cope with soil acidity and Al toxicity. PMID:11743127

  18. In vitro selection of induced mutants to salt-tolerance: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    A selection protocol to obtain salt tolerant calli, followed by regeneration and progeny-test of the regenerated plants for salt tolerance in rice was investigated. Callus cultures were initiated from salt-sensitive US elite rice lines and cv. 'Pokkali'. Salt-tolerant cell lines were selected from these by a single step selection procedure. The selected salt-tolerant lines grew well on medium with ± 0.5% or 1% NaCl, while the parent lines occasionally survived, but did not grow at these salt concentrations. Plants were regenerated from these cell lines through different passages on medium containing salt. Seed was collected from the regenerated plants and salt tolerance of R2 seedlings was compared with those regenerated without salt selection. Salt-tolerance was measured by survival and productive growth of newly germinated seedlings in Hoagland solution with 0.3% and 0.5% NaCl for 4 weeks. Heritable improvement in salt tolerance was obtained in R2 seedlings from one plant regenerated after 5 months selection. Survival and growth of these seedlings was equivalent to that from 'Pokkali' seedlings. These results show that cellular tolerance can provide salt-tolerance in rice plants. (author). 6 refs, 2 tabs

  19. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

    Directory of Open Access Journals (Sweden)

    Yoshiki eNakahara

    2015-10-01

    Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  20. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated by the d...... alternatives by returning to the notion of tolerance as the endurance of pain, linking this notion to exemplars and theories relevant to the politics of multiculturalism, religious freedom, and free speech....

  1. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    Science.gov (United States)

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. PMID:26919127

  2. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

    OpenAIRE

    Nakahara, Yoshiki; Sawabe, Shogo; Kainuma, Kenta; Katsuhara, Maki; Shibasaka, Mineo; SUZUKI, Masanori; Yamamoto, Kosuke; Oguri, Suguru; Sakamoto, Hikaru

    2015-01-01

    Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt toler...

  3. Aluminum-induced gene expression and protein localization of a cell wall-associated receptor kinase in Arabidopsis.

    Science.gov (United States)

    Sivaguru, Mayandi; Ezaki, Bunichi; He, Zheng-Hui; Tong, Hongyun; Osawa, Hiroki; Baluska, Frantisek; Volkmann, Dieter; Matsumoto, Hideaki

    2003-08-01

    Here, we report the aluminum (Al)-induced organ-specific expression of a WAK1 (cell wall-associated receptor kinase 1) gene and cell type-specific localization of WAK proteins in Arabidopsis. WAK1-specific reverse transcriptase-polymerase chain reaction analysis revealed an Al-induced WAK1 gene expression in roots. Short- and long-term analysis of gene expression in root fractions showed a typical "on" and "off" pattern with a first peak at 3 h of Al exposure followed by a sharp decline at 6 h and a complete disappearance after 9 h of Al exposure, suggesting the WAK1 is a further representative of Al-induced early genes. In shoots, upon root Al exposure, an increased but stable WAK1 expression was observed. Using confocal microscopy, we visualized Al-induced closure of leaf stomata, consistent with previous suggestions that the Al stress primarily experienced in roots associated with the transfer of root-shoot signals. Elevated levels of WAK protein in root cells were observed through western blots after 6 h of Al exposure, indicating a lag time between the Al-induced WAK transcription and translation. WAK proteins are localized abundantly to peripheries of cortex cells within the elongation zone of the root apex. In these root cells, disintegration of cortical microtubules was observed after Al treatment but not after the Al analog lanthanum treatments. Tip-growing control root hairs, stem stomata, and leaf stomatal pores are characterized with high amounts of WAKs, suggesting WAKs are accumulating at plasma membrane domains, which suffer from mechanical stress and lack dense arrays of supporting cortical microtubules. Further, transgenic plants overexpressing WAK1 showed an enhanced Al tolerance in terms of root growth when compared with the wild-type plants, making the WAK1 one of the important candidates for plant defense against Al toxicity. PMID:12913180

  4. Detection of drought tolerant genes within seedling apple rootstocks in Syria

    Science.gov (United States)

    This investigation was conducted to detect the drought tolerant genes (four genes) within seedling apple rootstocks derived from five apple genotypes, including Syrian apple cultivars. The results showed that the gene MdPepPro (a cyclophilin) was found in all studied genotypes and their progenies e...

  5. Cloning of genes and developing transgenic crops with enhanced tolerance to salinity and drought (abstract)

    International Nuclear Information System (INIS)

    Abiotic stresses represent the most limiting factors affecting agricultural productivity. In India more than 60% of total cultivated land is still rainfed and crops experience frequent droughts. Thus, we need to develop transgenic crops tolerant to drought, and other related abiotic stress factors such as salinity, low and high temperature stresses. At the National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (ICAR), we have initiated a programme on developing transgenic crops tolerant to a range of abiotic stresses. The major emphasis is on developing transgenic potato, tomato, mustard, rice and wheat. While, transgenic plants of potato. tomato and mustard have already been generated with osmotin gene and are at different stages of testing, other key genes imparting tolerance to abiotic stresses are being isolated from different species for producing transgenic rice and wheat cultivars tolerant to multiple stresses. Genes that have been isolated in our laboratory include ascorbate peroxidase gene (TaApx) and genes encoding transcription factor, CBFs (TaCBF2 and TaCBP3) from a drought tolerant wheat cultivar (C306), Lea1 cDNA from Brassica species, codA from Arthrobacter globiformis, and otsBA operon from E. coli. Apart from these stress-related genes, we have isolated a few stress-inducible promoters for deploying them in gene stacking in developing transgenic crops with enhanced tolerance to multiple abiotic stresses. The results will be presented. (author)

  6. Differentially Expressed Genes between Two Barley Cultivars Contrasting in Drought Tolerance

    Institute of Scientific and Technical Information of China (English)

    P.G. Guo; M. Baum; R.H. Li; S. Grando; R.K. Varshney; J. Valkoun; S. Ceccarelli; A. Grane

    2007-01-01

    @@ Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas. A number of genes have been described that respond to drought at the transcriptional level (Seki et al., 2002; Cheong et al.,2003).

  7. Identification of Genes Conferring Tolerance to Lignocellulose-Derived Inhibitors by Functional Selections in Soil Metagenomes.

    Science.gov (United States)

    Forsberg, Kevin J; Patel, Sanket; Witt, Evan; Wang, Bin; Ellison, Tyler D; Dantas, Gautam

    2016-01-01

    The production of fuels or chemicals from lignocellulose currently requires thermochemical pretreatment to release fermentable sugars. These harsh conditions also generate numerous small-molecule inhibitors of microbial growth and fermentation, limiting production. We applied small-insert functional metagenomic selections to discover genes that confer microbial tolerance to these inhibitors, identifying both individual genes and general biological processes associated with tolerance to multiple inhibitory compounds. Having screened over 248 Gb of DNA cloned from 16 diverse soil metagenomes, we describe gain-of-function tolerance against acid, alcohol, and aldehyde inhibitors derived from hemicellulose and lignin, demonstrating that uncultured soil microbial communities hold tremendous genetic potential to address the toxicity of pretreated lignocellulose. We recovered genes previously known to confer tolerance to lignocellulosic inhibitors as well as novel genes that confer tolerance via unknown functions. For instance, we implicated galactose metabolism in overcoming the toxicity of lignin monomers and identified a decarboxylase that confers tolerance to ferulic acid; this enzyme has been shown to catalyze the production of 4-vinyl guaiacol, a valuable precursor to vanillin production. These metagenomic tolerance genes can enable the flexible design of hardy microbial catalysts, customized to withstand inhibitors abundant in specific bioprocessing applications. PMID:26546427

  8. Tolerância ao alumínio em cultivares de aveia branca sob cultivo hidropônico Tolerance to the aluminum in oat cultivars under hydroponic culture

    Directory of Open Access Journals (Sweden)

    José Antonio Gonzalez da Silva

    2007-01-01

    Full Text Available O emprego do cultivo hidropônico para avaliar a tolerância à toxicidade pelo alumínio em genótipos de aveia pode ser feito por meio da medida da retomada do crescimento de raiz. Avaliaram-se 12 cultivares de aveia branca indicadas para o cultivo no Sul do Brasil com o intuito de caracterizar a tolerância ao alumínio, de maneira a ser estrategicamente recomendadas e/ou incluídas em blocos de cruzamento na obtenção de constituições genéticas de elevado potencial produtivo e tolerante ao íon metálico. Foram utilizadas doses de 10, 15 e 20 mg L-1 de alumínio na solução hidropônica e o delineamento experimental adotado foi o completamente casualizado, com três repetições, seguindo o esquema fatorial (12 x 3. As doses empregadas são altamente eficientes na identificação de genótipos de aveia tolerantes e sensíveis ao alumínio tóxico. As cultivares UPF 16, URS 21, UFRGS 14, UPF 19 e UFRGS 17 expressam tolerância.The use of hidroponic culture to evaluate tolerance to aluminum toxicity in oat genotypes can be performed by measuring root regrowth, allowing phenotypically to discriminate tolerant genetic constitutions sensitivity. Twelve white oat cultivars indicated for cultivation in Southern Brazil were evaluated aiming at to characterize their aluminum tolerance, in order to use them as parents in crosses or to recommend them for in cultivation regions. Aluminum concentration of 10, 15 and 20 mg L-1 were used in the hydroponic solution arranged in complete randomized blocks with three replications in 12 x 3 factorial designs. Concentrations of 10, 15 and 20 mg L-1 were highly efficient for the identification of tolerant and sensitive oat genotypes. Cultivars UPF 16, URS 21, UFRGS 14, UPF 19 and UFRGS 17 showed aluminum.

  9. Meta-analysis and candidate gene mining of low-phosphorus tolerance in maize

    Institute of Scientific and Technical Information of China (English)

    Hongwei Zhang; Mohammed Shalim Uddin; Cheng Zou; Chuanxiao Xie; Yunbi Xu; WenXue Li

    2014-01-01

    Plants with tolerance to low-phosphorus (P) can grow better under low-P conditions, and understanding of genetic mechanisms of low-P tolerance can not only facilitate identifying relevant genes but also help to develop low-P tolerant cultivars. QTL meta-analysis was conducted after a comprehensive review of the reports on QTL mapping for low-P tolerance-related traits in maize. Meta-analysis pro-duced 23 consensus QTL (cQTL), 17 of which located in similar chromosome regions to those previously reported to influence root traits. Meanwhile, candidate gene mining yielded 215 genes, 22 of which located in the cQTL regions. These 22 genes are homologous to 14 functionally character-ized genes that were found to participate in plant low-P tolerance, including genes encoding miR399s, Pi transporters and purple acid phosphatases. Four cQTL loci (cQTL2-1, cQTL5-3, cQTL6-2, and cQTL10-2) may play important roles for low-P tolerance because each contains more original QTL and has better consistency across previous reports.

  10. In vitro selection of mutants: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    Regulation of differentially expressed genes in plants may be involved in inducing tolerance to stress. Isogenic salt-sensitive and salt-tolerant alfalfa lines were investigated for molecular differences in their response to salt. The genes, which are differentially induced by salt in the salt-tolerant alfalfa cells and are also regulated by salt at the whole plant level, were cloned. Both transcriptional and post- transcriptional mechanisms influenced salt-induced product accumulation in the salt-tolerant alfalfa. The salt-tolerant plants doubled proline concentration rapidly in roots, while salt-sensitive plants showed a delayed response. To understand the regulatory system in the salt-tolerant alfalfa, two genes that are expressed in roots were studied. Alfin1 encodes a zinc-finger type putative DNA transcription factor conserved in alfalfa, rice and Arabidopsis, and MsPRP2 encodes a protein that serves as a cell wall- membrane linker in roots. Recombinant Alfin1 protein was selected, amplified, cloned and its consensus sequence was identified. The recombinant Alfin1 also bound specifically to fragments of the MsPRP2 promoter in vitro, containing the Alfin1 binding consensus sequence. The results show unambiguously binding specificity of Alfin1 DNA, supporting its role in gene regulation. Alfin1 function was tested in transformed alfalfa in vivo by over-expressing Alfin1 from 35S CaMV promoter. The transgenic plants appeared normal. However, plants harboring the anti-sense construct did not grow well in soil, indicating that Alfin1 expression was essential. Alfin1 over-expression in transgenic alfalfa led to enhanced levels of MsPRP2 transcript accumulation, demonstrating that Alfin1 functioned in vivo in gene regulation. Since MsPRP2 gene is also induced by salt, it is likely that Alfin1 is an important transcription factor for gene regulation in salt-tolerant alfalfa, and an excellent target for manipulation to improve salt tolerance. (author)

  11. Ectopic Expression of the Chinese Cabbage Malate Dehydrogenase Gene Promotes Growth and Aluminum Resistance in Arabidopsis.

    Science.gov (United States)

    Li, Qing-Fei; Zhao, Jing; Zhang, Jing; Dai, Zi-Hui; Zhang, Lu-Gang

    2016-01-01

    Malate dehydrogenases (MDHs) are key metabolic enzymes that play important roles in plant growth and development. In the present study, we isolated the full-length and coding sequences of BraMDH from Chinese cabbage [Brassica campestris L. ssp. pekinensis (Lour) Olsson]. We conducted bioinformatics analysis and a subcellular localization assay, which revealed that the BraMDH gene sequence contained no introns and that BraMDH is localized to the chloroplast. In addition, the expression pattern of BraMDH in Chinese cabbage was investigated, which revealed that BraMDH was heavily expressed in inflorescence apical meristems, as well as the effect of BraMDH overexpression in two homozygous transgenic Arabidopsis lines, which resulted in early bolting and taller inflorescence stems. Furthermore, the fresh and dry weights of aerial tissue from the transgenic Arabidopsis plants were significantly higher than those from the corresponding wild-type plants, as were plant height, the number of rosette leaves, and the number of siliques produced, and the transgenic plants also exhibited stronger aluminum resistance when treated with AlCl3. Therefore, our results suggest that BraMDH has a dramatic effect on plant growth and that the gene is involved in both plant growth and aluminum resistance. PMID:27536317

  12. Aluminum tolerance of two wheat cultivars (Brevor and Atlas66) in relation to their rhizosphere pH and organic acids exuded from roots.

    Science.gov (United States)

    Wang, Ping; Bi, Shuping; Ma, Liping; Han, Weiying

    2006-12-27

    Phytotoxicity of aluminum (Al) has become a serious problem in inhibiting plant growth on acid soils. Under Al stress, the changes of rhizosphere pH, root elongation, absorption of Al by wheat roots, organic acids exuded from roots, and some main factors related to Al-tolerant mechanisms have been studied using hydroponics, fluorescence spectrophotometry, and high performance liquid chromatography (HPLC). Two wheat cultivars, Brevor and Atlas66, differing in Al tolerance are chosen in the study. Accordingly, the rhizosphere pH has a positive effect on Al tolerance. Atlas66 (Al-tolerant) has higher capability to maintain high rhizosphere pH than Brevor (Al-sensitive) does. High pH can reduce Al3+ activity and toxicity, and increase the efficiency of exuding organic acids from the roots. More inhibition of root elongation has been found in Brevor because of the exposure of roots to Al3+ solution at low pH. Brevor accumulate more Al in roots than Atlas66 even at higher pH. Al-induced exudation of malic and citric acids has been found in Atlas66 roots, while no Al-induced organic acids have been found in Brevor. These results indicate that the Al-induced secretion of organic acids from Atlas66 roots has a positive correlation with Al tolerance. Comprehensive treatment of Al3+ and H+ indicates that wheat is adversely influenced by excess Al3+, rather than low pH. PMID:17177538

  13. Network Candidate Genes in Breeding for Drought Tolerant Crops

    OpenAIRE

    Christoph Tim Krannich; Lisa Maletzki; Christina Kurowsky; Renate Horn

    2015-01-01

    Climate change leading to increased periods of low water availability as well as increasing demands for food in the coming years makes breeding for drought tolerant crops a high priority. Plants have developed diverse strategies and mechanisms to survive drought stress. However, most of these represent drought escape or avoidance strategies like early flowering or low stomatal conductance that are not applicable in breeding for crops with high yields under drought conditions. Even though a gr...

  14. Identification of Listeria monocytogenes Genes Involved in Salt and Alkaline-pH Tolerance

    OpenAIRE

    Gardan, Rozenn; Cossart, Pascale; Labadie, Jean

    2003-01-01

    The capacity of Listeria monocytogenes to tolerate salt and alkaline stresses is of particular importance, as this pathogen is often exposed to such environments during food processing and food preservation. We screened a library of Tn917-lacZ insertional mutants in order to identify genes involved in salt and/or alkaline tolerance. We isolated six mutants sensitive to salt stress and 12 mutants sensitive to salt and alkaline stresses. The position of the insertion of the transposon was locat...

  15. Investigations of Aluminum-Doped Self-Healing Zircaloy Surfaces in Context of Accident-Tolerant Fuel Cladding Research

    Science.gov (United States)

    Carr, James; Vasudevamurthy, Gokul; Snead, Lance; Hinderliter, Brian; Massey, Caleb

    2016-06-01

    We present here some important results investigating aluminum as an effective surface dopant for increased oxidation resistance of zircaloy nuclear fuel cladding. At first, the transport behavior of aluminum into reactor grade zircaloy was studied using simple diffusion couples at temperatures greater than 770 K. The experiments revealed the formation of tens of microns thick graded Zr-Al layers. The activation energy of aluminum in zircaloy was found to be ~175 kJ/mol (~1.8 eV), indicating the high mobility of aluminum in zircaloy. Subsequently, aluminum sputter-coated zircaloy coupons were heat-treated to achieve surface doping and form compositionally graded layers. These coupons were then tested in steam environments at 1073 and 1273 K. The microstructure of the as-fabricated and steam-corroded specimens was compared to those of pure zircaloy control specimens. Analysis of data revealed that aluminum effectively competed with zircaloy for oxygen up until 1073 K blocking oxygen penetration, with no traces of large scale spalling, indicating mechanically stable interfaces and surfaces. At the highest steam test temperatures, aluminum was observed to segregate from the Zr-Al alloy under layers and migrate to the surface forming discrete clusters. Although this is perceived as an extremely desirable phenomenon, in the current experiments, oxygen was observed to penetrate into the zirconium-rich under layers, which could be attributed to formation of surface defects such as cracks in the surface alumina layers.

  16. Investigations of Aluminum-Doped Self-Healing Zircaloy Surfaces in Context of Accident-Tolerant Fuel Cladding Research

    Science.gov (United States)

    Carr, James; Vasudevamurthy, Gokul; Snead, Lance; Hinderliter, Brian; Massey, Caleb

    2016-05-01

    We present here some important results investigating aluminum as an effective surface dopant for increased oxidation resistance of zircaloy nuclear fuel cladding. At first, the transport behavior of aluminum into reactor grade zircaloy was studied using simple diffusion couples at temperatures greater than 770 K. The experiments revealed the formation of tens of microns thick graded Zr-Al layers. The activation energy of aluminum in zircaloy was found to be ~175 kJ/mol (~1.8 eV), indicating the high mobility of aluminum in zircaloy. Subsequently, aluminum sputter-coated zircaloy coupons were heat-treated to achieve surface doping and form compositionally graded layers. These coupons were then tested in steam environments at 1073 and 1273 K. The microstructure of the as-fabricated and steam-corroded specimens was compared to those of pure zircaloy control specimens. Analysis of data revealed that aluminum effectively competed with zircaloy for oxygen up until 1073 K blocking oxygen penetration, with no traces of large scale spalling, indicating mechanically stable interfaces and surfaces. At the highest steam test temperatures, aluminum was observed to segregate from the Zr-Al alloy under layers and migrate to the surface forming discrete clusters. Although this is perceived as an extremely desirable phenomenon, in the current experiments, oxygen was observed to penetrate into the zirconium-rich under layers, which could be attributed to formation of surface defects such as cracks in the surface alumina layers.

  17. Gene Therapy Induces Antigen-Specific Tolerance in Experimental Collagen-Induced Arthritis

    Science.gov (United States)

    Jirholt, Pernilla; Turesson, Olof; Wing, Kajsa; Holmdahl, Rikard; Kihlberg, Jan; Stern, Anna; Mårtensson, Inga-Lill; Henningsson, Louise; Gustafsson, Kenth; Gjertsson, Inger

    2016-01-01

    Here, we investigate induction of immunological tolerance by lentiviral based gene therapy in a mouse model of rheumatoid arthritis, collagen II-induced arthritis (CIA). Targeting the expression of the collagen type II (CII) to antigen presenting cells (APCs) induced antigen-specific tolerance, where only 5% of the mice developed arthritis as compared with 95% of the control mice. In the CII-tolerized mice, the proportion of Tregs as well as mRNA expression of SOCS1 (suppressors of cytokine signaling 1) increased at day 3 after CII immunization. Transfer of B cells or non-B cell APC, as well as T cells, from tolerized to naïve mice all mediated a certain degree of tolerance. Thus, sustainable tolerance is established very early during the course of arthritis and is mediated by both B and non-B cells as APCs. This novel approach for inducing tolerance to disease specific antigens can be used for studying tolerance mechanisms, not only in CIA but also in other autoimmune diseases. PMID:27159398

  18. Barley Genes as Tools to Confer Abiotic Stress Tolerance in Crops.

    Science.gov (United States)

    Gürel, Filiz; Öztürk, Zahide N; Uçarlı, Cüneyt; Rosellini, Daniele

    2016-01-01

    Barley is one of the oldest cultivated crops in the world with a high adaptive capacity. The natural tolerance of barley to stress has led to increasing interest in identification of stress responsive genes through small/large-scale omics studies, comparative genomics, and overexpression of some of these genes by genetic transformation. Two major categories of proteins involved in stress tolerance are transcription factors (TFs) responsible from the re-programming of the metabolism in stress environment, and genes encoding Late Embryogenesis Abundant (LEA) proteins, antioxidant enzymes, osmolytes, and transporters. Constitutive overexpression of several barley TFs, such as C-repeat binding factors (HvCBF4), dehydration-responsive element-binding factors (HvDREB1), and WRKYs (HvWRKY38), in transgenic plants resulted in higher tolerance to drought and salinity, possibly by effectively altering the expression levels of stress tolerance genes due to their higher DNA binding affinity. Na(+)/H(+) antiporters, channel proteins, and lipid transporters can also be the strong candidates for engineering plants for tolerance to salinity and low temperatures. PMID:27536305

  19. Key genes involved in desiccation tolerance and dormancy across life forms.

    Science.gov (United States)

    Costa, Maria Cecília D; Farrant, Jill M; Oliver, Melvin J; Ligterink, Wilco; Buitink, Julia; Hilhorst, Henk M W

    2016-10-01

    Desiccation tolerance (DT, the ability of certain organisms to survive severe dehydration) was a key trait in the evolution of life in terrestrial environments. Likely, the development of desiccation-tolerant life forms was accompanied by the acquisition of dormancy or a dormancy-like stage as a second powerful adaptation to cope with variations in the terrestrial environment. These naturally stress tolerant life forms may be a good source of genetic information to generate stress tolerant crops to face a future with predicted higher occurrence of drought. By mining for key genes and mechanisms related to DT and dormancy conserved across different species and life forms, unique candidate key genes may be identified. Here we identify several of these putative key genes, shared among multiple organisms, encoding for proteins involved in protection, growth and energy metabolism. Mutating a selection of these genes in the model plant Arabidopsis thaliana resulted in clear DT-, dormancy- and other seed-associated phenotypes, showing the efficiency and power of our approach and paves the way for the development of drought-stress tolerant crops. Our analysis supports a co-evolution of DT and dormancy by shared mechanisms that favour survival and adaptation to ever-changing environments with strong seasonal fluctuations. PMID:27593474

  20. Tolerancia al aluminio en especies vegetales: mecanismos y genes

    Directory of Open Access Journals (Sweden)

    Andrea Carreño

    2013-10-01

    Full Text Available Agricultural production in the Colombian Orinoco is affected by the high aluminum content found in 4.5 million hectares. Genotypes of different species have acquired different levels of tolerance and signaling pathways through various mechanisms, making a single model impossible. Some of the molecules commonly involved in the tolerance response have already been identified. To identify candidate genes to produce aluminum-tolerant cultivars, we consulted scientific articles published between 1987 and 2013. We obtained data of aluminum-tolerant materials and molecular mechanisms for tolerance through reports of techniques using hybridization, mutation, molecular marker-assisted selection and gene transfer. We found several reports on wholly or partially characterized genes with potential use in genetic engineering and in marker assisted selection to obtain aluminum tolerant genotypes.

  1. Overexpression of SOS (Salt Overly Sensitive)Genes Increases Salt Tolerance in Transgenic Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Qing Yang; Zhi-Zhong Chen; Xiao-Feng Zhoua; Hai-Bo Yin; Xia Li; Xiu-Fang Xin; Xu-Hui Hong; Jian-Kang Zhu; Zhizhong Gong

    2009-01-01

    Soil salinity is a major abiotic stress that decreases plant growth and productivity. Recently, it was reported that plants overexpressing AtNHX1 or SOS1 have significantly increased salt tolerance. To test whether overexpression of multiple genes can improve plant salt tolerance even more, we produced six different transgenic Arabidopsis plants that overexpress AtNHX1, SOS3, AtNHXl + SOS3, SOS1, SOS2 + SOS3, or SOS1 + SOS2 + SOS3. Northern blot analyses confirmed the presence of high levels of the relevant gene transcripts in transgenic plants. Transgenic Arabidopsis plants overexpressing AtNHX1 alone did not present any significant increase in salt tolerance, contrary to earlier reports. We found that transgenic plants overexpressing SOS3 exhibit increased salt tolerance similar to plants overexpressing SOS1. Moreover, salt tolerance of transgenic plants overexpressing AtNHXl + SOS3, 50S2 + SOS3, or SOS1 + SOS2 +SOS3, respectively, appeared similar to the tolerance of transgenic plants overexpressing either SOS1 or SOS3 alone.

  2. Tolerância de cultivares de arroz a diferentes níveis de alumínio em solução nutritiva Rice cultivars tolerance to different levels of aluminum in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1983-01-01

    relation to their tolerance to aluminum toxicity, at temperature of 25 ± 1°C and 30 ± 1°C using five different aluminum levels in 8.3 liter pots with 330 seedlings/pot, under controlled growth conditions. The tolerance was measured taking into account the root growth in an aluminum-free complete nutrient solution after a previous aluminum treatment. With an excessive amount of Al3+, the primary roots did not grow at all and remained thickened at the tip, showing a typical aluminum injury. In nutrient solutions at a temperature of 25 ± 1°C the rice cultivars IAC-899 and IR-841 were sensitive to the Al3+ concentration of 10mg/l of Al3+; IR-43, IR-45 and IR-8 were sensitive to 20mg/l and the cultivars IR-42 and CICA-4 were sensitive to 40mg/l; IAC-435, IAC-164, Pérola, Batatais, Pratão Precoce, Blue Bonnet, IAC-120, IAC-47, IAC-1246, IAC-25, IAC-165, Pratão, Dou-ado Precoce and CICA-8 showed tolerance to 40mg/l. In nutrient solutions at a temperature of 30 ± 1°C all cultivars presented tolerance to the Al3+ concentrations of 5, 10 and 20mg/l of Al+3. The cultivars Dourado Precoce, CICA-4, IR-42, IR-43, IR-45, IR-8, IAC-899, IR-665-4-5-5 and IR-841 were sensitive to 40mg/l of Al3+. Under the same conditions the following cultivars were considered tolerant to aluminum concentration of 40mg/l: IAC-47, Blue Bonnet, IAC-1246, IAC-164, Pratão, Pratão Precoce, CICA-8, IAC-435, IAC-120, IAC-25, IAC-165, Pérola and Batatais. The rice cultivars under study were ranked into classes of aluminum tolerance: tolerant: IAC-435, IAC-120, IAC-47, IAC-1246, IAC-25, IAC-165, IAC-164, Pérola, Batatais, Pratão Precoce, Blue Bonnet; moderately tolerant: Pratão, Dourado Precoce and CICA-8; and sensitive: CICA-4, IR-42, IR-43, IR-45, IR-8, IAC-899, IR-665-4-5-5 and IR-841.

  3. Developing transgenic maize (Zea mays L.) with insect resistance and glyphosate tolerance by fusion gene transformation

    Institute of Scientific and Technical Information of China (English)

    SUN He; LANG Zhi-hong; LU Wei; ZHANG Jie; HE Kang-lai; ZHU Li; LIN Min; HUANG Da-fang

    2015-01-01

    Using linker peptide LP4/2A for multiple gene transformation is considered to be an effective method to stack or pyramid several traits in plants. Bacil us thuringiensis (Bt) cry gene and epsps (5-enolpyruvylshikimate-3-phosphate synthase) gene are two important genes for culturing pest-resistant and glyphosate-tolerant crops. We used linker peptide LP4/2A to connect the Bt cry1Ah gene with the 2mG2-epsps gene and combined the wide-used manA gene as a selective marker to construct one coordinated expression vector cal ed p2EPUHLAGN. The expression vector was transferred into maize by Agrobacterium tumefaciens-mediated transformation, and 60 plants were obtained, 40%of which were positive transformants. Molecular detection demonstrated that the two genes in the fusion vector were expressed simultaneously and spliced correctly in translation processing;meanwhile bioassay detection proved the transgenic maize had preferable pest resistance and glyphosate tolerance. Therefore, linker peptide LP4/2A provided a simple and reliable strategy for producing gene stacking in maize and the result showed that the fusion gene transformation system of LP4/2A was feasible in monocot plants.

  4. Genetically engineered Rice with transcription factor DREB genes for abiotic stress tolerance(abstract)

    International Nuclear Information System (INIS)

    Water stress (drought and Salinity) is the most severe limitation to rice productivity. Several breeding approaches (MAS, QTL) applied to suitable genotypes are in place at IRRI and elsewhere. Phenotyping of water stress tolerance is in progress with potential predictability. Dr. Shinozaki's group has cloned a number of transcription factor genes, which have been shown to work in Arabidopsis to achieve drought, cold, and salinity tolerant plants. None of these genes have as yet displayed their potential functioning in rice. Genetic engineering aims at cross talk between different stress signaling pathways leading to stress tolerance. Osmotic Adjustment (OA) is an effective component of abiotic stress (drought and salinity) tolerance in many plants including rice. When plant experiences water stress, OA contributes to turgor maintenance of both shoots and roots. Conventional breeding could not achieve the OA in rice excepting a few rice cultivars, which are partially adapted to water-stress conditions. Several stress-related genes have now been cloned and transferred in to enhance the osmolytes and some transgenic lines showed increased tolerance to osmotic stress. A few strategies could be effectively deployed for a better understanding of water-stress tolerance in rice and to develop transgenic rice, which can survive for a critical period of water-stress conditions: 1) Switching on of transcription factor regulating the expression of several genes related to abiotic stress, 2) Use of a suitable stress inducible promoter driving the target gene for an efficient and directed expression in plants, 3) Understanding of phenotyping and GxE in a given environment, 4) Selection of a few adaptive rice cultivars suitable in drought/salinity prone areas, 5) Microarray, proteomics, QTL and MAS may expedite the cloning and characterizing the stress induced genes, and 6) Finally, the efficient transformation system for generating a large number of transgenic rice of different

  5. Towards a tolerance toolkit: Gene expression signatures enabling the emergence of resistant bacterial strains

    Science.gov (United States)

    Erickson, Keesha; Chatterjee, Anushree

    2014-03-01

    Microbial pathogens are able to rapidly acquire tolerance to chemical toxins. Developing next-generation antibiotics that impede the emergence of resistance will help avoid a world-wide health crisis. Conversely, the ability to induce rapid tolerance gains could lead to high-yielding strains for sustainable production of biofuels and commodity chemicals. Achieving these goals requires an understanding of the general mechanisms allowing microbes to become resistant to diverse toxins. We apply top-down and bottom-up methodologies to identify biological network changes leading to adaptation and tolerance. Using a top-down approach, we perform evolution experiments to isolate resistant strains, collect samples for transcriptomic and proteomic analysis, and use the omics data to inform mathematical gene regulatory models. Using a bottom-up approach, we build and test synthetic genetic devices that enable increased or decreased expression of selected genes. Unique patterns in gene expression are identified in cultures actively gaining resistance, especially in pathways known to be involved with stress response, efflux, and mutagenesis. Genes correlated with tolerance could potentially allow the design of resistance-free antibiotics or robust chemical production strains.

  6. Discovery and Characterization of Two Novel Salt-Tolerance Genes in Puccinellia tenuiflora

    Directory of Open Access Journals (Sweden)

    Ying Li

    2014-09-01

    Full Text Available Puccinellia tenuiflora is a monocotyledonous halophyte that is able to survive in extreme saline soil environments at an alkaline pH range of 9–10. In this study, we transformed full-length cDNAs of P. tenuiflora into Saccharomyces cerevisiae by using the full-length cDNA over-expressing gene-hunting system to identify novel salt-tolerance genes. In all, 32 yeast clones overexpressing P. tenuiflora cDNA were obtained by screening under NaCl stress conditions; of these, 31 clones showed stronger tolerance to NaCl and were amplified using polymerase chain reaction (PCR and sequenced. Four novel genes encoding proteins with unknown function were identified; these genes had no homology with genes from higher plants. Of the four isolated genes, two that encoded proteins with two transmembrane domains showed the strongest resistance to 1.3 M NaCl. RT-PCR and northern blot analysis of P. tenuiflora cultured cells confirmed the endogenous NaCl-induced expression of the two proteins. Both of the proteins conferred better tolerance in yeasts to high salt, alkaline and osmotic conditions, some heavy metals and H2O2 stress. Thus, we inferred that the two novel proteins might alleviate oxidative and other stresses in P. tenuiflora.

  7. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    Directory of Open Access Journals (Sweden)

    Bingfu eGuo

    2015-10-01

    Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

  8. Citrate-release-mediated aluminum resistance is coupled to the inducible expression of mitochondrial citrate synthase gene in Paraserianthes falcataria.

    Science.gov (United States)

    Osawa, Hiroki; Kojima, Katsumi

    2006-05-01

    Aluminum (Al) resistance in some leguminous plants is achieved by enhanced citrate release from roots. Enhancement requires several hours for complete activation and is postulated to involve Al-responsive genes or components. We examined the mechanism of Al-induced citrate release by studying the relationship between citrate release and expression of the mitochondrial citrate synthase (mCS) gene in three leguminous trees. Root elongation in Leucaena leucocephala (Lam.) de Wit was arrested within 24 h by 30 microM Al, whereas root elongation in Paraserianthes falcataria (L.) Neilson and Acacia mangium Willd. was inhibited mangium maintained enhanced release and accumulation of citrate for at least 28 days in response to Al treatment. Aluminum increased the accumulation of mCS transcripts in P. falcataria roots, but not in L. leucocephala roots, and thus up-regulation decreased following removal of Al. Lanthanum did not alter the expression level of mCS. Aluminum increased mCS activity concomitantly with enhanced mCS gene expression in P. falcataria, whereas it did not affect mCS activity in L. leucocephala. Aluminum content in root apices of P. falcataria was increased by cycloheximide, supporting the idea that de novo synthesis of proteins is a prerequisite for Al resistance. Our findings suggest that Al-inducible expression of mCS coupled with enhanced citrate release mediates Al resistance in P. falcataria. PMID:16452070

  9. Creation of the herbicide tolerant rice plants via T-DNA mediated gene targeting

    International Nuclear Information System (INIS)

    Precise modification of the plant genome is important both for the study of gene function in vivo and for producing publicly acceptable transgenic plants. Thus establishment of an efficient gene targeting (GT) system in plant is a significant goal. Here, we report a successful introduction of point mutations into an endogenous rice gene by T-DNA mediated GT. ALS is the primary target for at least four structurally distinct classes of herbicides. Recently, Shimizu et al. screened an ALS-inhibiting herbicide, bispyribac-sodium (BS) tolerant rice cells. BS tolerance was linked to two point mutations in ALS gene: a tryptophan (TGG) to leucine (TTG) change at amino acid 548 (W548L), and serine (AGT) to isoleucine (ATT) change at amino acide 627 (S627I). However, no plants could be recovered from the BS-tolerant rice cells due to prolonged tissue culture. Then we tried to produce BS tolerant rice plants containing these double mutations in ALS by T-DNA mediated GT. We obtained 70 GT plants from 1500 rice scutellum-derived calli infected with Agrobacterium horboring GT vector. GT rice homozygous for the modified ALS locus showed hyper tolerance to BS as compared to BS tolerant plants, which overexpressed W548L/S627I mutating ALS produced by a conventional transgenic system. This result indicates that exclusion of the BS sensitive wild-type ALS allele is important to confer high levels of BS tolerance. Not only selectable two point mutations, which confer BS tolerance but also non-selectable silent mutations on the targeting vector were incorporated into the GT plants. This result indicates that T-DNA mediated GT system is available for introduction of several point mutations to the target gene. Furthermore, point mutations on the targeting vector were incorporated into the genome with a mosaic manner in 3 plants out of 70 GT plants, suggesting the involvement of DNA mismatch repair system in the course of T-DNA mediated GT in these plants. (author)

  10. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    International Nuclear Information System (INIS)

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: → Evaluate Cd tolerance in wide sources of alfalfa accessions. → Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. → Cloned differentially expressed metallothionein (MT) genes. → Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. → MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  11. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xiaojuan, E-mail: xiaojuanwang@lzu.edu.cn [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Song, Yu [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Environment Management College of China, Qinhuangdao 066004 (China); Ma Yanhua [Hebei Normal University of Science and Technology, Qinhuangdao 066004 (China); Zhuo Renying [Key Lab of Tree Genomics, Research Institute of Subtropical of Forest, Chinese Academy of Forest, Fuyang 311400 (China); Jin Liang [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China)

    2011-12-15

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: > Evaluate Cd tolerance in wide sources of alfalfa accessions. > Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. > Cloned differentially expressed metallothionein (MT) genes. > Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. > MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  12. Expressing the sweet potato orange gene in transgenic potato improves drought tolerance and marketable tuber production.

    Science.gov (United States)

    Cho, Kwang-Soo; Han, Eun-Heui; Kwak, Sang-Soo; Cho, Ji-Hong; Im, Ju-Seong; Hong, Su-Young; Sohn, Hwang-Bae; Kim, Yun-Hee; Lee, Shin-Woo

    2016-01-01

    Potato (Solanum tuberosum L.) is generally considered to be sensitive to drought stress. Even short periods of water shortage can result in reduced tuber production and quality. We previously reported that transgenic potato plants expressing the sweet potato orange gene (IbOr) under the control of the stress-inducible SWPA2 promoter (referred to as SOR plants) showed increased tolerance to methyl viologen-mediated oxidative stress and high salinity, along with increased carotenoid contents. In this study, in an effort to improve the productivity and environmental stress tolerance of potato, we subjected transgenic potato plants expressing IbOr to water-deficient conditions in the greenhouse. The SOR plants exhibited increased tolerance to drought stress under greenhouse conditions. IbOr expression was associated with slightly negative phenotypes, including reduced tuber production. Controlling IbOr expression imparted the same degree of drought tolerance while ameliorating these negative phenotypic effects, leading to levels of tuber production similar to or better than those of wild-type plants under drought stress conditions. In particular, under drought stress, drought tolerance and the production of marketable tubers (over 80g) were improved in transgenic plants compared with non-transgenic plants. These results suggest that expressing the IbOr transgene can lead to significant gains in drought tolerance and tuber production in potato, thereby improving these agronomically important traits. PMID:27212605

  13. Identification of Molecular Marker Linked to Salt Tolerance Gene in Alfalfa

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The study has established the F2 offspring obtained by crossing salt-tolerant with salt-sensitive alfalfa, and appraised the salt-tolerant F2 offspring seedling was evaluated in pot culture. With the F2 segregated population, the research has obtained a molecular marker linked with salt-tolerant genes of alfalfa using the improved BSA combined with RAPD. The RAPD PCR products were excised from the agarose gel and purified using a kit, then were mixed with pMD-18T vector and sequenced. Sequencing result indicated the RAPD marker was 1 438 bp in length. Similarity researches using blast in Genbank indicated that the nucleotide sequence of the RAPD marker showed 93% and 91% similarity with mth2-6el8 gene fragment (347 bp) and mth2-33122 gene fragment (334 bp) of Medicago truncatula respectively. Medicago truncatula is a close relative of alfalfa and Mth2-6e18 is a molecular marker of the gene coding for a cysteine protease which was salt inducible in some plants. These results indicated the RAPD marker was possibly related to cysteine protease genes in alfalfa.

  14. Engineering Clostridium beijerinckii with the Cbei_4693 gene knockout for enhanced ferulic acid tolerance.

    Science.gov (United States)

    Liu, Jun; Guo, Ting; Shen, Xiaoning; Xu, Jiahui; Wang, Junzhi; Wang, Yanyan; Liu, Dong; Niu, Huanqing; Liang, Lei; Ying, Hanjie

    2016-07-10

    A mutant strain of Clostridium beijerinckii NCIMB 8052, C. beijerinckii M11, which exhibited ferulic acid tolerance up to 0.9g/L, was generated using atmospheric pressure glow discharge and high-throughput screening. Comparative genomic analysis revealed that this strain harbored a mutation of the Cbei_4693 gene, which encodes a hypothetical protein suspected to be an NADPH-dependent FMN reductase. After disrupting the Cbei_4693 gene in C. beijerinckii NCIMB 8052 using the ClosTron group II intron-based gene inactivation system, we obtained the Cbei_4693 gene inactivated mutant strain, C. beijerinckii 4693::int. Compared with C. beijerinckii NCIMB 8052, 6.23g/L of butanol was produced in P2 medium containing 0.5g/L of ferulic acid by 4693::int, and the ferulic acid tolerance was also significantly increased up to 0.8g/L. These data showed, for the first time, that the Cbei_4693 gene plays an important role in regulating ferulic acid tolerance in ABE fermentation by C. beijerinckii. PMID:27164255

  15. Tolerância de cultivares de trigo a diferentes níveis de alumínio em solução nutritiva e no solo Tolerance op wheat cultivars to different levels of aluminum toxicity

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1981-01-01

    Full Text Available Foram estudados dez cultivares de trigo em soluções nutritivas contendo cinco diferentes níveis de alumínio tóxico. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após um período prévio de 48 horas em solução contendo uma concentração conhecida de alumínio. Os cultivares Siete Cerros e Tobari-66 foram sensíveis, respectivamente, a 1 e 3 ppm de alumínio. 'Alondra-S-46', 'Alondra-S-45' e 'IAC-17' foram sensíveis a 6 ppm; 'BH-1146', 'IAC-5', 'IAC-18', 'IAC-13' e 'Londrina' foram tolerantes a 10 ppm, porém 'BH-1146', 'IAC-18' e 'IAC-13' foram mais tolerantes que 'IAC-5' e 'Londrina'. Os cultivares BH-1146, IAC-17, Alondra-S-46, Tobari-66 e Siete Cerros foram cultivados em vasos contendo solo ácido mostrando a presença de alumínio. Metade do número de vasos recebeu uma aplicação de calcário. Os resultados desse experimento mostraram que o cultivar BH-1146 diferiu significativamente em produção de grãos por planta de 'Tobari-66', 'Alondra-S-46', 'IAC-17' e 'Siete Cerros'. Esse resultado confirmou a tolerância ao alumínio do cultivar BH-1146, observada quando se empregou solução nutritiva com a presença desse elemento.Ten wheat cultivars were studied to aluminum toxicity using five different levels of this element. The tolerance was measured taking into account the root growth in a aluminum-free complete nutrient solution after a previous Al treatment. With toxic amounts of Al, the primary roots did not grow at all and remained thickned at the tip as a typical Al injury. The wheat cultivars Siete Cerros and Tobari-66 were sensitive to 1 and 3 ppm of aluminum, respectively. The cultivars Alondra-S-46, Alondra-S-45 and IAC-17 were sensitive to 6 ppm. The cultivars BH-1146, IAC-5, IAC-18, IAC-13 and Londrina showed tolerance to 10 ppm but BH-1146, IAC-18 and IAC-13 were more tolerant than IAC-5 and Londrina. The cultivars BH-1146, IAC-17, Alondra-S-46

  16. Micro-evolution of toxicant tolerance: from single genes to the genome's tangled bank.

    Science.gov (United States)

    van Straalen, Nico M; Janssens, Thierry K S; Roelofs, Dick

    2011-05-01

    Two case-studies published 55 years ago became textbook examples of evolution in action: DDT resistance in houseflies (Busvine) and the rise of melanic forms of the peppered moth (Kettlewell). Now, many years later, molecular studies have elucidated in detail the mechanisms conferring resistance. In this paper we focus on the case of metal tolerance in a soil-living arthropod, Orchesella cincta, and provide new evidence on the transcriptional regulation of a gene involved in stress tolerance, metallothionein. Evolution of resistance is often ascribed to cis-regulatory change of such stress-combatting genes. For example, DDT resistance in the housefly is due to insertion of a mobile element into the promoter of Cyp6g1, and overexpression of this gene allows rapid metabolism of DDT. The discovery of these mechanisms has promoted the idea that resistance to environmental toxicants can be brought about by relatively simple genetic changes, involving up-regulation, duplication or structural alteration of a single-gene. Similarly, the work on O. cincta shows that populations from metal-polluted mining sites have a higher constitutive expression of the cadmium-induced metallothionein (Mt) gene. Moreover, its promoter appears to include a large degree of polymorphism; Mt promoter alleles conferring high expression in cell-based bioreporter assays were shown to occur at higher frequency in populations living at polluted sites. The case is consistent with classical examples of micro-evolution through altered cis-regulation of a key gene. However, new data on qPCR analysis of gene expression in homozygous genotypes with both reference and metal-tolerant genetic backgrounds, show that Mt expression of the same pMt homozygotes depends on the origin of the population. This suggests that trans-acting factors are also important in the regulation of Mt expression and its evolution. So the idea that metal tolerance in Orchesella can be viewed as a single-gene adaptation must be

  17. Overexpression of wheat ubiquitin gene, Ta-Ub2, improves abiotic stress tolerance of Brachypodium distachyon.

    Science.gov (United States)

    Kang, Hanhan; Zhang, Meng; Zhou, Shumei; Guo, Qifang; Chen, Fengjuan; Wu, Jiajie; Wang, Wei

    2016-07-01

    Ubiquitination plays an important role in regulating plant's development and adaptability to abiotic stress. To investigate the possible functions of a wheat monoubiquitin gene Ta-Ub2 in abiotic stress in monocot and compare it with that in dicot, we generated transgenic Brachypodium plants overexpressing Ta-Ub2 under the control of CaMV35s and stress-inducible RD29A promoters. The constitutive expression of Ta-Ub2 displayed slight growth inhibition in the growth of transgenic Brachypodium distachyon under the control conditions. However, this inhibition was minimized by expression of Ta-Ub2 under the control of stress-inducible RD29A promoter. Compared with WT, the transgenic plants preserved more water and showed higher enzymatic antioxidants under drought stress, which might be related to the change in the expression of some antioxidant genes. The expression of C-repeat binding factors transcription factor genes in the transgenic B. distachyon lines were upregulated under water stress. Salt and cold tolerances of transgenic B. distachyon were also improved. Although the phenotypic changes in the transgenic plants were different, overexpression of Ta-Ub2 improved the abiotic stress tolerance in both dicot and monocot plants. The improvement in Ta-Ub2 transgenic plants in abiotic stress tolerance might be, at least partly, through regulating the gene expression and increasing the enzymatic antioxidants. PMID:27181952

  18. Neonatal Systemic AAV Induces Tolerance to CNS Gene Therapy in MPS I Dogs and Nonhuman Primates.

    Science.gov (United States)

    Hinderer, Christian; Bell, Peter; Louboutin, Jean-Pierre; Zhu, Yanqing; Yu, Hongwei; Lin, Gloria; Choa, Ruth; Gurda, Brittney L; Bagel, Jessica; O'Donnell, Patricia; Sikora, Tracey; Ruane, Therese; Wang, Ping; Tarantal, Alice F; Casal, Margret L; Haskins, Mark E; Wilson, James M

    2015-08-01

    The potential host immune response to a nonself protein poses a fundamental challenge for gene therapies targeting recessive diseases. We demonstrate in both dogs and nonhuman primates that liver-directed gene transfer using an adeno-associated virus (AAV) vector in neonates induces a persistent state of immunological tolerance to the transgene product, substantially improving the efficacy of subsequent vector administration targeting the central nervous system (CNS). We applied this approach to a canine model of mucopolysaccharidosis type I (MPS I), a progressive neuropathic lysosomal storage disease caused by deficient activity of the enzyme α-l-iduronidase (IDUA). MPS I dogs treated systemically in the first week of life with a vector expressing canine IDUA did not develop antibodies against the enzyme and exhibited robust expression in the CNS upon intrathecal AAV delivery at 1 month of age, resulting in complete correction of brain storage lesions. Newborn rhesus monkeys treated systemically with AAV vector expressing human IDUA developed tolerance to the transgene, resulting in high cerebrospinal fluid (CSF) IDUA expression and no antibody induction after subsequent CNS gene therapy. These findings suggest that inducing tolerance to the transgene product during a critical period in immunological development can improve the efficacy and safety of gene therapy. PMID:26022732

  19. Functional genomics of maize submergence tolerance and cloning of the related gene Sicyp51

    Institute of Scientific and Technical Information of China (English)

    TANG; Wanhu; ZHANG; Zuxin; ZOU; Xiling; ZHENG; Yonglian

    2005-01-01

    In this study, SSH (Suppression Subtractive Hybridization) and cDNA microarray were used to identify genes associated with waterlogging response of maize roots. Mo17 and Hz32 are two maize inbred lines with differential tolerance to hypoxia. Seedlings of the inbred lines with two leaves were submerged in hypoxia buffer. SSH libraries were constructed with cDNA samples from roots. Both forward and reverse subtractions were performed for each inbred line, and 105 positive clones induced by hypoxia were selected by differential screening. The treated and control message RNA were hybridized with the cDNA microarray of Mo17, sequentially, 57 of 3-fold differentially expressed clones were obtained. A total of 162 positive clones were all sequenced. Bioinformatics analysis showed these positive clones represent 85 TUGs, including genes involved in several biochemistry pathways, such as glycolysis, protection, signal transduction, cell construction and energy metabolism and 41 EST with unknown function. Comparison between Mo17 and Hz32 indicates that genes related to hypoxia tolerance have different expression patterns in submerged roots. Several positive clones' expression patterns were revealed by Northern or RT-PCR, and a new gene (Sicyp51), which may contribute to hypoxia tolerance, was identified.

  20. Overexpression of phospholipase Dα gene enhances drought and salt tolerance of Populus tomentosa

    Institute of Scientific and Technical Information of China (English)

    ZHANG TingTing; SONG YunZhi; LIU YuDong; GUO XingQi; ZHU ChangXiang; WEN FuJiang

    2008-01-01

    The cDNA of AtPLDα (Arabidopsis thaliana Phospholipase Da) gene was introduced into P. tomentosa (Populus tomentosa) under the control of the Cauliflower mosaic virus 35S promoter. Southern and Northern blot analyses suggested that the AtPLDα gene has been transferred into the P. tomentosa genome. No obvious morphological or developmental difference was observed between the transgenic and wild-type (WT) plants. Drought and salt tolerance and gene expression of seedlings of several transgenic lines and WT plants (control) were studied. The results showed that the rhizogenesis rate and the average root-length of transgenic lines were significantly higher than WT plants after mannitol and NaCl treatment under the same growth conditions. Northern blot analysis indicated that the higher the PLDα expression in the transgenic plants, the more tolerant the transgenic plants are to drought and salt treatment. Meanwhile, another group of these transgenic lines and WT plants (control) were treated with PEG6000 and NaCI separately. The contents of chlorophylls and the activities of some antioxidant enzymes (superoxide dismutase, guaiacol peroxidase and catalase) as well as malondialdehyde and relative electrical conductivity were analyzed. Altogether, our results demonstrated that overexpression of the PLDα gene can enhance the drought and salt tolerance in transgenic P. tomentosa plants.

  1. Phytohormones enabled endophytic fungal symbiosis improve aluminum phytoextraction in tolerant Solanum lycopersicum: An examples of Penicillium janthinellum LK5 and comparison with exogenous GA3.

    Science.gov (United States)

    Khan, Abdul Latif; Waqas, Muhammad; Hussain, Javid; Al-Harrasi, Ahmed; Hamayun, Muhammad; Lee, In-Jung

    2015-09-15

    This work investigates the potentials of fungal-endophyte Penicillium janthinellum LK5 (PjLK5) and its inherent gibberellic acid (GA3) as reference to enhance aluminum (Al) induced toxicity in tolerant tomato (Solanum lycopersicum) plants. Initial screening showed significantly higher uptake of Al by PjLK5. Aluminum stress (100 μM) significantly retarted plant growth in control plants. Conversely PjLK5 and GA3 application significantly increased morphological attributes of Al-tolerant tomato plants with or without Al-stress. PjLK5 inoculation with and without Al-stress maintained the plant growth whilst extracting and translocating higher Al in shoot (∼ 1 92 mg/kg) and root (∼ 296 mg/kg). This was almost similar in GA3 treatments as well. In addition, PjLK5 inoculation extended protective effects to tomato plants by maintaining reduced cellular superoxide anions in Al stress. Al-induced oxidative stress was further reduced due to significantly higher activity of metal-responsive reduced glutathione. The functional membrane was less damaged in PjLK5 and GA3 treatments because the plants synthesized reduced levels of malondialdhyde, lenolenic and linoleic acids. Defense-related endogenous phytohormone salicylic acid was significantly up-regulated to counteract the adverse effects of Al-stress. In conclusion, the PjLK5 possess a similar bio-prospective potential as of GA3. Application of such biochemically active endophyte could increase metal phytoextraction whilst maintaining crop physiological homeostasis. PMID:25885165

  2. Tolerância de genótipos de cereais de inverno ao alumínio em cultivo hidropônico e em campo Tolerance of small graine cereal genotypes to aluminum on hydroponic and field cultivation

    Directory of Open Access Journals (Sweden)

    Roberto Portaluppi

    2010-02-01

    Full Text Available O objetivo deste trabalho foi determinar a capacidade de crescimento radicular de 75 genótipos de cereais de inverno em cultivo hidropônico, em diferentes concentrações de alumínio, avaliar a relação entre o grau de tolerância/sensibilidade, em solução hidropônica, e a resistência/suscetibilidade ao crestamento em campo. Os cereais cevada, triticale, centeio, trigo e Aegilops tauschii foram avaliados em hidroponia, com concentrações de Al3+ que variaram entre 0,5 (cevada, 2 e 6 (triticale, 6 e 10 (centeio e 2 mg L-1 (trigo e Ae. tauschii. Os delineamentos experimentais foram inteiramente casualizados. Em campo, foram avaliados os mesmos genótipos, exceto Ae. tauschii, em solo com pH 4,4 e 4,85, corrigido a 1/2 e 1/4 do índice SMP. Utilizou-se uma escala de notas com variação de escores de 0,5 (altamente resistente a 5 (altamente suscetível. Foi observada elevada relação entre a tolerância ao alumínio em hidroponia e a resistência ao crestamento em campo. A seleção de cereais em meio hidropônico pode ser considerada eficiente como ferramenta de apoio aos programas de melhoramento genético para essa característica.The objective of this work was to determine the root growth capacity of 75 genotypes of small graine cereals in hydroponic culture under different aluminum concentrations, and to assess the relationship betwen the level of tolerance/sensitivity in hydroponic solution and the resistance/susceptibility index in the field. Barley, triticale, rye, wheat and Aegilops tauschii were evaluated in hydroponics, with Al3+ concentrations that varied between 0.5 (barley, 2 and 6 (triticale, 6 and 10 (rye and 2 mg L-1 (wheat and Ae. tauschii. The experiments' designs were completely randomized. In the field trial, the same genotypes were assessed, except for Ae. tauschii, in soil with pH 4.4 and 4.85 adjusted to 1/2 and 1/4 of the SMP index. A score scale ranging from 0.5 (highly resistant to 5 (highly susceptible was used

  3. Identification of Quantitative Trait Loci (QTL) and Candidate Genes for Cadmium Tolerance in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Gancho [West Virginia University; Yin, Tongming [ORNL; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Stephen P [West Virginia University

    2012-01-01

    Knowledge of genetic variation in response of Populus to heavy metals like cadmium (Cd) is an important step in understanding the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa and Populus deltoides was characterized for Cd exposure. The pedigree showed significant variation for Cd tolerance thus enabling the identification of relatively tolerant and susceptible genotypes for intensive characterization. A total of 16 QTLs at logarithm of odds (LOD) ratio > 2.5, were found to be associated with total dry weight, its components, and root volume. Four major QTLs for total dry weight were mapped to different linkage groups in control (LG III) and Cd conditions (LG XVI) and had opposite allelic effects on Cd tolerance, suggesting that these genomic regions were differentially controlled. The phenotypic variation explained by Cd QTL for all traits under study varied from 5.9% to 11.6% and averaged 8.2% across all QTL. Leaf Cd contents also showed significant variation suggesting the phytoextraction potential of Populus genotypes, though heritability of this trait was low (0.22). A whole-genome microarray study was conducted by using two genotypes with extreme responses for Cd tolerance in the above study and differentially expressed genes were identified. Candidate genes including CAD2 (CADMIUM SENSITIVE 2), HMA5 (HEAVY METAL ATPase5), ATGTST1 (Arabidopsis thaliana Glutathione S-Transferase1), ATGPX6 (Glutathione peroxidase 6), and ATMRP 14 (Arabidopsis thaliana Multidrug Resistance associated Protein 14) were identified from QTL intervals and microarray study. Functional characterization of these candidate genes could enhance phytoremediation capabilities of Populus.

  4. 40 CFR 180.1091 - Aluminum isopropoxide and aluminum secondary butoxide; exemption from the requirement of a...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Aluminum isopropoxide and aluminum... PESTICIDE CHEMICAL RESIDUES IN FOOD Exemptions From Tolerances § 180.1091 Aluminum isopropoxide and aluminum secondary butoxide; exemption from the requirement of a tolerance. Aluminum isopropoxide (CAS Reg. No....

  5. Expression of genes related to tolerance to low temperature for maize seed germination.

    Science.gov (United States)

    Silva-Neta, I C; Pinho, E V; Veiga, A D; Pìnho, R G; Guimarães, R M; Caixeta, F; Santos, H O; Marques, T L

    2015-01-01

    The aim of this study was to characterize maize lines tolerant to cold temperatures during the germination process. Seeds from lines with different levels of tolerance to low temperatures were used; 3 lines were classified as tolerant and 3 as susceptible to low germination temperatures. A field was set up to multiply seeds from selected lines. After the seeds were harvested and classified, we conducted physiological tests and analyzed fatty acid content of palmitic, stearic, oleic, linoleic, linolenic, and eicosenoic acids. In proteomic analysis, the expression of heat-resistant proteins, including catalase, peroxidase, esterase, superoxide dismutase, and α-amylase, were evaluated. Transcript analysis was used to measure the expression of the genes AOX1, AOX2, ZmMPK-17, and ZmAN-13. The material showing the highest susceptibility to low germination temperatures contained high saturated fatty acid content. Expression of α-amylase in seeds soaked for 72 h at a temperature of 10°C was lower than expression of α-amylase when soaked at 25°C for the same amount of time. We observed variation in the expression of heat-resistant proteins in seeds of the lines evaluated. The genes AOX and Zm-AN13 were promising for use in identifying maize materials that are tolerant to low germination temperatures. PMID:25867416

  6. A novel gene OsAHL1 improves both drought avoidance and drought tolerance in rice.

    Science.gov (United States)

    Zhou, Liguo; Liu, Zaochang; Liu, Yunhua; Kong, Deyan; Li, Tianfei; Yu, Shunwu; Mei, Hanwei; Xu, Xiaoyan; Liu, Hongyan; Chen, Liang; Luo, Lijun

    2016-01-01

    A novel gene, OsAHL1, containing an AT-hook motif and a PPC domain was identified through genome-wide profiling and analysis of mRNAs by comparing the microarray of drought-challenged versus normally watered rice. The results indicated OsAHL1 has both drought avoidance and drought tolerance that could greatly improve drought resistance of the rice plant. Overexpression of OsAHL1 enhanced multiple stress tolerances in rice plants during both seedling and panicle development stages. Functional studies revealed that OsAHL1 regulates root development under drought condition to enhance drought avoidance, participates in oxidative stress response and also regulates the content of chlorophyll in rice leaves. OsAHL1 specifically binds to the A/T rich sequence region of promoters or introns, and hence directly regulates the expression of many stress related downstream genes. PMID:27453463

  7. Characterization of gene expression associated with drought avoidance and tolerance traits in a perennial grass species.

    Directory of Open Access Journals (Sweden)

    Peng Zhou

    Full Text Available To understand molecular mechanisms of perennial grass adaptation to drought stress, genes associated with drought avoidance or tolerance traits were identified and their expression patterns were characterized in C4 hybrid bermudagrass [Cynodon dactylon (L. Pers.×C. transvaalensis Burtt Davy, cv. Tifway] and common bermudagrass (C. dactylon, cv. C299. Plants of drought-tolerant 'Tifway' and drought-sensitive 'C299' were exposed to drought for 5 d (mild stress and 10 d (severe stress by withholding irrigation in a growth chamber. 'Tifway' maintained significantly lower electrolyte leakage and higher relative water content than 'C299' at both 5 and 10 d of drought stress. Four cDNA libraries via suppression subtractive hybridization analysis were constructed and identified 277 drought-responsive genes in the two genotypes at 5 and 10 d of drought stress, which were mainly classified into the functional categories of stress defense, metabolism, osmoregulation, membrane system, signal and regulator, structural protein, protein synthesis and degradation, and energy metabolism. Quantitative-PCR analysis confirmed the expression of 36 drought up-regulated genes that were more highly expressed in drought-tolerant 'Tifway' than drought-sensitive 'C299', including those for drought avoidance traits, such as cuticle wax formation (CER1 and sterol desaturase, for drought tolerance traits, such as dehydration-protective proteins (dehydrins, HVA-22-like protein and oxidative stress defense (superoxide dismutase, dehydroascorbate reductase, 2-Cys peroxiredoxins, and for stress signaling (EREBP-4 like protein and WRKY transcription factor. The results suggest that the expression of genes for stress signaling, cuticle wax accumulation, antioxidant defense, and dehydration-protective protein accumulation could be critically important for warm-season perennial grass adaptation to long-term drought stress.

  8. Abiotic and biotic stress tolerance in Arabidopsis overexpressing the multiprotein bridging factor 1a (MBF1a) transcriptional coactivator gene.

    Science.gov (United States)

    Kim, Min-Jung; Lim, Gah-Hyun; Kim, Eun-Seon; Ko, Chang-Beom; Yang, Kwang-Yeol; Jeong, Jin-An; Lee, Myung-Chul; Kim, Cheol Soo

    2007-03-01

    We conducted a genetic yeast screen to identify salt tolerance (SAT) genes in a maize kernel cDNA library. During the screening, we identified a maize clone (SAT41) that seemed to confer elevated salt tolerance in comparison to control cells. SAT41 cDNA encodes a 16-kDa protein which is 82.4% identical to the Arabidopsis Multiprotein bridging factor 1a (MBF1a) transcriptional coactivator gene. To further examine salinity tolerance in Arabidopsis, we functionally characterized the MBF1a gene and found that dehydration as well as heightened glucose (Glc) induced MBF1a expression. Constitutive expression of MBF1a in Arabidopsis led to elevated salt tolerance in transgenic lines. Interestingly, plants overexpressing MBF1a exhibited insensitivity to Glc and resistance to fungal disease. Our results suggest that MBF1a is involved in stress tolerance as well as in ethylene and Glc signaling in Arabidopsis. PMID:17234157

  9. De novo transcriptome characterization and gene expression profiling of the desiccation tolerant moss Bryum argenteum following rehydration

    OpenAIRE

    Gao, Bei; Zhang, Daoyuan; Li, Xiaoshuang; Yang, Honglan; Zhang, Yuanming; Wood, Andrew J.

    2015-01-01

    Background The desiccation-tolerant moss Bryum argenteum is an important component of the Biological Soil Crusts (BSCs) found in the Gurbantunggut desert. Desiccation tolerance is defined as the ability to revive from the air dried state. To elucidate the molecular mechanisms related to desiccation tolerance, we employed RNA-Seq and digital gene expression (DGE) technologies to study the genome-wide expression profiles of the dehydration and rehydration processes in this important desert plan...

  10. Stress Responsive Zinc-finger Protein Gene of Populus euphratica in Tobacco Enhances Salt Tolerance

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The Populus euphratica stress responsive zinc-finger protein gene PSTZ, which encodes a protein including typical Cys2/His2 zinc finger structure, was isolated by reverse transcription-polymerase chain reaction from P. euphratica.Northern hybridization revealed that its expression was induced under drought and salt stress conditions. To examine its function, cDNA of the PSTZ gene, driven by the cauliflower mosaic virus 35S promoter, was cloned into a plant expression vector pBin438 and introduced into tobacco plants. Transgenic tobacco showed an enhanced salt tolerance, suggesting that PSTZ may play a role in plant responsiveness to salt stress.

  11. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress.

    Science.gov (United States)

    Deshnium, P; Los, D A; Hayashi, H; Mustardy, L; Murata, N

    1995-12-01

    Choline oxidase, isolated from the soil bacterium Arthrobacter globiformis, converts choline to glycinebetaine (N-trimethylglycine) without a requirement for any cofactors. The gene for this enzyme, designated codA, was cloned and introduced into the cyanobacterium Synechococcus sp. PCC 7942. The codA gene was expressed under the control of a strong constitutive promoter, and the transformed cells accumulated glycinebetaine at intracellular levels of 60-80 mM. Consequently the cells acquired tolerance to salt stress, as evaluated in terms of growth, accumulation of chlorophyll and photosynthetic activity. PMID:8555454

  12. OsDREB1 Gene from Rice Enhances Cold Tolerance in Tobacco

    Institute of Scientific and Technical Information of China (English)

    LI Ping; CHEN Feng; QUAN Chao; ZHANG Guiyou

    2005-01-01

    The OsDREB1 gene from rice encodes a transcription factor belonging to the DREBP transcription factor subfamily. Many DREBP transcription factors regulate gene expression in response to drought, high-salt, and cold stresses by binding specifically to the dehydration-responsive element (DRE). DRE-binding proteins, such as CBF1, DREB1A, and DREB2A, have been cloned from Arabidopsis thaliana and have been proved to play an important role in stress response of Arabidopsis and several other plants. In this study, the OsDREB1 gene was transferred to tobacco plants by the Agrobacterium-mediated transfer method, and 16 transgenic plants were identified. PCR analysis demonstrates that the foreign genes have been integrated into the tobacco genome. Results of freezing stress experiments indicate that the transgenic plants have enhanced cold tolerance.

  13. Experimental evolution and gene knockout studies reveal AcrA-mediated isobutanol tolerance in Ralstonia eutropha.

    Science.gov (United States)

    Bernardi, Amanda C; Gai, Claudia S; Lu, Jingnan; Sinskey, Anthony J; Brigham, Christopher J

    2016-07-01

    Isobutanol (IBT) has attracted much attention from researchers as a next generation drop-in biofuel. Ralstonia eutropha is a gram-negative bacterium which naturally produces polyhydroxybutyrate (PHB), and has been reported to produce IBT after metabolic engineering. Similar to other microbes, R. eutropha experiences toxicity from branched-chain alcohols and is unable to grow in the presence of IBT concentrations higher than 0.5% (v v(-1)). Such low tolerance greatly limits the ability of R. eutropha to grow and produce IBT. In order to study toxicity to the cells, IBT-tolerant strains were developed by experimental evolution, revealing that two genes, previously described as being related to IBT tolerance in Escherichia coli (acrA and acrA6), also presented mutations in R. eutropha evolved strains. The effect on the physiology of the cells of in-frame deletions of each of these genes was assessed in wild type and engineered IBT-producing strains in an attempt to reproduce a tolerant phenotype. The mutant strains' ability to tolerate, consume, and produce IBT were also analyzed. Although deletions of acrA6 and acrA did not significantly improve R. eutropha growth in the presence of IBT, these deletions improved cell survival in the presence of high concentrations of IBT in the extracellular milieu. Moreover, an in-frame acrA deletion in an engineered IBT-producing R. eutropha enhanced the strain's ability to produce IBT, which could potentially be associated with enhanced survival at high IBT concentrations. PMID:26811221

  14. Mechanisms of Salt Tolerance in Transgenic Arabidopsis thaliana Carrying a Peroxisomal Ascorbate Peroxidase Gene from Barley

    Institute of Scientific and Technical Information of China (English)

    XU Wei-Feng; SHI Wei-Ming; A. UEDA; T. TAKABE

    2008-01-01

    Ascorbate peroxidases (APX), localized in the cytosol, peroxisome, mitochondria, and chloroplasts of plant cells,catalyze the reduction of H2O2 to water by using ascorbic acid as the specific electron donor. To determine the role of peroxisomal type ascorbate peroxidasc (pAPX), an antioxidant enzyme, in protection against salt-induced oxidative stress, transgenic Arabidopsis thaliana plant carrying a pAPX gene (HvAPX1) from barley (Hordeum vulgare L.) was analyzed. The transgenic line pAPX3 was found to be more tolerant to salt stress than the wild type. Irrespective of salt stress, there were no significant differences in Na+, K+, Ca2+, and Mg2+ contents and the ratio of K+ to Na+ between pAPX3 and the wild type. Clearly, the salt tolerance in pAPX3 was not due to the maintenance and reestablishment of cellular ion homeostasis. However, the degree of H2O2 and lipid peroxidation (measured as the levels of malondialdehyde)accumulation under salt stress was higher in the wild type than in pAPX3. The mechanism of salt tolerance in transgenic pAPX3 can thus be explained by reduction of oxidative stress injury. Under all conditions tested, activities of superoxide,glutathionc reductase, and catalase were not significantly different between pAPX3 and the wild type. In contrast, the activity of APX was significantly higher in the transgcnic plant than in wild type under salt stress. These results suggested that in higher plants, HvAPX1 played an important role in salt tolerance and was a candidate gene for developing salt-tolerant crop plants.

  15. Effects of short-term acid and aluminum exposure on the parr-smolt transformation in Atlantic salmon (Salmo salar): Disruption of seawater tolerance and endocrine status

    Science.gov (United States)

    Monette, M.Y.; Bjornsson, Bjorn Thrandur; McCormick, S.D.

    2008-01-01

    Episodic acidification resulting in increased acidity and inorganic aluminum (Ali) is known to interfere with the parr-smolt transformation of Atlantic salmon (Salmo salar), and has been implicated as a possible cause of population decline. To determine the extent and mechanism(s) by which short-term acid/Al exposure compromises smolt development, Atlantic salmon smolts were exposed to either control (pH 6.7-6.9) or acid/Al (pH 5.4-6.3, 28-64 ??g l-1 Ali) conditions for 2 and 5 days, and impacts on freshwater (FW) ion regulation, seawater (SW) tolerance, plasma hormone levels and stress response were examined. Gill Al concentrations were elevated in all smolts exposed to acid/Al relative to controls confirming exposure to increased Ali. There was no effect of acid/Al on plasma ion concentrations in FW however, smolts exposed to acid/Al followed by a 24 h SW challenge exhibited greater plasma Cl- levels than controls, indicating reduced SW tolerance. Loss of SW tolerance was accompanied by reductions in gill Na+,K+-ATPase (NKA) activity and Na+,K+,2Cl- (NKCC) cotransporter protein abundance. Acid/Al exposure resulted in decreased plasma insulin-like growth factor (IGF-I) and 3,3???,5???-triiodo-l-thyronine (T3) levels, whereas no effect of treatment was seen on plasma cortisol, growth hormone (GH), or thyroxine (T4) levels. Acid/Al exposure resulted in increased hematocrit and plasma glucose levels in FW, but both returned to control levels after 24 h in SW. The results indicate that smolt development and SW tolerance are compromised by short-term exposure to acid/Al in the absence of detectable impacts on FW ion regulation. Loss of SW tolerance during short-term acid/Al exposure likely results from reductions in gill NKA and NKCC, possibly mediated by decreases in plasma IGF-I and T3. ?? 2008 Elsevier Inc.

  16. Tracking the evolution of a cold stress associated gene family in cold tolerant grasses

    Directory of Open Access Journals (Sweden)

    Asp Torben

    2008-09-01

    Full Text Available Abstract Background Grasses are adapted to a wide range of climatic conditions. Species of the subfamily Pooideae, which includes wheat, barley and important forage grasses, have evolved extreme frost tolerance. A class of ice binding proteins that inhibit ice re-crystallisation, specific to the Pooideae subfamily lineage, have been identified in perennial ryegrass and wheat, and these proteins are thought to have evolved from a leucine-rich repeat phytosulfokine receptor kinase (LRR-PSR-like ancestor gene. Even though the ice re-crystallisation inhibition function of these proteins has been studied extensively in vitro, little is known about the evolution of these genes on the molecular level. Results We identified 15 putative novel ice re-crystallisation inhibition (IRI-like protein coding genes in perennial ryegrass, barley, and wheat. Using synonymous divergence estimates we reconstructed the evolution of the IRI-like gene family. We also explored the hypothesis that the IRI-domain has evolved through repeated motif expansion and investigated the evolutionary relationship between a LRR-domain containing IRI coding gene in carrot and the Pooideae IRI-like genes. Our analysis showed that the main expansion of the IRI-gene family happened ~36 million years ago (Mya. In addition to IRI-like paralogs, wheat contained several sequences that likely were products of polyploidisation events (homoeologs. Through sequence analysis we identified two short motifs in the rice LRR-PSR gene highly similar to the repeat motifs of the IRI-domain in cold tolerant grasses. Finally we show that the LRR-domain of carrot and grass IRI proteins both share homology to an Arabidopsis thaliana LRR-trans membrane protein kinase (LRR-TPK. Conclusion The diverse IRI-like genes identified in this study tell a tale of a complex evolutionary history including birth of an ice binding domain, a burst of gene duplication events after cold tolerant grasses radiated from rice

  17. Gene expression programs during Brassica oleracea seed maturation, osmopriming and germination process and the stress tolerance level

    NARCIS (Netherlands)

    Soeda, Y.; Konings, M.C.J.M.; Vorst, O.F.J.; Houwelingen, van A.M.M.L.; Stoopen, G.M.; Maliepaard, C.A.; Kodde, J.; Bino, R.J.; Groot, S.P.C.; Geest, van der A.H.M.

    2005-01-01

    During seed maturation and germination, major changes in physiological status, gene expression, and metabolic events take place. Using chlorophyll sorting, osmopriming, and different drying regimes, Brassica oleracea seed lots of different maturity, stress tolerance, and germination behavior were cr

  18. Conditioning of Roots with Hypoxia Increases Aluminum and Acid Stress Tolerance by Mitigating Activation of K+ Efflux Channels by ROS in Barley: Insights into Cross-Tolerance Mechanisms.

    Science.gov (United States)

    Ma, Yanling; Zhu, Min; Shabala, Lana; Zhou, Meixue; Shabala, Sergey

    2016-01-01

    Aluminum (Al) is prevalent in soils, but Al toxicity is manifested only under acid conditions. It causes severe damages to the root system. Short-term waterlogging stress can occur simultaneously with Al toxicity in areas with high rainfall or an inappropriate irrigation pattern. Barley (Hordeum vulgare L.) is one of the most Al-sensitive small-grained cereals. In this work, we have investigated effects of short-term treatments with hypoxia and phenolic acid (two major constraints in waterlogged soils) on root sensitivity to low-pH and Al stresses. We showed that hypoxia-primed roots maintained higher cell viability when exposed to low-pH/Al stress, in both elongation and mature root zones, and possessed superior ability to retain K(+) in response to low-pH/Al stresses. These priming effects were not related to higher H(+)-ATPase activity and better membrane potential maintenance, and could not be explained by the increased expression levels of HvHAK1, which mediates high-affinity K(+) uptake in roots. Instead, hypoxia-conditioned roots were significantly less sensitive to H2O2 treatment, indicated by the 10-fold reduction in the magnitude of K(+) efflux changes. This suggested that roots pre-treated with hypoxia desensitized reactive oxygen species (ROS)-inducible K(+) efflux channels in root epidermis, most probably via enhanced antioxidative capacity. A possible role for Ca(2+) in stress-induced ROS signaling pathways is also discussed. Overall, our results report, for the first time, the phenomenon of cross-protection between hypoxia and low-pH/Al stresses, and causally link it to the cell's ability to maintain cytosolic K(+) homeostasis. PMID:26581863

  19. The autophagy associated gene, ULK1, promotes tolerance to chronic and acute hypoxia

    International Nuclear Information System (INIS)

    Background and purpose: Tumor hypoxia is associated with therapy resistance and malignancy. Previously we demonstrated that activation of autophagy and the unfolded protein response (UPR) promote hypoxia tolerance. Here we explored the importance of ULK1 in hypoxia tolerance, autophagy induction and its prognostic value for recurrence after treatment. Material and methods: Hypoxic regulation of ULK1 mRNA and protein was assessed in vitro and in primary human head and neck squamous cell carcinoma (HNSCC) xenografts. Its importance in autophagy induction, mitochondrial homeostasis and tolerance to chronic and acute hypoxia was evaluated in ULK1 knockdown cells. The prognostic value of ULK1 mRNA expression was assessed in 82 HNSCC patients. Results: ULK1 enrichment was observed in hypoxic tumor regions. High enrichment was associated with a high hypoxic fraction. In line with these findings, high ULK1 expression in HNSCC patients appeared associated with poor local control. Exposure of cells to hypoxia induced ULK1 mRNA in a UPR and HIF1α dependent manner. ULK1 knockdown decreased autophagy activation, increased mitochondrial mass and ROS exposure and sensitized cells to acute and chronic hypoxia. Conclusions: We demonstrate that ULK1 is a hypoxia regulated gene and is associated with hypoxia tolerance and a worse clinical outcome

  20. Identification of a novel drought tolerance gene in Gossypium hirsutum L. cv KC3

    Directory of Open Access Journals (Sweden)

    Jagadeesh N. Selvam

    2009-02-01

    Full Text Available Development of drought resistant cotton cultivars has long been a major breeding objective, since water stress limits fiber production and productivity. Recent advances in functional genomics can increase the efficiency of conventional breeding for genetic improvement of crop plants for improved abiotic stress resistance. To this end, a novel drought resistance gene was identified by comparing the gene expression profile of Gossypium hirsutum cv KC3 and MCU12 by employing a cDNA-RAPD approach. Physiological and biochemical studies showed that KC3 has relatively better drought tolerance than MCU12. Among 25 random primers, OPA15 has identified differentially expressed cDNA in KC3. Results of BLASTP algorithm have shown that this cDNA has significant homology with P-Glycoprotein, ACC oxidase2 and ABC transporter which are involved either directly, or indirectly, in stress tolerance in animals and plants. Hence, the cDNA sequence identified in this study may be a novel gene that confers drought resistance in cotton as KC3 is well adapted and is widely cultivated in rain-fed tracts of Tamil Nadu, India. Further characterization of this gene may show it has potential application for development of cotton with improved drought resistance, through genetic engineering and/or marker aided selection (MAS

  1. Overexpression of Bacterial mtlD Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol

    Directory of Open Access Journals (Sweden)

    Tengale Dipak Bhauso

    2014-01-01

    Full Text Available In the changing global environmental scenarios, water scarcity and recurrent drought impose huge reductions to the peanut (Arachis hypogaea L. crop yield. In plants, osmotic adjustments associated with efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms. Mannitol, a compatible solute, is known to scavenge hydroxyl radicals generated during various abiotic stresses, thereby conferring tolerance to water-deficit stress in many plant species. However, peanut plant is not known to synthesize mannitol. Therefore, bacterial mtlD gene coding for mannitol 1-phosphate dehydrogenase under the control of constitutive promoter CaMV35S was introduced and overexpressed in the peanut cv. GG 20 using Agrobacterium tumefaciens-mediated transformation. A total of eight independent transgenic events were confirmed at molecular level by PCR, Southern blotting, and RT-PCR. Transgenic lines had increased amount of mannitol and exhibited enhanced tolerance in response to water-deficit stress. Improved performance of the mtlD transgenics was indicated by excised-leaf water loss assay and relative water content under water-deficit stress. Better performance of transgenics was due to the ability of the plants to synthesize mannitol. However, regulation of mtlD gene expression in transgenic plants remains to be elucidated.

  2. Pharmacokinetic genes do not influence response or tolerance to citalopram in the STAR*D sample.

    Directory of Open Access Journals (Sweden)

    Eric J Peters

    Full Text Available BACKGROUND: We sought to determine whether clinical response or tolerance to the Selective Serotonin Reuptake Inhibitor (SSRI citalopram is associated with genetic polymorphisms in potentially relevant pharmacokinetic enzymes. METHODOLOGY: We used a two-stage case-control study design in which we split the sample of 1,953 subjects from the Sequenced Treatment Alternatives to Relieve Depression (STAR*D trial into a discovery (n = 831 and validation set (n = 1,046. Fifteen polymorphisms from five (CYP2D6, ABCB1, CYP2C19, CYP3A4, and CYP3A5 pharmacokinetic genes were genotyped. We examined the associations between these polymorphisms and citalopram response and tolerance. Significant associations were validated in the second stage for those polymorphism found to be statistically significant in the first stage. CONCLUSIONS: No genetic polymorphism in the pharmacokinetic genes examined was significantly associated with our response or tolerance phenotypes in both stages. For managing pharmacological treatment with citalopram, routine screening of the common pharmacokinetic DNA variants that we examined appears to be of limited clinical utility.

  3. Enhanced water stress tolerance of transgenic maize plants over-expressing LEA Rab28 gene.

    Science.gov (United States)

    Amara, Imen; Capellades, Montserrat; Ludevid, M Dolors; Pagès, Montserrat; Goday, Adela

    2013-06-15

    Late Embryogenesis Abundant (LEA) proteins participate in plant stress responses and contribute to the acquisition of desiccation tolerance. In this report Rab28 LEA gene has been over-expressed in maize plants under a constitutive maize promoter. The expression of Rab28 transcripts led to the accumulation and stability of Rab28 protein in the transgenic plants. Native Rab28 protein is localized to nucleoli in wild type maize embryo cells; here we find by whole-mount immunocytochemistry that in root cells of Rab28 transgenic and wild-type plants the protein is also associated to nucleolar structures. Transgenic plants were tested for stress tolerance and resulted in sustained growth under polyethyleneglycol (PEG)-mediated dehydration compared to wild-type controls. Under osmotic stress transgenic seedlings showed increased leaf and root areas, higher relative water content (RWC), reduced chlorophyll loss and lower Malondialdehyde (MDA) production in relation to wild-type plants. Moreover, transgenic seeds exhibited higher germination rates than wild-type seeds under water deficit. Overall, our results highlight the presence of transgenic Rab28 protein in nucleolar structures and point to the potential of group 5 LEA Rab28 gene as candidate to enhance stress tolerance in maize plants. PMID:23384757

  4. Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

    Science.gov (United States)

    Monette, M.Y.; Yada, T.; Matey, V.; McCormick, S.D.

    2010-01-01

    We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4??gl-1 Al), acid and low Al (LAl: pH 5.4, 11??gl-1 Al), acid and moderate Al (MAl: pH 5.3, 42??gl-1 Al), and acid and high Al (HAl: pH 5.4, 56??gl-1 Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na+/K+-ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl- channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time-course and severity of Al exposure. We propose that when smolts are

  5. Down-Regulated Expression of RACK1 Gene by RNA Interference Enhances Drought Tolerance in Rice

    Institute of Scientific and Technical Information of China (English)

    LI Da-hong; LIU Hui; YANG Yan-li; ZHEN Ping-ping; LIANG Jian-sheng

    2009-01-01

    The receptor for activated C-kinase 1 (RACK1) is a highly conserved scaffold protein with versatile functions, and plays important roles in the regulation of plant growth and development. Transgenic rice plants, in which the expression of RACK1 gene was inhibited by RNA interference (RNAi), were studied to elucidate the possible functions of RACK1 in responses to drought stress in rice. Real-time PCR analysis showed that the expression of RACK1 in transgenic rice plants was inhibited by more than 50%. The tolerance to drought stress of the transgenic rice plants was higher as compared with the non-transgenic rice plants. The peroxidation of membrane and the production of malondialdehyde were significantly lower, and the superoxide dismutase activity in transgenic rice plants was significantly higher than those in non-trangenic rice plants. It is suggested that RACK1 negatively regulated the redox system-related tolerance to drought stress of rice plants.

  6. Chilling Tolerance of Cucumber During Germination is Related to Expression of Lysine Decarboxylase Gene

    Institute of Scientific and Technical Information of China (English)

    LU Ming-hui; LI Xiao-ming; CHEN Jin-feng; CHEN Long-zheng; QIAN Chun-tao

    2005-01-01

    Using cDNA-AFLP technique, a specific fragment was isolated from cucumber cultivar Changchun mici possessing chilling tolerance induced at low temperature (15℃). This fragment, named cctr 132, could not be induced in the chilling sensitive cucumber cultivar Beijing jietou. After recovering the fragment, sequencing and translating, the results of blastx and blastp in GenBank of NCBI indicated that CCTR132 had 88.37% identities and 100% positives with Oryza sativa putative lysine decarboxylase-like protein respectively, and PGGXGTXXE, the putative conserved domain of lysine decarboxylase family, was detected from CCTR132, suggesting the cucumber chilling tolerance during germination is related to the expression of the lysine decarboxylase gene.

  7. Statistical methods in detecting differential expressed genes, analyzing insertion tolerance for genes and group selection for survival data

    Science.gov (United States)

    Liu, Fangfang

    The thesis is composed of three independent projects: (i) analyzing transposon-sequencing data to infer functions of genes on bacteria growth (chapter 2), (ii) developing semi-parametric Bayesian method for differential gene expression analysis with RNA-sequencing data (chapter 3), (iii) solving group selection problem for survival data (chapter 4). All projects are motivated by statistical challenges raised in biological research. The first project is motivated by the need to develop statistical models to accommodate the transposon insertion sequencing (Tn-Seq) data, Tn-Seq data consist of sequence reads around each transposon insertion site. The detection of transposon insertion at a given site indicates that the disruption of genomic sequence at this site does not cause essential function loss and the bacteria can still grow. Hence, such measurements have been used to infer the functions of each gene on bacteria growth. We propose a zero-inflated Poisson regression method for analyzing the Tn-Seq count data, and derive an Expectation-Maximization (EM) algorithm to obtain parameter estimates. We also propose a multiple testing procedure that categorizes genes into each of the three states, hypo-tolerant, tolerant, and hyper-tolerant, while controlling false discovery rate. Simulation studies show our method provides good estimation of model parameters and inference on gene functions. In the second project, we model the count data from RNA-sequencing experiment for each gene using a Poisson-Gamma hierarchical model, or equivalently, a negative binomial (NB) model. We derive a full semi-parametric Bayesian approach with Dirichlet process as the prior for the fold changes between two treatment means. An inference strategy using Gibbs algorithm is developed for differential expression analysis. We evaluate our method with several simulation studies, and the results demonstrate that our method outperforms other methods including the popularly applied ones such as edge

  8. CrGNAT gene regulates excess copper accumulation and tolerance in Chlamydomonas reinhardtii.

    Science.gov (United States)

    Wang, Ye; Cheng, Zhen Zhen; Chen, Xi; Zheng, Qi; Yang, Zhi Min

    2015-11-01

    Excess copper (Cu) in environment affects the growth and metabolism of plants and green algae. However, the molecular mechanism for regulating plant tolerance to excess Cu is not fully understood. Here, we report a gene CrGNAT enconding an acetyltransferase in Chlamydomonas reinhardtii and identified its role in regulating tolerance to Cu toxicity. Expression of CrGNAT was significantly induced by 75-400μM Cu. The top induction occurred at 100μM. Transgenic algae overexpressing CrGNAT (35S::CrGNAT) in C. reinhardtii showed high tolerance to excess Cu, with improved cell population, chlorophyll accumulation and photosynthesis efficiency, but with low degree of oxidation with regard to reduced hydrogen peroxide, lipid peroxides and non-protein thiol compounds. In contrast, CrGNAT knock-down lines with antisense led to sensitivity to Cu stress. 35S::CrGNAT algae accumulated more Cu and other metals (Zn, Fe, Cu, Mn and Mg) than wild-type, whereas the CrGNAT down-regulated algae (35S::AntiCrGNAT) had moderate levels of Cu and Mn, but no effects on Zn, Fe and Mg accumulation as compared to wild-type. The elevated metal absorption in CrGNAT overexpression algae implies that the metals can be removed from water media. Quantitative RT-PCR analysis revealed that expression of two genes encoding N-lysine histone methyltransferases was repressed in 35S::CrGNAT algae, suggesting that CrGNAT-regulated algal tolerance to Cu toxicity is likely associated with histone methylation and chromatin remodeling. The present work provided an example a basis to develop techniques for environmental restoration of metal-contaminated aquatic ecosystems. PMID:26475193

  9. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    International Nuclear Information System (INIS)

    Highlights: → Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. → Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. → Using in vitro T1 seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. → This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of 14C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T0 and T1) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  10. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  11. Prioritization of candidate genes in “QTL-hotspot” region for drought tolerance in chickpea (Cicer arietinum L.)

    Science.gov (United States)

    Kale, Sandip M; Jaganathan, Deepa; Ruperao, Pradeep; Chen, Charles; Punna, Ramu; Kudapa, Himabindu; Thudi, Mahendar; Roorkiwal, Manish; Katta, Mohan AVSK; Doddamani, Dadakhalandar; Garg, Vanika; Kishor, P B Kavi; Gaur, Pooran M; Nguyen, Henry T; Batley, Jacqueline; Edwards, David; Sutton, Tim; Varshney, Rajeev K

    2015-01-01

    A combination of two approaches, namely QTL analysis and gene enrichment analysis were used to identify candidate genes in the “QTL-hotspot” region for drought tolerance present on the Ca4 pseudomolecule in chickpea. In the first approach, a high-density bin map was developed using 53,223 single nucleotide polymorphisms (SNPs) identified in the recombinant inbred line (RIL) population of ICC 4958 (drought tolerant) and ICC 1882 (drought sensitive) cross. QTL analysis using recombination bins as markers along with the phenotyping data for 17 drought tolerance related traits obtained over 1–5 seasons and 1–5 locations split the “QTL-hotspot” region into two subregions namely “QTL-hotspot_a” (15 genes) and “QTL-hotspot_b” (11 genes). In the second approach, gene enrichment analysis using significant marker trait associations based on SNPs from the Ca4 pseudomolecule with the above mentioned phenotyping data, and the candidate genes from the refined “QTL-hotspot” region showed enrichment for 23 genes. Twelve genes were found common in both approaches. Functional validation using quantitative real-time PCR (qRT-PCR) indicated four promising candidate genes having functional implications on the effect of “QTL-hotspot” for drought tolerance in chickpea. PMID:26478518

  12. Promiscuous Gene Expression in the Thymus: The Root of Central Tolerance

    Directory of Open Access Journals (Sweden)

    Danielle A. R. Magalhães

    2006-01-01

    Full Text Available The thymus is a complex organ with an epithelium formed by two main cell types, the cortical thymic epithelial (cTECs and medullary thymic epithelial cells (mTECs, referred to as stroma. Immature thymocytes arising from the bone marrow, macrophages and dendritic cells also populate the thymus. Thymocytes evolve to mature T cells featuring cell differentiation antigens (CDs, which characterize the phenotypically distinct stages, defined as double-negative (DN, double positive (DP and single positive (SP, based on expression of the coreceptors CD4 and CD8. The thymus is therefore implicated in T cell differentiation and during development into T cells thymocytes are in close association with the stroma. Recent evidence showed that mTECs express a diverse set of genes coding for parenchymal organ specific proteins. This phenomenon has been termed promiscuous gene expression (PGE and has led to the reconsideration of the role of the thymus in central T cell tolerance to self-antigens, which prevents autoimmunity. The evidence of PGE is causing a reanalysis in the scope of central tolerance understanding. We summarize the evidence of PGE in the thymus, focusing particularly the use of cDNA microarray technology for the broad characterization of gene expression and demarcation of PGE emergence during thymus ontogeny.

  13. Improvement of Drought Tolerance in Transgenic Tobacco Plants by a Dehydrin-Like Gene Transfer

    Institute of Scientific and Technical Information of China (English)

    SHEN Ye; JIA Wei-long; ZHANG Yan-qin; HU Yuan-lei; WU Qi; LIN Zhong-ping

    2004-01-01

    A full-length cDNA of dehydrin BcDh2 from Boea crassifolia and its antisense nucleotide sequence have been transferred into tobacco (Nicotiana tabacum) NC89 under the control of a caulifower mosaic virus 35S promoter. Under a progressive water stress, photosynthetic rate, transpiration rate and stomatal conductance of the sense and antisense plants reduced, and those of the control reduced much more. Photosynthetic rate, transpiration rate and stomatal conductance of all plants tested increased significantly 24 hours later after recoveried water supply, and those of the sense and antisense plants were higher than control. These indicated that overexpression of a dehydrin gene in tobacco may improve tolerance to water stress for plants, however, antisense BcDh2 gene in transgenic plant did not influence physiological conditions. The results of germination experiment of the transgenic seeds showed that on MS medium with different concentration PEG (8000), sense seed could more endure drought than control, while antisense seed was sensitive to drought. The results suggested that the overexpression of a dehydrin gene in tobacco might improve the tolerance to water stress for plants.

  14. Improvement of Drought Tolerance in Transgenic Tobacco Plants by aDehydrin-Like Gene Transfer

    Institute of Scientific and Technical Information of China (English)

    SHENYe; JIAWei-long; ZHANGYan-qin; HUYuan-lei; WUQi; LINZhongping

    2004-01-01

    A full-length cDNA of dehydrin BcDh2 from Boea crassifolia and its antisense nucleotide sequence have been transferred into tobacco (Nicotiana tabacum) NC89 under the control of a caulifower mosaic virus 35S promoter. Under a progressive water stress, photosynthetic rate, transpiration rate and stomatal conductance of the sense and antisense plants reduced, and those of the control reduced much more. Photosynthetic rate, transpiration rate and stomatal conductance of all plants tested increased significantly 24 hours later after recoveried water supply, and those of the sense and antisense plants were higher than control. These indicated that overexpression of a dehydrin gene in tobacco may improve tolerance to water stress for plants, however, antisense BcDh2 gene in transgenic plant did not influence physiological conditions. The results of germination experiment of the transgenic seeds showed that on MS medium with different concentration PEG (8000), sense seed could more endure drought than control, while antisense seed was sensitive to drought. The results suggested that the overexpression of a dehydrin gene in tobacco might improve the tolerance to water stress for plants.

  15. [Involvement of PHO80 and PHO85 genes in Saccharomyces cerevisiae ion tolerance].

    Science.gov (United States)

    Mao, Xi-Cheng; Xia, Yu-Lei; Hu, Ya-Fang; Lu, Chang-De

    2003-01-01

    PHO85 is a versatile gene in Saccharomyces cerevisiae, which is involved in metabolism of inorganic phosphate and usage of carbon source, accumulation of glycogen, regulation of protein stability and cell cycle control. The viability of wild type budding yeast strain YPH499 and its derivative pho85Delta mutant, pho80 mutant, and pap1(pcl-7)Delta mutant in different cations were investigated and their tolerance to the cations(LC(50)) was measured. The results showed that the deletion of PHO85 or PHO80 gene both increased sensibility of Sacchromyces cerevisiae to ions K(+), Mg(2+), Zn(2+), Ca(2+) and Mn(2+), while the deletion of pap1(pcl-7) gene did not lead to such phenotype. The difference between the patterns of relative growth curve of the mutants and wild type strain in the above ions also implied that PHO80 was the unique PCLs in complex with PHO85 CDK, that were contributed to K(+) and Mg(2+) ion homeostasis control and there were some other PCLs besides PHO80 that were involved in Zn(2+), Ca(2+) and Mn(2+) tolerance regulation as cyclin of PHO85 CDK. Furthermore, the amount of the total cellular calcium of pho85Delta mutant, pho80Delta mutant and YPH499 indicated that the ability of calcium accumulation of pho85 mutant and pho80Delta mutant was impaired. PMID:12518234

  16. Silencing of TaBTF3 gene impairs tolerance to freezing and drought stresses in wheat.

    Science.gov (United States)

    Kang, Guozhang; Ma, Hongzhen; Liu, Guoqin; Han, Qiaoxia; Li, Chengwei; Guo, Tiancai

    2013-11-01

    Basic transcription factor 3 (BTF3), the β-subunit of the nascent polypeptide-associated complex, is responsible for the transcriptional initiation of RNA polymerase II and is also involved in cell apoptosis, translation initiation regulation, growth, development, and other functions. Here, we report the impact of BTF3 on abiotic tolerance in higher plants. The transcription levels of the TaBTF3 gene, first isolated from wheat seedlings in our lab, were differentially regulated by diverse abiotic stresses and hormone treatments, including PEG-induced stress (20 % polyethylene glycol 6000), cold (4 °C), salt (100 mM NaCl), abscisic acid (100 μM), methyl jasmonate (50 μM), and salicylic acid (50 μM). Southern blot analysis indicated that, in the wheat genome, TaBTF3 is a multi-copy gene. Compared to BSMV-GFP-infected wheat plants (control), under freezing (-8 °C for 48 h) or drought stress (withholding water for 15 days) conditions, TaBTF3-silenced wheat plants showed lower survival rates, free proline content, and relative water content and higher relative electrical conductivity and water loss rate. These results suggest that silencing of the TaBTF3 gene may impair tolerance to freezing and drought stresses in wheat and that it may be involved in the response to abiotic stresses in higher plants. PMID:23942841

  17. Overexpression of a Triticum aestivum Calreticulin gene (TaCRT1 Improves Salinity Tolerance in Tobacco.

    Directory of Open Access Journals (Sweden)

    Yang Xiang

    Full Text Available Calreticulin (CRT is a highly conserved and abundant multifunctional protein that is encoded by a small gene family and is often associated with abiotic/biotic stress responses in plants. However, the roles played by this protein in salt stress responses in wheat (Triticum aestivum remain obscure. In this study, three TaCRT genes were identified in wheat and named TaCRT1, TaCRT2 and TaCRT3-1 based on their sequence characteristics and their high homology to other known CRT genes. Quantitative real-time PCR expression data revealed that these three genes exhibit different expression patterns in different tissues and are strongly induced under salt stress in wheat. The calcium-binding properties of the purified recombinant TaCRT1 protein were determined using a PIPES/Arsenazo III analysis. TaCRT1 gene overexpression in Nicotiana tabacum decreased salt stress damage in transgenic tobacco plants. Physiological measurements indicated that transgenic tobacco plants showed higher activities of superoxide dismutase (SOD, peroxidase (POD and catalase (CAT than non-transgenic tobacco under normal growth conditions. Interestingly, overexpression of the entire TaCRT1 gene or of partial TaCRT1 segments resulted in significantly higher tolerance to salt stress in transgenic plants compared with their WT counterparts, thus revealing the essential role of the C-domain of TaCRT1 in countering salt stress in plants.

  18. Stable expression of mtlD gene imparts multiple stress tolerance in finger millet.

    Directory of Open Access Journals (Sweden)

    Ramanna Hema

    Full Text Available Finger millet is susceptible to abiotic stresses, especially drought and salinity stress, in the field during seed germination and early stages of seedling development. Therefore developing stress tolerant finger millet plants combating drought, salinity and associated oxidative stress in these two growth stages is important. Cellular protection through osmotic adjustment and efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms in plants. Mannitol, an osmolyte, is known to scavenge hydroxyl radicals generated during various abiotic stresses and thereby minimize stress damage in several plant species. In this study transgenic finger millet plants expressing the mannitol biosynthetic pathway gene from bacteria, mannitol-1-phosphate dehydrogenase (mtlD, were developed through Agrobacterium tumefaciens-mediated genetic transformation. mtlD gene integration in the putative transgenic plants was confirmed by Southern blot. Further, performance of transgenic finger millet under drought, salinity and oxidative stress was studied at plant level in T1 generation and in T1 and T2 generation seedlings. Results from these experiments showed that transgenic finger millet had better growth under drought and salinity stress compared to wild-type. At plant level, transgenic plants showed better osmotic adjustment and chlorophyll retention under drought stress compared to the wild-type. However, the overall increase in stress tolerance of transgenics for the three stresses, especially for oxidative stress, was only marginal compared to other mtlD gene expressing plant species reported in the literature. Moreover, the Agrobacterium-mediated genetic transformation protocol developed for finger millet in this study can be used to introduce diverse traits of agronomic importance in finger millet.

  19. Overexpression of Rab16A gene in indica rice variety for generating enhanced salt tolerance

    OpenAIRE

    Ganguly, Moumita; Datta, Karabi; Roychoudhury, Aryadeep; Gayen, Dipak; Sengupta, Dibyendu N; Datta, Swapan K.

    2012-01-01

    We report here the overexpression of Rab16A full length gene (promoter + ORF), from the salt-tolerant indica rice Pokkali, in the salt-susceptible indica rice variety Khitish, via particle bombardment. Molecular analysis of the transgenics revealed stable integration of the transgene upto T2 generation. High level of expression of the transgene (driven by its own stress-inducible promoter), as well as the protein, was detectable in the leaves under simulated salinity stress (250 mM NaCl, 24 h...

  20. Dynamic QTL analysis and candidate gene mapping for waterlogging tolerance at maize seedling stage.

    Directory of Open Access Journals (Sweden)

    Khalid A Osman

    Full Text Available Soil waterlogging is one of the major abiotic stresses adversely affecting maize growth and yield. To identify dynamic expression of genes or quantitative trait loci (QTL, QTL associated with plant height, root length, root dry weight, shoot dry weight and total dry weight were identified via conditional analysis in a mixed linear model and inclusive composite interval mapping method at three respective periods under waterlogging and control conditions. A total of 13, 19 and 23 QTL were detected at stages 3D|0D (the period during 0-3 d of waterlogging, 6D|3D and 9D|6D, respectively. The effects of each QTL were moderate and distributed over nine chromosomes, singly explaining 4.14-18.88% of the phenotypic variation. Six QTL (ph6-1, rl1-2, sdw4-1, sdw7-1, tdw4-1 and tdw7-1 were identified at two consistent stages of seedling development, which could reflect a continuous expression of genes; the remaining QTL were detected at only one stage. Thus, expression of most QTL was influenced by the developmental status. In order to provide additional evidence regarding the role of corresponding genes in waterlogging tolerance, mapping of Expressed Sequence Tags markers and microRNAs were conducted. Seven candidate genes were observed to co-localize with the identified QTL on chromosomes 1, 4, 6, 7 and 9, and may be important candidate genes for waterlogging tolerance. These results are a good starting point for understanding the genetic basis for selectively expressing of QTL in different stress periods and the common genetic control mechanism of the co-localized traits.

  1. Isolation of high salinity stress tolerant genes from Pisum sativum by random overexpression in Escherichia coli and their functional validation.

    Science.gov (United States)

    Joshi, Amita; Dang, Hung Quang; Vaid, Neha; Tuteja, Narendra

    2009-05-01

    Salinity stress is one of the major factors which reduce crop plants growth and productivity resulting in significant economic losses worldwide. Therefore, it would be fruitful to isolate and functionally identify new salinity stress-induced genes for understanding the mechanism and developing salinity stress tolerant plants. Based on functional gene screening assay, we have isolated few salinity tolerant genes out of one million Escherichia coli (SOLR) transformants containing pea cDNAs. Sequence analysis of three of these genes revealed homology to Ribosomal-L30E (RPL30E), Chlorophyll-a/b-binding protein (Chla/bBP) and FIDDLEHEAD (FDH). The salinity tolerance of these genes in bacteria was further confirmed by using another strain of E. coli (DH5alpha) transformants. The homology based computational modeling of these proteins suggested the high degree of conservation with the conserved domains of their homologous partners. The reverse transcriptase polymerase chain reaction (RT-PCR) analysis showed that the expression of these cDNAs (except the FDH) was upregulated in pea plants in response to NaCl stress. We observed that there was no significant effect of Li(+) ion on the expression level of these genes, while an increase in response to K(+) ion was observed. Overall, this study provides an evidence for a novel function of these genes in high salinity stress tolerance. The PsFDH showed constitutive expression in planta suggesting that it can be used as constitutively expressed marker gene for salinity stress tolerance in plants. This study brings new direction in identifying novel function of unidentified genes in abiotic stress tolerance without previous knowledge of the genome sequence. PMID:19816097

  2. Virus-induced gene silencing of Arabidopsis thaliana gene homologues in wheat identifies genes conferring improved drought tolerance

    OpenAIRE

    Manmathan, Harish; Shaner, Dale; Snelling, Jacob; Tisserat, Ned; Lapitan, Nora

    2013-01-01

    In a non-model staple crop like wheat (Triticum aestivumI L.), functional validation of potential drought stress responsive genes identified in Arabidopsis could provide gene targets for breeding. Virus-induced gene silencing (VIGS) of genes of interest can overcome the inherent problems of polyploidy and limited transformation potential that hamper functional validation studies in wheat. In this study, three potential candidate genes shown to be involved in abiotic stress response pathways i...

  3. Discovery of error-tolerant biclusters from noisy gene expression data

    Directory of Open Access Journals (Sweden)

    Gupta Rohit

    2011-11-01

    Full Text Available Abstract Background An important analysis performed on microarray gene-expression data is to discover biclusters, which denote groups of genes that are coherently expressed for a subset of conditions. Various biclustering algorithms have been proposed to find different types of biclusters from these real-valued gene-expression data sets. However, these algorithms suffer from several limitations such as inability to explicitly handle errors/noise in the data; difficulty in discovering small bicliusters due to their top-down approach; inability of some of the approaches to find overlapping biclusters, which is crucial as many genes participate in multiple biological processes. Association pattern mining also produce biclusters as their result and can naturally address some of these limitations. However, traditional association mining only finds exact biclusters, which limits its applicability in real-life data sets where the biclusters may be fragmented due to random noise/errors. Moreover, as they only work with binary or boolean attributes, their application on gene-expression data require transforming real-valued attributes to binary attributes, which often results in loss of information. Many past approaches have tried to address the issue of noise and handling real-valued attributes independently but there is no systematic approach that addresses both of these issues together. Results In this paper, we first propose a novel error-tolerant biclustering model, ‘ET-bicluster’, and then propose a bottom-up heuristic-based mining algorithm to sequentially discover error-tolerant biclusters directly from real-valued gene-expression data. The efficacy of our proposed approach is illustrated by comparing it with a recent approach RAP in the context of two biological problems: discovery of functional modules and discovery of biomarkers. For the first problem, two real-valued S.Cerevisiae microarray gene-expression data sets are used to demonstrate

  4. Over-expression of poplar transcription factor ERF76 gene confers salt tolerance in transgenic tobacco.

    Science.gov (United States)

    Yao, Wenjing; Wang, Lei; Zhou, Boru; Wang, Shengji; Li, Renhua; Jiang, Tingbo

    2016-07-01

    Ethylene response factors (ERFs) belong to a large plant-specific transcription factor family, which play a significant role in plant development and stress responses. Poplar ERF76 gene, a member of ERF TF family, can be up-regulated in response to salt stress, osmotic stress, and ABA treatment. The ERF76 protein was confirmed to be targeted preferentially in the nucleus of onion cell by particle bombardment. In order to understand the functions of ERF76 gene in salt stress response, we conducted temporal and spatial expression analysis of ERF76 gene in poplar. Then the ERF76 cDNA fragment containing an ORF was cloned from di-haploid Populus simonii×P. nigra and transferred into tobacco (Nicotiana tobacum) genome by Agrobacterium-mediated leaf disc method. Under salt stress, transgenic tobacco over-expressing ERF76 gene showed a significant increase in seed germination rate, plant height, root length, and fresh weight, as well as in relative water content (RWC), superoxide dismutase (SOD) activity, peroxidase (POD) activity, and proline content, compared to control tobacco lines. In contrast, transgenic tobacco lines displayed a decrease in malondialdehyde (MDA) accumulation, relative electrical conductivity (REC) and reactive oxygen species (ROS) accumulation in response to salt stress, compared to control tobacco lines. Over all, the results indicated that ERF76 gene plays a critical role in salt tolerance in transgenic tobacco. PMID:27123829

  5. Tracking the evolution of a cold stress associated gene family in cold tolerant grasses

    DEFF Research Database (Denmark)

    Sandve, Simen R; Rudi, Heidi; Asp, Torben;

    2008-01-01

    extensively in vitro, little is known about the evolution of these genes on the molecular level. Results We identified 15 putative novel ice re-crystallisation inhibition (IRI)-like protein coding genes in perennial ryegrass, barley, and wheat. Using synonymous divergence estimates we reconstructed the...... provide evidence for IRI-domain evolution probably occurring through increased copy number of a repeated motif. Finally, we discuss the possibility of parallel evolution of LRR domain containing IRI proteins in carrot and grasses through two completely different molecular adaptations.......Background Grasses are adapted to a wide range of climatic conditions. Species of the subfamily Pooideae, which includes wheat, barley and important forage grasses, have evolved extreme frost tolerance. A class of ice binding proteins that inhibit ice re-crystallisation, specific to the Pooideae...

  6. An Na+/H+ antiporter gene from wheat plays an important role in stress tolerance

    Indian Academy of Sciences (India)

    Jia Ning Yu; Jian Huang; Zi Ning Wang; Jin Song Zhang; Shou Yi Chen

    2007-09-01

    A vacuole Na+/H+ antiporter gene TaNHX2 was obtained by screening the wheat cDNA library and by the 5′-RACE method. The expression of TaNHX2 was induced in roots and leaves by treatment with NaCl, polyethylene glycol (PEG), cold and abscisic acid (ABA). When expressed in a yeast mutant (nhx1), TaNHX2 suppressed the salt sensitivity of the mutant, which was deficient in vacuolar Na+/H+ antiporter, and caused partial recovery of growth of nhx1 in NaCl and LiCl media. The survival rate of yeast cells was improved by overexpressing the TaNHX2 gene under NaCl, KCl, sorbitol and freezing stresses when compared with the control. The results imply that TaNHX2 might play an important role in salt and osmotic stress tolerance in plant cells.

  7. Identification of quantitative trait loci and candidate genes for cadmium tolerance in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Goncho T. [West Virginia University; Yin, Tongming [ORNL; Zhang, Xinye [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Steven P [West Virginia University

    2012-01-01

    Understanding genetic variation for the response of Populus to heavy metals like cadmium (Cd) is an important step in elucidating the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa Torr. & Gray and Populus deltoides Bart. was characterized for growth and performance traits after Cd exposure. A total of 16 quantitative trait loci (QTL) at logarithm of odds (LOD) ratio 2.5 were detected for total dry weight, its components and root volume. Major QTL for Cd responses were mapped to two different linkage groups and the relative allelic effects were in opposing directions on the two chromosomes, suggesting differential mechanisms at these two loci. The phenotypic variance explained by Cd QTL ranged from 5.9 to 11.6% and averaged 8.2% across all QTL. A whole-genome microarray study led to the identification of nine Cd-responsive genes from these QTL. Promising candidates for Cd tolerance include an NHL repeat membrane-spanning protein, a metal transporter and a putative transcription factor. Additional candidates in the QTL intervals include a putative homolog of a glutamate cysteine ligase, and a glutathione-S-transferase. Functional characterization of these candidate genes should enhance our understanding of Cd metabolism and transport and phytoremediation capabilities of Populus.

  8. Overexpression of a Cytosolic Ascorbate Peroxidase Gene, OsAPX2, Increases Salt Tolerance in Transgenic Alfalfa

    Institute of Scientific and Technical Information of China (English)

    ZHANG Qian; MA Cui; XUE Xin; XU Ming; LI Jing; WU Jin-xia

    2014-01-01

    Alfalfa (Medicago sativa L.) is an important forage crop in the world and it is of great signiifcance for the improvement of its salt tolerance. To improve salt tolerance in alfalfa, a rice ascorbate peroxidase gene (OsAPX2) was introduced into alfalfa using Agrobacterium tumefaciens-mediated transformation with marker gene bar. The different T-DNA insertions in T1 transgenic alfalfa were identiifed by Southern hybridization. Three independent T2 transgenic lines were selected for stress analysis and the results showed that all of them were salt tolerant compared with wild-type plants. The transgenic plants had low levels of H2O2, malondialdehyde and relative electrical conductivity under salt and drought stresses. Moreover, the contents of chlorophyll and proline, and APX activity were high in transgenic plants under salt and drought stresses. Taken together, the overexpression of OsAPX2 enhances salt tolerance in alfalfa through scavenging reactive oxygen species.

  9. Determination of drought tolerance using root activities in Robinia pseudoacacia 'Idaho' transformed with mtl-D gene

    Institute of Scientific and Technical Information of China (English)

    Wang Hua-fang; Zhu Yi-hong; Sun Hai-jun

    2006-01-01

    Idaho locust (Robinia pseudoacacia 'Idaho') is an exotic multi-purpose tree used in landscaping, soil and water conservation, fodder sources and others. To improve its drought tolerance for reclaiming arid land, five lines of transformed mtl-D gene, as osmotic regulator in plant cells, have been selected and managed to determine their drought tolerance under experimental conditions.Qualitative and quantitative variables of transformed plants were studied. The critical value of drought tolerance was determined by detecting the 2,3,5-triphenyl tetrazolium chloride (TTC) reductants in roots and soil water content (SWC). The critical value for drought tolerance was SWC 6% while for the control plants the critical SWC was 8%; a moderate level of SWC is 13% and the highest SWC for plant endurance was 18%. The method proved to be reliable and sensitive in the evaluation of drought tolerance for forest trees.

  10. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    DEFF Research Database (Denmark)

    Bouchabke-Coussa, O.; Quashie, M.L.; Seoane, Jose Miguel;

    2008-01-01

    Background: Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying...... as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results: All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant......'s improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE), which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis...

  11. Mapping of STS markers developed from drought tolerance candidate genes and preliminary analysis of their association with yield-related traits in common wheat (Triticum aestivum)

    Science.gov (United States)

    Drought is a severe abiotic stress that affects wheat production worldwide. In order to identify candidate genes for tolerance to water stress in wheat, sequences of 11 genes that have function of drought tolerance in other plant species were used to identify the wheat ortholog genes via homology se...

  12. Gene expression analysis of copper tolerance and wood decay in the brown rot fungus Fibroporia radiculosa.

    Science.gov (United States)

    Tang, Juliet D; Parker, Leslie A; Perkins, Andy D; Sonstegard, Tad S; Schroeder, Steven G; Nicholas, Darrel D; Diehl, Susan V

    2013-03-01

    High-throughput transcriptomics was used to identify Fibroporia radiculosa genes that were differentially regulated during colonization of wood treated with a copper-based preservative. The transcriptome was profiled at two time points while the fungus was growing on wood treated with micronized copper quat (MCQ). A total of 917 transcripts were differentially expressed. Fifty-eight of these genes were more highly expressed when the MCQ was protecting the wood from strength loss and had putative functions related to oxalate production/degradation, laccase activity, quinone biosynthesis, pectin degradation, ATP production, cytochrome P450 activity, signal transduction, and transcriptional regulation. Sixty-one genes were more highly expressed when the MCQ lost its effectiveness (>50% strength loss) and had functions related to oxalate degradation; cytochrome P450 activity; H(2)O(2) production and degradation; degradation of cellulose, hemicellulose, and pectin; hexose transport; membrane glycerophospholipid metabolism; and cell wall chemistry. Ten of these differentially regulated genes were quantified by reverse transcriptase PCR for a more in-depth study (4 time points on wood with or without MCQ treatment). Our results showed that MCQ induced higher than normal levels of expression for four genes (putative annotations for isocitrate lyase, glyoxylate dehydrogenase, laccase, and oxalate decarboxylase 1), while four other genes (putative annotations for oxalate decarboxylase 2, aryl alcohol oxidase, glycoside hydrolase 5, and glycoside hydrolase 10) were repressed. The significance of these results is that we have identified several genes that appear to be coregulated, with putative functions related to copper tolerance and/or wood decay. PMID:23263965

  13. Arabidopsis Vacuolar Pyrophosphatase gene (AVP1) induces drought and salt tolerance in Nicotiana tabacum plants (abstract)

    International Nuclear Information System (INIS)

    Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na

  14. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum) Seedlings and Identification of Salt Tolerance Genes

    OpenAIRE

    Liu, Jiangtao; Zhou, Yuelong; Luo, Changxin; Xiang, Yun; An, Lizhe

    2016-01-01

    Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS) technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf...

  15. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage

    OpenAIRE

    Guo, P; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R; Von Korff, M; Varshney, R.,; Graner, A.; Valkoun, V.

    2009-01-01

    Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas worldwide. Identification of the genes responsible for drought tolerance in barley (Hordeum vulgare L.) will facilitate understanding of the molecular mechanisms of drought tolerance, and also facilitate the genetic improvement of barley through marker-assisted selection or gene transformation. To monitor the changes in gene expression at the transcriptional level in barley leaves during the repro...

  16. The essential role of the Deinococcus radiodurans ssb gene in cell survival and radiation tolerance.

    Directory of Open Access Journals (Sweden)

    J Scott Lockhart

    Full Text Available Recent evidence has implicated single-stranded DNA-binding protein (SSB expression level as an important factor in microbial radiation resistance. The genome of the extremely radiation resistant bacterium Deinococcus radiodurans contains genes for two SSB homologs: the homodimeric, canonical Ssb, encoded by the gene ssb, and a novel pentameric protein encoded by the gene ddrB. ddrB is highly induced upon exposure to radiation, and deletions result in decreased radiation-resistance, suggesting an integral role of the protein in the extreme resistance exhibited by this organism. Although expression of ssb is also induced after irradiation, Ssb is thought to be involved primarily in replication. In this study, we demonstrate that Ssb in D. radiodurans is essential for cell survival. The lethality of an ssb deletion cannot be complemented by providing ddrB in trans. In addition, the radiation-sensitive phenotype conferred by a ddrB deletion is not alleviated by providing ssb in trans. By altering expression of the ssb gene, we also show that lower levels of transcription are required for optimal growth than are necessary for high radiation resistance. When expression is reduced to that of E. coli, ionizing radiation resistance is similarly reduced. UV resistance is also decreased under low ssb transcript levels where growth is unimpaired. These results indicate that the expression of ssb is a key component of both normal cellular metabolism as well as pathways responsible for the high radiation tolerance of D. radiodurans.

  17. Simultaneous induction of jasmonic acid and disease-responsive genes signifies tolerance of American elm to Dutch elm disease.

    Science.gov (United States)

    Sherif, S M; Shukla, M R; Murch, S J; Bernier, L; Saxena, P K

    2016-01-01

    Dutch elm disease (DED), caused by three fungal species in the genus Ophiostoma, is the most devastating disease of both native European and North American elm trees. Although many tolerant cultivars have been identified and released, the tolerance mechanisms are not well understood and true resistance has not yet been achieved. Here we show that the expression of disease-responsive genes in reactions leading to tolerance or susceptibility is significantly differentiated within the first 144 hours post-inoculation (hpi). Analysis of the levels of endogenous plant defense molecules such as jasmonic acid (JA) and salicylic acid (SA) in tolerant and susceptible American elm saplings suggested SA and methyl-jasmonate as potential defense response elicitors, which was further confirmed by field observations. However, the tolerant phenotype can be best characterized by a concurrent induction of JA and disease-responsive genes at 96 hpi. Molecular investigations indicated that the expression of fungal genes (i.e. cerato ulmin) was also modulated by endogenous SA and JA and this response was unique among aggressive and non-aggressive fungal strains. The present study not only provides better understanding of tolerance mechanisms to DED, but also represents a first, verified template for examining simultaneous transcriptomic changes during American elm-fungus interactions. PMID:26902398

  18. Genome-wide screening of Saccharomyces cerevisiae genes required to foster tolerance towards industrial wheat straw hydrolysates.

    Science.gov (United States)

    Pereira, Francisco B; Teixeira, Miguel C; Mira, Nuno P; Sá-Correia, Isabel; Domingues, Lucília

    2014-12-01

    The presence of toxic compounds derived from biomass pre-treatment in fermentation media represents an important drawback in second-generation bio-ethanol production technology and overcoming this inhibitory effect is one of the fundamental challenges to its industrial production. The aim of this study was to systematically identify, in industrial medium and at a genomic scale, the Saccharomyces cerevisiae genes required for simultaneous and maximal tolerance to key inhibitors of lignocellulosic fermentations. Based on the screening of EUROSCARF haploid mutant collection, 242 and 216 determinants of tolerance to inhibitory compounds present in industrial wheat straw hydrolysate (WSH) and in inhibitor-supplemented synthetic hydrolysate were identified, respectively. Genes associated to vitamin metabolism, mitochondrial and peroxisomal functions, ribosome biogenesis and microtubule biogenesis and dynamics are among the newly found determinants of WSH resistance. Moreover, PRS3, VMA8, ERG2, RAV1 and RPB4 were confirmed as key genes on yeast tolerance and fermentation of industrial WSH. PMID:25287021

  19. O pH das soluções nutritivas no comportamento de cultivares de trigo à toxicidade de alumínio Effect of pH in nutrient solution on tolerance to aluminum toxicity in wheat cultivars

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1984-01-01

    Full Text Available Foram estudados nove cultivares de trigo em soluções nutritivas contendo quatro níveis de alumínio (0, 5, 10 e 20mg/litro combinados com três níveis de pH (4,0, 5,0 e 6,0. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após um período de permanência de 48 horas em solução contendo determinados níveis de pH e de alumínio. Os cultivares BH-1146, IAC-18, IAC-13 e C-3 foram tolerantes; IAC-17 e Alondra-4546 foram moderadamente tolerantes, e Síete Cerros, Super-x e CNT-8 foram sensíveis à presença de quantidades crescentes de Al3+ nas soluções de tratamentos quando foi mantido o pH 4,0. Todos os cultivares foram tolerantes às dosagens de alumínio estudadas quando foram mantidos os níveis de pH 5,0 ou 6,0. Ficou confirmado que um controle rigoroso do pH da solução tratamento é um fator de grande importância no estudo da toxicidade do alumínio a diferentes cultivares de trigo.The aluminum tolerance of nine wheat cultivars was studied in nutrient solutions using three different levels of pH combined with four different concentrations of this element. The tolerance was evaluated by measuring the root growth in an aluminum-free complete nutrient solution after a previous treatment in aluminum added solutions (0, 5, 10 and 20mg/l under a particular pH (4.0, 5.0 and 6.0. The wheat cultivars BH-1146, IAC-18, IAC-13 and C-3 presented tolerance, IAC-17 and Alondra-4546 showed moderate tolerance and Siete Cerros, Super-x and CNT-8 were sensitive to the presence of increasing concentrations of Al3+ in the treatment solution under pH 4.0. All cultivars were tolerant to the different concentrations of aluminum under pH 5.0 and 6.0. The aluminum toxicity symptom (inhibition of root growth was dependent on the pH and the amount of aluminum in the treatment solution. For the same level of aluminum, toxicity symptoms increased, when the pH decreased in the solution from 6

  20. PpCBF3 from Cold-Tolerant Kentucky Bluegrass Involved in Freezing Tolerance Associated with Up-Regulation of Cold-Related Genes in Transgenic Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Lili Zhuang

    Full Text Available Dehydration-Responsive Element Binding proteins (DREB/C-repeat (CRT Binding Factors (CBF have been identified as transcriptional activators during plant responses to cold stress. The objective of this study was to determine the physiological roles of a CBF gene isolated from a cold-tolerant perennial grass species, Kentucky bluegrass (Poa pratensis L., which designated as PpCBF3, in regulating plant tolerance to freezing stress. Transient transformation of Arabidopsis thaliana mesophyll protoplast with PpCBF3-eGFP fused protein showed that PpCBF3 was localized to the nucleus. RT-PCR analysis showed that PpCBF3 was specifically induced by cold stress (4°C but not by drought stress [induced by 20% polyethylene glycol 6000 solution (PEG-6000] or salt stress (150 mM NaCl. Transgenic Arabidopsis overexpressing PpCBF3 showed significant improvement in freezing (-20°C tolerance demonstrated by a lower percentage of chlorotic leaves, lower cellular electrolyte leakage (EL and H2O2 and O2.- content, and higher chlorophyll content and photochemical efficiency compared to the wild type. Relative mRNA expression level analysis by qRT-PCR indicated that the improved freezing tolerance of transgenic Arabidopsis plants overexpressing PpCBF3 was conferred by sustained activation of downstream cold responsive (COR genes. Other interesting phenotypic changes in the PpCBF3-transgenic Arabidopsis plants included late flowering and slow growth or 'dwarfism', both of which are desirable phenotypic traits for perennial turfgrasses. Therefore, PpCBF3 has potential to be used in genetic engineering for improvement of turfgrass freezing tolerance and other desirable traits.

  1. Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

    Energy Technology Data Exchange (ETDEWEB)

    Monette, Michelle Y., E-mail: michelle.monette@yale.edu [Organismic and Evolutionary Biology Program, University of Massachusetts, Amherst, MA 01003 (United States); USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376 (United States); Yada, Takashi [Freshwater Fisheries Research Department, National Research Institute of Fisheries Science, Nikko (Japan); Matey, Victoria [Department of Biology, San Diego State University, San Diego, CA 92182 (United States); McCormick, Stephen D. [Organismic and Evolutionary Biology Program, University of Massachusetts, Amherst, MA 01003 (United States); USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376 (United States)

    2010-08-01

    We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4 {mu}g l{sup -1} Al), acid and low Al (LAl: pH 5.4, 11 {mu}g l{sup -1} Al), acid and moderate Al (MAl: pH 5.3, 42 {mu}g l{sup -1} Al), and acid and high Al (HAl: pH 5.4, 56 {mu}g l{sup -1} Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24 h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na{sup +}/K{sup +}-ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl{sup -} channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time

  2. SELEÇÃO PARA TOLERÂNCIA AO ALUMÍNIO EM SOJA TROPICAL SELECTION FOR ALUMINUM TOLERANCE IN TROPICAL SOYBEANS

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Spehar

    2007-09-01

    Full Text Available

    A acidez do solo é fator limitante para a maioria das plantas cultivadas no Cerrado Brasileiro. A toxidez causada por alumínio (Al é especialmente séria na subsuperfície, que permanece ácida após o uso de corretivos, por impedir o crescimento radicular e causar suscetibilidade à seca e desbalanceamento nutricional. Aqui objetivou-se a seleção de genótipos de soja com maior tolerância ao Al, pela associação de experimentos em hidroponia e no campo. Cruzamentos incluindo genótipos selecionados no Cerrado foram realizados. Sementes de indivíduos contrastantes, selecionados em hidroponia na geração F2 pelo crescimento radicular, foram obtidas para avaliação de progênies em F3, no campo, e em F4, novamente em hidroponia. Rendimento de grãos e de biomassa das progênies selecionadas foram superiores aos genitores, no experimento em solo ácido. Esses resultados foram confirmados pelo desempenho em hidroponia, indicando que o método de seleção pode ser empregado com êxito em programas de melhoramento para adaptação de cultivos a condições de acidez subsuperficial do solo.

    PALAVRAS-CHAVE: Acidez sub-superficial; Glycine max; estresse; genótipo; melhoramento de plantas.

    Soil acidity is a limiting factor for most of the cultivated plants in the Brazilian Savannah. Toxicity caused by aluminum (Al is especially serious in the acid subsurface, which remains acidic after soil has been amended, by hindering root growth and causing drought susceptibility and nutritional unbalance. This research aimed at selecting soybean with increased tolerance to Al through association of hydroponics and field experiments. Crosses including savannah adapted genotypes were obtained. Seeds of contrasting individuals, selected in hydroponics at F2 generation for root

  3. Melhoramento do trigo: III. Evidência de controle genético na tolerância ao manganês e alumínio tóxico em trigo Wheat breeding: III. Evidence of genetic control in the tolerance to manganese and aluminum toxicity in wheat

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1983-01-01

    Full Text Available Os cultivares Siete Cerros, tolerante, e BH-1146, sensível a elevadas doses de manganês, foram cruzados, obtendo-se sementes em gerações F1 e F2 desse cruzamento. As plantas dos cultivares pais e das gerações F1 e F2 foram cultivadas em soluções nutritivas contendo doses variadas de manganês (0,11; 300; 600 e 1.200mg/litro e testadas em outra solução nutritiva contendo 3mg/litro de alumínio. O comprimento das raízes primárias centrais das plantas dos genótipos estudados, após quinze dias de cultivo em soluções nutritivas contendo diferentes concentrações de manganês, serviu de base para avaliar a tolerância a esse elemento. Esse comprimento, após 72 horas de crescimento em solução nutritiva normal seguidas de 48 horas de crescimento em solução nutritiva contendo 3mg/litro de alumínio, foi utilizado para a avaliação da tolerância ao alumínio. Os valores da herdabilidade em sentido amplo para a tolerância a concentrações crescentes de manganês e para 3mg/litro de alumínio foram altos, indicando que grande parte da variabilidade encontrada nas populações segregantes para tolerância ao manganês e ao alumínio foram de origem genética, sugerindo que as seleções para estas características seriam efetivas a partir das gerações F2 e F3. Os dados mostraram que seria possível transferir, por meio de cruzamento entre os cultivares BH-1146 e Siete Cerros, a tolerância ao manganês do 'Siete Cerros' para o 'BH-1146' ou a tolerância ao alumínio deste para o 'Siete Cerros'.The cultivar Siete Cerros (P1 with tolerance to manganese toxicity and the cultivar BH-1146 (P2 showing sensitivity to manganese, were crossed. It was obtained the F1 and F2 generations of this cross. P1, P2, F1 and F2, where cultivated in nutrient solutions containing 0.11, 300, 600 and 1,200mg/l of manganese and they also were tested in other nutrient solution with 3mg/l of aluminum. The length of the central primary root of plants of each

  4. Systems biology analysis of gene expression during in vivo Mycobacterium avium paratuberculosis enteric colonization reveals role for immune tolerance.

    Directory of Open Access Journals (Sweden)

    Sangeeta Khare

    Full Text Available Survival and persistence of Mycobacterium avium subsp. paratuberculosis (MAP in the intestinal mucosa is associated with host immune tolerance. However, the initial events during MAP interaction with its host that lead to pathogen survival, granulomatous inflammation, and clinical disease progression are poorly defined. We hypothesize that immune tolerance is initiated upon initial contact of MAP with the intestinal Peyer's patch. To test our hypothesis, ligated ileal loops in neonatal calves were infected with MAP. Intestinal tissue RNAs were collected (0.5, 1, 2, 4, 8 and 12 hrs post-infection, processed, and hybridized to bovine gene expression microarrays. By comparing the gene transcription responses of calves infected with the MAP, informative complex patterns of expression were clearly visible. To interpret these complex data, changes in the gene expression were further analyzed by dynamic Bayesian analysis, and genes were grouped into the specific pathways and gene ontology categories to create a holistic model. This model revealed three different phases of responses: i early (30 min and 1 hr post-infection, ii intermediate (2, 4 and 8 hrs post-infection, and iii late (12 hrs post-infection. We describe here the data that include expression profiles for perturbed pathways, as well as, mechanistic genes (genes predicted to have regulatory influence that are associated with immune tolerance. In the Early Phase of MAP infection, multiple pathways were initiated in response to MAP invasion via receptor mediated endocytosis and changes in intestinal permeability. During the Intermediate Phase, perturbed pathways involved the inflammatory responses, cytokine-cytokine receptor interaction, and cell-cell signaling. During the Late Phase of infection, gene responses associated with immune tolerance were initiated at the level of T-cell signaling. Our study provides evidence that MAP infection resulted in differentially regulated genes, perturbed

  5. De novo transcriptome sequencing and discovery of genes related to copper tolerance in Paeonia ostii.

    Science.gov (United States)

    Wang, Yanjie; Dong, Chunlan; Xue, Zeyun; Jin, Qijiang; Xu, Yingchun

    2016-01-15

    Paeonia ostii, an important ornamental and medicinal plant, grows normally on copper (Cu) mines with widespread Cu contamination of soils, and it has the ability to lower Cu contents in the Cu-contaminated soils. However, very little molecular information concerned with Cu resistance of P. ostii is available. In this study, high-throughput de novo transcriptome sequencing was carried out for P. ostii with and without Cu treatment using Illumina HiSeq 2000 platform. A total of 77,704 All-unigenes were obtained with a mean length of 710 bp. Of these unigenes, 47,461 were annotated with public databases based on sequence similarities. Comparative transcript profiling allowed the discovery of 4324 differentially expressed genes (DEGs), with 2207 up-regulated and 2117 down-regulated unigenes in Cu-treated library as compared to the control counterpart. Based on these DEGs, Gene Ontology (GO) enrichment analysis indicated Cu stress-relevant terms, such as 'membrane' and 'antioxidant activity'. Meanwhile, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis uncovered some important pathways, including 'biosynthesis of secondary metabolites' and 'metabolic pathways'. In addition, expression patterns of 12 selected DEGs derived from quantitative real-time polymerase chain reaction (qRT-PCR) were consistent with their transcript abundance changes obtained by transcriptomic analyses, suggesting that all the 12 genes were authentically involved in Cu tolerance in P. ostii. This is the first report to identify genes related to Cu stress responses in P. ostii, which could offer valuable information on the molecular mechanisms of Cu resistance, and provide a basis for further genomics research on this and related ornamental species for phytoremediation. PMID:26435192

  6. Genome-wide functional profiling reveals genes required for tolerance to benzene metabolites in yeast.

    Directory of Open Access Journals (Sweden)

    Matthew North

    Full Text Available Benzene is a ubiquitous environmental contaminant and is widely used in industry. Exposure to benzene causes a number of serious health problems, including blood disorders and leukemia. Benzene undergoes complex metabolism in humans, making mechanistic determination of benzene toxicity difficult. We used a functional genomics approach to identify the genes that modulate the cellular toxicity of three of the phenolic metabolites of benzene, hydroquinone (HQ, catechol (CAT and 1,2,4-benzenetriol (BT, in the model eukaryote Saccharomyces cerevisiae. Benzene metabolites generate oxidative and cytoskeletal stress, and tolerance requires correct regulation of iron homeostasis and the vacuolar ATPase. We have identified a conserved bZIP transcription factor, Yap3p, as important for a HQ-specific response pathway, as well as two genes that encode putative NAD(PH:quinone oxidoreductases, PST2 and YCP4. Many of the yeast genes identified have human orthologs that may modulate human benzene toxicity in a similar manner and could play a role in benzene exposure-related disease.

  7. Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco.

    Science.gov (United States)

    Zhou, Shiyi; Hu, Wei; Deng, Xiaomin; Ma, Zhanbing; Chen, Lihong; Huang, Chao; Wang, Chen; Wang, Jie; He, Yanzhen; Yang, Guangxiao; He, Guangyuan

    2012-01-01

    Aquaporin (AQP) proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high water channel activity in Xenopus laevis oocytes and TaAQP7 transcript was induced by dehydration, and treatments with polyethylene glycol (PEG), abscisic acid (ABA) and H(2)O(2). Further, TaAQP7 was upregulated after PEG treatment and was blocked by inhibitors of ABA biosynthesis, implying that ABA signaling was involved in the upregulation of TaAQP7 after PEG treatment. Overexpression of TaAQP7 increased drought tolerance in tobacco. The transgenic tobacco lines had lower levels of malondialdehyde (MDA) and H(2)O(2), and less ion leakage (IL), but higher relative water content (RWC) and superoxide dismutase (SOD) and catalase (CAT) activities when compared with the wild type (WT) under drought stress. Taken together, our results show that TaAQP7 confers drought stress tolerance in transgenic tobacco by increasing the ability to retain water, reduce ROS accumulation and membrane damage, and enhance the activities of antioxidants. PMID:23285044

  8. Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Shiyi Zhou

    Full Text Available Aquaporin (AQP proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high water channel activity in Xenopus laevis oocytes and TaAQP7 transcript was induced by dehydration, and treatments with polyethylene glycol (PEG, abscisic acid (ABA and H(2O(2. Further, TaAQP7 was upregulated after PEG treatment and was blocked by inhibitors of ABA biosynthesis, implying that ABA signaling was involved in the upregulation of TaAQP7 after PEG treatment. Overexpression of TaAQP7 increased drought tolerance in tobacco. The transgenic tobacco lines had lower levels of malondialdehyde (MDA and H(2O(2, and less ion leakage (IL, but higher relative water content (RWC and superoxide dismutase (SOD and catalase (CAT activities when compared with the wild type (WT under drought stress. Taken together, our results show that TaAQP7 confers drought stress tolerance in transgenic tobacco by increasing the ability to retain water, reduce ROS accumulation and membrane damage, and enhance the activities of antioxidants.

  9. Transgenic barley overexpressing a cytokinin dehydrogenase gene shows greater tolerance to drought stress.

    Science.gov (United States)

    Pospíšilová, Hana; Jiskrová, Eva; Vojta, Petr; Mrízová, Katarína; Kokáš, Filip; Čudejková, Mária Majeská; Bergougnoux, Veronique; Plíhal, Ondřej; Klimešová, Jana; Novák, Ondřej; Dzurová, Lenka; Frébort, Ivo; Galuszka, Petr

    2016-09-25

    Together with auxins, cytokinins are the main plant hormones involved in many different physiological processes. Given this knowledge, cytokinin levels can be manipulated by genetic modification in order to improve agronomic parameters of cereals in relation to, for example, morphology, yield, and tolerance to various stresses. The barley (Hordeum vulgare) cultivar Golden Promise was transformed using the cytokinin dehydrogenase 1 gene from Arabidopsis thaliana (AtCKX1) under the control of mild root-specific β-glucosidase promoter from maize. Increased cytokinin degradation activity was observed positively to affect the number and length of lateral roots. The impact on morphology depended upon the recombinant protein's subcellular compartmentation. While assumed cytosolic and vacuolar targeting of AtCKX1 had negligible effect on shoot growth, secretion of AtCKX1 protein to the apoplast had a negative effect on development of the aerial part and yield. Upon the application of severe drought stress, all transgenic genotypes maintained higher water content and showed better growth and yield parameters during revitalization. Higher tolerance to drought stress was most caused by altered root morphology resulting in better dehydration avoidance. PMID:26773738

  10. Overexpression of yeast ArDH gene in chloroplasts confers salinity tolerance in plants (abstract)

    International Nuclear Information System (INIS)

    Water stress due to salinity and drought is the main limiting factor for plant growth, productivity and quality. A common response to water deficit is the accumulation of osmoprotectants such as sugars and amino acids. In yeast, arabitol dehydrogenase is found responsible for the production of arabitol from ribulose-5-phosphate. All plants synthesize ribulose-5-phosphate via pentose pathway in chloroplasts.. Therefore, osmotolerance of the plants could be enhanced through metabolic engineering of chloroplasts by introducing ArDH gene into the plastome, which is responsible for the conversion of ribulose-5- phosphate to arabitol. Here we report high-level expression of arabitol dehydrogenase (ArDH) in chloroplasts. Homoplasmic transgenic plants were recovered on spectinomycin-containing regeneration medium. Transformed tobacco plants survived whereas non-transformed were severely stressed or killed when two weeks old seedlings were exposed to NaCl (up to 400 mM), suggesting a role for arabitol in salt tolerance. Seedlings survived up to five weeks on medium containing high salt concentrations (350-400 mM). Nevertheless, seedlings remained green and grew normal on concentrations up to 350 mM NaCl for several weeks. Hypothesis that membranes are protected under stress conditions due to the arabitol accumulation in chloroplasts, seedlings were grown in liquid medium containing polyethylene glycol (PEG, up to 6%). Seedlings were tolerant to 6% PEG, suggesting that ArDH enzyme protects membranes integrity under stress. Therefore, it is concluded that ArDH gene could be expressed in crop plants to withstand abiotic stresses. (author)

  11. Cadmium tolerance and phytochelatin content of Arabidopsis seedlings over-expressing the phytochelatin synthase gene AtPCS1

    Science.gov (United States)

    Brunetti, Patrizia; Zanella, Letizia; Proia, Alessandra; De Paolis, Angelo; Falasca, Giuseppina; Altamura, Maria Maddalena; Sanità di Toppi, Luigi; Costantino, Paolo; Cardarelli, Maura

    2011-01-01

    Previous studies demonstrated that expression of the Arabidopsis phytochelatin (PC) biosynthetic gene AtPCS1 in Nicotiana tabacum plants increases the Cd tolerance in the presence of exogenous glutathione (GSH). In this paper, the Cd tolerance of Arabidopsis plants over-expressing AtPCS1 (AtPCSox lines) has been analysed and the differences between Arabidopsis and tobacco are shown. Based on the analysis of seedling fresh weight, primary root length, and alterations in root anatomy, evidence is provided that, at relatively low Cd concentrations, the Cd tolerance of AtPCSox lines is lower than the wild type, while AtPCS1 over-expressing tobacco is more tolerant to Cd than the wild type. At higher Cd concentrations, Arabidopsis AtPCSox seedlings are more tolerant to Cd than the wild type, while tobacco AtPCS1 seedlings are as sensitive as the wild type. Exogenous GSH, in contrast to what was observed in tobacco, did not increase the Cd tolerance of AtPCSox lines. The PC content in wild-type Arabidopsis at low Cd concentrations is more than three times higher than in tobacco and substantial differences were also found in the PC chain lengths. These data indicate that the differences in Cd tolerance and in its dependence on exogenous GSH between Arabidopsis and tobacco are due to species-specific differences in the endogenous content of PCs and GSH and may be in the relative abundance of PCs of different length. PMID:21841172

  12. Cadmium tolerance and phytochelatin content of Arabidopsis seedlings over-expressing the phytochelatin synthase gene AtPCS1.

    Science.gov (United States)

    Brunetti, Patrizia; Zanella, Letizia; Proia, Alessandra; De Paolis, Angelo; Falasca, Giuseppina; Altamura, Maria Maddalena; Sanità di Toppi, Luigi; Costantino, Paolo; Cardarelli, Maura

    2011-11-01

    Previous studies demonstrated that expression of the Arabidopsis phytochelatin (PC) biosynthetic gene AtPCS1 in Nicotiana tabacum plants increases the Cd tolerance in the presence of exogenous glutathione (GSH). In this paper, the Cd tolerance of Arabidopsis plants over-expressing AtPCS1 (AtPCSox lines) has been analysed and the differences between Arabidopsis and tobacco are shown. Based on the analysis of seedling fresh weight, primary root length, and alterations in root anatomy, evidence is provided that, at relatively low Cd concentrations, the Cd tolerance of AtPCSox lines is lower than the wild type, while AtPCS1 over-expressing tobacco is more tolerant to Cd than the wild type. At higher Cd concentrations, Arabidopsis AtPCSox seedlings are more tolerant to Cd than the wild type, while tobacco AtPCS1 seedlings are as sensitive as the wild type. Exogenous GSH, in contrast to what was observed in tobacco, did not increase the Cd tolerance of AtPCSox lines. The PC content in wild-type Arabidopsis at low Cd concentrations is more than three times higher than in tobacco and substantial differences were also found in the PC chain lengths. These data indicate that the differences in Cd tolerance and in its dependence on exogenous GSH between Arabidopsis and tobacco are due to species-specific differences in the endogenous content of PCs and GSH and may be in the relative abundance of PCs of different length. PMID:21841172

  13. Protein-protein interaction studies revealed genes associated with plant disease resistance and drought tolerance (abstract)

    International Nuclear Information System (INIS)

    Under natural conditions, plants are frequently subjected to biotic and abiotic constraints that cause considerable damage and limit plant productivity worldwide. Biotic and abiotic stresses results in the accumulation of Reactive Oxygen Species, ROS (H/sub 2/O/sub 2/, O/sub 2/), Nitric oxide (NO) and cytosolic calcium (Ca/sup 2), indicating that plant responses to diseases and drought may operate, at least in part, through common molecular pathways. Additionally, stress-inducible genes have been categorized in two different groups: (a) genes that directly protect against environmental stresses and (b) genes that encode protein kinases intriguingly, protein kinases are also involved in disease resistance since many resistance genes (R genes) are in fact kinases. Here, we describe an interactor hunt using the bacterial virulent gene, VirPphA as a bait to screen an Arabidopsis thaliana cDNA prey library. VirPpha shares sequence similarity with another type III effector protein. AvrPtoB. The screen, originally designed to search for key signaling components involved in disease resistance, identified several putative and promising interactors (2-cys peroxiredoxin-like protein, kinase-like protein and ER6 protein, which is a universal stress protein) that might be involved in both biotic and abiotic stress responses. Simultaneously, another screen using AvrPtoB as a bait was conducted searching the same library for common interactors. Fibrillin (Fibri, At4g04020) was identified in both screens indicating a possible involvement in plant disease resistance through its influence on the plant cytoskeleton, which has been implicated in localized defence response. Furthermore, At4g04020 is 82% similar to the Rice fibrillin, At4g22240, which was recently shown to interact the, rice SGT1 (OsSGT1). SGT1 is a gene that is required for multiple R-gene function. Using the yeast two-hybrid system, fibrillin was found to interact strongly with all VirPphA homologues identified in

  14. Transient B cell depletion or improved transgene expression by codon optimization promote tolerance to factor VIII in gene therapy.

    Directory of Open Access Journals (Sweden)

    Brandon K Sack

    Full Text Available The major complication in the treatment of hemophilia A is the development of neutralizing antibodies (inhibitors against factor VIII (FVIII. The current method for eradicating inhibitors, termed immune tolerance induction (ITI, is costly and protracted. Clinical protocols that prevent rather than treat inhibitors are not yet established. Liver-directed gene therapy hopes to achieve long-term correction of the disease while also inducing immune tolerance. We sought to investigate the use of adeno-associated viral (serotype 8 gene transfer to induce tolerance to human B domain deleted FVIII in hemophilia A mice. We administered an AAV8 vector with either human B domain deleted FVIII or a codon-optimized transgene, both under a liver-specific promoter to two strains of hemophilia A mice. Protein therapy or gene therapy was given either alone or in conjunction with anti-CD20 antibody-mediated B cell depletion. Gene therapy with a low-expressing vector resulted in sustained near-therapeutic expression. However, supplementary protein therapy revealed that gene transfer had sensitized mice to hFVIII in a high-responder strain but not in mice of a low-responding strain. This heightened response was ameliorated when gene therapy was delivered with anti-murine CD20 treatment. Transient B cell depletion prevented inhibitor formation in protein therapy, but failed to achieve a sustained hypo-responsiveness. Importantly, use of a codon-optimized hFVIII transgene resulted in sustained therapeutic expression and tolerance without a need for B cell depletion. Therefore, anti-CD20 may be beneficial in preventing vector-induced immune priming to FVIII, but higher levels of liver-restricted expression are preferred for tolerance.

  15. Structural characterization of the thermally-tolerant pectin methylesterase purified from Citrus sinensis fruit and its gene sequence

    Science.gov (United States)

    Despite the longstanding importance for the thermally-tolerant pectin methylesterase (TT-PME) activity in citrus juice processing and product quality, unequivocal identification of the protein and its corresponding gene has remained elusive. We purified TT-PME from sweet orange [Citrus sinensis (L.)...

  16. Identification of markers linked to genes for sprouting tolerance (independent of grain color) in hard white winter wheat (HWWW)

    Science.gov (United States)

    Identification of markers linked to genes for sprouting tolerance (independent of grain color) in hard white winter wheat (HWWW) ABSTRACT Pre-harvest sprouting (PHS) of wheat (Triticum aestivum L.) can negatively impact end-use quality and seed viability at planting. Due to preferences for white ...

  17. A novel gene, lstC, of Listeria monocytogenes is implicated in high salt tolerance.

    Science.gov (United States)

    Burall, Laurel S; Simpson, Alexandra C; Chou, Luoth; Laksanalamai, Pongpan; Datta, Atin R

    2015-06-01

    Listeria monocytogenes, causative agent of human listeriosis, has been isolated from a wide variety of foods including deli meats, soft cheeses, cantaloupes, sprouts and canned mushrooms. Standard control measures for restricting microbial growth such as refrigeration and high salt are often inadequate as L. monocytogenes grows quite well in these environments. In an effort to better understand the genetic and physiological basis by which L. monocytogenes circumvents these controls, a transposon library of L. monocytogenes was screened for changes in their ability to grow in 7% NaCl and/ or at 5 °C. This work identified a transposon insertion upstream of an operon, here named lstABC, that led to a reduction in growth in 7% NaCl. In-frame deletion studies identified lstC which codes for a GNAT-acetyltransferase being responsible for the phenotype. Transcriptomic and RT-PCR analyses identified nine genes that were upregulated in the presence of high salt in the ΔlstC mutant. Further analysis of lstC and the genes affected by ΔlstC is needed to understand LstC's role in salt tolerance. PMID:25790994

  18. The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms

    DEFF Research Database (Denmark)

    Nilsson, Martin; Rybtke, Morten; Givskov, Michael;

    2016-01-01

    Microbial biofilms are tolerant to antibiotic treatment and therefore cause problematic infections. Knowledge about the molecular mechanisms underlying biofilm-associated antimicrobial tolerance will aid the development of antibiofilm drugs. Screening of a Streptococcus mutans transposon mutant...

  19. Overexpression of WsSGTL1 gene of Withania somnifera enhances salt tolerance, heat tolerance and cold acclimation ability in transgenic Arabidopsis plants.

    Directory of Open Access Journals (Sweden)

    Manoj K Mishra

    Full Text Available BACKGROUND: Sterol glycosyltrnasferases (SGT are enzymes that glycosylate sterols which play important role in plant adaptation to stress and are medicinally important in plants like Withania somnifera. The present study aims to find the role of WsSGTL1 which is a sterol glycosyltransferase from W. somnifera, in plant's adaptation to abiotic stress. METHODOLOGY: The WsSGTL1 gene was transformed in Arabidopsis thaliana through Agrobacterium mediated transformation, using the binary vector pBI121, by floral dip method. The phenotypic and physiological parameters like germination, root length, shoot weight, relative electrolyte conductivity, MDA content, SOD levels, relative electrolyte leakage and chlorophyll measurements were compared between transgenic and wild type Arabidopsis plants under different abiotic stresses--salt, heat and cold. Biochemical analysis was done by HPLC-TLC and radiolabelled enzyme assay. The promoter of the WsSGTL1 gene was cloned by using Genome Walker kit (Clontech, USA and the 3D structures were predicted by using Discovery Studio Ver. 2.5. RESULTS: The WsSGTL1 transgenic plants were confirmed to be single copy by Southern and homozygous by segregation analysis. As compared to WT, the transgenic plants showed better germination, salt tolerance, heat and cold tolerance. The level of the transgene WsSGTL1 was elevated in heat, cold and salt stress along with other marker genes such as HSP70, HSP90, RD29, SOS3 and LEA4-5. Biochemical analysis showed the formation of sterol glycosides and increase in enzyme activity. When the promoter of WsSGTL1 gene was cloned from W. somnifera and sequenced, it contained stress responsive elements. Bioinformatics analysis of the 3D structure of the WsSGTL1 protein showed functional similarity with sterol glycosyltransferase AtSGT of A. thaliana. CONCLUSIONS: Transformation of WsSGTL1 gene in A. thaliana conferred abiotic stress tolerance. The promoter of the gene in W.somnifera was found

  20. The hangover gene defines a stress pathway required for ethanol tolerance development

    OpenAIRE

    Scholz, Henrike; Franz, Mirjam; Heberlein, Ulrike

    2005-01-01

    Repeated alcohol consumption leads to the development of tolerance, simply defined as an acquired resistance to the physiological and behavioral effects of the drug. This tolerance allows increased alcohol consumption, which over time leads to physical dependence and possibly addiction1–3. Previous studies showed that Drosophila develop ethanol tolerance with kinetics of acquisition and dissipation that mimic those seen in mammals. This tolerance requires the catecholamine octopamine, the fun...

  1. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    Directory of Open Access Journals (Sweden)

    Yu Agnes

    2008-12-01

    Full Text Available Abstract Background Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying potential targets for plant breeding. Drought tolerance in the field was successfully conferred to crops by transferring genes from this model species. While involved in a plant genomics programme, which aims to identify new genes responsible for plant response to abiotic stress, we identified ESKIMO1 as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE, which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis of one mutant line and its wild-type background was carried out. Under control watering conditions a number of genes were differentially expressed between the mutant and the wild type whereas under mild drought stress this list of genes was reduced. Among the genes that were differentially expressed between the wild type and mutant, two functional categories related to the response to stress or biotic and abiotic stimulus were over-represented. Under salt stress conditions, all gene functional categories were represented equally in both the mutant and wild type. Based on this transcriptome analysis we hypothesise that in control conditions the esk1 mutant behaves as if it was exposed to drought stress. Conclusion Overall our findings suggest that the

  2. Aspergillus glaucus Aquaglyceroporin Gene glpF Confers High Osmosis Tolerance in Heterologous Organisms.

    Science.gov (United States)

    Liu, Xiao-Dan; Wei, Yi; Zhou, Xiao-Yang; Pei, Xue; Zhang, Shi-Hong

    2015-10-01

    Aquaglyceroporins (GlpFs) that transport glycerol along with water and other uncharged solutes are involved in osmoregulation in myriad species. Fungal species form a large group of eukaryotic organisms, and their GlpFs may be diverse, exhibiting various activities. However, few filamentous fungal GlpFs have been biologically investigated. Here, a glpF gene from the halophilic fungus Aspergillus glaucus (AgglpF) was verified to be a channel of water or glycerol in Xenopus laevis oocytes and was further functionally analyzed in three heterologous systems. In Saccharomyces cerevisiae, cells overexpressing AgglpF possessed significant tolerance of drought, salt, and certain metal ions. AgglpF was then characterized in the filamentous fungus of Neurospora crassa. Based on the N. crassa aquaporin gene (NcAQP) disruption mutant (the Δaqp mutant), a series of complementary strains carrying NcAQP and AgglpF and three asparagine-proline-alanine-gene (NPA)-deleted AgglpF fragments were created. As revealed by salt resistance analysis, the AgglpF complementary strain possessed the highest salt resistance among the tested strains. In addition, the intracellular glycerol content in the AgglpF complementary strain was markedly higher than that in the other strains. The AgGlpF-green fluorescent protein (GFP) fusion protein was subcellularly localized in the plasma membrane of onion epidermal cells, suggesting that AgglpF functions in plants. Indeed, when AgglpF was expressed in Arabidopsis thaliana, transgenic lines survived under conditions of high osmotic stress and under conditions of drought stress in particular. Overall, our results revealed that AgGlpF as a water/glycerol transporter is required for survival of both fungi and plants under conditions of high osmotic stress and may have value in applications in genetic engineering for generating high salt and drought resistance. PMID:26209670

  3. [Analysis of gene loci and epistasis for drought tolerance in seedling stage of rice (Oryza sativa L.)].

    Science.gov (United States)

    Teng, Sheng; Qian, Qian; Zeng, Da-Li; Kunihiro, Yasufumi; Fujimoto, Kan; Huang, Da-Nian; Zhu, Li-Huang

    2002-01-01

    Drought tolerance of rice is important because a considerable proportion of the world rice area is not irrigated and is prone to water deficit. In this study, an indica variety, Zhai Ye Qing 8 (ZYQ8), and a japonica variety, Jing Xi 17 (JX17), and their double haploid (DH) population were used for genetic study of drought tolerance. Water supply was stopped in seedling period for 15 days and then drought tolerance of the DH population and their parents were investigated. Mapping quantitative trait loci (QTLs) was undertaken base on the constructed molecular linkage map of this population. Two QTLs (qDR-5 and qDR-12) for drought tolerance were identified, they were in the region of GA41-GA257 on chromosome 5 and RG457-Y12817R on chromosome 12, respectively. The tolerance alleles of both QTLs were from the indica parent, ZYQ8. In the meantime two genes for drought tolerance near GA257 and Y12817R were detected too by using Epistat software, that is in accordance with the result by using Mapmaker/QTL. In addition, three loci (RG541, G318 and G192 on chromosome 1, 4 and 8, respectively) were found interacting with GA257 by Epistat software, while one locus (CT234 on chromosome 3) found interacting with Y12817R were also detected by Epistat software. PMID:12182078

  4. A rice stress-responsive NAC gene enhances tolerance of transgenic wheat to drought and salt stresses.

    Science.gov (United States)

    Saad, Abu Sefyan I; Li, Xu; Li, He-Ping; Huang, Tao; Gao, Chun-Sheng; Guo, Mao-Wei; Cheng, Wei; Zhao, Guang-Yao; Liao, Yu-Cai

    2013-04-01

    Drought and salinity are the primary factors limiting wheat production worldwide. It has been shown that a rice stress-responsive transcription factor encoded by the rice NAC1 gene (SNAC1) plays an important role in drought stress tolerance. Therefore, we introduced the SNAC1 gene under the control of a maize ubiquitin promoter into an elite Chinese wheat variety Yangmai12. Plants expressing SNAC1 displayed significantly enhanced tolerance to drought and salinity in multiple generations, and contained higher levels of water and chlorophyll in their leaves, as compared to wild type. In addition, the fresh and dry weights of the roots of these plants were also increased, and the plants had increased sensitivities to abscisic acid (ABA), which inhibited root and shoot growth. Furthermore, quantitative real-time polymerase chain reactions revealed that the expressions of genes involved in abiotic stress/ABA signaling, such as wheat 1-phosphatidylinositol-3-phosphate-5-kinase, sucrose phosphate synthase, type 2C protein phosphatases and regulatory components of ABA receptor, were effectively regulated by the alien SNAC1 gene. These results indicated high and functional expression of the rice SNAC1 gene in wheat. And our study provided a promising approach to improve the tolerances of wheat cultivars to drought and salinity through genetic engineering. PMID:23415326

  5. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum) Seedlings and Identification of Salt Tolerance Genes

    Science.gov (United States)

    Liu, Jiangtao; Zhou, Yuelong; Luo, Changxin; Xiang, Yun; An, Lizhe

    2016-01-01

    Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS) technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf transcriptome of A. splendens obtained using an Illumina HiSeq 2500. Over 35 million clean reads were obtained from the leaf and root libraries. All of the RNA sequencing (RNA-seq) reads were assembled de novo into a total of 126,235 unigenes and 36,511 coding DNA sequences (CDS). We further identified 1663 differentially-expressed genes (DEGs) between the salt stress treatment and control. Functional annotation of the DEGs by gene ontology (GO), using Arabidopsis and rice as references, revealed enrichment of salt stress-related GO categories, including “oxidation reduction”, “transcription factor activity”, and “ion channel transporter”. Thus, this global transcriptome analysis of A. splendens has provided an important genetic resource for the study of salt tolerance in this halophyte. The identified sequences and their putative functional data will facilitate future investigations of the tolerance of Achnatherum species to various types of abiotic stress. PMID:27023614

  6. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum Seedlings and Identification of Salt Tolerance Genes

    Directory of Open Access Journals (Sweden)

    Jiangtao Liu

    2016-03-01

    Full Text Available Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf transcriptome of A. splendens obtained using an Illumina HiSeq 2500. Over 35 million clean reads were obtained from the leaf and root libraries. All of the RNA sequencing (RNA-seq reads were assembled de novo into a total of 126,235 unigenes and 36,511 coding DNA sequences (CDS. We further identified 1663 differentially-expressed genes (DEGs between the salt stress treatment and control. Functional annotation of the DEGs by gene ontology (GO, using Arabidopsis and rice as references, revealed enrichment of salt stress-related GO categories, including “oxidation reduction”, “transcription factor activity”, and “ion channel transporter”. Thus, this global transcriptome analysis of A. splendens has provided an important genetic resource for the study of salt tolerance in this halophyte. The identified sequences and their putative functional data will facilitate future investigations of the tolerance of Achnatherum species to various types of abiotic stress.

  7. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum) Seedlings and Identification of Salt Tolerance Genes.

    Science.gov (United States)

    Liu, Jiangtao; Zhou, Yuelong; Luo, Changxin; Xiang, Yun; An, Lizhe

    2016-01-01

    Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS) technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf transcriptome of A. splendens obtained using an Illumina HiSeq 2500. Over 35 million clean reads were obtained from the leaf and root libraries. All of the RNA sequencing (RNA-seq) reads were assembled de novo into a total of 126,235 unigenes and 36,511 coding DNA sequences (CDS). We further identified 1663 differentially-expressed genes (DEGs) between the salt stress treatment and control. Functional annotation of the DEGs by gene ontology (GO), using Arabidopsis and rice as references, revealed enrichment of salt stress-related GO categories, including "oxidation reduction", "transcription factor activity", and "ion channel transporter". Thus, this global transcriptome analysis of A. splendens has provided an important genetic resource for the study of salt tolerance in this halophyte. The identified sequences and their putative functional data will facilitate future investigations of the tolerance of Achnatherum species to various types of abiotic stress. PMID:27023614

  8. Cloning and expression pattern of a dehydrin-like BDN1 gene from drought-tolerant Boea crassifolia Hemsl.

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A 500-bp cDNA fragment was amplified via RT-PCR from drought-induced total RNA of the drought-tolerant B. crassifolia Hemsl. using primers based on the sequence of published dehydrin conserved region. By using 5′RACE, full-length coding region (1 148 bp) of BDN1 gene was produced. It is a new member of the dehydrin gene family. Southern analysis indicated that BDN1 is present in the B. crassifolia genome as a single-copy gene. Northern analysis revealed that its expression is inducible by drought and cold stresses as well as ABA application.

  9. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    International Nuclear Information System (INIS)

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance

  10. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  11. Over-expression of histone H3K4 demethylase gene JMJ15 enhances salt tolerance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Yuan eShen

    2014-06-01

    Full Text Available Histone H3 lysine 4 trimethylation (H3K4me3 has been shown to be involved in stress-responsive gene expression and gene priming in plants. However, the role of H3K4me3 resetting in the processes is not clear. In this work we studied the expression and function of Arabidopsis H3K4 demethylase gene JMJ15. We show that the expression of JMJ15 was relatively low and was limited to a number of tissues during vegetative growth but was higher in young floral organs. Over-expression of the gene in gain-of-function mutants reduced the plant height with accumulation of lignin in stems, while the loss-of-function mutation did not produce any visible phenotype. The gain-of-function mutants showed enhanced salt tolerance, whereas the loss-of-function mutant was more sensitive to salt compared to the wild type. Transcriptomic analysis revealed that over-expression of JMJ15 down-regulated many genes which are preferentially marked by H3K4me3 and H3K4me2. Many of the down-regulated genes encode transcription regulators involved in stress responses. The data suggest that increased JMJ15 levels may regulate the gene expression program that enhances stress tolerance.

  12. Improving freeze-tolerance of baker's yeast through seamless gene deletion of NTH1 and PUT1.

    Science.gov (United States)

    Dong, Jian; Chen, Didi; Wang, Guanglu; Zhang, Cuiying; Du, Liping; Liu, Shanshan; Zhao, Yu; Xiao, Dongguang

    2016-06-01

    Baker's yeast strains with freeze-tolerance are highly desirable to maintain high leavening ability after freezing. Enhanced intracellular concentration of trehalose and proline in yeast is linked with freeze-tolerance. In this study, we constructed baker's yeast with enhanced freeze-tolerance by simultaneous deletion of the neutral trehalase-encoded gene NTH1 and the proline oxidase-encoded gene PUT1. We first used the two-step integration-based seamless gene deletion method to separately delete NTH1 and PUT1 in haploid yeast. Subsequently, through two rounds of hybridization and sporulation-based allelic exchange and colony PCR-mediated tetrad analysis, we obtained strains with restored URA3 and deletion of NTH1 and/or PUT1. The resulting strain showed higher cell survival and dough-leavening ability after freezing compared to the wild-type strain due to enhanced accumulation of trehalose and/or proline. Moreover, mutant with simultaneous deletion of NTH1 and PUT1 exhibits the highest relative dough-leavening ability after freezing compared to mutants with single-gene deletion perhaps due to elevated levels of both trehalose and proline. These results verified that it is applicable to construct frozen dough baker's yeast using the method proposed in this paper. PMID:26965428

  13. TaASR1, a transcription factor gene in wheat, confers drought stress tolerance in transgenic tobacco.

    Science.gov (United States)

    Hu, Wei; Huang, Chao; Deng, Xiaomin; Zhou, Shiyi; Chen, Lihong; Li, Yin; Wang, Cheng; Ma, Zhanbing; Yuan, Qianqian; Wang, Yan; Cai, Rui; Liang, Xiaoyu; Yang, Guangxiao; He, Guangyuan

    2013-08-01

    Abscisic acid (ABA)-, stress-, and ripening-induced (ASR) proteins are reported to be involved in abiotic stresses. However, it is not known whether ASR genes confer drought stress tolerance by utilizing the antioxidant system. In this study, a wheat ASR gene, TaASR1, was cloned and characterized. TaASR1 transcripts increased after treatments with PEG6000, ABA and H(2)O(2). Overexpression of TaASR1 in tobacco resulted in increased drought/osmotic tolerance, which was demonstrated that transgenic lines had lesser malondialdehyde (MDA), ion leakage (IL) and reactive oxygen species (ROS), but higher relative water content (RWC) and superoxide dismutase (SOD) and catalase (CAT) activities than wild type (WT) under drought stress. Overexpression of TaASR1 in tobacco also enhanced the expression of ROS-related and stress-responsive genes under osmotic stress. In addition, transgenic lines exhibited improved tolerance to oxidative stress by retaining more effective antioxidant system. Finally, TaASR1 was localized in the cell nucleus and functioned as a transcriptional activator. Taken together, our results showed that TaASR1 functions as a positive factor under drought/osmotic stress, involved in the regulation of ROS homeostasis by activating antioxidant system and transcription of stress-associated genes. PMID:23356734

  14. Transgenic tobacco plants overexpressing a grass PpEXP1 gene exhibit enhanced tolerance to heat stress.

    Directory of Open Access Journals (Sweden)

    Qian Xu

    Full Text Available Heat stress is a detrimental abiotic stress limiting the growth of many plant species and is associated with various cellular and physiological damages. Expansins are a family of proteins which are known to play roles in regulating cell wall elongation and expansion, as well as other growth and developmental processes. The in vitro roles of expansins regulating plant heat tolerance are not well understood. The objectives of this study were to isolate and clone an expansin gene in a perennial grass species (Poa pratensis and to determine whether over-expression of expansin may improve plant heat tolerance. Tobacco (Nicotiana tabacum was used as the model plant for gene transformation and an expansin gene PpEXP1 from Poa pratensis was cloned. Sequence analysis showed PpEXP1 belonged to α-expansins and was closely related to two expansin genes in other perennial grass species (Festuca pratensis and Agrostis stolonifera as well as Triticum aestivum, Oryza sativa, and Brachypodium distachyon. Transgenic tobacco plants over-expressing PpEXP1 were generated through Agrobacterium-mediated transformation. Under heat stress (42°C in growth chambers, transgenic tobacco plants over-expressing the PpEXP1 gene exhibited a less structural damage to cells, lower electrolyte leakage, lower levels of membrane lipid peroxidation, and lower content of hydrogen peroxide, as well as higher chlorophyll content, net photosynthetic rate, relative water content, activity of antioxidant enzyme, and seed germination rates, compared to the wild-type plants. These results demonstrated the positive roles of PpEXP1 in enhancing plant tolerance to heat stress and the possibility of using expansins for genetic modification of cool-season perennial grasses in the development of heat-tolerant germplasm and cultivars.

  15. Transgenic tobacco plants overexpressing a grass PpEXP1 gene exhibit enhanced tolerance to heat stress.

    Science.gov (United States)

    Xu, Qian; Xu, Xiao; Shi, Yang; Xu, Jichen; Huang, Bingru

    2014-01-01

    Heat stress is a detrimental abiotic stress limiting the growth of many plant species and is associated with various cellular and physiological damages. Expansins are a family of proteins which are known to play roles in regulating cell wall elongation and expansion, as well as other growth and developmental processes. The in vitro roles of expansins regulating plant heat tolerance are not well understood. The objectives of this study were to isolate and clone an expansin gene in a perennial grass species (Poa pratensis) and to determine whether over-expression of expansin may improve plant heat tolerance. Tobacco (Nicotiana tabacum) was used as the model plant for gene transformation and an expansin gene PpEXP1 from Poa pratensis was cloned. Sequence analysis showed PpEXP1 belonged to α-expansins and was closely related to two expansin genes in other perennial grass species (Festuca pratensis and Agrostis stolonifera) as well as Triticum aestivum, Oryza sativa, and Brachypodium distachyon. Transgenic tobacco plants over-expressing PpEXP1 were generated through Agrobacterium-mediated transformation. Under heat stress (42°C) in growth chambers, transgenic tobacco plants over-expressing the PpEXP1 gene exhibited a less structural damage to cells, lower electrolyte leakage, lower levels of membrane lipid peroxidation, and lower content of hydrogen peroxide, as well as higher chlorophyll content, net photosynthetic rate, relative water content, activity of antioxidant enzyme, and seed germination rates, compared to the wild-type plants. These results demonstrated the positive roles of PpEXP1 in enhancing plant tolerance to heat stress and the possibility of using expansins for genetic modification of cool-season perennial grasses in the development of heat-tolerant germplasm and cultivars. PMID:25003197

  16. Evaluation of potential candidate genes involved in salinity tolerance in striped catfish (Pangasianodon hypophthalmus) using an RNA-Seq approach.

    Science.gov (United States)

    Nguyen, Tuan Viet; Jung, Hyungtaek; Nguyen, Thanh Minh; Hurwood, David; Mather, Peter

    2016-02-01

    Increasing salinity levels in freshwater and coastal environments caused by sea level rise linked to climate change is now recognized to be a major factor that can impact fish growth negatively, especially for freshwater teleost species. Striped catfish (Pangasianodon hypophthalmus) is an important freshwater teleost that is now widely farmed across the Mekong River Delta in Vietnam. Understanding the basis for tolerance and adaptation to raised environmental salinity conditions can assist the regional culture industry to mitigate predicted impacts of climate change across this region. Attempt of next generation sequencing using the ion proton platform results in more than 174 million raw reads from three tissue libraries (gill, kidney and intestine). Reads were filtered and de novo assembled using a variety of assemblers and then clustered together to generate a combined reference transcriptome. Downstream analysis resulted in a final reference transcriptome that contained 60,585 transcripts with an N50 of 683 bp. This resource was further annotated using a variety of bioinformatics databases, followed by differential gene expression analysis that resulted in 3062 transcripts that were differentially expressed in catfish samples raised under two experimental conditions (0 and 15 ppt). A number of transcripts with a potential role in salinity tolerance were then classified into six different functional gene categories based on their gene ontology assignments. These included; energy metabolism, ion transportation, detoxification, signal transduction, structural organization and detoxification. Finally, we combined the data on functional salinity tolerance genes into a hypothetical schematic model that attempted to describe potential relationships and interactions among target genes to explain the molecular pathways that control adaptive salinity responses in P. hypophthalmus. Our results indicate that P. hypophthalmus exhibit predictable plastic regulatory responses

  17. Tolerância de genótipos de trigo comum, trigo duro e triticale à toxicidade de alumínio em soluções nutritivas Tolerance of bread wheat, durum wheat and triticale genotypes to aluminum toxicity in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    2006-01-01

    Full Text Available Foi estudado o comportamento diferencial de 12 genótipos de trigo comum (Triticum aestivum L., um genótipo de trigo duro (Triticum durum L., e um de triticale (Triticosecale sp em soluções nutritivas de tratamento contendo duas concentrações salinas (1/5 e 1/10 da completa e seis concentrações de alumínio ( 0, 2, 4, 6, 8 e 10 mg L-1, à temperatura de 25 ± 1ºC e pH 4,0. Foram utilizadas dez plântulas por parcela e quatro repetições. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após permanecer 48 horas em solução nutritiva completa, contendo uma concentração conhecida de alumínio combinada com cada uma das concentrações salinas. Os genótipos de trigo comum IAC-289, IAC-350 e IAC-370 e a cultivar controle Anahuac, e os genótipos de trigo duro IAC-1003 e de triticale IAC-5 foram os mais sensíveis a níveis crescentes de Al3+nas soluções nutritivas de tratamento e, portanto, somente seriam indicados para cultivo em solos corrigidos. Os genótipos de trigo comum IAC-24 e IAC-378 e a cultivar controle BH-1146 destacaram-se pela tolerância à toxicidade de Al3+, com potencial para uso em solos ácidos e como fontes genéticas de tolerância nos futuros cruzamentos. Os sintomas de toxicidade de alumínio foram maiores com a elevação da concentração de alumínio e da diminuição das concentrações de sais da solução nutritiva para todos os genótipos estudados.Twelve bread wheat (Triticum aestivum L., one durum wheat (Triticum durum L. and one triticale (Triticosecale sp genotypes were studied in nutrient solutions with a high salt concentration in experiment 1 and a weak salt concentration in experiment 2, for aluminum tolerance at six levels: 0, 2, 4, 6, 8 and 10 mg L-1, under temperature 25 ± 1ºC and pH 4,0. Four replications were used per experiment. Aluminum tolerance was evaluated by measuring root growth in an aluminum-free complete

  18. Expression responses of five cold tolerant related genes to two temperature dropping treatments in sea cucumber Apostichopus japonicus

    Science.gov (United States)

    Li, Chengze; Chang, Yaqing; Pang, Zhenguo; Ding, Jun; Ji, Nanjing

    2015-03-01

    Environmental conditions, including ambient temperature, play important roles in survival, growth development, and reproduction of the Japanese sea cucumber, Apostichopus japonicus. Low temperatures result in slowed growth and skin ulceration disease. In a previous study, we investigated the effect of low temperature on gene expression profiles in A. japonicus by suppression subtractive hybridization (SSH). Genes encoding Ferritin, Lysozyme, Hsp70, gp96, and AjToll were selected from a subtracted cDNA library of A. japonicus under acute cold stress. The transcriptional expression profiles of these genes were investigated in different tissues (coelomocyte, respiratory tree, intestine, longitudinal muscle) after exposure to acute and mild temperature dropping treatments. The results show that (1) the five cold-tolerance-related genes were found in all four tissues and the highest mRNA levels were observed in coelomocyte and respiratory tree; (2) under the temperature dropping treatments, three types of transcriptional regulation patterns were observed: primary suppression followed by up-regulation at -2°C, suppressed expression throughout the two treatments, and more rarely an initial stimulation followed by suppression; and (3) gene expression suppression was more severe under acute temperature dropping than under mild temperature dropping treatment. The five cold-tolerance-related genes that were distributed mainly in coelomocyte and respiratory tissues were generally down-regulated by low temperature stress but an inverse up-regulation event was found at the extreme temperature (-2°C).

  19. Down-regulation of CBP80 gene expression as a strategy to engineer a drought-tolerant potato.

    Science.gov (United States)

    Pieczynski, Marcin; Marczewski, Waldemar; Hennig, Jacek; Dolata, Jakub; Bielewicz, Dawid; Piontek, Paulina; Wyrzykowska, Anna; Krusiewicz, Dominika; Strzelczyk-Zyta, Danuta; Konopka-Postupolska, Dorota; Krzeslowska, Magdalena; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

    2013-05-01

    Developing new strategies for crop plants to respond to drought is crucial for their innovative breeding. The down-regulation of nuclear cap-binding proteins in Arabidopsis renders plants drought tolerant. The CBP80 gene in the potato cultivar Desiree was silenced using artificial microRNAs. Transgenic plants displayed a higher tolerance to drought, ABA-hypersensitive stomatal closing, an increase in leaf stomata and trichome density, and compact cuticle structures with a lower number of microchannels. These findings were correlated with a higher tolerance to water stress. The level of miR159 was decreased, and the levels of its target mRNAs MYB33 and MYB101 increased in the transgenic plants subjected to drought. Similar trends were observed in an Arabidopsis cbp80 mutant. The evolutionary conservation of CBP80, a gene that plays a role in the response to drought, suggests that it is a candidate for genetic manipulations that aim to obtain improved water-deficit tolerance of crop plants. PMID:23231480

  20. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  1. Expression of the Autoimmune Regulator Gene and Its Relevance to the Mechanisms of Central and Peripheral Tolerance

    Directory of Open Access Journals (Sweden)

    Roberto Perniola

    2012-01-01

    Full Text Available The autoimmune polyendocrine syndrome type 1 (APS-1 is a monogenic disease due to pathogenic variants occurring in the autoimmune regulator (AIRE gene. Its related protein, AIRE, activates the transcription of genes encoding for tissue-specific antigens (TsAgs in a subset of medullary thymic epithelial cells: the presentation of TsAgs to the maturating thymocytes induces the apoptosis of the autoreactive clones and constitutes the main form of central tolerance. Dysregulation of thymic AIRE expression in genetically transmitted and acquired diseases other than APS-1 may contribute to further forms of autoimmunity. As AIRE and its murine homolog are also expressed in the secondary lymphoid organs, the extent and relevance of AIRE participation in the mechanisms of peripheral tolerance need to be thoroughly defined.

  2. Induction of immune tolerance to FIX by intramuscular AAV gene transfer is independent of the activation status of dendritic cells

    OpenAIRE

    Bharadwaj, Arpita S; Kelly, Meagan; Kim, Dongsoo; Chao, Hengjun

    2010-01-01

    The nature of viral vectors is suggested to be a significant contributor to undesirable immune responses subsequent to gene transfer. Such viral vectors, recognized as danger signals by the host immune system, activate dendritic cells (DCs), causing unwanted antivector and/or transgene product immunity. We recently reported efficient induction of immune tolerance to coagulation factor IX (FIX) by direct intramuscular injection of adeno-associated virus (AAV)–FIX. AAV vectors are nonpathogenic...

  3. Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene

    OpenAIRE

    Karaba, A.; Dixit, S.A.; Greco, Raffaella; Aharoni, A.; Trijatmiko, K.R.; Marsch-Martinez, N.; Krishnan, A; Nataraja, K.N.; Udayakumar, M.; A.B. Pereira

    2007-01-01

    Freshwater is a limited and dwindling global resource; therefore, efficient water use is required for food crops that have high water demands, such as rice, or for the production of sustainable energy biomass. We show here that expression of the Arabidopsis HARDY (HRD) gene in rice improves water use efficiency, the ratio of biomass produced to the water used, by enhancing photosynthetic assimilation and reducing transpiration. These drought-tolerant, low-water-consuming rice plants exhibit i...

  4. DAF-16 and Δ9 desaturase genes promote cold tolerance in long-lived Caenorhabditis elegans age-1 mutants.

    Directory of Open Access Journals (Sweden)

    Fiona R Savory

    Full Text Available In Caenorhabditis elegans, mutants of the conserved insulin/IGF-1 signalling (IIS pathway are long-lived and stress resistant due to the altered expression of DAF-16 target genes such as those involved in cellular defence and metabolism. The three Δ(9 desaturase genes, fat-5, fat-6 and fat-7, are included amongst these DAF-16 targets, and it is well established that Δ(9 desaturase enzymes play an important role in survival at low temperatures. However, no assessment of cold tolerance has previously been reported for IIS mutants. We demonstrate that long-lived age-1(hx546 mutants are remarkably resilient to low temperature stress relative to wild type worms, and that this is dependent upon daf-16. We also show that cold tolerance following direct transfer to low temperatures is increased in wild type worms during the facultative, daf-16 dependent, dauer stage. Although the cold tolerant phenotype of age-1(hx546 mutants is predominantly due to the Δ(9 desaturase genes, additional transcriptional targets of DAF-16 are also involved. Surprisingly, survival of wild type adults following a rapid temperature decline is not dependent upon functional daf-16, and cellular distributions of a DAF-16::GFP fusion protein indicate that DAF-16 is not activated during low temperature stress. This suggests that cold-induced physiological defences are not specifically regulated by the IIS pathway and DAF-16, but expression of DAF-16 target genes in IIS mutants and dauers is sufficient to promote cross tolerance to low temperatures in addition to other forms of stress.

  5. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  6. Conserved synteny at the protein family level reveals genes underlying Shewanella species cold tolerance and predicts their novel phenotypes

    Energy Technology Data Exchange (ETDEWEB)

    Karpinets, Tatiana V.; Obraztsova, Anna; Wang, Yanbing; Schmoyer, Denise D.; Kora, Guruprasad; Park, Byung H.; Serres, Margrethe H.; Romine, Margaret F.; Land, Miriam L.; Kothe, Terence B.; Fredrickson, Jim K.; Nealson, Kenneth H.; Uberbacher, Edward

    2010-03-01

    Bacteria of the genus Shewanella can thrive in different environments and demonstrate significant variability in their metabolic and ecophysiological capabilities including cold and salt tolerance. Genomic characteristics underlying this variability across species are largely unknown. In this study we address the problem by a comparison of the physiological, metabolic and genomic characteristics of 19 sequenced Shewanella species. We have employed two novel approaches based on association of a phenotypic trait with the number of the trait-specific protein families (Pfam domains) and on the conservation of synteny (order in the genome) of the trait-related genes. Our first approach is top-down and involves experimental evaluation and quantification of the species’ cold tolerance followed by identification of the correlated Pfam domains and genes with a conserved synteny. The second, a bottom-up approach, predicts novel phenotypes of the species by calculating profiles of each Pfam domain among their genomes and following pair-wise correlation of the profiles and their network clustering. Using the first approach we find a link between cold and salt tolerance of the species and the presence in the genome of a Na+/H+ antiporter gene cluster. Other cold tolerance related genes includes peptidases, chemotaxis sensory transducer proteins, a cysteine exporter, and helicases. Using the bottom-up approach we found several novel phenotypes in the newly sequenced Shewanella species, including degradation of aromatic compounds by an aerobic hybrid pathway in S. woodyi, degradation of ethanolamine by S. benthica, and propanediol degradation by S. putrefaciens CN32 and S. sp. W3-18-1.

  7. Genome-wide screening of Saccharomyces cerevisiae genes required to foster tolerance towards industrial wheat straw hydrolysates

    OpenAIRE

    Pereira, Francisco B.; Teixeira, Miguel C.; Mira, Nuno P.; Correia, Isabel Sá; Domingues, Lucília

    2014-01-01

    The presence of toxic compounds derived from biomass pre-treatment in fermentation media represents an important drawback in second-generation bio-ethanol production technology and overcoming this inhibitory effect is one of the fundamental challenges to its industrial production. The aim of this study was to systematically identify, in industrial medium and at a genomic scale, the Saccharomyces cerevisiae genes required for simultaneous and maximal tolerance to key inhibitors of lignocellulo...

  8. Differences in salinity tolerance and gene expression between two populations of Atlantic cod (Gadus morhua) in response to salinity stress

    DEFF Research Database (Denmark)

    Larsen, Peter Foged; Eg Nielsen, Einar; Meier, Kristian; Olsvik, P.A.; Hansen, M.M.; Loeschcke, V.

    salinity tolerance and gene expression among Atlantic cod (Gadus morhua) from two populations distributed across a steep salinity gradient, we observed high mortality (45% North Sea cod and 80% Baltic Sea cod) in a reciprocal common garden setup. Quantitative RT-PCR assays for expression of hsp70 and Na...... findings strongly suggest that Atlantic cod are adapted to local saline conditions, despite relatively low levels of neutral genetic divergence between populations...

  9. Expression of a Carrot 36 kD Antifreeze Protein Gene Improves Cold Stress Tolerance in Transgenic Tobacco

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Antifreeze proteins (AFPs) enable organisms to survive under cold conditions, and have great potential in improving cold tolerance of cold-sensitive plants. In order to determine whether expression of the carrot 36 kD antifreeze protein gene confers improved cold-resistant properties to plant tissues, we tried to obtain transgenic tobacco plants which expressed the antifreeze protein. Cold, salt, and drought induced promoter Prd29A was cloned using PCR from Arabidopsis. Two plant expression vectors based on pBI121 were constructed with CaMV35S:AFP and Prd29A:AFP. Tobacco plantlets were transformed by Agrobacterium-medicated transformation. PCR and Southern blotting demonstrated that the carrot 36 kD afp gene was successfully integrated into the genomes of transformed plantlets. The expression of the afp gene in transgenic plants led to improved tolerance to cold stress.However, the use of the strong constitutive 35S cauliflower mosaic virus (CaMV) promoter to drive expression of afp also resulted in growth retardation under normal growing conditions. In contrast, the expression of afp driven by the stress-inducible Prd29A promoter from Arabidopsis gave rise to minimal effects on plant growth while providing an increased tolerance to cold stress condition (2℃). The results demonstrated the prospect of using Prd29A-AFP transgenic plants in cold-stressed conditions that will in turn benefit agriculture.

  10. Over-Expression of SlSHN1 Gene Improves Drought Tolerance by Increasing Cuticular Wax Accumulation in Tomato

    Directory of Open Access Journals (Sweden)

    Ayed M. Al-Abdallat

    2014-10-01

    Full Text Available Increasing cuticular wax accumulation in plants has been associated with improving drought tolerance in plants. In this study, a cDNA clone encoding the SlSHN1 transcription factor, the closest ortholog to WIN/SHN1 gene in Arabidopsis, was isolated from tomato plant. Expression analysis of SlSHN1 indicated that it is induced in response to drought conditions. The over-expression of SlSHN1 in tomato under the control of the constitutive CaMV 35S promoter produced plants that showed mild growth retardation phenotype with shiny and dark green leaves. Scanning electron microscopy showed that the over-expression of SlSHN1 in tomato resulted in higher cuticular wax deposition on leaf epidermial tissue when compared to non-transformed plants. Expression analysis in transgenic lines over-expressing SlSHN1 indicated that several wax-related synthesis genes were induced. Transgenic tomato plants over-expressing SlSHN1 showed higher drought tolerance when compared with wild type plants; this was reflected in delayed wilting of transgenic lines, improved water status and reduced water loss rate when compared with wild type plants. In conclusion, the SlSHN1 gene can modulate wax accumulation and could be utilized to enhance drought tolerance in tomato plant.

  11. A novel stress-induced sugarcane gene confers tolerance to drought, salt and oxidative stress in transgenic tobacco plants.

    Directory of Open Access Journals (Sweden)

    Kevin Begcy

    Full Text Available BACKGROUND: Drought is a major abiotic stress that affects crop productivity worldwide. Sugarcane can withstand periods of water scarcity during the final stage of culm maturation, during which sucrose accumulation occurs. Meanwhile, prolonged periods of drought can cause severe plant losses. METHODOLOGY/PRINCIPAL FINDINGS: In a previous study, we evaluated the transcriptome of drought-stressed plants to better understand sugarcane responses to drought. Among the up-regulated genes was Scdr1 (sugarcane drought-responsive 1. The aim of the research reported here was to characterize this gene. Scdr1 encodes a putative protein containing 248 amino acids with a large number of proline (19% and cysteine (13% residues. Phylogenetic analysis showed that ScDR1is in a clade with homologs from other monocotyledonous plants, separate from those of dicotyledonous plants. The expression of Scdr1 in different varieties of sugarcane plants has not shown a clear association with drought tolerance. CONCLUSIONS/SIGNIFICANCE: The overexpression of Scdr1 in transgenic tobacco plants increased their tolerance to drought, salinity and oxidative stress, as demonstrated by increased photosynthesis, water content, biomass, germination rate, chlorophyll content and reduced accumulation of ROS. Physiological parameters, such as transpiration rate (E, net photosynthesis (A, stomatal conductance (gs and internal leaf CO(2 concentration, were less affected by abiotic stresses in transgenic Scdr1 plants compared with wild-type plants. Overall, our results indicated that Scdr1 conferred tolerance to multiple abiotic stresses, highlighting the potential of this gene for biotechnological applications.

  12. Transfer of E. coli gutD gene into maize and regeneration of salt-tolerant transgenic plants

    Institute of Scientific and Technical Information of China (English)

    刘岩; 王国英; 刘俊君; 彭学贤; 谢友菊; 戴景瑞; 郭世伟; 张福锁

    1999-01-01

    GutD gene, encoding a key enzyme (glucitol-6-phosphate dehydrogenase) of sugar alcohol metabolic pathway in E. coli, was transferred into maize. Results of Southern and Western blotting analysis certified that this gene had integrated and been expressed in transgenic maize plants and their progeny. The synthesis and accumulation of sorbitol were detected in transgenic maize plants and a preliminary nutrient solution culture experiment showed that gutD transgenic maize plants had an increased tolerance to salt stress compared with nontransgenic ones.

  13. Genome-wide analysis of ZmDREB genes and their association with natural variation in drought tolerance at seedling stage of Zea mays L.

    Directory of Open Access Journals (Sweden)

    Shengxue Liu

    Full Text Available The worldwide production of maize (Zea mays L. is frequently impacted by water scarcity and as a result, increased drought tolerance is a priority target in maize breeding programs. While DREB transcription factors have been demonstrated to play a central role in desiccation tolerance, whether or not natural sequence variations in these genes are associated with the phenotypic variability of this trait is largely unknown. In the present study, eighteen ZmDREB genes present in the maize B73 genome were cloned and systematically analyzed to determine their phylogenetic relationship, synteny with rice, maize and sorghum genomes; pattern of drought-responsive gene expression, and protein transactivation activity. Importantly, the association between the nucleic acid variation of each ZmDREB gene with drought tolerance was evaluated using a diverse population of maize consisting of 368 varieties from tropical and temperate regions. A significant association between the genetic variation of ZmDREB2.7 and drought tolerance at seedling stage was identified. Further analysis found that the DNA polymorphisms in the promoter region of ZmDREB2.7, but not the protein coding region itself, was associated with different levels of drought tolerance among maize varieties, likely due to distinct patterns of gene expression in response to drought stress. In vitro, protein-DNA binding assay demonstrated that ZmDREB2.7 protein could specifically interact with the target DNA sequences. The transgenic Arabidopsis overexpressing ZmDREB2.7 displayed enhanced tolerance to drought stress. Moreover, a favorable allele of ZmDREB2.7, identified in the drought-tolerant maize varieties, was effective in imparting plant tolerance to drought stress. Based upon these findings, we conclude that natural variation in the promoter of ZmDREB2.7 contributes to maize drought tolerance, and that the gene and its favorable allele may be an important genetic resource for the genetic

  14. Coordinated Regulation of miR-155 and miR-146a Genes during Induction of Endotoxin Tolerance in Macrophages

    DEFF Research Database (Denmark)

    Doxaki, Christina; Kampranis, Sotirios C; Eliopoulos, Aristides G;

    2015-01-01

    Endotoxin tolerance occurs to protect the organism from hyperactivation of innate immune responses, primarily mediated by macrophages. Regulation of endotoxin tolerance occurs at multiple levels of cell responses and requires significant changes in gene expression. In the process of macrophage ac...

  15. Proteomic Analyses Reveal the Mechanism of Dunaliella salina Ds-26-16 Gene Enhancing Salt Tolerance in Escherichia coli

    Science.gov (United States)

    Wang, Yanlong; Hu, Bin; Du, Shipeng; Gao, Shan; Chen, Xiwen; Chen, Defu

    2016-01-01

    We previously screened the novel gene Ds-26-16 from a 4 M salt-stressed Dunaliella salina cDNA library and discovered that this gene conferred salt tolerance to broad-spectrum organisms, including E. coli (Escherichia coli), Haematococcus pluvialis and tobacco. To determine the mechanism of this gene conferring salt tolerance, we studied the proteome of E. coli overexpressing the full-length cDNA of Ds-26-16 using the iTRAQ (isobaric tags for relative and absolute quantification) approach. A total of 1,610 proteins were identified, which comprised 39.4% of the whole proteome. Of the 559 differential proteins, 259 were up-regulated and 300 were down-regulated. GO (gene ontology) and KEGG (Kyoto encyclopedia of genes and genomes) enrichment analyses identified 202 major proteins, including those involved in amino acid and organic acid metabolism, energy metabolism, carbon metabolism, ROS (reactive oxygen species) scavenging, membrane proteins and ABC (ATP binding cassette) transporters, and peptidoglycan synthesis, as well as 5 up-regulated transcription factors. Our iTRAQ data suggest that Ds-26-16 up-regulates the transcription factors in E. coli to enhance salt resistance through osmotic balance, energy metabolism, and oxidative stress protection. Changes in the proteome were also observed in E. coli overexpressing the ORF (open reading frame) of Ds-26-16. Furthermore, pH, nitric oxide and glycerol content analyses indicated that Ds-26-16 overexpression increases nitric oxide content but has no effect on glycerol content, thus confirming that enhanced nitric oxide synthesis via lower intercellular pH was one of the mechanisms by which Ds-26-16 confers salt tolerance to E. coli. PMID:27135411

  16. Proteomic Analyses Reveal the Mechanism of Dunaliella salina Ds-26-16 Gene Enhancing Salt Tolerance in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Yanlong Wang

    Full Text Available We previously screened the novel gene Ds-26-16 from a 4 M salt-stressed Dunaliella salina cDNA library and discovered that this gene conferred salt tolerance to broad-spectrum organisms, including E. coli (Escherichia coli, Haematococcus pluvialis and tobacco. To determine the mechanism of this gene conferring salt tolerance, we studied the proteome of E. coli overexpressing the full-length cDNA of Ds-26-16 using the iTRAQ (isobaric tags for relative and absolute quantification approach. A total of 1,610 proteins were identified, which comprised 39.4% of the whole proteome. Of the 559 differential proteins, 259 were up-regulated and 300 were down-regulated. GO (gene ontology and KEGG (Kyoto encyclopedia of genes and genomes enrichment analyses identified 202 major proteins, including those involved in amino acid and organic acid metabolism, energy metabolism, carbon metabolism, ROS (reactive oxygen species scavenging, membrane proteins and ABC (ATP binding cassette transporters, and peptidoglycan synthesis, as well as 5 up-regulated transcription factors. Our iTRAQ data suggest that Ds-26-16 up-regulates the transcription factors in E. coli to enhance salt resistance through osmotic balance, energy metabolism, and oxidative stress protection. Changes in the proteome were also observed in E. coli overexpressing the ORF (open reading frame of Ds-26-16. Furthermore, pH, nitric oxide and glycerol content analyses indicated that Ds-26-16 overexpression increases nitric oxide content but has no effect on glycerol content, thus confirming that enhanced nitric oxide synthesis via lower intercellular pH was one of the mechanisms by which Ds-26-16 confers salt tolerance to E. coli.

  17. Abscisic acid enhances tolerance of wheat seedlings to drought and regulates transcript levels of genes encoding ascorbate-glutathione biosynthesis.

    Science.gov (United States)

    Wei, Liting; Wang, Lina; Yang, Yang; Wang, Pengfei; Guo, Tiancai; Kang, Guozhang

    2015-01-01

    Glutathione (GSH) and ascorbate (ASA) are associated with the abscisic acid (ABA)-induced abiotic tolerance in higher plant, however, its molecular mechanism remains obscure. In this study, exogenous application (10 μM) of ABA significantly increased the tolerance of seedlings of common wheat (Triticum aestivum L.) suffering from 5 days of 15% polyethylene glycol (PEG)-stimulated drought stress, as demonstrated by increased shoot lengths and shoot and root dry weights, while showing decreased content of hydrogen peroxide (H2O2) and malondialdehyde (MDA). Under drought stress conditions, ABA markedly increased content of GSH and ASA in both leaves and roots of ABA-treated plants. Temporal and spatial expression patterns of eight genes encoding ASA and GSH synthesis-related enzymes were measured using quantitative real-time reverse transcription polymerase chain reaction (qPCR). The results showed that ABA temporally regulated the transcript levels of genes encoding ASA-GSH cycle enzymes. Moreover, these genes exhibited differential expression patterns between the root and leaf organs of ABA-treated wheat seedlings during drought stress. These results implied that exogenous ABA increased the levels of GSH and ASA in drought-stressed wheat seedlings in time- and organ-specific manners. Moreover, the transcriptional profiles of ASA-GSH synthesis-related enzyme genes in the leaf tissue were compared between ABA- and salicylic acid (SA)-treated wheat seedlings under PEG-stimulated drought stress, suggesting that they increased the content of ASA and GSH by differentially regulating expression levels of ASA-GSH synthesis enzyme genes. Our results increase our understanding of the molecular mechanism of ABA-induced drought tolerance in higher plants. PMID:26175737

  18. Heterologous expression of the AtDREB1A gene in chrysanthemum increases drought and salt stress tolerance

    Institute of Scientific and Technical Information of China (English)

    HONG; Bo; TONG; Zheng; MA; Nan; LI; Jianke; KASUGA; Mie; YAMAGUCHI-SHINOZAKI; Kazuko; GAO; Junping

    2006-01-01

    DNA cassette containing an AtDREB1A cDNA and a nos terminator, driven by a cauliflower mosaic 35S promoter, or a stress-inducible rd29A promoter, was transformed into the ground cover chrysanthemum (Dendranthema grandiflorum) 'Fall Color' genome. Compared with wild type plants, severe growth retardation was observed in 35S:DREB1A plants, but not in rd29A:DREB1A plants. RT-PCR analysis revealed that, under stress conditions, the DREB1A gene was over-expressed constitutively in 35S:DREB1A plants, but was over-expressed inductively in rd29A:DREB1A plants. The transgenic plants exhibited tolerance to drought and salt stress, and the tolerance was significantly stronger in rd29A:DREB1A plants than tn 35S:DREB1A plants. Proline content and SOD activity were increased inductively in rd29A:DREB1A plants than in 35S:DREB1A plants under stress conditions. These results indicate that heterologous AtDREB1A can confer drought and salt tolerance in transgenic chrysanthemum, and improvement of the stress tolerance may be related to enhancement of proline content and SOD activity.

  19. Overexpression of MuHSP70 gene from Macrotyloma uniflorum confers multiple abiotic stress tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Masand, Shikha; Yadav, Sudesh Kumar

    2016-02-01

    A 70-KD heat shock protein (HSP70) is one of the most conserved chaperones. It is involved in de novo protein folding and prevents the aggregation of unfolded proteins under lethal environmental factors. The purpose of this study is to characterise a MuHSP70 from horsegram (Macrotyloma uniflorum) and elucidating its role in stress tolerance of plants. A MuHSP70 was cloned and characterised from a natural drought stress tolerant HPK4 variety of horsegram (M. uniflorum). For functional characterization, MuHSP70 was overexpressed in transgenic Arabidopsis. Overexpression of MuHSP70 was found to provide tolerance to the transgenic Arabidopsis against various stresses such as heat, cold, drought, salinity and oxidative stress. MuHSP70 transgenics were observed to maintain the shoot biomass, root length, relative water content, and chlorophyll content during exposure to multi-stresses relative to non-transgenic control. Transgenic lines have further shown the reduced levels of MDA, H2O2, and proteolytic activity. Together, these findings suggest that overexpression of MuHSP70 plays an important role in improving abiotic stress tolerance and could be a crucial candidate gene for exploration in crop improvement program. PMID:26694324

  20. The expression of the Saccharomyces cerevisiae HAL1 gene increases salt tolerance in transgenic watermelon [Citrullus lanatus (Thunb.) Matsun. & Nakai.].

    Science.gov (United States)

    Ellul, P; Ríos, G; Atarés, A; Roig, L A; Serrano, R; Moreno, V

    2003-08-01

    An optimised Agrobacterium-mediated gene transfer protocol was developed in order to obtain watermelon transgenic plants [Citrullus lanatus (Thunb.) Matsun. & Nakai.]. Transformation efficiencies ranged from 2.8% to 5.3%, depending on the cultivar. The method was applied to obtain genetically engineered watermelon plants expressing the Saccharomyces cerevisiae HAL1 gene related to salt tolerance. In order to enhance its constitutive expression in plants, the HAL1 gene was cloned in a pBiN19 plasmid under control of the 35S promoter with a double enhancer sequence from the cauliflower mosaic virus and the RNA4 leader sequence of the alfalfa mosaic virus. This vector was introduced into Agrobacterium tumefaciens strain LBA4404 for further inoculation of watermelon half-cotyledon explants. The introduction of both the neomycin phosphotransferase II and HAL1 genes was assessed in primary transformants (TG1) by polymerase chain reaction analysis and Southern hybridisation. The expression of the HAL1 gene was determined by Northern analysis, and the diploid level of transgenic plants was confirmed by flow cytometry. The presence of the selectable marker gene in the expected Mendelian ratios was demonstrated in TG2 progenies. The TG2 kanamycin-resistant plantlets elongated better and produced new roots and leaves in culture media supplemented with NaCl compared with the control. Salt tolerance was confirmed in a semi-hydroponic system (EC=6 dS m(-1)) on the basis of the higher growth performance of homozygous TG3 lines with respect to their respective azygous control lines without the transgene. The halotolerance observed confirmed the inheritance of the trait and supports the potential usefulness of the HAL1 gene of S. cerevisiae as a molecular tool for genetic engineering of salt-stress protection in other crop species. PMID:12783167

  1. Putrescine accumulation confers drought tolerance in transgenic Arabidopsis plants over-expressing the homologous Arginine decarboxylase 2 gene.

    Science.gov (United States)

    Alcázar, Rubén; Planas, Joan; Saxena, Triambak; Zarza, Xavier; Bortolotti, Cristina; Cuevas, Juan; Bitrián, Marta; Tiburcio, Antonio F; Altabella, Teresa

    2010-07-01

    In Arabidopsis, a model genus missing a functional ornithine decarboxylase pathway, most of the key genes involved in polyamine biosynthesis are duplicated. This gene redundancy has been related to the involvement of certain gene isoforms in the response to specific environmental stimuli. We have previously shown that drought stress induces Arginine decarboxlase 2 expression, while transcript levels for Arginine decarboxlase 1 remain constant. Accumulation of putrescine and increased arginine decarboxlase activity (EC 4.1.1.19) levels in response to different abiotic stresses have been reported in many different plant systems, but the biological meaning of this increase remains unclear. To get a new insight into these questions, we have studied the response to drought of transgenic Arabidopsis thaliana lines constitutively expressing the homologous Arginine decarboxlase 2 gene. These lines contain high levels of putrescine with no changes in spermidine and spermine content even under drought stress. Drought tolerance experiments indicate that the different degree of resistance to dehydration correlates with Put content. Although no significant differences were observed in the number of stomata between wild-type and transgenic plants, a reduction in transpiration rate and stomata conductance was observed in the ADC2 over-expressor lines. These results indicate that one of the mechanisms involved in the drought tolerance of transgenic plants over-producing Put is related to a reduction of water loss by transpiration. PMID:20206537

  2. Comparative study of Saccharomyces cerevisiae wine strains to identify potential marker genes correlated to desiccation stress tolerance.

    Science.gov (United States)

    Capece, Angela; Votta, Sonia; Guaragnella, Nicoletta; Zambuto, Marianna; Romaniello, Rossana; Romano, Patrizia

    2016-05-01

    The most diffused formulation of starter for winemaking is active dry yeast (ADY). ADYs production process is essentially characterized by air-drying stress, a combination of several stresses, including thermal, hyperosmotic and oxidative and cell capacity to counteract such multiple stresses will determine its survival. The molecular mechanisms underlying cell stress response to desiccation have been mostly studied in laboratory and commercial yeast strains, but a growing interest is currently developing for indigenous yeast strains which represent a valuable and alternative source of genetic and molecular biodiversity to be exploited. In this work, a comparative study of different Saccharomyces cerevisiae indigenous wine strains, previously selected for their technological traits, has been carried out to identify potentially relevant genes involved in desiccation stress tolerance. Cell viability was evaluated along desiccation treatment and gene expression was analyzed by real-time PCR before and during the stress. Our data show that the observed differences in individual strain sensitivity to desiccation stress could be associated to specific gene expression over time. In particular, either the basal or the stress-induced mRNA levels of certain genes, such as HSP12, SSA3, TPS1, TPS2, CTT1 and SOD1, result tightly correlated to the strain survival advantage. This study provides a reliable and sensitive method to predict desiccation stress tolerance of indigenous wine yeast strains which could be preliminary to biotechnological applications. PMID:26882930

  3. Overexpression of the brassinosteroid biosynthetic gene DWF4 in Brassica napus simultaneously increases seed yield and stress tolerance.

    Science.gov (United States)

    Sahni, Sangita; Prasad, Bishun D; Liu, Qing; Grbic, Vojislava; Sharpe, Andrew; Singh, Surinder P; Krishna, Priti

    2016-01-01

    As a resource allocation strategy, plant growth and defense responses are generally mutually antagonistic. Brassinosteroid (BR) regulates many aspects of plant development and stress responses, however, genetic evidence of its integrated effects on plant growth and stress tolerance is lacking. We overexpressed the Arabidopsis BR biosynthetic gene AtDWF4 in the oilseed plant Brassica napus and scored growth and stress response phenotypes. The transgenic B. napus plants, in comparison to wild type, displayed increased seed yield leading to increased overall oil content per plant, higher root biomass and root length, significantly better tolerance to dehydration and heat stress, and enhanced resistance to necrotrophic fungal pathogens Leptosphaeria maculans and Sclerotinia sclerotiorum. Transcriptome analysis supported the integrated effects of BR on growth and stress responses; in addition to BR responses associated with growth, a predominant plant defense signature, likely mediated by BES1/BZR1, was evident in the transgenic plants. These results establish that BR can interactively and simultaneously enhance abiotic and biotic stress tolerance and plant productivity. The ability to confer pleiotropic beneficial effects that are associated with different agronomic traits suggests that BR-related genes may be important targets for simultaneously increasing plant productivity and performance under stress conditions. PMID:27324083

  4. Expression of Echmr gene from Eichhornia offers multiple stress tolerance to Cd sensitive Escherichia coli Δgsh mutants.

    Science.gov (United States)

    Thapa, G; Das, D; Gunupuru, L R

    2016-09-01

    The detoxification of heavy metals frequently involves conjugation to glutathione prior to compartmentalization and eflux in higher plants. We have expressed a heavy metal stress responsive (Echmr) gene from water hyacinth, which conferred tolerance to Cd sensitive Escherichia coli Δgsh mutants against heavy metals and abiotic stresses. The recombinant E. coli Δgsh mutant cells showed better growth recovery and survival than control cells under Cd (200 μM), Pb(200 μM), heat shock (50 °C), cold stress at 4 °C for 4 h, and UV-B (20 min) exposure. The enhanced expression of Echmr gene revealed by northern analysis during above stresses further advocates its role in multi-stress tolerance. Heterologous expression of EcHMR from Eichhornia rescued Cd(2+) sensitive E. coli mutants from Cd(2+) toxicity and induced better recovery post abiotic stresses. This may suggests a possible role of Echmr in Cd(II) and desiccation tolerance in plants for enhanced stress response. PMID:27457806

  5. The role of the F-box gene TaFBA1 from wheat (Triticum aestivum L.) in drought tolerance.

    Science.gov (United States)

    Zhou, Shumei; Sun, Xiudong; Yin, Suhong; Kong, Xiangzhu; Zhou, Shan; Xu, Ying; Luo, Yin; Wang, Wei

    2014-11-01

    Drought is one of the most important factors limiting plant growth and development. We identified a gene in wheat (Triticum aestivum L.) under drought stress named TaFBA1. TaFBA1 encodes a putative 325-amino-acid F-box protein with a conserved N-terminal F-box domain and a C-terminal AMN1 domain. Real-time RT-PCR analysis revealed that TaFBA1 transcript accumulation was upregulated by high-salinity, water stress, and abscisic acid (ABA) treatment. To evaluate the functions of TaFBA1 in the regulation of drought stress responses, we produced transgenic tobacco lines overexpressing TaFBA1. Under water stress conditions, the transgenic tobacco plants had a higher germination rate, higher relative water content, net photosynthesis rate (Pn), less chlorophyll loss, and less growth inhibition than WT. These results demonstrate the high tolerance of the transgenic plants to drought stress compared to the WT. The enhanced oxidative stress tolerance of these plants, which may be involved in their drought tolerance, was indicated by their lower levels of reactive oxygen species (ROS) accumulation, MDA content, and cell membrane damage under drought stress compared to WT. The antioxidant enzyme activities were higher in the transgenic plants than in WT, which may be related to the upregulated expression of some antioxidant genes via overexpression of TaFBA1. PMID:25299612

  6. Transgenic tobacco plants expressing BoRS1 gene from Brassica oleracea var. acephala show enhanced tolerance to water stress

    Indian Academy of Sciences (India)

    Dongqin Tang; Hongmei Qian; Lingxia Zhao; Danfeng Huang; Kexuan Tang

    2005-12-01

    Water stress is by far the leading environmental stress limiting crop yields worldwide. Genetic engineering techniques hold great promise for developing crop cultivars with high tolerance to water stress. In this study, the Brassica oleracea var. acephala BoRS1 gene was transferred into tobacco through Agrobacterium-mediated leaf disc transformation. The transgenic status and transgene expression of the transgenic plants was confirmed by polymerase chain reaction (PCR) analysis, Southern hybridization and semi-quantitative one step RT-PCR analysis respectively. Subsequently, the growth status under water stress, and physiological responses to water stress of transgenic tobacco were studied. The results showed that the transgenic plants exhibited better growth status under water stress condition compared to the untransformed control plants. In physiological assessment of water tolerance, transgenic plants showed more dry matter accumulation and maintained significantly higher levels of leaf chlorophyll content along with increasing levels of water stress than the untransformed control plants. This study shows that BoRS1 is a candidate gene in the engineering of crops for enhanced water stress tolerance.

  7. Tolerance and responsive gene expression of Sogatella furcifera under extreme temperature stresses are altered by its vectored plant virus.

    Science.gov (United States)

    Xu, Donglin; Zhong, Ting; Feng, Wendi; Zhou, Guohui

    2016-01-01

    Southern rice black-streaked dwarf virus (SRBSDV), a newly emerged fijivirus causing great loss to rice production in eastern and southeastern Asian countries in recent years, is efficiently transmitted by a rice pest, white-backed planthopper (WBPH, Sogatella furcifera) in a persistent, circulative propagative manner and can be considered as an insect virus. In this study, SRBSDV infection in WBPH was found to increase the vector's death rate under extreme cold stress but improve its survival rate under extreme heat stress. Digital gene expression profiling based on RNA-Seq revealed different gene regulation patterns in WBPH under viral and/or temperature stress. Under cold stress, the virus infection upregulated 1540 genes and downregulated 131 genes in the insect, most of which were related to membrane properties and biological processes of actin and cytoskeleton; whereas under heat stress, it upregulated 363 genes and downregulated 548 genes, most of which were associated to metabolism and intracellular organelles. Several types of stress-responsive genes involving intestinal mucin, cuticle protein, ubiquitin protease, immune response, RNA interference and heat shock response, were largely upregulated under cold stress, but largely downregulated under heat stress, by SRBSDV infection. Our results suggest two distinct mechanisms of virus-altered vector insect tolerance to temperature stress. PMID:27531640

  8. Salt tolerance conferred by over-expression of OsNHX1 gene in Poplar 84K

    Institute of Scientific and Technical Information of China (English)

    WANG Shuyao; CHEN Qijun; WANG Wenlong; WANG Xuechen; LU Mengzhu

    2005-01-01

    OsNHX1 gene (Na+/H+ antiporter gene of Oryza sativa L.) was introduced into Poplar 84K with Agrobacterium tumefaciens-mediated transformation. PCR, Southern and Northern blot analysis showed that OsNHX1 gene was incorporated successfully into the genome of Poplar 84K and expressed in these transgenic plants. Salt tolerance test showed that three lines of transgenic plants grew normally in the presence of 200 mmol/L NaCl, while the Na+ content in the leaves of the transgenic plants grown at 200 mmol/L NaCl was significantly higher than that in plants grown at 0 mmol/L NaCl. The osmotic potential in the transgenic plants with high salinity treatment was lower than that of control plants. Our results demonstrate the potential use of these transgenic plants for agricultural use in saline soils.

  9. Over-Expression of ScMnSOD, a SOD Gene Derived from Jojoba, Improve Drought Tolerance in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    LIU Xiao-fei; ZHANG Gen-fa; SUN Wei-min; LI Ze-qin; BAI Rui-xue; LI Jing-xiao; SHI Zi-han; GENG Hong-wei; ZHENG Ying; ZHANG Jun

    2013-01-01

    Jojoba (Simmondsia chinensis) is mainly distributed in desert, and the molecular mechanisms of jojoba in response to abiotic stress still remain elusive. In this paper, we cloned and characterized a SOD gene from jojoba named as ScMnSOD, and introduced into Arabidopsis to investigate its functions of responding to drought stress. The transgenic Arabidopsis showed an improvement in drought tolerance. Moreover, under a water deifcit condition, the accumulation of reactive oxygen species (ROS) was remarkably decreased in the transgenic lines compared to the WT. Furthermore, the ScMnSOD promoter was cloned to the 5´-upstream of GUS coding region in a binary vector, and introduced into Arabidopsis. And results showed that ScMnSOD expression can be induced by drought, salt, ABA, and low temperature. In conclusion, ScMnSOD plays an important role in drought tolerance which is, at least partially, attributed to its role in ROS detoxiifcation.

  10. The adenylate cyclase gene MaAC is required for virulence and multi-stress tolerance of Metarhizium acridum

    Directory of Open Access Journals (Sweden)

    Liu Shuyang

    2012-08-01

    Full Text Available Abstract Background The efficacy of entomopathogenic fungi in pest control is mainly affected by various adverse environmental factors, such as heat shock and UV-B radiation, and by responses of the host insect, such as oxidative stress, osmotic stress and fever. In this study, an adenylate cyclase gene (MaAC was cloned from the locust-specific entomopathogenic fungus, Metarhizium acridum, which is homologous to various fungal adenylate cyclase genes. RNA silencing was adapted to analyze the role of MaAC in virulence and tolerance to adverse environmental and host insect factors. Results Compared with the wild type, the vegetative growth of the RNAi mutant was decreased in PD (potato dextrose medium, Czapek-dox and PDA plates, respectively, demonstrating that MaAC affected vegetative growth. The cAMP levels were also reduced in PD liquid culture, and exogenous cAMP restored the growth of RNAi mutants. These findings suggested that MaAC is involved in cAMP synthesis. The knockdown of MaAC by RNAi led to a reduction in virulence after injection or topical inoculation. Furthermore, the RNAi mutant grew much slower than the wild type in the haemolymph of locust in vitro and in vivo, thus demonstrating that MaAC affects the virulence of M. acridum via fungal growth inside the host locust. A plate assay indicated that the tolerances of the MaAC RNAi mutant under oxidative stress, osmotic stress, heat shock and UV-B radiation was decreased compared with the wild type. Conclusion MaAC is required for virulence and tolerance to oxidative stress, osmotic stress, heat shock and UV-B radiation. MaAC affects fungal virulence via vegetative growth inside the insect and tolerance against oxidative stress, osmotic stress and locust fever.

  11. Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L. varieties differing in drought tolerance

    Directory of Open Access Journals (Sweden)

    Chattopadhyay Debasis

    2010-02-01

    Full Text Available Abstract Background Chickpea (C. arietinum L. ranks third in food legume crop production in the world. However, drought poses a serious threat to chickpea production, and development of drought-resistant varieties is a necessity. Unfortunately, cultivated chickpea has a high morphological but narrow genetic diversity, and understanding the genetic processes of this plant is hindered by the fact that the chickpea genome has not yet been sequenced and its EST resources are limited. In this study, two chickpea varieties having contrasting levels of drought-tolerance were analyzed for differences in transcript profiling during drought stress treatment by withdrawal of irrigation at different time points. Transcript profiles of ESTs derived from subtractive cDNA libraries constructed with RNA from whole seedlings of both varieties were analyzed at different stages of stress treatment. Results A series of comparisons of transcript abundance between two varieties at different time points were made. 319 unique ESTs available from different libraries were categorized into eleven clusters according to their comparative expression profiles. Expression analysis revealed that 70% of the ESTs were more than two fold abundant in the tolerant cultivar at any point of the stress treatment of which expression of 33% ESTs were more than two fold high even under the control condition. 53 ESTs that displayed very high fold relative expression in the tolerant variety were screened for further analysis. These ESTs were clustered in four groups according to their expression patterns. Conclusions Annotation of the highly expressed ESTs in the tolerant cultivar predicted that most of them encoded proteins involved in cellular organization, protein metabolism, signal transduction, and transcription. Results from this study may help in targeting useful genes for improving drought tolerance in chickpea.

  12. Enhanced cadmium accumulation and tolerance in transgenic tobacco overexpressing rice metal tolerance protein gene OsMTP1 is promising for phytoremediation.

    Science.gov (United States)

    Das, Natasha; Bhattacharya, Surajit; Maiti, Mrinal K

    2016-08-01

    One of the most grievous heavy metal pollutants in the environment is cadmium (Cd), which is not only responsible for the crop yield loss owing to its phytotoxicity, but also for the human health hazards as the toxic elements usually accumulate in the consumable parts of crop plants. In the present study, we aimed to isolate and functionally characterize the OsMTP1 gene from indica rice (Oryza sativa L. cv. IR64) to study its potential application for efficient phytoremediation of Cd. The 1257 bp coding DNA sequence (CDS) of OsMTP1 encodes a ∼46 kDa protein belonging to the cation diffusion facilitator (CDF) or metal tolerance/transport protein (MTP) family. The OsMTP1 transcript in rice plant was found to respond during external Cd stress. Heterologous expression of OsMTP1 in tobacco resulted in the reduction of Cd stress-induced phytotoxic effects, including growth inhibition, lipid peroxidation, and cell death. Compared to untransformed control, the transgenic tobacco plants showed enhanced vacuolar thiol content, indicating vacuolar localization of the sequestered Cd. The transgenic tobacco plants exhibited significantly higher biomass growth (2.2-2.8-folds) and hyperaccumulation of Cd (1.96-2.22-folds) compared to untransformed control under Cd exposure. The transgenic plants also showed moderate tolerance and accumulation of arsenic (As) upon exogenous As stress, signifying broad substrate specificity of OsMTP1. Together, findings of our research suggest that the transgenic tobacco plants overexpressing OsMTP1 with its hyperaccumulating activity and increased growth rate could be useful for future phytoremediation applications to clean up the Cd-contaminated soil. PMID:27214086

  13. Overexpression of a zinc-finger protein gene from rice confers tolerance to cold, dehydration, and salt stress in transgenic tobacco

    OpenAIRE

    Mukhopadhyay, Arnab; Vij, Shubha; Tyagi, Akhilesh K

    2004-01-01

    Stress perception and signal transduction leading to tolerance involve a complex interplay of different gene products. We describe here the isolation and characterization of an intronless gene (OSISAP1) from rice encoding a zinc-finger protein that is induced after different types of stresses, namely cold, desiccation, salt, submergence, and heavy metals as well as injury. The gene is also induced by stress hormone abscisic acid. Overexpression of the gene in transgenic tobacco conferred tole...

  14. Aluminum Hydroxide

    Science.gov (United States)

    Aluminum hydroxide is used for the relief of heartburn, sour stomach, and peptic ulcer pain and to ... Aluminum hydroxide comes as a capsule, a tablet, and an oral liquid and suspension. The dose and ...

  15. The yajC gene from Lactobacillus buchneri and Escherichia coli and its role in ethanol tolerance.

    Science.gov (United States)

    Liu, Siqing; Skory, Chris; Qureshi, Nasib; Hughes, Stephen

    2016-04-01

    The yajC gene (Lbuc_0921) from Lactobacillus buchneri NRRL B-30929 was identified from previous proteomics analyses in response to ethanol treatment. The YajC protein expression was increased by 15-fold in response to 10 % ethanol vs 0 % ethanol. The yajC gene encodes the smaller subunit of the preprotein translocase complex, which interacts with membrane protein SecD and SecF to coordinate protein transport and secretion across cytoplasmic membrane in Escherichia coli. The YajC protein was linked to sensitivity to growth temperatures in E. coli, involved in translocation of virulence factors during Listeria infection, and stimulating a T cell-mediated response of Brucella abortus. In this study, the L. buchneri yajC gene was over-expressed in E. coli. The strain carrying pET28byajC that produces YajC after isopropyl β-D-1-thiogalactopyranoside induction showed tolerance to 4 % ethanol in growth media, compared to the control carrying pET28b. This is the first report linking YajC to ethanol stress and tolerance. PMID:26790414

  16. HyPRP1 Gene Suppressed by Multiple Stresses Plays a Negative Role in Abiotic Stress Tolerance in Tomato.

    Science.gov (United States)

    Li, Jinhua; Ouyang, Bo; Wang, Taotao; Luo, Zhidan; Yang, Changxian; Li, Hanxia; Sima, Wei; Zhang, Junhong; Ye, Zhibiao

    2016-01-01

    Many hybrid proline-rich protein (HyPRP) genes respond to biotic and abiotic stresses in plants, but little is known about their roles other than as putative cell-wall structural proteins. A HyPRP1 gene encodes a protein with proline-rich domain, and an eight-cysteine motif was identified from our previous microarray experiments on drought-tolerant tomato. In this study, the expression of the HyPRP1 gene in tomato was suppressed under various abiotic stresses, such as drought, high salinity, cold, heat, and oxidative stress. Transgenic functional analysis showed no obvious changes in phenotypes, but enhanced tolerance to various abiotic stresses (e.g., oxidative stress, dehydration, and salinity) was observed in RNAi transgenic plants. Interestingly, several SO2 detoxification-related enzymes, including sulfite oxidase, ferredoxins (Fds), and methionine sulfoxide reductase A (Msr A), were revealed in HyPRP1-interacting proteins identified by Yeast Two-Hybrid screening. More sulfates and transcripts of Msr A and Fds were accumulated in HyPRP1 knockdown lines when wild-type plants were exposed to SO2 gas. Our findings illustrate that the tomato HyPRP1 is a negative regulator of salt and oxidative stresses and is probably involved in sulfite metabolism. PMID:27446190

  17. Cloning of the Lycopene β-cyclase Gene in Nicotiana tabacum and Its Overexpression Confers Salt and Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yanmei Shi

    2015-12-01

    Full Text Available Carotenoids are important pigments in plants that play crucial roles in plant growth and in plant responses to environmental stress. Lycopene β cyclase (β-LCY functions at the branch point of the carotenoid biosynthesis pathway, catalyzing the cyclization of lycopene. Here, a β-LCY gene from Nicotiana tabacum, designated as Ntβ-LCY1, was cloned and functionally characterized. Robust expression of Ntβ-LCY1 was found in leaves, and Ntβ-LCY1 expression was obviously induced by salt, drought, and exogenous abscisic acid treatments. Strong accumulation of carotenoids and expression of carotenoid biosynthesis genes resulted from Ntβ-LCY1 overexpression. Additionally, compared to wild-type plants, transgenic plants with overexpression showed enhanced tolerance to salt and drought stress with higher abscisic acid levels and lower levels of malondialdehyde and reactive oxygen species. Conversely, transgenic RNA interference plants had a clear albino phenotype in leaves, and some plants did not survive beyond the early developmental stages. The suppression of Ntβ-LCY1 expression led to lower expression levels of genes in the carotenoid biosynthesis pathway and to reduced accumulation of carotenoids, chlorophyll, and abscisic acid. These results indicate that Ntβ-LCY1 is not only a likely cyclization enzyme involved in carotenoid accumulation but also confers salt and drought stress tolerance in Nicotiana tabacum.

  18. Overexpression of the Wheat Expansin Gene TaEXPA2 Improved Seed Production and Drought Tolerance in Transgenic Tobacco Plants.

    Science.gov (United States)

    Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei

    2016-01-01

    Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants. PMID:27073898

  19. Overexpression of a stress-responsive NAC transcription factor gene ONAC022 improves drought and salt tolerance in rice

    Directory of Open Access Journals (Sweden)

    Yongbo eHong

    2016-01-01

    Full Text Available The NAC transcription factors play critical roles in regulating stress responses in plants. However, the functions for many of the NAC family members in rice are yet to be identified. In the present study, a novel stress-responsive rice NAC gene, ONAC022, was identified. Expression of ONAC022 was induced by drought, high salinity and abscisic acid (ABA. The ONAC022 protein was found to bind specifically to a canonical NAC recognition cis-element sequence and showed transactivation activity at its C-terminus in yeast. The ONAC022 protein was localized to nucleus when transiently expressed in Nicotiana benthamiana. Three independent transgenic rice lines with overexpression of ONAC022 were generated and used to explore the function of ONAC022 in drought and salt stress tolerance. Under drought stress condition in greenhouse, soil-grown ONAC022-overexpressing (N22oe transgenic rice plants showed an increased drought tolerance, leading to higher survival ratios and better growth than wild type plants. When grown hydroponically in Hogland solution supplemented with 150 mM NaCl, the N22oe plants displayed an enhanced salt tolerance and accumulated less Na+ in roots and shoots as compared to the wild type plants. Under drought stress condition, the N22oe plants exhibited decreased rates of water loss and transpiration, reduced percentage of open stomata and increased contents of proline and soluble sugars. However, the N22oe lines showed increased sensitivity to exogenous ABA at seed germination and seedling growth stages but contained higher level of endogenous ABA. Expression of some ABA biosynthetic genes (OsNCEDs and OsPSY, signaling and regulatory genes (OsPP2C02, OsPP2C49, OsPP2C68, OsbZIP23, OsAP37, OsDREB2a and OsMYB2 and late stress-responsive genes (OsRAB21, OsLEA3 and OsP5CS1 was upregulated in the N22oe plants. Our data demonstrate that ONAC022 functions as a stress-responsive NAC with transcriptional activator activity and plays a positive

  20. Overexpression of a Stress-Responsive NAC Transcription Factor Gene ONAC022 Improves Drought and Salt Tolerance in Rice.

    Science.gov (United States)

    Hong, Yongbo; Zhang, Huijuan; Huang, Lei; Li, Dayong; Song, Fengming

    2016-01-01

    The NAC transcription factors play critical roles in regulating stress responses in plants. However, the functions for many of the NAC family members in rice are yet to be identified. In the present study, a novel stress-responsive rice NAC gene, ONAC022, was identified. Expression of ONAC022 was induced by drought, high salinity, and abscisic acid (ABA). The ONAC022 protein was found to bind specifically to a canonical NAC recognition cis-element sequence and showed transactivation activity at its C-terminus in yeast. The ONAC022 protein was localized to nucleus when transiently expressed in Nicotiana benthamiana. Three independent transgenic rice lines with overexpression of ONAC022 were generated and used to explore the function of ONAC022 in drought and salt stress tolerance. Under drought stress condition in greenhouse, soil-grown ONAC022-overexpressing (N22oe) transgenic rice plants showed an increased drought tolerance, leading to higher survival ratios and better growth than wild-type (WT) plants. When grown hydroponically in Hogland solution supplemented with 150 mM NaCl, the N22oe plants displayed an enhanced salt tolerance and accumulated less Na(+) in roots and shoots as compared to WT plants. Under drought stress condition, the N22oe plants exhibited decreased rates of water loss and transpiration, reduced percentage of open stomata and increased contents of proline and soluble sugars. However, the N22oe lines showed increased sensitivity to exogenous ABA at seed germination and seedling growth stages but contained higher level of endogenous ABA. Expression of some ABA biosynthetic genes (OsNCEDs and OsPSY), signaling and regulatory genes (OsPP2C02, OsPP2C49, OsPP2C68, OsbZIP23, OsAP37, OsDREB2a, and OsMYB2), and late stress-responsive genes (OsRAB21, OsLEA3, and OsP5CS1) was upregulated in N22oe plants. Our data demonstrate that ONAC022 functions as a stress-responsive NAC with transcriptional activator activity and plays a positive role in drought

  1. Crescimento radicular e produção de ácidos orgânicos em cultivares de soja com diferentes tolerâncias ao alumínio Root growth and production of organic acids by soybean cultivars with different tolerance to aluminum

    Directory of Open Access Journals (Sweden)

    Orival Gastão Menosso

    2001-11-01

    Full Text Available A elucidação dos mecanismos que definem o comportamento diferencial entre genótipos de soja quanto à toxidez de Al facilita a utilização da variabilidade genética existente ou produzida. O objetivo deste trabalho foi avaliar a influência do Al no crescimento radicular, na modificação do pH da solução e no conteúdo de ácidos orgânicos em extratos de raízes de cultivares de soja tolerantes ao Al, FT-1 e FT-6 (Veneza e sensíveis, IAC-13 e Paraná. As plantas cresceram por nove dias em solução contendo 50 mg L-1 de Ca e 0,0 e 0,2 mg L-1 de Al, com pH inicial de 4,76. Houve maior crescimento de raízes nas cultivares tolerantes e não houve alterações do pH da solução relacionadas à tolerância das cultivares ao alumínio. A presença do Al reduziu o conteúdo dos ácidos cítrico, lático, succínico, oxálico e málico, em ambos os grupos de cultivares avaliados, porém com maior redução no grupo das cultivares sensíveis. O ácido cítrico foi encontrado em maior quantidade nas cultivares tolerantes. A capacidade das cultivares de soja FT-1 e FT-6 (Veneza de alterar o conteúdo de ácidos orgânicos não-voláteis, principalmente o ácido cítrico, que pode complexar o Al, indica que este mecanismo pode ser muito importante para a tolerância a esse elemento.The understanding of the mechanisms for the differential performance of soybean genotypes in relation to Al toxicity is important to explore the existing or produced genetic variability. The objective of this study was to determine the Al influence on root growth, solution pH modifications and organic acid content in root extracts of Al tolerant, FT-1 and FT-6 (Veneza and sensitive, IAC-13 and Paraná, soybean cultivars. Plants were grown during nine days in a solution containing 50 mg L-1 of calcium and 0.0 and 0.2 mg L-1 of aluminum. The solution pH at the beginning was 4.76. Root growth in Al solutions of the tolerant soybean cultivars was higher than that of the

  2. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata”) and Their Interspecific Inbred Line “Maxchata”

    OpenAIRE

    Neelam Ara; Korakot Nakkanong; Wenhui Lv; Jinghua Yang; Zhongyuan Hu; Mingfang Zhang

    2013-01-01

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant inte...

  3. Characterization of genes involved in salt tolerance in gamma induced mutations in potatoes

    International Nuclear Information System (INIS)

    Random Amplified Polymorphic DNA (RAPD) and Inter-Simple Sequence Repeat (ISSR) were deployed to study the genetic relatedness of nineteen different potato lines previously obtained by gamma irradiation and believed to be salt tolerant. The lines which belong to three different cultivars, Spunta, Draga and Diamant were confirmed to be salt tolerant in comparison with their controls. Twenty seven random primers and twenty five ISSR oligonucleotides were utilized to determine the genetic relatedness and to amplify DNA fragments involved in salt tolerance. ISSR clustering and Percent disagreement values (PDV) resembled that of the RAPDs for all studied lines. Consequently, RAPD and ISSR were reliable and could be used to determine the genetic relatedness of potato lines belonging to the same cultivar. Moreover, twenty unique DNA fragments were amplified using RAPD or ISSR in the tolerant mutant lines but not in their respective controls. The fragments were gel excised, reamplified and cloned in a cloning vector using QIAGEN A-addition and PCR cloning Kits. However, Blast data base search with the fragments sequences did not reveal any significant homology indicating the weakness of both the RAPD and ISSR techniques in identifying specific targets. (author)

  4. Bistable expression of virulence genes in salmonella leads to the formation of an antibiotic-tolerant subpopulation.

    Directory of Open Access Journals (Sweden)

    Markus Arnoldini

    2014-08-01

    Full Text Available Phenotypic heterogeneity can confer clonal groups of organisms with new functionality. A paradigmatic example is the bistable expression of virulence genes in Salmonella typhimurium, which leads to phenotypically virulent and phenotypically avirulent subpopulations. The two subpopulations have been shown to divide labor during S. typhimurium infections. Here, we show that heterogeneous virulence gene expression in this organism also promotes survival against exposure to antibiotics through a bet-hedging mechanism. Using microfluidic devices in combination with fluorescence time-lapse microscopy and quantitative image analysis, we analyzed the expression of virulence genes at the single cell level and related it to survival when exposed to antibiotics. We found that, across different types of antibiotics and under concentrations that are clinically relevant, the subpopulation of bacterial cells that express virulence genes shows increased survival after exposure to antibiotics. Intriguingly, there is an interplay between the two consequences of phenotypic heterogeneity. The bet-hedging effect that arises through heterogeneity in virulence gene expression can protect clonal populations against avirulent mutants that exploit and subvert the division of labor within these populations. We conclude that bet-hedging and the division of labor can arise through variation in a single trait and interact with each other. This reveals a new degree of functional complexity of phenotypic heterogeneity. In addition, our results suggest a general principle of how pathogens can evade antibiotics: Expression of virulence factors often entails metabolic costs and the resulting growth retardation could generally increase tolerance against antibiotics and thus compromise treatment.

  5. Seleção de genótipos de Brachiaria Ruziziensis quanto ao alumínio em solução nutritiva: II: Avaliação da tolerância ao alumínio Brachiaria Ruziziensis genotypes selection: II: Evaluation of the aluminum tolerance

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Balbino Miguel

    2011-01-01

    Full Text Available O alumínio, em solos ácidos, é um dos principais responsáveis pela baixa produtividade de culturas. O objetivo deste trabalho foi avaliar a variabilidade genética da Brachiaria ruziziensis para a tolerância ao alumínio. Foram utilizados 10 genótipos da espécie referida, crescidas em vasos com 0, 30 e 60 mg/L de alumínio em solução nutritiva. Foi utilizado o delineamento inteiramente casualizado em esquema fatorial, com seis repetições e parcelas de uma planta por vaso. Foram avaliados: a produção de massa verde da parte aérea e raízes (MVPA e MVR, a produção de matéria seca da parte aérea e raízes (MSPA e MSR, o incremento no crescimento da parte aérea e das raízes (IPA e IR, expresso pela diferença entre o crescimento final e o inicial, e o incremento no número de perfilhos (INP. O aumento nas concentrações de alumínio provocou decréscimos para as médias de todas as características avaliadas, excetuando o IR. A ausência de diferenças do genótipo 8 para seis das sete características analisadas, com exceção da MVPA, demonstra ser ela a mais promissora para estudos posteriores em melhoramento, visando maior produtividade em solos ácidos. Os resultados evidenciaram a existência de variabilidade genética entre os genótipos avaliados para a tolerância ao alumínio tóxico, sendo possível identificar materiais mais produtivos na presença desse metal.In acid soils, the aluminum is responsible for the low cultures productivity. The objective of this work was to evaluate the Brachiaria ruziziensis genetic variability for the aluminum tolerance.10 genotypes of that species were used, grown in vases with 0, 30 and 60 mg/L of aluminum in nutritious solution. A completely randomized design under 10 x 3 factorial, with six replicates. The following variables were evaluated: the green mass production of the aerial part and roots (MVPA and MVR, the dry matter production of the aerial part and roots (MSPA and MSR

  6. Analysis of Stress-Responsive Gene Expression in Cultivated and Weedy Rice Differing in Cold Stress Tolerance.

    Science.gov (United States)

    Bevilacqua, Caroline Borges; Basu, Supratim; Pereira, Andy; Tseng, Te-Ming; Zimmer, Paulo Dejalma; Burgos, Nilda Roma

    2015-01-01

    Rice (Oryza sativa L.) cultivars show impairment of growth in response to environmental stresses such as cold at the early seedling stage. Locally adapted weedy rice is able to survive under adverse environmental conditions, and can emerge in fields from greater soil depth. Cold-tolerant weedy rice can be a good genetic source for developing cold-tolerant, weed-competitive rice cultivars. An in-depth analysis is presented here of diverse indica and japonica rice genotypes, mostly weedy rice, for cold stress response to provide an understanding of different stress adaptive mechanisms towards improvement of the rice crop performance in the field. We have tested a collection of weedy rice genotypes to: 1) classify the subspecies (ssp.) grouping (japonica or indica) of 21 accessions; 2) evaluate their sensitivity to cold stress; and 3) analyze the expression of stress-responsive genes under cold stress and a combination of cold and depth stress. Seeds were germinated at 25°C at 1.5- and 10-cm sowing depth for 10d. Seedlings were then exposed to cold stress at 10°C for 6, 24 and 96h, and the expression of cold-, anoxia-, and submergence-inducible genes was analyzed. Control plants were seeded at 1.5cm depth and kept at 25°C. The analysis revealed that cold stress signaling in indica genotypes is more complex than that of japonica as it operates via both the CBF-dependent and CBF-independent pathways, implicated through induction of transcription factors including OsNAC2, OsMYB46 and OsF-BOX28. When plants were exposed to cold + sowing depth stress, a complex signaling network was induced that involved cross talk between stresses mediated by CBF-dependent and CBF-independent pathways to circumvent the detrimental effects of stresses. The experiments revealed the importance of the CBF regulon for tolerance to both stresses in japonica and indica ssp. The mechanisms for cold tolerance differed among weedy indica genotypes and also between weedy indica and cultivated

  7. Analysis of Stress-Responsive Gene Expression in Cultivated and Weedy Rice Differing in Cold Stress Tolerance.

    Directory of Open Access Journals (Sweden)

    Caroline Borges Bevilacqua

    Full Text Available Rice (Oryza sativa L. cultivars show impairment of growth in response to environmental stresses such as cold at the early seedling stage. Locally adapted weedy rice is able to survive under adverse environmental conditions, and can emerge in fields from greater soil depth. Cold-tolerant weedy rice can be a good genetic source for developing cold-tolerant, weed-competitive rice cultivars. An in-depth analysis is presented here of diverse indica and japonica rice genotypes, mostly weedy rice, for cold stress response to provide an understanding of different stress adaptive mechanisms towards improvement of the rice crop performance in the field. We have tested a collection of weedy rice genotypes to: 1 classify the subspecies (ssp. grouping (japonica or indica of 21 accessions; 2 evaluate their sensitivity to cold stress; and 3 analyze the expression of stress-responsive genes under cold stress and a combination of cold and depth stress. Seeds were germinated at 25°C at 1.5- and 10-cm sowing depth for 10d. Seedlings were then exposed to cold stress at 10°C for 6, 24 and 96h, and the expression of cold-, anoxia-, and submergence-inducible genes was analyzed. Control plants were seeded at 1.5cm depth and kept at 25°C. The analysis revealed that cold stress signaling in indica genotypes is more complex than that of japonica as it operates via both the CBF-dependent and CBF-independent pathways, implicated through induction of transcription factors including OsNAC2, OsMYB46 and OsF-BOX28. When plants were exposed to cold + sowing depth stress, a complex signaling network was induced that involved cross talk between stresses mediated by CBF-dependent and CBF-independent pathways to circumvent the detrimental effects of stresses. The experiments revealed the importance of the CBF regulon for tolerance to both stresses in japonica and indica ssp. The mechanisms for cold tolerance differed among weedy indica genotypes and also between weedy indica and

  8. A wheat PI4K gene whose product possesses threonine autophophorylation activity confers tolerance to drought and salt in Arabidopsis.

    Science.gov (United States)

    Liu, Pei; Xu, Zhao-Shi; Pan-Pan, Lu; Hu, Di; Chen, Ming; Li, Lian-Cheng; Ma, You-Zhi

    2013-07-01

    Phosphoinositides are involved in regulation of recruitment and activity of signalling proteins in cell membranes. Phosphatidylinositol (PI) 4-kinases (PI4Ks) generate PI4-phosphate the precursor of regulatory phosphoinositides. No type II PI4K research on the abiotic stress response has previously been reported in plants. A stress-inducible type II PI4K gene, named TaPI4KIIγ, was obtained by de novo transcriptome sequencing of drought-treated wheat (Triticum aestivum). TaPI4KIIγ, localized on the plasma membrane, underwent threonine autophosphorylation, but had no detectable lipid kinase activity. Interaction of TaPI4KIIγ with wheat ubiquitin fusion degradation protein (TaUDF1) indicated that it might be hydrolysed by the proteinase system. Overexpression of TaPI4KIIγ revealed that it could enhance drought and salt stress tolerance during seed germination and seedling growth. A ubdkγ7 mutant, identified as an orthologue of TaPI4KIIγ in Arabidopsis, was sensitive to salt, polyethylene glycol (PEG), and abscisic acid (ABA), and overexpression of TaPI4KIIγ in the ubdkγ7 mutant compensated stress sensitivity. TaPI4KIIγ promoted root growth in Arabidopsis, suggesting that TaPI4KIIγ might enhance stress resistance by improving root growth. Overexpression of TaPI4KIIγ led to an altered expression level of stress-related genes and changes in several physiological traits that made the plants more tolerant to stress. The results provided evidence that overexpression of TaPI4KIIγ could improve drought and salt tolerance. PMID:23682116

  9. The Cotton WRKY Gene GhWRKY41 Positively Regulates Salt and Drought Stress Tolerance in Transgenic Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Xiaoqian Chu

    Full Text Available WRKY transcription factors constitute a very large family of proteins in plants and participate in modulating plant biological processes, such as growth, development and stress responses. However, the exact roles of WRKY proteins are unclear, particularly in non-model plants. In this study, Gossypium hirsutum WRKY41 (GhWRKY41 was isolated and transformed into Nicotiana benthamiana. Our results showed that overexpression of GhWRKY41 enhanced the drought and salt stress tolerance of transgenic Nicotiana benthamiana. The transgenic plants exhibited lower malondialdehyde content and higher antioxidant enzyme activity, and the expression of antioxidant genes was upregulated in transgenic plants exposed to osmotic stress. A β-glucuronidase (GUS staining assay showed that GhWRKY41 was highly expressed in the stomata when plants were exposed to osmotic stress, and plants overexpressing GhWRKY41 exhibited enhanced stomatal closure when they were exposed to osmotic stress. Taken together, our findings demonstrate that GhWRKY41 may enhance plant tolerance to stress by functioning as a positive regulator of stoma closure and by regulating reactive oxygen species (ROS scavenging and the expression of antioxidant genes.

  10. Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum

    Indian Academy of Sciences (India)

    Xiuhong Yang; Chao Sun; Yuanlei Hun; Zhongping Lin

    2008-03-01

    A RING zinc finger ankyrin protein gene, designated AdZFP1, was isolated from drought-tolerant Artemisia desertorum Spreng by mRNA differential display and RACE. Its cDNA was 1723 bp and encoded a putative protein of 445 amino acids with a predicted molecular mass of 47.9 kDa and an isoelectric point (pI) of 7.49. A typical C3HC4-type RING finger domain was found at the C-terminal region of the AdZFP1 protein, and several groups of ankyrin repeats were found at the N-terminal region. Alignments of amino acid sequence showed that AdZFP1 was 66% identical to the Arabidopsis thaliana putative RING zinc finger ankyrin protein AAN31869. Transcriptional analysis showed that AdZFP1 was inducible under drought stress in root, stem and leaf of the plant. Semi-quantitative reverse-transcriptase-polymerase chain reaction (RT-PCR) analysis showed that the transcript of AdZFP1 was strongly induced by exogenous abscisic acid (ABA) and also by salinity, cold and heat to some extent. Overexpression of the AdZFP1 gene in transgenic tobacco enhanced their tolerance to drought stress.

  11. The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco

    OpenAIRE

    Yadav Narendra; Shukla Pushp; Jha Anupama; Agarwal Pradeep K; Jha Bhavanath

    2012-01-01

    Abstract Background Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1) gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. Results The SbSOS1 gene is 3774 bp long and encodes a protein of 115...

  12. Field Supervisory Test of DREB-Transgenic Populus: Salt Tolerance, Long-Term Gene Stability and Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Nan Lu

    2014-05-01

    Full Text Available Improving saline resistance may be useful for reducing environmental susceptibility and improving yields in poplar plantations. However, the instability of genetically engineered traits and gene transfer reduce their usefulness and commercial value. To investigate whether the foreign gene is still present in the genome of receptor plants after seven years (i.e., long-term foreign gene stability and gene transfer, we randomly analyzed ten field-grown transgenic hybrid Populus ((Populus tomentosa × Populus bolleana × P. tomentosa carrying the DREB1 gene from Atriplex hortensis. The results of PCR and tissue culture experiments showed that AhDREB1 was present in the transgenic trees and was still expressed. However, the transcriptional expression level had decreased compared with that four years earlier. The PCR results also indicated no foreign gene in the genomic DNA of microorganisms in the soil near the transgenic poplars, indicating that no significant gene transfer had occurred from the transgenic poplars to the microorganisms at seven years after planting.

  13. A tandem array of CBF/DREB1 genes is located in a major freezing tolerance QTL region on Medicago truncatula chromosome 6

    OpenAIRE

    Tayeh, Nadim; Bahrman, Nasser; Sellier, Hélène; Bluteau, Aurélie; Blassiau, Christelle; Fourment, Joelle; Bellec, Arnaud; Debellé, Frederic; Lejeune-Henaut, Isabelle; Delbreil, Bruno

    2013-01-01

    Background Freezing provokes severe yield losses to different fall-sown annual legumes. Understanding the molecular bases of freezing tolerance is of great interest for breeding programs. Medicago truncatula Gaertn. is an annual temperate forage legume that has been chosen as a model species for agronomically and economically important legume crops. The present study aimed to identify positional candidate genes for a major freezing tolerance quantitative trait locus that was previously mapped...

  14. Discovery of error-tolerant biclusters from noisy gene expression data

    OpenAIRE

    Gupta Rohit; Rao Navneet; Kumar Vipin

    2011-01-01

    Abstract Background An important analysis performed on microarray gene-expression data is to discover biclusters, which denote groups of genes that are coherently expressed for a subset of conditions. Various biclustering algorithms have been proposed to find different types of biclusters from these real-valued gene-expression data sets. However, these algorithms suffer from several limitations such as inability to explicitly handle errors/noise in the data; difficulty in discovering small bi...

  15. Candidate genes for drought tolerance and improved productivity in rice (Oryza sativa L.)

    Indian Academy of Sciences (India)

    M S Vinod; Naveen Sharma; K Manjunatha; Adnan Kanbar; N B Prakash; H E Shashidhar

    2006-03-01

    Candidate genes are sequenced genes of known biological action involved in the development or physiology of a trait. Twenty-one putative candidate genes were designed after an exhaustive search in the public databases along with an elaborate literature survey for candidate gene products and/or regulatory sequences associated with enhanced drought resistance. The downloaded sequences were then used to design primers considering the flanking sequences as well. Polymerase chain reaction (PCR) performed on 10 diverse cultivars that involved Japonica, Indica and local accessions, revealed 12 polymorphic candidate genes. Seven polymorphic candidate genes were then utilized to genotype 148 individuals of CT9993 × IR62266 doubled haploid (DH) mapping population. The segregation data were tested for deviation from the expected Mendelian ratio (1:1) using a Chi-square test (<1%). Based on this, four candidate genes were assessed to be significant and the remaining three, as non-significant. All the significant candidate genes were biased towards CT9993, the female parent in the DH mapping population. Single-marker analysis strongly associated ( < 1%) them to different traits under both well-watered and low-moisture stress conditions. Two candidate genes, EXP15 and EXP13, were found to be associated with root number and silicon content in the stem respectively, under both well-watered and low-moisture stress conditions.

  16. Potassium sensitivity differs among strains of the harmful cyanobacterium Microcystis and correlates with the presence of salt tolerance genes.

    Science.gov (United States)

    Sandrini, Giovanni; Huisman, Jef; Matthijs, Hans C P

    2015-08-01

    Microcystis aeruginosa is a ubiquitous harmful cyanobacterium that causes problems in eutrophic lakes. Potassium ion (K(+)) addition is one of the suggested methods to combat harmful cyanobacterial blooms. To investigate the effectiveness of this method, we compared the potassium ion sensitivity of four Microcystis strains. Microcystis strains PCC 7005 and NIES-843 were very susceptible to potassium ion concentrations of ∼ 12 mmol L(-1), whereas strain PCC 7806 and its non-toxic mutant PCC 7806 ΔmcyB were not affected by added potassium ions. The origin of the strain appears to be of importance. Strain PCC 7806 originates from brackish water and possesses genes for the synthesis of the compatible solute sucrose, the water channel protein gene aqpZ and the sodium influx gene nhaS2, whereas strains PCC 7005 and NIES-843 have a freshwater origin and lack these genes. We conclude that potassium ion addition will not be a successful mitigation strategy in brackish waters, but may temporarily suppress Microcystis blooms in freshwater lakes. However, in the long run other Microcystis strains or other cyanobacteria with a higher salt tolerance will likely take over. In addition, our results also have implications for the potassium ion concentrations of mineral media used in laboratory studies with cyanobacteria. PMID:26208527

  17. Expression in Escherichia coli of Three Different Soybean Late Embryogenesis Abundant (LEA) Genes to Investigate Enhanced Stress Tolerance

    Institute of Scientific and Technical Information of China (English)

    Ying LAN; Dan CAI; Yi-Zhi ZHENG

    2005-01-01

    In order to identify the function of late embryogenesis abundant (LEA) genes, in vitro functional analyses were perfo rmed using an Escherichia coli heterologous expression system. Three soybean late embryogenesis abundant (LEA) genes, PM11 (GenBank accession No. AF004805; group 1), PM30 (AF1 17884; group 3), and ZLDE-2 (AY351918; group 2), were cloned and expressed in a pET-28a system.The gene products were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and identified by mass spectrometry. E. coli cells containing the recombinant plasmids or empty vector as controls were treated by salt and low temperature stress. Compared with control cells, the E. coli cells expressing either PM11 or PM30 showed a shorter lag period and improved growth when transferred to LB (Luria-Bertani) liquid media containing 800 mmol/L NaCl or 700 mmol/L KCl or after 4 ℃ treatment. E. coli cells expressing ZLDE-2 did not show obvious growth improvement both in either high KCl medium or after 4 ℃ treatment. The results indicate that the E. coli expression system is a simple, useful method to identify the functions of some stress-tolerant genes from plants.

  18. Development of highly glyphosate-tolerant tobacco by coexpression of glyphosate acetyltransferase gat and EPSPS G2-aroA genes

    Institute of Scientific and Technical Information of China (English)

    Baoqing; Dun; Xujing; Wang; Wei; Lu; Ming; Chen; Wei; Zhang; Shuzhen; Ping; Zhixing; Wang; Baoming; Zhang; Min; Lin

    2014-01-01

    The widely used herbicide glyphosate targets 5-enolpyruvylshikimate-3-phosphate synthase(EPSPS).Glyphosate acetyltransferase(GAT)effectively detoxifies glyphosate by N-acetylation.With the aim of identifying a new strategy for development of glyphosate-tolerant crops,the plant expression vector pG2-GAT harboring gat and G2-aroA(encoding EPSPS)has been transformed into tobacco(Nicotiana tabacum)to develop novel plants with higher tolerance to glyphosate.Results from Southern and Western blotting analyses indicated that the target genes were integrated into tobacco chromosomes and expressed effectively at the protein level.Glyphosate tolerance was compared among transgenic tobacco plants containing gat,G2-aroA,or both genes.Plants containing both gat and G2-aroA genes were the most glyphosate-tolerant.This study has shown that a combination of different strategies may result in higher tolerance in transgenic crops,providing a new approach for development of glyphosate-tolerant crops.

  19. Overexpression of calmodulin-like (ShCML44) stress-responsive gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses.

    Science.gov (United States)

    Munir, Shoaib; Liu, Hui; Xing, Yali; Hussain, Saddam; Ouyang, Bo; Zhang, Yuyang; Li, Hanxia; Ye, Zhibiao

    2016-01-01

    Calmodulin-like (CML) proteins are important Ca(2+) sensors, which play significant role in mediating plant stress tolerance. In the present study, cold responsive calmodulin-like (ShCML44) gene was isolated from cold tolerant wild tomato (Solanum habrochaites), and functionally characterized. The ShCML44 was differentially expressed in all plant tissues including root, stem, leaf, flower and fruit, and was strongly up-regulated under cold, drought and salinity stresses along with plant growth hormones. Under cold stress, progressive increase in the expression of ShCML44 was observed particularly in cold-tolerant S. habrochaites. The ShCML44-overexpressed plants showed greater tolerance to cold, drought, and salinity stresses, and recorded higher germination and better seedling growth. Transgenic tomato plants demonstrated higher antioxidant enzymes activity, gas exchange and water retention capacity with lower malondialdehyde accumulation and membrane damage under cold and drought stresses compared to wild-type. Moreover, transgenic plants exhibited reduced reactive oxygen species and higher relative water contents under cold and drought stress, respectively. Greater stress tolerance of transgenic plants was further reflected by the up-/down-regulation of stress-related genes including SOD, GST, CAT, POD, LOX, PR and ERD. In crux, these results strengthen the molecular understanding of ShCML44 gene to improve the abiotic stress tolerance in tomato. PMID:27546315

  20. The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Amit Kumar Chaturvedi

    Full Text Available Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13 showed significantly enhanced salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

  1. Chromosome mapping of low-temperature induced Wcs120 family genes and regulation of cold-tolerance expression in wheat.

    Science.gov (United States)

    Limin, A E; Danyluk, J; Chauvin, L P; Fowler, D B; Sarhan, F

    1997-02-27

    Low-temperature (LT) induced genes of the Wcs120 family in wheat (Triticum aestivum) were mapped to specific chromosome arms using Western and Southern blot analysis on the ditelocentric series in the cultivar Chinese Spring (CS). Identified genes were located on the long arms of the homoeologous group 6 chromosomes of all 3 genomes (A, B, and D) of hexaploid wheat. Related species carrying either the A, D, or AB genomes were also examined using Southern and Western analysis with the Wcs120 probe and the WCS120 antibody. All closely related species carrying one or more of the genomes of hexaploid wheat produced a 50 kDa protein that was identified by the antibody, and a Wcs120 homoeologue was detected by Southern analysis in all species. In the absence of chromosome arm 6DL in hexaploid CS wheat no 50 kDa protein was produced and the high-intensity Wcs120 band was missing, indicating 6DL as the location of Wcs120 but suggesting silencing of the Wcs120 homoeologue in the A genome. Levels of proteins that cross-reacted with the Wcs120 antibody and degrees of cold tolerance were also investigated in the Chinese Spring/Cheyenne (CS/CNN) chromosome substitution series. CNN chromosome 5A increased the cold tolerance of CS wheat. Densitometry scanning of Western blots to determine protein levels showed that the group 5 chromosome 5A had a regulatory effect on the expression of the Wcs120 gene family located on the group 6 chromosomes of all three hexaploid wheat genomes. PMID:9079883

  2. Overexpression of Heat Shock Factor Gene HsfA3 Increases Galactinol Levels and Oxidative Stress Tolerance in Arabidopsis.

    Science.gov (United States)

    Song, Chieun; Chung, Woo Sik; Lim, Chae Oh

    2016-06-30

    Heat shock factors (Hsfs) are central regulators of abiotic stress responses, especially heat stress responses, in plants. In the current study, we characterized the activity of the Hsf gene HsfA3 in Arabidopsis under oxidative stress conditions. HsfA3 transcription in seedlings was induced by reactive oxygen species (ROS), exogenous hydrogen peroxide (H2O2), and an endogenous H2O2 propagator, 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB). HsfA3-overexpressing transgenic plants exhibited increased oxidative stress tolerance compared to untransformed wild-type plants (WT), as revealed by changes in fresh weight, chlorophyll fluorescence, and ion leakage under light conditions. The expression of several genes encoding galactinol synthase (GolS), a key enzyme in the biosynthesis of raffinose family oligosaccharides (RFOs), which function as antioxidants in plant cells, was induced in HsfA3 overexpressors. In addition, galactinol levels were higher in HsfA3 overexpressors than in WT under unstressed conditions. In transient transactivation assays using Arabidopsis leaf protoplasts, HsfA3 activated the transcription of a reporter gene driven by the GolS1 or GolS2 promoter. Electrophoretic mobility shift assays showed that GolS1 and GolS2 are directly regulated by HsfA3. Taken together, these findings provide evidence that GolS1 and GolS2 are directly regulated by HsfA3 and that GolS enzymes play an important role in improving oxidative stress tolerance by increasing galactinol biosynthesis in Arabidopsis. PMID:27109422

  3. Seleção de populações de Lotus corniculatus L. com maior tolerância ao alumínio em solução nutritiva Selection of populations of Lotus corniculatus L. with increased tolerance to aluminum in nutrient solution

    Directory of Open Access Journals (Sweden)

    Aline Janke

    2010-11-01

    Full Text Available O experimento foi realizado com o objetivo de selecionar genótipos de Lotus corniculatus L. (Draco, São Gabriel e UFRGS mais tolerantes ao alumínio, utilizando-se a técnica de seleção em solução nutritiva. A solução continha 200 µmol/L de cálcio (CaCl2, 100 µmol/L de alumínio (AlCl3 e pH controlado na faixa de 4,1 a 4,3. Realizaram-se dois ciclos de seleção, nos quais as plântulas foram selecionadas pelo comprimento final das radículas. Posteriormente, avaliou-se o ganho genético alcançado nos ciclos de seleção, tanto nas populações originais como nas melhoradas, em um experimento com solução nutritiva com quatro concentrações de alumínio (0, 50, 100 e 150 µmol/L (AlCl3, por meio do crescimento radicular líquido. O uso de solução nutritiva foi eficiente na seleção de plântulas de cornichão tolerantes ao alumínio. Os materiais analisados apresentam diferenças em relação a esta característica, destacando-se o genótipo UFRGS F2, proveniente de dois ciclos de seleção, como o material com maior tolerância ao alumínio.The experiment was carried out to select genotypes of Lotus corniculatus L. (Draco, São Gabriel and UFRGS more tolerant to aluminum, using the technique of selection in nutrient solution. The solution contained 200 µmol/L calcium (CaCl2 and 100 µmol/L aluminum (AlCl3 and a pH controlled in the range from 4.1 to 4.3. It was performed two cycles of selection, in which the seedlings were selected by the root final length. Subsequently, the genetic gain achieved in the cycles of selection was tested, in original and improved populations in an experiment in nutrient solution with four concentrations of aluminum (0, 50, 100 and 150 µmol/L (AlCl3, by liquid root growth. Use of nutritional solution was efficient in the selection of seedlings of birdsfoot trefoil tolerant to aluminum. The materials analyzed differ for this characteristic, with the genotype UFRGS F2, being the most tolerant.

  4. Analysis of gene expression provides insights into the mechanism of cadmium tolerance in Acidithiobacillus ferrooxidans.

    Science.gov (United States)

    Chen, Minjie; Li, Yanjun; Zhang, Li; Wang, Jianying; Zheng, Chunli; Zhang, Xuefeng

    2015-02-01

    Acidithiobacillus ferrooxidans plays a critical role in metal solubilization in the biomining industry, and occupies an ecological niche characterized by high acidity and high concentrations of toxic heavy metal ions. In order to investigate the possible metal resistance mechanism, the cellular distribution of cadmium was tested. The result indicated that Cd(2+) entered the cells upon initial exposure resulting in increased intracellular concentrations, followed by its excretion from the cells during subsequent growth and adaptation. Sequence homology analyses were used to identify 10 genes predicted to participate in heavy metal homeostasis, and the expression of these genes was investigated in cells cultured in the presence of increasing concentrations of toxic divalent cadmium (Cd(2+)). The results suggested that one gene (cmtR A.f ) encoded a putative Cd(2+)/Pb(2+)-responsive transcriptional regulator; four genes (czcA1 A.f , czcA2 A.f , czcB1 A.f ; and czcC1 A.f ) encoded heavy metal efflux proteins for Cd(2+); two genes (cadA1 A.f and cadB1 A.f ) encoded putative cation channel proteins related to the transport of Cd(2+). No significant enhancement of gene expression was observed at low concentrations of Cd(2+) (5 mM) and most of the putative metal resistance genes were up-regulated except cmtR A.f , cadB3 A.f ; and czcB1 A.f at higher concentrations (15 and 30 mM) according to real-time polymerase chain reaction. A model was developed for the mechanism of resistance to cadmium ions based on homology analyses of the predicted genes, the transcription of putative Cd(2+) resistance genes, and previous work. PMID:25344309

  5. Identification and characterization of a salt tolerance-responsive gene( AtGRP9) of Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Soil salinity is one of the important limiting factors for plant growth and development. A cDNA clone encoding a glycine-rich protein (designated AtGRP9) was identified from Arabidopsis by functional expression of the plant cDNA library in the fission yeast S. pombe. Yeast cells overexpressing AtGRP9 displayed significantly enhanced salt tolerance. Northern analysis showed that expression of AtGRP9 in Arabidopsis was induced by NaCl and plant hormone abscisic acid (ABA). These results suggest that AtGRP9 may be involved in the salt stress response in Arabidopsis.

  6. Analysis of changes in hepatic gene expression in a murine model of tolerance to acetaminophen hepatotoxicity (autoprotection)

    Energy Technology Data Exchange (ETDEWEB)

    O' Connor, Meeghan A., E-mail: meeghan.oconnor@boehringer-ingelheim.com [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Boehringer Ingelheim Pharmaceuticals Inc., 900 Ridgebury Road, Ridgefield, CT 06877-0368 (United States); Koza-Taylor, Petra, E-mail: petra.h.koza-taylor@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Campion, Sarah N., E-mail: sarah.campion@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Aleksunes, Lauren M., E-mail: aleksunes@eohsi.rutgers.edu [Rutgers University, Department of Pharmacology and Toxicology, Environmental and Occupational Health Sciences Institute, Piscataway, NJ 08854 (United States); Gu, Xinsheng, E-mail: xinsheng.gu@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Enayetallah, Ahmed E., E-mail: ahmed.enayetallah@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Lawton, Michael P., E-mail: michael.lawton@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Manautou, José E., E-mail: jose.manautou@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States)

    2014-01-01

    Pretreatment of mice with a low hepatotoxic dose of acetaminophen (APAP) results in resistance to a subsequent, higher dose of APAP. This mouse model, termed APAP autoprotection was used here to identify differentially expressed genes and cellular pathways that could contribute to this development of resistance to hepatotoxicity. Male C57BL/6J mice were pretreated with APAP (400 mg/kg) and then challenged 48 h later with 600 mg APAP/kg. Livers were obtained 4 or 24 h later and total hepatic RNA was isolated and hybridized to Affymetrix Mouse Genome MU430{sub 2} GeneChip. Statistically significant genes were determined and gene expression changes were also interrogated using the Causal Reasoning Engine (CRE). Extensive literature review narrowed our focus to methionine adenosyl transferase-1 alpha (MAT1A), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), flavin-containing monooxygenase 3 (Fmo3) and galectin-3 (Lgals3). Down-regulation of MAT1A could lead to decreases in S-adenosylmethionine (SAMe), which is known to protect against APAP toxicity. Nrf2 activation is expected to play a role in protective adaptation. Up-regulation of Lgals3, one of the genes supporting the Nrf2 hypothesis, can lead to suppression of apoptosis and reduced mitochondrial dysfunction. Fmo3 induction suggests the involvement of an enzyme not known to metabolize APAP in the development of tolerance to APAP toxicity. Subsequent quantitative RT-PCR and immunochemical analysis confirmed the differential expression of some of these genes in the APAP autoprotection model. In conclusion, our genomics strategy identified cellular pathways that might further explain the molecular basis for APAP autoprotection. - Highlights: • Differential expression of genes in mice resistant to acetaminophen hepatotoxicity. • Increased gene expression of Flavin-containing monooxygenase 3 and Galectin-3. • Decrease in MAT1A expression and compensatory hepatocellular regeneration. • Two distinct gene

  7. Analysis of changes in hepatic gene expression in a murine model of tolerance to acetaminophen hepatotoxicity (autoprotection)

    International Nuclear Information System (INIS)

    Pretreatment of mice with a low hepatotoxic dose of acetaminophen (APAP) results in resistance to a subsequent, higher dose of APAP. This mouse model, termed APAP autoprotection was used here to identify differentially expressed genes and cellular pathways that could contribute to this development of resistance to hepatotoxicity. Male C57BL/6J mice were pretreated with APAP (400 mg/kg) and then challenged 48 h later with 600 mg APAP/kg. Livers were obtained 4 or 24 h later and total hepatic RNA was isolated and hybridized to Affymetrix Mouse Genome MU4302 GeneChip. Statistically significant genes were determined and gene expression changes were also interrogated using the Causal Reasoning Engine (CRE). Extensive literature review narrowed our focus to methionine adenosyl transferase-1 alpha (MAT1A), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), flavin-containing monooxygenase 3 (Fmo3) and galectin-3 (Lgals3). Down-regulation of MAT1A could lead to decreases in S-adenosylmethionine (SAMe), which is known to protect against APAP toxicity. Nrf2 activation is expected to play a role in protective adaptation. Up-regulation of Lgals3, one of the genes supporting the Nrf2 hypothesis, can lead to suppression of apoptosis and reduced mitochondrial dysfunction. Fmo3 induction suggests the involvement of an enzyme not known to metabolize APAP in the development of tolerance to APAP toxicity. Subsequent quantitative RT-PCR and immunochemical analysis confirmed the differential expression of some of these genes in the APAP autoprotection model. In conclusion, our genomics strategy identified cellular pathways that might further explain the molecular basis for APAP autoprotection. - Highlights: • Differential expression of genes in mice resistant to acetaminophen hepatotoxicity. • Increased gene expression of Flavin-containing monooxygenase 3 and Galectin-3. • Decrease in MAT1A expression and compensatory hepatocellular regeneration. • Two distinct gene expression

  8. 21 CFR 182.2122 - Aluminum calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Aluminum calcium silicate. 182.2122 Section 182.2122 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED....2122 Aluminum calcium silicate. (a) Product. Aluminum calcium silicate. (b) Tolerance. 2 percent....

  9. 21 CFR 582.2122 - Aluminum calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aluminum calcium silicate. 582.2122 Section 582.2122 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED....2122 Aluminum calcium silicate. (a) Product. Aluminum calcium silicate. (b) Tolerance. 2 percent....

  10. Discrete dynamical system modelling for gene regulatory networks of 5-hydroxymethylfural tolerance for ethanologenic yeast

    Science.gov (United States)

    Composed of linear difference equations, a discrete dynamic system model was designed to reconstruct transcriptional regulations in gene regulatory networks in response to 5-hydroxymethylfurfural, a bioethanol conversion inhibitor for ethanologenic yeast Saccharomyces cerevisiae. The modeling aims ...

  11. Tolerância de genótipos de cereais de inverno ao alumínio em cultivo hidropônico e em campo Tolerance of small graine cereal genotypes to aluminum on hydroponic and field cultivation

    OpenAIRE

    Roberto Portaluppi; Sandra Patussi Brammer; Jurandir Vieira de Magalhães; Cibele Tesser da Costa; Eduardo Caierão; Alfredo do Nascimento Junior; José Pereira da Silva Junior

    2010-01-01

    O objetivo deste trabalho foi determinar a capacidade de crescimento radicular de 75 genótipos de cereais de inverno em cultivo hidropônico, em diferentes concentrações de alumínio, avaliar a relação entre o grau de tolerância/sensibilidade, em solução hidropônica, e a resistência/suscetibilidade ao crestamento em campo. Os cereais cevada, triticale, centeio, trigo e Aegilops tauschii foram avaliados em hidroponia, com concentrações de Al3+ que variaram entre 0,5 (cevada), 2 e 6 (triticale), ...

  12. Disease-tolerance of transgenic tobacco plants expressing Ah-AMP gene of Amaranthus hypochondriacus

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    An antimicrobial peptide gene from Amaranthus hypochondriacus, Ah-AMP, was amplified by PCR and cloned. Sequence analysis results revealed that this gene is 261 bp in length encoding a precursor polypeptide of 87 amino acid residues. Ah-AMP gene was inserted in the binary vector pBin438 to construct a plant expression vector pBinAH916. Leave explants of Nicotiana tabacum var. SR1 were transformed with Agrobacterium tumefaciens LBA4404 harboring the above expression vector. Results from PCR, Southern and Northern blot analyses confirmed that the Ah-AMP gene had been integrated into the tobacco genome and was transcribed at mRNA level. Two bacterial-resistant transgenic plants were selected by inoculating the plants with Pseudomonas solanacearum and statistic analysis of two T1 lines showed that the resistance increased by 2.24 and 1.62 grade and the disease index decreased by 49.6% and 37.3% respectively when compared with the non-transformed control plants SR1. The results from challenging the plants with inoculums of Phytophthora parasitica showed that the symptom development was delayed and disease index was significantly reduced. These results suggest that Ah-AMP gene may be a potentially valuable gene for genetic engineering of plant for disease-resistance.

  13. Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances.

    Science.gov (United States)

    Wang, Xiatian; Zeng, Jian; Li, Ying; Rong, Xiaoli; Sun, Jiutong; Sun, Tao; Li, Miao; Wang, Lianzhe; Feng, Ying; Chai, Ruihong; Chen, Mingjie; Chang, Junli; Li, Kexiu; Yang, Guangxiao; He, Guangyuan

    2015-01-01

    The WRKY transcription factors have been reported to be involved in various plant physiological and biochemical processes. In this study, we successfully assembled 10 unigenes from expressed sequence tags (ESTs) of wheat and designated them as TaWRKY44-TaWRKY53, respectively. Among these genes, a subgroup I gene, TaWRKY44, was found to be upregulated by treatments with PEG6000, NaCl, 4°C, abscisic acid (ABA), H2O2 and gibberellin (GA). The TaWRKY44-GFP fusion protein was localized to the nucleus of onion epidermal cells, and TaWRKY44 was able to bind to the core DNA sequences of TTGACC and TTAACC in yeast. The N-terminal of TaWRKY44 showed transcriptional activation activity. Expression of TaWRKY44 in tobacco plants conferred drought and salt tolerance and transgenic tobacco exhibited a higher survival rate, relative water content (RWC), soluble sugar, proline and superoxide dismutase (SOD) content, as well as higher activities of catalase (CAT) and peroxidase (POD), but less ion leakage (IL), lower contents of malondialdehyde (MDA), and H2O2. In addition, expression of TaWRKY44 also increased the seed germination rate in the transgenic lines under osmotic stress conditions while exhibiting a lower H2O2 content and higher SOD, CAT, and POD activities. Expression of TaWRKY44 upregulated the expression of some reactive oxygen species (ROS)-related genes and stress-responsive genes in tobacco under osmotic stresses. These data demonstrate that TaWRKY44 may act as a positive regulator in drought/salt/osmotic stress responses by either efficient ROS elimination through direct or indirect activation of the cellular antioxidant systems or activation of stress-associated gene expression. PMID:26322057

  14. Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances

    Directory of Open Access Journals (Sweden)

    Xiatian eWang

    2015-08-01

    Full Text Available The WRKY transcription factors have been reported to be involved in various plant physiological and biochemical processes. In this study, we successfully assembled ten unigenes from expressed sequence tags (ESTs of wheat and designated them as TaWRKY44–TaWRKY53, respectively. Among these genes, a subgroup I gene, TaWRKY44, was found to be upregulated by treatments with PEG6000, NaCl, 4°C, abscisic acid (ABA, H2O2 and gibberellin (GA. The TaWRKY44-GFP fusion protein was localized to the nucleus of onion epidermal cells, and TaWRKY44 was able to bind to the core DNA sequences of TTGACC and TTAACC in yeast. The N-terminal of TaWRKY44 showed transcriptional activation activity. Expression of TaWRKY44 in tobacco plants conferred drought and salt tolerance and transgenic tobacco exhibited a higher survival rate, relative water content (RWC, soluble sugar, proline and superoxide dismutase (SOD content, as well as higher activities of catalase (CAT and peroxidase (POD, but less ion leakage (IL, lower contents of malondialdehyde (MDA, and H2O2. In addition, expression of TaWRKY44 also increased the seed germination rate in the transgenic lines under osmotic stress conditions while exhibiting a lower H2O2 content and higher SOD, CAT and POD activities. Expression of TaWRKY44 upregulated the expression of some reactive oxygen species (ROS-related genes and stress-responsive genes in tobacco under osmotic stresses. These data demonstrate that TaWRKY44 may act as a positive regulator in drought/salt/osmotic stress responses by either efficient ROS elimination through direct or indirect activation of the cellular antioxidant systems or activation of stress-associated gene expression.

  15. Linhagens diaplóides de trigo: produção de grãos, características agronômicas e tolerância à toxicidade de alumínio Dihaploid wheat lines: grain yield, agronomic characteristics and tolerance to aluminum toxicity

    Directory of Open Access Journals (Sweden)

    CARLOS EDUARDO DE OLIVEIRA CAMARGO

    1999-01-01

    spike. All of them were tolerant to aluminum toxicity except IAC-287 (sensitive control.

  16. Characterization of the HMA7 gene and transcriptomic analysis of candidate genes for copper tolerance in two Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Baloun, J.; Nevrtalová, E.; Kováčová, V.; Hudzieczek, V.; Čegan, R.; Vyskot, B.; Hobza, Roman

    2014-01-01

    Roč. 171, č. 13 (2014), s. 1188-1196. ISSN 0176-1617 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:61389030 Keywords : Copper * Genes coding ROS-eliminating and Cu-transporting proteins * RNA-Seq database Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.557, year: 2014

  17. ABI-like transcription factor gene TaABL1 from wheat improves multiple abiotic stress tolerances in transgenic plants.

    Science.gov (United States)

    Xu, Dong-Bei; Gao, Shi-Qing; Ma, You-Zhi; Xu, Zhao-Shi; Zhao, Chang-Ping; Tang, Yi-Miao; Li, Xue-Yin; Li, Lian-Cheng; Chen, Yao-Feng; Chen, Ming

    2014-12-01

    The phytohormone abscisic acid (ABA) plays crucial roles in adaptive responses of plants to abiotic stresses. ABA-responsive element binding proteins (AREBs) are basic leucine zipper transcription factors that regulate the expression of downstream genes containing ABA-responsive elements (ABREs) in promoter regions. A novel ABI-like (ABA-insensitive) transcription factor gene, named TaABL1, containing a conserved basic leucine zipper (bZIP) domain was cloned from wheat. Southern blotting showed that three copies were present in the wheat genome. Phylogenetic analyses indicated that TaABL1 belonged to the AREB subfamily of the bZIP transcription factor family and was most closely related to ZmABI5 in maize and OsAREB2 in rice. Expression of TaABL1 was highly induced in wheat roots, stems, and leaves by ABA, drought, high salt, and low temperature stresses. TaABL1 was localized inside the nuclei of transformed wheat mesophyll protoplast. Overexpression of TaABL1 enhanced responses of transgenic plants to ABA and hastened stomatal closure under stress, thereby improving tolerance to multiple abiotic stresses. Furthermore, overexpression of TaABL1 upregulated or downregulated the expression of some stress-related genes controlling stomatal closure in transgenic plants under ABA and drought stress conditions, suggesting that TaABL1 might be a valuable genetic resource for transgenic molecular breeding. PMID:25344442

  18. Neurospora crassa tox-1 Gene Encodes a pH- and Temperature-Tolerant Mini-Cellulase.

    Science.gov (United States)

    Xiao, Yue; Zhang, Qiongsi; Luo, Yiquan; Zhang, Ying; Luo, Xi; Wang, Yuchuan; Cao, Weiguo; Pinto, Vito De; Liu, Qiuyun; Li, Gang

    2016-06-15

    Cellulases that endure extreme conditions are essential in various industrial sectors. This study reports a mini-cellulase gene tox-1 from Neurospora crassa. The gene tox-1 was cloned in Escherichia coli after chimerization with the YebF gene and substitutions of certain isoleucine and valine with leucine residues. The yeast transformants could grow on rice straw-agar medium. The 44-amino acid peptide and its two mutant variants displayed potent cellulase activities in Congo Red assay and enzymatic assays. Conservative replacements with leucine have substantially increased the stabilities and half-lives of the peptides at alkaline pH and low and high temperatures and also the tolerance to organic solvents and surfactants, on the basis of activities toward cellose. The small size of the mini-cellulase would allow for commercially viable automatic chemical peptide synthesis. This work suggests that conservative leucine replacements may serve as a general strategy in the engineering of more robust enzymes with special features with little loss of activities. PMID:27229865

  19. Overexpression of Arachis hypogaea AREB1 Gene Enhances Drought Tolerance by Modulating ROS Scavenging and Maintaining Endogenous ABA Content

    Directory of Open Access Journals (Sweden)

    Ling Li

    2013-06-01

    Full Text Available AhAREB1 (Arachis hypogaea Abscisic-acid Response Element Binding Protein 1 is a member of the basic domain leucine zipper (bZIP-type transcription factor in peanut. Previously, we found that expression of AhAREB1 was specifically induced by abscisic acid (ABA, dehydration and drought. To understand the drought defense mechanism regulated by AhAREB1, transgenic Arabidopsis overexpressing AhAREB1 was conducted in wild-type (WT, and a complementation experiment was employed to ABA non-sensitivity mutant abi5 (abscisic acid-insensitive 5. Constitutive expression of AhAREB1 confers water stress tolerance and is highly sensitive to exogenous ABA. Microarray and further real-time PCR analysis revealed that drought stress, reactive oxygen species (ROS scavenging, ABA synthesis/metabolism-related genes and others were regulated in transgenic Arabidopsis overexpressing AhAREB1. Accordingly, low level of ROS, but higher ABA content was detected in the transgenic Arabidopsis plants’ overexpression of AhAREB1. Taken together, it was concluded that AhAREB1 modulates ROS accumulation and endogenous ABA level to improve drought tolerance in transgenic Arabidopsis.

  20. In planta transformation of sorghum (Sorghum bicolor (L.) Moench) using TPS1 gene for enhancing tolerance to abiotic stresses

    Indian Academy of Sciences (India)

    Varalaxmi Yellisetty; L. A. Reddy; Maheswari Mandapaka

    2015-09-01

    An in planta transformation protocol for sorghum (Sorghum bicolor (L.) Moench) using shoot apical meristem of germinating seedlings is reported in this study. Agrobacterium tumefaciens strain, LBA4404 with pCAMBIA1303 vector and construct pCAMBIA1303TPS1 were individually used for transformation. Since, the transgene is integrated into the cells of already differentiated tissues, the T0 plants were chimeric and stable integration was observed in T1 generation. -Glucuronidase (GUS) expression in the seedlings and spikelets of emerging cob was the first indication of transformability in T0 generation which was further confirmed by PCR analysis using hpt and TPS1 gene-specific primers. Screening on 25 mg/L hygromycin combined with PCR analysis was used for selection of transformants in the T1 generation. Transformation efficiencies ranged between 34–38% and 26–34% using pCAMBIA1303 vector and construct pCAMBIA1303TPS1, respectively. Molecular characterization of the T2 transgenics using PCR, RT-PCR and Southern blot analyses further revealed the integration, expression and inheritance of the transgene. These results indicate the feasibility of the method to generate transgenics with pCAM-BIA1303 vector and construct pCAMBIA1303TPS1. The abiotic stress tolerance of TPS1 transgenics developed in the present study was evident by the ability of the transformants to tolerate 200 mM NaCl as well as higher root growth and biomass.

  1. Zinc up-regulated the expression of the rice metallonthionein gene family and enhanced the zinc tolerance of yeast cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Northern blot and functional complementation assay were employed to analyze the effects of zinc on expression of ten rice metallothionein genes (OsMT-Is) in rice seedlings and the growth of yeast cells transformed with OsMT-Is. Northern blot revealed that in shoots of the rice seedlings treated with different Zn2+ concentrations, expression of most members of OsMT-I family was increased, except the type 4 OsMT-Is (OsMT-I-4a, 4b and 4c). In roots, Zn2+ significantly increased the transcription of OsMT-I-1b and OsMT-I-2c, but reduced the trascription of OsMT-I-1a and OsMT-I-3a. When these ten cDNAs were heterologously expressed in zinc sensitive yeast mutant, all transgenic yeasts showed increased tolerance to Zn2+, and zinc accumulation in these yeast cells also increased.These indicated that OsMT-I family members might respond to extra Zn2+, and they could enhance Zn2+ tolerance of cells by direct binding Zn2+.

  2. In planta transformation of sorghum (Sorghum bicolor (L.) Moench) using TPS1 gene for enhancing tolerance to abiotic stresses.

    Science.gov (United States)

    Yellisetty, Varalaxmi; Reddy, L A; Mandapaka, Maheswari

    2015-09-01

    An in planta transformation protocol for sorghum (Sorghum bicolor (L.) Moench) using shoot apical meristem of germinating seedlings is reported in this study. Agrobacterium tumefaciens strain, LBA4404 with pCAMBIA1303 vector and construct pCAMBIA1303TPS1 were individually used for transformation. Since, the transgene is integrated into the cells of already differentiated tissues, the T 0 plants were chimeric and stable integration was observed in T1 generation. β-Glucuronidase (GUS) expression in the seedlings and spikelets of emerging cob was the first indication of transformability in T0 generation which was further confirmed by PCR analysis using hpt and TPS1 gene-specific primers. Screening on 25 mg/L hygromycin combined with PCR analysis was used for selection of transformants in the T1 generation. Transformation efficiencies ranged between 34-38% and 26-34% using pCAMBIA1303 vector and construct pCAMBIA1303TPS1, respectively. Molecular characterization of the T2 transgenics using PCR, RT-PCR and Southern blot analyses further revealed the integration, expression and inheritance of the transgene. These results indicate the feasibility of the method to generate transgenics with pCAM-BIA1303 vector and construct pCAMBIA1303TPS1. The abiotic stress tolerance of TPS1 transgenics developed in the present study was evident by the ability of the transformants to tolerate 200 mM NaCl as well as higher root growth and biomass. PMID:26440081

  3. A Rice Immunophilin Gene, OsFKBP16-3, Confers Tolerance to Environmental Stress in Arabidopsis and Rice

    Directory of Open Access Journals (Sweden)

    Jun Cheul Ahn

    2013-03-01

    Full Text Available The putative thylakoid lumen immunophilin, FKBP16-3, has not yet been characterized, although this protein is known to be regulated by thioredoxin and possesses a well-conserved CxxxC motif in photosynthetic organisms. Here, we characterized rice OsFKBP16-3 and examined the role of this gene in the regulation of abiotic stress in plants. FKBP16-3s are well conserved in eukaryotic photosynthetic organisms, including the presence of a unique disulfide-forming CxxxC motif in their N-terminal regions. OsFKBP16-3 was mainly expressed in rice leaf tissues and was upregulated by various abiotic stresses, including salt, drought, high light, hydrogen peroxide, heat and methyl viologen. The chloroplast localization of OsFKBP16-3-GFP was confirmed through the transient expression of OsFKBP16-3 in Nicotiana benthamiana leaves. Transgenic Arabidopsis and transgenic rice plants that constitutively expressed OsFKBP16-3 exhibited increased tolerance to salinity, drought and oxidative stresses, but showed no change in growth or phenotype, compared with vector control plants, when grown under non-stressed conditions. This is the first report to demonstrate the potential role of FKBP16-3 in the environmental stress response, which may be regulated by a redox relay process in the thylakoid lumen, suggesting that artificial regulation of FKBP16-3 expression is a candidate for stress-tolerant crop breeding.

  4. A Rice Immunophilin Gene, OsFKBP16-3, Confers Tolerance to Environmental Stress in Arabidopsis and Rice

    Science.gov (United States)

    Park, Hyun Ji; Lee, Sang Sook; You, Young Nim; Yoon, Dae Hwa; Kim, Beom-Gi; Ahn, Jun Cheul; Cho, Hye Sun

    2013-01-01

    The putative thylakoid lumen immunophilin, FKBP16-3, has not yet been characterized, although this protein is known to be regulated by thioredoxin and possesses a well-conserved CxxxC motif in photosynthetic organisms. Here, we characterized rice OsFKBP16-3 and examined the role of this gene in the regulation of abiotic stress in plants. FKBP16-3s are well conserved in eukaryotic photosynthetic organisms, including the presence of a unique disulfide-forming CxxxC motif in their N-terminal regions. OsFKBP16-3 was mainly expressed in rice leaf tissues and was upregulated by various abiotic stresses, including salt, drought, high light, hydrogen peroxide, heat and methyl viologen. The chloroplast localization of OsFKBP16-3-GFP was confirmed through the transient expression of OsFKBP16-3 in Nicotiana benthamiana leaves. Transgenic Arabidopsis and transgenic rice plants that constitutively expressed OsFKBP16-3 exhibited increased tolerance to salinity, drought and oxidative stresses, but showed no change in growth or phenotype, compared with vector control plants, when grown under non-stressed conditions. This is the first report to demonstrate the potential role of FKBP16-3 in the environmental stress response, which may be regulated by a redox relay process in the thylakoid lumen, suggesting that artificial regulation of FKBP16-3 expression is a candidate for stress-tolerant crop breeding. PMID:23485991

  5. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra.

    Directory of Open Access Journals (Sweden)

    Weidong Gao

    Full Text Available Late embryogenesis abundant (LEA genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA was transformed into Xiaohei poplar (Populussimonii × P. nigra via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR and ribonucleic acid (RNA gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11 showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  6. HVP10 (V-PPase, A CANDIDATE GENE FOR HvNax3 CONTROLLING SODIUM EXCLUSION AND SALINITY TOLERANCE IN BARLEY: MAPPING, SEQUENCE ANALYSIS AND GENE EXPRESSION

    Directory of Open Access Journals (Sweden)

    Shavrukov Yuri

    2012-08-01

    Full Text Available Salinity is a major abiotic stress limiting the production of agricultural plants in Australia and in other countries across the world. Wild relatives of cultivated barley have wider diversity in tolerance to salinity. We previously reported the identification of a major QTL for sodium exclusion (HvNax3 on chromosome 7HS, in a barley mapping population originating from a cross between the Australian feed barley Barque-73 and a Hordeum spontaneum accession, CPI-71284. Initial analysis of an AB-QTL population and F2 recombinants reduced the interval containing HvNax3 from 15.0 cM to 1.3 cM. For fine mapping of this region, four F3 progenies (60-100 individuals in each with different recombination events were genotyped with various CAPS markers and phenotyped for sodium exclusion. The interval was further reduced to 0.4 cM, limiting the number of candidate genes based on rice-barley synteny to five, with the most promising candidate encoding a vacuolar pyrophosphatase proton pump, V-PPase (HVP10 gene. The protein encoded by this gene has been shown to be responsible for establishing an electrochemical gradient across the tonoplast that allows other transporters such as Na+/H+ antiporters to transport sodium into the vacuole, thereby reducing toxic effects of excess Na+ in the cytosol. BLAST analysis of sequences of the complete HVP10 gene from both parents indicated the presence of eight exons and seven introns, with an open reading frame of 4,356 bp. The eight exons were well-conserved with only seven SNPs in the coding regions identified between the two parents but none of the SNPs altered the amino-acid sequence. The differences in Na+ accumulation between the two parents is, therefore, not related to the coding sequence of the HVP10 gene. However, Q-PCR experiments showed that expression of the gene in shoots and in roots of CPI-71284 was two-fold and 24%, respectively, higher than in Barque-73 on the third day following exposure to salt stress

  7. Characterization of the HMA7 gene and transcriptomic analysis of candidate genes for copper tolerance in two Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Baloun, Jiří; Nevrtalová, Eva; Kováčová, Viera; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Hobza, Roman

    2014-01-01

    Roč. 171, č. 13 (2014), s. 1188-1196. ISSN 0176-1617 R&D Projects: GA ČR(CZ) GBP501/12/G090; GA MŠk LO1204 Institutional support: RVO:68081707 Keywords : Copper * Genes coding ROS-eliminating and Cu-transporting proteins * RNA-Seq database Subject RIV: BO - Biophysics Impact factor: 2.557, year: 2014

  8. Plant-mediated RNAi of a gap gene-enhanced tobacco tolerance against the Myzus persicae.

    Science.gov (United States)

    Mao, Jianjun; Zeng, Fanrong

    2014-02-01

    Plant-mediated RNAi has been developed as a powerful weapon in the fight against agricultural insect pests. The gap gene hunchback (hb) is of crucial importance in insect axial patterning and knockdown of hb is deforming and lethal to the next generation. The peach potato aphid, Myzus persicae (Sulzer), has many host plants and can be found throughout the world. To investigate the effect of plant-mediated RNAi on control of this insect, the hb gene in M. persicae was cloned, plant RNAi vector was constructed, and transgenic tobacco expressing Mphb dsRNA was developed. Transgenic tobacco had a different integration pattern of the transgene. Bioassays were performed by applying neonate aphids to homozygous transgenic plants in the T2 generation. Results revealed that continuous feeding of transgenic diet reduced Mphb mRNA level in the fed aphids and inhibited insect reproduction, indicating successful knockdown of the target gene in M. persicae by plant-mediated RNAi. PMID:23949691

  9. Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes

    OpenAIRE

    Avishek Dey; Milan Kumar Samanta; Srimonta Gayen; Sen, Soumitra K; Maiti, Mrinal K.

    2016-01-01

    Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selec...

  10. The Drosophila melanogaster Muc68E Mucin Gene Influences Adult Size, Starvation Tolerance, and Cold Recovery

    Directory of Open Access Journals (Sweden)

    Micael Reis

    2016-07-01

    Full Text Available Mucins have been implicated in many different biological processes, such as protection from mechanical damage, microorganisms, and toxic molecules, as well as providing a luminal scaffold during development. Nevertheless, it is conceivable that mucins have the potential to modulate food absorption as well, and thus contribute to the definition of several important phenotypic traits. Here we show that the Drosophila melanogaster Muc68E gene is 40- to 60-million-yr old, and is present in Drosophila species of the subgenus Sophophora only. The central repeat region of this gene is fast evolving, and shows evidence for repeated expansions/contractions. This and/or frequent gene conversion events lead to the homogenization of its repeats. The amino acid pattern P[ED][ED][ST][ST][ST] is found in the repeat region of Muc68E proteins from all Drosophila species studied, and can occur multiple times within a single conserved repeat block, and thus may have functional significance. Muc68E is a nonessential gene under laboratory conditions, but Muc68E mutant flies are smaller and lighter than controls at birth. However, at 4 d of age, Muc68E mutants are heavier, recover faster from chill-coma, and are more resistant to starvation than control flies, although they have the same percentage of lipids as controls. Mutant flies have enlarged abdominal size 1 d after chill-coma recovery, which is associated with higher lipid content. These results suggest that Muc68E has a role in metabolism modulation, food absorption, and/or feeding patterns in larvae and adults, and under normal and stress conditions. Such biological function is novel for mucin genes.

  11. 油菜苗期耐铝基因型筛选和鉴定指标的研究%Screening of Rapeseed Genotypes with Aluminum Tolerance at Seedling Stage and Evaluation of Selecting Indices

    Institute of Scientific and Technical Information of China (English)

    熊洁; 邹小云; 陈伦林; 李书宇; 邹晓芬; 宋来强

    2015-01-01

    得到最优回归方程,23个品种苗期的耐铝性预测值与D值极显著相关。并且筛选出株高、根长、叶中可溶性糖含量、叶中脯氨酸含量等4项对耐铝性有显著影响的指标,可作为油菜苗期耐铝性的鉴定指标。【结论】采用主成分分析、聚类分析和逐步回归分析的方法进行油菜苗期耐铝性的综合评价较为可靠,既避免了单一指标的片面性和不稳定性,又揭示了油菜耐铝相关性状与耐铝性的关系。%[Objective]Rapeseed is the most important oil crop in China, and it is mainly grown in south of the Yangtze River, that is heavily contaminated with aluminum (Al). Al toxicity is one of the important factors that limit rapeseed production in south China. In order to reduce and avoid the harms of Al toxicity to rapeseed, breeding Al-tolerant varieties is a cost-effective and practical way. Therefore, screening and identifying of Al-tolerant genotypes in rapeseed is significant. The main purpose of this paper was to explore the methods of Al tolerance evaluation, and to screen rapeseed genotypes with Al tolerance at seedling stage.[Method]The Al tolerance of 23 rapeseed genotypes which are cultivated in large areas of Jiangxi Province was investigated by a pot culture. Principal component analysis, subordinate function analysis, clustering analysis and step regression analysis were used to evaluate the Al tolerance of rapeseed based on the Al-tolerance coefficients of morphological and physiological traits under the condition of Al stress and control. These traits included plant height (PH), root length (RL), rhizome thickness (RT), root dry weight (RDW), shoot dry weight (SDW), soluble sugar content in leaf (SSCL), soluble sugar content in root (SSCR), praline content in leaf (PCL), praline content in root (PCR) and SPAD. [Result]There were significantly different responses of morphological and physiological indexes among genotypes under Al stress. Correlation analysis showed that Al

  12. Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Tokuyasu Ken

    2008-04-01

    Full Text Available Abstract Background Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Results Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Conclusion Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

  13. Detection of genes providing salinity-tolerance in rice - doi: 10.4025/actascibiolsci.v36i1.15437

    Directory of Open Access Journals (Sweden)

    Maria da Graça de Souza Lima

    2013-09-01

    Full Text Available The present study aimed to identify salinity-tolerant genes in three cultivars (BRS-7 Taim, BRS Querência and BRS Atalanta of Oryza sativa L. ssp. indica S. Kato and in three cultivars (BRS Bojurú, IAS 12-9 Formosa and Goyakuman of Oryza sativa L. ssp. japonica S. Kato. Ten days after emergence seedlings were transferred to a greenhouse and placed in a 15L vessel with half strength Hoagland nutrient solution, which was changed every four days, under controlled temperature and humidity. Plants were harvested 56 days after transfer. DNA extraction was carried out by CTAB method and salinity-tolerant genes SOS and CK1 were identified by in silico research. Amplification of gene sequence was performed with in silico primers. Bands were detected by agar gel electrophoresis and visualized under ultraviolet light after staining with ethidium bromide. Gene SOS1 fragments were present in all cultivars, except in BRS Atalanta, whereas CK1 gene was present in all evaluated cultivars. Results show that salinity-tolerant genes under analysis were identified in the two sub-species.

  14. Nylon Filter Arrays Reveal Differential Expression of Expressed Sequence Tags in Wheat Roots Under Aluminum Stress

    Institute of Scientific and Technical Information of China (English)

    Kai XIAO; Gui-Hua BAI; Brett F CARVER

    2005-01-01

    To enrich differentially expressed sequence tags (ESTs) for aluminum (Al) tolerance, cDNA subtraction libraries were generated from Al-stressed roots of two wheat (Triticum aestivum L.) nearisogenic lines (NILs) contrasting in Al-tolerance gene(s) from the Al-tolerant cultivar Atlas 66, using suppression subtractive hybridization (SSH). Expression patterns of the ESTs were investigated with nylon filter arrays containing 614 cDNA clones from the subtraction library. Gene expression profiles from macroarray analysis indicated that 25 ESTs were upregulated in the tolerant NIL in response to Al stress. The result from Northern analysis of selected upregulated ESTs was similar to that from macroarray analysis. These highly expressed ESTs showed high homology with genes involved in signal transduction, oxidative stress alleviation, membrane structure, Mg2+ transportation, and other functions. Under Al stress, the Al-tolerant NIL may possess altered structure or function of the cell wall, plasma membrane, and mitochondrion. The wheat response to Al stress may involve complicated defense-related signaling and metabolic pathways.The present experiment did not detect any induced or activated genes involved in the synthesis of malate and other organic acids in wheat under Al-stress.

  15. Over-expression of an Arabidopsis δ-OAT gene enhances salt and drought tolerance in transgenic rice

    Institute of Scientific and Technical Information of China (English)

    WU Liangqi; FAN Zhanmin; GUO Lei; LI Yongqing; ZHANG Wenjing; QU Li-Jia; CHEN Zhangliang

    2003-01-01

    δ-OAT, ornithine-δ-aminotransferase, is the key enzyme involved in proline biosynthesis. In this study the Arabidopsisδ-OAT gene was transferred into rice (Oryza sativa L. ssp japonica cv. Zhongzuo 321), whose successful integration was demonstrated by PCR and Southern blot analysis. The over-expression of the gene in transgenic rice was also confirmed. Biochemical analysis showed that, under salt or drought stress conditions, proline contents in the leaves and roots in transgenic rice plants were 5- to 15-fold of those in non-transgenic controls. Under stress conditions, germinating rate of transgenic lines is higher than that of controls. Although the growth of rice plants tested were more and more retarded with the increasing of NaCl concentration, the transgenic plants grow faster compared to the controls under the same stress condition. Meanwhile, the resistance to KCl and MgSO4 stresses was also found enhanced in transgenic rice. Furthermore, the over-expression ofδ-OAT also improved the yield of transgenic plants under stress conditions. The average yield per plant of transgenic lines increases about 12%-41% more than that of control lines under 0.1 mol/L NaCl stress. These data indicated that the over-expression of δ-OAT, with the accumulation of proline, resulted in the enhancement of salt and drought tolerance and an increase of rice yield, which is of significance in agriculture.

  16. Thellungiella halophilaThPIP1 gene enhances the tolerance of the transgenic rice to salt stress

    Institute of Scientific and Technical Information of China (English)

    QIANG Xiao-jing; YU Guo-hong; JIANG Lin-lin; SUN Lin-lin; ZHANG Shu-hui; LI Wei; CHENG Xian-guo

    2015-01-01

    Aquaporin proteins were demonstrated to play an important regulatory role in transporting water and other smal mole-cules. To better understand physiological functions of aquaporins in extremophile plants, a novelThPIP1 gene from the Thelungiela halophila was isolated and functionaly characterized in the transgenic rice. Data showed that the ThPIP1 protein encoded 284 amino acids, and was identiifed to be located on the plasma membrane. The expression ofThPIP1 genein the shoots and roots ofT. halophilaseedlings were induced by high salinity. The transgenic rice overexpressing ThPIP1 gene signiifcantly increased plants tolerance to salt stress through the pathway regulating the osmotic potentials, accumulation of organic smal molecules substances and the ratio of K+/Na+ in the plant cels. Moreover, split-ubiquitin yeast two-hybrid assay showed that ThPIP1 protein speciifcaly interacted with ThPIP2 and a non-speciifc lipid-transfer protein 2, suggesting thatThPIP1 probably play a key role in responding to the reactions of multiple external stimulus and in participating in different physiological processes of plants exposed to salt stress.

  17. Characterization of a Type 1 Metallothionein Gene from the Stresses-Tolerant Plant Ziziphus jujuba

    Directory of Open Access Journals (Sweden)

    Mingxia Yang

    2015-07-01

    Full Text Available Plant metallothioneins (MTs are a family of low molecular weight, cysteine-rich, and metal-binding proteins, which play an important role in the detoxification of heavy metal ions, osmotic stresses, and hormone treatment. Sequence analysis revealed that the open-reading frame (ORF of ZjMT was 225 bp, which encodes a protein composed of 75 amino acid residues with a calculated molecular mass of 7.376 kDa and a predicated isoelectric point (pI of 4.83. ZjMT belongs to the type I MT, which consists of two highly conserved cysteine-rich terminal domains linked by a cysteine free region. Our studies showed that ZjMT was primarily localized in the cytoplasm and the nucleus of cells and ZjMT expression was up-regulated by NaCl, CdCl2 and polyethylene glycol (PEG treatments. Constitutive expression of ZjMT in wild type Arabidopsis plants enhanced their tolerance to NaCl stress during the germination stage. Compared with the wild type, transgenic plants accumulate more Cd2+ in root, but less in leaf, suggesting that ZjMT may have a function in Cd2+ retension in roots and, therefore, decrease the toxicity of Cd2+.

  18. Long-Term Boron-Excess-Induced Alterations of Gene Profiles in Roots of Two Citrus Species Differing in Boron-Tolerance Revealed by cDNA-AFLP

    Science.gov (United States)

    Guo, Peng; Qi, Yi-Ping; Yang, Lin-Tong; Ye, Xin; Huang, Jing-Hao; Chen, Li-Song

    2016-01-01

    Boron (B) toxicity is observed in some citrus orchards in China. However, limited data are available on the molecular mechanisms of citrus B-toxicity and B-tolerance. Using cDNA-AFLP, we identified 20 up- and 52 down-regulated genes, and 44 up- and 66 down-regulated genes from excess B-treated Citrus sinensis and Citrus grandis roots, respectively, thereby demonstrating that gene expression profiles were more affected in the latter. In addition, phosphorus and total soluble protein concentrations were lowered only in excess B-treated C. grandis roots. Apparently, C. sinensis had higher B-tolerance than C. grandis. Our results suggested that the following several aspects were responsible for the difference in the B-tolerance between the two citrus species including: (a) B-excess induced Root Hair Defective 3 expression in C. sinensis roots, and repressed villin4 expression in C. grandis roots; accordingly, root growth was less inhibited by B-excess in the former; (b) antioxidant systems were impaired in excess B-treated C. grandis roots, hence accelerating root senescence; (c) genes related to Ca2+ signals were inhibited (induced) by B-excess in C. grandis (C. sinensis) roots. B-excess-responsive genes related to energy (i.e., alternative oxidase and cytochrome P450), lipid (i.e., Glycerol-3-phosphate acyltransferase 9 and citrus dioxygenase), and nucleic acid (i.e., HDA19, histone 4, and ribonucleotide reductase RNR1 like protein) metabolisms also possibly accounted for the difference in the B-tolerance between the two citrus species. These data increased our understanding of the mechanisms on citrus B-toxicity and B-tolerance at transcriptional level. PMID:27446128

  19. Comprehensive analysis of SET domain gene family in foxtail millet identifies the putative role of SiSET14 in abiotic stress tolerance

    Science.gov (United States)

    Yadav, Chandra Bhan; Muthamilarasan, Mehanathan; Dangi, Anand; Shweta, Shweta; Prasad, Manoj

    2016-01-01

    SET domain-containing genes catalyse histone lysine methylation, which alters chromatin structure and regulates the transcription of genes that are involved in various developmental and physiological processes. The present study identified 53 SET domain-containing genes in C4 panicoid model, foxtail millet (Setaria italica) and the genes were physically mapped onto nine chromosomes. Phylogenetic and structural analyses classified SiSET proteins into five classes (I–V). RNA-seq derived expression profiling showed that SiSET genes were differentially expressed in four tissues namely, leaf, root, stem and spica. Expression analyses using qRT-PCR was performed for 21 SiSET genes under different abiotic stress and hormonal treatments, which showed differential expression of these genes during late phase of stress and hormonal treatments. Significant upregulation of SiSET gene was observed during cold stress, which has been confirmed by over-expressing a candidate gene, SiSET14 in yeast. Interestingly, hypermethylation was observed in gene body of highly differentially expressed genes, whereas methylation event was completely absent in their transcription start sites. This suggested the occurrence of demethylation events during various abiotic stresses, which enhance the gene expression. Altogether, the present study would serve as a base for further functional characterization of SiSET genes towards understanding their molecular roles in conferring stress tolerance. PMID:27585852

  20. Trigo duro: tolerância à toxicidade de alumínio, manganês e ferro em soluções nutritivas Durum wheat: tolerance to aluminum, manganese and iron toxicities in nutrient solutions

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1995-01-01

    Full Text Available Avaliou-se o comportamento diferencial de 23 linhagens de trigo duro (Triticum durum L. em compraração com os seguintes cultivares de trigo (T. aestivum L.: IAC-24, BH-1146, Siete Cerros e IAC-60, quanto aos níveis de Al3+ (0;0,2;0,4; 0,6; 0,8 e 1,0 mg/L, de Mn2+ (0,11; 300; 600 c 1.200 mg/L e de Fe2+ (0,56; 5; 10 e 20 mg/L em solução nutritiva. Os cultivares de trigo Siete Cerros (sensível à toxicidade de Al3+, BH-1146, IAC-60 e IAC-24 (tolerantes à toxicidade de Al3+, exibiram crescimento das raízes na presença de 1 mg/L de Al3+, e todas as linhagens de trigo duro avaliadas foram totalmente sensíveis a 0,4 mg/L de Al3+, com paralisação irreversível do crescimento das raízes. O aumento das concentrações de Mn2+(0,11 a 1.200 mg/L e de Fe2+ (0,56 a 20 mg/L nas soluções causou uma redução significativa no comprimento das raízes dos genótipos em estudo. As linhagens de trigo duro I (Avetoro "S" x Anhinga "S" - Purcell "S"/D.67.2, 2 (Cando - Yavaros "S", 6 (Chen "S" e 8 (Carcomum "S" apresentaram-se muito tolerantes à toxicidade de Mn2+ em relação ao controle 'Siete Cerros'. O 'Siete Cerros' e as linhagens de trigo duro 1, 6, 12 (CI 14955 x Yavaros "S"- Gediz "S"/Tropic Bird, 16 e 21 (Swan "S" c 20 (Boyeros "S"/Cocorit-71/5/Crane/Ganso//Marte "S"/3/Tildillo "S"/4/ Memo "S" exibiram tolerância à presença de elevadas quantidades de Fe2+ nas soluções nutritivas.Twenty three durum wheat inbred lines were evaluated with four bread wheat cultivars (IAC-24, BH-1146, Siete Cerros and IAC-60 in three experiments, using nutrient solutions. In the first experiment, the following levels of Al3+ were used: 0; 0.2; 0.4; 0.6; 0.8 and 1.0 mg/L; in the second experiment, the following levels of Mn2+ were used: 0.11; 300; 600 and 1.200 mg/L; and in the third experiment, Fe2+ was used at: 0.56; 5; 10 and 1.200 mg/L. The wheat cultivars Siete Cerros (sensitive to Al3+ toxicity and BH-1146, IAC-24 and IAC-60 (tolerant to Al3+ toxicity

  1. Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes.

    Directory of Open Access Journals (Sweden)

    Avishek Dey

    Full Text Available Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.. Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE and gene-silencing (RNAi. Analyses of the coding DNA sequence (CDS of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5'-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene

  2. Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes.

    Science.gov (United States)

    Dey, Avishek; Samanta, Milan Kumar; Gayen, Srimonta; Sen, Soumitra K; Maiti, Mrinal K

    2016-01-01

    Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE) and gene-silencing (RNAi). Analyses of the coding DNA sequence (CDS) of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5'-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS) of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene expression rather than

  3. Overexpression of the Wheat Aquaporin Gene, TaAQP7, Enhances Drought Tolerance in Transgenic Tobacco

    OpenAIRE

    Shiyi Zhou; Wei Hu; Xiaomin Deng; Zhanbing Ma; Lihong Chen; Chao Huang; Chen Wang,; Jie Wang; Yanzhen He; Guangxiao Yang; Guangyuan He

    2012-01-01

    Aquaporin (AQP) proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high ...

  4. Combination of CTLA4-FasL gene transfer and allogeneic bone marrow transplantation led to durable macrochimerism and donor-specific tolerance in mouse model

    Institute of Scientific and Technical Information of China (English)

    FENG Yougang; WANG Guangming; HAO Jie; LI Ailing; YUAN Guohong; LI Chong; ZENG Fuqing; XIE Shusheng

    2005-01-01

    Mixed hemopoietic chimerism is capable of inducing donor specific tolerance, thus eliminating the chronic immunosuppressive therapy following organ transplantation. As yet no safe and effective tolerance protocol is available for clinical implementation. Here we describe an alternative nonmyeloablative based strategy of using a single injection of recombination adenovirus vector encoding CTLA4-FasL fusing gene and donor bone marrow cells to promote durable mixed macrochimerism (>20% on 140 d). Chimeras exhibited robust donor-specific tolerance, as evidenced by acceptance of fully allogeneic skin grafts (the mean survival time (MST)>200 d) and rejection of third- party skin grafts in a normal manner (MST<10 d). In this model, the frequencies of helper T lymphocyte precursor (HTLp) and cytotoxic T lymphocyte precursor (CTLp) were greatly reduced on day 14 after transplantation, suggesting that CTLA4-FasL led to rapid systemic peripheral tolerance to facilitate the bone marrow engraftment, while both HTLp and CTLp remained at low level only in recipient mice with mixed chimerism on day 140 after transplantation, demonstrating that long-term skin grafts tolerance was associated with stable mixed chimerism, and central deletion of donor specific T cell may be the main mechanism for tolerance maintenance.

  5. Antigen-specific tolerance induced by IL-10 gene modified immature dendritic cells in experimental autoimmune myocarditis in rats

    Institute of Scientific and Technical Information of China (English)

    LI Wei-min; LI Yue; LIU Wei; GAO Cheng; ZHOU Bao-guo; YANG Shu-sen; WANG Zheng; ZHANG Rui-hong; GAN Run-tao; KONG Yi-hui

    2006-01-01

    underwent maturation induced by in vitro exposure to LPS. IL-10 gene modified iDC inhibited the antigen specific T cell responses towards cardiac myosin. IκB protein was up-regulated significantly in the IL-10 gene modified iDC group.Conclusions IL-10 gene modified iDC induced antigen-specific tolerance in EAM. The underlying mechanisms may be related to costimulatory molecules down-regulation and NF-κB pathway inhibition.

  6. Differential Expression Analysis of a Subset of Drought-Responsive GmNAC Genes in Two Soybean Cultivars Differing in Drought Tolerance

    OpenAIRE

    Nguyen Phuong Thao; Nguyen Binh Anh Thu; Xuan Lan Thi Hoang; Chien Van Ha; Lam-Son Phan Tran

    2013-01-01

    The plant-specific NAC transcription factors play important roles in plant response to drought stress. Here, we have compared the expression levels of a subset of GmNAC genes in drought-tolerant DT51 and drought-sensitive MTD720 under both normal and drought stress conditions aimed at identifying correlation between GmNAC expression levels and drought tolerance degree, as well as potential GmNAC candidates for genetic engineering. The expression of 23 selected dehydration-responsive GmNACs wa...

  7. Association of the ACTN3 R557X polymorphism with glucose tolerance and gene expression of sarcomeric proteins in human skeletal muscle

    OpenAIRE

    Riedl, Isabelle; Osler, Megan E.; Benziane, Boubacar; Chibalin, Alexander V; Juleen R. Zierath

    2015-01-01

    A common polymorphism (R577X) in the α-actinin (ACTN) 3 gene, which leads to complete deficiency of a functional protein in skeletal muscle, could directly influence metabolism in the context of health and disease. Therefore, we tested the hypothesis that states of glucose tolerance are associated with the ACTN3 R577X genotype. We analyzed the prevalence of the ACTN3 R577X polymorphism in people with normal glucose tolerance (NGT) and type 2 diabetes (T2D) and measured muscle-specific α-actin...

  8. Allelic variation at a single gene increases food value in a drought-tolerant staple cereal.

    Science.gov (United States)

    Gilding, Edward K; Frère, Celine H; Cruickshank, Alan; Rada, Anna K; Prentis, Peter J; Mudge, Agnieszka M; Mace, Emma S; Jordan, David R; Godwin, Ian D

    2013-01-01

    The production of adequate agricultural outputs to support the growing human population places great demands on agriculture, especially in light of ever-greater restrictions on input resources. Sorghum is a drought-adapted cereal capable of reliable production where other cereals fail, and thus represents a good candidate to address food security as agricultural inputs of water and arable land grow scarce. A long-standing issue with sorghum grain is that it has an inherently lower digestibility. Here we show that a low-frequency allele type in the starch metabolic gene, pullulanase, is associated with increased digestibility, regardless of genotypic background. We also provide evidence that the beneficial allele type is not associated with deleterious pleiotropic effects in the modern field environment. We argue that increasing the digestibility of an adapted crop is a viable way forward towards addressing food security while maximizing water and land-use efficiency. PMID:23403584

  9. A novel gene SbSI-2 encoding nuclear protein from a halophyte confers abiotic stress tolerance in E. coli and tobacco.

    Directory of Open Access Journals (Sweden)

    Narendra Singh Yadav

    Full Text Available Salicornia brachiata is an extreme halophyte that grows luxuriantly in coastal marshes. Previously, we have reported isolation and characterization of ESTs from Salicornia with large number of novel/unknown salt-responsive gene sequences. In this study, we have selected a novel salt-inducible gene SbSI-2 (Salicornia brachiata salt-inducible-2 for functional characterization. Bioinformatics analysis revealed that SbSI-2 protein has predicted nuclear localization signals and a strong protein-protein interaction domain. Transient expression of the RFP:SbSI2 fusion protein confirmed that SbSI-2 is a nuclear-localized protein. Genomic organization study showed that SbSI-2 is intronless and has a single copy in Salicornia genome. Quantitative RT-PCR analysis revealed higher SbSI-2 expression under salt stress and desiccation conditions. The SbSI-2 gene was transformed in E. coli and tobacco for functional characterization. pET28a-SbSI-2 recombinant E. coli cells showed higher tolerance to desiccation and salinity compared to vector alone. Transgenic tobacco plants overexpressing SbSI-2 have improved salt- and osmotic tolerance, accompanied by better growth parameters, higher relative water content, elevated accumulation of compatible osmolytes, lower Na+ and ROS accumulation and lesser electrolyte leakage than the wild-type. Overexpression of the SbSI-2 also enhanced transcript levels of ROS-scavenging genes and some stress-related transcription factors under salt and osmotic stresses. Taken together, these results demonstrate that SbSI-2 might play an important positive modulation role in abiotic stress tolerance. This identifies SbSI-2 as a novel determinant of salt/osmotic tolerance and suggests that it could be a potential bioresource for engineering abiotic stress tolerance in crop plants.

  10. Two P5CS genes from common bean exhibiting different tolerance to salt stress in transgenic Arabidopsis

    Indian Academy of Sciences (India)

    Ji Bao Chen; Jian Wei Yang; Zhao Yuan Zhang; Xiao Fan Feng; Shu Min Wang

    2013-12-01

    Many plants accumulate proline in response to salt stress. -pyrroline-5-carboxylate synthetase (P5CS) is the rate-limiting enzyme in proline biosynthesis in plants. Plasmid DNA (pCHF3-PvP5CS1 and pCHF3-PvP5CS2) containing the selectable neomycin phosphotransferase gene for kanamycin resistance and Phaseolus vulgaris P5CS (PvP5CS1 and PvP5CS2) cDNA was introduced into Arabidopsis plants using Agrobacterium-mediated gene transfer. Southern blot, northern blot and RT-PCR analyses demonstrated that the foreign genes were integrated into Arabidopsis chromosomal DNA and expressed. Single-gene transformants were analysed in this study. Transgenic plants expressed higher levels of PvP5CS1 and PvP5CS2 transcripts under salt stress conditions than under normal conditions. When treated with 0, 100 and 200 mM NaCl, the average proline content in leaves of transgenic plants was significantly higher $(P \\lt 0.01)$ than control plants. The average relative electrical conductivity (REC) of transgenic lines was significantly lower $(P \\lt 0.01)$ than control plants under salt stress condition. Biomass production of transgenic lines was significantly higher $(P \\lt 0.05)$ than control plants under 200 mM NaCl stress treatment. These results indicated that introducing PvP5CS1 and PvP5CS2 cDNA into transgenic Arabidopsis caused proline overproduction, increasing salt tolerance. Although the expression of PvP5CS1 in L4 lines and PvP5CS2 in S4 lines was the same under salt stress condition, the S4 lines accumulated 1.6 and 1.9 times more proline than the L4 lines under 100 and 200 mM NaCl treatments, respectively. The REC of S4 plants was 0.5 (100 mM NaCl) and 0.6 times (200 mM NaCl) that of L4 plants. The biomass production of S4 plants was 1.6 times (200 mM NaCl) more than in L4 plants. Total P5CS enzyme activity of S4 was significantly higher than that of L4. These results implied that the PvP5CS2 protein had stronger capacity to catalyze proline synthesis than PvP5CS1 under salt

  11. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

    Directory of Open Access Journals (Sweden)

    Bingying Han

    2016-07-01

    Full Text Available Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD. Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis. All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g−1 fresh weight (FW, and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3–5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS, 10 trehalose-6-phosphate phosphatases (TPP, and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1–4 that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1 in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose

  12. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava.

    Science.gov (United States)

    Han, Bingying; Fu, Lili; Zhang, Dan; He, Xiuquan; Chen, Qiang; Peng, Ming; Zhang, Jiaming

    2016-01-01

    Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz) is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD). Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis). All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g(-1) fresh weight (FW), and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3-5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS), 10 trehalose-6-phosphate phosphatases (TPP), and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1-4) that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1) in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose under normal

  13. Gene cloning and enzymatic characterization of an alkali-tolerant endo-1,4-β-mannanase from Rhizomucor miehei.

    Science.gov (United States)

    Katrolia, Priti; Yan, Qiaojuan; Zhang, Pan; Zhou, Peng; Yang, Shaoqing; Jiang, Zhengqiang

    2013-01-16

    An endo-1,4-β-mannanase gene (RmMan5A) was cloned from the thermophilic fungus Rhizomucor miehei for the first time and expressed in Escherichia coli . The gene had an open reading frame of 1330 bp encoding 378 amino acids and contained four introns. It displayed the highest amino acid sequence identity (42%) with the endo-1,4-β-mannanases from glycoside hydrolase family 5. The purified enzyme was a monomer of 43 kDa. RmMan5A displayed maximum activity at 55 °C and an optimal pH of 7.0. It was thermostable up to 55 °C and alkali-tolerant, displaying excellent stability over a broad pH range of 4.0-10.0, when incubated for 30 min without substrate. The enzyme displayed the highest specificity for locust bean gum (K(m) = 3.78 mg mL⁻¹), followed by guar gum (K(m) = 7.75 mg mL⁻¹) and konjac powder (K(m) = 22.7 mg mL⁻¹). RmMan5A hydrolyzed locust bean gum and konjac powder yielding mannobiose, mannotriose, and a mixture of various mannose-linked oligosaccharides. It was confirmed to be a true endo-acting β-1,4-mannanase, which showed requirement of four mannose residues for hydrolysis, and was also capable of catalyzing transglycosylation reactions. These properties make RmMan5A highly useful in the food/feed, paper and pulp, and detergent industries. PMID:23252695

  14. Tn-seq of Caulobacter crescentus under uranium stress reveals genes essential for detoxification and stress tolerance

    International Nuclear Information System (INIS)

    Ubiquitous aquatic bacterium Caulobacter crescentus is highly resistant to uranium (U) and facilitates U biomineralization and thus holds promise as an agent of U bioremediation. In order to gain an understanding of how C. crescentus tolerates U, we employed transposon (Tn) mutagenesis paired with deep sequencing (Tn-seq) in a global screen for genomic elements required for U resistance. Of the 3,879 annotated genes in the C. crescentus genome, 37 were found to be specifically associated with fitness under U stress, 15 of which were subsequently tested through mutational analysis. Systematic deletion analysis revealed that mutants lacking outer membrane transporters (rsaFa and rsaFb), a stress-responsive transcription factor (cztR), or a ppGpp synthetase/hydrolase (spoT) exhibited a significantly lower survival rate under U stress. RsaFa and RsaFb, which are homologues of TolC in Escherichia coli, have previously been shown to mediate S-layer export. Transcriptional analysis revealed upregulation of rsaFa and rsaFb by 4- and 10-fold, respectively, in the presence of U. We additionally show that rsaFa mutants accumulated higher levels of U than the wild type, with no significant increase in oxidative stress levels. These results suggest a function for RsaFa and RsaFb in U efflux and/or maintenance of membrane integrity during U stress. In addition, we present data implicating CztR and SpoT in resistance to U stress. Together, our findings reveal novel gene targets that are key to understanding the molecular mechanisms of U resistance in C. crescentus

  15. Transcriptional Analysis of Drought-Induced Genes in the Roots of a Tolerant Genotype of the Common Bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Siu Mui Tsai

    2013-03-01

    Full Text Available In Brazil, common bean (Phaseolus vulgaris L. productivity is severely affected by drought stress due to low technology cultivation systems. Our purpose was to identify differentially expressed genes in roots of a genotype tolerant to water deficit (BAT 477 when submitted to an interruption of irrigation during its development. A SSH library was constructed taking as “driver” the genotype Carioca 80SH (susceptible to drought. After clustering and data mining, 1572 valid reads were obtained, resulting in 1120 ESTs (expressed sequence tags. We found sequences for transcription factors, carbohydrates metabolism, proline-rich proteins, aquaporins, chaperones and ubiquitins, all of them organized according to their biological processes. Our suppressive subtractive hybridization (SSH library was validated through RT-qPCR experiment by assessing the expression patterns of 10 selected genes in both genotypes under stressed and control conditions. Finally, the expression patterns of 31 ESTs, putatively related to drought responses, were analyzed in a time-course experiment. Our results confirmed that such genes are more expressed in the tolerant genotype during stress; however, they are not exclusive, since different levels of these transcripts were also detected in the susceptible genotype. In addition, we observed a fluctuation in gene regulation over time for both the genotypes, which seem to adopt and adapt different strategies in order to develop tolerance against this stress.

  16. Semi-dwarfism and lodging tolerance in tef (Eragrostis tef) is linked to a mutation in the α-Tubulin 1 gene.

    Science.gov (United States)

    Jöst, Moritz; Esfeld, Korinna; Burian, Agata; Cannarozzi, Gina; Chanyalew, Solomon; Kuhlemeier, Cris; Assefa, Kebebew; Tadele, Zerihun

    2015-02-01

    Genetic improvement of native crops is a new and promising strategy to combat hunger in the developing world. Tef is the major staple food crop for approximately 50 million people in Ethiopia. As an indigenous cereal, it is well adapted to diverse climatic and soil conditions; however, its productivity is extremely low mainly due to susceptibility to lodging. Tef has a tall and weak stem, liable to lodge (or fall over), which is aggravated by wind, rain, or application of nitrogen fertilizer. To circumvent this problem, the first semi-dwarf lodging-tolerant tef line, called kegne, was developed from an ethyl methanesulphonate (EMS)-mutagenized population. The response of kegne to microtubule-depolymerizing and -stabilizing drugs, as well as subsequent gene sequencing and segregation analysis, suggests that a defect in the α-Tubulin gene is functionally and genetically tightly linked to the kegne phenotype. In diploid species such as rice, homozygous mutations in α-Tubulin genes result in extreme dwarfism and weak stems. In the allotetraploid tef, only one homeologue is mutated, and the presence of the second intact α-Tubulin gene copy confers the agriculturally beneficial semi-dwarf and lodging-tolerant phenotype. Introgression of kegne into locally adapted and popular tef cultivars in Ethiopia will increase the lodging tolerance in the tef germplasm and, as a result, will improve the productivity of this valuable crop. PMID:25399019

  17. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Wei Chen

    Full Text Available Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS, named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG. Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD in transgenic seedlings. In addition, the level of malondialdehyde (MDA was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress.

  18. A subchronic feeding study of dicamba-tolerant soybean with the dmo gene in Sprague-Dawley rats.

    Science.gov (United States)

    Wang, Xiaoyun; He, Xiaoyun; Zou, Shiyin; Xu, Wentao; Jia, Xin; Zhao, Bo; Zhao, Changhui; Huang, Kunlun; Liang, Zhihong

    2016-06-01

    The dicamba-tolerant soybean MON87708 expresses the dicamba mono-oxygenase (DMO) enzyme that is encoded by the dmo gene. In order to evaluate the safety of this soybean, a 90-day subchronic feeding toxicity study (13 weeks) was conducted on Sprague-Dawley rats. A total of 140 rats were divided into 7 groups (10/sex/group), including a standard commercial diet control group. The genetically modified (GM) soybean MON87708 and the near isogenic non-GM soybean A3525 were respectively processed to unhulled, full-fat, and heat-treated powder, then mixed into the diet at levels of 7.5%, 15%, and 30% (wt/wt) with the main nutrients of the various diets balanced and then fed to 6 groups. The remaining group of rats fed with a commercial rat diet served as blank control. Some isolated parameters indicated statistically significant differences in body weight, feed consumption/utilization, hematology, serum biochemistry, and relative organ weights. These differences were not consistent across gender or test-diet dose, which were attributed to incidental and biological variability. In conclusion, the results demonstrated that the transgenic soybean MON87708 containing DMO was as safe as non-transgenic isogenic counterpart with historical safe use. PMID:26850684

  19. Genetic dissection of drought and heat tolerance in chickpea through genome-wide and candidate gene-based association mapping approaches.

    Science.gov (United States)

    Thudi, Mahendar; Upadhyaya, Hari D; Rathore, Abhishek; Gaur, Pooran Mal; Krishnamurthy, Lakshmanan; Roorkiwal, Manish; Nayak, Spurthi N; Chaturvedi, Sushil Kumar; Basu, Partha Sarathi; Gangarao, N V P R; Fikre, Asnake; Kimurto, Paul; Sharma, Prakash C; Sheshashayee, M S; Tobita, Satoshi; Kashiwagi, Junichi; Ito, Osamu; Killian, Andrzej; Varshney, Rajeev Kumar

    2014-01-01

    To understand the genetic basis of tolerance to drought and heat stresses in chickpea, a comprehensive association mapping approach has been undertaken. Phenotypic data were generated on the reference set (300 accessions, including 211 mini-core collection accessions) for drought tolerance related root traits, heat tolerance, yield and yield component traits from 1-7 seasons and 1-3 locations in India (Patancheru, Kanpur, Bangalore) and three locations in Africa (Nairobi, Egerton in Kenya and Debre Zeit in Ethiopia). Diversity Array Technology (DArT) markers equally distributed across chickpea genome were used to determine population structure and three sub-populations were identified using admixture model in STRUCTURE. The pairwise linkage disequilibrium (LD) estimated using the squared-allele frequency correlations (r2; when r2<0.20) was found to decay rapidly with the genetic distance of 5 cM. For establishing marker-trait associations (MTAs), both genome-wide and candidate gene-sequencing based association mapping approaches were conducted using 1,872 markers (1,072 DArTs, 651 single nucleotide polymorphisms [SNPs], 113 gene-based SNPs and 36 simple sequence repeats [SSRs]) and phenotyping data mentioned above employing mixed linear model (MLM) analysis with optimum compression with P3D method and kinship matrix. As a result, 312 significant MTAs were identified and a maximum number of MTAs (70) was identified for 100-seed weight. A total of 18 SNPs from 5 genes (ERECTA, 11 SNPs; ASR, 4 SNPs; DREB, 1 SNP; CAP2 promoter, 1 SNP and AMDH, 1SNP) were significantly associated with different traits. This study provides significant MTAs for drought and heat tolerance in chickpea that can be used, after validation, in molecular breeding for developing superior varieties with enhanced drought and heat tolerance. PMID:24801366

  20. Genetic dissection of drought and heat tolerance in chickpea through genome-wide and candidate gene-based association mapping approaches.

    Directory of Open Access Journals (Sweden)

    Mahendar Thudi

    Full Text Available To understand the genetic basis of tolerance to drought and heat stresses in chickpea, a comprehensive association mapping approach has been undertaken. Phenotypic data were generated on the reference set (300 accessions, including 211 mini-core collection accessions for drought tolerance related root traits, heat tolerance, yield and yield component traits from 1-7 seasons and 1-3 locations in India (Patancheru, Kanpur, Bangalore and three locations in Africa (Nairobi, Egerton in Kenya and Debre Zeit in Ethiopia. Diversity Array Technology (DArT markers equally distributed across chickpea genome were used to determine population structure and three sub-populations were identified using admixture model in STRUCTURE. The pairwise linkage disequilibrium (LD estimated using the squared-allele frequency correlations (r2; when r2<0.20 was found to decay rapidly with the genetic distance of 5 cM. For establishing marker-trait associations (MTAs, both genome-wide and candidate gene-sequencing based association mapping approaches were conducted using 1,872 markers (1,072 DArTs, 651 single nucleotide polymorphisms [SNPs], 113 gene-based SNPs and 36 simple sequence repeats [SSRs] and phenotyping data mentioned above employing mixed linear model (MLM analysis with optimum compression with P3D method and kinship matrix. As a result, 312 significant MTAs were identified and a maximum number of MTAs (70 was identified for 100-seed weight. A total of 18 SNPs from 5 genes (ERECTA, 11 SNPs; ASR, 4 SNPs; DREB, 1 SNP; CAP2 promoter, 1 SNP and AMDH, 1SNP were significantly associated with different traits. This study provides significant MTAs for drought and heat tolerance in chickpea that can be used, after validation, in molecular breeding for developing superior varieties with enhanced drought and heat tolerance.

  1. AtHsfA2 modulates expression of stress responsive genes and enhances tolerance to heat and oxidative stress in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    LI Chunguang; CHEN Qijun; GAO Xinqi; QI Bishu; CHEN Naizhi; XU Shouming; CHEN Jia; WANG Xuechen

    2005-01-01

    There is increasing evidence for considerable interlinking between the responses to heat stress and oxidative stress, and recent researches suggest heat shock transcription factors (Hsfs) play an important role in linking heat shock with oxidative stress signals. In this paper, we present evidence that AtHsfA2 modulated expression of stress responsive genes and enhanced tolerance to heat and oxidative stress in Arabidopsis. Using Northern blot and quantitative RT-PCR analysis, we demonstrated that the expression of AtHsfA2 was induced by not only HS but also oxidative stress. By functional analysis of AtHsfA2 knockout mutants and AtHsfA2 overexpressing transgenic plants, we also demonstrated that the mutants displayed reduced the basal and acquired thermotolerance as well as oxidative stress tolerance but the overexpression lines displayed increased tolerance to these stress. The phenotypes correlated with the expression of some Hsps and APX1, ion leakage, H2O2 level and degree of oxidative injuries. These results showed that, by modulated expression of stress responsive genes, AtHsfA2 enhanced tolerance to heat and oxidative stress in Arabidopsis. So we suggest that AtHsfA2 plays an important role in linking heat shock with oxidative stress signals.

  2. Expression of multiple resistance genes enhances tolerance to environmental stressors in transgenic poplar (Populus × euramericana 'Guariento'.

    Directory of Open Access Journals (Sweden)

    Xiaohua Su

    Full Text Available Commercial and non-commercial plants face a variety of environmental stressors that often cannot be controlled. In this study, transgenic hybrid poplar (Populus × euramericana 'Guariento' harboring five effector genes (vgb, SacB, JERF36, BtCry3A and OC-I were subjected to drought, salinity, waterlogging and insect stressors in greenhouse or laboratory conditions. Field trials were also conducted to investigate long-term effects of transgenic trees on insects and salt tolerance in the transformants. In greenhouse studies, two transgenic lines D5-20 and D5-21 showed improved growth, as evidenced by greater height and basal diameter increments and total biomass relative to the control plants after drought or salt stress treatments. The improved tolerance to drought and salt was primarily attributed to greater instantaneous water use efficiency (WUEi in the transgenic trees. The chlorophyll concentrations tended to be higher in the transgenic lines under drought or saline conditions. Transformed trees in drought conditions accumulated more fructan and proline and had increased Fv/Fm ratios (maximum quantum yield of photosystem II under waterlogging stress. Insect-feeding assays in the laboratory revealed a higher total mortality rate and lower exuviation index of leaf beetle [Plagiodera versicolora (Laicharting] larvae fed with D5-21 leaves, suggesting enhanced insect resistance in the transgenic poplar. In field trials, the dominance of targeted insects on 2-year-old D5-21 transgenic trees was substantially lower than that of the controls, indicating enhanced resistance to Coleoptera. The average height and DBH (diameter at breast height of 2.5-year-old transgenic trees growing in naturally saline soil were 3.80% and 4.12% greater than those of the control trees, but these increases were not significant. These results suggested that multiple stress-resistance properties in important crop tree species could be simultaneously improved, although

  3. Tolerating Zero Tolerance?

    Science.gov (United States)

    Moore, Brian N.

    2010-01-01

    The concept of zero tolerance dates back to the mid-1990s when New Jersey was creating laws to address nuisance crimes in communities. The main goal of these neighborhood crime policies was to have zero tolerance for petty crime such as graffiti or littering so as to keep more serious crimes from occurring. Next came the war on drugs. In federal…

  4. Adenoviral-mediated localized CTLA-4Ig gene expression induces long-term allograft pancreas survival and donor-specific immune tolerance in rats

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    T cell activation following alloantigen recognition plays a critical role in the development of the rejection in all solid organ, tissue and cell transplantation. A recombinant molecule, cytotoxic T lymphocyte antigen 4 antibody (CTLA-4Ig), is known to induce to T-cell into "anergy" by blocking the costimulatory B7-CD28 interaction. Either systemic or localized administration of CTLA-Ig has been shown to prolong allograft survival and induce donor-specific tolerance in some transplant models. In this study, we characterized the expression and immunosuppressive effectiveness of adenoviral-mediated CTLA-4Ig gene transfer. We demonstrated transduction of the allografts with AdCTLA-41g resulted in localized expression, permanent graft survival and stable donor-specific tolerance. In addition, by performing simultaneous dual-organ transplantation, we targeted on immunosuppression through a local expression of CTLA-4Ig via adenoviral-mediated gene transfer into pancreatic allografts.

  5. Comparison of gene expression changes in susceptible, tolerant and resistant hosts in response to infection with Citrus tristeza virus and huanglongbing

    OpenAIRE

    Bowman, K D; Albrecht, U

    2015-01-01

    The pathogens Candidatus Liberibacter asiaticus (Las) and Citrus tristeza virus (CTV) are both phloem limited and have significant economic impact on citrus production wherever they are found. Studies of host resistance have indicated that Poncirus trifoliata has tolerance or resistance to both pathogens, suggesting that there may be some common factors in the 2 kinds of resistance. We have conducted studies of host gene expression changes that occur in response to infection to gain further i...

  6. Juvenile hormone facilitates the antagonism between adult reproduction and diapause through the methoprene-tolerant gene in the female Colaphellus bowringi.

    Science.gov (United States)

    Liu, Wen; Li, Yi; Zhu, Li; Zhu, Fen; Lei, Chao-Liang; Wang, Xiao-Ping

    2016-07-01

    In insects, the process whereby juvenile hormone (JH) regulates short-day (SD)-induced reproductive diapause has been previously investigated. However, we still do not understand the mechanism by which JH regulates long-day (LD)-induced reproductive diapause. In this study, we use a cabbage beetle, Colaphellus bowringi, which is a serious pest of cruciferous vegetables in Asia capable of entering reproductive diapause under LD conditions, as a model to test whether JH regulates female reproductive diapause similar to the mechanism of SD-induced diapause. Our results showed that the JH analog (JHA) methoprene significantly induced ovarian development but inhibited lipid accumulation of diapause-destined adults. Meanwhile, the transcripts of the vitellogenin (Vg) genes were upregulated, whereas the expression of the fat synthesis and stress tolerance genes were downregulated. RNA interference of the JH candidate receptor gene methoprene-tolerant (Met) blocked JH-induced ovarian development and Vg transcription, suggesting a positive regulatory function for JH-Met signaling in reproduction. Furthermore, under reproduction-inducing conditions, Met depletion promoted a diapause-like phenotype, including arrested ovarian development and increased lipid storage, and stimulated the expression of diapause-related genes involved in lipid synthesis and stress tolerance, suggesting JH-Met signaling plays an important role in the inhibition of diapause. Accordingly, our data indicate that JH acts through Met to facilitate development of the reproductive system by upregulating Vg expression while inhibiting diapause by suppressing lipid synthesis and stress tolerance in the cabbage beetle. Combined with previous studies in SD-induced reproductive diapause, we conclude that JH may regulate female reproductive diapause using a conserved Met-dependent pathway, regardless of the length of the photoperiod inducing diapause in insects. PMID:27180724

  7. Melhoramento do trigo: XXVII. Estimativas de variância, herdabilidade e correlações em populações híbridas para produção de grãos, tolerância a toxicidade de alumínio e altura das plantas Wheat breeding: XXVII. Variance, heritability and correlations in hybrid populations for grain yield, tolerance to aluminum toxicity and plant height

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1992-01-01

    éticas.Crosses were made involving the cultivars: BH-1146, tall and aluminum tolerant, IAC-24, semidwarf and aluminum tolerant and Anahuac, semidwarf and aluminum sensitive. Parents, F1's, F2's and reciprocal backcrosses were tested for their seedling reaction to 6mg/l of Al3+ in nutrient solution, in laboratory condition, and evaluated for grain yield and plant height at maturity in an experiment using pots, under a screen house in 1988 conditions at Experimental Center of Campinas, State of São Paulo, Brazil. Narrow sense heritabilities estimates were moderate to high for plant height (0.432-0.799 and for aluminum tolerance (0.425-0.922 and low for grain yield (0.037-0.195. Phenotypic correlations between grain yield and plant height were positive and significant for all populations under study. Phenotypic correlations between grain yield and aluminum tolerance were non significant (except for the population BH-1146 x IAC-24. The phenotypic correlation between plant height and aluminum tolerance was only positive and significant for the population BH-1146 x IAC-24. Results suggest it would be possible to select semidwarf plants, with aluminum tolerance and with high yield potential if large segregating populations were used to identify desired genotypes originated from eventual recombinations.

  8. Protein Phosphatase 2A Catalytic Subunit α Plays a MyD88-Dependent, Central Role in the Gene-Specific Regulation of Endotoxin Tolerance

    Directory of Open Access Journals (Sweden)

    Ling Xie

    2013-03-01

    Full Text Available MyD88, the intracellular adaptor of most TLRs, mediates either proinflammatory or immunosuppressive signaling that contributes to chronic inflammation-associated diseases. Although gene-specific chromatin modifications regulate inflammation, the role of MyD88 signaling in establishing such epigenetic landscapes under different inflammatory states remains elusive. Using quantitative proteomics to enumerate the inflammation-phenotypic constituents of the MyD88 interactome, we found that in endotoxin-tolerant macrophages, protein phosphatase 2A catalytic subunit α (PP2Ac enhances its association with MyD88 and is constitutively activated. Knockdown of PP2Ac prevents suppression of proinflammatory genes and resistance to apoptosis. Through site-specific dephosphorylation, constitutively active PP2Ac disrupts the signal-promoting TLR4-MyD88 complex and broadly suppresses the activities of multiple proinflammatory/proapoptotic pathways as well, shifting proinflammatory MyD88 signaling to a prosurvival mode. Constitutively active PP2Ac translocated with MyD88 into the nuclei of tolerant macrophages establishes the immunosuppressive pattern of chromatin modifications and represses chromatin remodeling to selectively silence proinflammatory genes, coordinating the MyD88-dependent inflammation control at both signaling and epigenetic levels under endotoxin-tolerant conditions.

  9. The Opuntia streptacantha OpsHSP18 Gene Confers Salt and Osmotic Stress Tolerance in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Juan Francisco Jiménez-Bremont

    2012-08-01

    Full Text Available Abiotic stress limits seed germination, plant growth, flowering and fruit quality, causing economic decrease. Small Heat Shock Proteins (sHSPs are chaperons with roles in stress tolerance. Herein, we report the functional characterization of a cytosolic class CI sHSP (OpsHSP18 from Opuntia streptacantha during seed germination in Arabidopsis thaliana transgenic lines subjected to different stress and hormone treatments. The over-expression of the OpsHSP18 gene in A. thaliana increased the seed germination rate under salt (NaCl and osmotic (glucose and mannitol stress, and in ABA treatments, compared with WT. On the other hand, the over-expression of the OpsHSP18 gene enhanced tolerance to salt (150 mM NaCl and osmotic (274 mM mannitol stress in Arabidopsis seedlings treated during 14 and 21 days, respectively. These plants showed increased survival rates (52.00 and 73.33%, respectively with respect to the WT (18.75 and 53.75%, respectively. Thus, our results show that OpsHSP18 gene might have an important role in abiotic stress tolerance, in particular in seed germination and survival rate of Arabidopsis plants under unfavorable conditions.

  10. Regulation of Vibrio cholerae Genes Required for Acid Tolerance by a Member of the “ToxR-Like” Family of Transcriptional Regulators

    OpenAIRE

    Merrell, D. Scott; Camilli, Andrew

    2000-01-01

    The ability of the intestinal pathogen Vibrio cholerae to undergo an adaptive stress response, known as the acid tolerance response (ATR), was previously shown to enhance virulence. An essential component of the ATR is CadA-mediated lysine decarboxylation. CadA is encoded by the acid- and infection-induced gene cadA. Herein, cadA is shown to be the second gene in an operon with cadB, encoding a lysine/cadaverine antiporter. cadC, which is 5′ of cadB, encodes an acid-responsive, positive trans...

  11. Transcriptional analysis of cell wall and cuticle related genes during fruit development of two sweet cherry cultivars with contrasting levels of cracking tolerance

    Directory of Open Access Journals (Sweden)

    Cristián Balbontín

    2014-04-01

    Full Text Available Rain-induced cracking before harvest is the major cause of crop loss in sweet cherry (Prunus avium [L.] L. In order to better understand the relationship between cherry fruit cracking and gene expression, the transcriptional patterns of six genes related to cell wall modification and cuticular wax biosynthesis were analyzed during fruit setting (FS, fruit color change (FC and fruit ripening (FR, employing two contrasting cultivars: the cracking resistant 'Kordia' and the cracking susceptible 'Bing'. The transcription levels of AP2/EREBP-type transcription factor (PaWINB, wax synthase (WS, ß-ketoacyl-CoA synthase (PaKCS6, and ß-galactosidase (ß-Gal showed higher levels in 'Kordia' than in 'Bing' during the FS stage, while similar values were observed in both cultivars at FR stage. In contrast to that pattern, transcription levels of expansin (PaEXPl were higher at FR stage in 'Kordia' than in 'Bing'. Transcript profile of lipid transport protein gene (PaLTPGl decreased during fruit development, with higher levels in 'Bing' than in 'Kordia' at FC and FR stages suggesting no relation with cracking tolerance. The expression profiles of PaWINB, WS, PaKCS6, and ß-Gal suggest that they are genes involved in conferring cracking tolerance, likely due to their function in cuticle deposition during early stages of fruit development. In addition, a greater expression level of expansin gene would allow for a faster growth rate in 'Kordia' at FR stage.

  12. Gut: An underestimated target organ for Aluminum.

    Science.gov (United States)

    Vignal, C; Desreumaux, P; Body-Malapel, M

    2016-06-01

    Since World War II, several factors such as an impressive industrial growth, an enhanced environmental bioavailability and intensified food consumption have contributed to a significant amplification of human exposure to aluminum. Aluminum is particularly present in food, beverages, some drugs and airbone dust. In our food, aluminum is superimposed via additives and cooking utensils. Therefore, the tolerable intake of aluminum is exceeded for a significant part of the world population, especially in children who are more vulnerable to toxic effects of pollutants than adults. Faced with this oral aluminum influx, intestinal tract is an essential barrier, especially as 38% of ingested aluminum accumulates at the intestinal mucosa. Although still poorly documented to date, the impact of oral exposure to aluminum in conditions relevant to real human exposure appears to be deleterious for gut homeostasis. Aluminum ingestion affects the regulation of the permeability, the microflora and the immune function of intestine. Nowadays, several arguments are consistent with an involvement of aluminum as an environmental risk factor for inflammatory bowel diseases. PMID:26970682

  13. Differential Expression Analysis of a Subset of Drought-Responsive GmNAC Genes in Two Soybean Cultivars Differing in Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Nguyen Phuong Thao

    2013-12-01

    Full Text Available The plant-specific NAC transcription factors play important roles in plant response to drought stress. Here, we have compared the expression levels of a subset of GmNAC genes in drought-tolerant DT51 and drought-sensitive MTD720 under both normal and drought stress conditions aimed at identifying correlation between GmNAC expression levels and drought tolerance degree, as well as potential GmNAC candidates for genetic engineering. The expression of 23 selected dehydration-responsive GmNACs was assessed in both stressed and unstressed root tissues of DT51 and MTD720 using real-time quantitative PCR. The results indicated that expression of GmNACs was genotype-dependent. Seven and 13 of 23 tested GmNACs showed higher expression levels in roots of DT51 in comparison with MTD720 under normal and drought stress conditions, respectively, whereas none of them displayed lower transcript levels under any conditions. This finding suggests that the higher drought tolerance of DT51 might be positively correlated with the higher induction of the GmNAC genes during water deficit. The drought-inducible GmNAC011 needs to be mentioned as its transcript accumulation was more than 76-fold higher in drought-stressed DT51 roots relative to MTD720 roots. Additionally, among the GmNAC genes examined, GmNAC085, 092, 095, 101 and 109 were not only drought-inducible but also more highly up-regulated in DT51 roots than in that of MTD720 under both treatment conditions. These data together suggest that GmNAC011, 085, 092, 095, 101 and 109 might be promising candidates for improvement of drought tolerance in soybean by biotechnological approaches.

  14. Transgenic rice expressing a cassava (Manihot esculenta Crantz) plasma membrane gene MePMP3-2 exhibits enhanced tolerance to salt and drought stresses.

    Science.gov (United States)

    Yu, Y; Cui, Y C; Ren, C; Rocha, P S C F; Peng, M; Xu, G Y; Wang, M L; Xia, X J

    2016-01-01

    Plasma membrane proteolipid 3 (PMP3) is a class of small hydrophobic proteins found in many organisms including higher plants. Some plant PMP3 genes have been shown to respond to abiotic stresses and to participate in the processes of plant stress tolerance. In this study, we isolated the cassava (Manihot esculenta Crantz) MePMP3-2 gene and functionally characterized its role in tolerance to abiotic stress by expressing it in rice (Oryza sativa L.). MePMP3-2 encodes a 77-amino acid protein belonging to a subgroup of plant PMP3s that have long hydrophylic C-terminal tails of unknown function. In silico analysis and co-localization studies indicated that MePMP3-2 is a plasma membrane protein with two transmembrane domains, similar to other PMP3s. In cassava leaves, MePMP3-2 expression was up-regulated by salt and drought stresses. Heterologous constitutive expression of MePMP3-2 in rice did not alter plant growth and development but increased tolerance to salt and drought stresses. In addition, under stress conditions MePMP3-2 transgenic plants accumulated less malondialdehyde, had increased levels of proline, and exhibited greater up-regulation of the stress-related genes OsProT and OsP5CS, but led to only minor changes in OsDREB2A and OsLEA3 expression. These findings indicate that MePMP3-2 may play an important role in salt and drought stress tolerance in transgenic rice. PMID:26909954

  15. Aluminum tolerance in sorghum and maize

    Science.gov (United States)

    The soils of the tropics and subtropics are highly weathered, leading to poor soil fertility and low soil pH. Root growth and function on these acid soils is impaired by aluminium (Al) toxicity, leading to yield instability that jeopardizes food security worldwide. A wealth of physiological evidence...

  16. Estabelecimento de critérios para selecionar porta-enxertos de macieira tolerantes ao alumínio em solução nutritiva Establishment of criteria to select apple tree rootstocks tolerant to the aluminum in nutritious solution

    Directory of Open Access Journals (Sweden)

    Elaine Cristina Stolf

    2008-06-01

    Full Text Available Dentre todas as fruteiras de clima temperado, a macieira é a que mais atenção tem recebido no sentido de se obterem porta-enxertos com características de boa adaptação, resistência ou sanidade. O desenvolvimento de um método eficiente para caracterizar genótipos com tolerância ao alumínio é o primeiro passo para a realização de estudos de mecanismos genéticos envolvidos na herança desse caráter. Assim, o presente trabalho teve por objetivo avaliar a tolerância ao alumínio dos porta-enxertos de macieira M.9 e Marubakaido em cinco concentrações (0; 50;150; 250 e 350 µM L-1 em solução nutritiva. As estacas de Marubakaido, na concentração intermediária de alumínio apresentaram menor crescimento radicular e aéreo. O M.9 mostrou menor crescimento radicular nas concentrações de 250 e 350 mM de alumínio. As características de crescimento avaliadas permitiram discriminar o porta-enxerto Marubakaido como mais tolerante que o M.9, e a concentração de 350 µM L-1 é a mais eficiente para a discriminação da tolerância ao alumínio aos 15 dias de cultivo em solução nutritiva.Among all of the temperate fruit trees, the apple tree is the one that has attracted more attention when it comes to obtaining rootstocks with characteristics of good adaptation, resistance or sanity. The development of an efficient method to characterize genotypes with tolerance to the aluminum is the first step for the accomplishment of genetic mechanisms studies involved in the inheritance of this character. Thus, the present work aimed to evaluate the tolerance to aluminum of the apple tree rootstocks M.9 and Marubakaido in five concentrations (0, 50, 150, 250 and 350 µM L-1 in nutritious solution. The cuttings of Marubakaido, in the intermediate concentration of aluminum presented smaller root and aerial growth. M.9 showed smaller root growth in the concentrations of 250 and 350 µM of aluminum. The evaluated growth characteristics permitted

  17. Over-expression of BvMTSH, a fusion gene for maltooligosyltrehalose synthase and maltooligosyltrehalose trehalohydrolase, enhances drought tolerance in transgenic rice.

    Science.gov (United States)

    Joo, Joungsu; Choi, Hae Jong; Lee, Youn Hab; Lee, Sarah; Lee, Choong Hwan; Kim, Chung Ho; Cheong, Jong-Joo; Choi, Yang Do; Song, Sang Ik

    2014-01-01

    Plant abiotic stress tolerance has been modulated by engineering the trehalose synthesis pathway. However, many stress-tolerant plants that have been genetically engineered for the trehalose synthesis pathway also show abnormal development. The metabolic intermediate trehalose 6-phosphate has the potential to cause aberrations in growth. To avoid growth inhibition by trehalose 6-phosphate, we used a gene that encodes a bifunctional in-frame fusion (BvMTSH) of maltooligosyltrehalose synthase (BvMTS) and maltooligosyltrehalose trehalohydrolase (BvMTH) from the nonpathogenic bacterium Brevibacterium helvolum. BvMTS converts maltooligosaccharides into maltooligosyltrehalose and BvMTH releases trehalose. Transgenic rice plants that over-express BvMTSH under the control of the constitutive rice cytochrome c promoter (101MTSH) or the ABA-inducible Ai promoter (105MTSH) show enhanced drought tolerance without growth inhibition. Moreover, 101MTSH and 105MTSH showed an ABA-hyposensitive phenotype in the roots. Our results suggest that over-expression of BvMTSH enhances drought-stress tolerance without any abnormal growth and showes ABA hyposensitive phenotype in the roots. PMID:24209631

  18. Identification of Differentially Expressed Genes Related to Dehydration Resistance in a Highly Drought-Tolerant Pear, Pyrus betulaefolia, as through RNA-Seq.

    Science.gov (United States)

    Li, Kong-Qing; Xu, Xiao-Yong; Huang, Xiao-San

    2016-01-01

    Drought is a major abiotic stress that affects plant growth, development and productivity. Pear is one of the most important deciduous fruit trees in the world, but the mechanisms of drought tolerance in this plant are still unclear. To better understand the molecular basis regarding drought stress response, RNA-seq was performed on samples collected before and after dehydration in Pyrus betulaefolia. In total, 19,532 differentially expressed genes (DEGs) were identified. These genes were annotated into 144 Gene Ontology (GO) terms and 18 clusters of orthologous groups (COG) involved in 129 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. These DEGs comprised 49 (26 up-regulated, 23 down-regulated), 248 (166 up-regulated, 82 down-regulated), 3483 (1295 up-regulated, 2188 down-regulated), 1455 (1065 up-regulated, 390 down-regulated) genes from the 1 h, 3 h and 6 h dehydration-treated samples and a 24 h recovery samples, respectively. RNA-seq was validated by analyzing the expresson patterns of randomly selected 16 DEGs by quantitative real-time PCR. Photosynthesis, signal transduction, innate immune response, protein phosphorylation, response to water, response to biotic stimulus, and plant hormone signal transduction were the most significantly enriched GO categories amongst the DEGs. A total of 637 transcription factors were shown to be dehydration responsive. In addition, a number of genes involved in the metabolism and signaling of hormones were significantly affected by the dehydration stress. This dataset provides valuable information regarding the Pyrus betulaefolia transcriptome changes in response to dehydration and may promote identification and functional analysis of potential genes that could be used for improving drought tolerance via genetic engineering of non-model, but economically-important, perennial species. PMID:26900681

  19. Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

  20. Analysis of Antioxidant Enzyme Activity and Antioxidant Genes Expression During Germination of Two Different Genotypes of Lolium multiflorum Under Salt Tolerance.

    Science.gov (United States)

    Wang, Xia; Ma, Xiao; Xinquan-Zhang; Linkai-Huang; Li, Zhou; Nie, Wenzhi-Xu Gang

    2016-01-01

    Annual ryegrass (Lolium multiflorum) is widely used as a cool-season forage grass for its luxuriant growth, palatable and high digestible. To investigate the salt tolerance mechanism in annual ryegrass under salt stress, salt-tolerant genotype 'R102-3' and salt-sensitive genotype 'Tetragold' were subject to 300mmol/L NaCl in a controlled growth chamber for 12 days. The results showed high concentrations of NaCl decreased relative water content (RWC), and increased the electrolyte leakage (EL) in both genotypes. However the 'Tetragold' had a greater increased extent of malondialdehyde (MDA) and EL than in 'R102-3', in contrast, the activities of Superoxide (SOD), Peroxidase (POD), Catalase (CAT) and Ascorbate peroxidase (APX) were higher in salt resistant compared to sensitive ones. For ensure the accurate of qRT-PCR, we used RefFinder to choose the most stably reference genes eEF1A(s) and GAPDH to normalize the antioxidant genes expression data. The results indicated that higher expression of Fe-SOD, Mn-SOD, Chl-Cu/Zn SOD, Cyt-Cu/Zn SOD, POD and CAT in 'R102-3' when compared with 'Tetragold', which may play an important role in defensed damage of Reactive oxygen species (ROS) under salt stress. Thus, the salt-tolerant genotype could effectively resist oxidative damage induced by salt tress relative to salt-sensitive genotype. PMID:26972970

  1. Physiological basis of tolerance to complete submergence in rice involves genetic factors in addition to the SUB1 gene

    OpenAIRE

    Singh, Sudhanshu; Mackill, David J.; Ismail, Abdelbagi M.

    2014-01-01

    Recurring floods in Asia cause poor crop establishment. Yields decline drastically when plants are completely submerged for a few days. Traditional rice cultivars predominate because they have acquired moderate tolerance to flooding but they carry the penalty of inherently lower grain yields. In contrast, modern high-yielding varieties are highly susceptible to flooding. Cultivars with tolerance to complete submergence were recently developed in the background of popular varieties by transfer...

  2. Abscisic acid enhances tolerance of wheat seedlings to drought and regulates transcript levels of genes encoding ascorbate-glutathione biosynthesis

    OpenAIRE

    Wei, Liting; Wang, Lina; Yang, Yang; Wang, Pengfei; Guo, Tiancai; Kang, Guozhang

    2015-01-01

    Glutathione (GSH) and ascorbate (ASA) are associated with the abscisic acid (ABA)-induced abiotic tolerance in higher plant, however, its molecular mechanism remains obscure. In this study, exogenous application (10 μM) of ABA significantly increased the tolerance of seedlings of common wheat (Triticum aestivum L.) suffering from 5 days of 15% polyethylene glycol (PEG)-stimulated drought stress, as demonstrated by increased shoot lengths and shoot and root dry weights, while showing decreased...

  3. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions. PMID:17213639

  4. Effects of a healthy Nordic diet on gene expression changes in peripheral blood mononuclear cells in response to an oral glucose tolerance test in subjects with metabolic syndrome

    DEFF Research Database (Denmark)

    Leder, Lena; Kolehmainen, Marjukka; Narverud, Ingunn;

    2016-01-01

    BACKGROUND: Diet has a great impact on the risk of developing features of metabolic syndrome (MetS), type 2 diabetes mellitus (T2DM), and cardiovascular diseases (CVD). We evaluated whether a long-term healthy Nordic diet (ND) can modify the expression of inflammation and lipid metabolism......-related genes in peripheral blood mononuclear cells (PBMCs) during a 2-h oral glucose tolerance test (OGTT) in individuals with MetS. METHODS: A Nordic multicenter randomized dietary study included subjects (n = 213) with MetS, randomized to a ND group or a control diet (CD) group applying an isocaloric study...... the mRNA gene expression analysis was measured by quantitative real-time polymerase chain reaction (qPCR). We analyzed the mRNA expression changes of 44 genes before and after a 2hOGTT at the beginning and the end of the intervention. RESULTS: The healthy ND significantly down-regulated the expression...

  5. The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco

    Directory of Open Access Journals (Sweden)

    Yadav Narendra

    2012-10-01

    Full Text Available Abstract Background Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1 gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. Results The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC, chlorophyll, K+/Na+ ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na+ content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na+ content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na+ loading to xylem from root and leaf tissues. Transgenic lines also showed increased K+ and Ca2+ content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Conclusions Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na+ efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na+ content in different organs and also affect the other

  6. Brassinosteroids-Induced Systemic Stress Tolerance was Associated with Increased Transcripts of Several Defence-Related Genes in the Phloem in Cucumis sativus.

    Directory of Open Access Journals (Sweden)

    Pingfang Li

    Full Text Available Brassinosteroids (BRs, a group of naturally occurring plant steroidal compounds, are essential for plant growth, development and stress tolerance. Recent studies showed that BRs could induce systemic tolerance to biotic and abiotic stresses; however, the molecular mechanisms by which BRs signals lead to responses in the whole plant are largely unknown. In this study, 24-epibrassinosteroid (EBR-induced systemic tolerance in Cucumis sativus L. cv. Jinyan No. 4 was analyzed through the assessment of symptoms of photooxidative stress by chlorophyll fluorescence imaging pulse amplitude modulation. Expression of defense/stress related genes were induced in both treated local leaves and untreated systemic leaves by local EBR application. With the suppressive subtractive hybridization (SSH library using cDNA from the phloem sap of EBR-treated plants as the tester and distilled water (DW-treated plants as the driver, 14 transcripts out of 260 clones were identified. Quantitative Real Time-Polymerase Chain Reaction (RT-qPCR validated the specific up-regulation of these transcripts. Of the differentially expressed transcripts with known functions, transcripts for the selected four cDNAs, which encode an auxin-responsive protein (IAA14, a putative ankyrin-repeat protein, an F-box protein (PP2, and a major latex, pathogenesis-related (MLP-like protein, were induced in local leaves, systemic leaves and roots after foliar application of EBR onto mature leaves. Our results demonstrated that EBR-induced systemic tolerance is accompanied with increased transcript of genes in the defense response in other organs. The potential role of phloem mRNAs as signaling components in mediating BR-regulated systemic resistance is discussed.

  7. Overexpression of Rice Sphingosine-1-Phoshpate Lyase Gene OsSPL1 in Transgenic Tobacco Reduces Salt and Oxidative Stress Tolerance

    Institute of Scientific and Technical Information of China (English)

    Huijuan Zhang; Jing Zhai; Jibo Mo; Dayong Li; Fengming Song

    2012-01-01

    Sphingolipids,including sphingosine-1-phosphate (S1P),have been shown to function as signaling mediators to regulate diverse aspects of plant growth,development,and stress response.In this study,we performed functional analysis of a rice (Oryza sativa) S1P lyase gene OsSPL1 in transgenic tobacco plants and explored its possible involvement in abiotic stress response.Overexpression of OsSPL1 in transgenic tobacco resulted in enhanced sensitivity to exogenous abscisic acid (ABA),and decreased tolerance to salt and oxidative stress,when compared with the wild type.Furthermore,the expression levels of some selected stress-related genes in OsSPL1-overexpressing plants were reduced after application of salt or oxidative stress,indicating that the altered responsiveness of stress-related genes may be responsible for the reduced tolerance in OsSPL1-overexpressing tobacco plants under salt and oxidative stress.Our results suggest that rice OsSPL1 plays an important role in abiotic stress responses.

  8. GpDSR7, a Novel E3 Ubiquitin Ligase Gene in Grimmia pilifera Is Involved in Tolerance to Drought Stress in Arabidopsis.

    Science.gov (United States)

    Li, Mengmeng; Li, Yihao; Zhao, Junyi; Liu, Hai; Jia, Shenghua; Li, Jie; Zhao, Heping; Han, Shengcheng; Wang, Yingdian

    2016-01-01

    The growth and development of plants under drought stress depends mainly on the expression levels of various genes and modification of proteins. To clarify the molecular mechanism of drought-tolerance of plants, suppression subtractive hybridisation cDNA libraries were screened to identify drought-stress-responsive unigenes in Grimmia pilifera, and a novel E3 ubiquitin ligase gene, GpDSR7, was identified among the 240 responsive unigenes. GpDSR7 expression was induced by various abiotic stresses, particularly by drought. GpDSR7 displayed E3 ubiquitin ligase activity in vitro and was exclusively localised on the ER membrane in Arabidopsis mesophyll protoplasts. GpDSR7-overexpressing transgenic Arabidopsis plants showed a high water content and survival ratio under drought stress. Moreover, the expression levels of some marker genes involved in drought stress were higher in the transgenic plants than in wild-type plants. These results suggest that GpDSR7, an E3 ubiquitin ligase, is involved in tolerance to drought stress at the protein modification level. PMID:27228205

  9. Association of the ACTN3 R557X polymorphism with glucose tolerance and gene expression of sarcomeric proteins in human skeletal muscle

    Science.gov (United States)

    Riedl, Isabelle; Osler, Megan E; Benziane, Boubacar; Chibalin, Alexander V; Zierath, Juleen R

    2015-01-01

    A common polymorphism (R577X) in the α-actinin (ACTN) 3 gene, which leads to complete deficiency of a functional protein in skeletal muscle, could directly influence metabolism in the context of health and disease. Therefore, we tested the hypothesis that states of glucose tolerance are associated with the ACTN3 R577X genotype. We analyzed the prevalence of the ACTN3 R577X polymorphism in people with normal glucose tolerance (NGT) and type 2 diabetes (T2D) and measured muscle-specific α-actinin 2 and 3 mRNA and protein abundance in skeletal muscle biopsies. Furthermore, we investigated the protein abundance of the myosin heavy chain isoforms and the components of the mitochondrial electron transport chain in skeletal muscle from people with NGT or T2D. mRNA of selected sarcomeric z-disk proteins was also assessed. Although the prevalence of the ACTN3 577XX genotype was higher in T2D patients, genotype distribution was unrelated to metabolic control or obesity. ACTN2 and ACTN3 mRNA expression and protein abundance was unchanged between NGT and T2D participants. Protein abundance of mitochondrial complexes II and IV was related to genotype and glucose tolerance status. Gene expression of sarcomeric z-disk proteins was increased in skeletal muscle from NGT participants with the ACTN3 577XX genotype. While genetic variation in ACTN3 does not influence metabolic control, genotype does appear to influence gene expression of other sarcomeric proteins, which could contribute to the functional properties of skeletal muscle and the fatigue-resistant phenotype associated with the R577X polymorphism. PMID:25780092

  10. Association of the ACTN3 R577X polymorphism with glucose tolerance and gene expression of sarcomeric proteins in human skeletal muscle.

    Science.gov (United States)

    Riedl, Isabelle; Osler, Megan E; Benziane, Boubacar; Chibalin, Alexander V; Zierath, Juleen R

    2015-03-01

    A common polymorphism (R577X) in the α-actinin (ACTN) 3 gene, which leads to complete deficiency of a functional protein in skeletal muscle, could directly influence metabolism in the context of health and disease. Therefore, we tested the hypothesis that states of glucose tolerance are associated with the ACTN3 R577X genotype. We analyzed the prevalence of the ACTN3 R577X polymorphism in people with normal glucose tolerance (NGT) and type 2 diabetes (T2D) and measured muscle-specific α-actinin 2 and 3 mRNA and protein abundance in skeletal muscle biopsies. Furthermore, we investigated the protein abundance of the myosin heavy chain isoforms and the components of the mitochondrial electron transport chain in skeletal muscle from people with NGT or T2D. mRNA of selected sarcomeric z-disk proteins was also assessed. Although the prevalence of the ACTN3 577XX genotype was higher in T2D patients, genotype distribution was unrelated to metabolic control or obesity. ACTN2 and ACTN3 mRNA expression and protein abundance was unchanged between NGT and T2D participants. Protein abundance of mitochondrial complexes II and IV was related to genotype and glucose tolerance status. Gene expression of sarcomeric z-disk proteins was increased in skeletal muscle from NGT participants with the ACTN3 577XX genotype. While genetic variation in ACTN3 does not influence metabolic control, genotype does appear to influence gene expression of other sarcomeric proteins, which could contribute to the functional properties of skeletal muscle and the fatigue-resistant phenotype associated with the R577X polymorphism. PMID:25780092

  11. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang

    2013-11-01

    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  12. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression.

    Science.gov (United States)

    Sagor, G H M; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  13. Endothelin receptor B, a candidate gene from human studies at high altitude, improves cardiac tolerance to hypoxia in genetically engineered heterozygote mice.

    Science.gov (United States)

    Stobdan, Tsering; Zhou, Dan; Ao-Ieong, Eilleen; Ortiz, Daniel; Ronen, Roy; Hartley, Iain; Gan, Zhuohui; McCulloch, Andrew D; Bafna, Vineet; Cabrales, Pedro; Haddad, Gabriel G

    2015-08-18

    To better understand human adaptation to stress, and in particular to hypoxia, we took advantage of one of nature's experiments at high altitude (HA) and studied Ethiopians, a population that is well-adapted to HA hypoxic stress. Using whole-genome sequencing, we discovered that EDNRB (Endothelin receptor type B) is a candidate gene involved in HA adaptation. To test whether EDNRB plays a critical role in hypoxia tolerance and adaptation, we generated EdnrB knockout mice and found that when EdnrB (-/+) heterozygote mice are treated with lower levels of oxygen (O2), they tolerate various levels of hypoxia (even extreme hypoxia, e.g., 5% O2) very well. For example, they maintain ejection fraction, cardiac contractility, and cardiac output in severe hypoxia. Furthermore, O2 delivery to vital organs was significantly higher and blood lactate was lower in EdnrB (-/+) compared with wild type in hypoxia. Tissue hypoxia in brain, heart, and kidney was lower in EdnrB (-/+) mice as well. These data demonstrate that a lower level of EDNRB significantly improves cardiac performance and tissue perfusion under various levels of hypoxia. Transcriptomic profiling of left ventricles revealed three specific genes [natriuretic peptide type A (Nppa), sarcolipin (Sln), and myosin light polypeptide 4 (Myl4)] that were oppositely expressed (q < 0.05) between EdnrB (-/+) and wild type. Functions related to these gene networks were consistent with a better cardiac contractility and performance. We conclude that EDNRB plays a key role in hypoxia tolerance and that a lower level of EDNRB contributes, at least in part, to HA adaptation in humans. PMID:26240367

  14. Overexpression of a Chloroplast-located Peroxiredoxin Q Gene, SsPrxQ, Increases the Salt and Low-temperature Tolerance of Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Li-Wen Jing; Shi-Hua Chen; Xiao-Li Guo; Hui Zhang; Yan-Xiu Zhao

    2006-01-01

    Abiotic stress, such as salt, drought and extreme temperature,can result in enhanced production of reactive oxygen species (ROS). Plants have developed both enzymatic ROS-scavenging and non-enzymatic ROS-scavenging systems. The major ROS-scavenging enzymes of plants include superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), glutathione peroxidase (GPX) and peroxiredoxins (Prxs). In the present work, we identified a gene encoding chloroplast-located peroxiredoxin Q, SsPrxQ, from Suaeda salsa L. Located at chloroplast. Overexpression of SsPrxQ in Arabidopsis leads to an increase in salt and low-temperature tolerance.

  15. Association analysis of frost tolerance in rye using candidate genes and phenotypic data from controlled, semi-controlled, and field phenotyping platforms

    Directory of Open Access Journals (Sweden)

    Li Yongle

    2011-10-01

    Full Text Available Abstract Background Frost is an important abiotic stress that limits cereal production in the temperate zone. As the most frost tolerant small grain cereal, rye (Secale cereale L. is an ideal cereal model for investigating the genetic basis of frost tolerance (FT, a complex trait with polygenic inheritance. Using 201 genotypes from five Eastern and Middle European winter rye populations, this study reports a multi-platform candidate gene-based association analysis in rye using 161 single nucleotide polymorphisms (SNPs and nine insertion-deletion (Indel polymorphisms previously identified from twelve candidate genes with a putative role in the frost responsive network. Results Phenotypic data analyses of FT in three different phenotyping platforms, controlled, semi-controlled and field, revealed significant genetic variations in the plant material under study. Statistically significant (P ScCbf15 and one in ScCbf12, all leading to amino acid exchanges, were significantly associated with FT over all three phenotyping platforms. Distribution of SNP effect sizes expressed as percentage of the genetic variance explained by individual SNPs was highly skewed towards zero with a few SNPs obtaining large effects. Two-way epistasis was found between 14 pairs of candidate genes. Relatively low to medium empirical correlations of SNP-FT associations were observed across the three platforms underlining the need for multi-level experimentation for dissecting complex associations between genotypes and FT in rye. Conclusions Candidate gene based-association studies are a powerful tool for investigating the genetic basis of FT in rye. Results of this study support the findings of bi-parental linkage mapping and expression studies that the Cbf gene family plays an essential role in FT.

  16. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata” and Their Interspecific Inbred Line “Maxchata”

    Directory of Open Access Journals (Sweden)

    Neelam Ara

    2013-12-01

    Full Text Available The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C and severe (42 °C heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2, superoxide (O2− and malondialdehyde (MDA contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD, ascorbate peroxidase (APX, catalase (CAT and peroxidase (POD were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  17. Studying the possibility of isolating and characterizing genes responsible for salinity tolerance in some gamma irradiation-induced potato mutants

    International Nuclear Information System (INIS)

    Random Amplified Polymorphic DNA(RAPD) and Inter-Simple Sequence Repeat (ISSR) were deployed to study the genetic relatedness of nineteen different potato lines previously obtained by gamma irradiation and believed to be salt tolerant. The lines which belong to three different cultivars, Spunta, Draga and Diamant were confirmed to be salt tolerant in comparison with their controls. Twenty seven random primers and twenty five ISSR oligonucleotides were utilized to determine the genetic relatedness and to amplify DNA fragments involved in salt tolerance. ISSR clustering and Percent disagreement values (PDV) resembled that of the RAPDs for all studied lines. Consequently, RAPD and ISSR were reliable and could be used to determine the genetic relatedness of potato lines belonging to the same cultivar. Moreover, twenty unique DNA fragments were amplified using RAPD or ISSR in the tolerant mutant lines but not in their respective controls. The fragments were gel excised, reamplified and cloned in a cloning vector using QIAGEN A-addition and PCR cloning Kits. However, Blast data base search with the fragments sequences did not reveal any significant homology indicating the weakness of both the RAPD and ISSR techniques in identifying specific targets.(Authors)

  18. Developing herbicide-tolerant crops from mutations

    International Nuclear Information System (INIS)

    Herbicide-tolerant crops in combination with their corresponding herbicides are able to control many weeds that cannot be or are less effectively controlled with other means. Commercial herbicide-tolerant crops developed from herbicide-tolerant mutants include imidazolinone-tolerant maize, rice, wheat, oilseed rape, sunflower, and lentil; sulfonylurea-tolerant soybean and sunflower; cyclohexanedione-tolerant maize; and triazine-tolerant oilseed rape. Most of the herbicide-tolerant mutants were developed through chemical mutagenesis followed by herbicide selection. Several herbicide-tolerant mutants were also discovered through direct herbicide selection of spontaneous mutations. All mutations used in commercial herbicide-tolerant crops are derived from a single nucleotide substitution of genes that encode enzymes or proteins targeted by herbicides. Imidazolinone-tolerant maize, rice, wheat, and oilseed rape have a gene variant encoding an altered acetohydoxyacid synthase (AHAS) with the S653N amino acid substitution. Additionally, imidazolinone-tolerant maize and oilseed rape have an AHAS with the W574L amino acid substitution. Imidazolinone-tolerant sunflower has been developed from the A205V AHAS gene mutation. In contrast, sulfonylurea-tolerant sunflower selected from a farm field has an AHAS enzyme variant with the P197L amino acid substitution. Similarly, sulfonylurea-tolerant soybean has a P197S AHAS gene mutation. Sulfonylurea-tolerant sunflower from seed mutagenesis and imidazolinone-tolerant lentil are also derived from AHAS gene mutations. Cyclohexanedione-tolerant maize has an altered acetyl-CoA carboxylase with the I1781L amino acid substitution. Triazine-tolerant oil seed rape possesses a psbA gene variant that encodes the D1 protein of photosynthesis with the S264G amino acid substitution. The alleles of all commercial herbicide-tolerant mutations are incompletely-dominant and not pleiotropic except for the triazine-tolerant mutation which is

  19. Over-expression of VvWRKY1 in grapevines induces expression of jasmonic acid pathway-related genes and confers higher tolerance to the downy mildew.

    Directory of Open Access Journals (Sweden)

    Chloé Marchive

    Full Text Available Most WRKY transcription factors activate expression of defence genes in a salicylic acid- and/or jasmonic acid-dependent signalling pathway. We previously identified a WRKY gene, VvWRKY1, which is able to enhance tolerance to fungal pathogens when it is overexpressed in tobacco. The present work analyzes the effects of VvWRKY1 overexpression in grapevine. Microarray analysis showed that genes encoding defence-related proteins were up-regulated in the leaves of transgenic 35S::VvWRKY1 grapevines. Quantitative RT-PCR analysis confirmed that three genes putatively involved in jasmonic acid signalling pathway were overexpressed in the transgenic grapes. The ability of VvWRKY1 to trans-activate the promoters of these genes was demonstrated by transient expression in grape protoplasts. The resistance to the causal agent of downy mildew, Plasmopara viticola, was enhanced in the transgenic plants. These results show that VvWRKY1 can increase resistance of grapevine against the downy mildew through transcriptional reprogramming leading to activation of the jasmonic acid signalling pathway.

  20. Over-expression of VvWRKY1 in grapevines induces expression of jasmonic acid pathway-related genes and confers higher tolerance to the downy mildew.

    Science.gov (United States)

    Marchive, Chloé; Léon, Céline; Kappel, Christian; Coutos-Thévenot, Pierre; Corio-Costet, Marie-France; Delrot, Serge; Lauvergeat, Virginie

    2013-01-01

    Most WRKY transcription factors activate expression of defence genes in a salicylic acid- and/or jasmonic acid-dependent signalling pathway. We previously identified a WRKY gene, VvWRKY1, which is able to enhance tolerance to fungal pathogens when it is overexpressed in tobacco. The present work analyzes the effects of VvWRKY1 overexpression in grapevine. Microarray analysis showed that genes encoding defence-related proteins were up-regulated in the leaves of transgenic 35S::VvWRKY1 grapevines. Quantitative RT-PCR analysis confirmed that three genes putatively involved in jasmonic acid signalling pathway were overexpressed in the transgenic grapes. The ability of VvWRKY1 to trans-activate the promoters of these genes was demonstrated by transient expression in grape protoplasts. The resistance to the causal agent of downy mildew, Plasmopara viticola, was enhanced in the transgenic plants. These results show that VvWRKY1 can increase resistance of grapevine against the downy mildew through transcriptional reprogramming leading to activation of the jasmonic acid signalling pathway. PMID:23342101

  1. Construction and Verification of LuxS-negative Mutants of Streptococcus Mutans and the Effect of the Absence of LuxS Gene on the Acid Tolerance

    Institute of Scientific and Technical Information of China (English)

    YU Dan-ni; CHEN Jie; ZHANG Yao-chao; HAN Yu-zhi

    2009-01-01

    Objective: To knock out the entire Luxs gene of Streptococcus mutans(S.mutans) UA159 strain via homologous recombination and construct a Luxs-deleted mutant strain of S. Mutans. To study the difference between the acid resistance of S. Mutans Ingbritt C international standard strain and the acid resistance of LuxS mutant strain. Methods: Two DNA fragments locating in the upper and downstream of Luxs gene were amplified and a erythromycin resistance gene of PJT10 between them were engineered into PUC19 plasmid for constructing the recombination plasmid pUCluxKO. Electrotransformation of S.mutans cells with pUCluxKO-mutant resulted in isolation of erythromycin resistant S. Mutans transformants, which was identified by polymerase chain reaction, V.harveyi BB170 luminescence bioassay and sequencing analysis. Solutions of S. Mutans standard strain and LuxS mutant strain with same density were made and cultured at pH 3.5 to 7.0 BHI liquid for the same period.Terminal growth situation was compared.Firstly acidized in pH 5.5 BHI liquid,the two strains were cultured at pH 3.0 BHI liquid. The acid tolerance responses of the two strains were compared.Results:Restriction endonuclease analyses showed that pUCluxKO-mutant vector had been successfully recombined. The Luxs-deleted status of S.mutans mutants was confirmed by PCR with primers which were specific for the genes of Luxs and Erythromycin resistance. S.mutans mutant can not induce bioluminescence, indiating the mutant had been successfully recombined. After twenty generations of culture, the constructed Chinese S.mutans mutants were confirmed to be stable. Significant difference of aciduricity was observed between S.mutans standard strain and LuxS mutant strain.The acid resistance of standard strain was stronger than that of LuxS mutant strain.The two strains both displayed the capability of acid tolerance responses. Conclusion:The S.mutans gene allelic exchange plasmid is constructed correctively and a Luxs

  2. Effect of the C.-1 388 A〉G polymorphism in chicken heat shock transcription factor 3 gene on heat tolerance

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-wu[1,2,3; KONG Li-na[1,2,3; ZHANG De-xian[1,4; JI Cong-liang[4; ZHANG Xi-quan[1,2; LUO Qing-bin[1,2,3

    2015-01-01

    Heat stress is one of the main factors that influence poultry production. Heat shock proteins (HSPs) are known to affect heat tolerance. The formation of HSPs is regulated by heat shock transcription factor 3 (HSF3) in chicken. A DNA pool was established for identifying single nucleotide polymorphisms (SNPs) of the chicken HSF3, and 13 SNPs were detected. The bioinformatic analysis showed that 8 SNPs had the capacity to alter the transcdption activity of HSF3. The dual luciferase report gene assay showed that there was a significant difference (P〈0.01) in the Firefly luciferase/Renilla luciferase ratio (F/R) of C.-1 703 A〉G ($1) and C.-1 388 A〉G (S4) sites at the 5"-untranslated region (UTR) of chicken HSF3. The elec- trophoretic mobility shift assay showed that the S4 site was a transcription binding factor. The analysis of the association of the S1 and S4 sites with heat tolerance index revealed that the $4 site was significantly correlated with the CD3+ T cell, corticosterone, and T3 levels in Lingshan chickens and with the heterophil/lymphocyte value in White Recessive Rock. These results showed that the S4 site at the 5 UTR of chicken HSF3 might have an impact on heat tolerance in summer and could be used as a potential marker for the selection of chicken with heat tolerance in the future.

  3. A myo-inositol-1-phosphate synthase gene, IbMIPS1, enhances salt and drought tolerance and stem nematode resistance in transgenic sweet potato.

    Science.gov (United States)

    Zhai, Hong; Wang, Feibing; Si, Zengzhi; Huo, Jinxi; Xing, Lei; An, Yanyan; He, Shaozhen; Liu, Qingchang

    2016-02-01

    Myo-inositol-1-phosphate synthase (MIPS) is a key rate limiting enzyme in myo-inositol biosynthesis. The MIPS gene has been shown to improve tolerance to abiotic stresses in several plant species. However, its role in resistance to biotic stresses has not been reported. In this study, we found that expression of the sweet potato IbMIPS1 gene was induced by NaCl, polyethylene glycol (PEG), abscisic acid (ABA) and stem nematodes. Its overexpression significantly enhanced stem nematode resistance as well as salt and drought tolerance in transgenic sweet potato under field conditions. Transcriptome and real-time quantitative PCR analyses showed that overexpression of IbMIPS1 up-regulated the genes involved in inositol biosynthesis, phosphatidylinositol (PI) and ABA signalling pathways, stress responses, photosynthesis and ROS-scavenging system under salt, drought and stem nematode stresses. Inositol, inositol-1,4,5-trisphosphate (IP3 ), phosphatidic acid (PA), Ca(2+) , ABA, K(+) , proline and trehalose content was significantly increased, whereas malonaldehyde (MDA), Na(+) and H2 O2 content was significantly decreased in the transgenic plants under salt and drought stresses. After stem nematode infection, the significant increase of inositol, IP3 , PA, Ca(2+) , ABA, callose and lignin content and significant reduction of MDA content were found, and a rapid increase of H2 O2 levels was observed, peaked at 1 to 2 days and thereafter declined in the transgenic plants. This study indicates that the IbMIPS1 gene has the potential to be used to improve the resistance to biotic and abiotic stresses in plants. PMID:26011089

  4. Expression of the maize ZmGF14-6 gene in rice confers tolerance to drought stress while enhancing susceptibility to pathogen infection.

    Science.gov (United States)

    Campo, Sonia; Peris-Peris, Cristina; Montesinos, Laura; Peñas, Gisela; Messeguer, Joaquima; San Segundo, Blanca

    2012-01-01

    14-3-3 proteins are found in all eukaryotes where they act as regulators of diverse signalling pathways associated with a wide range of biological processes. In this study the functional characterization of the ZmGF14-6 gene encoding a maize 14-3-3 protein is reported. Gene expression analyses indicated that ZmGF14-6 is up-regulated by fungal infection and salt treatment in maize plants, whereas its expression is down-regulated by drought stress. It is reported that rice plants constitutively expressing ZmGF14-6 displayed enhanced tolerance to drought stress which was accompanied by a stronger induction of drought-associated rice genes. However, rice plants expressing ZmGF14-6 either in a constitutive or under a pathogen-inducible regime showed a higher susceptibility to infection by the fungal pathogens Fusarium verticillioides and Magnaporthe oryzae. Under infection conditions, a lower intensity in the expression of defence-related genes occurred in ZmGF14-6 rice plants. These findings support that ZmGF14-6 positively regulates drought tolerance in transgenic rice while negatively modulating the plant defence response to pathogen infection. Transient expression assays of fluorescently labelled ZmGF14-6 protein in onion epidermal cells revealed a widespread distribution of ZmGF14-6 in the cytoplasm and nucleus. Additionally, colocalization experiments of fluorescently labelled ZmGF14-6 with organelle markers, in combination with cell labelling with the endocytic tracer FM4-64, revealed a subcellular localization of ZmGF14-6 in the early endosomes. Taken together, these results improve our understanding of the role of ZmGF14-6 in stress signalling pathways, while indicating that ZmGF14-6 inversely regulates the plant response to biotic and abiotic stresses. PMID:22016430

  5. Enhanced Acid Tolerance in Bifidobacterium longum by Adaptive Evolution: Comparison of the Genes between the Acid-Resistant Variant and Wild-Type Strain.

    Science.gov (United States)

    Jiang, Yunyun; Ren, Fazheng; Liu, Songling; Zhao, Liang; Guo, Huiyuan; Hou, Caiyun

    2016-03-28

    Acid stress can affect the viability of probiotics, especially Bifidobacterium. This study aimed to improve the acid tolerance of Bifidobacterium longum BBMN68 using adaptive evolution. The stress response, and genomic differences of the parental strain and the variant strain were compared by acid stress. The highest acid-resistant mutant strain (BBMN68m) was isolated from more than 100 asexual lines, which were adaptive to the acid stress for 10(th), 20(th), 30(th), 40(th), and 50(th) repeats, respectively. The variant strain showed a significant increase in acid tolerance under conditions of pH 2.5 for 2 h (from 7.92 to 4.44 log CFU/ml) compared with the wildtype strain (WT, from 7.87 to 0 log CFU/ml). The surface of the variant strain was also smoother. Comparative whole-genome analysis showed that the galactosyl transferase D gene (cpsD, bbmn68_1012), a key gene involved in exopolysaccharide (EPS) synthesis, was altered by two nucleotides in the mutant, causing alteration in amino acids, pI (from 8.94 to 9.19), and predicted protein structure. Meanwhile, cpsD expression and EPS production were also reduced in the variant strain (p < 0.05) compared with WT, and the exogenous WT-EPS in the variant strain reduced its acid-resistant ability. These results suggested EPS was related to acid responses of BBMN68. PMID:26608165

  6. Sequence polymorphism of GroEL gene in natural population of Bacillus and Brevibacillus spp. that showed variation in thermal tolerance capacity and mRNA expression.

    Science.gov (United States)

    Sen, R; Tripathy, S; Padhi, S K; Mohanty, S; Maiti, N K

    2014-10-01

    GroEL, a class I chaperonin, plays an important role in the thermal adaptation of the cell and helps to maintain the viability of the cell under heat shock condition. Function of groEL in vivo depends on the maintenance of proper structure of the protein which in turn depends on the nucleotide and amino acid sequence of the gene. In this study, we investigated the changes in nucleotide and amino acid sequences of the partial groEL gene that may affect the thermotolerance capacity as well as mRNA expression of bacterial isolates. Sequences among the same species having differences in the amino acid level were identified as different alleles. The effect of allelic variation on the groEL gene expression was analyzed by comparison and relative quantification in each allele under thermal shock condition by RT-PCR. Evaluation of K a/K s ratio among the strains of same species showed that the groEL gene of all the species had undergone similar functional constrain during evolution. The strains showing similar thermotolerance capacity was found to carry same allele of groEL gene. The isolates carrying allele having amino acid substitution inside the highly ATP/ADP or Mg(2+)-binding region could not tolerate thermal stress and showed lower expression of the groEL gene. Our results indicate that during evolution of these bacterial species the groEL gene has undergone the process of natural selection, and the isolates have evolved with the groEL allelic sequences that help them to withstand the thermal stress during their interaction with the environment. PMID:24894903

  7. Characterization of pbt genes conferring increased Pb(2+) and Cd(2+) tolerance upon Achromobacter xylosoxidans A8

    Czech Academy of Sciences Publication Activity Database

    Hložková, K.; Šuman, J.; Strnad, Hynek; Ruml, T.; Pačes, Václav; Kotrba, P.

    2013-01-01

    Roč. 164, č. 10 (2013), s. 1009-1018. ISSN 1769-7123 R&D Projects: GA MŠk(CZ) 1M0520 Grant ostatní: GA ČR(CZ) GAP504/11/0484 Institutional support: RVO:68378050 Keywords : Achromobacter xylosoxidans * metal tolerance * lead * cadmium * zinc * P1-type ATPase * MerR family * transcriptional control Subject RIV: EB - Genetics ; Molecular Biology

  8. Improved Shoot Regeneration, Salinity Tolerance and Reduced Fungal Susceptibility in Transgenic Tobacco Constitutively Expressing PR-10a Gene

    OpenAIRE

    Agarwal, Parinita; Dabi, Mitali; More, Prashant; Patel, Khantika; Jana, Kalyanashis; Agarwal, Pradeep K.

    2016-01-01

    Plants in ecosystems are simultaneously exposed to abiotic and biotic stresses, which restrict plant growth and development. The complex responses to these stresses are largely regulated by plant hormones, which in turn, orchestrate the different biochemical and molecular pathways to maneuver stress tolerance. The PR-10 protein family is reported to be involved in defense regulation, stress response and plant growth and development. The JcPR-10a overexpression resulted in increased number of ...

  9. Improved Shoot Regeneration, Salinity Tolerance and Reduced Fungal Susceptibility in Transgenic Tobacco Constitutively Expressing PR-10a Gene.

    Science.gov (United States)

    Agarwal, Parinita; Dabi, Mitali; More, Prashant; Patel, Khantika; Jana, Kalyanashis; Agarwal, Pradeep K

    2016-01-01

    Plants in ecosystems are simultaneously exposed to abiotic and biotic stresses, which restrict plant growth and development. The complex responses to these stresses are largely regulated by plant hormones, which in turn, orchestrate the different biochemical and molecular pathways to maneuver stress tolerance. The PR-10 protein family is reported to be involved in defense regulation, stress response and plant growth and development. The JcPR-10a overexpression resulted in increased number of shoot buds in tobacco (Nicotiana tabacum), which could be due to high cytokinin to auxin ratio in the transgenics. The docking analysis shows the binding of three BAP molecules at the active sites of JcPR-10a protein. JcPR-10a transgenics showed enhanced salt tolerance, as was evident by increased germination rate, shoot and root length, relative water content, proline, soluble sugar and amino acid content under salinity. Interestingly, the transgenics also showed enhanced endogenous cytokinin level as compared to WT, which, further increased with salinity. Exposure of gradual salinity resulted in increased stomatal conductance, water use efficiency, photosynthesis rate and reduced transpiration rate. Furthermore, the transgenics also showed enhanced resistance against Macrophomina fungus. Thus, JcPR-10a might be working in co-ordination with cytokinin signaling in mitigating the stress induced damage by regulating different stress signaling pathways, leading to enhanced stress tolerance. PMID:26973666

  10. Improved Shoot Regeneration, Salinity Tolerance and Reduced Fungal Susceptibility in Transgenic Tobacco Constitutively Expressing PR-10a Gene

    Science.gov (United States)

    Agarwal, Parinita; Dabi, Mitali; More, Prashant; Patel, Khantika; Jana, Kalyanashis; Agarwal, Pradeep K.

    2016-01-01

    Plants in ecosystems are simultaneously exposed to abiotic and biotic stresses, which restrict plant growth and development. The complex responses to these stresses are largely regulated by plant hormones, which in turn, orchestrate the different biochemical and molecular pathways to maneuver stress tolerance. The PR-10 protein family is reported to be involved in defense regulation, stress response and plant growth and development. The JcPR-10a overexpression resulted in increased number of shoot buds in tobacco (Nicotiana tabacum), which could be due to high cytokinin to auxin ratio in the transgenics. The docking analysis shows the binding of three BAP molecules at the active sites of JcPR-10a protein. JcPR-10a transgenics showed enhanced salt tolerance, as was evident by increased germination rate, shoot and root length, relative water content, proline, soluble sugar and amino acid content under salinity. Interestingly, the transgenics also showed enhanced endogenous cytokinin level as compared to WT, which, further increased with salinity. Exposure of gradual salinity resulted in increased stomatal conductance, water use efficiency, photosynthesis rate and reduced transpiration rate. Furthermore, the transgenics also showed enhanced resistance against Macrophomina fungus. Thus, JcPR-10a might be working in co-ordination with cytokinin signaling in mitigating the stress induced damage by regulating different stress signaling pathways, leading to enhanced stress tolerance. PMID:26973666

  11. Improved shoot regeneration, salinity tolerance and reduced fungal susceptibility in transgenic tobacco constitutively expressing PR-10a gene

    Directory of Open Access Journals (Sweden)

    Parinita eAgarwal

    2016-02-01

    Full Text Available Plants in ecosystems are simultaneously exposed to abiotic and biotic stresses, which restrict plant growth and development. The complex responses to these stresses are largely regulated by plant hormones, which in turn, orchestrate the different biochemical and molecular pathways to manoeuvre stress tolerance. The PR-10 protein family is reported to be involved in defence regulation, stress response and plant growth and development. The JcPR-10a overexpression resulted in increased number of shoot buds in tobacco (Nicotiana tabacum, which could be due to high cytokinin to auxin ratio in the transgenics. The docking analysis shows the binding of three BAP molecules at the active sites of JcPR-10a protein. JcPR-10a transgenics showed enhanced salt tolerance, as was evident by increased germination rate, shoot and root length, relative water content, proline, soluble sugar and amino acid content under salinity. Interestingly, the transgenics also showed enhanced endogenous cytokinin level as compared to WT, which, further increased with salinity. Exposure of gradual salinity resulted in increased stomatal conductance, water use efficiency, photosynthesis rate and reduced transpiration rate. Furthermore, the transgenics also showed enhanced resistance against Macrophomina fungus. Thus, JcPR-10a might be working in co-ordination with cytokinin signalling in mitigating the stress induced damage by regulating different stress signalling pathways, leading to enhanced stress tolerance.

  12. Expression of a Codon-Optimized dsdA Gene in Tobacco Plastids and Rice Nucleus Confers D-Serine Tolerance.

    Science.gov (United States)

    Li, Yanmei; Wang, Rui; Hu, Zongliang; Li, Hongcai; Lu, Shizhan; Zhang, Juanjuan; Lin, Yongjun; Zhou, Fei

    2016-01-01

    D-serine is toxic to plants. D-serine ammonia lyase, which is encoded by the dsdA gene, can attenuate this toxicity with high specificity. In the present study, we explored the function of codon-optimized dsdA with tobacco plastids and rice nuclear transformation system. It was shown that dsdA gene was site-specifically integrated into the tobacco plastid genome and displayed a high level of expression. Genetic analysis of the progenies showed that dsdA gene is maternally inherited and confers sufficient D-serine resistance in tobacco. The effective screening concentrations of D-serine for seed germination, callus regeneration and foliar spray were 10, 30, and 75 mM, respectively. In addition, calluses from homozygous transgenic rice lines also showed significant tolerance to D-serine (up to 75 mM). Our study proves the feasibility of using dsdA gene as a selectable marker in both plastid and nuclear transformation systems. PMID:27242842

  13. Expression of a codon-optimized dsdA gene in tobacco plastids and rice nuclear confers D-serine tolerance

    Directory of Open Access Journals (Sweden)

    Yanmei eLi

    2016-05-01

    Full Text Available D-serine is toxic to plants. D-serine ammonia lyase, which is encoded by the dsdA gene, can attenuate this toxicity with high specificity. In the present study, we explored the function of codon-optimized dsdA with tobacco plastids and rice nuclear transformation system. It was shown that the dsdA gene was site-specifically integrated into the tobacco chloroplast genome and displayed a high level of expression. Genetic analysis of the progenies showed that the dsdA gene is maternally inherited and confers sufficient D-serine resistance in tobacco. The effective screening concentrations of D-serine for seed germination, callus regeneration and foliar spray were 10 mM, 30 mM and 75 mM, respectively. In addition, calluses from homozygous transgenic rice lines also showed significant tolerance to D-serine (up to 75 mM. Our study proves the feasibility of using dsdA gene as a selectable marker in both chloroplast and nuclear transformation systems.

  14. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    Science.gov (United States)

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  15. Cloning and Sequence Analysis of a Glucose-6-Phosphate Dehydrogenase Gene PsG6PDH from Freezing-tolerant Populus suaveolens

    Institute of Scientific and Technical Information of China (English)

    Lin Yuan-zhen; Lin Shan-zhi; Zhang Wei; Zhang Qian; Zhang Zhi-yi; Guo Huan

    2005-01-01

    A 1207 hp cDNA fragment (PsG6PDH) was amplified by PT-PCR from cold-induced total Pna of the freexing-tolerant P. Suaveolens, using primers based on the highly comserved region of published plant glucose-6-phosphate dehydrogenase (G6PDH)genes. The sepuence analysis showed that PsG6PDH coding region had 1 101 bp and encoded 367 predicted aminoacid residues. Moreover, the nucleotide sequence of psG6PDH showed 83%,82%,79%,79% and 78% identity, and the derived amino acid sequence shared 44.2%,44.7%,42.0%,40.5% and 43.9% identity with those of the Solanum tuberosum, Nicotiana tabacum, Triticum aestivum, Oryxa sativa and Arabidopsis thaliana, respectively. The results show that PsG6PDH is a new member of G6PDH gene family and belongs to cytosolic G6PDH gene. This is the first report on clonign of the G6PDH gene from woody plants.

  16. Molecular cloning of a novel bioH gene from an environmental metagenome encoding a carboxylesterase with exceptional tolerance to organic solvents

    Directory of Open Access Journals (Sweden)

    Shi Yuping

    2013-02-01

    Full Text Available Abstract Background BioH is one of the key enzymes to produce the precursor pimeloyl-ACP to initiate biotin biosynthesis de novo in bacteria. To date, very few bioH genes have been characterized. In this study, we cloned and identified a novel bioH gene, bioHx, from an environmental metagenome by a functional metagenomic approach. The bioHx gene, encoding an enzyme that is capable of hydrolysis of p-nitrophenyl esters of fatty acids, was expressed in Escherichia coli BL21 using the pET expression system. The biochemical property of the purified BioHx protein was also investigated. Results Screening of an unamplified metagenomic library with a tributyrin-containing medium led to the isolation of a clone exhibiting lipolytic activity. This clone carried a 4,570-bp DNA fragment encoding for six genes, designated bioF, bioHx, fabG, bioC, orf5 and sdh, four of which were implicated in the de novo biotin biosynthesis. The bioHx gene encodes a protein of 259 aa with a calculated molecular mass of 28.60 kDa, displaying 24-39% amino acid sequence identity to a few characterized bacterial BioH enzymes. It contains a pentapeptide motif (Gly76-Trp77-Ser78-Met79-Gly80 and a catalytic triad (Ser78-His230-Asp202, both of which are characteristic for lipolytic enzymes. BioHx was expressed as a recombinant protein and characterized. The purified BioHx protein displayed carboxylesterase activity, and it was most active on p-nitrophenyl esters of fatty acids substrate with a short acyl chain (C4. Comparing BioHx with other known BioH proteins revealed interesting diversity in their sensitivity to ionic and nonionic detergents and organic solvents, and BioHx exhibited exceptional resistance to organic solvents, being the most tolerant one amongst all known BioH enzymes. This ascribed BioHx as a novel carboxylesterase with a strong potential in industrial applications. Conclusions This study constituted the first investigation of a novel bioHx gene in a biotin

  17. Metagenomic identification of a novel salt tolerance gene from the human gut microbiome which encodes a membrane protein with homology to a brp/blh-family β-carotene 15,15'-monooxygenase.

    Directory of Open Access Journals (Sweden)

    Eamonn P Culligan

    Full Text Available The human gut microbiome consists of at least 3 million non-redundant genes, 150 times that of the core human genome. Herein, we report the identification and characterisation of a novel stress tolerance gene from the human gut metagenome. The locus, assigned brpA, encodes a membrane protein with homology to a brp/blh-family β-carotene monooxygenase. Cloning and heterologous expression of brpA in Escherichia coli confers a significant salt tolerance phenotype. Furthermore, when cultured in the presence of exogenous β-carotene, cell pellets adopt a red/orange pigmentation indicating the incorporation of carotenoids in the cell membrane.

  18. Metagenomic identification of a novel salt tolerance gene from the human gut microbiome which encodes a membrane protein with homology to a brp/blh-family β-carotene 15,15'-monooxygenase.

    Science.gov (United States)

    Culligan, Eamonn P; Sleator, Roy D; Marchesi, Julian R; Hill, Colin

    2014-01-01

    The human gut microbiome consists of at least 3 million non-redundant genes, 150 times that of the core human genome. Herein, we report the identification and characterisation of a novel stress tolerance gene from the human gut metagenome. The locus, assigned brpA, encodes a membrane protein with homology to a brp/blh-family β-carotene monooxygenase. Cloning and heterologous expression of brpA in Escherichia coli confers a significant salt tolerance phenotype. Furthermore, when cultured in the presence of exogenous β-carotene, cell pellets adopt a red/orange pigmentation indicating the incorporation of carotenoids in the cell membrane. PMID:25058308

  19. Metagenomic Identification of a Novel Salt Tolerance Gene from the Human Gut Microbiome Which Encodes a Membrane Protein with Homology to a brp/blh-Family β-Carotene 15,15′-Monooxygenase

    OpenAIRE

    Culligan, Eamonn P.; Sleator, Roy D.; Marchesi, Julian R.; Hill, Colin

    2014-01-01

    The human gut microbiome consists of at least 3 million non-redundant genes, 150 times that of the core human genome. Herein, we report the identification and characterisation of a novel stress tolerance gene from the human gut metagenome. The locus, assigned brpA, encodes a membrane protein with homology to a brp/blh-family β-carotene monooxygenase. Cloning and heterologous expression of brpA in Escherichia coli confers a significant salt tolerance phenotype. Furthermore, when cultured in th...

  20. Studies of the Pro12Ala polymorphism of the peroxisome proliferator-activated receptor-gamma2 (PPAR-gamma2) gene in relation to insulin sensitivity among glucose tolerant caucasians

    DEFF Research Database (Denmark)

    Ek, J; Andersen, G; Urhammer, S A; Hansen, L; Carstensen, B; Borch-Johnsen, K; Drivsholm, T; Berglund, Lars Erik; Hansen, T; Lithell, H; Pedersen, O

    2001-01-01

    We examined whether the Pro12-Ala polymorphism of the human peroxisome proliferator-activated receptor-gamma2 (PPAR-gamma2) gene was related to altered insulin sensitivity among glucose-tolerant subjects or a lower accumulated incidence or prevalence of IGT and Type II (non-insulin-dependent) dia......-insulin-dependent) diabetes mellitus among Scandinavian Caucasians.......We examined whether the Pro12-Ala polymorphism of the human peroxisome proliferator-activated receptor-gamma2 (PPAR-gamma2) gene was related to altered insulin sensitivity among glucose-tolerant subjects or a lower accumulated incidence or prevalence of IGT and Type II (non...

  1. An exceptional salt tolerant antimicrobial peptide derived from a novel gene family of hemocytes of the marine invertebrate Ciona intestinalis

    OpenAIRE

    Fedders, Henning; Michalek, Matthias; Grötzinger, Joachim; Leippe, Matthias

    2008-01-01

    Abstract A novel gene family coding for putative antimicrobial peptides was identified in the EST data base of the sea squirt Ciona intestinalis, and one of these genes was molecularly cloned from the Northern European Ciona subspecies. In situ hybridisation and immunocytochemical analysis revealed that the natural peptide is synthesized and stored in a distinct hemocyte type, the univacuolar non-refractile granulocytes. By semiquantitative RT-PCR analysis it was shown that the exp...

  2. Multiple abiotic stress tolerance in Vigna mungo is altered by overexpression of ALDRXV4 gene via reactive carbonyl detoxification.

    Science.gov (United States)

    Singh, Preeti; Kumar, Deepak; Sarin, Neera Bhalla

    2016-06-01

    Vigna mungo (blackgram) is an important leguminous pulse crop, which is grown for its protein rich edible seeds. Drought and salinity are the major abiotic stresses which adversely affect the growth and productivity of crop plants including blackgram. The ALDRXV4 belongs to the aldo-keto reductase superfamily of enzymes that catalyze the reduction of carbonyl metabolites in the cells and plays an important role in the osmoprotection and detoxification of the reactive carbonyl species. In the present study, we developed transgenic plants of V. mungo using Agrobacterium mediated transformation. The transgene integration was confirmed by Southern blot analysis whereas the expression was confirmed by RT-PCR, Western blot and enzyme activity. The T1 generation transgenic plants displayed improved tolerance to various environmental stresses, including drought, salt, methyl viologen and H2O2 induced oxidative stress. The increased aldose reductase activity, higher sorbitol content and less accumulation of the toxic metabolite, methylglyoxal in the transgenic lines under non-stress and stress (drought and salinity) conditions resulted in increased protection through maintenance of better photosynthetic efficiency, higher relative water content and less photooxidative damage. The accumulation of reactive oxygen species was remarkably decreased in the transgenic lines as compared with the wild type plants. This study of engineering multiple stress tolerance in blackgram, is the first report to date and this strategy for trait improvement is proposed to provide a novel germplasm for blackgram production on marginal lands. PMID:26956699

  3. Co-silencing of tomato S-adenosylhomocysteine hydrolase genes confers increased immunity against Pseudomonas syringae pv. tomato DC3000 and enhanced tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    Li Xiao Hui

    2015-09-01

    Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.

  4. Genes associated with heavy metal tolerance and accumulation in Zn/Cd hyperaccumulator Arabidopsis halleri: a genomic survey with cDNA microarray.

    Science.gov (United States)

    Chiang, Huai-Chih; Lo, Jing-Chi; Yeh, Kuo-Chen

    2006-11-01

    To survive in variable soil conditions, plants possess homeostatic mechanisms to maintain a suitable concentration of essential heavy metal ions. Certain plants, inhabiting heavy metal-enriched or -contaminated soil, thus are named hyperaccumulators. Studying hyperaccumulators has great potential to provide information for phytoremediation. To better understand the hyperaccumulating mechanism, we used an Arabidopsis cDNA microarray to compare the gene expression of the Zn/Cd hyperaccumulator Arabidopsis halleri and a nonhyperaccumulator, Arabidopsis thaliana. By analyzing the expression of metal-chelators, antioxidation-related genes, and transporters, we revealed a few novel molecular features. We found that metallothionein 2b and 3, APX and MDAR4 in the ascorbate-glutathione pathway, and certain metal transporters in P(1B)-type ATPase, ZIP, Nramp, and CDF families, are expressed at higher levels in A. halleri than in A. thaliana. We further validated that the enzymatic activity of ascorbate peroxidase and class III peroxidases are highly elevated in A. halleri. This observation positively correlates with the higher ability of A. halleri to detoxify H2O2 produced by cadmium and paraquat treatments. We thus suggest that higher peroxidase activities contribute to the heavy metal tolerance in A. halleri by alleviating the ROS damage. We have revealed genes that could be candidates for the future engineering of plants with large biomass for use in phytoremediation. PMID:17144312

  5. Water deficit stress tolerance in maize conferred by expression of an isopentenyltransferase (IPT) gene driven by a stress- and maturation-induced promoter.

    Science.gov (United States)

    Décima Oneto, Cecilia; Otegui, María Elena; Baroli, Irene; Beznec, Ailin; Faccio, Paula; Bossio, Ezequiel; Blumwald, Eduardo; Lewi, Dalia

    2016-02-20

    Senescence can be delayed in transgenic plants overexpressing the enzyme isopentenyltransferase (IPT) due to stress-induced increased levels of endogenous cytokinins. This trait leads to sustained photosynthetic activity and improved tolerance to abiotic stress. The aim of this study was to generate and characterize transgenic plants of maize (Zea mays L.) transformed with the IPT gene sequence under the regulation of SARK promoter (protein kinase receptor-associated senescence). Three independent transgenic events and their segregating null controls were evaluated in two watering regimes (WW: well watered; WD: water deficit) imposed for two weeks around anthesis. Our results show that the WD treatment induced IPT expression with the concomitant increase in cytokinin levels, which prolonged the persistence of total green leaf area, and maintained normal photosynthetic rate and stomatal conductance. These trends were accompanied by a minor decrease in number of grains per plant, individual grain weight and plant grain yield as compared to WW plants. Plants expressing the IPT gene under WD had PGR, anthesis and silking dates and biomass levels similar to WW plants. Our results demonstrate that expression of the IPT gene under the regulation of the SARK promoter helps improve productivity under WD conditions in C4 plants like maize. PMID:26784988

  6. Expression of Rice CYP450-Like Gene (Os08g01480 in Arabidopsis Modulates Regulatory Network Leading to Heavy Metal and Other Abiotic Stress Tolerance.

    Directory of Open Access Journals (Sweden)

    Arti Rai

    Full Text Available Heavy metal (HM toxicity has become a grave problem in the world since it leads to hazardous effects on living organisms. Transcriptomic/proteomic studies in plants have identified a large number of metal-responsive gene families. Of these, cytochrome-P450 (CYPs family members are composed of enzymes carrying out detoxification of exogenous molecules. Here, we report a CYP-like protein encoded by Os08g01480 locus in rice that helps the plant to combat HM and other abiotic stresses. To functionally characterize CYP-like gene, cDNA and promoter were isolated from rice to develop Arabidopsis transgenic lines. Heterologous expression of Os08g01480 in Arabidopsis provided significant tolerance towards abiotic stresses. In silico analysis reveals that Os08g01480 might help plants to combat environmental stress via modulating auxin metabolism. Transgenic lines expressing reporter gene under control of Os08g01480 promoter demonstrated differential promoter activity in different tissues during environmental stresses. These studies indicated that differential expression of Os08g01480 might be modulating response of plants towards environmental stresses as well as in different developmental stages.

  7. Association of the ACTN3 R577X polymorphism with glucose tolerance and gene expression of sarcomeric proteins in human skeletal muscle

    DEFF Research Database (Denmark)

    Riedl, Isabelle; Osler, Megan E; Benziane, Boubacar;

    2015-01-01

    A common polymorphism (R577X) in the α-actinin (ACTN) 3 gene, which leads to complete deficiency of a functional protein in skeletal muscle, could directly influence metabolism in the context of health and disease. Therefore, we tested the hypothesis that states of glucose tolerance are associated...... with the ACTN3 R577X genotype. We analyzed the prevalence of the ACTN3 R577X polymorphism in people with normal glucose tolerance (NGT) and type 2 diabetes (T2D) and measured muscle-specific α-actinin 2 and 3 mRNA and protein abundance in skeletal muscle biopsies. Furthermore, we investigated the...... protein abundance of the myosin heavy chain isoforms and the components of the mitochondrial electron transport chain in skeletal muscle from people with NGT or T2D. mRNA of selected sarcomeric z-disk proteins was also assessed. Although the prevalence of the ACTN3 577XX genotype was higher in T2D...

  8. OsLEA3-2, an abiotic stress induced gene of rice plays a key role in salt and drought tolerance.

    Directory of Open Access Journals (Sweden)

    Jianli Duan

    Full Text Available Late embryogenesis abundant (LEA proteins are involved in tolerance to drought, cold and high salinity in many different organisms. In this report, a LEA protein producing full-length gene OsLEA3-2 was identified in rice (Oryza sativa using the Rapid Amplification of cDNA Ends (RACE method. OsLEA3-2 was found to be only expressed in the embryo and can be induced by abiotic stresses. The coding protein localizes to the nucleus and overexpression of OsLEA3-2 in yeast improved growth performance compared with control under salt- and osmotic-stress conditions. OsLEA3-2 was also inserted into pHB vector and overexpressed in Arabidopsis and rice. The transgenic Arabidopsis seedlings showed better growth on MS media supplemented with 150 mM mannitol or 100 mM NaCl as compared with wild type plants. The transgenic rice also showed significantly stronger growth performance than control under salinity or osmotic stress conditions and were able to recover after 20 days of drought stress. In vitro analysis showed that OsLEA3-2 was able to protect LDH from aggregation on freezing and inactivation on desiccation. These results indicated that OsLEA3-2 plays an important role in tolerance to abiotic stresses.

  9. Overexpression of rice NAC gene SNAC1 improves drought and salt tolerance by enhancing root development and reducing transpiration rate in transgenic cotton.

    Directory of Open Access Journals (Sweden)

    Guanze Liu

    Full Text Available The SNAC1 gene belongs to the stress-related NAC superfamily of transcription factors. It was identified from rice and overexpressed in cotton cultivar YZ1 by Agrobacterium tumefaciens-mediated transformation. SNAC1-overexpressing cotton plants showed more vigorous growth, especially in terms of root development, than the wild-type plants in the presence of 250 mM NaCl under hydroponic growth conditions. The content of proline was enhanced but the MDA content was decreased in the transgenic cotton seedlings under drought and salt treatments compared to the wild-type. Furthermore, SNAC1-overexpressing cotton plants also displayed significantly improved tolerance to both drought and salt stresses in the greenhouse. The performances of the SNAC1-overexpressing lines under drought and salt stress were significantly better than those of the wild-type in terms of the boll number. During the drought and salt treatments, the transpiration rate of transgenic plants significantly decreased in comparison to the wild-type, but the photosynthesis rate maintained the same at the flowering stage in the transgenic plants. These results suggested that overexpression of SNAC1 improve more tolerance to drought and salt in cotton through enhanced root development and reduced transpiration rates.

  10. Global transcriptome analysis of Al-induced genes in an Al-accumulating species, common buckwheat (Fagopyrum esculentum Moench).

    Science.gov (United States)

    Yokosho, Kengo; Yamaji, Naoki; Ma, Jian Feng

    2014-12-01

    Buckwheat (Fagopyrum esculentum Moench) is a species with high aluminum (Al) tolerance and accumulation. Although the physiological mechanisms for external and internal detoxification of Al have been well studied, the molecular mechanisms responsible are poorly understood. Here, we conducted a genome-wide transcriptome analysis of Al-responsive genes in the roots and leaves using RNA sequencing (RNA-Seq) technology. RNA-Seq generated reads ranging from 56×10(6) to 93×10(6). A total of 148,734 transcript contigs with an average length of 1,014 bp were assembled, generating 84,516 unigenes. Among them, 31,730 and 23,853 unigenes were annotated, respectively, in the NCBI plant database and TAIR database for Arabidopsis. Of the annotated genes, 4,067 genes in the roots and 2,663 genes in the leaves were up-regulated (>2-fold) by Al exposure, while 2,456 genes in the roots and 2,426 genes in the leaves were down-regulated (<2-fold) A few STOP1/ART1 (SENSITIVE TO PROTON RHIZOTOXICITY1/AL RESISTANCE TRANSCRIPTION FACTOR1)-regulated gene homologs including FeSTAR1, FeALS3 (ALUMINUM SENSITIVE3), FeALS1 (ALUMINUM SENSITIVE1), FeMATE1 and FeMATE2 (MULTIDRUG AND TOXIC COMPOUND EXTRUSION1 and 2) were also up-regulated in buckwheat, indicating some common Al tolerance mechanism across the species, although most STOP1/ART1-regulated gene homologs were not changed. Most genes involved in citric and oxalic acid biosynthesis were not significantly altered. Some transporter genes were highly expressed in the roots and leaves and responded to Al stress, implicating their role in Al tolerance and accumulation. Overall, our data provide a platform for further characterizing the functions of genes involved in Al tolerance and accumulation in buckwheat. PMID:25273892

  11. Developing Herbicide-Tolerant Crops from Mutations

    International Nuclear Information System (INIS)

    Several herbicide-tolerant crops have been developed and commercialized from herbicide-tolerant mutants obtained through chemical mutagenesis followed by herbicide selection or direct herbicide selection of spontaneous mutations. All mutations used in commercial herbicide-tolerant crops are derived from a single nucleotide substitution of genes that encode enzymes or proteins targeted by herbicides. The alleles of all commercial herbicide-tolerant mutations are incompletely-dominant except for the triazine-tolerant mutation. (author)

  12. Gene cloning and characterization of a novel highly organic solvent tolerant lipase from Proteus sp. SW1 and its application for biodiesel production.

    Science.gov (United States)

    Whangsuk, Wirongrong; Sungkeeree, Pareenart; Thiengmag, Sirinthra; Kerdwong, Jarunee; Sallabhan, Ratiboot; Mongkolsuk, Skorn; Loprasert, Suvit

    2013-01-01

    Proteus sp. SW1 was found to produce an extracellular solvent tolerant lipase. The gene, lipA, encoding a bacterial lipase, was cloned from total Proteus sp. SW1 DNA. lipA was predicted to encode a 287 amino acid protein of 31.2 kDa belonging to the Group I proteobacterial lipases. Purified His-tagged LipA exhibited optimal activity at pH 10.0 and 55°C. It was highly stable in organic solvents retaining 112% of its activity in 100% isopropanol after 24 h, and exhibited more than 200% of its initial activity upon exposure to 60% acetone, ethanol, and hexane for 18 h. Biodiesel synthesis reactions, using a single step addition of 13% an acyl acceptor ethanol, showed that LipA was highly effective at converting palm oil into biodiesel. PMID:22371263

  13. Tolerance to the antimicrobial peptide colistin in Pseudomonas aeruginosa biofilms is linked to metabolically active cells, and depends on the pmr and mexAB-oprM genes

    DEFF Research Database (Denmark)

    Pamp, Sünje Johanna; Gjermansen, Morten; Johansen, Helle Krogh;

    2008-01-01

    antimicrobial peptide colistin. On the contrary, biofilm cells exhibiting low metabolic activity were killed by colistin. We demonstrate that the subpopulation of metabolically active cells is able to adapt to colistin by inducing a specific adaptation mechanism mediated by the pmr operon, as well as an...... unspecific adaptation mechanism mediated by the mexAB-oprM genes. Mutants defective in either pmr-mediated lipopolysaccharide modification or in mexAB-oprM-mediated antimicrobial efflux were not able to develop a tolerant subpopulation in biofilms. In contrast to the observed pattern of colistin...... physiologically distinct subpopulations by combined antimicrobial treatment with either ciprofloxacin and colistin or tetracycline and colistin almost completely eradicated all biofilm cells....

  14. A maize calcium-dependent protein kinase gene, ZmCPK4, positively regulated abscisic acid signaling and enhanced drought stress tolerance in transgenic Arabidopsis.

    Science.gov (United States)

    Jiang, Shanshan; Zhang, Dan; Wang, Li; Pan, Jiaowen; Liu, Yang; Kong, Xiangpei; Zhou, Yan; Li, Dequan

    2013-10-01

    Calcium-dependent protein kinases (CDPKs) play essential roles in calcium-mediated signal transductions in plant response to abiotic stress. Several members have been identified to be regulators for plants response to abscisic acid (ABA) signaling. Here, we isolated a subgroup I CDPK gene, ZmCPK4, from maize. Quantitative real time PCR (qRT-PCR) analysis revealed that the ZmCPK4 transcripts were induced by various stresses and signal molecules. Transient and stable expression of the ZmCPK4-GFP fusion proteins revealed ZmCPK4 localized to the membrane. Moreover, overexpression of ZmCPK4 in the transgenic Arabidopsis enhanced ABA sensitivity in seed germination, seedling growth and stomatal movement. The transgenic plants also enhanced drought stress tolerance. Taken together, the results suggest that ZmCPK4 might be involved in ABA-mediated regulation of stomatal closure in response to drought stress. PMID:23911729

  15. Arabidopsis Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Gene Raf43 Is Required for Tolerance to Multiple Abiotic Stresses.

    Directory of Open Access Journals (Sweden)

    Nasar Virk

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are critical signaling modules that mediate the transduction of extracellular stimuli into intracellular response. A relatively large number of MAPKKKs have been identified in a variety of plant genomes but only a few of them have been studied for their biological function. In the present study, we identified an Arabidopsis Raf-like MAPKKK gene Raf43 and studied its function in biotic and abiotic stress response using a T-DNA insertion mutant raf43-1 and two Raf43-overexpressing lines Raf43-OE#1 and Raf43-OE#13. Expression of Raf43 was induced by multiple abiotic and biotic stresses including treatments with drought, mannitol and oxidative stress or defense signaling molecule salicylic acid and infection with necrotrophic fungal pathogen Botrytis cinerea. Seed germination and seedling root growth of raf43-1 were significantly inhibited on MS medium containing mannitol, NaCl, H2O2 or methyl viologen (MV while seed germination and seedling root growth of the Raf43-OE#1 and Raf43-OE#13 lines was similar to wild type Col-0 under the above stress conditions. Soil-grown raf43-1 plants exhibited reduced tolerance to MV, drought and salt stress. Abscisic acid inhibited significantly seed germination and seedling root growth of the raf43-1 line but had no effect on the two Raf43-overexpressing lines. Expression of stress-responsive RD17 and DREB2A genes was significantly down-regulated in raf43-1 plants. However, the raf43-1 and Raf43-overexpressing plants showed similar disease phenotype to the wild type plants after infection with B. cinerea or Pseudomonas syringae pv. tomato DC3000. Our results demonstrate that Raf43, encoding for a Raf-like MAPKKK, is required for tolerance to multiple abiotic stresses in Arabidopsis.

  16. Cloning of theOAT gene and the correlation between its expression and drought tolerance inPhaseolus vulgaris L.

    Institute of Scientific and Technical Information of China (English)

    CHEN Ji-bao; CAO Yuan-nan; ZHANG Zhao-yuan; WANG Shu-min; WU Jing; WANG Lan-fen

    2016-01-01

    Drought stress is a major abiotic stress of common bean (Phaseolus vulgaris L.) throughout the world. Increasing the proline accumulation contributes to enhance crop drought tolerance. A cDNA for δ-ornithine aminotransferase (δ-OAT), an enzyme involved in the biosynthesis of proline, was isolated fromPhaseolus vulgaris (PvOAT).PvOAT exhibits 87.4 and 39.8% similarity of the deduced amino acid sequences withδ-OAT fromGlycine maxandVigna aconitifolia, respectively. The transcriptional analysis revealed thatPvOAT was strongly induced by drought stress. And the expression ofPvOAT was higher in leaves than that in the root and stem of common bean by drought stress. Similar increase of the proline accumulation was observed in leaves and roots of common bean by drought stress. Furthermore, the proline content, the PvOAT expression and the PvOAT enzyme activity in cultivar F5575 was signiifcantly (P<0.01) higher than that in cultivar F4851 under drought-stress conditions. Interestingly, it had been observed that, in the later stage of drought stress, the proline steadily maintained at the maximum level maybe result from the PvOAT enzyme activity increasing steadily. These results indicated that the expression ofPvOAT and the accumulation of proline induced by drought stress treatment were related to the degree of common bean drought tolerance. So our results support the view that δ-OAT is associated with proline synthesis under drought stress conditions.

  17. STOP2 Activates Transcription of Several Genesfor AI- and Low pH-Tolerance that Are Regulatedby STOP1 in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    2014-01-01

    The zinc-finger protein STOP1 (sensitive to proton rhizotoxicity 1) regulates transcription of multiple genescritical for tolerance to aluminum (AI) and low pH in Arabidopsis. We evaluated the contributions of genes that are sup-pressed in the stop1 mutant to AI- and low pH-tolerance using T-DNA-inserted disruptants, and transgenic stop1 mutantsexpressing each of the suppressed genes. STOP2, a STOP1 homolog, partially recovered AI- and low pH-tolerance byrecovering the expression of genes regulated by STOP1. Growth and root tip viability under proton stress were partiallyrescued in the STOP2-complemented line. STOP2 localized in the nucleus and regulated transcription of two genes (PGIP1and PGIP2) associated with cell wall stabilization at low pH. GUS assays revealed that STOP1 and STOP2 showed similarcellular expression in the root. However, the expression level of STOP2 was much lower than that of STOP1. In a STOP1promoter::STOP2-complemented line, AI tolerance was slightly recovered, concomitant with the recovery of expressionof ALS3 (aluminum sensitive 3) and AtMATE (Arabidopsis thaliana multidrug and toxic compound extrusion), while theexpression of AtALMT1 (aluminum-activated malate transporter 1) was not recovered. These analyses indicated thatSTOP2 is a physiologically minor isoform of STOP1, but it can activate expression of some genes regulated by STOP1.

  18. High prevalence of multidrug-tolerant bacteria and associated antimicrobial resistance genes isolated from ornamental fish and their carriage water

    Science.gov (United States)

    Objectives: The aim of the study was to assess the extent to which ornamental fish and their carriage water harbour antibiotic resistant bacteria and associated antibiotic resistance genes. Methods: 129 Aeromonas spp. isolated from warm water and coldwater ornamental fish species were screened for r...

  19. The Aluminum Smelting Process

    OpenAIRE

    Kvande, Halvor

    2014-01-01

    This introduction to the industrial primary aluminum production process presents a short description of the electrolytic reduction technology, the history of aluminum, and the importance of this metal and its production process to modern society. Aluminum's special qualities have enabled advances in technologies coupled with energy and cost savings. Aircraft capabilities have been greatly enhanced, and increases in size and capacity are made possible by advances in aluminum technology. The me...

  20. Correlation between differential drought tolerability of two contrasting drought-responsive chickpea cultivars and differential expression of a subset of CaNAC genes under normal and dehydration conditions

    OpenAIRE

    Nguyen, Kien Huu; Van Ha, Chien; Watanabe, Yasuko; Tran, Uyen Thi; Nasr Esfahani, Maryam; Nguyen, Dong; Tran, Lam-Son Phan

    2015-01-01

    Drought causes detrimental effect to growth and productivity of many plants, including crops. NAC transcription factors have been reported to play important role in drought tolerance. In this study, we assessed the expression profiles of 19 dehydration-responsive CaNAC genes in roots and leaves of two contrasting drought-responsive chickpea varieties treated with water (control) and dehydration to examine the correlation between the differential expression levels of the CaNAC genes and the di...

  1. Screening Jatropha genotypes for aluminum tolerance using the solution-paper methodSeleção de genótipos de pinhão-manso tolerantes ao alumínio usando o método papel-solução

    Directory of Open Access Journals (Sweden)

    Tatiana Barbosa Rosado

    2012-08-01

    Full Text Available The identification of genetic material tolerant to aluminum (Al can offer important advantages to breeding programs and to recommendations for cultivars with the aim of utilizing acidic soil. Based on this, our aim was to determine, by using the solution-paper method, the aluminum concentration that best demonstrates tolerance of Jatropha accessions to this element. For this study, seeds from eight Jatropha accessions (CNPAE 114, CNPAE 154, CNPAE 169, CNPAE 178, CNPAE 218, CNPAE 200, CNPAE 226, CNPAE 228 were placed in a germination chamber with different concentrations of Al (0, 85, 155, 225 and 295 mg L-1 using the solution-paper technique. After 14 days, the length of the primary root was evaluated and the percentage by which those subjected to doses of Al was calculated. A concentration of 85 mg L-1 was the level that separated the accessions in terms of Al tolerance; the accessions CNPAE 114 and CNPAE 154 were the most sensitive to the presence of this toxic element in the solution. It was concluded that the solution-paper method is efficient and can be used in Jatropha breeding programs for the selection of Al-tolerant genotypes. A identificação de material genético tolerante ao alumínio (Al pode oferecer importantes subsídios aos programas de melhoramento e à recomendação de cultivares destinada a utilização de solos ácidos. Assim, o objetivo deste trabalho foi determinar, através do método de papel-solução, a concentração de alumínio que melhor discrimine acessos de pinhão-manso quanto à tolerância ao Al. Para este estudo, sementes de oito acessos de pinhão-manso (CNPAE 114, CNPAE 154, CNPAE 169, CNPAE 178, CNPAE 218, CNPAE 200, CNPAE 226, CNPAE 228 foram colocadas para germinar em diferentes concentrações de Al (0, 85, 155, 225 e 295 mg L-1 utilizando a técnica do papel solução. Após 14 dias o comprimento da raiz primária foi avaliado e a porcentagem de redução foi calculada para os sujeitados as doses de

  2. Interpopulation differences in expression of candidate genes for salinity tolerance in winter migrating anadromous brown trout ( Salmo trutta L.)

    DEFF Research Database (Denmark)

    Larsen, Peter Foged; Eg Nielsen, Einar; Koed, Anders;

    2008-01-01

    Background: Winter migration of immature brown trout (Salmo trutta) into freshwater rivers has been hypothesized to result from physiologically stressful combinations of high salinity and low temperature in the sea. Results: We sampled brown trout from two Danish populations entering different...... conditions in the sea drive sea-run brown trout into freshwater rivers in winter. However, our results also demonstrate intra-specific differences in expression of important stress and osmoregulative genes most likely reflecting adaptive differences between trout populations on a regional scale, thus...... found in trout from the river entering high saline conditions, while a temperature independent up-regulation of both genes in full-strength seawater was found for trout entering marine conditions with lower salinities. Conclusion: Overall our results support the hypothesis that physiologically stressful...

  3. Mutations in the Listerial proB Gene Leading to Proline Overproduction: Effects on Salt Tolerance and Murine Infection

    OpenAIRE

    Sleator, Roy D.; Gahan, Cormac G. M.; Hill, Colin

    2001-01-01

    The observed sensitivity of Listeria monocytogenes to the toxic proline analogue l-azetidine-2-carboxylic acid (AZ) suggested that proline synthesis in Listeria may be regulated by feedback inhibition of γ-glutamyl kinase (GK), the first enzyme of the proline biosynthesis pathway, encoded by the proB gene. Taking advantage of the Epicurian coli mutator strain XL1-Red, we performed random mutagenesis of the recently described proBA operon and generated three independent mutations in the lister...

  4. Overexpression of lycopene ε-cyclase gene from lycium chinense confers tolerance to chilling stress in Arabidopsis thaliana.

    Science.gov (United States)

    Song, Xinyu; Diao, Jinjin; Ji, Jing; Wang, Gang; Li, Zhaodi; Wu, Jiang; Josine, Tchouopou Lontchi; Wang, Yurong

    2016-01-15

    Lutein plays an important role in protecting the photosynthetic apparatus from photodamage and eliminating ROS to render normal physiological function of cells. As a rate-limiting step for lutein synthesis in plants, lycopene ε-cyclase catalyzes lycopene to δ-carotene. We cloned a lycopene ε-cyclase gene (Lcε-LYC) from Lycium chinense (L. chinense), a deciduous woody perennial halophyte growing in various environmental conditions. The Lcε-LYC gene has an ORF of 1569bp encoding a protein of 522 aa. The deduced amino acid sequence of Lcε-LYC gene has higher homology with LycEs in other plants, such as Nicotiana tabacum and Solanum tuberosum. When L. chinense was exposed to chilling stress, relative expression of Lcε-LYC increased. To study the protective role of Lcε-LYC against chilling stress, we overexpressed the Lcε-LYC gene in Arabidopsis thaliana. Lcε-LYC overexpression led to an increase of lutein accumulation in transgenic A. thaliana, and the content of lutein decreased when transgenics were under cold conditions. In addition, the transgenic plants under chilling stress displayed higher activities of superoxide dismutase (SOD) and peroxidase (POD) and less H2O2 and malondialdehyde (MDA) than the control. Moreover, the photosynthesis rate, photosystem II activity (Fv/fm), and Non-photochemical quenching (NPQ) also increased in the transgenetic plants. On the whole, overexpression of Lcε-LYC ameliorates photoinhibition and photooxidation, and decreases the sensitivity of photosynthesis to chilling stress in transgenic plants. PMID:26526130

  5. Inducible and constitutive expression of an elicitor gene Hrip1 from Alternaria tenuissima enhances stress tolerance in Arabidopsis.

    Science.gov (United States)

    Peng, Xue-Cong; Qiu, De-Wen; Zeng, Hong-Mei; Guo, Li-Hua; Yang, Xiu-Fen; Liu, Zheng

    2015-02-01

    Hrip1 is a novel hypersensitive response-inducing protein secreted by Alternaria tenuissima that activates defense responses and systemic acquired resistance in tobacco. This study investigates the role that Hrip1 plays in responses to abiotic and biotic stress using transgenic Arabidopsis thaliana expressing the Hrip1 gene under the control of the stress-inducible rd29A promoter or constitutive cauliflower mosaic virus 35S promoter. Bioassays showed that inducible Hrip1 expression in rd29A∷Hrip1 transgenic lines had a significantly higher effect on plant height, silique length, plant dry weight, seed germination and root length under salt and drought stress compared to expression in 35S∷Hrip1 lines and wild type plants. The level of enhancement of resistance to Botrytis cinerea by the 35S∷Hrip1 lines was higher than in the rd29A∷Hrip1 lines. Moreover, stress-related gene expression in the transgenic Arabidopsis lines was significantly increased by 200 mM NaCl and 200 mM mannitol treatments, and defense genes in the jasmonic acid and ethylene signaling pathway were significantly up-regulated after Botrytis inoculation in the Hrip1 transgenic plants. Furthermore, the activity of some antioxidant enzymes, such as peroxidase and catalase increased after salt and drought stress and Botrytis infection. These results suggested that the Hrip1 protein contributes to abiotic and biotic resistance in transgenic Arabidopsis and may be used as a useful gene for resistance breeding in crops. Although the constitutive expression of Hrip1 is suitable for biotic resistance, inducible Hrip1 expression is more responsive for abiotic resistance. PMID:25120219

  6. Interpopulation differences in expression of candidate genes for salinity tolerance in winter migrating anadromous brown trout (Salmo trutta L.

    Directory of Open Access Journals (Sweden)

    Thomsen Dennis S

    2008-01-01

    Full Text Available Abstract Background Winter migration of immature brown trout (Salmo trutta into freshwater rivers has been hypothesized to result from physiologically stressful combinations of high salinity and low temperature in the sea. Results We sampled brown trout from two Danish populations entering different saline conditions and quantified expression of the hsp70 and Na/K-ATPases α 1b genes following acclimation to freshwater and full-strength seawater at 2°C and 10°C. An interaction effect of low temperature and high salinity on expression of both hsp70 and Na/K-ATPase α 1b was found in trout from the river entering high saline conditions, while a temperature independent up-regulation of both genes in full-strength seawater was found for trout entering marine conditions with lower salinities. Conclusion Overall our results support the hypothesis that physiologically stressful conditions in the sea drive sea-run brown trout into freshwater rivers in winter. However, our results also demonstrate intra-specific differences in expression of important stress and osmoregulative genes most likely reflecting adaptive differences between trout populations on a regional scale, thus strongly suggesting local adaptations driven by the local marine environment.

  7. Boron/aluminum shelf for shuttle orbiter

    International Nuclear Information System (INIS)

    Boron/aluminum skins and channels were used in the fabrication of a prototype honeycomb sandwich avionics shelf. The avionic shelves are stiffness-critical and must be vibration tolerant. In conjunction with the shelf mounting system, they must isolate the avionics equipment from the severe vibration of the primary and secondary structure nearby. Design rationale, fabrication procedures, vibration test criteria and test results are presented. (9 fig) (U.S.)

  8. O pH das soluções nutritivas no comportamento de cultivares de trigo à toxicidade de alumínio Effect of pH in nutrient solution on tolerance to aluminum toxicity in wheat cultivars

    OpenAIRE

    Carlos Eduardo de Oliveira Camargo

    1984-01-01

    Foram estudados nove cultivares de trigo em soluções nutritivas contendo quatro níveis de alumínio (0, 5, 10 e 20mg/litro) combinados com três níveis de pH (4,0, 5,0 e 6,0). A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após um período de permanência de 48 horas em solução contendo determinados níveis de pH e de alumínio. Os cultivares BH-1146, IAC-18, IAC-13 e C-3 foram tolerantes; IAC-17 e Alondra-4546 foram moderadamente toler...

  9. Graphene-aluminum nanocomposites

    International Nuclear Information System (INIS)

    Highlights: → We investigated the mechanical properties of aluminum and aluminum nanocomposites. → Graphene composite had lower strength and hardness compared to nanotube reinforcement. → Processing causes aluminum carbide formation at graphene defects. → The carbides in between grains is a source of weakness and lowers tensile strength. - Abstract: Composites of graphene platelets and powdered aluminum were made using ball milling, hot isostatic pressing and extrusion. The mechanical properties and microstructure were studied using hardness and tensile tests, as well as electron microscopy, X-ray diffraction and differential scanning calorimetry. Compared to the pure aluminum and multi-walled carbon nanotube composites, the graphene-aluminum composite showed decreased strength and hardness. This is explained in the context of enhanced aluminum carbide formation with the graphene filler.

  10. Graphene-aluminum nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Bartolucci, Stephen F., E-mail: stephen.bartolucci@us.army.mil [U.S. Army Benet Laboratories, Armaments Research Development and Engineering Center, Watervliet, NY 12189-4000 (United States); Paras, Joseph [U.S. Army Benet Laboratories, Armaments Research Development and Engineering Center, Watervliet, NY 12189-4000 (United States); Rafiee, Mohammad A. [Department of Mechanical Engineering and Materials Science, Rice University, Houston, TX 77005 (United States); Rafiee, Javad [Department of Mechanical, Aerospace and Nuclear Engineering, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Lee, Sabrina; Kapoor, Deepak [U.S. Army Benet Laboratories, Armaments Research Development and Engineering Center, Watervliet, NY 12189-4000 (United States); Koratkar, Nikhil, E-mail: koratn@rpi.edu [Department of Mechanical, Aerospace and Nuclear Engineering, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)

    2011-10-15

    Highlights: {yields} We investigated the mechanical properties of aluminum and aluminum nanocomposites. {yields} Graphene composite had lower strength and hardness compared to nanotube reinforcement. {yields} Processing causes aluminum carbide formation at graphene defects. {yields} The carbides in between grains is a source of weakness and lowers tensile strength. - Abstract: Composites of graphene platelets and powdered aluminum were made using ball milling, hot isostatic pressing and extrusion. The mechanical properties and microstructure were studied using hardness and tensile tests, as well as electron microscopy, X-ray diffraction and differential scanning calorimetry. Compared to the pure aluminum and multi-walled carbon nanotube composites, the graphene-aluminum composite showed decreased strength and hardness. This is explained in the context of enhanced aluminum carbide formation with the graphene filler.

  11. Excision repair cross complementation group 1 is a chemotherapy-tolerating gene in cisplatin-based treatment for non-small cell lung cancer.

    Science.gov (United States)

    Wang, Shoufeng; Pan, Hong; Liu, Desen; Mao, Naiquan; Zuo, Chuantian; Li, Li; Xie, Tong; Huang, Dingming; Huang, Yaoyuan; Pan, Qi; Yang, Li; Wu, Junwei

    2015-02-01

    This study aimed to evaluate the biological functions of excision repair cross complementation goup 1 (ERCC1) in cell proliferation, cell cycle, invasion and cisplatin response of non-small cell lung cancer (NSCLC) cells. Firstly, ERCC1 gene was successfully transfected into H1299 cells by gene cloning and transfection techniques. Then, cell proliferation was determined with the cell growth curve and colony-forming assays. Flow cytometry (FCM) was employed to investigate the cell cycle distribution. The ability of cell invasion was estimated by means of Matrigel invasion assays. Response of NSCLC cells to cisplatin was detected utilizing MTT assays, and the intracellular drug concentrations were determined by the high performance liquid chromatography (HPLC) analysis. Expression of the two cell membrane proteins, P-glycoprotein (P-gp) and multidrug resistance-associated protein (MRP), was also evaluated utilizing FCM technique. By contrast, ERCC1 expression in the NSCLC A549 cells was silenced by small interfering RNA (siRNA) through RNAi technique. In addition, the cytotoxic effect of cisplatin on A549 cells was detected by MTT assays. In the present study, the results demonstrated that ERCC1 had no effect on cell proliferation, cell cycle and the ability of invasion, but showed significant impact on cisplatin response of the NSCLC H1299 cells. Furthermore, siRNA-induced suppression of ERCC1 evidently enhanced sensitivity to cisplatin of NSCLC A549 cells. Therefore, it is confirmed that ERCC1 is a chemotherapy-tolerating gene and a promising predictor in tailoring chemotherapy of NSCLC. PMID:25434755

  12. Rapid detection of sequence variation in Clostridium difficile genes using LATE-PCR with multiple mismatch-tolerant hybridization probes.

    Science.gov (United States)

    Pierce, Kenneth E; Khan, Huma; Mistry, Rohit; Goldenberg, Simon D; French, Gary L; Wangh, Lawrence J

    2012-11-01

    A novel molecular assay for Clostridium difficile was developed using Linear-After-The-Exponential polymerase chain reaction (LATE-PCR). Single-stranded DNA products generated by LATE-PCR were detected and distinguished by hybridization to fluorescent mismatch-tolerant probes, as the temperature was lowered after amplification in 5(°)C intervals between 65°C and 25°C. Single-tube multiplex reactions for tcdA, tcdB, tcdC, and cdtB (binary toxin) sequences were initially optimized using synthetic targets and were subsequently done using genomic DNA; each target was detected and characterized by hybridization to one or more probes of a different fluorescent color. In the case of tcdC, three probes, each labeled with a Quasar fluorophore, hybridize to different locations with known mutations, including the deletion at nucleotide 117 in ribotype 027 strains and the premature stop codon mutation at nucleotide 184 in ribotype 078 strains, each of which is associated with hypervirulent infections. These and other tcdC mutations were distinguished from the reference sequence, as well as from each other by changes in the fluorescent contour generated from the combined Quasar-labeled probes. Specific variations in tcdA and tcdB were also identified in the multiplex assay, including those that identified strains lacking toxin A production. This single closed-tube assay generates substantially more information about virulent C. difficile than currently available commercial assays and could be further expanded to provide strain typing. PMID:22982259

  13. A wheat PI4K gene whose product possesses threonine autophophorylation activity confers tolerance to drought and salt in Arabidopsis

    OpenAIRE

    Liu, Pei; Xu, Zhao-Shi; Pan-Pan, Lu; Hu, Di; Chen, Ming; Li, Lian-Cheng; Ma, You-Zhi

    2013-01-01

    Phosphoinositides are involved in regulation of recruitment and activity of signalling proteins in cell membranes. Phosphatidylinositol (PI) 4-kinases (PI4Ks) generate PI4-phosphate the precursor of regulatory phosphoinositides. No type II PI4K research on the abiotic stress response has previously been reported in plants. A stress-inducible type II PI4K gene, named TaPI4KIIγ, was obtained by de novo transcriptome sequencing of drought-treated wheat (Triticum aestivum). TaPI4KIIγ, localized o...

  14. OsSFR6 is a functional rice orthologue of SENSITIVE TO FREEZING-6 and can act as a regulator of COR gene expression, osmotic stress and freezing tolerance in Arabidopsis.

    OpenAIRE

    Wathugala, D.L.; Richards, S.A.; Knight, H; Knight, M.R.

    2011-01-01

    The Arabidopsis protein SENSITIVE TO FREEZING-6 (AtSFR6) is required for cold- and drought-inducible expression of COLD-ON REGULATED (COR) genes and, as a consequence, AtSFR6 is essential for osmotic stress and freezing tolerance in Arabidopsis. Therefore, orthologues of AtSFR6 in crop species represent important candidate targets for future manipulation of stress tolerance. We identified and cloned a homologue of AtSFR6 from rice (Oryza sativa), OsSFR6, and confirmed its orthology in Arabido...

  15. Low-P tolerance mechanisms and differential gene expression in contrasting wheat genotypes Mecanismos de tolerância à deficiência de fósforo e expressão diferenciada de genes em genótipos de trigo contrastantes

    Directory of Open Access Journals (Sweden)

    Laize Fraga Espindula

    2009-09-01

    Full Text Available The objectives of this study were to determine low-P tolerance mechanisms in contrasting wheat genotypes and to evaluate the association of these mechanisms to differential gene expression. Wheat seedlings of cultivars Toropi (tolerant to low-P availability and Anahuac (sensitive were evaluated. Seedlings were hydroponically grown in the absence or presence of P (1.0 mmol L-1 during three different time periods: 24, 120 and 240 hours. Free phosphate (Pi and total P contents were measured in shoots and roots. The experiment's design was in randomized blocks with three replicates, each formed by ten plants. The relative expression of genes encoding the malate transporter TaALMT1 and the transcription factor PTF1 was evaluated. Phosphorus starvation beyond ten days increased the expression of TaALMT1 only in 'Toropi'. PTF1's expression was early induced in both genotypes under P starvation, but remained significant after ten days only in 'Toropi'. Shoot Pi concentration in 'Toropi' was independent from P availability; under starvation, 'Toropi' favored the maintenance of shoot Pi concentration. The low-P tolerance of Toropi cultivar at initial growth stages is mainly due to its ability to maintain constant the Pi shoot level.Os objetivos deste estudo foram determinar os mecanismos da tolerância à deficiência de P em genótipos de trigo contrastantes e avaliar a associação desses mecanismos à expressão diferenciada de genes. Foram avaliadas plântulas das cultivares de trigo Toropi (tolerante à deficiência de P e Anahuac (sensível. As plântulas foram cultivadas em hidroponia, na ausência ou presença (1,0 mmol L-1 de P, durante três períodos de tempo: 24, 120 e 240 horas. Os teores de fosfato livre (Pi e P total foram medidos na parte aérea e nas raízes. O delineamento experimental foi em blocos ao acaso com três repetições, cada uma formada por dez plantas. Foi avaliada a expressão relativa dos genes que codificam o

  16. Crescimento em vasos, de cultivares de soja e de trigo em função da saturação de alumínio Tolerance of soybean and wheat varieties in sub-soil high in exchangeable aluminum

    Directory of Open Access Journals (Sweden)

    H.A.A. Mascarenhas

    1995-08-01

    parameter measured (height of the plant, number of nodes, lenght of internodes, number of trifoliate leaves, dry matter weights of shoots and roots there were no significant differences within each variety for the concentration of aluminum saturation, showing that the three varieties were tolerant to Al. These results were confirmed with two wheat varieties BH-1146 (tolerant to Al and Siete Cerros (susceptible which were sown in the same pots. The variety BH-1146 did no show root lenght differences for the Al saturation treaments confirming its tolerance. On the other hand the cultivar Siete Cerros showed increase hi root lenght as the Al saturation was reduced, showing its suscebility.

  17. Mechanism analysis of acid tolerance response of bifidobacterium longum subsp. longum BBMN 68 by gene expression profile using RNA-sequencing.

    Directory of Open Access Journals (Sweden)

    Junhua Jin

    Full Text Available To analyze the mechanism of the acid tolerance response (ATR in Bifidobacterium longum subsp. longum BBMN68, we optimized the acid-adaptation condition to stimulate ATR effectively and analyzed the change of gene expression profile after acid-adaptation using high-throughput RNA-Seq. After acid-adaptation at pH 4.5 for 2 hours, the survival rate of BBMN68 at lethal pH 3.5 for 120 min was increased by 70 fold and the expression of 293 genes were upregulated by more than 2 fold, and 245 genes were downregulated by more than 2 fold. Gene expression profiling of ATR in BBMN68 suggested that, when the bacteria faced acid stress, the cells strengthened the integrity of cell wall and changed the permeability of membrane to keep the H(+ from entering. Once the H(+ entered the cytoplasm, the cells showed four main responses: First, the F(0F(1-ATPase system was initiated to discharge H(+. Second, the ability to produce NH(3 by cysteine-cystathionine-cycle was strengthened to neutralize excess H(+. Third, the cells started NER-UVR and NER-VSR systems to minimize the damage to DNA and upregulated HtpX, IbpA, and γ-glutamylcysteine production to protect proteins against damage. Fourth, the cells initiated global response signals ((pppGpp, polyP, and Sec-SRP to bring the whole cell into a state of response to the stress. The cells also secreted the quorum sensing signal (AI-2 to communicate between intraspecies cells by the cellular signal system, such as two-component systems, to improve the overall survival rate. Besides, the cells varied the pathways of producing energy by shifting to BCAA metabolism and enhanced the ability to utilize sugar to supply sufficient energy for the operation of the mechanism mentioned above. Based on these reults, it was inferred that, during industrial applications, the acid resistance of bifidobacteria could be improved by adding BCAA, γ-glutamylcysteine, cysteine, and cystathionine into the acid-stress environment.

  18. Improvement of copper tolerance of Arabidopsis by transgenic expression of an allene oxide cyclase gene, GhAOC1, in upland cotton (Gossypium hirsutum L.)

    Institute of Scientific and Technical Information of China (English)

    Yuange Wang; Huaihua Liu; Qingguo Xin

    2015-01-01

    Allene oxide cyclase (AOC, E 5.3.99.6) is an essential enzyme in the jasmonic acid (JA) biosynthetic pathway and mediates a wide range of adaptive responses. In this report, five AOC genes (GhAOC1–GhAOC5) were cloned from upland cotton (Gossypium hirsutum L.), sequenced, and characterized. Real-time PCR analysis indicated that the transcripts of GhAOCs were abundantly expressed in roots and less in fibers, and regulated in cotton plants under methyl jasmonate (MeJA) and CuCl2 stresses. To investigate the role of GhAOC under copper stress, transgenic Arabidopsis plants overexpressing cotton GhAOC1 under control of the Cauliflower mosaic virus 35S (CaMV 35S) promoter were generated. Compared to untransformed plants, GhAOC1-overexpressing Arabidopsis thaliana plants exhibited markedly higher survival rate, shoot fresh weight, shoot dry weight, and photosynthetic efficiency, and reduced cell membrane damage and lipid peroxidation under copper stress. This study provides the first evidence that GhAOC1 plays an important role in copper stress tolerance.

  19. Improvement of copper tolerance of Arabidopsis by transgenic expression of an allene oxide cyclase gene, GhAOC1, in upland cotton (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Yuange Wang

    2015-08-01

    Full Text Available Allene oxide cyclase (AOC, E 5.3.99.6 is an essential enzyme in the jasmonic acid (JA biosynthetic pathway and mediates a wide range of adaptive responses. In this report, five AOC genes (GhAOC1–GhAOC5 were cloned from upland cotton (Gossypium hirsutum L., sequenced, and characterized. Real-time PCR analysis indicated that the transcripts of GhAOCs were abundantly expressed in roots and less in fibers, and regulated in cotton plants under methyl jasmonate (MeJA and CuCl2 stresses. To investigate the role of GhAOC under copper stress, transgenic Arabidopsis plants overexpressing cotton GhAOC1 under control of the Cauliflower mosaic virus 35S (CaMV 35S promoter were generated. Compared to untransformed plants, GhAOC1-overexpressing Arabidopsis thaliana plants exhibited markedly higher survival rate, shoot fresh weight, shoot dry weight, and photosynthetic efficiency, and reduced cell membrane damage and lipid peroxidation under copper stress. This study provides the first evidence that GhAOC1 plays an important role in copper stress tolerance.

  20. RcLEA, a late embryogenesis abundant protein gene isolated from Rosa chinensis, confers tolerance to Escherichia coli and Arabidopsis thaliana and stabilizes enzyme activity under diverse stresses.

    Science.gov (United States)

    Zhang, Xuan; Lu, Songchong; Jiang, Changhua; Wang, Yaofeng; Lv, Bo; Shen, Jiabin; Ming, Feng

    2014-07-01

    The late embryogenesis abundant (LEA) protein family is a large protein family that is closely associated with resistance to abiotic stresses in many organisms, such as plants, bacteria and animals. In this study, we isolated a LEA gene, RcLEA, which was cytoplasm-localized, from Rosa chinensis. RcLEA was found to be induced by high temperature through RT-PCR. Overexpression of RcLEA in Escherichia coli improved its growth performance compared with the control under high temperature, low temperature, NaCl and oxidative stress conditions. RcLEA was also overexpressed in Arabidopsis thaliana. The transgenic Arabidopsis showed better growth after high and low temperature treatment and exhibited less peroxide according to 3, 3-diaminobenzidine staining. However, RcLEA did not improve the tolerance to NaCl or osmotic stress in Arabidopsis. In vitro analysis showed that RcLEA was able to prevent the freeze-thaw-induced inactivation or heat-induced aggregation of various substrates, such as lactate dehydrogenase and citrate synthase. It also protected the proteome of E. coli from denaturation when the proteins were heat-shocked or subjected to acidic conditions. Furthermore, bimolecular fluorescence complementation assays suggested that RcLEA proteins function in a complex manner by making the form of homodimers. PMID:24760474

  1. Overexpression of an Apocynum venetum DEAD-Box Helicase Gene (AvDH1) in Cotton Confers Salinity Tolerance and Increases Yield in a Saline Field

    Science.gov (United States)

    Chen, Jie; Wan, Sibao; Liu, Huaihua; Fan, Shuli; Zhang, Yujuan; Wang, Wei; Xia, Minxuan; Yuan, Rui; Deng, Fenni; Shen, Fafu

    2016-01-01

    Soil salinity is a major environmental stress limiting plant growth and productivity. We have reported previously the isolation of an Apocynum venetum DEAD-box helicase 1 (AvDH1) that is expressed in response to salt exposure. Here, we report that the overexpression of AvDH1 driven by a constitutive cauliflower mosaic virus-35S promoter in cotton plants confers salinity tolerance. Southern and Northern blotting analyses showed that the AvDH1 gene was integrated into the cotton genome and expressed. In this study, the growth of transgenic cotton expressing AvDH1 was evaluated under saline conditions in a growth chamber and in a saline field trial. Transgenic cotton overexpressing AvDH1 was much more resistant to salt than the wild-type plants when grown in a growth chamber. The lower membrane ion leakage, along with increased activity of superoxide dismutase, in AvDH1 transgenic lines suggested that these characteristics may prevent membrane damage, which increases plant survival rates. In a saline field, the transgenic cotton lines expressing AvDH1 showed increased boll numbers, boll weights and seed cotton yields compared with wild-type plants, especially at high soil salinity levels. This study indicates that transgenic cotton expressing AvDH1 is a promising option for increasing crop productivity in saline fields. PMID:26779246

  2. Aluminum powder metallurgy processing

    Energy Technology Data Exchange (ETDEWEB)

    Flumerfelt, J.F.

    1999-02-12

    The objective of this dissertation is to explore the hypothesis that there is a strong linkage between gas atomization processing conditions, as-atomized aluminum powder characteristics, and the consolidation methodology required to make components from aluminum powder. The hypothesis was tested with pure aluminum powders produced by commercial air atomization, commercial inert gas atomization, and gas atomization reaction synthesis (GARS). A comparison of the GARS aluminum powders with the commercial aluminum powders showed the former to exhibit superior powder characteristics. The powders were compared in terms of size and shape, bulk chemistry, surface oxide chemistry and structure, and oxide film thickness. Minimum explosive concentration measurements assessed the dependence of explosibility hazard on surface area, oxide film thickness, and gas atomization processing conditions. The GARS aluminum powders were exposed to different relative humidity levels, demonstrating the effect of atmospheric conditions on post-atomization processing conditions. The GARS aluminum powders were exposed to different relative humidity levels, demonstrating the effect of atmospheric conditions on post-atomization oxidation of aluminum powder. An Al-Ti-Y GARS alloy exposed in ambient air at different temperatures revealed the effect of reactive alloy elements on post-atomization powder oxidation. The pure aluminum powders were consolidated by two different routes, a conventional consolidation process for fabricating aerospace components with aluminum powder and a proposed alternative. The consolidation procedures were compared by evaluating the consolidated microstructures and the corresponding mechanical properties. A low temperature solid state sintering experiment demonstrated that tap densified GARS aluminum powders can form sintering necks between contacting powder particles, unlike the total resistance to sintering of commercial air atomization aluminum powder.

  3. Is the Aluminum Hypothesis Dead?

    OpenAIRE

    Lidsky, Theodore I.

    2014-01-01

    The Aluminum Hypothesis, the idea that aluminum exposure is involved in the etiology of Alzheimer disease, dates back to a 1965 demonstration that aluminum causes neurofibrillary tangles in the brains of rabbits. Initially the focus of intensive research, the Aluminum Hypothesis has gradually been abandoned by most researchers. Yet, despite this current indifference, the Aluminum Hypothesis continues to attract the attention of a small group of scientists and aluminum continues to be viewed w...

  4. Transcriptome responses to aluminum stress in roots of aspen (Populus tremula

    Directory of Open Access Journals (Sweden)

    Grisel Nadine

    2010-08-01

    Full Text Available Abstract Background Ionic aluminum (mainly Al3+ is rhizotoxic and can be present in acid soils at concentrations high enough to inhibit root growth. Many forest tree species grow naturally in acid soils and often tolerate high concentrations of Al. Previously, we have shown that aspen (Populus tremula releases citrate and oxalate from roots in response to Al exposure. To obtain further insights into the root responses of aspen to Al, we investigated root gene expression at Al conditions that inhibit root growth. Results Treatment of the aspen roots with 500 μM Al induced a strong inhibition of root growth within 6 h of exposure time. The root growth subsequently recovered, reaching growth rates comparable to that of control plants. Changes in gene expression were determined after 6 h, 2 d, and 10 d of Al exposure. Replicated transcriptome analyses using the Affymetrix poplar genome array revealed a total of 175 significantly up-regulated and 69 down-regulated genes, of which 70% could be annotated based on Arabidopsis genome resources. Between 6 h and 2 d, the number of responsive genes strongly decreased from 202 to 26, and then the number of changes remained low. The responses after 6 h were characterized by genes involved in cell wall modification, ion transport, and oxidative stress. Two genes with prolonged induction were closely related to the Arabidopsis Al tolerance genes ALS3 (for Al sensitive 3 and MATE (for multidrug and toxin efflux protein, mediating citrate efflux. Patterns of expression in different plant organs and in response to Al indicated that the two aspen genes are homologs of the Arabidopsis ALS3 and MATE. Conclusion Exposure of aspen roots to Al results in a rapid inhibition of root growth and a large change in root gene expression. The subsequent root growth recovery and the concomitant reduction in the number of responsive genes presumably reflect the success of the roots in activating Al tolerance mechanisms. The

  5. Anodizing Aluminum with Frills.

    Science.gov (United States)

    Doeltz, Anne E.; And Others

    1983-01-01

    "Anodizing Aluminum" (previously reported in this journal) describes a vivid/relevant laboratory experience for general chemistry students explaining the anodizing of aluminum in sulfuric acid and constrasting it to electroplating. Additions to this procedure and the experiment in which they are used are discussed. Reactions involved are also…

  6. The aluminum smelting process.

    Science.gov (United States)

    Kvande, Halvor

    2014-05-01

    This introduction to the industrial primary aluminum production process presents a short description of the electrolytic reduction technology, the history of aluminum, and the importance of this metal and its production process to modern society. Aluminum's special qualities have enabled advances in technologies coupled with energy and cost savings. Aircraft capabilities have been greatly enhanced, and increases in size and capacity are made possible by advances in aluminum technology. The metal's flexibility for shaping and extruding has led to architectural advances in energy-saving building construction. The high strength-to-weight ratio has meant a substantial reduction in energy consumption for trucks and other vehicles. The aluminum industry is therefore a pivotal one for ecological sustainability and strategic for technological development. PMID:24806722

  7. Introduction of the anti-apoptotic baculovirus p35 gene in passion fruit induces herbicide tolerance, reduced bacterial lesions, but does not inhibits passion fruit woodiness disease progress induced by cowpea aphid-borne mosaic virus (CABMV).

    Science.gov (United States)

    de Freitas, Daniele Scandiucci; Coelho, Marly C Felipe; Souza, Manoel T; Marques, Abi; Ribeiro, E Bergmann Morais

    2007-01-01

    The introduction of anti-apoptotic genes into plants leads to resistance to environmental stress and broad-spectrum disease resistance. The anti-apoptotic gene (p35) from a baculovirus was introduced into the genome of passion fruit plants by biobalistics. Eleven regenerated plants showed the presence of the p35 gene by PCR and/or dot blot hybridization. Transcriptional analysis of regenerated plants showed the presence of specific p35 transcripts in 9 of them. Regenerated plants containing the p35 gene were inoculated with the cowpea aphid-borne mosaic virus (CABMV), the bacterium Xanthomonas axonopodis pv passiflorae, and the herbicide, glufosinate, (Syngenta). None of the plants showed resistance to CABMV. Regenerated plants (p35+) showed less than half of local lesions showed by non-transgenic plants when inoculated with X. axonopodis and some p35+ plants showed increased tolerance to the glufosinate herbicide when compared to non-transgenic plants. PMID:17016672

  8. Melhoramento do trigo: XXVI. Avaliação de linhagens com tolerância à toxicidade de alumínio, manganês e ferro em soluções nutritivas Wheat breeding: XXVI. Evaluation of inbred lines with tolerance to aluminum, manganese and iron toxicities in nutrient solutions

    OpenAIRE

    Carlos Eduardo de Oliveira Camargo; Laércio Soares Rocha Júnior; Antonio Wilson Penteado Ferreira Filho

    1991-01-01

    Efetuaram-se cruzamentos entre o cultivar BH-1146, de porte alto, tolerante à toxicidade de alumínio e sensível à toxicidade de ferro e manganês, e o cultivar Siete Cerros, de porte semi-anão, sensível à toxicidade de alumínio, porém com tolerância à toxicidade de ferro e manganês. Selecionaram-se plântulas desse cruzamento, em geração F2, quanto à tolerância ao alumínio (10mg/litro), empregando-se soluções nutritivas, e plantaram-nas em vasos no telado contra o ataque de pássaros. A partir d...

  9. Melhoramento do trigo: VI. hereditariedade da tolerância a três concentrações de alumínio em solução nutritiva Wheat breeding: VI. inheritance of tolerance to three different aluminum concentrations in nutrient solution

    OpenAIRE

    Carlos Eduardo de Oliveira Camargo

    1984-01-01

    No estudo dos cultivares de trigo C-3, BH-1146, Siete Cerros e Brevor em soluções nutritivas contendo oito concentrações de alumínio (0, 1, 2, 3, 4, 5, 6 e 10mg/litro), BH-1146 e C-3 mostraram tolerância a todas as concentrações de Al empregadas, e Brevor e Siete Cerros apresentaram-se sensíveis à presença de 1mg/litro de Al3+ nas soluções. A tolerância a dada concentração de alumínio foi medida pela capacidade de crescimento da raiz primária central da planta em solução nutritiva completa, a...

  10. De novo transcriptome assembly of a Chinese locoweed (Oxytropis ochrocephala species provides insights into genes associated with drought, salinity and cold tolerance

    Directory of Open Access Journals (Sweden)

    Wei eHe

    2015-12-01

    Full Text Available Background: Locoweeds (toxic Oxytropis and Astraglus species, containing the toxic agent swainsonine, pose serious threats to animal husbandry on grasslands in both China and the US. Some locoweeds have evolved adaptations in order to resist various stress conditions such as drought, salt and cold. As a result they replace other plants in their communities and become an ecological problem. Currently very limited genetic information of locoweeds is available and this hinders our understanding in the molecular basis of their environmental plasticity, and the interaction between locoweeds and their symbiotic swainsonine producing endophytes. Next-generation sequencing provides a means of obtaining transcriptomic sequences in a timely manner, which is particularly useful for non-model plants. In this study, we performed transcriptome sequencing of Oxytropis ochrocephala plants followed by a de nove assembly. Our primary aim was to provide an enriched pool of genetic sequences of an Oxytropis sp. for further locoweed research. Results: Transcriptomes of four different O. ochrocephala samples, from control (CK plants, and those that had experienced either drought (20% PEG, salt (150 mM NaCl or cold (4 °C stress were sequenced using an Illumina Hiseq 2000 platform. From 232,209,506 clean reads 23,220,950,600 (~23 G nucleotides, 182,430 transcripts and 88,942 unigenes were retrieved, with an N50 value of 1,237. Differential expression analysis revealed putative genes encoding heat shock proteins (HSPs and late embryogenesis abundant (LEA proteins, enzymes in secondary metabolite and plant hormone biosyntheses, and transcription factors which are involved in stress tolerance in O. ochrocephala. In order to validate our sequencing results, we further analyzed the expression profiles of nine genes by quantitative real-time PCR. Finally, we discuss the possible mechanism of O. ochrocephala’s adaptations to stress environment. Conclusion: Our

  11. Burning characteristics of individual aluminum/aluminum oxide particles

    OpenAIRE

    Ruttenberg, Eric C.

    1996-01-01

    Approved for public release; distribution is unlimited An experimental investigation was conducted in which the burning characteristics of individual aluminum/aluminum oxide particles were measured using a windowed combustion bomb at atmospheric pressure and under gravity-fall conditions. A scanning electron microscope (SEM) was used to measure the size distribution of the initial aluminum particles and the aluminum oxide residue. Analysis of the residue indicated that the mass of aluminum...

  12. Purifying Aluminum by Vacuum Distillation

    Science.gov (United States)

    Du Fresne, E. R.

    1985-01-01

    Proposed method for purifying aluminum employs one-step vacuum distillation. Raw material for process impure aluminum produced in electrolysis of aluminum ore. Impure metal melted in vacuum. Since aluminum has much higher vapor pressure than other constituents, boils off and condenses on nearby cold surfaces in proportions much greater than those of other constituents.

  13. Genome-wide gene expression profiling and a forward genetic screen show that differential expression of the sodium ion transporter Ena21 contributes to the differential tolerance of Candida albicans and Candida dubliniensis to osmotic stress.

    LENUS (Irish Health Repository)

    Enjalbert, Brice

    2009-04-01

    Candida albicans is more pathogenic than Candida dubliniensis. However, this disparity in virulence is surprising given the high level of sequence conservation and the wide range of phenotypic traits shared by these two species. Increased sensitivity to environmental stresses has been suggested to be a possible contributory factor to the lower virulence of C. dubliniensis. In this study, we investigated, in the first comparison of C. albicans and C. dubliniensis by transcriptional profiling, global gene expression in each species when grown under conditions in which the two species exhibit differential stress tolerance. The profiles revealed similar core responses to stresses in both species, but differences in the amplitude of the general transcriptional responses to thermal, salt and oxidative stress. Differences in the regulation of specific stress genes were observed between the two species. In particular, ENA21, encoding a sodium ion transporter, was strongly induced in C. albicans but not in C. dubliniensis. In addition, ENA21 was identified in a forward genetic screen for C. albicans genomic sequences that increase salt tolerance in C. dubliniensis. Introduction of a single copy of CaENA21 was subsequently shown to be sufficient to confer salt tolerance upon C. dubliniensis.

  14. SRK2C, a SNF1-related protein kinase 2, improves drought tolerance by controlling stress-responsive gene expression in Arabidopsis thaliana

    OpenAIRE

    Umezawa, Taishi; Yoshida, Riichiro; Maruyama, Kyonoshin; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2004-01-01

    Protein phosphorylation/dephosphorylation are major signaling events induced by osmotic stress in higher plants. Here, we showed that a SNF1-related protein kinase 2 (SnRK2), SRK2C, is an osmotic-stress-activated protein kinase in Arabidopsis thaliana that can significantly impact drought tolerance of Arabidopsis plants. Knockout mutants of SRK2C exhibited drought hypersensitivity in their roots, suggesting that SRK2C is a positive regulator of drought tolerance in Arabidopsis roots. Addition...

  15. Development of highly glyphosate-tolerant tobacco by coexpression of glyphosate acetyltransferase gat and EPSPS G2-aroA genes

    OpenAIRE

    Baoqing Dun; Xujing Wang; Wei Lu; Ming Chen; Wei Zhang; Shuzhen Ping; Zhixing Wang; Baoming Zhang; Min Lin

    2014-01-01

    The widely used herbicide glyphosate targets 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Glyphosate acetyltransferase (GAT) effectively detoxifies glyphosate by N-acetylation. With the aim of identifying a new strategy for development of glyphosate-tolerant crops, the plant expression vector pG2-GAT harboring gat and G2-aroA (encoding EPSPS) has been transformed into tobacco (Nicotiana tabacum) to develop novel plants with higher tolerance to glyphosate. Results from Southern and Wes...

  16. Drought Tolerance in Wheat

    Directory of Open Access Journals (Sweden)

    Arash Nezhadahmadi

    2013-01-01

    Full Text Available Drought is one of the most important phenomena which limit crops’ production and yield. Crops demonstrate various morphological, physiological, biochemical, and molecular responses to tackle drought stress. Plants’ vegetative and reproductive stages are intensively influenced by drought stress. Drought tolerance is a complicated trait which is controlled by polygenes and their expressions are influenced by various environmental elements. This means that breeding for this trait is so difficult and new molecular methods such as molecular markers, quantitative trait loci (QTL mapping strategies, and expression patterns of genes should be applied to produce drought tolerant genotypes. In wheat, there are several genes which are responsible for drought stress tolerance and produce different types of enzymes and proteins for instance, late embryogenesis abundant (lea, responsive to abscisic acid (Rab, rubisco, helicase, proline, glutathione-S-transferase (GST, and carbohydrates during drought stress. This review paper has concentrated on the study of water limitation and its effects on morphological, physiological, biochemical, and molecular responses of wheat with the possible losses caused by drought stress.

  17. Drought tolerance in wheat.

    Science.gov (United States)

    Nezhadahmadi, Arash; Prodhan, Zakaria Hossain; Faruq, Golam

    2013-01-01

    Drought is one of the most important phenomena which limit crops' production and yield. Crops demonstrate various morphological, physiological, biochemical, and molecular responses to tackle drought stress. Plants' vegetative and reproductive stages are intensively influenced by drought stress. Drought tolerance is a complicated trait which is controlled by polygenes and their expressions are influenced by various environmental elements. This means that breeding for this trait is so difficult and new molecular methods such as molecular markers, quantitative trait loci (QTL) mapping strategies, and expression patterns of genes should be applied to produce drought tolerant genotypes. In wheat, there are several genes which are responsible for drought stress tolerance and produce different types of enzymes and proteins for instance, late embryogenesis abundant (lea), responsive to abscisic acid (Rab), rubisco, helicase, proline, glutathione-S-transferase (GST), and carbohydrates during drought stress. This review paper has concentrated on the study of water limitation and its effects on morphological, physiological, biochemical, and molecular responses of wheat with the possible losses caused by drought stress. PMID:24319376

  18. Corrosion Inhibitors for Aluminum.

    Science.gov (United States)

    Muller, Bodo

    1995-01-01

    Describes a simple and reliable test method used to investigate the corrosion-inhibiting effects of various chelating agents on aluminum pigments in aqueous alkaline media. The experiments that are presented require no complicated or expensive electronic equipment. (DDR)

  19. Advances in aluminum anodizing

    Science.gov (United States)

    Dale, K. H.

    1969-01-01

    White anodize is applied to aluminum alloy surfaces by specific surface preparation, anodizing, pigmentation, and sealing techniques. The development techniques resulted in alloys, which are used in space vehicles, with good reflectance values and excellent corrosive resistance.

  20. TabHLH1, a bHLH-type transcription factor gene in wheat, improves plant tolerance to Pi and N deprivation via regulation of nutrient transporter gene transcription and ROS homeostasis.

    Science.gov (United States)

    Yang, Tongren; Hao, Lin; Yao, Sufei; Zhao, Yuanyuan; Lu, Wenjing; Xiao, Kai

    2016-07-01

    Basic helix-loop-helix (bHLH) transcription factors (TFs) comprise a large TF family and act as crucial regulators in various biological processes in plants. Here, we report the functional characterization of TabHLH1, a bHLH TF member in wheat (Triticum aestivum). TabHLH1 shares conserved bHLH domain and targets to nucleus with transactivation activity. Upon Pi and N deprivation, the expression of TabHLH1 was up-regulated in roots and leaves, showing a pattern to be gradually increased within 23-h treatment regimes. The lines with overexpression of TabHLH1 exhibited drastically improved tolerance to Pi and N deprivation, showing larger plant phenotype, more biomass, higher concentration and more accumulation of P and N than wild type (WT) upon the Pi- and N-starvation stresses. NtPT1 and NtNRT2.2, the genes encoding phosphate transporter (PT) and nitrate transporter (NRT) in tobacco, respectively, showed up-regulated expression in TabHLH1-overexpressing plants; knockdown expression of them led to deteriorated growth feature, lowered biomass, and decreased nutrient accumulation of plants under Pi- and N-deficient conditions. Compared with WT, the TabHLH1-overexpressing plants also showed lowered reactive oxygen species (ROS) accumulation and improved antioxidant enzyme (AE) activities, such as those of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). NtSOD1, NtCAT1, and NtPOD1;6 that encode SOD, CAT, and POD, respectively, were up-regulated in TabHLH1-overexpressing plants. Further knockdown of these AE gene expression caused reduced antioxidant enzymatic activities, indicative of their crucial roles in mediating cellular ROS homeostasis in Pi- and N-starvation conditions. Together, TabHLH1 plays an important role in mediating adaptation to the Pi- and N-starvation stresses through transcriptional regulation of a set of genes encoding PT, NRT and AEs that mediate the taken up of Pi and N and the cellular homeostasis of ROS initiated by the nutrient

  1. Melhoramento do trigo: XXX. Avaliação de linhagens com tolerância a toxicidade de alumínio, manganês e ferro em condições de campo Wheat breeding: XXX. Evaluation of inbred lines tolerant to aluminum, manganese and iron toxicities under field conditions

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1995-01-01

    Full Text Available Compararam-se 23 linhagens tolerantes, ao mesmo tempo, à toxicidade de Al3+ Mn2+ e Fe2+, provindas do cruzamento entre 'BH-1146' (tolerante à toxicidade de A1(3+ e sensível à de Mn2+ e Fe2+ e 'Siete Cerros' (sensível à toxicidade de A1(3+ e tolerante à de Mn2+ e Fe2+ e os dois cultivares utilizados como pais em quatro ensaios instalados nas Estações Experimentais de Itararé (1990-92 e de Capão Bonito (1992, em solos ácidos, e em cinco ensaios realizados no Centro Experimental de Campinas (1990-92 e na Fazenda Santa Lúcia (1990-91, município de Cruzália, em solos corrigidos, analisando os seguintes parâmetros: rendimento de grãos, características agronômicas e resistência às doenças. Em solos ácidos, vinte linhagens e o 'BH-1146' mostraram maior rendimento de grãos em relação ao 'Siete Cerros' indicando que a toxicidade de alumínio foi um dos principais fatores limitantes à produção. Em solos corrigidos, não se verificaram diferenças significativas entre os genótipos estudados quanto ao rendimento de grãos, mostrando não haver urna associação entre baixa produtividade e tolerância ao A1(3+ nessas condições. A linhagem 21 foi moderadamente resistente ao agente causal de oídio em condições naturais de infecção. Todos os genótipos avaliados revelaram suscetibilidade aos agentes causais das manchas foliares. O 'Siete Cerros' e as linhagens 3 a 12 apresentaram porte baixo associado à menor porcentagem de acamamento; as 13, 14 e 23 mostraram espigas compridas; a 12, maior número de espiguetas e grãos por espiga, e a 17, grãos mais pesados, representando fontes genéticas de valor para essas características.Twenty three inbred lines showing at the same time tolerance to A1(3+, Mn2+ and Fe2+ toxicities, originated from the cross between 'BH-1146' (tolerant to Al3+ toxicity and sensitive to Mn2+ and Fe2+ toxicities and 'Siete Cerros' (sensitive to Al3+ and tolerant to Mn2+ and Fe2+ toxicities, and the two

  2. Salt Tolerance

    OpenAIRE

    Xiong, Liming; Zhu, Jian-Kang

    2002-01-01

    Studying salt stress is an important means to the understanding of plant ion homeostasis and osmo-balance. Salt stress research also benefits agriculture because soil salinity significantly limits plant productivity on agricultural lands. Decades of physiological and molecular studies have generated a large body of literature regarding potential salt tolerance determinants. Recent advances in applying molecular genetic analysis and genomics tools in the model plant Arabidopsis thaliana are sh...

  3. OsSFR6 is a functional rice orthologue of SENSITIVE TO FREEZING-6 and can act as a regulator of COR gene expression, osmotic stress and freezing tolerance in Arabidopsis.

    Science.gov (United States)

    Wathugala, Deepthi L; Richards, Shane A; Knight, Heather; Knight, Marc R

    2011-09-01

    The Arabidopsis protein SENSITIVE TO FREEZING-6 (AtSFR6) is required for cold- and drought-inducible expression of COLD-ON REGULATED (COR) genes and, as a consequence, AtSFR6 is essential for osmotic stress and freezing tolerance in Arabidopsis. Therefore, orthologues of AtSFR6 in crop species represent important candidate targets for future manipulation of stress tolerance. We identified and cloned a homologue of AtSFR6 from rice (Oryza sativa), OsSFR6, and confirmed its orthology in Arabidopsis. OsSFR6 was identified by homology searches, and a full-length coding region isolated using reverse transcription polymerase chain reaction (RT-PCR) from Oryza sativa cDNA. To test for orthology, OsSFR6 was expressed in an Arabidopsis sfr6 loss-of-function mutant background, and restoration of wild-type phenotypes was assessed. Searching the rice genome revealed a single homologue of AtSFR6. Cloning and sequencing the OsSFR6 coding region showed OsSFR6 to have 61.7% identity and 71.1% similarity to AtSFR6 at the predicted protein sequence level. Expression of OsSFR6 in the atsfr6 mutant background restored the wild-type visible phenotype, as well as restoring wild-type levels of COR gene expression and tolerance of osmotic and freezing stresses. OsSFR6 is an orthologue of AtSFR6, and thus a target for future manipulation to improve tolerance to osmotic and other abiotic stresses. PMID:21585388

  4. Fabrication of aluminum foam from aluminum scrap Hamza

    OpenAIRE

    O. A. Osman1 ,; Mining and Petroleum Engineering, Faculty of Engineering- Qena, Al_Azhar University, Egypt

    2015-01-01

    In this study the optimum parameters affecting the preparation of aluminum foam from recycled aluminum were studied, these parameters are: temperature, CaCO3 to aluminum scrap wt. ratio as foaming agent, Al2O3 to aluminum scrap wt. ratio as thickening agent, and stirring time. The results show that, the optimum parameters are the temperature ranged from 800 to 850oC, CaCO3 to aluminum scrap wt. ratio was 5%, Al2O3 to aluminum scrap wt. ratio was 3% and stirring time was 45 second ...

  5. Efeito de diferentes concentrações de sais em solução nutritiva na tolerância de cultivares de trigo à toxicidade de alumínio Influence of salt concentrations in nutrient solution on tolerance to aluminum toxicity in wheat cultivars

    OpenAIRE

    Carlos Eduardo de Oliveira Camargo; Otávio Franco de Oliveira; Arquimedes Lavorenti

    1981-01-01

    Foram estudados dez cultivares de trigo em soluções nutritivas contendo três diferentes níveis de alumínio tóxico combinados com quatro diferentes concentrações salinas. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após permanência de 46 horas em solução contendo determinadas concentrações de sais e de alumínio. Os cultivares Siete Cerros, Tobari-66 e INIA-66 foram os mais sensíveis, IAC-15 moderadamente sensível, Alondra S-46 e...

  6. Trigo: efeito de magnésio combinado com forças iônicas em solução nutritiva na tolerância ao alumínio Aluminum tolerance of wheat cultivars as related to magnesium levels combined with salt concentrations in nutrient solutions

    OpenAIRE

    Carlos Eduardo de Oliveira Camargo

    1987-01-01

    Os cultivares BH-1146, IAC-17 e Siete Cerros foram estudados em soluções nutritivas contendo 10 mg/litro de Al3+, combinados com três concentrações de sais (um décimo, um quinto e a metade da concentração de sais da solução nutritiva completa) e cinco níveis de Mg (0; 9,6; 48; 96 e 192 mg/litro). A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em soluções sem alumínio após permanência de 24, 48 e 72 horas em soluções de tratamento contendo determinada forç...

  7. A concentração de fósforo na tolerância de cultivares de trigo à toxicidade de alumínio em soluções nutritivas Effect of phosphorus in nutrient solution on the tolerance to aluminum toxicity in wheat cultivars

    OpenAIRE

    Carlos Eduardo de Oliveira Camargo

    1985-01-01

    Em dois experimentos empregando soluções nutritivas, foi estudada a tolerância de cultivares de trigo na presença de 5mg/litro de Al3+, medida pela capacidade de as raízes primárias continuarem a crescer em solução nutritiva completa sem alumínio, após permanência de 48 horas em solução contendo alumínio com diferentes concentrações de fósforo, controle do pH e temperatura de 25 ± 1ºC. No primeiro experimento, foram estudados oito cultivares de trigo em soluções nutritivas contendo qua...

  8. A natural mutation-led truncation in one of the two aluminum-activated malate transporter-like genes at the Ma locus is associated with low fruit acidity in apple.

    Science.gov (United States)

    Bai, Yang; Dougherty, Laura; Li, Mingjun; Fazio, Gennaro; Cheng, Lailiang; Xu, Kenong

    2012-08-01

    Acidity levels greatly affect the taste and flavor of fruit, and consequently its market value. In mature apple fruit, malic acid is the predominant organic acid. Several studies have confirmed that the major quantitative trait locus Ma largely controls the variation of fruit acidity levels. The Ma locus has recently been defined in a region of 150 kb that contains 44 predicted genes on chromosome 16 in the Golden Delicious genome. In this study, we identified two aluminum-activated malate transporter-like genes, designated Ma1 and Ma2, as strong candidates of Ma by narrowing down the Ma locus to 65-82 kb containing 12-19 predicted genes depending on the haplotypes. The Ma haplotypes were determined by sequencing two bacterial artificial chromosome clones from G.41 (an apple rootstock of genotype Mama) that cover the two distinct haplotypes at the Ma locus. Gene expression profiling in 18 apple germplasm accessions suggested that Ma1 is the major determinant at the Ma locus controlling fruit acidity as Ma1 is expressed at a much higher level than Ma2 and the Ma1 expression is significantly correlated with fruit titratable acidity (R (2) = 0.4543, P = 0.0021). In the coding sequences of low acidity alleles of Ma1 and Ma2, sequence variations at the amino acid level between Golden Delicious and G.41 were not detected. But the alleles for high acidity vary considerably between the two genotypes. The low acidity allele of Ma1, Ma1-1455A, is mainly characterized by a mutation at base 1455 in the open reading frame. The mutation leads to a premature stop codon that truncates the carboxyl terminus of Ma1-1455A by 84 amino acids compared with Ma1-1455G. A survey of 29 apple germplasm accessions using marker CAPS(1455) that targets the SNP(1455) in Ma1 showed that the CAPS(1455A) allele was associated completely with high pH and highly with low titratable acidity, suggesting that the natural mutation-led truncation is most likely responsible for the abolished function of Ma

  9. Antibiotic tolerance and microbial biofilms

    DEFF Research Database (Denmark)

    Folkesson, Anders

    Increased tolerance to antimicrobial agents is thought to be an important feature of microbes growing in biofilms. We study the dynamics of antibiotic action within hydrodynamic flow chamber biofilms of Escherichia coli and Pseudomonas aeruginosa using isogenic mutants and fluorescent gene...... expression reporters and we address the question of how biofilm organization affects antibiotic susceptibility. The dynamics of microbial killing is monitored by viable count determination, and confocal laser microscopy. Our work shows that the apparent increased antibiotic tolerance is due to the formation...... of antibiotic tolerant subpopulations within the biofilm. The formation of these subpopulations is highly variable and dependent on the antibiotic used, the biofilm structural organization and the induction of specific tolerance mechanisms....

  10. Desempenho de linhagens de trigo, oriundas de hibridações, em duas condições de cultivo do Estado de São Paulo e tolerância de alumínio em laboratório Performance of wheat lines in two tillage conditions os State of São Paulo and their tolerance to aluminum toxicity

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    2008-01-01

    Full Text Available Compararam-se 18 linhagens provenientes de cruzamentos entre genótipos de trigo comum (Triticum aestivum L. e entre genótipos de trigo comum e de trigo duro (T. durum L., e as cultivares-controle IAC-24 e IAC-370 em experimentos instalados em condição de sequeiro e solo ácido de Capão Bonito, e em condição de irrigação por aspersão e solo ácido com aplicação de calcário de Mococa, no período 2003-2005. Analisaram-se produção de grãos, outros componentes da produção, características agronômicas e resistência ao agente causal da ferrugem-da-folha. Estudou-se também a tolerância ao alumínio em soluções nutritivas, no laboratório. As linhagens 9 (IAC-24/Anahuac M - Tol Al e 14 (BH-1146//AA"S"/WIN"S"/3/G.C.W1/SERI destacaram-se quanto à produção de grãos em Mococa e a linhagem 10 (IAC-24/Anahuac M - Tol Al, tolerante à toxicidade de Al3+, em soluções nutritivas, sobressaíu-se quanto à produção de grãos, apresentando as plantas semi-anãs mais altas, em Capão Bonito. Todos os genótipos tiveram porte semi-anão e a cultivar IAC-370 e as linhagens 13 (BH-1146//AA"S"/WIN"S"/3/IAC-287, 14 e 15 F12.71/COC// CMH76.173/CMH 75 A 66/3/Desconhecido exibiram resistência ao acamamento. As linhagens 13 e 14 pela baixa incidência da ferrugem-da-folha mostraram ser boas fontes de resistência a essa doença em programas de melhoramento genético. As linhagens 17, 18, 19 e 20, oriundas do cruzamento interespecífico Maya"S"/SPRW"S"//SAP"S"/3/BUC"S"/4/IAC-225/5/IAC-1003 tiveram espigas compridas associadas aos grãos pesados, a linhagem 3 (IAC-24/Siete Cerros destacaram-se em relação ao número de grãos por espiga e por espigueta e a linhagem 14 pelo número de espiguetas por espiga. As cultivares IAC-24 e BH-1146, e as linhagens 4, 5, 6, 7, 8 e 10, selecionadas a partir do híbrido IAC-24/Anahuac M - Tol Al sobressaíram-se em relação à tolerância, à presença de 10 mg L-1 de Al3+, em soluções nutritivas

  11. Fabrication of aluminum foam from aluminum scrap Hamza

    Directory of Open Access Journals (Sweden)

    O. A. Osman1 ,

    2015-02-01

    Full Text Available In this study the optimum parameters affecting the preparation of aluminum foam from recycled aluminum were studied, these parameters are: temperature, CaCO3 to aluminum scrap wt. ratio as foaming agent, Al2O3 to aluminum scrap wt. ratio as thickening agent, and stirring time. The results show that, the optimum parameters are the temperature ranged from 800 to 850oC, CaCO3 to aluminum scrap wt. ratio was 5%, Al2O3 to aluminum scrap wt. ratio was 3% and stirring time was 45 second with stirring speed 1200 rpm. The produced foam apparent densities ranged from 0.40-0.60 g/cm3. The microstructure of aluminum foam was examined by using SEM, EDX and XRD, the results show that, the aluminum pores were uniformly distributed along the all matrices and the cell walls covered by thin oxide film.

  12. ALUMINUM RECLAMATION BY ACIDIC EXTRACTION OF ALUMINUM-ANODIZING SLUDGES

    Science.gov (United States)

    Extraction of aluminum-anodizing sludges with sulfuric acid was examined to determine the potential for production of commercial-strength solutions of aluminum sulfate, that is liquid alum. The research established kinetic and stoichiometric relationships and evaluates product qu...

  13. Evidence for an association between the Leu162Val polymorphism of the PPARalpha gene and decreased fasting serum triglyceride levels in glucose tolerant subjects

    DEFF Research Database (Denmark)

    Nielsen, Eva-Maria D; Hansen, Lars; Echwald, Søren Morgenthaler;

    2003-01-01

    The aim of the study was to investigate whether genetic variation in the peroxisome proliferator-activated receptor-alpha (PPARalpha) is associated with type 2 diabetes and altered lipid or carbohydrate metabolism in glucose tolerant subjects. Mutation analyses of PPARalpha were performed in 56 t...

  14. A common polymorphism in the promoter of the IGF-I gene associates with increased fasting serum triglyceride levels in glucose-tolerant subjects

    DEFF Research Database (Denmark)

    Nielsen, Eva-Maria D; Hansen, Lars; Lajer, Maria;

    2004-01-01

    The aim of the present study was to examine if absence of a common allele in a microsatellite polymorphism in the insulin-like growth factor I (IGF-I) promoter was associated with type 2 diabetes and alterations in quantitative traits in glucose-tolerant subjects....

  15. Tonoplast- and plasma membrane-localized aquaporin-family transporters in blue hydrangea sepals of aluminum hyperaccumulating plant.

    Directory of Open Access Journals (Sweden)

    Takashi Negishi

    Full Text Available Hydrangea (Hydrangea macrophylla is tolerant of acidic soils in which toxicity generally arises from the presence of the soluble aluminum (Al ion. When hydrangea is cultivated in acidic soil, its resulting blue sepal color is caused by the Al complex formation of anthocyanin. The concentration of vacuolar Al in blue sepal cells can reach levels in excess of approximately 15 mM, suggesting the existence of an Al-transport and/or storage system. However, until now, no Al transporter has been identified in Al hyperaccumulating plants, animals or microorganisms. To identify the transporter being responsible for Al hyperaccumulation, we prepared a cDNA library from blue sepals according to the sepal maturation stage, and then selected candidate genes using a microarray analysis and an in silico study. Here, we identified the vacuolar and plasma membrane-localized Al transporters genes vacuolar Al transporter (VALT and plasma membrane Al transporter 1 (PALT1, respectively, which are both members of the aquaporin family. The localization of each protein was confirmed by the transient co-expression of the genes. Reverse transcription-PCR and immunoblotting results indicated that VALT and PALT1 are highly expressed in sepal tissue. The overexpression of VALT and PALT1 in Arabidopsis thaliana conferred Al-tolerance and Al-sensitivity, respectively.

  16. Regeneration of aluminum hydride

    Science.gov (United States)

    Graetz, Jason Allan; Reilly, James J; Wegrzyn, James E

    2012-09-18

    The present invention provides methods and materials for the formation of hydrogen storage alanes, AlH.sub.x, where x is greater than 0 and less than or equal to 6 at reduced H.sub.2 pressures and temperatures. The methods rely upon reduction of the change in free energy of the reaction between aluminum and molecular H.sub.2. The change in free energy is reduced by lowering the entropy change during the reaction by providing aluminum in a state of high entropy, and by increasing the magnitude of the change in enthalpy of the reaction or combinations thereof.

  17. Aluminum Hydroxide and Magnesium Hydroxide

    Science.gov (United States)

    Aluminum Hydroxide, Magnesium Hydroxide are antacids used together to relieve heartburn, acid indigestion, and upset stomach. They ... They combine with stomach acid and neutralize it. Aluminum Hydroxide, Magnesium Hydroxide are available without a prescription. ...

  18. Melhoramento do trigo: X. Estimativas da herdabilidade e correlações entre tolerância à toxicidade de alumínio e produção de grãos com outros caracteres agronômicos em trigo Wheat breeding: X. Heritability estimates and associations of tolerance to aluminum toxicity and grain yield with other agronomic characteristics in wheat

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1984-01-01

    Full Text Available Visando estimar a herdabilidade para várias características da planta de trigo (tolerância ao Al3+, altura, produção de grãos, número de espigas, número de espiguetas e de grãos por espiga, número de grãos por espigueta, peso de cem grãos e comprimento da espiga, bem como as correlações entre produção de grãos com sete caracteres agronômicos e aquelas entre tolerância ao alumínio com produção de grãos, altura das plantas e número de grãos por espigueta (fertilidade da espiga, foram efetuados cruzamentos entre o cultivar de porte semi-anão Alondra S-46, e os de porte alto 'IAC-5', 'BH-1146' e 'C-3'. Plântulas representando os pais, as gerações F1 e F2 e os retrocruzamentos para ambos os pais foram testados para a reação a 6mg/litro de Al3+ em solução nutritiva. As plantas, devidamente identificadas, foram transplantadas em número de quatro por vaso, empregando-se no total 500 vasos dispostos em quatro blocos ao acaso. Os dados referentes à produção de grãos e a outros caracteres agronômicos foram obtidos de plantas individuais. Os valores da herdabilidade no sentido restrito para comprimento da espiga, número de grãos por espiga, peso de cem grãos e altura da planta foram 0,885; 0,748; 0,760 e 0,720 respectivamente, e de 0,413 e 0,588 para número de espigas por planta e de espiguetas por espiga. Para os demais caracteres estudados, os valores estimados foram baixos, variando de 0,072 a 0,224. Esses resultados indicaram que grande parte da variabilidade genética total para comprimento da espiga, número de grãos por espiga, peso de cem grãos e altura das plantas está associada a uma ação aditiva dos genes. Nas populações estudadas, a característica produção de grãos foi correlacionada significativamente com todos os caracteres agronômicos estudados com exceção do caráter número de espiguetas por espiga. Nessas populações, a tolerância ao alumínio não foi associada com altura das

  19. RECLAMATION OF ALUMINUM FINISHING SLUDGES

    Science.gov (United States)

    The research study of the reclamation of aluminum-anodizing sludges was conducted in two sequential phases focused on enhanced dewatering of aluminum-anodizing sludges to produce commercial-strength solutions of aluminum sulfate, i.e., liquid alum. The use of high-pressure (14 to...

  20. Electrically conductive anodized aluminum coatings

    Science.gov (United States)

    Alwitt, Robert S. (Inventor); Liu, Yanming (Inventor)

    2001-01-01

    A process for producing anodized aluminum with enhanced electrical conductivity, comprising anodic oxidation of aluminum alloy substrate, electrolytic deposition of a small amount of metal into the pores of the anodized aluminum, and electrolytic anodic deposition of an electrically conductive oxide, including manganese dioxide, into the pores containing the metal deposit; and the product produced by the process.