WorldWideScience

Sample records for aluminum tolerance genes

  1. Association and linkage analysis of aluminum tolerance genes in maize.

    Directory of Open Access Journals (Sweden)

    Allison M Krill

    Full Text Available BACKGROUND: Aluminum (Al toxicity is a major worldwide constraint to crop productivity on acidic soils. Al becomes soluble at low pH, inhibiting root growth and severely reducing yields. Maize is an important staple food and commodity crop in acidic soil regions, especially in South America and Africa where these soils are very common. Al exclusion and intracellular tolerance have been suggested as two important mechanisms for Al tolerance in maize, but little is known about the underlying genetics. METHODOLOGY: An association panel of 282 diverse maize inbred lines and three F2 linkage populations with approximately 200 individuals each were used to study genetic variation in this complex trait. Al tolerance was measured as net root growth in nutrient solution under Al stress, which exhibited a wide range of variation between lines. Comparative and physiological genomics-based approaches were used to select 21 candidate genes for evaluation by association analysis. CONCLUSIONS: Six candidate genes had significant results from association analysis, but only four were confirmed by linkage analysis as putatively contributing to Al tolerance: Zea mays AltSB like (ZmASL, Zea mays aluminum-activated malate transporter2 (ALMT2, S-adenosyl-L-homocysteinase (SAHH, and Malic Enzyme (ME. These four candidate genes are high priority subjects for follow-up biochemical and physiological studies on the mechanisms of Al tolerance in maize. Immediately, elite haplotype-specific molecular markers can be developed for these four genes and used for efficient marker-assisted selection of superior alleles in Al tolerance maize breeding programs.

  2. Overexpression of BdMATE Gene Improves Aluminum Tolerance in Setaria viridis

    Directory of Open Access Journals (Sweden)

    Ana P. Ribeiro

    2017-06-01

    Full Text Available Acidic soils are distributed worldwide, predominantly in tropical and subtropical areas, reaching around 50% of the arable soil. This type of soil strongly reduces crop production, mainly because of the presence of aluminum, which has its solubility increased at low pH levels. A well-known physiological mechanism used by plants to cope with Al stress involves activation of membrane transporters responsible for organic acid anions secretion from the root apex to the rhizosphere, which chelate Al, preventing its absorption by roots. In sorghum, a membrane transporter gene belonging to multidrug and toxic compound extrusion (MATE family was identified and characterized as an aluminum-activated citrate transporter gene responsible for Al tolerance in this crop. Setaria viridis is an emerging model for C4 species and it is an important model to validate some genes for further C4 crops transformation, such as sugarcane, maize, and wheat. In the present work, Setaria viridis was used as a model plant to overexpress a newly identified MATE gene from Brachypodium distachyon (BdMATE, closely related to SbMATE, for aluminum tolerance assays. Transgenic S. viridis plants overexpressing a BdMATE presented an improved Al tolerance phenotype, characterized by sustained root growth and exclusion of aluminum from the root apex in transgenic plants, as confirmed by hematoxylin assay. In addition, transgenic plants showed higher root citrate exudation into the rhizosphere, suggesting that Al tolerance improvement in these plants could be related to the chelation of the metal by the organic acid anion. These results suggest that BdMATE gene can be used to transform C4 crops of economic importance with improved aluminum tolerance.

  3. Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

    Science.gov (United States)

    Houde, Mario; Diallo, Amadou Oury

    2008-08-27

    Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

  4. Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines

    Directory of Open Access Journals (Sweden)

    Diallo Amadou

    2008-08-01

    Full Text Available Abstract Background Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive that differ in their response to Al were performed. Results Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. Conclusion In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

  5. Searching for RFLP markers to identify genes for aluminum tolerance in maize

    International Nuclear Information System (INIS)

    Paiva, E.; Lopes, M.A.; Parentoni, S.N.; Martins, P.R.; Torres, G.A.

    1998-01-01

    The objective of this study was to identify restriction fragment length polymorphism (RFLP) markers linked to Quantitative Trait Loci (QTL) that control aluminum (Al) tolerance in maize. The strategy used was bulked segregant analysis (BSA) and the genetic materials utilized were the F 2 , F 3 and F 4 populations derived from a cross between the Al-susceptible inbred line L53 and Al-tolerant inbred line L1327. The populations were evaluated in a nutrient solution containing a toxic concentration of Al (6 ppm) and relative seminal root length (RSRL) was used as a phenotypic measure of tolerance. Seedlings of the F 2 population with the highest and lowest RSRL values were transplanted to the field and subsequently selfed to obtain F 3 and F 4 families. The efficiency of the phenotypic index for selection was found to be greater when mean values were used instead of individual RSRL values. F 3 and F 4 families were then evaluated in nutrient solution to identify those that were not segregating. One hundred and thirteen probes, with an average interval of 30 cM, covering the 10 maize chromosomes were tested for their ability to discriminate the parental lines. Fifty four of these probes were polymorphic with 46 showing codominance. These probes were hybridized with DNA from two F 3 contrasting, bulks and three probes on chromosome 8 were found to be able distinguish the F 3 contrasting bulks on the basis of band position and intensity. DNA of families from the F 3 bulks hybridized with these probes showed the presence of heterozygous individuals. These three selected probes were also hybridized with DNA from F 2 individuals. Two of them showed a significant regression coefficient with the character. However, each of these probes explained only about 10% of the phenotypic variance observed in 70 F 2 individuals. One of the probes UMC 103 was hybridized with DNA from 168 F 4 families and the regression analysis of RFLP data showed a significant regression coefficient

  6. AtALMT1, which encodes a malate transporter, is identified as one of several genes critical for aluminum tolerance in Arabidopsis

    OpenAIRE

    Hoekenga, Owen A.; Maron, Lyza G.; Piñeros, Miguel A.; Cançado, Geraldo M. A.; Shaff, Jon; Kobayashi, Yuriko; Ryan, Peter R.; Dong, Bei; Delhaize, Emmanuel; Sasaki, Takayuki; Matsumoto, Hideaki; Yamamoto, Yoko; Koyama, Hiroyuki; Kochian, Leon V.

    2006-01-01

    Aluminum (Al) tolerance in Arabidopsis is a genetically complex trait, yet it is mediated by a single physiological mechanism based on Al-activated root malate efflux. We investigated a possible molecular determinant for Al tolerance involving a homolog of the wheat Al-activated malate transporter, ALMT1. This gene, named AtALMT1 (At1g08430), was the best candidate from the 14-memberAtALMT family to be involved with Al tolerance based on expression patterns and genomic location. Physiological...

  7. Aluminum tolerance association mapping in triticale

    Directory of Open Access Journals (Sweden)

    Niedziela Agnieszka

    2012-02-01

    Full Text Available Abstract Background Crop production practices and industrialization processes result in increasing acidification of arable soils. At lower pH levels (below 5.0, aluminum (Al remains in a cationic form that is toxic to plants, reducing growth and yield. The effect of aluminum on agronomic performance is particularly important in cereals like wheat, which has promoted the development of programs directed towards selection of tolerant forms. Even in intermediately tolerant cereals (i.e., triticale, the decrease in yield may be significant. In triticale, Al tolerance seems to be influenced by both wheat and rye genomes. However, little is known about the precise chromosomal location of tolerance-related genes, and whether wheat or rye genomes are crucial for the expression of that trait in the hybrid. Results A mapping population consisting of 232 advanced breeding triticale forms was developed and phenotyped for Al tolerance using physiological tests. AFLP, SSR and DArT marker platforms were applied to obtain a sufficiently large set of molecular markers (over 3000. Associations between the markers and the trait were tested using General (GLM and Multiple (MLM Linear Models, as well as the Statistical Machine Learning (SML approach. The chromosomal locations of candidate markers were verified based on known assignments of SSRs and DArTs or by using genetic maps of rye and triticale. Two candidate markers on chromosome 3R and 9, 15 and 11 on chromosomes 4R, 6R and 7R, respectively, were identified. The r2 values were between 0.066 and 0.220 in most cases, indicating a good fit of the data, with better results obtained with the GML than the MLM approach. Several QTLs on rye chromosomes appeared to be involved in the phenotypic expression of the trait, suggesting that rye genome factors are predominantly responsible for Al tolerance in triticale. Conclusions The Diversity Arrays Technology was applied successfully to association mapping studies

  8. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes

    2002-01-01

    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  9. Regulation of galactolipid biosynthesis by overexpression of the rice MGD gene contributes to enhanced aluminum tolerance in tobacco

    Directory of Open Access Journals (Sweden)

    Meijuan eZhang

    2016-03-01

    Full Text Available Membrane lipid alterations affect Al tolerance in plants, but little is known about the regulation of membrane lipid metabolism in response to Al stress. Transgenic tobacco (Nicotiana tabacum overexpressing rice monogalactosyldiacylglycerol (MGDG synthase (OsMGD gene and wild-type tobacco plants were exposed to AlCl3, and the impact of Al toxicity on root growth, Al accumulation, plasma membrane integrity, lipid peroxidation and membrane lipid composition were investigated. Compared with the wild type, the transgenic plants exhibited rapid regrowth of roots after removal of Al and less damage to membrane integrity and lipid peroxidation under Al stress, meanwhile, the Al accumulation showed no difference between wild-type and transgenic plants. Lipid analysis showed that Al treatment dramatically decreased the content of MGDG and the ratio of MGDG to digalactosyldiacylglycerol (DGDG in wild-type plants, while it was unchanged in transgenic plants. The stable of MGDG level and the ratio of MGDG/DGDG contribute to maintain the membrane stability and permeability. Moreover, Al caused a significant increase in phospholipids in wild-type plants, resulting in a high proportion of phospholipids and low proportion of galactolipids, but these proportions were unaffected in transgenic plants. The high proportion of phospholipids could contribute to a higher rate of Al3+ binding in the membrane and thereby leads to more membrane perturbation and damage. These results show that the regulation of galactolipid biosynthesis could play an important role in maintaining membrane structure and function under Al stress.

  10. Aluminum exclusion and aluminum tolerance in woody plants.

    Science.gov (United States)

    Brunner, Ivano; Sperisen, Christoph

    2013-01-01

    The aluminum (Al) cation Al(3) (+) is highly rhizotoxic and is a major stress factor to plants on acid soils, which cover large areas of tropical and boreal regions. Many woody plant species are native to acid soils and are well adapted to high Al(3) (+) conditions. In tropical regions, both woody Al accumulator and non-Al accumulator plants occur, whereas in boreal regions woody plants are non-Al accumulators. The mechanisms of these adaptations can be divided into those that facilitate the exclusion of Al(3) (+) from root cells (exclusion mechanisms) and those that enable plants to tolerate Al(3) (+) once it has entered the root and shoot symplast (internal tolerance mechanisms). The biochemical and molecular basis of these mechanisms have been intensively studied in several crop plants and the model plant Arabidopsis. In this review, we examine the current understanding of Al(3) (+) exclusion and tolerance mechanisms from woody plants. In addition, we discuss the ecology of woody non-Al accumulator and Al accumulator plants, and present examples of Al(3) (+) adaptations in woody plant populations. This paper complements previous reviews focusing on crop plants and provides insights into evolutionary processes operating in plant communities that are widespread on acid soils.

  11. Identification and characterization of acidity-tolerant and aluminum ...

    African Journals Online (AJOL)

    An acidity-tolerant, aluminum resistant bacterium was isolated from tea soils in Kagoshima Experimental Station (Japan). Based on the morphological, physiological and biochemical characteristics and 16S rDNA nucleotide sequence analysis, the bacterium was identified as Bacillus sp. An 3 (DQ234657) in Bacillus cereus ...

  12. Natural variation underlies alterations in NRAT1 expression and function that play a key role in rice aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) toxicity is a major constraint for crop production on acid soils which comprise approximately 40% of arable land in the tropics and subtropics. Rice is the most Al tolerant cereal crop, and offers a good model for identifying Al tolerance genes and mechanisms. Here we investigated natu...

  13. 40 CFR 180.415 - Aluminum tris (O-ethylphosphonate); tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Aluminum tris (O-ethylphosphonate... Tolerances § 180.415 Aluminum tris (O-ethylphosphonate); tolerances for residues. (a) General. Tolerances are established for residues of the fungicide aluminum tris(O-ethylphosphonate) in or on the following food...

  14. A molecular, genetic and physiological analysis of plant aluminum tolerance (abstract)

    International Nuclear Information System (INIS)

    Pineros, M.

    2005-01-01

    Aluminum (Al) toxicity is an important agronomic trait, limiting crop production on acid soils that comprise up to 50% of the world's potentially arable lands. A significant genetic variation in Al tolerance exists in both crop plants and Arabidopsis. The exploitation of this genetic variation to breed crops with increased Al tolerance has been a productive and active area of research, however, the underlying molecular, genetic and physiological bases are still not well understood. Only very recently was the first Al tolerance gene, ALMT1, isolated in wheat and shown to be a novel Al-activated malate transporter. Work in our laboratory has focused on using integrated genomic (gene and protein expression profiling), molecular genetic and physiological approaches to identify novel Al tolerance genes and the physiological mechanisms they control in the cereal crops maize and sorghum, and also in arabidopsis. In sorghum we had previously shown that Al tolerance is the result of a single locus, Alt/sub SB/ which maps to the top of sorghum chromosome 3 in a region totally distinct from where the major Al tolerance maps in wheat and other related members of the Triticeae. Very recently, we have used map-based cloning techniques in sorghum to clone Alt/sub SB/ and have found it is a novel Al tolerance gene. Here we will present a molecular characterization of the Alt/sub SB/ gene and also the physiological mechanism of sorghum Al tolerance it controls. In arabidopsis, we have previously shown that Al tolerance is a quantitative trait and have identified two major Al tolerance QTL on chromosomes 1 and 5. These genes function to confer tolerance via Al via activated root malate release. We found that a member of the arabidopsis gene family that is a close homolog to wheat ALMT1 maps near the largest tolerance QTL on chromosome 1 and have also found this gene encodes the Al-activated malate transport involved in arabidopsis Al tolerance. However, we have clear molecular

  15. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance.

    Science.gov (United States)

    Liu, Jiping; Magalhaes, Jurandir V; Shaff, Jon; Kochian, Leon V

    2009-02-01

    Aluminum-activated root malate and citrate exudation play an important role in plant Al tolerance. This paper characterizes AtMATE, a homolog of the recently discovered sorghum and barley Al-tolerance genes, shown here to encode an Al-activated citrate transporter in Arabidopsis. Together with the previously characterized Al-activated malate transporter, AtALMT1, this discovery allowed us to examine the relationship in the same species between members of the two gene families for which Al-tolerance genes have been identified. AtMATE is expressed primarily in roots and is induced by Al. An AtMATE T-DNA knockdown line exhibited very low AtMATE expression and Al-activated root citrate exudation was abolished. The AtALMT1 AtMATE double mutant lacked both Al-activated root malate and citrate exudation and showed greater Al sensitivity than the AtALMT1 mutant. Therefore, although AtALMT1 is a major contributor to Arabidopsis Al tolerance, AtMATE also makes a significant but smaller contribution. The expression patterns of AtALMT1 and AtMATE and the profiles of Al-activated root citrate and malate exudation are not affected by the presence or absence of the other gene. These results suggest that AtALMT1-mediated malate exudation and AtMATE-mediated citrate exudation evolved independently to confer Al tolerance in Arabidopsis. However, a link between regulation of expression of the two transporters in response to Al was identified through work on STOP1, a transcription factor that was previously shown to be necessary for AtALMT1 expression. Here we show that STOP1 is also required for AtMATE expression and Al-activated citrate exudation.

  16. Different Aluminum Tolerance among Indica, Japonica and Hybrid Rice Varieties

    Directory of Open Access Journals (Sweden)

    Shu Chang

    2015-05-01

    Full Text Available Hydroponic cultures were conducted to compare the aluminum (Al tolerance among different rice (Oryza sativa L. varieties, including indica, japonica and their hybrids. The results showed that the root growth of rice plant was inhibited in different degrees among Al treated varieties. The Al tolerance observed through relative root elongation indicated that five japonica varieties including Longjing 9, Dharial, LGC 1, Ribenyou and Koshihikari were relatively more tolerant than indica varieties. Most indica varieties in this study, such as Aus 373 and 9311 (awnless, were sensitive to Al toxicity. The Al tolerance of most progenies from japonica × indica or indica × japonica crosses was constantly consistent with indica parents. The differences of Al tolerance among Longjing 9 (japonica, Yangdao 6 (indica and Wuyunjing 7 (japonica were studied. Biomass and the malondial-dehyde content of Yangdao 6 under Al exposure decreased and increased, respectively, while there was no significant effect on those of Longjing 9 and Wuyunjing 7. Remarkable reduction of root activities was observed in all these three rice varieties. Significantly higher Al content in roots was found in Yangdao 6 compared to Longjing 9 or Wuyunjing 7.

  17. Toxicity and tolerance of aluminum in plants: tailoring plants to suit to acid soils.

    Science.gov (United States)

    Sade, Hemalatha; Meriga, Balaji; Surapu, Varalakshmi; Gadi, Jogeswar; Sunita, M S L; Suravajhala, Prashanth; Kavi Kishor, P B

    2016-04-01

    Aluminum (Al) stress is one of the serious limiting factors in plant productivity in acidic soils, which constitute about 50 % of the world's potentially arable lands and causes anywhere between 25 and 80 % of yield losses depending upon the species. The mechanism of Al toxicity and tolerance has been examined in plants, which is vital for crop improvement and enhanced food production in the future. Two mechanisms that facilitate Al tolerance in plants are Al exclusion from the roots and the ability to tolerate Al in the symplast or both. Although efforts have been made to unravel Al-resistant factors, many aspects remain unclear. Certain gene families such as MATE, ALMT, ASR, and ABC transporters have been implicated in some plants for resistance to Al which would enhance the opportunities for creating crop plants suitable to grow in acidic soils. Though QTLs have been identified related to Al-tolerance, no crop plant that is tolerant to Al has been evolved so far using breeding or molecular approaches. The remarkable changes that plants experience at the physiological, biochemical and molecular level under Al stress, the vast array of genes involved in Al toxicity-tolerance, the underlying signaling events and the holistic image of the molecular regulation, and the possibility of creating transgenics for Al tolerance are discussed in this review.

  18. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.

    Directory of Open Access Journals (Sweden)

    Huaxin Dai

    Full Text Available Aluminum (Al toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance.

  19. Rapid screening for aluminum tolerance in maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Carlos Daniel Giaveno

    2000-12-01

    Full Text Available A significant decrease in maize grain yield due to aluminum toxicity is considered to be one of the most important agricultural problems for tropical regions. Genetic improvement is a useful approach to increase maize yield in acid soils, but this requires a rapid and reliable method to discriminate between genotypes. In our work we investigated the feasibility of using hematoxylin staining (HS to detect Al-tolerant plants at the seedling stage. The original population along with two populations obtained after one cycle of divergent selection were evaluated by net root growth (NRG and HS after 7 days in nutrient solution. Results showed a negative correlation between NRG and HS in all populations, in which sensitive plants, characterized by low NRG, exhibited more intense staining than tolerant plants. These results indicate that HS is a useful procedure for selecting Al-tolerant maize seedlings.A importante diminuição nos rendimentos de milho causados pela toxidez produzida pelo alumínio é considerada um dos mais importantes problemas nas regiões tropicais. O melhoramento genético é uma metodologia útil para aumentar os rendimentos do milho em solos ácidos, requerendo um método rápido e seguro que permita diferenciar os diferentes genótipos. O objetivo deste trabalho foi avaliar a possibilidade de utilizar a técnica da coloração com hematoxilina (HS na detecção de plântulas tolerantes ao alumínio. Duas populações obtidas de um ciclo de seleção divergente e a original, foram avaliadas depois de sete dias em solução nutritiva utilizando os parâmetros NRG (crescimento líquido da raiz principal e HS. Os resultados apresentaram uma correlação negativa entre NRG e HS em todas as populações devido ao fato de que as plântulas suscetíveis, caracterizadas por um baixo NRG, apresentaram uma coloração mais intensa do que as tolerantes. Nossos resultados permitem concluir que a técnica de coloração com hematoxilina

  20. Physiological and molecular analysis of selected Kenyan maize lines for aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) toxicity is an important limitation to maize production in many tropical and sub-tropical acid soil areas. The aim of this study was to survey the variation in Al tolerance in a panel of maize lines adapted for Kenya and look for novel sources of Al tolerance. 112 Kenyan maize accessio...

  1. Genetic Architecture of Aluminum Tolerance in Rice (Oryza sativa) Determined through Genome-Wide Association Analysis and QTL Mapping

    Science.gov (United States)

    Famoso, Adam N.; Zhao, Keyan; Clark, Randy T.; Tung, Chih-Wei; Wright, Mark H.; Bustamante, Carlos; Kochian, Leon V.; McCouch, Susan R.

    2011-01-01

    Aluminum (Al) toxicity is a primary limitation to crop productivity on acid soils, and rice has been demonstrated to be significantly more Al tolerant than other cereal crops. However, the mechanisms of rice Al tolerance are largely unknown, and no genes underlying natural variation have been reported. We screened 383 diverse rice accessions, conducted a genome-wide association (GWA) study, and conducted QTL mapping in two bi-parental populations using three estimates of Al tolerance based on root growth. Subpopulation structure explained 57% of the phenotypic variation, and the mean Al tolerance in Japonica was twice that of Indica. Forty-eight regions associated with Al tolerance were identified by GWA analysis, most of which were subpopulation-specific. Four of these regions co-localized with a priori candidate genes, and two highly significant regions co-localized with previously identified QTLs. Three regions corresponding to induced Al-sensitive rice mutants (ART1, STAR2, Nrat1) were identified through bi-parental QTL mapping or GWA to be involved in natural variation for Al tolerance. Haplotype analysis around the Nrat1 gene identified susceptible and tolerant haplotypes explaining 40% of the Al tolerance variation within the aus subpopulation, and sequence analysis of Nrat1 identified a trio of non-synonymous mutations predictive of Al sensitivity in our diversity panel. GWA analysis discovered more phenotype–genotype associations and provided higher resolution, but QTL mapping identified critical rare and/or subpopulation-specific alleles not detected by GWA analysis. Mapping using Indica/Japonica populations identified QTLs associated with transgressive variation where alleles from a susceptible aus or indica parent enhanced Al tolerance in a tolerant Japonica background. This work supports the hypothesis that selectively introgressing alleles across subpopulations is an efficient approach for trait enhancement in plant breeding programs and

  2. Induced genetic variation for aluminum and salt tolerance in rice

    International Nuclear Information System (INIS)

    Chaudhry, M.A.; Yoshida, S.; Vegara, B.S.

    1989-01-01

    Full text: MNH applied to fertilized egg cells of 'Taichung 65' led to an increase in genetic variation in the progenies. Of a M 2 population of 15,000 seedlings, 2.3% were scored tolerant to salt. Tolerant plants showed less shoot and root growth inhibition. 50 variants expressed different degrees of tolerance to Al, even up to 30 ppm. The tolerance was related to longer root development. (author)

  3. Isolation of cowpea genes conferring drought tolerance ...

    African Journals Online (AJOL)

    The main objective of this study was to identify and isolate the genes conferring drought tolerance in cowpea. A cDNA library enriched for cowpea genes expressed specifically during responses to drought was constructed. A procedure called suppression subtractive hybridisation (SSH) was successfully employed to obtain ...

  4. Global Transcriptome Analysis Reveals Distinct Aluminum-Tolerance Pathways in the Al-Accumulating Species Hydrangea macrophylla and Marker Identification.

    Directory of Open Access Journals (Sweden)

    Haixia Chen

    Full Text Available Hydrangea (Hydrangea macrophylla is a well known Al-accumulating plant, showing a high level of aluminum (Al tolerance and accumulation. Although the physiological mechanisms for detoxification of Al and the roles of Al in blue hydrangea sepals have been reported, the molecular mechanisms of Al tolerance and accumulation are poorly understood in hydrangea. In this study, we conducted a genome-wide transcriptome analysis of Al-response genes in the roots and leaves of hydrangea by RNA sequencing (RNA-seq. The assembly of hydrangea transcriptome provides a rich source for gene identification and mining molecular markers, including single nucleotide polymorphism (SNP and simple sequence repeat (SSR. A total of 401,215 transcripts with an average length of 810.77 bp were assembled, generating 256,127 unigenes. After annotation, 4,287 genes in the roots and 730 genes in the leaves were up-regulated by Al exposure, while 236 genes in the roots and 719 genes in the leaves were down-regulated, respectively. Many transporters, including MATE and ABC families, were involved in the process of Al-citrate complex transporting from the roots in hydrangea. A plasma membrane Al uptake transporter, Nramp aluminum transporter was up-regulated in roots and leaves under Al stress, indicating it may play an important role in Al tolerance by reducing the level of toxic Al. Although the exact roles of these candidate genes remain to be examined, these results provide a platform for further functional analysis of the process of detoxification of Al in hydrangea.

  5. Effects of exogenous salicylic acid on cell wall polysaccharides and aluminum tolerance of trichosanthes kirilowii

    International Nuclear Information System (INIS)

    Xu, G.; Liu, D.; Xio, Y.; Liu, P.; Gao, P. P.; Cao, L.; Wu, Y.

    2015-01-01

    A hydroponic experiment was conducted to study the effects of exogenous salicylic acid (SA) on root length, relative aluminum content in the apical cell wall, acid phosphatase (APA) and pectin methyl esterase (PME) activity, root pectin, hemicellulose 1(HC1), and hemicellulose 2 (HC2) contents of Anguo Trichosanthes kirilowii (Al-tolerant genotype) and Pujiang T. kirilowii (Al-sensitive genotype) under 800 micro mol/L of aluminum stress. The results showed that the growth of Al-tolerant Anguo T. kirilowii and Al-sensitive Pujiang T. kirilowii was inhibited when exposed to 800 micro mol/L of aluminum solution. APA and PME activities were also enhanced for both genotypes. The contents of relative aluminum, pectin, HC1, and HC2, as well as Al accumulation in the root tips were increased under aluminum toxicity. Pujiang T. kirilowii showed higher enzyme activity and cell wall polysaccharide contents than Anguo T. kirilowii. In addition, the root cell wall pectin, HC1, and HC2 contents of Pujiang T. kirilowii were increased by a large margin, showing its greater sensitivity to aluminum toxicity. Root length is an important indicator of aluminum toxicity, and has an important relationship with cell wall polysaccharide content. Aluminum toxicity led to the accumulation of pectin and high PME activity, and also increased the number of free carboxyl groups, which have more aluminum binding sites. Membrane skim increased extensively with the increase in APA activity, damaging membrane structure and function. Different SA concentrations can decrease enzyme activity and cell wall polysaccharide content to some extent. With the addition of different SA concentrations, the root relative aluminum content, cell wall polysaccharide content, APA and PME activities decreased. Aluminum toxicity to both genotypes of T. kirilowii was relieved in different degrees as exogenous SA concentration increased. Inter-simple sequence repeat (ISSR) marker was used to examine the genetic distance

  6. Complete mitochondrial genome of the aluminum-tolerant fungus Rhodotorula taiwanensis RS1 and comparative analysis of Basidiomycota mitochondrial genomes.

    Science.gov (United States)

    Zhao, Xue Qiang; Aizawa, Tomoko; Schneider, Jessica; Wang, Chao; Shen, Ren Fang; Sunairi, Michio

    2013-04-01

    The complete mitochondrial genome of Rhodotorula taiwanensis RS1, an aluminum-tolerant Basidiomycota fungus, was determined and compared with the known mitochondrial genomes of 12 Basidiomycota species. The mitochondrial genome of R. taiwanensis RS1 is a circular DNA molecule of 40,392 bp and encodes the typical 15 mitochondrial proteins, 23 tRNAs, and small and large rRNAs as well as 10 intronic open reading frames. These genes are apparently transcribed in two directions and do not show syntenies in gene order with other investigated Basidiomycota species. The average G+C content (41%) of the mitochondrial genome of R. taiwanensis RS1 is the highest among the Basidiomycota species. Two introns were detected in the sequence of the atp9 gene of R. taiwanensis RS1, but not in that of other Basidiomycota species. Rhodotorula taiwanensis is the first species of the genus Rhodotorula whose full mitochondrial genome has been sequenced; and the data presented here supply valuable information for understanding the evolution of fungal mitochondrial genomes and researching the mechanism of aluminum tolerance in microorganisms. © 2013 The Authors. Published by Blackwell Publishing Ltd.

  7. Polyphenol-aluminum complex formation: Implications for aluminum tolerance in plants

    Science.gov (United States)

    Natural polyphenols may play an important role in aluminum detoxification in some plants. We examined the interaction between Al3+ and the purified high molecular weight polyphenols pentagalloyl glucose (940 Da) and oenothein B (1568 Da), and the related compound methyl gallate (184 Da) at pH 4 and ...

  8. Comparison of tolerance to soil acidity among crop plants. II. Tolerance to high levels of aluminum and manganese. Comparative plant nutrition

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, A; Hayakawa, Y

    1975-01-01

    Research was conducted by growing various species of plants in solutions containing high concentrations of manganese or aluminum. A comparison was made of the tolerance of these plants to low pH and to the manganese and aluminum. In addition, the element content of the plants was compared. Plants high in calcium were found to have an intermediate tolerance to high concentrations of manganese and aluminum. Gramineae had a high tolerance to these elements and to low pH. They also accumulated high levels of these elements. Legumes had a high tolerance to manganese and aluminum and to low pH. However, they also accumulated high levels of these elements. Legumes had a high tolerance to manganese and aluminum and to low pH. However, they also accumulated high levels of these elements. Cruciferae had a low tolerance to the elements and to low pH. They contained low levels of manganese and aluminum. Chenopodiaceae had a low tolerance to the elements as well as low element contents. However, they were highly tolerant to low pH.

  9. BoALMT1, an Al-Induced Malate Transporter in Cabbage, Enhances Aluminum Tolerance in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    2018-01-01

    Full Text Available Aluminum (Al is present in approximately 50% of the arable land worldwide and is regarded as the main limiting factor of crop yield on acidic soil. Al-induced root malate efflux plays an important role in the Al tolerance of plants. Here, the aluminum induced malate transporter BoALMT1 (KF322104 was cloned from cabbage (Brassica oleracea. BoALMT1 showed higher expression in roots than in shoots. The expression of BoALMT1 was specifically induced by Al treatment, but not the trivalent cations lanthanum (La, cadmium (Cd, zinc (Zn, or copper (Cu. Subcellular localization studies were performed in onion epidermal cells and revealed that BoALMT1 was localized at the plasma membrane. Scanning Ion-selective Electrode Technique was used to analyze H+ flux. Xenopus oocytes and Arabidopsis thaliana expressing BoALMT1 excreted more H+ under Al treatment. Overexpressing BoALMT1 in transgenic Arabidopsis resulted in enhanced Al tolerance and increased malate secretion. The results suggested that BoALMT1 functions as an Al-resistant gene and encodes a malate transporter. Expressing BoALMT1 in Xenopus oocytes or A. thaliana indicated that BoALMT1 could increase malate secretion and H+ efflux to resist Al tolerance.

  10. Tolerance of physic nut plants to aluminum activity in nutrient solution

    OpenAIRE

    Lana, Maria do Carmo; Steiner, Fábio [UNESP; Zoz, Tiago [UNESP; Fey, Rubens; Frandoloso, Jucenei Fernando

    2013-01-01

    Plants have different levels of tolerance to phytotoxic effects of aluminum and the exploitation of this characteristic is of significant importance to the use of acid soils. This research aimed to evaluate the effect of aluminum activity in nutrient solution on growth of physic nut young plant. After seven days of adaptation, plants were submitted to Al concentrations of 0; 200; 400; 600; 800 and 1,000 μmol L-1, corresponding to Al3+ activity solution, of: 14.5, 21.4; 46.6; 75.6; 108.3 e 144...

  11. Identification of a STOP1-like protein in Eucalyptus that regulates transcription of Al tolerance genes.

    Science.gov (United States)

    Sawaki, Yoshiharu; Kobayashi, Yuriko; Kihara-Doi, Tomonori; Nishikubo, Nobuyuki; Kawazu, Tetsu; Kobayashi, Masatomo; Kobayashi, Yasufumi; Iuchi, Satoshi; Koyama, Hiroyuki; Sato, Shigeru

    2014-06-01

    Tolerance to soil acidity is an important trait for eucalyptus clones that are introduced to commercial forestry plantations in pacific Asian countries, where acidic soil is dominant in many locations. A conserved transcription factor regulating aluminum (Al) and proton (H⁺) tolerance in land-plant species, STOP1 (SENSITIVE TOPROTON RHIZOTOXICITY 1)-like protein, was isolated by polymerase chain reaction-based cloning, and then suppressed by RNA interference in hairy roots produced by Agrobacterium rhizogenes-mediated transformation. Eucalyptus STOP1-like protein complemented proton tolerance in an Arabidopsis thaliana stop1-mutant, and localized to the nucleus in a transient assay of a green fluorescent protein fusion protein expressed in tobacco leaves by Agrobacterium tumefaciens-mediated transformation. Genes encoding a citrate transporting MULTIDRUGS AND TOXIC COMPOUND EXTRUSION protein and an orthologue of ALUMINUM SENSITIVE 3 were suppressed in transgenic hairy roots in which the STOP1 orthologue was knocked down. In summary, we identified a series of genes for Al-tolerance in eucalyptus, including a gene for STOP1-like protein and the Al-tolerance genes it regulates. These genes may be useful for molecular breeding and genomic selection of elite clones to introduce into acid soil regions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Proteomic analysis of a high aluminum tolerant yeast Rhodotorula taiwanensis RS1 in response to aluminum stress.

    Science.gov (United States)

    Wang, Chao; Wang, Chang Yi; Zhao, Xue Qiang; Chen, Rong Fu; Lan, Ping; Shen, Ren Fang

    2013-10-01

    Rhodotorula taiwanensis RS1 is a high-aluminum (Al)-tolerant yeast that can survive in Al concentrations up to 200mM. The mechanisms for the high Al tolerance of R. taiwanensis RS1 are not well understood. To investigate the molecular mechanisms underlying Al tolerance and toxicity in R. taiwanensis RS1, Al toxicity-induced changes in the total soluble protein profile were analyzed using two-dimensional gel electrophoresis (2-DE) coupled with mass spectrometry. A total of 33 differentially expressed proteins responding to Al stress were identified from approximately 850 reproducibly detected proteins. Among them, the abundance of 29 proteins decreased and 4 increased. In the presence of 100mM Al, the abundance of proteins involved in DNA transcription, protein translation, DNA defense, Golgi functions and glucose metabolism was decreased. By contrast, Al treatment led to increased abundance of malate dehydrogenase, which correlated with increased malate dehydrogenase activity and the accumulation of intracellular citrate, suggesting that Al-induced intracellular citrate could play an important role in detoxification of Al in R. taiwanensis RS1. © 2013.

  13. Damage Tolerance Behavior of Friction Stir Welds in Aluminum Alloys

    Science.gov (United States)

    McGill, Preston; Burkholder, Jonathan

    2012-01-01

    Friction stir welding is a solid state welding process used in the fabrication of various aerospace structures. Self-reacting and conventional friction stir welding are variations of the friction stir weld process employed in the fabrication of cryogenic propellant tanks which are classified as pressurized structure in many spaceflight vehicle architectures. In order to address damage tolerance behavior associated with friction stir welds in these safety critical structures, nondestructive inspection and proof testing may be required to screen hardware for mission critical defects. The efficacy of the nondestructive evaluation or the proof test is based on an assessment of the critical flaw size. Test data describing fracture behavior, residual strength capability, and cyclic mission life capability of friction stir welds at ambient and cryogenic temperatures have been generated and will be presented in this paper. Fracture behavior will include fracture toughness and tearing (R-curve) response of the friction stir welds. Residual strength behavior will include an evaluation of the effects of lack of penetration on conventional friction stir welds, the effects of internal defects (wormholes) on self-reacting friction stir welds, and an evaluation of the effects of fatigue cycled surface cracks on both conventional and selfreacting welds. Cyclic mission life capability will demonstrate the effects of surface crack defects on service load cycle capability. The fracture data will be used to evaluate nondestructive inspection and proof test requirements for the welds.

  14. Nuclear Radiation Tolerance of Single Crystal Aluminum Nitride Ultrasonic Transducer

    Science.gov (United States)

    Reinhard, Brian; Tittmann, Bernhard R.; Suprock, Andrew

    Ultrasonic technologies offer the potential for high accuracy and resolution in-pile measurement of a range of parameters, including geometry changes, temperature, crack initiation and growth, gas pressure and composition, and microstructural changes. Many Department of Energy-Office of Nuclear Energy (DOE-NE) programs are exploring the use of ultrasonic technologies to provide enhanced sensors for in-pile instrumentation during irradiation testing. For example, the ability of small diameter ultrasonic thermometers (UTs) to provide a temperature profile in candidate metallic and oxide fuel would provide much needed data for validating new fuel performance models, (Rempe et al., 2011; Kazys et al., 2005). These efforts are limited by the lack of identified ultrasonic transducer materials capable of long term performance under irradiation test conditions. To address this need, the Pennsylvania State University (PSU) was awarded an Advanced Test Reactor National Scientific User Facility (ATR NSUF) project to evaluate the performance of promising magnetostrictive and piezoelectric transducers in the Massachusetts Institute of Technology Research Reactor (MITR) up to a fast fluence of at least 1021 n/cm2. The irradiation is also supported by a multi-National Laboratory collaboration funded by the Nuclear Energy Enabling Technologies Advanced Sensors and Instrumentation (NEET ASI) program. The results from this irradiation, which started in February 2014, offer the potential to enable the development of novel radiation tolerant ultrasonic sensors for use in Material Testing Reactors (MTRs). As such, this test is an instrumented lead test and real-time transducer performance data is collected along with temperature and neutron and gamma flux data. Hence, results from this irradiation offer the potential to bridge the gap between proven out-of-pile ultrasonic techniques and in-pile deployment of ultrasonic sensors by acquiring the data necessary to demonstrate the

  15. Morpho-physiological analysis of tolerance to aluminum toxicity in rice varieties of North East India.

    Science.gov (United States)

    Awasthi, Jay Prakash; Saha, Bedabrata; Regon, Preetom; Sahoo, Smita; Chowra, Umakanta; Pradhan, Amit; Roy, Anupam; Panda, Sanjib Kumar

    2017-01-01

    Aluminum (Al) is the third most abundant metal in earth crust, whose chemical form is mainly dependent on soil pH. The most toxic form of Al with respect to plants is Al3+, which exists in soil pH Eastern India 80% soil are acidic). Al3+ toxicity in plants ensues root growth inhibition leading to less nutrient and water uptake impacting crop productivity as a whole. Rice is one of the chief grains which constitutes the staple food of two-third of the world population including India and is not untouched by Al3+ toxicity. Al contamination is a critical constraint to plant production in agricultural soils of North East India. 24 indigenous Indica rice varieties (including Badshahbhog as tolerant check and Mashuri as sensitive check) were screened for Al stress tolerance in hydroponic plant growth system. Results show marked difference in growth parameters (relative growth rate, Root tolerance index, fresh and dry weight of root) of rice seedlings due to Al (100 μM) toxicity. Al3+ uptake and lipid peroxidation level also increased concomitantly under Al treatment. Histochemical assay were also performed to elucidate uptake of aluminum, loss of membrane integrity and lipid peroxidation, which were found to be more in sensitive genotypes at higher Al concentration. This study revealed that aluminum toxicity is a serious harmful problem for rice crop productivity in acid soil. Based on various parameters studied it's concluded that Disang is a comparatively tolerant variety whereas Joymati a sensitive variety. Western blot hybridization further strengthened the claim, as it demonstrated more accumulation of Glutathione reductase (GR) protein in Disang rice variety than Joymati under stressed condition. This study also observed that the emergence of lethal toxic symptoms occurs only after 48h irrespective of the dose used in the study.

  16. Morpho-physiological analysis of tolerance to aluminum toxicity in rice varieties of North East India.

    Directory of Open Access Journals (Sweden)

    Jay Prakash Awasthi

    Full Text Available Aluminum (Al is the third most abundant metal in earth crust, whose chemical form is mainly dependent on soil pH. The most toxic form of Al with respect to plants is Al3+, which exists in soil pH <5. Acidic soil significantly limits crop production mainly due to Al3+ toxicity worldwide, impacting approximately 50% of the world's arable land (in North-Eastern India 80% soil are acidic. Al3+ toxicity in plants ensues root growth inhibition leading to less nutrient and water uptake impacting crop productivity as a whole. Rice is one of the chief grains which constitutes the staple food of two-third of the world population including India and is not untouched by Al3+ toxicity. Al contamination is a critical constraint to plant production in agricultural soils of North East India. 24 indigenous Indica rice varieties (including Badshahbhog as tolerant check and Mashuri as sensitive check were screened for Al stress tolerance in hydroponic plant growth system. Results show marked difference in growth parameters (relative growth rate, Root tolerance index, fresh and dry weight of root of rice seedlings due to Al (100 μM toxicity. Al3+ uptake and lipid peroxidation level also increased concomitantly under Al treatment. Histochemical assay were also performed to elucidate uptake of aluminum, loss of membrane integrity and lipid peroxidation, which were found to be more in sensitive genotypes at higher Al concentration. This study revealed that aluminum toxicity is a serious harmful problem for rice crop productivity in acid soil. Based on various parameters studied it's concluded that Disang is a comparatively tolerant variety whereas Joymati a sensitive variety. Western blot hybridization further strengthened the claim, as it demonstrated more accumulation of Glutathione reductase (GR protein in Disang rice variety than Joymati under stressed condition. This study also observed that the emergence of lethal toxic symptoms occurs only after 48h

  17. Cowpea symbiotic efficiency, pH and aluminum tolerance in nitrogen-fixing bacteria

    Directory of Open Access Journals (Sweden)

    Bruno Lima Soares

    2014-06-01

    Full Text Available Cowpea (Vigna unguiculata cultivation in northern and northeastern Brazil provides an excellent source of nutrients and carbohydrates for the poor and underprivileged. Production surplus leads to its consumption in other regions of Brazil and also as an export commodity. Its capacity to establish relationships with atmospheric nitrogen-fixing bacteria is crucial to the reduction of production costs and the environmental impact of nitrogen fertilizers. This study assessed the symbiotic efficiency of new strains of symbiotic nitrogen-fixing bacteria with cowpea and their tolerance to pH and aluminum. Twenty-seven strains of bacteria from different soils were evaluated under axenic conditions. These strains were compared to the following inoculant strains: INPA03-11B, UFLA03-84 and BR3267 and two controls that were not inoculated (with and without mineral nitrogen. Six strains and the three strains approved as inoculants were selected to increase the dry weight production of the aerial part (DWAP and were tested in pots with soil that had a high-density of nitrogen-fixing native rhizobia. In this experiment, three strains (UFLA03-164, UFLA03-153, and UFLA03-154 yielded higher DWAP values. These strains grow at pH levels of 5.0, 6.0, 6.8 and at high aluminum concentration levels, reaching 10(9 CFU mL-1. In particular UFLA03-84, UFLA03-153, and UFLA03-164 tolerate up to 20 mmol c dm-3 of Al+3. Inoculation with rhizobial strains, that had been carefully selected according to their ability to nodulate and fix N2, combined with their ability to compete in soils that are acidic and contain high levels of Al, is a cheaper and more sustainable alternative that can be made available to farmers than mineral fertilizers.

  18. Cell wall pectin methyl-esterification and organic acids of root tips involve in aluminum tolerance in Camellia sinensis.

    Science.gov (United States)

    Li, Dongqin; Shu, Zaifa; Ye, Xiaoli; Zhu, Jiaojiao; Pan, Junting; Wang, Weidong; Chang, Pinpin; Cui, Chuanlei; Shen, Jiazhi; Fang, Wanping; Zhu, Xujun; Wang, Yuhua

    2017-10-01

    Tea plant (Camellia sinensis (O.) Kuntze) can survive from high levels of aluminum (Al) in strongly acidic soils. However, the mechanism driving its tolerance to Al, the predominant factor limiting plant growth in acid condition, is still not fully understood. Here, two-year-old rooted cuttings of C. sinensis cultivar 'Longjingchangye' were used for Al resistance experiments. We found that the tea plants grew better in the presence of 0.4 mM Al than those grew under lower concentration of Al treatments (0 and 0.1 mM) as well as higher levels treatment (2 and 4 mM), confirming that appropriate Al increased tea plant growth. Hematoxylin staining assay showed that the apical region was the main accumulator in tea plant root. Subsequently, immunolocalization of pectins in the root tip cell wall showed a rise in low-methyl-ester pectin levels and a reduction of high-methyl-ester pectin content with the increasing Al concentration of treatments. Furthermore, we observed the increased expressions of C. sinensis pectin methylesterase (CsPME) genes along with the increasing de-esterified pectin levels during response to Al treatments. Additionally, the levels of organic acids increased steadily after treatment with 0.1, 0.4 or 2 mM Al, while they dropped after treatment with 4 mM Al. The organic acids secretion from root followed a similar trend. Similarly, a gradual increase in malate dehydrogenase (MDH), citrate synthase (CS) and glycolate oxidase (GO) enzyme activities and relevant metabolic genes expression were detected after the treatment of 0.1, 0.4 or 2 mM Al, while a sharp decrease was resulted from treatment with 4 mM Al. These results confirm that both pectin methylesterases and organic acids contribute to Al tolerance in C. sinensis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.

    Science.gov (United States)

    Mishra, Avinash; Tanna, Bhakti

    2017-01-01

    Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  20. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-05-01

    Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  1. Candidate genes for drought tolerance and improved productivity in ...

    Indian Academy of Sciences (India)

    Madhu

    tropics. Improving drought tolerance and productivity is one of the most difficult tasks for cereal breeders. The diffi- culty arises from the diverse strategies adopted by plants themselves to combat drought stress depending on the timing,. Candidate genes for drought tolerance and improved productivity in rice (Oryza sativa L.).

  2. Candidate genes for drought tolerance and improved productivity in ...

    Indian Academy of Sciences (India)

    Madhu

    Improving drought tolerance and productivity is one of the most difficult tasks for ... Keywords. Candidate gene; mapping population; polymerase chain reaction; single marker analysis. .... ple and the mean value computed. 2.4 Isolation of DNA.

  3. BoALMT1, an Al-Induced Malate Transporter in Cabbage, Enhances Aluminum Tolerance in Arabidopsis thaliana

    OpenAIRE

    Zhang, Lei; Wu, Xin-Xin; Wang, Jinfang; Qi, Chuandong; Wang, Xiaoyun; Wang, Gongle; Li, Mingyue; Li, Xingsheng; Guo, Yang-Dong

    2018-01-01

    Aluminum (Al) is present in approximately 50% of the arable land worldwide and is regarded as the main limiting factor of crop yield on acidic soil. Al-induced root malate efflux plays an important role in the Al tolerance of plants. Here, the aluminum induced malate transporter BoALMT1 (KF322104) was cloned from cabbage (Brassica oleracea). BoALMT1 showed higher expression in roots than in shoots. The expression of BoALMT1 was specifically induced by Al treatment, but not the trivalent catio...

  4. Damage Tolerance Assessment of Friction Pull Plug Welds in an Aluminum Alloy

    Science.gov (United States)

    McGill, Preston; Burkholder, Jonathan

    2012-01-01

    Friction stir welding is a solid state welding process used in the fabrication of cryogenic propellant tanks. Self-reacting friction stir welding is one variation of the friction stir weld process being developed for manufacturing tanks. Friction pull plug welding is used to seal the exit hole that remains in a circumferential self-reacting friction stir weld. A friction plug weld placed in a self-reacting friction stir weld results in a non-homogenous weld joint where the initial weld, plug weld, their respective heat affected zones and the base metal all interact. The welded joint is a composite plastically deformed material system with a complex residual stress field. In order to address damage tolerance concerns associated with friction plug welds in safety critical structures, such as propellant tanks, nondestructive inspection and proof testing may be required to screen hardware for mission critical defects. The efficacy of the nondestructive evaluation or the proof test is based on an assessment of the critical flaw size. Test data relating residual strength capability to flaw size in an aluminum alloy friction plug weld will be presented.

  5. Wheat genotypes differing in aluminum tolerance differ in their growth response to CO2 enrichment in acid soils

    OpenAIRE

    Tian, Qiuying; Zhang, Xinxin; Gao, Yan; Bai, Wenming; Ge, Feng; Ma, Yibing; Zhang, Wen-Hao

    2013-01-01

    Aluminum (Al) toxicity is a major factor limiting plant growth in acid soils. Elevated atmospheric CO2 [CO2] enhances plant growth. However, there is no report on the effect of elevated [CO2] on growth of plant genotypes differing in Al tolerance grown in acid soils. We investigated the effect of short-term elevated [CO2] on growth of Al-tolerant (ET8) and Al-sensitive (ES8) wheat plants and malate exudation from root apices by growing them in acid soils under ambient [CO2] and elevated [CO2]...

  6. Rapid activation of catalase followed by citrate efflux effectively improves aluminum tolerance in the roots of chick pea (Cicer arietinum).

    Science.gov (United States)

    Sharma, Manorma; Sharma, Vinay; Tripathi, Bhumi Nath

    2016-05-01

    The present study demonstrates the comparative response of two contrasting genotypes (aluminum (Al) tolerant and Al sensitive) of chick pea (Cicer arietinum) against Al stress. The Al-tolerant genotype (RSG 974) showed lesser inhibition of root growth as well as lower oxidative damages, measured in terms of the accumulation of H2O2 and lipid peroxidation compared to the Al-sensitive genotype (RSG 945). The accumulation of Al by roots of both genotypes was almost equal at 96 and 144 h after Al treatment; however, it was higher in Al-tolerant than Al-sensitive genotype at 48 h after Al treatment. Further, the Al-mediated induction of superoxide dismutase (SOD) activity was significantly higher in Al-tolerant than Al-sensitive genotype. Ascorbate peroxidase (APX) activity was almost similar in both genotypes. Al treatment promptly activated catalase activity in Al-tolerant genotype, and it was remarkably higher than that of Al-sensitive genotype. As another important Al detoxification mechanism, citrate efflux was almost equal in both genotypes except at 1000 μM Al treatment for 96 and 144 h. Further, citrate carrier and anion channel inhibitor experiment confirmed the contribution of citrate efflux in conferring Al tolerance in Al-tolerant genotype. Based on the available data, the present study concludes that rapid activation of catalase (also SOD) activity followed by citrate efflux effectively improves Al tolerance in chick pea.

  7. RAPD tagging of salt tolerance gene in rice

    International Nuclear Information System (INIS)

    Ding, H.; Zhang, G.; Guo, Y.; Chen, S.; Chen, S.

    1998-01-01

    Salinity, which is critical in determining the growth and development of plants, is a major problem affecting ever-increasing areas throughout the world. A salt tolerant rice mutant (M-20) was obtained from accession 77-170 (Oryza sativa) through EMS mutagenesis and selection in vitro. The use of 220 10-mer RAPD primers allowed the identification of a new molecular marker, whose genetic distance from a salt tolerance gene is about 16.4 cM. (author)

  8. Network Candidate Genes in Breeding for Drought Tolerant Crops

    Directory of Open Access Journals (Sweden)

    Christoph Tim Krannich

    2015-07-01

    Full Text Available Climate change leading to increased periods of low water availability as well as increasing demands for food in the coming years makes breeding for drought tolerant crops a high priority. Plants have developed diverse strategies and mechanisms to survive drought stress. However, most of these represent drought escape or avoidance strategies like early flowering or low stomatal conductance that are not applicable in breeding for crops with high yields under drought conditions. Even though a great deal of research is ongoing, especially in cereals, in this regard, not all mechanisms involved in drought tolerance are yet understood. The identification of candidate genes for drought tolerance that have a high potential to be used for breeding drought tolerant crops represents a challenge. Breeding for drought tolerant crops has to focus on acceptable yields under water-limited conditions and not on survival. However, as more and more knowledge about the complex networks and the cross talk during drought is available, more options are revealed. In addition, it has to be considered that conditioning a crop for drought tolerance might require the production of metabolites and might cost the plants energy and resources that cannot be used in terms of yield. Recent research indicates that yield penalty exists and efficient breeding for drought tolerant crops with acceptable yields under well-watered and drought conditions might require uncoupling yield penalty from drought tolerance.

  9. Expression of the 68-kilodalton neurofilament gene in aluminum intoxication

    International Nuclear Information System (INIS)

    Muma, N.A.; Troncoso, J.C.; Hoffman, P.N.; Price, D.L.

    1986-01-01

    Intrathecal administration of aluminum salts induces accumulation of neurofilaments (NFs) in cell bodies and proximal axons of rabbit spinal motor neurons. Mechanisms leading to this pathological change are not well understood. Although impairments of NF transport have been demonstrated in this model, the hypothesis that NF accumulations are the result of an increase in NF synthesis needs to be explored. In rabbits, a large percentage of neurons develop accumulations of NFs following injections of aluminum lactate directly into the cisterna magna or into a reservoir placed in the lateral ventricle. To study levels of mRNA encoding cytoskeletal proteins, spinal cord RNA was extracted, separated on a denaturing agarose gel, transferred to nitrocellulose paper, and hybridized to [ 32 P]-labeled cDNA clones encoding the mouse 68-kilodalton (kd) NF subunit and tubulin. Examining a constant amount of RNA, the radioactivity of labeled mRNA bands for the 68-kd NF subunit and for tubulin was decreased in spinal cords of aluminum-treated rabbits. These preliminary results will be followed up by in situ hybridization to determine levels of mRNA for tubulin and 68-kd NF subunit in affected and in normal spinal neurons. In conclusion, administration of aluminum decreased mRNA for the 608-kd NF protein in spinal neurons

  10. Aluminum-Tolerant Pisolithus Ectomycorrhizas Confer Increased Growth, Mineral Nutrition, and Metal Tolerance to Eucalyptus in Acidic Mine Spoil

    Directory of Open Access Journals (Sweden)

    Louise Egerton-Warburton

    2015-01-01

    Full Text Available Ectomycorrhizal fungi (ECM may increase the tolerance of their host plants to Al toxicity by immobilizing Al in fungal tissues and/or improving plant mineral nutrition. Although these benefits have been demonstrated in in vitro (pure culture or short-term nutrient solution (hydroponic experiments, fewer studies have examined these benefits in the field. This study examined the growth, mineral nutrition, and Al levels in two Eucalyptus species inoculated with three Pisolithus ecotypes that varied in Al tolerance (in vitro and grown in mine spoil in the greenhouse and field. All three ecotypes of Pisolithus improved Eucalyptus growth and increased host plant tolerance to Al in comparison to noninoculated plants. However, large variations in plant growth and mineral nutrition were detected among the Pisolithus-inoculated plants; these differences were largely explained by the functional properties of the Pisolithus inoculum. Seedlings inoculated with the most Al-tolerant Pisolithus inoculum showed significantly higher levels of N, P, Ca, Mg, and K and lower levels of Al than seedlings inoculated with Al-sensitive ecotypes of Pisolithus. These findings indicate an agreement between the fungal tolerance to Al in vitro and performance in symbiosis, indicating that both ECM-mediated mineral nutrient acquisition and Al accumulation are important in increasing the host plant Al tolerance.

  11. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  12. Associated mechanisms of aluminum tolerance in plants/ Mecanismos associados à tolerância ao alumínio em plantas

    Directory of Open Access Journals (Sweden)

    Cecília Estima Sacramento dos Reis

    2007-10-01

    Full Text Available Aluminum toxicity is one of the major limiting factor regarding plant development in acid soils. The use of liming for correcting soil pH is not viable for some of acid soil areas (technique or economic reasons, making the development of Al tolerant genotypes the best alternative. Thus, the tolerance mechanisms as well as the genetic basis of Al tolerance has deserved special attention in the scientific community. In the last years, a significant progress has been achieved towards these goals, as well as in developing cultivars adapted to acid soils. The Al tolerance mechanisms are divided basically in two classes: the exclusion mechanisms that act after absorption or blocking its entry in the root system and those involved in detoxification, complexing the Al in specific organelles, mainly in the vacuoles. In many species, physiological mechanisms have been reported as responsible for the activation of organic acids (mainly citrate and malate that act as Al quelating agents, however many process are not yet understood and cleared. Currently, the basis for the internal detoxification is becoming clear through organic acid complexes and there sequestering by the vacuoles. Other potential mechanisms are the target for discussions.A toxicidade do alumínio é um dos principais fatores limitantes do desenvolvimento das plantas em solos ácidos. Pelo fato da utilização de corretivos da acidez do solo não ser a estratégia mais viável em muitas situações com solos ácidos (por razões técnicas e econômicas, o desenvolvimento de genótipos tolerantes ao Al tem sido o caminho mais focado, assim a investigação dos mecanismos de tolerância bem como as bases genéticas da tolerância ao Al têm merecido atenção especial pela pesquisa científica. Nos últimos anos, foi gerado um significativo progresso no entendimento das bases dos mecanismos de tolerância ao Al, assim como no desenvolvimento de cultivares mais adaptados as condições de

  13. Rice-arsenate interactions in hydroponics: a three-gene model for tolerance.

    Science.gov (United States)

    Norton, Gareth J; Nigar, Meher; Williams, Paul N; Dasgupta, Tapash; Meharg, Andrew A; Price, Adam H

    2008-01-01

    In this study, the genetic mapping of the tolerance of root growth to 13.3 muM arsenate [As(V)] using the BalaxAzucena population is improved, and candidate genes for further study are identified. A remarkable three-gene model of tolerance is advanced, which appears to involve epistatic interaction between three major genes, two on chromosome 6 and one on chromosome 10. Any combination of two of these genes inherited from the tolerant parent leads to the plant having tolerance. Lists of potential positional candidate genes are presented. These are then refined using whole genome transcriptomics data and bioinformatics. Physiological evidence is also provided that genes related to phosphate transport are unlikely to be behind the genetic loci conferring tolerance. These results offer testable hypotheses for genes related to As(V) tolerance that might offer strategies for mitigating arsenic (As) accumulation in consumed rice.

  14. Rice–arsenate interactions in hydroponics: a three-gene model for tolerance

    Science.gov (United States)

    Norton, Gareth J.; Nigar, Meher; Dasgupta, Tapash; Meharg, Andrew A.; Price, Adam H.

    2008-01-01

    In this study, the genetic mapping of the tolerance of root growth to 13.3 μM arsenate [As(V)] using the Bala×Azucena population is improved, and candidate genes for further study are identified. A remarkable three-gene model of tolerance is advanced, which appears to involve epistatic interaction between three major genes, two on chromosome 6 and one on chromosome 10. Any combination of two of these genes inherited from the tolerant parent leads to the plant having tolerance. Lists of potential positional candidate genes are presented. These are then refined using whole genome transcriptomics data and bioinformatics. Physiological evidence is also provided that genes related to phosphate transport are unlikely to be behind the genetic loci conferring tolerance. These results offer testable hypotheses for genes related to As(V) tolerance that might offer strategies for mitigating arsenic (As) accumulation in consumed rice. PMID:18453529

  15. Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

    Science.gov (United States)

    Xiaoqing Yu; Guihua Bai; Shuwei Liu; Na Luo; Ying Wang; Douglas S. Richmond; Paula M. Pijut; Scott A. Jackson; Jianming Yu; Yiwei. Jiang

    2013-01-01

    Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse...

  16. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  17. Transcriptomic variation among six Arabidopsis thaliana accessions identified several novel genes controlling aluminium tolerance.

    Science.gov (United States)

    Kusunoki, Kazutaka; Nakano, Yuki; Tanaka, Keisuke; Sakata, Yoichi; Koyama, Hiroyuki; Kobayashi, Yuriko

    2017-02-01

    Differences in the expression levels of aluminium (Al) tolerance genes are a known determinant of Al tolerance among plant varieties. We combined transcriptomic analysis of six Arabidopsis thaliana accessions with contrasting Al tolerance and a reverse genetic approach to identify Al-tolerance genes responsible for differences in Al tolerance between accession groups. Gene expression variation increased in the signal transduction process under Al stress and in growth-related processes in the absence of stress. Co-expression analysis and promoter single nucleotide polymorphism searching suggested that both trans-acting polymorphisms of Al signal transduction pathway and cis-acting polymorphisms in the promoter sequences caused the variations in gene expression associated with Al tolerance. Compared with the wild type, Al sensitivity increased in T-DNA knockout (KO) lines for five genes, including TARGET OF AVRB OPERATION1 (TAO1) and an unannotated gene (At5g22530). These were identified from 53 Al-inducible genes showing significantly higher expression in tolerant accessions than in sensitive accessions. These results indicate that the difference in transcriptional signalling is partly associated with the natural variation in Al tolerance in Arabidopsis. Our study also demonstrates the feasibility of comparative transcriptome analysis by using natural genetic variation for the identification of genes responsible for Al stress tolerance. © 2016 John Wiley & Sons Ltd.

  18. Relative abundance of Delta(5)-sterols in plasma membrane lipids of root-tip cells correlates with aluminum tolerance of rice.

    Science.gov (United States)

    Khan, M Shahadat Hossain; Tawaraya, Keitarou; Sekimoto, Hiroshi; Koyama, Hiroyuki; Kobayashi, Yuriko; Murayama, Tetsuya; Chuba, Masaru; Kambayashi, Mihoko; Shiono, Yoshihito; Uemura, Matsuo; Ishikawa, Satoru; Wagatsuma, Tadao

    2009-01-01

    We investigated variations in aluminum (Al) tolerance among rice plants, using ancestor cultivars from the family line of the Al-tolerant and widely cultivated Japonica cultivar, Sasanishiki. The cultivar Rikuu-20 was Al sensitive, whereas a closely related cultivar that is a descendant of Rikuu-20, Rikuu-132, was Al tolerant. These two cultivars were compared to determine mechanisms underlying variations in Al tolerance. The sensitive cultivar Rikuu-20 showed increased permeability of the plasma membrane (PM) and greater Al uptake within 1 h of Al treatment. This could not be explained by organic acid release. Lipid composition of the PM differed between these cultivars, and may account for the difference in Al tolerance. The tolerant cultivar Rikuu-132 had a lower ratio of phospholipids to Delta(5)-sterols than the sensitive cultivar Rikuu-20, suggesting that the PM of Rikuu-132 is less negatively charged and less permeabilized than that of Rikuu-20. We used inhibitors of Delta(5)-sterol synthesis to alter the ratio of phospholipids to Delta(5)-sterols in both cultivars. These inhibitors reduced Al tolerance in Rikuu-132 and its Al-tolerant ancestor cultivars Kamenoo and Kyoku. In addition, Rikuu-132 showed a similar level of Al sensitivity when the ratio of phospholipids to Delta(5)-sterols was increased to match that of Rikuu-20 after treatment with uniconazole-P, an inhibitor of obtusifoliol-14alpha-demethylase. These results indicate that PM lipid composition is a factor underlying variations in Al tolerance among rice cultivars.

  19. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  20. Alcohol-induced histone acetylation reveals a gene network involved in alcohol tolerance.

    Directory of Open Access Journals (Sweden)

    Alfredo Ghezzi

    Full Text Available Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol.

  1. Quantitative transcription dynamic analysis reveals candidate genes and key regulators for ethanol tolerance in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Ma Menggen

    2010-06-01

    Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance

  2. In vitro selection of induced mutants to salt-tolerance: Inducible gene regulation for salt tolerance

    Energy Technology Data Exchange (ETDEWEB)

    Winicov, I [Department of Microbiology and Biochemistry, Univ. of Nevada-Reno, Reno, NV (United States)

    1997-07-01

    A selection protocol to obtain salt tolerant calli, followed by regeneration and progeny-test of the regenerated plants for salt tolerance in rice was investigated. Callus cultures were initiated from salt-sensitive US elite rice lines and cv. `Pokkali`. Salt-tolerant cell lines were selected from these by a single step selection procedure. The selected salt-tolerant lines grew well on medium with {+-} 0.5% or 1% NaCl, while the parent lines occasionally survived, but did not grow at these salt concentrations. Plants were regenerated from these cell lines through different passages on medium containing salt. Seed was collected from the regenerated plants and salt tolerance of R2 seedlings was compared with those regenerated without salt selection. Salt-tolerance was measured by survival and productive growth of newly germinated seedlings in Hoagland solution with 0.3% and 0.5% NaCl for 4 weeks. Heritable improvement in salt tolerance was obtained in R2 seedlings from one plant regenerated after 5 months selection. Survival and growth of these seedlings was equivalent to that from `Pokkali` seedlings. These results show that cellular tolerance can provide salt-tolerance in rice plants. (author). 6 refs, 2 tabs.

  3. In vitro selection of induced mutants to salt-tolerance: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    Winicov, I.

    1997-01-01

    A selection protocol to obtain salt tolerant calli, followed by regeneration and progeny-test of the regenerated plants for salt tolerance in rice was investigated. Callus cultures were initiated from salt-sensitive US elite rice lines and cv. 'Pokkali'. Salt-tolerant cell lines were selected from these by a single step selection procedure. The selected salt-tolerant lines grew well on medium with ± 0.5% or 1% NaCl, while the parent lines occasionally survived, but did not grow at these salt concentrations. Plants were regenerated from these cell lines through different passages on medium containing salt. Seed was collected from the regenerated plants and salt tolerance of R2 seedlings was compared with those regenerated without salt selection. Salt-tolerance was measured by survival and productive growth of newly germinated seedlings in Hoagland solution with 0.3% and 0.5% NaCl for 4 weeks. Heritable improvement in salt tolerance was obtained in R2 seedlings from one plant regenerated after 5 months selection. Survival and growth of these seedlings was equivalent to that from 'Pokkali' seedlings. These results show that cellular tolerance can provide salt-tolerance in rice plants. (author). 6 refs, 2 tabs

  4. Tolerância ao alumínio em cultivares de aveia branca sob cultivo hidropônico Tolerance to the aluminum in oat cultivars under hydroponic culture

    Directory of Open Access Journals (Sweden)

    José Antonio Gonzalez da Silva

    2007-01-01

    Full Text Available O emprego do cultivo hidropônico para avaliar a tolerância à toxicidade pelo alumínio em genótipos de aveia pode ser feito por meio da medida da retomada do crescimento de raiz. Avaliaram-se 12 cultivares de aveia branca indicadas para o cultivo no Sul do Brasil com o intuito de caracterizar a tolerância ao alumínio, de maneira a ser estrategicamente recomendadas e/ou incluídas em blocos de cruzamento na obtenção de constituições genéticas de elevado potencial produtivo e tolerante ao íon metálico. Foram utilizadas doses de 10, 15 e 20 mg L-1 de alumínio na solução hidropônica e o delineamento experimental adotado foi o completamente casualizado, com três repetições, seguindo o esquema fatorial (12 x 3. As doses empregadas são altamente eficientes na identificação de genótipos de aveia tolerantes e sensíveis ao alumínio tóxico. As cultivares UPF 16, URS 21, UFRGS 14, UPF 19 e UFRGS 17 expressam tolerância.The use of hidroponic culture to evaluate tolerance to aluminum toxicity in oat genotypes can be performed by measuring root regrowth, allowing phenotypically to discriminate tolerant genetic constitutions sensitivity. Twelve white oat cultivars indicated for cultivation in Southern Brazil were evaluated aiming at to characterize their aluminum tolerance, in order to use them as parents in crosses or to recommend them for in cultivation regions. Aluminum concentration of 10, 15 and 20 mg L-1 were used in the hydroponic solution arranged in complete randomized blocks with three replications in 12 x 3 factorial designs. Concentrations of 10, 15 and 20 mg L-1 were highly efficient for the identification of tolerant and sensitive oat genotypes. Cultivars UPF 16, URS 21, UFRGS 14, UPF 19 and UFRGS 17 showed aluminum.

  5. Boron Supply Enhances Aluminum Tolerance in Root Border Cells of Pea (Pisum sativum by Interacting with Cell Wall Pectins

    Directory of Open Access Journals (Sweden)

    Xue Wen Li

    2017-05-01

    Full Text Available Aluminum (Al toxicity is the primary factor limiting crop growth in acidic soils. Boron (B alleviates Al toxicity in plants, which is mainly considered to be due to the formation of Rhamnogalacturonan II-B (RGII-B complexes, which helps to stabilize the cytoskeleton. It is unclear yet whether this is due to the increasing of net negative charges and/or further mechanisms. Kinetics of Al accumulation and adsorption were investigated using entire cells, cell wall and pectin of root border cells (RBCs of pea (Pisum sativum, to reveal the mechanism of B in interacting with alkali-soluble and chelator-soluble pectin for an increased Al tolerance in RBCs. The results show that B could rescue RBCs from Al-induced cell death by accumulating more Al in the cell wall, predominately in alkali-soluble pectin. Boron also promotes Al3+ adsorption and inhibits Al3+ desorption from alkali-soluble pectin. Thus, more Al3+ is immobilized within the alkali-soluble pectin fraction and less in the chelator-soluble pectin, rendering Al3+ less mobile. Boron induces an increase of RG-II (KDO,2-keto-3-deoxyoctonic acid content for forming more borate-RGII complexes, and the decrease of pectin methyl-esterification, thus creates more negative charges to immobilize Al3+ in cell wall pectin. The study provides evidence that abundant B supply enhances the immobilization of Al in alkali-soluble pectin, thus most likely reducing the entry of Al3+ into the symplast from the surroundings.

  6. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea.

    Science.gov (United States)

    Nakahara, Yoshiki; Sawabe, Shogo; Kainuma, Kenta; Katsuhara, Maki; Shibasaka, Mineo; Suzuki, Masanori; Yamamoto, Kosuke; Oguri, Suguru; Sakamoto, Hikaru

    2015-01-01

    Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1) a novel protein highly homologous to thaumatin-like proteins, (2) a novel coiled-coil protein of unknown function, and (3) a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  7. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

    Directory of Open Access Journals (Sweden)

    Yoshiki eNakahara

    2015-10-01

    Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  8. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    OpenAIRE

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

    2015-01-01

    Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

  9. Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

    Science.gov (United States)

    Jespersen, David; Belanger, Faith C; Huang, Bingru

    2017-01-01

    Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

  10. Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

    Directory of Open Access Journals (Sweden)

    David Jespersen

    Full Text Available Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L. x creeping bentgrass (Agrostis stolonifera L. hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease, antioxidant defense (catalase and glutathione-S-transferase, energy metabolism (glyceraldehyde-3-phosphate dehydrogenase, cell expansion (expansin, and stress protection (heat shock proteins HSP26, HSP70, and HSP101. Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

  11. Role of Metabolic Genes in Blood Aluminum Concentrations of Jamaican Children with and without Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Mohammad H. Rahbar

    2016-11-01

    Full Text Available Aluminum is a neurotoxic metal with known health effects in animals and humans. Glutathione-S-transferase (GST genes and enzymes play a major role in detoxification of several heavy metals. Besides a direct relationship with oxidative stress; aluminum decreases GST enzyme activities. Using data from 116 Jamaican children; age 2–8 years; with Autism Spectrum Disorder (ASD and 116 sex- and age-matched typically developing (TD children; we investigated the association of polymorphisms in three GST genes (GSTP1; GSTM1; and GSTT1 with mean blood aluminum concentrations in children with and without ASD. Using log-transformed blood aluminum concentration as the dependent variable in a linear regression model; we assessed the additive and interactive effects of ASD status and polymorphisms in the three aforementioned GST genes in relation to blood aluminum concentrations. Although none of the additive effects were statistically significant (all p > 0.16; we observed a marginally significant interaction between GSTP1 Ile105Val (rs1695 and ASD status (p = 0.07; even after controlling for parental education level and consumption of avocado; root vegetables; and tuna (canned fish. Our findings indicate a significantly lower (p < 0.03 adjusted geometric mean blood aluminum concentration for TD children who had the Val/Val genotype (14.57 µg/L; compared with those with Ile/Ile or Ile/Val genotypes who had an adjusted geometric mean of 23.75 µg/L. However; this difference was not statistically significant among the ASD cases (p = 0.76. Our findings indicate that ASD status may be a potential effect modifier when assessing the association between GSTP1 rs1695 and blood aluminum concentrations among Jamaican children. These findings require replication in other populations.

  12. Quantitative Trait Locus Mapping of Salt Tolerance and Identification of Salt-Tolerant Genes in Brassica napus L

    Directory of Open Access Journals (Sweden)

    Lina Lang

    2017-06-01

    Full Text Available Salinity stress is one of typical abiotic stresses that seriously limit crop production. In this study, a genetic linkage map based on 532 molecular markers covering 1341.1 cM was constructed to identify the loci associated with salt tolerance in Brassica napus. Up to 45 quantitative trait loci (QTLs for 10 indicators were identified in the F2:3 populations. These QTLs can account for 4.80–51.14% of the phenotypic variation. A major QTL, qSPAD5 on LG5 associated with chlorophyll can be detected in three replicates. Two intron polymorphic (IP markers in this QTL region were developed successfully to narrow down the QTL location to a region of 390 kb. A salt tolerance related gene Bra003640 was primary identified as the candidate gene in this region. The full length of the candidate gene was 1,063 bp containing three exons and two introns in B. napus L. The open reading frame (ORF is 867 bp and encodes 287 amino acids. Three amino acid differences (34, 54, and 83 in the conserved domain (B-box were identified. RT-qPCR analysis showed that the gene expression had significant difference between the two parents. The study laid great foundation for salt tolerance related gene mapping and cloning in B. napus L.

  13. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    Science.gov (United States)

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. © 2016 The Royal Entomological Society.

  14. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    is linked to a different set of circumstances than the ones suggested by existing models in contemporary democratic theory. Reorienting the discussion of tolerance, the book raises the question of how to disclose new possibilities within our given context of affect and perception. Once we move away from......Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated...... by the desire to experiment and to become otherwise. The objective is to discuss what gets lost, conceptually as well as politically, when we neglect the subsistence of active tolerance within other practices of tolerance, and to develop a theory of active tolerance in which tolerance's mobilizing character...

  15. Detection of drought tolerant genes within seedling apple rootstocks in Syria

    Science.gov (United States)

    This investigation was conducted to detect the drought tolerant genes (four genes) within seedling apple rootstocks derived from five apple genotypes, including Syrian apple cultivars. The results showed that the gene MdPepPro (a cyclophilin) was found in all studied genotypes and their progenies e...

  16. Low cadmium (LCD), a novel gene related to cadmium tolerance and accumulation in rice

    OpenAIRE

    Shimo, Hugo; Ishimaru, Yasuhiro; An, Gynheung; Yamakawa, Takashi; Nakanishi, Hiromi; Nishizawa, Naoko K.

    2011-01-01

    The contamination of food crops by cadmium (Cd) is a major concern in food production because it can reduce crop yields and threaten human health. In this study, knockout rice plants (Oryza sativa) tagged with the gene trap vector pGA2707 were screened for Cd tolerance, and the tolerant line lcd was obtained. The lcd mutant showed tolerance to Cd on agar plates and in hydroponic culture during early plant development. Metal concentration measurements in hydroponically grown plants revealed si...

  17. Cloning of genes and developing transgenic crops with enhanced tolerance to salinity and drought (abstract)

    International Nuclear Information System (INIS)

    Bansal, K.C.; Chinnusamy, V.; Tayal, D.; Das, A.; Goel, D.; Yadav, V.; Singh, A.K.; Lakhshmi, K.

    2005-01-01

    Abiotic stresses represent the most limiting factors affecting agricultural productivity. In India more than 60% of total cultivated land is still rainfed and crops experience frequent droughts. Thus, we need to develop transgenic crops tolerant to drought, and other related abiotic stress factors such as salinity, low and high temperature stresses. At the National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (ICAR), we have initiated a programme on developing transgenic crops tolerant to a range of abiotic stresses. The major emphasis is on developing transgenic potato, tomato, mustard, rice and wheat. While, transgenic plants of potato. tomato and mustard have already been generated with osmotin gene and are at different stages of testing, other key genes imparting tolerance to abiotic stresses are being isolated from different species for producing transgenic rice and wheat cultivars tolerant to multiple stresses. Genes that have been isolated in our laboratory include ascorbate peroxidase gene (TaApx) and genes encoding transcription factor, CBFs (TaCBF2 and TaCBP3) from a drought tolerant wheat cultivar (C306), Lea1 cDNA from Brassica species, codA from Arthrobacter globiformis, and otsBA operon from E. coli. Apart from these stress-related genes, we have isolated a few stress-inducible promoters for deploying them in gene stacking in developing transgenic crops with enhanced tolerance to multiple abiotic stresses. The results will be presented. (author)

  18. The Heat Shock Protein 26 Gene is Required for Ethanol Tolerance in Drosophila

    Directory of Open Access Journals (Sweden)

    Awoyemi A. Awofala

    2011-01-01

    Full Text Available Stress plays an important role in drug- and addiction-related behaviours. However, the mechanisms underlying these behavioural responses are still poorly understood. In the light of recent reports that show consistent regulation of many genes encoding stress proteins including heat shock proteins following ethanol exposure in Drosophila , it was hypothesised that transition to alcohol dependence may involve the dysregulation of the circuits that mediate behavioural responses to stressors. Thus, behavioural genetic methodologies were used to investigate the role of the Drosophila hsp26 gene, a small heat shock protein coding gene which is induced in response to various stresses, in the development of rapid tolerance to ethanol sedation. Rapid tolerance was quantified as the percentage difference in the mean sedation times between the second and first ethanol exposure. Two independently isolated P-element mutations near the hsp26 gene eliminated the capacity for tolerance. In addition, RNAi-mediated functional knockdown of hsp26 expression in the glial cells and the whole nervous system also caused a defect in tolerance development. The rapid tolerance phenotype of the hsp26 mutants was rescued by the expression of the wild-type hsp26 gene in the nervous system. None of these manipulations of the hsp26 gene caused changes in the rate of ethanol absorption. Hsp26 genes are evolutionary conserved, thus the role of hsp26 in ethanol tolerance may present a new direction for research into alcohol dependency.

  19. The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms

    DEFF Research Database (Denmark)

    Nilsson, Carl Martin Peter; Rybtke, Morten; Givskov, Michael

    2016-01-01

    library for genes that are important for biofilm-associated antimicrobial tolerance provided evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The minimum bactericidal concentration for biofilm cells (MBC-B) for a dltA transposon mutant was eight-fold lower...... and complemented strain confirmed that the dlt genes in S. mutans play a role in biofilm-associated tolerance to gentamicin. Confocal laser scanning microscopy analyses of biofilms grown on glass slides showed that the dltA mutant produced roughly the same amount of biofilm as the wild-type, indicating...... that the reduced antimicrobial tolerance of the dltA mutant is not due to a defect in biofilm formation. The products of the dlt genes have been shown to mediate alanylation of teichoic acids, and in accordance the dltA mutant showed a more negatively charged surface than the wild-type, which likely...

  20. A potato NOA gene increased salinity tolerance in Arabidopsis ...

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... in Arabidopsis thaliana salt stress responses and increased its salinity tolerance. Key words: StNOA1 ... (NR)-dependent pathways (Cueto et al., 1996; Delledonne ..... plastome-encoded proteins uncovers a mechanism for the.

  1. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated by the d...... these alternatives by returning to the notion of tolerance as the endurance of pain, linking this notion to exemplars and theories relevant to the politics of multiculturalism, religious freedom, and free speech....

  2. Meta-analysis and candidate gene mining of low-phosphorus tolerance in maize.

    Science.gov (United States)

    Zhang, Hongwei; Uddin, Mohammed Shalim; Zou, Cheng; Xie, Chuanxiao; Xu, Yunbi; Li, Wen-Xue

    2014-03-01

    Plants with tolerance to low-phosphorus (P) can grow better under low-P conditions, and understanding of genetic mechanisms of low-P tolerance can not only facilitate identifying relevant genes but also help to develop low-P tolerant cultivars. QTL meta-analysis was conducted after a comprehensive review of the reports on QTL mapping for low-P tolerance-related traits in maize. Meta-analysis produced 23 consensus QTL (cQTL), 17 of which located in similar chromosome regions to those previously reported to influence root traits. Meanwhile, candidate gene mining yielded 215 genes, 22 of which located in the cQTL regions. These 22 genes are homologous to 14 functionally characterized genes that were found to participate in plant low-P tolerance, including genes encoding miR399s, Pi transporters and purple acid phosphatases. Four cQTL loci (cQTL2-1, cQTL5-3, cQTL6-2, and cQTL10-2) may play important roles for low-P tolerance because each contains more original QTL and has better consistency across previous reports. © 2014 Institute of Botany, Chinese Academy of Sciences.

  3. Expression of Aluminum-Induced Genes in Transgenic Arabidopsis Plants Can Ameliorate Aluminum Stress and/or Oxidative Stress1

    Science.gov (United States)

    Ezaki, Bunichi; Gardner, Richard C.; Ezaki, Yuka; Matsumoto, Hideaki

    2000-01-01

    To examine the biological role of Al-stress-induced genes, nine genes derived from Arabidopsis, tobacco (Nicotiana tabacum L.), wheat (Triticum aestivum L.), and yeast (Saccharomyces cerevisiae) were expressed in Arabidopsis ecotype Landsberg. Lines containing eight of these genes were phenotypically normal and were tested in root elongation assays for their sensitivity to Al, Cd, Cu, Na, Zn, and to oxidative stresses. An Arabidopsis blue-copper-binding protein gene (AtBCB), a tobacco glutathione S-transferase gene (parB), a tobacco peroxidase gene (NtPox), and a tobacco GDP-dissociation inhibitor gene (NtGDI1) conferred a degree of resistance to Al. Two of these genes, AtBCB and parB, and a peroxidase gene from Arabidopsis (AtPox) also showed increased resistance to oxidative stress induced by diamide, while parB conferred resistance to Cu and Na. Al content of Al-treated root tips was reduced in the four Al-resistant plant lines compared with wild-type Ler-0, as judged by morin staining. All four Al-resistant lines also showed reduced staining of roots with 2′,7′-dichloro fluorescein diacetate (H2DCFDA), an indicator of oxidative stress. We conclude that Al-induced genes can serve to protect against Al toxicity, and also provide genetic evidence for a link between Al stress and oxidative stress in plants. PMID:10712528

  4. In vitro selection of mutants: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    Winicov, I.; Bastola, D.R.; Deutch, C.E.; Pethe, V.V.; Petrusa, L.

    2001-01-01

    Regulation of differentially expressed genes in plants may be involved in inducing tolerance to stress. Isogenic salt-sensitive and salt-tolerant alfalfa lines were investigated for molecular differences in their response to salt. The genes, which are differentially induced by salt in the salt-tolerant alfalfa cells and are also regulated by salt at the whole plant level, were cloned. Both transcriptional and post- transcriptional mechanisms influenced salt-induced product accumulation in the salt-tolerant alfalfa. The salt-tolerant plants doubled proline concentration rapidly in roots, while salt-sensitive plants showed a delayed response. To understand the regulatory system in the salt-tolerant alfalfa, two genes that are expressed in roots were studied. Alfin1 encodes a zinc-finger type putative DNA transcription factor conserved in alfalfa, rice and Arabidopsis, and MsPRP2 encodes a protein that serves as a cell wall- membrane linker in roots. Recombinant Alfin1 protein was selected, amplified, cloned and its consensus sequence was identified. The recombinant Alfin1 also bound specifically to fragments of the MsPRP2 promoter in vitro, containing the Alfin1 binding consensus sequence. The results show unambiguously binding specificity of Alfin1 DNA, supporting its role in gene regulation. Alfin1 function was tested in transformed alfalfa in vivo by over-expressing Alfin1 from 35S CaMV promoter. The transgenic plants appeared normal. However, plants harboring the anti-sense construct did not grow well in soil, indicating that Alfin1 expression was essential. Alfin1 over-expression in transgenic alfalfa led to enhanced levels of MsPRP2 transcript accumulation, demonstrating that Alfin1 functioned in vivo in gene regulation. Since MsPRP2 gene is also induced by salt, it is likely that Alfin1 is an important transcription factor for gene regulation in salt-tolerant alfalfa, and an excellent target for manipulation to improve salt tolerance. (author)

  5. Suppression of a NAC-like transcription factor gene improves boron-toxicity tolerance in rice.

    Science.gov (United States)

    Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru

    2011-07-01

    We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity.

  6. Relative expression of genes related with cold tolerance in ...

    African Journals Online (AJOL)

    SAM

    2014-06-18

    Jun 18, 2014 ... Low temperature is one of the main abiotic stresses affecting rice yield in Chile. Alterations ... To find mechanisms of cold tolerance in Chilean cultivars, we ... dependent on the development stage and the intensity of the cold ...

  7. Over-expression of Sub1 A, a submergence tolerance gene from ...

    African Journals Online (AJOL)

    Sub1A, an ethylene-response-factor-like (ERE-like) gene, mediates the extinguished submergence tolerance of rice. To gain further insight into the function of Sub1A in other species, we transformed tobacco plants with the gene under the control of the ubiquitin promoter. Compared to the wild-type plants, transgenic plants ...

  8. Novel properties of the wheat aluminum tolerance organic acid transporter (TaALMT1) revealed by electrophysiological characterization in Xenopus Oocytes: functional and structural implications.

    Science.gov (United States)

    Piñeros, Miguel A; Cançado, Geraldo M A; Kochian, Leon V

    2008-08-01

    Many plant species avoid the phytotoxic effects of aluminum (Al) by exuding dicarboxylic and tricarboxylic acids that chelate and immobilize Al(3+) at the root surface, thus preventing it from entering root cells. Several novel genes that encode membrane transporters from the ALMT and MATE families recently were cloned and implicated in mediating the organic acid transport underlying this Al tolerance response. Given our limited understanding of the functional properties of ALMTs, in this study a detailed characterization of the transport properties of TaALMT1 (formerly named ALMT1) from wheat (Triticum aestivum) expressed in Xenopus laevis oocytes was conducted. The electrophysiological findings are as follows. Although the activity of TaALMT1 is highly dependent on the presence of extracellular Al(3+) (K(m1/2) of approximately 5 microm Al(3+) activity), TaALMT1 is functionally active and can mediate ion transport in the absence of extracellular Al(3+). The lack of change in the reversal potential (E(rev)) upon exposure to Al(3+) suggests that the "enhancement" of TaALMT1 malate transport by Al is not due to alteration in the transporter's selectivity properties but is solely due to increases in its anion permeability. The consistent shift in the direction of the E(rev) as the intracellular malate activity increases indicates that TaALMT1 is selective for the transport of malate over other anions. The estimated permeability ratio between malate and chloride varied between 1 and 30. However, the complex behavior of the E(rev) as the extracellular Cl(-) activity was varied indicates that this estimate can only be used as a general guide to understanding the relative affinity of TaALMT1 for malate, representing only an approximation of those expected under physiologically relevant ionic conditions. TaALMT1 can also mediate a large anion influx (i.e. outward currents). TaALMT1 is permeable not only to malate but also to other physiologically relevant anions such as Cl

  9. Novel Properties of the Wheat Aluminum Tolerance Organic Acid Transporter (TaALMT1) Revealed by Electrophysiological Characterization in Xenopus Oocytes: Functional and Structural Implications1[OA

    Science.gov (United States)

    Piñeros, Miguel A.; Cançado, Geraldo M.A.; Kochian, Leon V.

    2008-01-01

    Many plant species avoid the phytotoxic effects of aluminum (Al) by exuding dicarboxylic and tricarboxylic acids that chelate and immobilize Al3+ at the root surface, thus preventing it from entering root cells. Several novel genes that encode membrane transporters from the ALMT and MATE families recently were cloned and implicated in mediating the organic acid transport underlying this Al tolerance response. Given our limited understanding of the functional properties of ALMTs, in this study a detailed characterization of the transport properties of TaALMT1 (formerly named ALMT1) from wheat (Triticum aestivum) expressed in Xenopus laevis oocytes was conducted. The electrophysiological findings are as follows. Although the activity of TaALMT1 is highly dependent on the presence of extracellular Al3+ (Km1/2 of approximately 5 μm Al3+ activity), TaALMT1 is functionally active and can mediate ion transport in the absence of extracellular Al3+. The lack of change in the reversal potential (Erev) upon exposure to Al3+ suggests that the “enhancement” of TaALMT1 malate transport by Al is not due to alteration in the transporter's selectivity properties but is solely due to increases in its anion permeability. The consistent shift in the direction of the Erev as the intracellular malate activity increases indicates that TaALMT1 is selective for the transport of malate over other anions. The estimated permeability ratio between malate and chloride varied between 1 and 30. However, the complex behavior of the Erev as the extracellular Cl− activity was varied indicates that this estimate can only be used as a general guide to understanding the relative affinity of TaALMT1 for malate, representing only an approximation of those expected under physiologically relevant ionic conditions. TaALMT1 can also mediate a large anion influx (i.e. outward currents). TaALMT1 is permeable not only to malate but also to other physiologically relevant anions such as Cl−, NO3−, and

  10. Comparison of genome-wide selection strategies to identify furfural tolerance genes in Escherichia coli.

    Science.gov (United States)

    Glebes, Tirzah Y; Sandoval, Nicholas R; Gillis, Jacob H; Gill, Ryan T

    2015-01-01

    Engineering both feedstock and product tolerance is important for transitioning towards next-generation biofuels derived from renewable sources. Tolerance to chemical inhibitors typically results in complex phenotypes, for which multiple genetic changes must often be made to confer tolerance. Here, we performed a genome-wide search for furfural-tolerant alleles using the TRackable Multiplex Recombineering (TRMR) method (Warner et al. (2010), Nature Biotechnology), which uses chromosomally integrated mutations directed towards increased or decreased expression of virtually every gene in Escherichia coli. We employed various growth selection strategies to assess the role of selection design towards growth enrichments. We also compared genes with increased fitness from our TRMR selection to those from a previously reported genome-wide identification study of furfural tolerance genes using a plasmid-based genomic library approach (Glebes et al. (2014) PLOS ONE). In several cases, growth improvements were observed for the chromosomally integrated promoter/RBS mutations but not for the plasmid-based overexpression constructs. Through this assessment, four novel tolerance genes, ahpC, yhjH, rna, and dicA, were identified and confirmed for their effect on improving growth in the presence of furfural. © 2014 Wiley Periodicals, Inc.

  11. Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.

    Science.gov (United States)

    Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel

    2014-09-01

    Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  12. Tolerância de cultivares de arroz a diferentes níveis de alumínio em solução nutritiva Rice cultivars tolerance to different levels of aluminum in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1983-01-01

    relation to their tolerance to aluminum toxicity, at temperature of 25 ± 1°C and 30 ± 1°C using five different aluminum levels in 8.3 liter pots with 330 seedlings/pot, under controlled growth conditions. The tolerance was measured taking into account the root growth in an aluminum-free complete nutrient solution after a previous aluminum treatment. With an excessive amount of Al3+, the primary roots did not grow at all and remained thickened at the tip, showing a typical aluminum injury. In nutrient solutions at a temperature of 25 ± 1°C the rice cultivars IAC-899 and IR-841 were sensitive to the Al3+ concentration of 10mg/l of Al3+; IR-43, IR-45 and IR-8 were sensitive to 20mg/l and the cultivars IR-42 and CICA-4 were sensitive to 40mg/l; IAC-435, IAC-164, Pérola, Batatais, Pratão Precoce, Blue Bonnet, IAC-120, IAC-47, IAC-1246, IAC-25, IAC-165, Pratão, Dou-ado Precoce and CICA-8 showed tolerance to 40mg/l. In nutrient solutions at a temperature of 30 ± 1°C all cultivars presented tolerance to the Al3+ concentrations of 5, 10 and 20mg/l of Al+3. The cultivars Dourado Precoce, CICA-4, IR-42, IR-43, IR-45, IR-8, IAC-899, IR-665-4-5-5 and IR-841 were sensitive to 40mg/l of Al3+. Under the same conditions the following cultivars were considered tolerant to aluminum concentration of 40mg/l: IAC-47, Blue Bonnet, IAC-1246, IAC-164, Pratão, Pratão Precoce, CICA-8, IAC-435, IAC-120, IAC-25, IAC-165, Pérola and Batatais. The rice cultivars under study were ranked into classes of aluminum tolerance: tolerant: IAC-435, IAC-120, IAC-47, IAC-1246, IAC-25, IAC-165, IAC-164, Pérola, Batatais, Pratão Precoce, Blue Bonnet; moderately tolerant: Pratão, Dourado Precoce and CICA-8; and sensitive: CICA-4, IR-42, IR-43, IR-45, IR-8, IAC-899, IR-665-4-5-5 and IR-841.

  13. Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa

    Science.gov (United States)

    Basyuni, M.; Sumardi

    2017-01-01

    This study descibes bioinformatics approach on the analyze of the salt tolerance genes in mangrove plant, Rhizophora stylosa on DDBJ/EMBL/GenBank as well as similarity, phylogenetic, potential peptide, and subcellular localization. The DNA sequence between salt tolerance gene from R. stylosa exhibited 42-11% between themselves The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the salt-tolerant genes in R. stylosa, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, first branch of Cu/Zn SOD and reverse transcriptase genes, the second branch consists of the majority genes and the last group was MAP3K alpha protein kinase only. The present study, therefore, suggested that salt tolerance genes form distinct clusters in the tree.

  14. Transcriptome profiling of genes and pathways associated with arsenic toxicity and tolerance in Arabidopsis

    Science.gov (United States)

    2014-01-01

    Background Arsenic (As) is a toxic metalloid found ubiquitously in the environment and widely considered an acute poison and carcinogen. However, the molecular mechanisms of the plant response to As and ensuing tolerance have not been extensively characterized. Here, we report on transcriptional changes with As treatment in two Arabidopsis accessions, Col-0 and Ws-2. Results The root elongation rate was greater for Col-0 than Ws-2 with As exposure. Accumulation of As was lower in the more tolerant accession Col-0 than in Ws-2. We compared the effect of As exposure on genome-wide gene expression in the two accessions by comparative microarray assay. The genes related to heat response and oxidative stresses were common to both accessions, which indicates conserved As stress-associated responses for the two accessions. Most of the specific response genes encoded heat shock proteins, heat shock factors, ubiquitin and aquaporin transporters. Genes coding for ethylene-signalling components were enriched in As-tolerant Col-0 with As exposure. A tolerance-associated gene candidate encoding Leucine-Rich Repeat receptor-like kinase VIII (LRR-RLK VIII) was selected for functional characterization. Genetic loss-of-function analysis of the LRR-RLK VIII gene revealed altered As sensitivity and the metal accumulation in roots. Conclusions Thus, ethylene-related pathways, maintenance of protein structure and LRR-RLK VIII-mediated signalling may be important mechanisms for toxicity and tolerance to As in the species. Here, we provide a comprehensive survey of global transcriptional regulation for As and identify stress- and tolerance-associated genes responding to As. PMID:24734953

  15. The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms.

    Science.gov (United States)

    Nilsson, Martin; Rybtke, Morten; Givskov, Michael; Høiby, Niels; Twetman, Svante; Tolker-Nielsen, Tim

    2016-09-01

    Microbial biofilms are tolerant to antibiotic treatment and therefore cause problematic infections. Knowledge about the molecular mechanisms underlying biofilm-associated antimicrobial tolerance will aid the development of antibiofilm drugs. Screening of a Streptococcus mutans transposon mutant library for genes that are important for biofilm-associated antimicrobial tolerance provided evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The minimum bactericidal concentration for biofilm cells (MBC-B) for a dltA transposon mutant was eight-fold lower than that of the wild-type. The minimum bactericidal concentration for planktonic cells (MBC-P) was only slightly reduced, indicating that the mechanism involved in the observed antimicrobial tolerance has a predominant role specifically in biofilms. Experiments with a knockout dltA mutant and complemented strain confirmed that the dlt genes in S. mutans play a role in biofilm-associated tolerance to gentamicin. Confocal laser scanning microscopy analyses of biofilms grown on glass slides showed that the dltA mutant produced roughly the same amount of biofilm as the wild-type, indicating that the reduced antimicrobial tolerance of the dltA mutant is not due to a defect in biofilm formation. The products of the dlt genes have been shown to mediate alanylation of teichoic acids, and in accordance the dltA mutant showed a more negatively charged surface than the wild-type, which likely is an important factor in the reduced tolerance of the dltA mutant biofilms towards the positively charged gentamicin. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  16. Genome-wide mapping of furfural tolerance genes in Escherichia coli.

    Science.gov (United States)

    Glebes, Tirzah Y; Sandoval, Nicholas R; Reeder, Philippa J; Schilling, Katherine D; Zhang, Min; Gill, Ryan T

    2014-01-01

    Advances in genomics have improved the ability to map complex genotype-to-phenotype relationships, like those required for engineering chemical tolerance. Here, we have applied the multiSCale Analysis of Library Enrichments (SCALEs; Lynch et al. (2007) Nat. Method.) approach to map, in parallel, the effect of increased dosage for >10(5) different fragments of the Escherichia coli genome onto furfural tolerance (furfural is a key toxin of lignocellulosic hydrolysate). Only 268 of >4,000 E. coli genes (∼ 6%) were enriched after growth selections in the presence of furfural. Several of the enriched genes were cloned and tested individually for their effect on furfural tolerance. Overexpression of thyA, lpcA, or groESL individually increased growth in the presence of furfural. Overexpression of lpcA, but not groESL or thyA, resulted in increased furfural reduction rate, a previously identified mechanism underlying furfural tolerance. We additionally show that plasmid-based expression of functional LpcA or GroESL is required to confer furfural tolerance. This study identifies new furfural tolerant genes, which can be applied in future strain design efforts focused on the production of fuels and chemicals from lignocellulosic hydrolysate.

  17. Genome-wide mapping of furfural tolerance genes in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Tirzah Y Glebes

    Full Text Available Advances in genomics have improved the ability to map complex genotype-to-phenotype relationships, like those required for engineering chemical tolerance. Here, we have applied the multiSCale Analysis of Library Enrichments (SCALEs; Lynch et al. (2007 Nat. Method. approach to map, in parallel, the effect of increased dosage for >10(5 different fragments of the Escherichia coli genome onto furfural tolerance (furfural is a key toxin of lignocellulosic hydrolysate. Only 268 of >4,000 E. coli genes (∼ 6% were enriched after growth selections in the presence of furfural. Several of the enriched genes were cloned and tested individually for their effect on furfural tolerance. Overexpression of thyA, lpcA, or groESL individually increased growth in the presence of furfural. Overexpression of lpcA, but not groESL or thyA, resulted in increased furfural reduction rate, a previously identified mechanism underlying furfural tolerance. We additionally show that plasmid-based expression of functional LpcA or GroESL is required to confer furfural tolerance. This study identifies new furfural tolerant genes, which can be applied in future strain design efforts focused on the production of fuels and chemicals from lignocellulosic hydrolysate.

  18. Enhanced salt tolerance of alfalfa (Medicago sativa) by rstB gene transformation.

    Science.gov (United States)

    Zhang, Wan-Jun; Wang, Tao

    2015-05-01

    Generating salt tolerance forage plant is essential for use of the land affected by high salinity. A salt tolerance gene rstB was used as a selectable marker gene in Agrobacterium-mediated transformation of tobacco under a selective regime of 170mM NaCl. The transgenic plants showed clear improvement in salt tolerance. To improve salt tolerance of alfalfa (Medicago sativa L.), rstB gene was introduced into alfalfa genome by Agrobacterium-mediated transformation. No abnormal phenotype was observed among the transgenic plants when compared with wild type (wt) plants. Significant enhancement of resistance to salt-shock treatment was noted on the rstB transgenic (T0) plants. Transgenic second-generation (T1) seeds showed improved germination rate and seedling growth under salt-stress condition. Hindered Na(+) accumulation, but enhanced Ca(2+) accumulation was observed on the rstB T1 plants when subjected to salt-stresses. Enhanced calcium accumulation in transgenic plants was also verified by cytohistochemical localization of calcium. Under salt-stress of 50mM NaCl, about 15% of the transgenic plants finished their life-cycle but the wt plants had no flower formation. The results demonstrated that the expression of rstB gene improved salt tolerance in transgenic alfalfa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Suppression of PCD-related genes affects salt tolerance in Arabidopsis.

    Science.gov (United States)

    Bahieldin, Ahmed; Alqarni, Dhafer A M; Atef, Ahmed; Gadalla, Nour O; Al-matary, Mohammed; Edris, Sherif; Al-Kordy, Magdy A; Makki, Rania M; Al-Doss, Abdullah A; Sabir, Jamal S M; Mutwakil, Mohammed H Z; El-Domyati, Fotouh M

    2016-01-01

    This work aims at examining a natural exciting phenomenon suggesting that suppression of genes inducing programmed cell death (PCD) might confer tolerance against abiotic stresses in plants. PCD-related genes were induced in tobacco under oxalic acid (OA) treatment (20 mM), and plant cells were characterized to confirm the incidence of PCD. The results indicated that PCD was triggered 24 h after the exposure to OA. Then, RNAs were extracted from tobacco cells 0, 2, 6, 12 and 24 h after treatment for deep sequencing. RNA-Seq analyses were done with a special emphasis to clusters whose PCD-related genes were upregulated after 2 h of OA exposure. Accordingly, 23 tobacco PCD-related genes were knocked down via virus-induced gene silencing (VIGS), whereas our results indicated the influence of five of them on inducing or suppressing PCD. Knockout T-DNA insertion mutants of these five genes in Arabidopsis were tested under salt stress (0, 100, 150, and 200 mM NaCl), and the results indicated that a mutant of an antiapoptotic gene, namely Bax Inhibitor-1 (BI-1), whose VIGS induced PCD in tobacco, was salt sensitive, while a mutant of an apoptotic gene, namely mildew resistance locus O (Mlo), whose VIGS suppressed PCD, was salt tolerant as compared to the WT (Col) control. These data support our hypothesis that retarding PCD-inducing genes can result in higher levels of salt tolerance, while retarding PCD-suppressing genes can result in lower levels of salt tolerance in plants. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  20. 40 CFR 180.1091 - Aluminum isopropoxide and aluminum secondary butoxide; exemption from the requirement of a...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Aluminum isopropoxide and aluminum... PESTICIDE CHEMICAL RESIDUES IN FOOD Exemptions From Tolerances § 180.1091 Aluminum isopropoxide and aluminum secondary butoxide; exemption from the requirement of a tolerance. Aluminum isopropoxide (CAS Reg. No. 555...

  1. Tracking the evolution of a cold stress associated gene family in cold tolerant grasses

    DEFF Research Database (Denmark)

    Sandve, Simen R; Rudi, Heidi; Asp, Torben

    2008-01-01

    to the repeat motifs of the IRI-domain in cold tolerant grasses. Finally we show that the LRR-domain of carrot and grass IRI proteins both share homology to an Arabidopsis thaliana LRR-trans membrane protein kinase (LRR-TPK). Conclusion The diverse IRI-like genes identified in this study tell a tale...... of a complex evolutionary history including birth of an ice binding domain, a burst of gene duplication events after cold tolerant grasses radiated from rice, protein domain structure differentiation between paralogs, and sub- and/or neofunctionalisation of IRI-like proteins. From our sequence analysis we...

  2. Relative expression of genes related with cold tolerance in ...

    African Journals Online (AJOL)

    Low temperature is one of the main abiotic stresses affecting rice yield in Chile. Alterations in phenology and physiology of the crop are observed after a cold event. The objective of this work was to study the relative expression of genes related with cold stress in Chilean cultivars of rice. For this, we analyzed the expression ...

  3. An Alcohol Dehydrogenase Gene from Synechocystis sp. Confers Salt Tolerance in Transgenic Tobacco

    Directory of Open Access Journals (Sweden)

    So Young Yi

    2017-11-01

    Full Text Available Synechocystis salt-responsive gene 1 (sysr1 was engineered for expression in higher plants, and gene construction was stably incorporated into tobacco plants. We investigated the role of Sysr1 [a member of the alcohol dehydrogenase (ADH superfamily] by examining the salt tolerance of sysr1-overexpressing (sysr1-OX tobacco plants using quantitative real-time polymerase chain reactions, gas chromatography-mass spectrometry, and bioassays. The sysr1-OX plants exhibited considerably increased ADH activity and tolerance to salt stress conditions. Additionally, the expression levels of several stress-responsive genes were upregulated. Moreover, airborne signals from salt-stressed sysr1-OX plants triggered salinity tolerance in neighboring wild-type (WT plants. Therefore, Sysr1 enhanced the interconversion of aldehydes to alcohols, and this occurrence might affect the quality of green leaf volatiles (GLVs in sysr1-OX plants. Actually, the Z-3-hexenol level was approximately twofold higher in sysr1-OX plants than in WT plants within 1–2 h of wounding. Furthermore, analyses of WT plants treated with vaporized GLVs indicated that Z-3-hexenol was a stronger inducer of stress-related gene expression and salt tolerance than E-2-hexenal. The results of the study suggested that increased C6 alcohol (Z-3-hexenol induced the expression of resistance genes, thereby enhancing salt tolerance of transgenic plants. Our results revealed a role for ADH in salinity stress responses, and the results provided a genetic engineering strategy that could improve the salt tolerance of crops.

  4. Tolerância de cultivares de trigo a diferentes níveis de alumínio em solução nutritiva e no solo Tolerance op wheat cultivars to different levels of aluminum toxicity

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1981-01-01

    Full Text Available Foram estudados dez cultivares de trigo em soluções nutritivas contendo cinco diferentes níveis de alumínio tóxico. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após um período prévio de 48 horas em solução contendo uma concentração conhecida de alumínio. Os cultivares Siete Cerros e Tobari-66 foram sensíveis, respectivamente, a 1 e 3 ppm de alumínio. 'Alondra-S-46', 'Alondra-S-45' e 'IAC-17' foram sensíveis a 6 ppm; 'BH-1146', 'IAC-5', 'IAC-18', 'IAC-13' e 'Londrina' foram tolerantes a 10 ppm, porém 'BH-1146', 'IAC-18' e 'IAC-13' foram mais tolerantes que 'IAC-5' e 'Londrina'. Os cultivares BH-1146, IAC-17, Alondra-S-46, Tobari-66 e Siete Cerros foram cultivados em vasos contendo solo ácido mostrando a presença de alumínio. Metade do número de vasos recebeu uma aplicação de calcário. Os resultados desse experimento mostraram que o cultivar BH-1146 diferiu significativamente em produção de grãos por planta de 'Tobari-66', 'Alondra-S-46', 'IAC-17' e 'Siete Cerros'. Esse resultado confirmou a tolerância ao alumínio do cultivar BH-1146, observada quando se empregou solução nutritiva com a presença desse elemento.Ten wheat cultivars were studied to aluminum toxicity using five different levels of this element. The tolerance was measured taking into account the root growth in a aluminum-free complete nutrient solution after a previous Al treatment. With toxic amounts of Al, the primary roots did not grow at all and remained thickned at the tip as a typical Al injury. The wheat cultivars Siete Cerros and Tobari-66 were sensitive to 1 and 3 ppm of aluminum, respectively. The cultivars Alondra-S-46, Alondra-S-45 and IAC-17 were sensitive to 6 ppm. The cultivars BH-1146, IAC-5, IAC-18, IAC-13 and Londrina showed tolerance to 10 ppm but BH-1146, IAC-18 and IAC-13 were more tolerant than IAC-5 and Londrina. The cultivars BH-1146, IAC-17, Alondra-S-46

  5. Phytohormones enabled endophytic fungal symbiosis improve aluminum phytoextraction in tolerant Solanum lycopersicum: An examples of Penicillium janthinellum LK5 and comparison with exogenous GA3.

    Science.gov (United States)

    Khan, Abdul Latif; Waqas, Muhammad; Hussain, Javid; Al-Harrasi, Ahmed; Hamayun, Muhammad; Lee, In-Jung

    2015-09-15

    This work investigates the potentials of fungal-endophyte Penicillium janthinellum LK5 (PjLK5) and its inherent gibberellic acid (GA3) as reference to enhance aluminum (Al) induced toxicity in tolerant tomato (Solanum lycopersicum) plants. Initial screening showed significantly higher uptake of Al by PjLK5. Aluminum stress (100 μM) significantly retarted plant growth in control plants. Conversely PjLK5 and GA3 application significantly increased morphological attributes of Al-tolerant tomato plants with or without Al-stress. PjLK5 inoculation with and without Al-stress maintained the plant growth whilst extracting and translocating higher Al in shoot (∼ 1 92 mg/kg) and root (∼ 296 mg/kg). This was almost similar in GA3 treatments as well. In addition, PjLK5 inoculation extended protective effects to tomato plants by maintaining reduced cellular superoxide anions in Al stress. Al-induced oxidative stress was further reduced due to significantly higher activity of metal-responsive reduced glutathione. The functional membrane was less damaged in PjLK5 and GA3 treatments because the plants synthesized reduced levels of malondialdhyde, lenolenic and linoleic acids. Defense-related endogenous phytohormone salicylic acid was significantly up-regulated to counteract the adverse effects of Al-stress. In conclusion, the PjLK5 possess a similar bio-prospective potential as of GA3. Application of such biochemically active endophyte could increase metal phytoextraction whilst maintaining crop physiological homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Genetically engineered Rice with transcription factor DREB genes for abiotic stress tolerance(abstract)

    International Nuclear Information System (INIS)

    Datta, S.K.; Datta, K.

    2005-01-01

    Water stress (drought and Salinity) is the most severe limitation to rice productivity. Several breeding approaches (MAS, QTL) applied to suitable genotypes are in place at IRRI and elsewhere. Phenotyping of water stress tolerance is in progress with potential predictability. Dr. Shinozaki's group has cloned a number of transcription factor genes, which have been shown to work in Arabidopsis to achieve drought, cold, and salinity tolerant plants. None of these genes have as yet displayed their potential functioning in rice. Genetic engineering aims at cross talk between different stress signaling pathways leading to stress tolerance. Osmotic Adjustment (OA) is an effective component of abiotic stress (drought and salinity) tolerance in many plants including rice. When plant experiences water stress, OA contributes to turgor maintenance of both shoots and roots. Conventional breeding could not achieve the OA in rice excepting a few rice cultivars, which are partially adapted to water-stress conditions. Several stress-related genes have now been cloned and transferred in to enhance the osmolytes and some transgenic lines showed increased tolerance to osmotic stress. A few strategies could be effectively deployed for a better understanding of water-stress tolerance in rice and to develop transgenic rice, which can survive for a critical period of water-stress conditions: 1) Switching on of transcription factor regulating the expression of several genes related to abiotic stress, 2) Use of a suitable stress inducible promoter driving the target gene for an efficient and directed expression in plants, 3) Understanding of phenotyping and GxE in a given environment, 4) Selection of a few adaptive rice cultivars suitable in drought/salinity prone areas, 5) Microarray, proteomics, QTL and MAS may expedite the cloning and characterizing the stress induced genes, and 6) Finally, the efficient transformation system for generating a large number of transgenic rice of different

  7. Discovery and Characterization of Two Novel Salt-Tolerance Genes in Puccinellia tenuiflora

    Directory of Open Access Journals (Sweden)

    Ying Li

    2014-09-01

    Full Text Available Puccinellia tenuiflora is a monocotyledonous halophyte that is able to survive in extreme saline soil environments at an alkaline pH range of 9–10. In this study, we transformed full-length cDNAs of P. tenuiflora into Saccharomyces cerevisiae by using the full-length cDNA over-expressing gene-hunting system to identify novel salt-tolerance genes. In all, 32 yeast clones overexpressing P. tenuiflora cDNA were obtained by screening under NaCl stress conditions; of these, 31 clones showed stronger tolerance to NaCl and were amplified using polymerase chain reaction (PCR and sequenced. Four novel genes encoding proteins with unknown function were identified; these genes had no homology with genes from higher plants. Of the four isolated genes, two that encoded proteins with two transmembrane domains showed the strongest resistance to 1.3 M NaCl. RT-PCR and northern blot analysis of P. tenuiflora cultured cells confirmed the endogenous NaCl-induced expression of the two proteins. Both of the proteins conferred better tolerance in yeasts to high salt, alkaline and osmotic conditions, some heavy metals and H2O2 stress. Thus, we inferred that the two novel proteins might alleviate oxidative and other stresses in P. tenuiflora.

  8. Gene expression changes governing extreme dehydration tolerance in an Antarctic insect

    Science.gov (United States)

    Teets, Nicholas M.; Peyton, Justin T.; Colinet, Herve; Renault, David; Kelley, Joanna L.; Kawarasaki, Yuta; Lee, Richard E.; Denlinger, David L.

    2012-01-01

    Among terrestrial organisms, arthropods are especially susceptible to dehydration, given their small body size and high surface area to volume ratio. This challenge is particularly acute for polar arthropods that face near-constant desiccating conditions, as water is frozen and thus unavailable for much of the year. The molecular mechanisms that govern extreme dehydration tolerance in insects remain largely undefined. In this study, we used RNA sequencing to quantify transcriptional mechanisms of extreme dehydration tolerance in the Antarctic midge, Belgica antarctica, the world’s southernmost insect and only insect endemic to Antarctica. Larvae of B. antarctica are remarkably tolerant of dehydration, surviving losses up to 70% of their body water. Gene expression changes in response to dehydration indicated up-regulation of cellular recycling pathways including the ubiquitin-mediated proteasome and autophagy, with concurrent down-regulation of genes involved in general metabolism and ATP production. Metabolomics results revealed shifts in metabolite pools that correlated closely with changes in gene expression, indicating that coordinated changes in gene expression and metabolism are a critical component of the dehydration response. Finally, using comparative genomics, we compared our gene expression results with a transcriptomic dataset for the Arctic collembolan, Megaphorura arctica. Although B. antarctica and M. arctica are adapted to similar environments, our analysis indicated very little overlap in expression profiles between these two arthropods. Whereas several orthologous genes showed similar expression patterns, transcriptional changes were largely species specific, indicating these polar arthropods have developed distinct transcriptional mechanisms to cope with similar desiccating conditions. PMID:23197828

  9. Does Nilaparvata lugens gain tolerance to rice resistance genes through conspecifics at shared feeding sites?

    NARCIS (Netherlands)

    Ferrater, Jedeliza B.; Horgan, Finbarr G.

    2016-01-01

    This study examines the possibility of horizontal and vertical transmission of virulence (the ability to tolerate a given resistant plant or resistance gene) between individuals from brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae), populations with distinct feeding abilities

  10. Genome-wide analysis of desiccation tolerance-related genes in Arabidopsis seeds

    NARCIS (Netherlands)

    Maia de Oliveira, Julio; Dekkers, Bas; Ligterink, Wilco; Provart, Nicholas J.; Hilhorst, Henk

    2013-01-01

    The combination of robust physiological models with “omics” studies holds promise for the discovery of genes and pathways linked to how organisms deal with drying. Here we used a transcriptomics approach in combination with an in vivo physiological model of re-establishment of desiccation tolerance

  11. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    International Nuclear Information System (INIS)

    Wang Xiaojuan; Song, Yu; Ma Yanhua; Zhuo Renying; Jin Liang

    2011-01-01

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: → Evaluate Cd tolerance in wide sources of alfalfa accessions. → Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. → Cloned differentially expressed metallothionein (MT) genes. → Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. → MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  12. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xiaojuan, E-mail: xiaojuanwang@lzu.edu.cn [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Song, Yu [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Environment Management College of China, Qinhuangdao 066004 (China); Ma Yanhua [Hebei Normal University of Science and Technology, Qinhuangdao 066004 (China); Zhuo Renying [Key Lab of Tree Genomics, Research Institute of Subtropical of Forest, Chinese Academy of Forest, Fuyang 311400 (China); Jin Liang [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China)

    2011-12-15

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: > Evaluate Cd tolerance in wide sources of alfalfa accessions. > Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. > Cloned differentially expressed metallothionein (MT) genes. > Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. > MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  13. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    Directory of Open Access Journals (Sweden)

    Bingfu eGuo

    2015-10-01

    Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

  14. In silico design and functional assessment of semisynthetic genes that confer tolerance to phosphinothricin

    Directory of Open Access Journals (Sweden)

    Jenny Paola Jiménez

    2016-07-01

    Full Text Available Herbicide tolerance is one of the features most used in GM crops, which has shown positive results for farmers and the environment. The starting point is the development of expression cassettes that express the characteristic of interest, they are initially constructed by standard molecular biology techniques. Currently, by bioinformatics and synthetic biology tools, it is possible to design and test the construct in silico, and then hire their synthesis. This approach allows optimizing expression by modifying the codon usage. In this work there were designed and evaluated semi-synthetic versions of genes in Nicotiana benthamiana, these genes confer tolerance to the herbicide phosphinothricin. It was made an analysis of freedom to operate in order to ensure that the designed constructs not violate intellectual property in Colombia. There were obtained two expression cassettes with freedom to operate, which express versions of the bar gene.

  15. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.

    Science.gov (United States)

    Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A

    2014-09-01

    An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones. © 2014

  16. A wheat calreticulin gene (TaCRT1) contributes to drought tolerance in transgenic arabidopsis

    International Nuclear Information System (INIS)

    Xiang, V.; Du, C.; Jia, H.; Song, M.; Wang, Y.; Ma, Z.

    2018-01-01

    The TaCRT1 gene is a member of calreticulin (CRT) family in wheat. In our previous study, we showed that transgenic tobacco lines over expressing wheat TaCRT1 showed enhanced tolerance to salt stress. This study aimed to determine whether TaCRT1 over expression would increase drought tolerance in transgenic Arabidopsis. Over expression of TaCRT1 in Arabidopsis plants enhances tolerance to drought stress. However, the transgenic line was found to retard the growth. Moreover, the transgenic line showed decreased water loss but higher sensitivity to exogenous abscisic acid (ABA) compared with the wild type (Col-0). Meanwhile, the transgenic line had the elevated endogenous ABA level. The semi-quantitative RT-PCR (sqRT-PCR) analysis showed that transcription levels of ABA-biosynthesizing gene (NCED3) and ABA-responsive gene (ABF3) were higher in the transgenic line than that in the Col-0 under normal condition. The above results implied that the TaCRT1 might be able to used as a potential target to improve the drought tolerance in crops. (author)

  17. Cadmium induces cadmium-tolerant gene expression in the filamentous fungus Trichoderma harzianum.

    Science.gov (United States)

    Cacciola, Santa O; Puglisi, Ivana; Faedda, Roberto; Sanzaro, Vincenzo; Pane, Antonella; Lo Piero, Angela R; Evoli, Maria; Petrone, Goffredo

    2015-11-01

    The filamentous fungus Trichoderma harzianum, strain IMI 393899, was able to grow in the presence of the heavy metals cadmium and mercury. The main objective of this research was to study the molecular mechanisms underlying the tolerance of the fungus T. harzianum to cadmium. The suppression subtractive hybridization (SSH) method was used for the characterization of the genes of T. harzianum implicated in cadmium tolerance compared with those expressed in the response to the stress induced by mercury. Finally, the effects of cadmium exposure were also validated by measuring the expression levels of the putative genes coding for a glucose transporter, a plasma membrane ATPase, a Cd(2+)/Zn(2+) transporter protein and a two-component system sensor histidine kinase YcbA, by real-time-PCR. By using the aforementioned SSH strategy, it was possible to identify 108 differentially expressed genes of the strain IMI 393899 of T. harzianum grown in a mineral substrate with the addition of cadmium. The expressed sequence tags identified by SSH technique were encoding different genes that may be involved in different biological processes, including those associated to primary and secondary metabolism, intracellular transport, transcription factors, cell defence, signal transduction, DNA metabolism, cell growth and protein synthesis. Finally, the results show that in the mechanism of tolerance to cadmium a possible signal transduction pathway could activate a Cd(2+)/Zn(2+) transporter protein and/or a plasma membrane ATPase that could be involved in the compartmentalization of cadmium inside the cell.

  18. RNAseq analysis reveals pathways and candidate genes associated with salinity tolerance in a spaceflight-induced wheat mutant.

    Science.gov (United States)

    Xiong, Hongchun; Guo, Huijun; Xie, Yongdun; Zhao, Linshu; Gu, Jiayu; Zhao, Shirong; Li, Junhui; Liu, Luxiang

    2017-06-02

    Salinity stress has become an increasing threat to food security worldwide and elucidation of the mechanism for salinity tolerance is of great significance. Induced mutation, especially spaceflight mutagenesis, is one important method for crop breeding. In this study, we show that a spaceflight-induced wheat mutant, named salinity tolerance 1 (st1), is a salinity-tolerant line. We report the characteristics of transcriptomic sequence variation induced by spaceflight, and show that mutations in genes associated with sodium ion transport may directly contribute to salinity tolerance in st1. Furthermore, GO and KEGG enrichment analysis of differentially expressed genes (DEGs) between salinity-treated st1 and wild type suggested that the homeostasis of oxidation-reduction process is important for salt tolerance in st1. Through KEGG pathway analysis, "Butanoate metabolism" was identified as a new pathway for salinity responses. Additionally, key genes for salinity tolerance, such as genes encoding arginine decarboxylase, polyamine oxidase, hormones-related, were not only salt-induced in st1 but also showed higher expression in salt-treated st1 compared with salt-treated WT, indicating that these genes may play important roles in salinity tolerance in st1. This study presents valuable genetic resources for studies on transcriptome variation caused by induced mutation and the identification of salt tolerance genes in crops.

  19. Association Mapping of Ferrous, Zinc, and Aluminum Tolerance at the Seedling Stage in Indica Rice using MAGIC Populations

    Directory of Open Access Journals (Sweden)

    Lijun Meng

    2017-10-01

    Full Text Available Excessive amounts of metal are toxic and severely affect plant growth and development. Understanding the genetic control of metal tolerance is crucial to improve rice resistance to Fe, Zn, and Al toxicity. The multi-parent advanced generation inter-cross (MAGIC populations were genotyped using a 55 K rice SNP array and screened at the seedling stage for Fe, Zn, and Al toxicity using a hydroponics system. Association analysis was conducted by implementing a mixed linear model (MLM for each of the five MAGIC populations double cross DC1 (founders were SAGC-08, HHZ5-SAL9-Y3-Y1, BP1976B-2-3-7-TB-1-1, PR33282-B-8-1-1-1-1-1, double cross DC2 (founders of double cross were FFZ1, CT 16658-5-2-2SR-2-3-6MP, IR 68, IR 02A127, eight parents population 8way (founders were SAGC-08, HHZ5-SAL9-Y3-Y1, BP1976B-2-3-7-TB-1-1, PR33282-B-8-1-1-1-1-1, FFZ1, CT 16658-5-2-2SR-2-3-6MP, IR 68, IR 02A127, DC12 (DC1+DC2 and rice multi-parent recombinant inbred line population RMPRIL (DC1+DC2+8way. A total of 21, 30, and 21 QTL were identified for Fe, Zn, and Al toxicity tolerance, respectively. For multi tolerance (MT as Fe, Zn, and Al tolerance-related traits, three genomic regions, MT1.1 (chr.1: 35.4–36.3 Mb, MT1.2 (chr.1: 35.4–36.3 Mb, and MT3.2 (chr.3: 35.4-36.2 Mb harbored QTL. The chromosomal regions MT2.1 (chr.2: 2.4–2.8 Mb, MT2.2 (chr.2: 24.5–25.8 Mb, MT4 (chr.4: 1.2 Mb Mb, MT8.1 (chr.8: 0.7–0.9 Mb, and MT8.2 (chr.8: 2.2–2.4 Mb harbored QTL for Fe and Zn tolerance, while MT2.3 (chr.2: 30.5–31.6 Mb, MT3.1 (chr.3: 12.5–12.8 Mb, and MT6 (chr.6: 2.0–3.0 Mb possessed QTL for Al and Zn tolerance. The chromosomal region MT9.1 (chr.9: 14.2–14.7 Mb possessed QTL for Fe and Al tolerance. A total of 11 QTL were detected across different MAGIC populations and 12 clustered regions were detected under different metal conditions, suggesting that these genomic regions might constitute valuable regions for further marker-assisted selection (MAS in breeding

  20. Community-Level Analysis of psbA Gene Sequences and Irgarol Tolerance in Marine Periphyton▿

    Science.gov (United States)

    Eriksson, K. M.; Clarke, A. K.; Franzen, L.-G.; Kuylenstierna, M.; Martinez, K.; Blanck, H.

    2009-01-01

    This study analyzes psbA gene sequences, predicted D1 protein sequences, species relative abundance, and pollution-induced community tolerance in marine periphyton communities exposed to the antifouling compound Irgarol 1051. The mechanism of action of Irgarol is the inhibition of photosynthetic electron transport at photosystem II by binding to the D1 protein. The metagenome of the communities was used to produce clone libraries containing fragments of the psbA gene encoding the D1 protein. Community tolerance was quantified with a short-term test for the inhibition of photosynthesis. The communities were established in a continuous flow of natural seawater through microcosms with or without added Irgarol. The selection pressure from Irgarol resulted in an altered species composition and an inducted community tolerance to Irgarol. Moreover, there was a very high diversity in the psbA gene sequences in the periphyton, and the composition of psbA and D1 fragments within the communities was dramatically altered by increased Irgarol exposure. Even though tolerance to this type of compound in land plants often depends on a single amino acid substitution (Ser264→Gly) in the D1 protein, this was not the case for marine periphyton species. Instead, the tolerance mechanism likely involves increased degradation of D1. When we compared sequences from low and high Irgarol exposure, differences in nonconserved amino acids were found only in the so-called PEST region of D1, which is involved in regulating its degradation. Our results suggest that environmental contamination with Irgarol has led to selection for high-turnover D1 proteins in marine periphyton communities at the west coast of Sweden. PMID:19088321

  1. Identification of Quantitative Trait Loci (QTL) and Candidate Genes for Cadmium Tolerance in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Gancho [West Virginia University; Yin, Tongming [ORNL; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Stephen P [West Virginia University

    2012-01-01

    Knowledge of genetic variation in response of Populus to heavy metals like cadmium (Cd) is an important step in understanding the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa and Populus deltoides was characterized for Cd exposure. The pedigree showed significant variation for Cd tolerance thus enabling the identification of relatively tolerant and susceptible genotypes for intensive characterization. A total of 16 QTLs at logarithm of odds (LOD) ratio > 2.5, were found to be associated with total dry weight, its components, and root volume. Four major QTLs for total dry weight were mapped to different linkage groups in control (LG III) and Cd conditions (LG XVI) and had opposite allelic effects on Cd tolerance, suggesting that these genomic regions were differentially controlled. The phenotypic variation explained by Cd QTL for all traits under study varied from 5.9% to 11.6% and averaged 8.2% across all QTL. Leaf Cd contents also showed significant variation suggesting the phytoextraction potential of Populus genotypes, though heritability of this trait was low (0.22). A whole-genome microarray study was conducted by using two genotypes with extreme responses for Cd tolerance in the above study and differentially expressed genes were identified. Candidate genes including CAD2 (CADMIUM SENSITIVE 2), HMA5 (HEAVY METAL ATPase5), ATGTST1 (Arabidopsis thaliana Glutathione S-Transferase1), ATGPX6 (Glutathione peroxidase 6), and ATMRP 14 (Arabidopsis thaliana Multidrug Resistance associated Protein 14) were identified from QTL intervals and microarray study. Functional characterization of these candidate genes could enhance phytoremediation capabilities of Populus.

  2. Profiling dehydrin gene sequence and physiological parameters in drought tolerant and susceptible spring wheat cultivars

    International Nuclear Information System (INIS)

    Baloch, M.J.; Jatoi, W.A.

    2012-01-01

    Physiological and yield traits such as stomatal conductance (mmol m-/sup 2/s/sup -1/), Leaf relative water content (RWC %) and grain yield per plant were studied in a separate experiment. Results revealed that five out of sixteen cultivars viz. Anmol, Moomal, Sarsabz, Bhitai and Pavan, appeared to be relatively more drought tolerant. Based on morphophysiological results, studies were continued to look at these cultivars for drought tolerance at molecular level. Initially, four well recognized primers for dehydrin genes (DHNs) responsible for drought induction in T. durum L., T. aestivum L. and O. sativa L. were used for profiling gene sequence of sixteen wheat cultivars. The primers amplified the DHN genes variably like Primer WDHN13 (T. aestivum L.) amplified the DHN gene in only seven cultivars whereas primer TdDHN15 ( T. durum L.) amplified all the sixteen cultivars with even different DNA banding patterns some showing second weaker DNA bands. Third primer TdDHN16 (T. durum L.) has shown entirely different PCR amplification prototype, specially showing two strong DNA bands while fourth primer RAB16C (O. sativa L.) failed to amplify DHN gene in any of the cultivars. Examination of DNA sequences revealed several interesting features. First, it identified the two exon/one intron structure of this gene (complete sequences were not shown), a feature not previously described in the two database cDNA sequences available from T. aestivum L. (gi|21850). Secondly, the analysis identified several single nucleotide polymorphisms (SNPs), positions in gene sequence. Although complete gene sequence was not obtained for all the cultivars, yet there were a total of 38 variable positions in exonic (coding region) sequence, from a total gene length of 453 nucleotides. Matrix of SNP shows these 37 positions with individual sequence at positions given for each of the 14 cultivars (sequence of two cultivars was not obtained) included in this analysis. It demonstrated a considerab le

  3. Transgenic Alfalfa Plants Expressing the Sweetpotato Orange Gene Exhibit Enhanced Abiotic Stress Tolerance

    Science.gov (United States)

    Wang, Zhi; Ke, Qingbo; Kim, Myoung Duck; Kim, Sun Ha; Ji, Chang Yoon; Jeong, Jae Cheol; Lee, Haeng-Soon; Park, Woo Sung; Ahn, Mi-Jeong; Li, Hongbing; Xu, Bingcheng; Deng, Xiping; Lee, Sang-Hoon; Lim, Yong Pyo; Kwak, Sang-Soo

    2015-01-01

    Alfalfa (Medicago sativa L.), a perennial forage crop with high nutritional content, is widely distributed in various environments worldwide. We recently demonstrated that the sweetpotato Orange gene (IbOr) is involved in increasing carotenoid accumulation and enhancing resistance to multiple abiotic stresses. In this study, in an effort to improve the nutritional quality and environmental stress tolerance of alfalfa, we transferred the IbOr gene into alfalfa (cv. Xinjiang Daye) under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter through Agrobacterium tumefaciens-mediated transformation. Among the 11 transgenic alfalfa lines (referred to as SOR plants), three lines (SOR2, SOR3, and SOR8) selected based on their IbOr transcript levels were examined for their tolerance to methyl viologen (MV)-induced oxidative stress in a leaf disc assay. The SOR plants exhibited less damage in response to MV-mediated oxidative stress and salt stress than non-transgenic plants. The SOR plants also exhibited enhanced tolerance to drought stress, along with higher total carotenoid levels. The results suggest that SOR alfalfa plants would be useful as forage crops with improved nutritional value and increased tolerance to multiple abiotic stresses, which would enhance the development of sustainable agriculture on marginal lands. PMID:25946429

  4. Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

    Science.gov (United States)

    Monette, M.Y.; Yada, T.; Matey, V.; McCormick, S.D.

    2010-01-01

    We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4??gl-1 Al), acid and low Al (LAl: pH 5.4, 11??gl-1 Al), acid and moderate Al (MAl: pH 5.3, 42??gl-1 Al), and acid and high Al (HAl: pH 5.4, 56??gl-1 Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na+/K+-ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl- channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time-course and severity of Al exposure. We propose that when smolts are

  5. Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

    International Nuclear Information System (INIS)

    Monette, Michelle Y.; Yada, Takashi; Matey, Victoria; McCormick, Stephen D.

    2010-01-01

    We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4 μg l -1 Al), acid and low Al (LAl: pH 5.4, 11 μg l -1 Al), acid and moderate Al (MAl: pH 5.3, 42 μg l -1 Al), and acid and high Al (HAl: pH 5.4, 56 μg l -1 Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24 h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na + /K + -ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl - channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time-course and severity of Al exposure. We propose

  6. Expression pattern of salt tolerance-related genes in Aegilops cylindrica.

    Science.gov (United States)

    Arabbeigi, Mahbube; Arzani, Ahmad; Majidi, Mohammad Mahdi; Sayed-Tabatabaei, Badraldin Ebrahim; Saha, Prasenjit

    2018-02-01

    Aegilops cylindrica , a salt-tolerant gene pool of wheat, is a useful plant model for understanding mechanism of salt tolerance. A salt-tolerant USL26 and a salt-sensitive K44 genotypes of A. cylindrica , originating from Uremia Salt Lake shores in Northwest Iran and a non-saline Kurdestan province in West Iran, respectively, were identified based on screening evaluation and used for this work. The objective of the current study was to investigate the expression patterns of four genes related to ion homeostasis in this species. Under treatment of 400 mM NaCl, USL26 showed significantly higher root and shoot dry matter levels and K + concentrations, together with lower Na + concentrations than K44 genotype. A. cylindrica HKT1;5 ( AecHKT1;5 ), SOS1 ( AecSOS1 ), NHX1 ( AecNHX1 ) and VP1 ( AecVP1 ) were partially sequenced to design each gene specific primer. Quantitative real-time PCR showed a differential expression pattern of these genes between the two genotypes and between the root and shoot tissues. Expressions of AecHKT1;5 and AecSOS1 was greater in the roots than in the shoots of USL26 while AecNHX1 and AecVP1 were equally expressed in both tissues of USL26 and K44. The higher transcripts of AecHKT1;5 in the roots versus the shoots could explain both the lower Na + in the shoots and the much lower Na + and higher K + concentrations in the roots/shoots of USL26 compared to K44. Therefore, the involvement of AecHKT1;5 in shoot-to-root handover of Na + in possible combination with the exclusion of excessive Na + from the root in the salt-tolerant genotype are suggested.

  7. Characterization of gene expression associated with drought avoidance and tolerance traits in a perennial grass species.

    Directory of Open Access Journals (Sweden)

    Peng Zhou

    Full Text Available To understand molecular mechanisms of perennial grass adaptation to drought stress, genes associated with drought avoidance or tolerance traits were identified and their expression patterns were characterized in C4 hybrid bermudagrass [Cynodon dactylon (L. Pers.×C. transvaalensis Burtt Davy, cv. Tifway] and common bermudagrass (C. dactylon, cv. C299. Plants of drought-tolerant 'Tifway' and drought-sensitive 'C299' were exposed to drought for 5 d (mild stress and 10 d (severe stress by withholding irrigation in a growth chamber. 'Tifway' maintained significantly lower electrolyte leakage and higher relative water content than 'C299' at both 5 and 10 d of drought stress. Four cDNA libraries via suppression subtractive hybridization analysis were constructed and identified 277 drought-responsive genes in the two genotypes at 5 and 10 d of drought stress, which were mainly classified into the functional categories of stress defense, metabolism, osmoregulation, membrane system, signal and regulator, structural protein, protein synthesis and degradation, and energy metabolism. Quantitative-PCR analysis confirmed the expression of 36 drought up-regulated genes that were more highly expressed in drought-tolerant 'Tifway' than drought-sensitive 'C299', including those for drought avoidance traits, such as cuticle wax formation (CER1 and sterol desaturase, for drought tolerance traits, such as dehydration-protective proteins (dehydrins, HVA-22-like protein and oxidative stress defense (superoxide dismutase, dehydroascorbate reductase, 2-Cys peroxiredoxins, and for stress signaling (EREBP-4 like protein and WRKY transcription factor. The results suggest that the expression of genes for stress signaling, cuticle wax accumulation, antioxidant defense, and dehydration-protective protein accumulation could be critically important for warm-season perennial grass adaptation to long-term drought stress.

  8. Transcriptome sequencing of the naked mole rat (Heterocephalus glaber and identification of hypoxia tolerance genes

    Directory of Open Access Journals (Sweden)

    Bang Xiao

    2017-12-01

    Full Text Available The naked mole rat (NMR; Heterocephalus glaber is a small rodent species found in regions of Kenya, Ethiopia and Somalia. It has a high tolerance for hypoxia and is thus considered one of the most important natural models for studying hypoxia tolerance mechanisms. The various mechanisms underlying the NMR's hypoxia tolerance are beginning to be understood at different levels of organization, and next-generation sequencing methods promise to expand this understanding to the level of gene expression. In this study, we examined the sequence and transcript abundance data of the muscle transcriptome of NMRs exposed to hypoxia using the Illumina HiSeq 2500 system to clarify the possible genomic adaptive responses to the hypoxic underground surroundings. The RNA-seq raw FastQ data were mapped against the NMR genome. We identified 2337 differentially expressed genes (DEGs by comparison of the hypoxic and control groups. Functional annotation of the DEGs by gene ontology (GO analysis revealed enrichment of hypoxia stress-related GO categories, including ‘biological regulation’, ‘cellular process’, ‘ion transport’ and ‘cell-cell signaling’. Enrichment of DEGs in signaling pathways was analyzed against the Kyoto Encyclopedia of Genes and Genomes (KEGG database to identify possible interactions between DEGs. The results revealed significant enrichment of DEGs in focal adhesion, the mitogen-activated protein kinase (MAPK signaling pathway and the glycine, serine and threonine metabolism pathway. Furthermore, inhibition of DEGs (STMN1, MAPK8IP1 and MAPK10 expression induced apoptosis and arrested cell growth in NMR fibroblasts following hypoxia. Thus, this global transcriptome analysis of NMRs can provide an important genetic resource for the study of hypoxia tolerance in mammals. Furthermore, the identified DEGs may provide important molecular targets for biomedical research into therapeutic strategies for stroke and cardiovascular diseases.

  9. Genome-wide identification of Saccharomyces cerevisiae genes required for tolerance to acetic acid

    Directory of Open Access Journals (Sweden)

    Sá-Correia Isabel

    2010-10-01

    Full Text Available Abstract Background Acetic acid is a byproduct of Saccharomyces cerevisiae alcoholic fermentation. Together with high concentrations of ethanol and other toxic metabolites, acetic acid may contribute to fermentation arrest and reduced ethanol productivity. This weak acid is also a present in lignocellulosic hydrolysates, a highly interesting non-feedstock substrate in industrial biotechnology. Therefore, the better understanding of the molecular mechanisms underlying S. cerevisiae tolerance to acetic acid is essential for the rational selection of optimal fermentation conditions and the engineering of more robust industrial strains to be used in processes in which yeast is explored as cell factory. Results The yeast genes conferring protection against acetic acid were identified in this study at a genome-wide scale, based on the screening of the EUROSCARF haploid mutant collection for susceptibility phenotypes to this weak acid (concentrations in the range 70-110 mM, at pH 4.5. Approximately 650 determinants of tolerance to acetic acid were identified. Clustering of these acetic acid-resistance genes based on their biological function indicated an enrichment of genes involved in transcription, internal pH homeostasis, carbohydrate metabolism, cell wall assembly, biogenesis of mitochondria, ribosome and vacuole, and in the sensing, signalling and uptake of various nutrients in particular iron, potassium, glucose and amino acids. A correlation between increased resistance to acetic acid and the level of potassium in the growth medium was found. The activation of the Snf1p signalling pathway, involved in yeast response to glucose starvation, is demonstrated to occur in response to acetic acid stress but no evidence was obtained supporting the acetic acid-induced inhibition of glucose uptake. Conclusions Approximately 490 of the 650 determinants of tolerance to acetic acid identified in this work are implicated, for the first time, in tolerance to

  10. Oral Tolerance: A New Tool for the Treatment of Gastrointestinal Inflammatory Disorders and Liver-Directed Gene Therapy

    Directory of Open Access Journals (Sweden)

    Yaron Ilan

    1999-01-01

    Full Text Available Oral tolerance is a method of downregulating an immune response by feeding antigens. The use of oral tolerance toward adenoviruses and colitis-extracted proteins for long term gene therapy and alleviation of experimental colitis, and the mechanisms of tolerance induction are presented. Adenoviruses are efficient vectors in liver-directed gene therapy; however, the antiviral immune response precludes the ability to achieve long term gene expression and prohibits the ability to reinject the recombinant virus. Oral tolerance induction via feeding of viral-extracted proteins prevented the antiadenoviral humoral and cellular immune responses, thus enabling long term gene therapy using these viruses. Moreover, pre-existing immune response to the virus was overcome by tolerance induction, enabling prolonged gene expression in a presensitized host. Inflammatory bowel diseases are immune-mediated disorders where an imbalance between proinflammatory (T helper cell type 1 and anti-inflammatory (T helper cell type 2 cytokines are thought to play a role in the pathogenesis. In the experimental colitis model, the feeding of colitis-extracted proteins downregulated the anticolon immune response. Tolerance induction toward colitis-extracted proteins ameliorated colonic inflammation as shown by decreased diarrhea and reduction of colonic ulcerations, intestinal and peritoneal adhesions, wall thickness and edema. Histological parameters for colitis were markedly improved in tolerized animals. In both models, tolerized animals developed an increase in transforming growth factor-beta, interleukin-4 and interleukin-10, and a decrease in the mRNA of interferon-gamma lymphocytes and serum levels. Adoptive transfer of tolerized lymphocytes enabled the transfer of tolerance toward adenoviruses and colon-extracted proteins. Thus, oral tolerance induces suppressor lymphocytes that mediate immune response downregulation by induction of a shift from a proinflammatory T

  11. Gene expression programs during Brassica oleracea seed maturation, osmopriming and germination process and the stress tolerance level

    NARCIS (Netherlands)

    Soeda, Y.; Konings, M.C.J.M.; Vorst, O.F.J.; Houwelingen, van A.M.M.L.; Stoopen, G.M.; Maliepaard, C.A.; Kodde, J.; Bino, R.J.; Groot, S.P.C.; Geest, van der A.H.M.

    2005-01-01

    During seed maturation and germination, major changes in physiological status, gene expression, and metabolic events take place. Using chlorophyll sorting, osmopriming, and different drying regimes, Brassica oleracea seed lots of different maturity, stress tolerance, and germination behavior were

  12. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  13. Alteration of gene expression during the induction of freezing tolerance in Brassica napus suspension cultures

    International Nuclear Information System (INIS)

    Johnson-Flanagan, A.M.; Singh, J.

    1987-01-01

    Brassica napus suspension-cultured cells can be hardened to a lethal temperature for 50% of the sample of -20 0 C in eight days at room temperature with abscisic acid. During the induction of freezing tolerance, changes were observed in the electrophoretic pattern of [ 35 S]methionine labeled polypeptides. In hardening cells, a 20 kilodalton polypeptide was induced on day 2 and its level increased during hardening. The induction of freezing tolerance with nonmaximal hardening regimens also resulted in increases in the 20 kilodalton polypeptide. The 20 kilodalton polypeptide was associated with a membrane fraction enriched in endoplasmic reticulum and was resolved as a single spot by two-dimensional electrophoresis. In vitro translation of mRNA indicate alteration of gene expression during abscisic acid induction of freezing tolerance. The new mRNA encodes a 20 kilodalton polypeptide associated with increased freezing tolerance induced by either abscisic acid or high sucrose. A 20 kilodalton polypeptide was also translated by mRNA isolated from cold-hardened B. napus plants

  14. Overexpression of Bacterial mtlD Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol

    Directory of Open Access Journals (Sweden)

    Tengale Dipak Bhauso

    2014-01-01

    Full Text Available In the changing global environmental scenarios, water scarcity and recurrent drought impose huge reductions to the peanut (Arachis hypogaea L. crop yield. In plants, osmotic adjustments associated with efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms. Mannitol, a compatible solute, is known to scavenge hydroxyl radicals generated during various abiotic stresses, thereby conferring tolerance to water-deficit stress in many plant species. However, peanut plant is not known to synthesize mannitol. Therefore, bacterial mtlD gene coding for mannitol 1-phosphate dehydrogenase under the control of constitutive promoter CaMV35S was introduced and overexpressed in the peanut cv. GG 20 using Agrobacterium tumefaciens-mediated transformation. A total of eight independent transgenic events were confirmed at molecular level by PCR, Southern blotting, and RT-PCR. Transgenic lines had increased amount of mannitol and exhibited enhanced tolerance in response to water-deficit stress. Improved performance of the mtlD transgenics was indicated by excised-leaf water loss assay and relative water content under water-deficit stress. Better performance of transgenics was due to the ability of the plants to synthesize mannitol. However, regulation of mtlD gene expression in transgenic plants remains to be elucidated.

  15. Over-Expression of Arabidopsis EDT1 Gene Confers Drought Tolerance in Alfalfa (Medicago sativa L.

    Directory of Open Access Journals (Sweden)

    Guangshun Zheng

    2017-12-01

    Full Text Available Alfalfa (Medicago sativa L. is an important legume forage crop with great economic value. However, as the growth of alfalfa is seriously affected by an inadequate supply of water, drought is probably the major abiotic environmental factor that most severely affects alfalfa production worldwide. In an effort to enhance alfalfa drought tolerance, we transformed the Arabidopsis Enhanced Drought Tolerance 1 (AtEDT1 gene into alfalfa via Agrobacterium-mediated transformation. Compared with wild type plants, drought stress treatment resulted in higher survival rates and biomass, but reduced water loss rates in the transgenic plants. Furthermore, transgenic alfalfa plants had increased stomatal size, but reduced stomatal density, and these stomatal changes contributed greatly to reduced water loss from leaves. Importantly, transgenic alfalfa plants exhibited larger root systems with larger root lengths, root weight, and root diameters than wild type plants. The transgenic alfalfa plants had reduced membrane permeability and malondialdehyde content, but higher soluble sugar and proline content, higher superoxide dismutase activity, higher chlorophyll content, enhanced expression of drought-responsive genes, as compared with wild type plants. Notably, transgenic alfalfa plants grew better in a 2-year field trial and showed enhanced growth performance with increased biomass yield. All of our morphological, physiological, and molecular analyses demonstrated that the ectopic expression of AtEDT1 improved growth and enhanced drought tolerance in alfalfa. Our study provides alfalfa germplasm for use in forage improvement programs, and may help to increase alfalfa production in arid lands.

  16. Enhanced water stress tolerance of transgenic maize plants over-expressing LEA Rab28 gene.

    Science.gov (United States)

    Amara, Imen; Capellades, Montserrat; Ludevid, M Dolors; Pagès, Montserrat; Goday, Adela

    2013-06-15

    Late Embryogenesis Abundant (LEA) proteins participate in plant stress responses and contribute to the acquisition of desiccation tolerance. In this report Rab28 LEA gene has been over-expressed in maize plants under a constitutive maize promoter. The expression of Rab28 transcripts led to the accumulation and stability of Rab28 protein in the transgenic plants. Native Rab28 protein is localized to nucleoli in wild type maize embryo cells; here we find by whole-mount immunocytochemistry that in root cells of Rab28 transgenic and wild-type plants the protein is also associated to nucleolar structures. Transgenic plants were tested for stress tolerance and resulted in sustained growth under polyethyleneglycol (PEG)-mediated dehydration compared to wild-type controls. Under osmotic stress transgenic seedlings showed increased leaf and root areas, higher relative water content (RWC), reduced chlorophyll loss and lower Malondialdehyde (MDA) production in relation to wild-type plants. Moreover, transgenic seeds exhibited higher germination rates than wild-type seeds under water deficit. Overall, our results highlight the presence of transgenic Rab28 protein in nucleolar structures and point to the potential of group 5 LEA Rab28 gene as candidate to enhance stress tolerance in maize plants. Copyright © 2013 Elsevier GmbH. All rights reserved.

  17. Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance

    Science.gov (United States)

    Ensminger, Stephan M.; Spriewald, Bernd M.

    2012-01-01

    Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401

  18. Overexpression of AmRosea1 Gene Confers Drought and Salt Tolerance in Rice

    Directory of Open Access Journals (Sweden)

    Mingzhu Dou

    2016-12-01

    Full Text Available Ectopic expression of the MYB transcription factor of AmROSEA1 from Antirrhinum majus has been reported to change anthocyanin and other metabolites in several species. In this study, we found that overexpression of AmRosea1 significantly improved the tolerance of transgenic rice to drought and salinity stresses. Transcriptome analysis revealed that a considerable number of stress-related genes were affected by exogenous AmRosea1 during both drought and salinity stress treatments. These affected genes are involved in stress signal transduction, the hormone signal pathway, ion homeostasis and the enzymes that remove peroxides. This work suggests that the AmRosea1 gene is a potential candidate for genetic engineering of crops.

  19. Sequence-Based Introgression Mapping Identifies Candidate White Mold Tolerance Genes in Common Bean

    Directory of Open Access Journals (Sweden)

    Sujan Mamidi

    2016-07-01

    Full Text Available White mold, caused by the necrotrophic fungus (Lib. de Bary, is a major disease of common bean ( L.. WM7.1 and WM8.3 are two quantitative trait loci (QTL with major effects on tolerance to the pathogen. Advanced backcross populations segregating individually for either of the two QTL, and a recombinant inbred (RI population segregating for both QTL were used to fine map and confirm the genetic location of the QTL. The QTL intervals were physically mapped using the reference common bean genome sequence, and the physical intervals for each QTL were further confirmed by sequence-based introgression mapping. Using whole-genome sequence data from susceptible and tolerant DNA pools, introgressed regions were identified as those with significantly higher numbers of single-nucleotide polymorphisms (SNPs relative to the whole genome. By combining the QTL and SNP data, WM7.1 was located to a 660-kb region that contained 41 gene models on the proximal end of chromosome Pv07, while the WM8.3 introgression was narrowed to a 1.36-Mb region containing 70 gene models. The most polymorphic candidate gene in the WM7.1 region encodes a BEACH-domain protein associated with apoptosis. Within the WM8.3 interval, a receptor-like protein with the potential to recognize pathogen effectors was the most polymorphic gene. The use of gene and sequence-based mapping identified two candidate genes whose putative functions are consistent with the current model of pathogenicity.

  20. Mapping of HKT1;5 Gene in Barley Using GWAS Approach and Its Implication in Salt Tolerance Mechanism

    Science.gov (United States)

    Hazzouri, Khaled M.; Khraiwesh, Basel; Amiri, Khaled M. A.; Pauli, Duke; Blake, Tom; Shahid, Mohammad; Mullath, Sangeeta K.; Nelson, David; Mansour, Alain L.; Salehi-Ashtiani, Kourosh; Purugganan, Michael; Masmoudi, Khaled

    2018-01-01

    Sodium (Na+) accumulation in the cytosol will result in ion homeostasis imbalance and toxicity of transpiring leaves. Studies of salinity tolerance in the diploid wheat ancestor Triticum monococcum showed that HKT1;5-like gene was a major gene in the QTL for salt tolerance, named Nax2. In the present study, we were interested in investigating the molecular mechanisms underpinning the role of the HKT1;5 gene in salt tolerance in barley (Hordeum vulgare). A USDA mini-core collection of 2,671 barley lines, part of a field trial was screened for salinity tolerance, and a Genome Wide Association Study (GWAS) was performed. Our results showed important SNPs that are correlated with salt tolerance that mapped to a region where HKT1;5 ion transporter located on chromosome four. Furthermore, sodium (Na+) and potassium (K+) content analysis revealed that tolerant lines accumulate more sodium in roots and leaf sheaths, than in the sensitive ones. In contrast, sodium concentration was reduced in leaf blades of the tolerant lines under salt stress. In the absence of NaCl, the concentration of Na+ and K+ were the same in the roots, leaf sheaths and leaf blades between the tolerant and the sensitive lines. In order to study the molecular mechanism behind that, alleles of the HKT1;5 gene from five tolerant and five sensitive barley lines were cloned and sequenced. Sequence analysis did not show the presence of any polymorphism that distinguishes between the tolerant and sensitive alleles. Our real-time RT-PCR experiments, showed that the expression of HKT1;5 gene in roots of the tolerant line was significantly induced after challenging the plants with salt stress. In contrast, in leaf sheaths the expression was decreased after salt treatment. In sensitive lines, there was no difference in the expression of HKT1;5 gene in leaf sheath under control and saline conditions, while a slight increase in the expression was observed in roots after salt treatment. These results provide

  1. Mapping of HKT1;5 Gene in Barley Using GWAS Approach and Its Implication in Salt Tolerance Mechanism

    Directory of Open Access Journals (Sweden)

    Khaled M. Hazzouri

    2018-02-01

    Full Text Available Sodium (Na+ accumulation in the cytosol will result in ion homeostasis imbalance and toxicity of transpiring leaves. Studies of salinity tolerance in the diploid wheat ancestor Triticum monococcum showed that HKT1;5-like gene was a major gene in the QTL for salt tolerance, named Nax2. In the present study, we were interested in investigating the molecular mechanisms underpinning the role of the HKT1;5 gene in salt tolerance in barley (Hordeum vulgare. A USDA mini-core collection of 2,671 barley lines, part of a field trial was screened for salinity tolerance, and a Genome Wide Association Study (GWAS was performed. Our results showed important SNPs that are correlated with salt tolerance that mapped to a region where HKT1;5 ion transporter located on chromosome four. Furthermore, sodium (Na+ and potassium (K+ content analysis revealed that tolerant lines accumulate more sodium in roots and leaf sheaths, than in the sensitive ones. In contrast, sodium concentration was reduced in leaf blades of the tolerant lines under salt stress. In the absence of NaCl, the concentration of Na+ and K+ were the same in the roots, leaf sheaths and leaf blades between the tolerant and the sensitive lines. In order to study the molecular mechanism behind that, alleles of the HKT1;5 gene from five tolerant and five sensitive barley lines were cloned and sequenced. Sequence analysis did not show the presence of any polymorphism that distinguishes between the tolerant and sensitive alleles. Our real-time RT-PCR experiments, showed that the expression of HKT1;5 gene in roots of the tolerant line was significantly induced after challenging the plants with salt stress. In contrast, in leaf sheaths the expression was decreased after salt treatment. In sensitive lines, there was no difference in the expression of HKT1;5 gene in leaf sheath under control and saline conditions, while a slight increase in the expression was observed in roots after salt treatment. These

  2. Diagnostic value of tolerance-related gene expression measured in the recipient alloantigen-reactive T cell fraction.

    Science.gov (United States)

    Lim, Dong-Gyun; Park, Youn-Hee; Kim, Sung-Eun; Jeong, Seong-Hee; Kim, Song-Cheol

    2013-08-01

    The efficient development of tolerance-inducing therapies and safe reduction of immunosuppression should be supported by early diagnosis and prediction of tolerance in transplantation. Using mouse models of donor-specific tolerance to allogeneic skin and islet grafts we tested whether measurement of tolerance-related gene expression in their alloantigen-reactive peripheral T cell fraction efficiently reflected the tolerance status of recipients. We found that Foxp3, Nrn1, and Klrg1 were preferentially expressed in conditions of tolerance compared with rejection or unmanipulated controls if their expression is measured in CD69(+) T cells prepared from coculture of recipient peripheral T cells and donor antigen-presenting cells. The same pattern of gene expression was observed in recipients grafted with either skin or islets, recipients of different genetic origins, and even those taking immunosuppressive drugs. These findings suggest that the expression of tolerance-related genes in the alloantigen-reactive T cell fraction could be used to detect tolerance in the clinic. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Differential activation of genes related to aluminium tolerance in two contrasting rice cultivars.

    Science.gov (United States)

    Roselló, Maite; Poschenrieder, Charlotte; Gunsé, Benet; Barceló, Juan; Llugany, Mercè

    2015-11-01

    Rice (Oryza sativa) is a highly Al-tolerant crop. Among other mechanisms, a higher expression of STAR1/STAR2 (sensitive to Al rhizotoxicity1/2) genes and of Nrat1 (NRAMP Aluminium Transporter 1), and ALS1 (Aluminium sensitive 1) can at least in part be responsible for the inducible Al tolerance in this species. Here we analysed the responses to Al in two contrasting rice varieties. All analysed toxicity/tolerance markers (root elongation, Evans blue, morin and haematoxylin staining) indicated higher Al-tolerance in variety Nipponbare, than in variety Modan. Nipponbare accumulated much less Al in the roots than Modan. Aluminium supply caused stronger expression of STAR1 in Nipponbare than in Modan. A distinctively higher increase of Al-induced abscisic acid (ABA) accumulation was found in the roots of Nipponbare than in Modan. Highest ABA levels were observed in Nipponbare after 48 h exposure to Al. This ABA peak was coincident in time with the highest expression level of STAR1. It is proposed that ABA may be required for cell wall remodulation facilitated by the enhanced UDP-glucose transport to the walls through STAR1/STAR2. Contrastingly, in the roots of Modan the expression of both Nrat1 coding for a plasma membrane Al-transporter and of ALS1 coding for a tonoplast-localized Al transporter was considerably enhanced. Moreover, Modan had a higher Al-induced expression of ASR1 a gene that has been proposed to code for a reactive oxygen scavenging protein. In conclusion, the Al-exclusion strategy of Nipponbare, at least in part mediated by STAR1 and probably regulated by ABA, provided better protection against Al toxicity than the accumulation and internal detoxification strategy of Modan mediated by Nrat1, ALS1 and ARS1. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    Energy Technology Data Exchange (ETDEWEB)

    Dixit, Prachy; Mukherjee, Prasun K.; Sherkhane, Pramod D.; Kale, Sharad P. [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Eapen, Susan, E-mail: eapenhome@yahoo.com [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2011-08-15

    Highlights: {yields} Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. {yields} Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. {yields} Using in vitro T{sub 1} seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. {yields} This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of {sup 14}C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T{sub 0} and T{sub 1}) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  5. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    International Nuclear Information System (INIS)

    Dixit, Prachy; Mukherjee, Prasun K.; Sherkhane, Pramod D.; Kale, Sharad P.; Eapen, Susan

    2011-01-01

    Highlights: → Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. → Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. → Using in vitro T 1 seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. → This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of 14 C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T 0 and T 1 ) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  6. Overexpression of a Triticum aestivum Calreticulin gene (TaCRT1 Improves Salinity Tolerance in Tobacco.

    Directory of Open Access Journals (Sweden)

    Yang Xiang

    Full Text Available Calreticulin (CRT is a highly conserved and abundant multifunctional protein that is encoded by a small gene family and is often associated with abiotic/biotic stress responses in plants. However, the roles played by this protein in salt stress responses in wheat (Triticum aestivum remain obscure. In this study, three TaCRT genes were identified in wheat and named TaCRT1, TaCRT2 and TaCRT3-1 based on their sequence characteristics and their high homology to other known CRT genes. Quantitative real-time PCR expression data revealed that these three genes exhibit different expression patterns in different tissues and are strongly induced under salt stress in wheat. The calcium-binding properties of the purified recombinant TaCRT1 protein were determined using a PIPES/Arsenazo III analysis. TaCRT1 gene overexpression in Nicotiana tabacum decreased salt stress damage in transgenic tobacco plants. Physiological measurements indicated that transgenic tobacco plants showed higher activities of superoxide dismutase (SOD, peroxidase (POD and catalase (CAT than non-transgenic tobacco under normal growth conditions. Interestingly, overexpression of the entire TaCRT1 gene or of partial TaCRT1 segments resulted in significantly higher tolerance to salt stress in transgenic plants compared with their WT counterparts, thus revealing the essential role of the C-domain of TaCRT1 in countering salt stress in plants.

  7. Suppression of a NAC-Like Transcription Factor Gene Improves Boron-Toxicity Tolerance in Rice1

    Science.gov (United States)

    Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru

    2011-01-01

    We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity. PMID:21543724

  8. Intermittent hypoxia training in prediabetes patients: Beneficial effects on glucose homeostasis, hypoxia tolerance and gene expression.

    Science.gov (United States)

    Serebrovska, Tetiana V; Portnychenko, Alla G; Drevytska, Tetiana I; Portnichenko, Vladimir I; Xi, Lei; Egorov, Egor; Gavalko, Anna V; Naskalova, Svitlana; Chizhova, Valentina; Shatylo, Valeriy B

    2017-09-01

    The present study aimed at examining beneficial effects of intermittent hypoxia training (IHT) under prediabetic conditions. We investigate the effects of three-week IHT on blood glucose level, tolerance to acute hypoxia, and leukocyte mRNA expression of hypoxia inducible factor 1α (HIF-1α) and its target genes, i.e. insulin receptor, facilitated glucose transporter-solute carrier family-2, and potassium voltage-gated channel subfamily J. Seven healthy and 11 prediabetic men and women (44-70 years of age) were examined before, next day and one month after three-week IHT (3 sessions per week, each session consisting 4 cycles of 5-min 12% O 2 and 5-min room air breathing). We found that IHT afforded beneficial effects on glucose homeostasis in patients with prediabetes reducing fasting glucose and during standard oral glucose tolerance test. The most pronounced positive effects were observed at one month after IHT termination. IHT also significantly increased the tolerance to acute hypoxia (i.e. SaO 2 level at 20th min of breathing with 12% O 2 ) and improved functional parameters of respiratory and cardiovascular systems. IHT stimulated HIF-1α mRNA expression in blood leukocytes in healthy and prediabetic subjects, but in prediabetes patients the maximum increase was lagged. The greatest changes in mRNA expression of HIF-1α target genes occurred a month after IHT and coincided with the largest decrease in blood glucose levels. The higher expression of HIF-1α was positively associated with higher tolerance to hypoxia and better glucose homeostasis. In conclusion, our results suggest that IHT may be useful for preventing the development of type 2 diabetes. Impact statement The present study investigated the beneficial effects of intermittent hypoxia training (IHT) in humans under prediabetic conditions. We found that three-week moderate IHT induced higher HIF-1α mRNA expressions as well as its target genes, which were positively correlated with higher tolerance

  9. Overexpression of snapdragon Delila (Del) gene in tobacco enhances anthocyanin accumulation and abiotic stress tolerance.

    Science.gov (United States)

    Naing, Aung Htay; Park, Kyeung Il; Ai, Trinh Ngoc; Chung, Mi Young; Han, Jeung Sul; Kang, Young-Wha; Lim, Ki Byung; Kim, Chang Kil

    2017-03-23

    Rosea1 (Ros1) and Delila (Del) co-expression controls anthocyanin accumulation in snapdragon flowers, while their overexpression in tomato strongly induces anthocyanin accumulation. However, little data exist on how Del expression alone influences anthocyanin accumulation. In tobacco (Nicotiana tabacum 'Xanthi'), Del expression enhanced leaf and flower anthocyanin production through regulating NtCHS, NtCHI, NtF3H, NtDFR, and NtANS transcript levels. Transgenic lines displayed different anthocyanin colors (e.g., pale red: T 0 -P, red: T 0 -R, and strong red: T 0 -S), resulting from varying levels of biosynthetic gene transcripts. Under salt stress, the T 2 generation had higher total polyphenol content, radical (DPPH, ABTS) scavenging activities, antioxidant-related gene expression, as well as overall greater salt and drought tolerance than wild type (WT). We propose that Del overexpression elevates transcript levels of anthocyanin biosynthetic and antioxidant-related genes, leading to enhanced anthocyanin production and antioxidant activity. The resultant increase of anthocyanin and antioxidant activity improves abiotic stress tolerance.

  10. Wheat TaSP gene improves salt tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Ma, Xiaoli; Cui, Weina; Liang, Wenji; Huang, Zhanjing

    2015-12-01

    A novel salt-induced gene with unknown functions was cloned through analysis of gene expression profile of a salt-tolerant wheat mutant RH8706-49 under salt stress. The gene was named Triticum aestivum salt-related protein (TaSP) and deposited in GenBank (Accession No. KF307326). Quantitative polymerase chain reaction (qPCR) results showed that TaSP expression was induced under salt, abscisic acid (ABA), and polyethylene glycol (PEG) stresses. Subcellular localization revealed that TaSP was mainly localized in cell membrane. Overexpression of TaSP in Arabidopsis could improve salt tolerance of 35S::TaSP transgenic Arabidopsis. 35S::TaSP transgenic Arabidopsis lines after salt stress presented better physiological indexes than the control group. In the non-invasive micro-test (NMT), an evident Na(+) excretion was observed at the root tip of salt-stressed 35S::TaSP transgenic Arabidopsis. TaSP promoter was cloned, and its beta-glucuronidase (GUS) activities before and after ABA, salt, cold, heat, and salicylic acid (SA) stresses were determined. Full-length TaSP promoter contained ABA and salt response elements. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  11. Stable expression of mtlD gene imparts multiple stress tolerance in finger millet.

    Science.gov (United States)

    Hema, Ramanna; Vemanna, Ramu S; Sreeramulu, Shivakumar; Reddy, Chandrasekhara P; Senthil-Kumar, Muthappa; Udayakumar, Makarla

    2014-01-01

    Finger millet is susceptible to abiotic stresses, especially drought and salinity stress, in the field during seed germination and early stages of seedling development. Therefore developing stress tolerant finger millet plants combating drought, salinity and associated oxidative stress in these two growth stages is important. Cellular protection through osmotic adjustment and efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms in plants. Mannitol, an osmolyte, is known to scavenge hydroxyl radicals generated during various abiotic stresses and thereby minimize stress damage in several plant species. In this study transgenic finger millet plants expressing the mannitol biosynthetic pathway gene from bacteria, mannitol-1-phosphate dehydrogenase (mtlD), were developed through Agrobacterium tumefaciens-mediated genetic transformation. mtlD gene integration in the putative transgenic plants was confirmed by Southern blot. Further, performance of transgenic finger millet under drought, salinity and oxidative stress was studied at plant level in T1 generation and in T1 and T2 generation seedlings. Results from these experiments showed that transgenic finger millet had better growth under drought and salinity stress compared to wild-type. At plant level, transgenic plants showed better osmotic adjustment and chlorophyll retention under drought stress compared to the wild-type. However, the overall increase in stress tolerance of transgenics for the three stresses, especially for oxidative stress, was only marginal compared to other mtlD gene expressing plant species reported in the literature. Moreover, the Agrobacterium-mediated genetic transformation protocol developed for finger millet in this study can be used to introduce diverse traits of agronomic importance in finger millet.

  12. Stable expression of mtlD gene imparts multiple stress tolerance in finger millet.

    Directory of Open Access Journals (Sweden)

    Ramanna Hema

    Full Text Available Finger millet is susceptible to abiotic stresses, especially drought and salinity stress, in the field during seed germination and early stages of seedling development. Therefore developing stress tolerant finger millet plants combating drought, salinity and associated oxidative stress in these two growth stages is important. Cellular protection through osmotic adjustment and efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms in plants. Mannitol, an osmolyte, is known to scavenge hydroxyl radicals generated during various abiotic stresses and thereby minimize stress damage in several plant species. In this study transgenic finger millet plants expressing the mannitol biosynthetic pathway gene from bacteria, mannitol-1-phosphate dehydrogenase (mtlD, were developed through Agrobacterium tumefaciens-mediated genetic transformation. mtlD gene integration in the putative transgenic plants was confirmed by Southern blot. Further, performance of transgenic finger millet under drought, salinity and oxidative stress was studied at plant level in T1 generation and in T1 and T2 generation seedlings. Results from these experiments showed that transgenic finger millet had better growth under drought and salinity stress compared to wild-type. At plant level, transgenic plants showed better osmotic adjustment and chlorophyll retention under drought stress compared to the wild-type. However, the overall increase in stress tolerance of transgenics for the three stresses, especially for oxidative stress, was only marginal compared to other mtlD gene expressing plant species reported in the literature. Moreover, the Agrobacterium-mediated genetic transformation protocol developed for finger millet in this study can be used to introduce diverse traits of agronomic importance in finger millet.

  13. Dynamic QTL analysis and candidate gene mapping for waterlogging tolerance at maize seedling stage.

    Directory of Open Access Journals (Sweden)

    Khalid A Osman

    Full Text Available Soil waterlogging is one of the major abiotic stresses adversely affecting maize growth and yield. To identify dynamic expression of genes or quantitative trait loci (QTL, QTL associated with plant height, root length, root dry weight, shoot dry weight and total dry weight were identified via conditional analysis in a mixed linear model and inclusive composite interval mapping method at three respective periods under waterlogging and control conditions. A total of 13, 19 and 23 QTL were detected at stages 3D|0D (the period during 0-3 d of waterlogging, 6D|3D and 9D|6D, respectively. The effects of each QTL were moderate and distributed over nine chromosomes, singly explaining 4.14-18.88% of the phenotypic variation. Six QTL (ph6-1, rl1-2, sdw4-1, sdw7-1, tdw4-1 and tdw7-1 were identified at two consistent stages of seedling development, which could reflect a continuous expression of genes; the remaining QTL were detected at only one stage. Thus, expression of most QTL was influenced by the developmental status. In order to provide additional evidence regarding the role of corresponding genes in waterlogging tolerance, mapping of Expressed Sequence Tags markers and microRNAs were conducted. Seven candidate genes were observed to co-localize with the identified QTL on chromosomes 1, 4, 6, 7 and 9, and may be important candidate genes for waterlogging tolerance. These results are a good starting point for understanding the genetic basis for selectively expressing of QTL in different stress periods and the common genetic control mechanism of the co-localized traits.

  14. Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

    Energy Technology Data Exchange (ETDEWEB)

    Monette, Michelle Y., E-mail: michelle.monette@yale.edu [Organismic and Evolutionary Biology Program, University of Massachusetts, Amherst, MA 01003 (United States); USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376 (United States); Yada, Takashi [Freshwater Fisheries Research Department, National Research Institute of Fisheries Science, Nikko (Japan); Matey, Victoria [Department of Biology, San Diego State University, San Diego, CA 92182 (United States); McCormick, Stephen D. [Organismic and Evolutionary Biology Program, University of Massachusetts, Amherst, MA 01003 (United States); USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376 (United States)

    2010-08-01

    We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4 {mu}g l{sup -1} Al), acid and low Al (LAl: pH 5.4, 11 {mu}g l{sup -1} Al), acid and moderate Al (MAl: pH 5.3, 42 {mu}g l{sup -1} Al), and acid and high Al (HAl: pH 5.4, 56 {mu}g l{sup -1} Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24 h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na{sup +}/K{sup +}-ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl{sup -} channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time

  15. SELECTION FOR ALUMINUM TOLERANCE IN TROPICAL SOYBEANS SELEÇÃO PARA TOLERÂNCIA AO ALUMÍNIO EM SOJA TROPICAL

    Directory of Open Access Journals (Sweden)

    Luiz Augusto Copati Souza

    2007-09-01

    Full Text Available

    Soil acidity is a limiting factor for most of the cultivated plants in the Brazilian Savannah. Toxicity caused by aluminum (Al is especially serious in the acid subsurface, which remains acidic after soil has been amended, by hindering root growth and causing drought susceptibility and nutritional unbalance. This research aimed at selecting soybean with increased tolerance to Al through association of hydroponics and field experiments. Crosses including savannah adapted genotypes were obtained. Seeds of contrasting individuals, selected in hydroponics at F2 generation for root growth, were obtained for progeny evaluation at F3, in the field, and at F4 in hydroponics. Grain production and total dry matter of selected progenies were superior to the parentals, in the acid soil experiment. These results were confirmed by performance in hydroponics, indicating the method may be successfully employed in breeding programs for crop adaptation to subsurface acid soil conditions.

    KEY-WORDS: Subsurface acidity; Glycine max; Al stress; plant breeding.

    A acidez do solo é fator limitante para a maioria das plantas cultivadas no Cerrado Brasileiro. A toxidez causada por alumínio (Al é especialmente séria na subsuperfície, que permanece ácida após o uso de corretivos, por impedir o crescimento radicular e causar suscetibilidade à seca e desbalanceamento nutricional. Aqui objetivou-se a seleção de genótipos de soja com maior tolerância ao Al, pela associação de experimentos em hidroponia e no campo. Cruzamentos incluindo genótipos selecionados no Cerrado foram realizados. Sementes de indivíduos contrastantes, selecionados em hidroponia na geração F2 pelo crescimento radicular, foram obtidas para avaliação de progênies em F3, no campo, e em F4, novamente em hidroponia

  16. Genetic and molecular analyses of natural variation indicate CBF2 as a candidate gene for underlying a freezing tolerance quantitative trait locus in Arabidopsis

    NARCIS (Netherlands)

    Alonso-Blanco, C.; Gomez-Mena, C.; Llorente, F.; Koornneef, M.; Salinas, J.; Martinez-Zapater, J.M.

    2005-01-01

    Natural variation for freezing tolerance is a major component of adaptation and geographic distribution of plant species. However, little is known about the genes and molecular mechanisms that determine its naturally occurring diversity. We have analyzed the intraspecific freezing tolerance

  17. Association between ghrelin gene variations and blood pressure in subjects with impaired glucose tolerance.

    Science.gov (United States)

    Mager, Ursula; Kolehmainen, Marjukka; Lindström, Jaana; Eriksson, Johan G; Valle, Timo T; Hämäläinen, Helena; Ilanne-Parikka, Pirjo; Keinänen-Kiukaanniemi, Sirkka; Tuomilehto, Jaakko O; Pulkkinen, Leena; Uusitupa, Matti I

    2006-09-01

    Ghrelin is a gut-brain hormone, which stimulates food intake and controls energy balance. Recently, it has been shown that ghrelin may also play a role in the regulation of blood pressure (BP) by acting at the sympathetic nervous system. In the present study we genotyped six variants of the ghrelin gene and its promoter, and tested whether these single nucleotide polymorphisms (SNPs) were associated with BP levels in participants of the Finnish Diabetes Prevention Study. The Finnish Diabetes Prevention Study was a longitudinal study where 522 subjects with impaired glucose tolerance were randomized into either an intervention or control group. DNA was available from 507 subjects (mean body mass index [BMI] 31.2+/-4.5 kg/m2, age 55+/-7 years). All six SNPs were screened by the restriction fragment length polymorphism method. Subjects with the most common genotype combination of the following four SNPs, -604G/A, -501A/C, Leu72Met, and Gln90Leu, had the lowest systolic (131+/-11 v 137+/-13 mm Hg, P=.003) and diastolic BP levels (79+/-7 v 83+/-7 mm Hg, P=.004) at the baseline of the study and during 3 years of follow-up compared to all other genotypes. Adjustments for age, gender, antihypertensive medication, BMI, waist circumference, and alcohol intake did not change this association. Several ghrelin gene variations were associated with BP levels in subjects with impaired glucose tolerance.

  18. Neonatal tolerance induction enables accurate evaluation of gene therapy for MPS I in a canine model.

    Science.gov (United States)

    Hinderer, Christian; Bell, Peter; Louboutin, Jean-Pierre; Katz, Nathan; Zhu, Yanqing; Lin, Gloria; Choa, Ruth; Bagel, Jessica; O'Donnell, Patricia; Fitzgerald, Caitlin A; Langan, Therese; Wang, Ping; Casal, Margret L; Haskins, Mark E; Wilson, James M

    2016-09-01

    High fidelity animal models of human disease are essential for preclinical evaluation of novel gene and protein therapeutics. However, these studies can be complicated by exaggerated immune responses against the human transgene. Here we demonstrate that dogs with a genetic deficiency of the enzyme α-l-iduronidase (IDUA), a model of the lysosomal storage disease mucopolysaccharidosis type I (MPS I), can be rendered immunologically tolerant to human IDUA through neonatal exposure to the enzyme. Using MPS I dogs tolerized to human IDUA as neonates, we evaluated intrathecal delivery of an adeno-associated virus serotype 9 vector expressing human IDUA as a therapy for the central nervous system manifestations of MPS I. These studies established the efficacy of the human vector in the canine model, and allowed for estimation of the minimum effective dose, providing key information for the design of first-in-human trials. This approach can facilitate evaluation of human therapeutics in relevant animal models, and may also have clinical applications for the prevention of immune responses to gene and protein replacement therapies. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Differential regulation of mitochondrial pyruvate carrier genes modulates respiratory capacity and stress tolerance in yeast.

    Directory of Open Access Journals (Sweden)

    Alba Timón-Gómez

    Full Text Available Mpc proteins are highly conserved from yeast to humans and are necessary for the uptake of pyruvate at the inner mitochondrial membrane, which is used for leucine and valine biosynthesis and as a fuel for respiration. Our analysis of the yeast MPC gene family suggests that amino acid biosynthesis, respiration rate and oxidative stress tolerance are regulated by changes in the Mpc protein composition of the mitochondria. Mpc2 and Mpc3 are highly similar but functionally different: Mpc2 is most abundant under fermentative non stress conditions and important for amino acid biosynthesis, while Mpc3 is the most abundant family member upon salt stress or when high respiration rates are required. Accordingly, expression of the MPC3 gene is highly activated upon NaCl stress or during the transition from fermentation to respiration, both types of regulation depend on the Hog1 MAP kinase. Overexpression experiments show that gain of Mpc2 function leads to a severe respiration defect and ROS accumulation, while Mpc3 stimulates respiration and enhances tolerance to oxidative stress. Our results identify the regulated mitochondrial pyruvate uptake as an important determinant of respiration rate and stress resistance.

  20. Differential regulation of mitochondrial pyruvate carrier genes modulates respiratory capacity and stress tolerance in yeast.

    Science.gov (United States)

    Timón-Gómez, Alba; Proft, Markus; Pascual-Ahuir, Amparo

    2013-01-01

    Mpc proteins are highly conserved from yeast to humans and are necessary for the uptake of pyruvate at the inner mitochondrial membrane, which is used for leucine and valine biosynthesis and as a fuel for respiration. Our analysis of the yeast MPC gene family suggests that amino acid biosynthesis, respiration rate and oxidative stress tolerance are regulated by changes in the Mpc protein composition of the mitochondria. Mpc2 and Mpc3 are highly similar but functionally different: Mpc2 is most abundant under fermentative non stress conditions and important for amino acid biosynthesis, while Mpc3 is the most abundant family member upon salt stress or when high respiration rates are required. Accordingly, expression of the MPC3 gene is highly activated upon NaCl stress or during the transition from fermentation to respiration, both types of regulation depend on the Hog1 MAP kinase. Overexpression experiments show that gain of Mpc2 function leads to a severe respiration defect and ROS accumulation, while Mpc3 stimulates respiration and enhances tolerance to oxidative stress. Our results identify the regulated mitochondrial pyruvate uptake as an important determinant of respiration rate and stress resistance.

  1. Overexpression of Thellungiella halophila H+-pyrophosphatase Gene Improves Low Phosphate Tolerance in Maize

    Science.gov (United States)

    Pei, Laming; Wang, Jiemin; Li, Kunpeng; Li, Yongjun; Li, Bei; Gao, Feng; Yang, Aifang

    2012-01-01

    Low phosphate availability is a major constraint on plant growth and agricultural productivity. Engineering a crop with enhanced low phosphate tolerance by transgenic technique could be one way of alleviating agricultural losses due to phosphate deficiency. In this study, we reported that transgenic maize plants that overexpressed the Thellungiella halophila vacuolar H+-pyrophosphatase gene (TsVP) were more tolerant to phosphate deficit stress than the wild type. Under phosphate sufficient conditions, transgenic plants showed more vigorous root growth than the wild type. When phosphate deficit stress was imposed, they also developed more robust root systems than the wild type, this advantage facilitated phosphate uptake, which meant that transgenic plants accumulated more phosphorus. So the growth and development in the transgenic maize plants were not damaged as much as in the wild type plants under phosphate limitation. Overexpression of TsVP increased the expression of genes involved in auxin transport, which indicated that the development of larger root systems in transgenic plants might be due in part to enhanced auxin transport which controls developmental events in plants. Moreover, transgenic plants showed less reproductive development retardation and a higher grain yield per plant than the wild type plants when grown in a low phosphate soil. The phenotypes of transgenic maize plants suggested that the overexpression of TsVP led to larger root systems that allowed transgenic maize plants to take up more phosphate, which led to less injury and better performance than the wild type under phosphate deficiency conditions. This study describes a feasible strategy for improving low phosphate tolerance in maize and reducing agricultural losses caused by phosphate deficit stress. PMID:22952696

  2. Arabidopsis Vacuolar Pyrophosphatase gene (AVP1) induces drought and salt tolerance in Nicotiana tabacum plants (abstract)

    International Nuclear Information System (INIS)

    Arif, A.; Mohsin, A.M.; Shafiq, S.; Zafar, Y.; Hameed, S.M.; Arif, M.; Javed, M.; Gaxiola, R.A.

    2005-01-01

    Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na

  3. An Alfin-like gene from Atriplex hortensis enhances salt and drought tolerance and abscisic acid response in transgenic Arabidopsis.

    Science.gov (United States)

    Tao, Jian-Jun; Wei, Wei; Pan, Wen-Jia; Lu, Long; Li, Qing-Tian; Ma, Jin-Biao; Zhang, Wan-Ke; Ma, Biao; Chen, Shou-Yi; Zhang, Jin-Song

    2018-02-09

    Alfin-like (AL) is a small plant-specific gene family with prominent roles in root growth and abiotic stress response. Here, we aimed to identify novel stress tolerance AL genes from the stress-tolerant species Atriplex hortensis. Totally, we isolated four AhAL genes, all encoding nuclear-localized proteins with cis-element-binding and transrepression activities. Constitutive expression of AhAL1 in Arabidopsis facilitated plants to survive under saline condition, while expressing anyone of the other three AhAL genes led to salt-hypersensitive response, indicating functional divergence of AhAL family. AhAL1 also conferred enhanced drought tolerance, as judged from enhanced survival, improved growth, decreased malonaldehyde (MDA) content and reduced water loss in AhAL1-expressing plants compared to WT. In addition, abscisic acid (ABA)-mediated stomatal closure and inhibition of seed germination and primary root elongation were enhanced in AhAL1-transgenic plants. Further analysis demonstrated that AhAL1 could bind to promoter regions of GRF7, DREB1C and several group-A PP2C genes and repress their expression. Correspondingly, the expression levels of positive stress regulator genes DREB1A, DREB2A and three ABFs were all increased in AhAL1-expressing plants. Based on these results, AhAL1 was identified as a novel candidate gene for improving abiotic stress tolerance of crop plants.

  4. A moso bamboo WRKY gene PeWRKY83 confers salinity tolerance in transgenic Arabidopsis plants.

    Science.gov (United States)

    Wu, Min; Liu, Huanlong; Han, Guomin; Cai, Ronghao; Pan, Feng; Xiang, Yan

    2017-09-15

    The WRKY family are transcription factors, involved in plant development, and response to biotic and abiotic stresses. Moso bamboo is an important bamboo that has high ecological, economic and cultural value and is widely distributed in the south of China. In this study, we performed a genome-wide identification of WRKY members in moso bamboo and identified 89 members. By comparative analysis in six grass genomes, we found the WRKY gene family may have experienced or be experiencing purifying selection. Based on relative expression levels among WRKY IIc members under three abiotic stresses, PeWRKY83 functioned as a transcription factor and was selected for detailed analysis. The transgenic Arabidopsis of PeWRKY83 showed superior physiological properties compared with the WT under salt stress. Overexpression plants were less sensitive to ABA at both germination and postgermination stages and accumulated more endogenous ABA under salt stress conditions. Further studies demonstrated that overexpression of PeWRKY83 could regulate the expression of some ABA biosynthesis genes (AtAAO3, AtNCED2, AtNCED3), signaling genes (AtABI1, AtPP2CA) and responsive genes (AtRD29A, AtRD29B, AtABF1) under salt stress. Together, these results suggested that PeWRKY83 functions as a novel WRKY-related TF which plays a positive role in salt tolerance by regulating stress-induced ABA synthesis.

  5. The essential role of the Deinococcus radiodurans ssb gene in cell survival and radiation tolerance.

    Directory of Open Access Journals (Sweden)

    J Scott Lockhart

    Full Text Available Recent evidence has implicated single-stranded DNA-binding protein (SSB expression level as an important factor in microbial radiation resistance. The genome of the extremely radiation resistant bacterium Deinococcus radiodurans contains genes for two SSB homologs: the homodimeric, canonical Ssb, encoded by the gene ssb, and a novel pentameric protein encoded by the gene ddrB. ddrB is highly induced upon exposure to radiation, and deletions result in decreased radiation-resistance, suggesting an integral role of the protein in the extreme resistance exhibited by this organism. Although expression of ssb is also induced after irradiation, Ssb is thought to be involved primarily in replication. In this study, we demonstrate that Ssb in D. radiodurans is essential for cell survival. The lethality of an ssb deletion cannot be complemented by providing ddrB in trans. In addition, the radiation-sensitive phenotype conferred by a ddrB deletion is not alleviated by providing ssb in trans. By altering expression of the ssb gene, we also show that lower levels of transcription are required for optimal growth than are necessary for high radiation resistance. When expression is reduced to that of E. coli, ionizing radiation resistance is similarly reduced. UV resistance is also decreased under low ssb transcript levels where growth is unimpaired. These results indicate that the expression of ssb is a key component of both normal cellular metabolism as well as pathways responsible for the high radiation tolerance of D. radiodurans.

  6. Biotic and abiotic stress tolerance in transgenic tomatoes by constitutive expression of S-adenosylmethionine decarboxylase gene.

    Science.gov (United States)

    Hazarika, Pranjal; Rajam, Manchikatla Venkat

    2011-04-01

    Recent findings have implicated the role of polyamines (putrescine, spermidine and spermine) in stress tolerance. Therefore, the present work was carried out with the goal of generating transgenic tomato plants with human S-adenosylmethionine decarboxylase (samdc) gene, a key gene involved in biosynthesis of polyamines, viz. spermidine and spermine and evaluating the transgenic plants for tolerance to both biotic and abiotic stresses. Several putative transgenic tomato plants with normal phenotype were obtained, and the transgene integration and expression was validated by PCR, Southern blot analysis and RT-PCR analysis, respectively. The transgenic plants exhibited high levels of polyamines as compared to the untransformed control plants. They also showed increased resistance against two important fungal pathogens of tomato, the wilt causing Fusarium oxysporum and the early blight causing Alternaria solani and tolerance to multiple abiotic stresses such as salinity, drought, cold and high temperature. These results suggest that engineering polyamine accumulation can confer tolerance to both biotic and abiotic stresses in plants.

  7. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    DEFF Research Database (Denmark)

    Bouchabke-Coussa, O.; Quashie, M.L.; Seoane, Jose Miguel

    2008-01-01

    's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE), which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis......Background: Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying...... as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results: All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant...

  8. A cold-induced pectin methyl-esterase inhibitor gene contributes negatively to freezing tolerance but positively to salt tolerance in Arabidopsis.

    Science.gov (United States)

    Chen, Jian; Chen, Xuehui; Zhang, Qingfeng; Zhang, Yidan; Ou, Xiangli; An, Lizhe; Feng, Huyuan; Zhao, Zhiguang

    2018-03-01

    Plant pectin methyl-esterase (PME) and PME inhibitor (PMEI) belong to large gene families whose members are proposed to be widely involved in growth, development, and stress responses; however, the biological functions of most PMEs and PMEIs have not been characterized. In this study, we studied the roles of CbPMEI1, a cold-induced pectin methyl-esterase inhibitor (PMEI) gene from Chorispora bungeana, under freezing and salt stress. The putative CbPMEI1 peptide shares highest similarity (83%) with AT5G62360 (PMEI13) of Arabidopsis. Overexpression of either CbPMEI1 or PMEI13 in Arabidopsis decreased tissue PME activity and enhanced the degree of methoxylation of cell wall pectins, indicating that both genes encode functional PMEIs. CbPMEI1 and PMEI13 were induced by cold but repressed by salt stress and abscisic acid, suggesting distinct roles of the genes in freezing and salt stress tolerance. Interestingly, transgenic Arabidopsis plants overexpressing CbPMEI1 or PMEI13 showed decreased freezing tolerance, as indicated by survival and electrolyte leakage assays. On the other hand, the salt tolerance of transgenic plants was increased, showing higher rates of germination, root growth, and survival under salinity conditions as compared with non-transgenic wild-type plants. Although the transgenic plants were freezing-sensitive, they showed longer roots than wild-type plants under cold conditions, suggesting a role of PMEs in balancing the trade-off between freezing tolerance and growth. Thus, our study indicates that CbPMEI1 and PMEI13 are involved in root growth regulation under cold and salt stresses, and suggests that PMEIs may be potential targets for genetic engineering aimed to improve fitness of plants under stress conditions. Copyright © 2018 Elsevier GmbH. All rights reserved.

  9. Simultaneous induction of jasmonic acid and disease-responsive genes signifies tolerance of American elm to Dutch elm disease

    Science.gov (United States)

    Sherif , S. M.; Shukla, M. R.; Murch, S. J.; Bernier, L.; Saxena, P. K.

    2016-01-01

    Dutch elm disease (DED), caused by three fungal species in the genus Ophiostoma, is the most devastating disease of both native European and North American elm trees. Although many tolerant cultivars have been identified and released, the tolerance mechanisms are not well understood and true resistance has not yet been achieved. Here we show that the expression of disease-responsive genes in reactions leading to tolerance or susceptibility is significantly differentiated within the first 144 hours post-inoculation (hpi). Analysis of the levels of endogenous plant defense molecules such as jasmonic acid (JA) and salicylic acid (SA) in tolerant and susceptible American elm saplings suggested SA and methyl-jasmonate as potential defense response elicitors, which was further confirmed by field observations. However, the tolerant phenotype can be best characterized by a concurrent induction of JA and disease-responsive genes at 96 hpi. Molecular investigations indicated that the expression of fungal genes (i.e. cerato ulmin) was also modulated by endogenous SA and JA and this response was unique among aggressive and non-aggressive fungal strains. The present study not only provides better understanding of tolerance mechanisms to DED, but also represents a first, verified template for examining simultaneous transcriptomic changes during American elm-fungus interactions. PMID:26902398

  10. Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

    Science.gov (United States)

    Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

    2008-08-01

    Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

  11. Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Shiyi Zhou

    Full Text Available Aquaporin (AQP proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high water channel activity in Xenopus laevis oocytes and TaAQP7 transcript was induced by dehydration, and treatments with polyethylene glycol (PEG, abscisic acid (ABA and H(2O(2. Further, TaAQP7 was upregulated after PEG treatment and was blocked by inhibitors of ABA biosynthesis, implying that ABA signaling was involved in the upregulation of TaAQP7 after PEG treatment. Overexpression of TaAQP7 increased drought tolerance in tobacco. The transgenic tobacco lines had lower levels of malondialdehyde (MDA and H(2O(2, and less ion leakage (IL, but higher relative water content (RWC and superoxide dismutase (SOD and catalase (CAT activities when compared with the wild type (WT under drought stress. Taken together, our results show that TaAQP7 confers drought stress tolerance in transgenic tobacco by increasing the ability to retain water, reduce ROS accumulation and membrane damage, and enhance the activities of antioxidants.

  12. Overexpression of yeast ArDH gene in chloroplasts confers salinity tolerance in plants (abstract)

    International Nuclear Information System (INIS)

    Khan, M.S.; Kanwal, B.; Khalid, A.M.; Zafar, Y.; Malik, K.A.

    2005-01-01

    Water stress due to salinity and drought is the main limiting factor for plant growth, productivity and quality. A common response to water deficit is the accumulation of osmoprotectants such as sugars and amino acids. In yeast, arabitol dehydrogenase is found responsible for the production of arabitol from ribulose-5-phosphate. All plants synthesize ribulose-5-phosphate via pentose pathway in chloroplasts.. Therefore, osmotolerance of the plants could be enhanced through metabolic engineering of chloroplasts by introducing ArDH gene into the plastome, which is responsible for the conversion of ribulose-5- phosphate to arabitol. Here we report high-level expression of arabitol dehydrogenase (ArDH) in chloroplasts. Homoplasmic transgenic plants were recovered on spectinomycin-containing regeneration medium. Transformed tobacco plants survived whereas non-transformed were severely stressed or killed when two weeks old seedlings were exposed to NaCl (up to 400 mM), suggesting a role for arabitol in salt tolerance. Seedlings survived up to five weeks on medium containing high salt concentrations (350-400 mM). Nevertheless, seedlings remained green and grew normal on concentrations up to 350 mM NaCl for several weeks. Hypothesis that membranes are protected under stress conditions due to the arabitol accumulation in chloroplasts, seedlings were grown in liquid medium containing polyethylene glycol (PEG, up to 6%). Seedlings were tolerant to 6% PEG, suggesting that ArDH enzyme protects membranes integrity under stress. Therefore, it is concluded that ArDH gene could be expressed in crop plants to withstand abiotic stresses. (author)

  13. The Antirrhinum AmDEL gene enhances flavonoids accumulation and salt and drought tolerance in transgenic Arabidopsis.

    Science.gov (United States)

    Wang, Feibing; Zhu, Hong; Kong, Weili; Peng, Rihe; Liu, Qingchang; Yao, Quanhong

    2016-07-01

    A basic helix-loop-helix (bHLH) transcription factor gene from Antirrhinum, AmDEL , increases flavonoids accumulation and enhances salt and drought tolerance via up-regulating flavonoid biosynthesis, proline biosynthesis and ROS scavenging genes in transgenic Arabidopsis. In plants, transcriptional regulation is the most important tools for increasing flavonoid biosynthesis. The AmDEL gene, as a basic helix-loop-helix transcription factor gene from Antirrhinum, has been shown to increase flavonoids accumulation in tomato. However, its role in tolerance to abiotic stresses has not yet been investigated. In this study, the codon-optimized AmDEL gene was chemically synthesized. Subcellular localization analysis in onion epidermal cells indicated that AmDEL protein was localized to the nucleus. Expression analysis in yeast showed that the full length of AmDEL exhibited transcriptional activation. Overexpression of AmDEL significantly increased flavonoids accumulation and enhanced salt and drought tolerance in transgenic Arabidopsis plants. Real-time quantitative PCR analysis showed that overexpression of AmDEL resulted in the up-regulation of genes involved in flavonoid biosynthesis, proline biosynthesis and ROS scavenging under salt and drought stresses. Meanwhile, Western blot and enzymatic analyses showed that the activities of phenylalanine ammonia lyase, chalcone isomerase, dihydroflavonol reductase, pyrroline-5-carboxylate synthase, superoxide dismutase and peroxidase were also increased. Further components analyses indicated that the significant increase of proline and relative water content and the significant reduction of H2O2 and malonaldehyde content were observed under salt and drought stresses. In addition, the rates of electrolyte leakage and water loss were reduced in transgenic plants. These findings imply functions of AmDEL in accumulation of flavonoids and tolerance to salt and drought stresses. The AmDEL gene has the potential to be used to increase

  14. Expression of jasmonic ethylene responsive factor gene in transgenic poplar tree leads to increased salt tolerance.

    Science.gov (United States)

    Li, Yiliang; Su, Xiaohua; Zhang, Bingyu; Huang, Qinjun; Zhang, Xianghua; Huang, Rongfeng

    2009-02-01

    The stress resistance of plants can be enhanced by regulating the expression of multiple downstream genes associated with stress resistance. We used the Agrobacterium method to transfer the tomato jasmonic ethylene responsive factors (JERFs) gene that encodes the ethylene response factor (ERF) like transcription factor to the genome of a hybrid poplar (Populus alba x Populus berolinensis). Eighteen resistant plants were obtained, of which 13 were identified by polymerase chain reaction (PCR), reverse transcriptase PCR and Southern blot analyses as having incorporated the JERFs gene and able to express it at the transcriptional level. Salinity tests were conducted in a greenhouse with 0, 100, 200 and 300 mM NaCl. In the absence of NaCl, the transgenic plants were significantly taller than the control plants, but no statistically significant differences in the concentrations of proline and chlorophyll were observed. With increasing salinity, the extent of damage was significantly less in transgenic plants than that in control plants, and the reductions in height, basal diameter and biomass were less in transgenic plants than those in control plants. At 200 and 300 mM NaCl concentrations, transgenic plants were 128.9% and 98.8% taller, respectively, and had 199.8% and 113.0% more dry biomass, respectively, than control plants. The saline-induced reduction in leaf water content and increase in root/crown ratio were less in transgenic plants than in control plants. Foliar proline concentration increased more in response to salt treatment in transgenic plants than in control plants. Foliar Na(+) concentration was higher in transgenic plants than in control plants. In the coastal area in Panjin of Liaoning where the total soil salt concentration is 0.3%, a salt tolerance trial of transgenic plants indicated that 3-year-old transgenic plants were 14.5% and 33.6% taller than the control plants at two field sites. The transgenic plants at the two field sites were growing

  15. Transient B cell depletion or improved transgene expression by codon optimization promote tolerance to factor VIII in gene therapy.

    Directory of Open Access Journals (Sweden)

    Brandon K Sack

    Full Text Available The major complication in the treatment of hemophilia A is the development of neutralizing antibodies (inhibitors against factor VIII (FVIII. The current method for eradicating inhibitors, termed immune tolerance induction (ITI, is costly and protracted. Clinical protocols that prevent rather than treat inhibitors are not yet established. Liver-directed gene therapy hopes to achieve long-term correction of the disease while also inducing immune tolerance. We sought to investigate the use of adeno-associated viral (serotype 8 gene transfer to induce tolerance to human B domain deleted FVIII in hemophilia A mice. We administered an AAV8 vector with either human B domain deleted FVIII or a codon-optimized transgene, both under a liver-specific promoter to two strains of hemophilia A mice. Protein therapy or gene therapy was given either alone or in conjunction with anti-CD20 antibody-mediated B cell depletion. Gene therapy with a low-expressing vector resulted in sustained near-therapeutic expression. However, supplementary protein therapy revealed that gene transfer had sensitized mice to hFVIII in a high-responder strain but not in mice of a low-responding strain. This heightened response was ameliorated when gene therapy was delivered with anti-murine CD20 treatment. Transient B cell depletion prevented inhibitor formation in protein therapy, but failed to achieve a sustained hypo-responsiveness. Importantly, use of a codon-optimized hFVIII transgene resulted in sustained therapeutic expression and tolerance without a need for B cell depletion. Therefore, anti-CD20 may be beneficial in preventing vector-induced immune priming to FVIII, but higher levels of liver-restricted expression are preferred for tolerance.

  16. bHLH106 Integrates Functions of Multiple Genes through Their G-Box to Confer Salt Tolerance on Arabidopsis.

    Science.gov (United States)

    Ahmad, Aftab; Niwa, Yasuo; Goto, Shingo; Ogawa, Takeshi; Shimizu, Masanori; Suzuki, Akane; Kobayashi, Kyoko; Kobayashi, Hirokazu

    2015-01-01

    An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8) as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO) lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX) of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP) fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'). The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.

  17. Tolerance induction to cytoplasmic beta-galactosidase by hepatic AAV gene transfer: implications for antigen presentation and immunotoxicity.

    Directory of Open Access Journals (Sweden)

    Ashley T Martino

    2009-08-01

    Full Text Available Hepatic gene transfer, in particular using adeno-associated viral (AAV vectors, has been shown to induce immune tolerance to several protein antigens. This approach has been exploited in animal models of inherited protein deficiency for systemic delivery of therapeutic proteins. Adequate levels of transgene expression in hepatocytes induce a suppressive T cell response, thereby promoting immune tolerance. This study addresses the question of whether AAV gene transfer can induce tolerance to a cytoplasmic protein.AAV-2 vector-mediated hepatic gene transfer for expression of cytoplasmic beta-galactosidase (beta-gal was performed in immune competent mice, followed by a secondary beta-gal gene transfer with E1/E3-deleted adenoviral Ad-LacZ vector to provoke a severe immunotoxic response. Transgene expression from the AAV-2 vector in approximately 2% of hepatocytes almost completely protected from inflammatory T cell responses against beta-gal, eliminated antibody formation, and significantly reduced adenovirus-induced hepatotoxicity. Consequently, approximately 10% of hepatocytes continued to express beta-gal 45 days after secondary Ad-LacZ gene transfer, a time point when control mice had lost all Ad-LacZ derived expression. Suppression of inflammatory T cell infiltration in the liver and liver damage was linked to specific transgene expression and was not seen for secondary gene transfer with Ad-GFP. A combination of adoptive transfer studies and flow cytometric analyses demonstrated induction of Treg that actively suppressed CD8(+ T cell responses to beta-gal and that was amplified in liver and spleen upon secondary Ad-LacZ gene transfer.These data demonstrate that tolerance induction by hepatic AAV gene transfer does not require systemic delivery of the transgene product and that expression of a cytoplasmic neo-antigen in few hepatocytes can induce Treg and provide long-term suppression of inflammatory responses and immunotoxicity.

  18. Aluminum Hydroxide

    Science.gov (United States)

    Aluminum hydroxide is used for the relief of heartburn, sour stomach, and peptic ulcer pain and to ... Aluminum hydroxide comes as a capsule, a tablet, and an oral liquid and suspension. The dose and ...

  19. Simultaneous Expression of PDH45 with EPSPS Gene Improves Salinity and Herbicide Tolerance in Transgenic Tobacco Plants.

    Science.gov (United States)

    Garg, Bharti; Gill, Sarvajeet S; Biswas, Dipul K; Sahoo, Ranjan K; Kunchge, Nandkumar S; Tuteja, Renu; Tuteja, Narendra

    2017-01-01

    To cope with the problem of salinity- and weed-induced crop losses, a multi-stress tolerant trait is need of the hour but a combinatorial view of such traits is not yet explored. The overexpression of PDH45 (pea DNA helicase 45) and EPSPS (5-enoylpruvyl shikimate-3-phosphate synthase) genes have been reported to impart salinity and herbicide tolerance. Further, the understanding of mechanism and pathways utilized by PDH45 and EPSPS for salinity and herbicide tolerance will help to improve the crops of economical importance. In the present study, we have performed a comparative analysis of salinity and herbicide tolerance to check the biochemical parameters and antioxidant status of tobacco transgenic plants. Collectively, the results showed that PDH45 overexpressing transgenic lines display efficient tolerance to salinity stress, while PDH45+EPSPS transgenics showed tolerance to both the salinity and herbicide as compared to the control [wild type (WT) and vector control (VC)] plants. The activities of the components of enzymatic antioxidant machinery were observed to be higher in the transgenic plants indicating the presence of an efficient antioxidant defense system which helps to cope with the stress-induced oxidative-damages. Photosynthetic parameters also showed significant increase in PDH45 and PDH45+EPSPS overexpressing transgenic plants in comparison to WT, VC and EPSPS transgenic plants under salinity stress. Furthermore, PDH45 and PDH45+EPSPS synergistically modulate the jasmonic acid and salicylic acid mediated signaling pathways for combating salinity stress. The findings of our study suggest that pyramiding of the PDH45 gene with EPSPS gene renders host plants tolerant to salinity and herbicide by enhancing the antioxidant machinery thus photosynthesis.

  20. The Metallothionein Gene, TaMT3, from Tamarix androssowii Confers Cd2+ Tolerance in Tobacco

    Directory of Open Access Journals (Sweden)

    Boru Zhou

    2014-06-01

    Full Text Available Cadmium (Cd is a nonessential microelement and low concentration Cd2+ has strong toxicity to plant growth. Plant metallothioneins, a class of low molecular, cystein(Cys-rich and heavy-metal binding proteins, play an important role in both metal chaperoning and scavenging of reactive oxygen species (ROS with their large number of cysteine residues and therefore, protect plants from oxidative damage. In this study, a metallothionein gene, TaMT3, isolated from Tamarix androssowii was transformed into tobacco (Nicotiana tobacum through Agrobacterium-mediated leaf disc method, and correctly expressed under the control of 35S promoter. Under Cd2+ stress, the transgenic tobacco showed significant increases of superoxide dismutase (SOD activity and chlorophyll concentration, but decreases of peroxidase (POD activity and malondialdehyde (MDA accumulation when compared to the non-transgenic tobacco. Vigorous growth of transgenic tobacco was observed at the early development stages, resulting in plant height and fresh weight were significantly larger than those of the non-transgenic tobacco under Cd2+ stress. These results demonstrated that the expression of the exogenous TaMT3 gene increased the ability of ROS cleaning-up, indicating a stronger tolerance to Cd2+ stress.

  1. The metallothionein gene, TaMT3, from Tamarix androssowii confers Cd2+ tolerance in tobacco.

    Science.gov (United States)

    Zhou, Boru; Yao, Wenjing; Wang, Shengji; Wang, Xinwang; Jiang, Tingbo

    2014-06-10

    Cadmium (Cd) is a nonessential microelement and low concentration Cd2+ has strong toxicity to plant growth. Plant metallothioneins, a class of low molecular, cystein(Cys)-rich and heavy-metal binding proteins, play an important role in both metal chaperoning and scavenging of reactive oxygen species (ROS) with their large number of cysteine residues and therefore, protect plants from oxidative damage. In this study, a metallothionein gene, TaMT3, isolated from Tamarix androssowii was transformed into tobacco (Nicotiana tobacum) through Agrobacterium-mediated leaf disc method, and correctly expressed under the control of 35S promoter. Under Cd2+ stress, the transgenic tobacco showed significant increases of superoxide dismutase (SOD) activity and chlorophyll concentration, but decreases of peroxidase (POD) activity and malondialdehyde (MDA) accumulation when compared to the non-transgenic tobacco. Vigorous growth of transgenic tobacco was observed at the early development stages, resulting in plant height and fresh weight were significantly larger than those of the non-transgenic tobacco under Cd2+ stress. These results demonstrated that the expression of the exogenous TaMT3 gene increased the ability of ROS cleaning-up, indicating a stronger tolerance to Cd2+ stress.

  2. Exploration for the Salinity Tolerance-Related Genes from Xero-Halophyte Atriplex canescens Exploiting Yeast Functional Screening System

    Directory of Open Access Journals (Sweden)

    Gang Yu

    2017-11-01

    Full Text Available Plant productivity is limited by salinity stress, both in natural and agricultural systems. Identification of salt stress-related genes from halophyte can provide insights into mechanisms of salt stress tolerance in plants. Atriplex canescens is a xero-halophyte that exhibits optimum growth in the presence of 400 mM NaCl. A cDNA library derived from highly salt-treated A. canescens plants was constructed based on a yeast expression system. A total of 53 transgenic yeast clones expressing enhanced salt tolerance were selected from 105 transformants. Their plasmids were sequenced and the gene characteristics were annotated using a BLASTX search. Retransformation of yeast cells with the selected plasmids conferred salt tolerance to the resulting transformants. The expression patterns of 28 of these stress-related genes were further investigated in A. canescens leaves by quantitative reverse transcription-PCR. In this study, we provided a rapid and robust assay system for large-scale screening of genes for varied abiotic stress tolerance with high efficiency in A. canescens.

  3. Structural characterization of the thermally-tolerant pectin methylesterase purified from Citrus sinensis fruit and its gene sequence

    Science.gov (United States)

    Despite the longstanding importance for the thermally-tolerant pectin methylesterase (TT-PME) activity in citrus juice processing and product quality, unequivocal identification of the protein and its corresponding gene has remained elusive. We purified TT-PME from sweet orange [Citrus sinensis (L.)...

  4. AS3MT-mediated tolerance to arsenic evolved by multiple independent horizontal gene transfers from bacteria to eukaryotes

    DEFF Research Database (Denmark)

    Palmgren, Michael; Engström, Karin; Hallström, Björn M.

    2017-01-01

    the evolutionary origin of AS3MT and assessed the ability of different genotypes to produce methylated arsenic metabolites. Phylogenetic analysis suggests that multiple, independent horizontal gene transfers between different bacteria, and from bacteria to eukaryotes, increased tolerance to environmental arsenic...

  5. Tolerância de genótipos de trigo comum, trigo duro e triticale à toxicidade de alumínio em soluções nutritivas Tolerance of bread wheat, durum wheat and triticale genotypes to aluminum toxicity in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    2006-01-01

    Full Text Available Foi estudado o comportamento diferencial de 12 genótipos de trigo comum (Triticum aestivum L., um genótipo de trigo duro (Triticum durum L., e um de triticale (Triticosecale sp em soluções nutritivas de tratamento contendo duas concentrações salinas (1/5 e 1/10 da completa e seis concentrações de alumínio ( 0, 2, 4, 6, 8 e 10 mg L-1, à temperatura de 25 ± 1ºC e pH 4,0. Foram utilizadas dez plântulas por parcela e quatro repetições. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após permanecer 48 horas em solução nutritiva completa, contendo uma concentração conhecida de alumínio combinada com cada uma das concentrações salinas. Os genótipos de trigo comum IAC-289, IAC-350 e IAC-370 e a cultivar controle Anahuac, e os genótipos de trigo duro IAC-1003 e de triticale IAC-5 foram os mais sensíveis a níveis crescentes de Al3+nas soluções nutritivas de tratamento e, portanto, somente seriam indicados para cultivo em solos corrigidos. Os genótipos de trigo comum IAC-24 e IAC-378 e a cultivar controle BH-1146 destacaram-se pela tolerância à toxicidade de Al3+, com potencial para uso em solos ácidos e como fontes genéticas de tolerância nos futuros cruzamentos. Os sintomas de toxicidade de alumínio foram maiores com a elevação da concentração de alumínio e da diminuição das concentrações de sais da solução nutritiva para todos os genótipos estudados.Twelve bread wheat (Triticum aestivum L., one durum wheat (Triticum durum L. and one triticale (Triticosecale sp genotypes were studied in nutrient solutions with a high salt concentration in experiment 1 and a weak salt concentration in experiment 2, for aluminum tolerance at six levels: 0, 2, 4, 6, 8 and 10 mg L-1, under temperature 25 ± 1ºC and pH 4,0. Four replications were used per experiment. Aluminum tolerance was evaluated by measuring root growth in an aluminum-free complete

  6. Overexpression of WsSGTL1 Gene of Withania somnifera Enhances Salt Tolerance, Heat Tolerance and Cold Acclimation Ability in Transgenic Arabidopsis Plants

    Science.gov (United States)

    Mishra, Manoj K.; Chaturvedi, Pankaj; Singh, Ruchi; Singh, Gaurav; Sharma, Lokendra K.; Pandey, Vibha; Kumari, Nishi; Misra, Pratibha

    2013-01-01

    Background Sterol glycosyltrnasferases (SGT) are enzymes that glycosylate sterols which play important role in plant adaptation to stress and are medicinally important in plants like Withania somnifera. The present study aims to find the role of WsSGTL1 which is a sterol glycosyltransferase from W. somnifera, in plant’s adaptation to abiotic stress. Methodology The WsSGTL1 gene was transformed in Arabidopsis thaliana through Agrobacterium mediated transformation, using the binary vector pBI121, by floral dip method. The phenotypic and physiological parameters like germination, root length, shoot weight, relative electrolyte conductivity, MDA content, SOD levels, relative electrolyte leakage and chlorophyll measurements were compared between transgenic and wild type Arabidopsis plants under different abiotic stresses - salt, heat and cold. Biochemical analysis was done by HPLC-TLC and radiolabelled enzyme assay. The promoter of the WsSGTL1 gene was cloned by using Genome Walker kit (Clontech, USA) and the 3D structures were predicted by using Discovery Studio Ver. 2.5. Results The WsSGTL1 transgenic plants were confirmed to be single copy by Southern and homozygous by segregation analysis. As compared to WT, the transgenic plants showed better germination, salt tolerance, heat and cold tolerance. The level of the transgene WsSGTL1 was elevated in heat, cold and salt stress along with other marker genes such as HSP70, HSP90, RD29, SOS3 and LEA4-5. Biochemical analysis showed the formation of sterol glycosides and increase in enzyme activity. When the promoter of WsSGTL1 gene was cloned from W. somnifera and sequenced, it contained stress responsive elements. Bioinformatics analysis of the 3D structure of the WsSGTL1 protein showed functional similarity with sterol glycosyltransferase AtSGT of A. thaliana. Conclusions Transformation of WsSGTL1 gene in A. thaliana conferred abiotic stress tolerance. The promoter of the gene in W.somnifera was found to have stress

  7. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    Directory of Open Access Journals (Sweden)

    Yu Agnes

    2008-12-01

    Full Text Available Abstract Background Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying potential targets for plant breeding. Drought tolerance in the field was successfully conferred to crops by transferring genes from this model species. While involved in a plant genomics programme, which aims to identify new genes responsible for plant response to abiotic stress, we identified ESKIMO1 as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE, which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis of one mutant line and its wild-type background was carried out. Under control watering conditions a number of genes were differentially expressed between the mutant and the wild type whereas under mild drought stress this list of genes was reduced. Among the genes that were differentially expressed between the wild type and mutant, two functional categories related to the response to stress or biotic and abiotic stimulus were over-represented. Under salt stress conditions, all gene functional categories were represented equally in both the mutant and wild type. Based on this transcriptome analysis we hypothesise that in control conditions the esk1 mutant behaves as if it was exposed to drought stress. Conclusion Overall our findings suggest that the

  8. [Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

    Science.gov (United States)

    Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

    2014-04-01

    Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

  9. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum Seedlings and Identification of Salt Tolerance Genes

    Directory of Open Access Journals (Sweden)

    Jiangtao Liu

    2016-03-01

    Full Text Available Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf transcriptome of A. splendens obtained using an Illumina HiSeq 2500. Over 35 million clean reads were obtained from the leaf and root libraries. All of the RNA sequencing (RNA-seq reads were assembled de novo into a total of 126,235 unigenes and 36,511 coding DNA sequences (CDS. We further identified 1663 differentially-expressed genes (DEGs between the salt stress treatment and control. Functional annotation of the DEGs by gene ontology (GO, using Arabidopsis and rice as references, revealed enrichment of salt stress-related GO categories, including “oxidation reduction”, “transcription factor activity”, and “ion channel transporter”. Thus, this global transcriptome analysis of A. splendens has provided an important genetic resource for the study of salt tolerance in this halophyte. The identified sequences and their putative functional data will facilitate future investigations of the tolerance of Achnatherum species to various types of abiotic stress.

  10. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    International Nuclear Information System (INIS)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

    2014-01-01

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd 2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance

  11. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  12. De Novo Transcriptome Sequencing in Passiflora edulis Sims to Identify Genes and Signaling Pathways Involved in Cold Tolerance

    Directory of Open Access Journals (Sweden)

    Sian Liu

    2017-11-01

    Full Text Available The passion fruit (Passiflora edulis Sims, also known as the purple granadilla, is widely cultivated as the new darling of the fruit market throughout southern China. This exotic and perennial climber is adapted to warm and humid climates, and thus is generally intolerant of cold. There is limited information about gene regulation and signaling pathways related to the cold stress response in this species. In this study, two transcriptome libraries (KEDU_AP vs. GX_AP were constructed from the aerial parts of cold-tolerant and cold-susceptible varieties of P. edulis, respectively. Overall, 126,284,018 clean reads were obtained, and 86,880 unigenes with a mean size of 1449 bp were assembled. Of these, there were 64,067 (73.74% unigenes with significant similarity to publicly available plant protein sequences. Expression profiles were generated, and 3045 genes were found to be significantly differentially expressed between the KEDU_AP and GX_AP libraries, including 1075 (35.3% up-regulated and 1970 (64.7% down-regulated. These included 36 genes in enriched pathways of plant hormone signal transduction, and 56 genes encoding putative transcription factors. Six genes involved in the ICE1–CBF–COR pathway were induced in the cold-tolerant variety, and their expression levels were further verified using quantitative real-time PCR. This report is the first to identify genes and signaling pathways involved in cold tolerance using high-throughput transcriptome sequencing in P. edulis. These findings may provide useful insights into the molecular mechanisms regulating cold tolerance and genetic breeding in Passiflora spp.

  13. Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance

    International Nuclear Information System (INIS)

    Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K.; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming

    2012-01-01

    Highlights: ► We isolated and characterized a novel JAZ family gene, GsJAZ2, from Glycine soja. ► Overexpression of GsJAZ2 enhanced plant tolerance to salt and alkali stress. ► The transcriptions of stress marker genes were higher in GsJAZ2 overexpression lines. ► GsJAZ2 was localized to nucleus. -- Abstract: Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.

  14. Over-expression of histone H3K4 demethylase gene JMJ15 enhances salt tolerance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Yuan eShen

    2014-06-01

    Full Text Available Histone H3 lysine 4 trimethylation (H3K4me3 has been shown to be involved in stress-responsive gene expression and gene priming in plants. However, the role of H3K4me3 resetting in the processes is not clear. In this work we studied the expression and function of Arabidopsis H3K4 demethylase gene JMJ15. We show that the expression of JMJ15 was relatively low and was limited to a number of tissues during vegetative growth but was higher in young floral organs. Over-expression of the gene in gain-of-function mutants reduced the plant height with accumulation of lignin in stems, while the loss-of-function mutation did not produce any visible phenotype. The gain-of-function mutants showed enhanced salt tolerance, whereas the loss-of-function mutant was more sensitive to salt compared to the wild type. Transcriptomic analysis revealed that over-expression of JMJ15 down-regulated many genes which are preferentially marked by H3K4me3 and H3K4me2. Many of the down-regulated genes encode transcription regulators involved in stress responses. The data suggest that increased JMJ15 levels may regulate the gene expression program that enhances stress tolerance.

  15. Heterologous expression of wheat VERNALIZATION 2 (TaVRN2 gene in Arabidopsis delays flowering and enhances freezing tolerance.

    Directory of Open Access Journals (Sweden)

    Amadou Diallo

    Full Text Available The vernalization gene 2 (VRN2, is a major flowering repressor in temperate cereals that is regulated by low temperature and photoperiod. Here we show that the gene from Triticum aestivum (TaVRN2 is also regulated by salt, heat shock, dehydration, wounding and abscissic acid. Promoter analysis indicates that TaVRN2 regulatory region possesses all the specific responsive elements to these stresses. This suggests pleiotropic effects of TaVRN2 in wheat development and adaptability to the environment. To test if TaVRN2 can act as a flowering repressor in species different from the temperate cereals, the gene was ectopically expressed in the model plant Arabidopsis. Transgenic plants showed no alteration in morphology, but their flowering time was significantly delayed compared to controls plants, indicating that TaVRN2, although having no ortholog in Brassicaceae, can act as a flowering repressor in these species. To identify the possible mechanism by which TaVRN2 gene delays flowering in Arabidopsis, the expression level of several genes involved in flowering time regulation was determined. The analysis indicates that the late flowering of the 35S::TaVRN2 plants was associated with a complex pattern of expression of the major flowering control genes, FCA, FLC, FT, FVE and SOC1. This suggests that heterologous expression of TaVRN2 in Arabidopsis can delay flowering by modulating several floral inductive pathways. Furthermore, transgenic plants showed higher freezing tolerance, likely due to the accumulation of CBF2, CBF3 and the COR genes. Overall, our data suggests that TaVRN2 gene could modulate a common regulator of the two interacting pathways that regulate flowering time and the induction of cold tolerance. The results also demonstrate that TaVRN2 could be used to manipulate flowering time and improve cold tolerance in other species.

  16. Aluminium resistant, plant growth promoting bacteria induce overexpression of Aluminium stress related genes in Arabidopsis thaliana and increase the ginseng tolerance against Aluminium stress.

    Science.gov (United States)

    Farh, Mohamed El-Agamy; Kim, Yeon-Ju; Sukweenadhi, Johan; Singh, Priyanka; Yang, Deok-Chun

    2017-07-01

    Panax ginseng is an important cash crop in the Asian countries due to its pharmaceutical effects, however the plant is exposed to various abiotic stresses, lead to reduction of its quality. One of them is the Aluminum (Al) accumulation. Plant growth promoting bacteria which able to tolerate heavy metals has been considered as a new trend for supporting the growth of many crops in heavy metal occupied areas. In this study, twelve bacteria strains were isolated from rhizosphere of diseased Korean ginseng roots located in Gochang province, Republic of Korea and tested for their ability to grow in Al-embedded broth media. Out of them, four strains (Pseudomonas simiae N3, Pseudomonas fragi N8, Chryseobacterium polytrichastri N10, and Burkholderia ginsengiterrae N11-2) were able to grow. The strains could also show other plant growth promoting activities e.g. auxins and siderophores production and phosphate solubilization. P. simiae N3, C. polytrichastri N10, and B. ginsengiterrae N11-2 strains were able to support the growth of Arabidopsis thaliana stressed by Al while P. fragi N8 could not. Plants inoculated with P. simiae N3, C. polytrichastri N10, and B. ginsengiterrae N11-2 showed higher expression level of Al-stress related genes, AtAIP, AtALS3 and AtALMT1, compared to non-bacterized plants. Expression profiles of the genes reveal the induction of external mechanism of Al resistance by P. simiae N3 and B. ginsengiterrae N11-2 and internal mechanism by C. polytrichastri N10. Korean ginseng seedlings treated with these strains showed higher biomass, particularly the foliar part, higher chlorophyll content than non-bacterized Al-stressed seedlings. According to the present results, these strains can be used in the future for the cultivation of ginseng in Al-persisted locations. Copyright © 2017 Elsevier GmbH. All rights reserved.

  17. Differential response of plants to aluminum. A review

    OpenAIRE

    Valencia R, Rubén A; Ligarreto M, Gustavo A

    2012-01-01

    Aluminum toxicity is a major limiting factor to the growth and development of plants in acidic soils worldwide, occurring in 40% of arable soils. The root seems to be the object of aluminum toxicity, particularly the apex, producing a rapid inhibition of cell division and elongation of the root. Fortunately, plants differ in their ability to tolerate aluminum and grow in acidic soils. Tolerance mechanisms have commonly been defined in genetic and physiological terms, however, tolerance mechan...

  18. Novel SNPs in HSPB8 gene and their association with heat tolerance traits in Sahiwal indigenous cattle.

    Science.gov (United States)

    Verma, Nishant; Gupta, Ishwar Dayal; Verma, Archana; Kumar, Rakesh; Das, Ramendra; Vineeth, M R

    2016-01-01

    Heat shock proteins (HSPs) are expressed in response to heat stress, and the polymorphism in HSP genes at single-nucleotide level has been reported to be associated with heat tolerance and production performance traits in cattle. HSPB8 gene has been mapped on Bos taurus autosome 17 (BTA-17) spanning nearly 13,252 bp and comprising three exons and two introns. The present study was conducted in Sahiwal cows (n = 108) reared in subtropical climate with the objectives to identify SNPs in all three exons and part of intron 1 of HSPB8 gene and to analyze their association with heat tolerance traits in Sahiwal cows. Respiration rate (RR) and rectal temperature (RT) were recorded once during probable extreme hours in different seasons or Temperature-Humidity Index (THI), i.e., winter, spring, and summer. Heat tolerance coefficient (HTC) was also calculated to check the adaptability of the animals during the period of heat stress. The comparative sequence analysis revealed a total two single-nucleotide polymorphisms (SNPs), i.e., g.507G>A in exon 1 and g.881T>C in intron 1 of HSPB8 gene. Out of these two identified SNPs, only one SNP, i.e., g.507G>A, was found to be significantly associated with heat tolerance indicator traits (RR, RT, and HTC) in Sahiwal cows. The perusal of results across different seasons showed the significant (P A SNP of HSPB8 gene. However, in case of another SNP, i.e., g.881T>C, located on intron 1, the RR, RT, and HTC were having non-significant association with the different genotypes, i.e., TT and TC. These findings may partly suggest that GA genotype of SNP g.507G>A of HSPB8 gene has a probable role in heat tolerance in Sahiwal cattle and can therefore be utilized as a marker in propagation of thermo-tolerance cattle in hot tropical and subtropical climate. Nevertheless, the involvement of other regulatory mechanisms cannot be overruled.

  19. Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance.

    Science.gov (United States)

    Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming

    2012-09-21

    Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

  20. A novel zinc-finger-like gene from Tamarix hispida is involved in salt and osmotic tolerance.

    Science.gov (United States)

    An, Yan; Wang, Yucheng; Lou, Lingling; Zheng, Tangchun; Qu, Guan-Zheng

    2011-11-01

    In the present study, a zinc-finger-like cDNA (ThZFL) was cloned from the Tamarix hispida. Northern blot analysis showed that the expression of ThZFL can be induced by salt, osmotic stress and ABA treatment. Overexpression of the ThZFL confers salt and osmotic stress tolerance in both yeast Saccharomyces cerevisiae and tobacco. Furthermore, MDA levels in ThZFL transformed tobacco were significantly decreased compared with control plants under salt and osmotic stress, suggesting ThZFL may confer stress tolerance by decreasing membrane lipid peroxidation. Subcellular localization analysis showed the ThZFL protein is localized in the cell wall. Our results indicated the ThZFL gene is an excellent candidate for genetic engineering to improve salt and osmotic tolerance in agricultural plants.

  1. Expression responses of five cold tolerant related genes to two temperature dropping treatments in sea cucumber Apostichopus japonicus

    Science.gov (United States)

    Li, Chengze; Chang, Yaqing; Pang, Zhenguo; Ding, Jun; Ji, Nanjing

    2015-03-01

    Environmental conditions, including ambient temperature, play important roles in survival, growth development, and reproduction of the Japanese sea cucumber, Apostichopus japonicus. Low temperatures result in slowed growth and skin ulceration disease. In a previous study, we investigated the effect of low temperature on gene expression profiles in A. japonicus by suppression subtractive hybridization (SSH). Genes encoding Ferritin, Lysozyme, Hsp70, gp96, and AjToll were selected from a subtracted cDNA library of A. japonicus under acute cold stress. The transcriptional expression profiles of these genes were investigated in different tissues (coelomocyte, respiratory tree, intestine, longitudinal muscle) after exposure to acute and mild temperature dropping treatments. The results show that (1) the five cold-tolerance-related genes were found in all four tissues and the highest mRNA levels were observed in coelomocyte and respiratory tree; (2) under the temperature dropping treatments, three types of transcriptional regulation patterns were observed: primary suppression followed by up-regulation at -2°C, suppressed expression throughout the two treatments, and more rarely an initial stimulation followed by suppression; and (3) gene expression suppression was more severe under acute temperature dropping than under mild temperature dropping treatment. The five cold-tolerance-related genes that were distributed mainly in coelomocyte and respiratory tissues were generally down-regulated by low temperature stress but an inverse up-regulation event was found at the extreme temperature (-2°C).

  2. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Cloning a T-DNA-Linked Phosphate Gene that mediates Salt Tolerance on Mutant of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Njoroge, N.C; Tremblay, L.; Lefebvre, D.D.

    2006-01-01

    T-DNA insertionally mutagenized seeds of Arabidopsis thaliana were used to unravel genetic mechanisms underlying salt tolerance in plants. Over a period of two weeks, kanamycin homozygous (KK) seeds of the mutant NN143 attain germination levels of 65% and 77% on 175mM Nacl and 300mM mannitol respectively. Under these conditions of osmotic stress, the wild type seeds were incapable of germination. The mutant was also capable of germination on a medium containing 2μM abscisic acid (ABA). After two weeks on 2μM ABA, it attained 100% germination and the wild type did not germinate. The ABA level in the mutant was 40% higher than the wild type. Segregation analysis indicated that salt tolerance in the mutant is T-DNA linked. Genetic analysis of the F1 and F2 generations indicated that the salt tolerance trait in the mutant is dominant. The putative salt tolerance gene of mutant NN143 was cloned by plasmid rescue and sequence data indicated involvement of a protein phosphatase. The possible mechanism underlying salt tolerance in the mutant is discussed.(author)

  4. Comparative study of SOS2 and a novel PMP3-1 gene expression in two sunflower (Helianthus annuus L.) lines differing in salt tolerance.

    Science.gov (United States)

    Saadia, Mubshara; Jamil, Amer; Ashraf, Muhammad; Akram, Nudrat Aisha

    2013-06-01

    Gene expression pattern of two important regulatory proteins, salt overly sensitive 2 (SOS2) and plasma membrane protein 3-1 (PMP3-1), involved in ion homeostasis, was analyzed in two salinity-contrasting sunflower (Helianthus annuus L.) lines, Hysun-38 (salt tolerant) and S-278 (moderately salt tolerant). The pattern was studied at selected time intervals (24 h) under 150 mM NaCl treatment. Using reverse transcription PCR, SOS2 gene fragment was obtained from young leaf and root tissues of opposing lines while that for PMP3-1 was obtained only from young root tissues. Both tolerant and moderately tolerant lines showed a gradual increase in SOS2 expression in sunflower root tissues. Leaf tissues showed the gradually increasing pattern of SOS2 expression in tolerant plants as compared to that for moderately tolerant ones that showed a relatively lower level of expression for this gene. We found the highest level of PMP 3-1 expression in the roots of tolerant sunflower line at 6 and 12 h postsalinity treatment. The moderately tolerant line showed higher expression of PMP3-1 at 12 and 24 h after salt treatment. Overall, the expression of genes for both the regulator proteins varied significantly in the two sunflower lines differing in salinity tolerance.

  5. MsZEP, a novel zeaxanthin epoxidase gene from alfalfa (Medicago sativa), confers drought and salt tolerance in transgenic tobacco.

    Science.gov (United States)

    Zhang, Zhiqiang; Wang, Yafang; Chang, Leqin; Zhang, Tong; An, Jie; Liu, Yushi; Cao, Yuman; Zhao, Xia; Sha, Xuyang; Hu, Tianming; Yang, Peizhi

    2016-02-01

    The zeaxanthin epoxidase gene ( MsZEP ) was cloned and characterized from alfalfa and validated for its function of tolerance toward drought and salt stresses by heterologous expression in Nicotiana tabacum. Zeaxanthin epoxidase (ZEP) plays important roles in plant response to various environment stresses due to its functions in ABA biosynthetic and the xanthophyll cycle. To understand the expression characteristics and the biological functions of ZEP in alfalfa (Medicago sativa), a novel gene, designated as MsZEP (KM044311), was cloned, characterized and overexpressed in Nicotiana tabacum. The open reading frame of MsZEP contains 1992 bp nucleotides and encodes a 663-amino acid polypeptide. Amino acid sequence alignment indicated that deduced MsZEP protein was highly homologous to other plant ZEP sequences. Phylogenetic analysis showed that MsZEP was grouped into a branch with other legume plants. Real-time quantitative PCR revealed that MsZEP gene expression was clearly tissue-specific, and the expression levels were higher in green tissues (leaves and stems) than in roots. MsZEP expression decreased in shoots under drought, cold, heat and ABA treatment, while the expression levels in roots showed different trends. Besides, the results showed that nodules could up-regulate the MsZEP expression under non-stressful conditions and in the earlier stage of different abiotic stress. Heterologous expression of the MsZEP gene in N. tabacum could confer tolerance to drought and salt stress by affecting various physiological pathways, ABA levels and stress-responsive genes expression. Taken together, these results suggested that the MsZEP gene may be involved in alfalfa responses to different abiotic stresses and nodules, and could enhance drought and salt tolerance of transgenic tobacco by heterologous expression.

  6. DAF-16 and Δ9 desaturase genes promote cold tolerance in long-lived Caenorhabditis elegans age-1 mutants.

    Directory of Open Access Journals (Sweden)

    Fiona R Savory

    Full Text Available In Caenorhabditis elegans, mutants of the conserved insulin/IGF-1 signalling (IIS pathway are long-lived and stress resistant due to the altered expression of DAF-16 target genes such as those involved in cellular defence and metabolism. The three Δ(9 desaturase genes, fat-5, fat-6 and fat-7, are included amongst these DAF-16 targets, and it is well established that Δ(9 desaturase enzymes play an important role in survival at low temperatures. However, no assessment of cold tolerance has previously been reported for IIS mutants. We demonstrate that long-lived age-1(hx546 mutants are remarkably resilient to low temperature stress relative to wild type worms, and that this is dependent upon daf-16. We also show that cold tolerance following direct transfer to low temperatures is increased in wild type worms during the facultative, daf-16 dependent, dauer stage. Although the cold tolerant phenotype of age-1(hx546 mutants is predominantly due to the Δ(9 desaturase genes, additional transcriptional targets of DAF-16 are also involved. Surprisingly, survival of wild type adults following a rapid temperature decline is not dependent upon functional daf-16, and cellular distributions of a DAF-16::GFP fusion protein indicate that DAF-16 is not activated during low temperature stress. This suggests that cold-induced physiological defences are not specifically regulated by the IIS pathway and DAF-16, but expression of DAF-16 target genes in IIS mutants and dauers is sufficient to promote cross tolerance to low temperatures in addition to other forms of stress.

  7. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  8. Key genes involved in desiccation tolerance and dormancy across life forms

    NARCIS (Netherlands)

    Costa, M.C.D.; Farrant, Jill M.; Oliver, Melvin J.; Ligterink, Wilco; Buitink, Julia; Hilhorst, H.M.W.

    2016-01-01

    Desiccation tolerance (DT, the ability of certain organisms to survive severe dehydration) was a key trait in the evolution of life in terrestrial environments. Likely, the development of desiccation-tolerant life forms was accompanied by the acquisition of dormancy or a dormancy-like stage as a

  9. Expression of an Arabidopsis molybdenum cofactor sulphurase gene in soybean enhances drought tolerance and increases yield under field conditions.

    Science.gov (United States)

    Li, Yajun; Zhang, Jiachang; Zhang, Juan; Hao, Ling; Hua, Jinping; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu

    2013-08-01

    LOS5/ABA3 gene encoding molybdenum cofactor sulphurase is involved in aldehyde oxidase (AO) activity in Arabidopsis, which indirectly regulates ABA biosynthesis and increased stress tolerance. Here, we used a constitutive super promoter to drive LOS5/ABA3 overexpression in soybean (Glycine max L.) to enhance drought tolerance in growth chamber and field conditions. Expression of LOS5/ABA3 was up-regulated by drought stress, which led to increasing AO activity and then a notable increase in ABA accumulation. Transgenic soybean under drought stress had reduced water loss by decreased stomatal aperture size and transpiration rate, which alleviated leaf wilting and maintained higher relative water content. Exposed to drought stress, transgenic soybean exhibited reduced cell membrane damage by reducing electrolyte leakage and production of malondialdehyde and promoting proline accumulation and antioxidant enzyme activities. Also, overexpression of LOS5/ABA3 enhanced expression of stress-up-regulated genes. Furthermore, the seed yield of transgenic plants is at least 21% higher than that of wide-type plants under drought stress conditions in the field. These data suggest that overexpression of LOS5/ABA3 could improve drought tolerance in transgenic soybean via enhanced ABA accumulation, which could activate expression of stress-up-regulated genes and cause a series of physiological and biochemical resistant responses. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  10. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  11. Rice leaf hydrophobicity and gas films are conferred by a wax synthesis gene (LGF1) and contribute to flood tolerance

    DEFF Research Database (Denmark)

    Kurokawa, Yusuke; Nagai, Keisuke; Hung, Phung Danh

    2018-01-01

    Floods impede gas (O2and CO2) exchange between plants and the environment. A mechanism to enhance plant gas exchange under water comprises gas films on hydrophobic leaves, but the genetic regulation of this mechanism is unknown. We used a rice mutant (dripping wet leaf 7, drp7) which does...... not retain gas films on leaves, and its wild-type (Kinmaze), in gene discovery for this trait. Gene complementation was tested in transgenic lines. Functional properties of leaves as related to gas film retention and underwater photosynthesis were evaluated. Leaf Gas Film 1 (LGF1) was identified as the gene...... determining leaf gas films. LGF1 regulates C30 primary alcohol synthesis, which is necessary for abundant epicuticular wax platelets, leaf hydrophobicity and gas films on submerged leaves. This trait enhanced underwater photosynthesis 8.2-fold and contributes to submergence tolerance. Gene function...

  12. Identification of Candidate Genes Involved in the Salt Tolerance of Date Palm (Phoenix dactylifera L.) Based on a Yeast Functional Bioassay.

    Science.gov (United States)

    Patankar, Himanshu V; Al-Harrasi, Ibtisam; Al-Yahyai, Rashid; Yaish, Mahmoud W

    2018-06-01

    Although date palm is a relatively salt-tolerant plant, the molecular basis of this tolerance is complex and poorly understood. Therefore, this study aimed to identify the genes involved in salinity tolerance using a basic yeast functional bioassay. To achieve this, a date palm cDNA library was overexpressed in Saccharomyces cerevisiae cells. The expression levels of selected genes that make yeast cells tolerant to salt were subsequently validated in the leaf and root tissues of date palm seedlings using a quantitative PCR method. About 6000 yeast transformant cells were replica printed and screened on a synthetic minimal medium containing 1.0 M of NaCl. The screening results showed the presence of 62 salt-tolerant transformant colonies. Sequence analysis of the recombinant yeast plasmids revealed the presence of a group of genes with potential salt-tolerance functions, such as aquaporins (PIP), serine/threonine protein kinases (STKs), ethylene-responsive transcription factor 1 (ERF1), and peroxidases (PRX). The expression pattern of the selected genes endorsed the hypothesis that these genes may be involved in salinity tolerance, as they showed a significant (p < 0.05) overexpression trend in both the leaf and root tissues in response to salinity. The genes identified in this project are suitable candidates for the further functional characterization of date palms.

  13. A remorin gene SiREM6, the target gene of SiARDP, from foxtail millet (Setaria italica) promotes high salt tolerance in transgenic Arabidopsis.

    Science.gov (United States)

    Yue, Jing; Li, Cong; Liu, Yuwei; Yu, Jingjuan

    2014-01-01

    Remorin proteins (REMs) form a plant-specific protein family, with some REMs being responsive to abiotic stress. However, the precise functions of REMs in abiotic stress tolerance are not clear. In this study, we identified 11 remorin genes from foxtail millet (Setaria italica) and cloned a remorin gene, SiREM6, for further investigation. The transcript level of SiREM6 was increased by high salt stress, low temperature stress and abscisic acid (ABA) treatment, but not by drought stress. The potential oligomerization of SiREM6 was examined by negative staining electron microscopy. The overexpression of SiREM6 improved high salt stress tolerance in transgenic Arabidopsis at the germination and seedling stages as revealed by germination rate, survival rate, relative electrolyte leakage and proline content. The SiREM6 promoter contains two dehydration responsive elements (DRE) and one ABA responsive element (ABRE). An ABA responsive DRE-binding transcription factor, SiARDP, and an ABRE-binding transcription factor, SiAREB1, were cloned from foxtail millet. SiARDP could physically bind to the DREs, but SiAREB1 could not. These results revealed that SiREM6 is a target gene of SiARDP and plays a critical role in high salt stress tolerance.

  14. A remorin gene SiREM6, the target gene of SiARDP, from foxtail millet (Setaria italica promotes high salt tolerance in transgenic Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jing Yue

    Full Text Available Remorin proteins (REMs form a plant-specific protein family, with some REMs being responsive to abiotic stress. However, the precise functions of REMs in abiotic stress tolerance are not clear. In this study, we identified 11 remorin genes from foxtail millet (Setaria italica and cloned a remorin gene, SiREM6, for further investigation. The transcript level of SiREM6 was increased by high salt stress, low temperature stress and abscisic acid (ABA treatment, but not by drought stress. The potential oligomerization of SiREM6 was examined by negative staining electron microscopy. The overexpression of SiREM6 improved high salt stress tolerance in transgenic Arabidopsis at the germination and seedling stages as revealed by germination rate, survival rate, relative electrolyte leakage and proline content. The SiREM6 promoter contains two dehydration responsive elements (DRE and one ABA responsive element (ABRE. An ABA responsive DRE-binding transcription factor, SiARDP, and an ABRE-binding transcription factor, SiAREB1, were cloned from foxtail millet. SiARDP could physically bind to the DREs, but SiAREB1 could not. These results revealed that SiREM6 is a target gene of SiARDP and plays a critical role in high salt stress tolerance.

  15. The involvement of wheat F-box protein gene TaFBA1 in the oxidative stress tolerance of plants.

    Directory of Open Access Journals (Sweden)

    Shu-Mei Zhou

    Full Text Available As one of the largest gene families, F-box domain proteins have been found to play important roles in abiotic stress responses via the ubiquitin pathway. TaFBA1 encodes a homologous F-box protein contained in E3 ubiquitin ligases. In our previous study, we found that the overexpression of TaFBA1 enhanced drought tolerance in transgenic plants. To investigate the mechanisms involved, in this study, we investigated the tolerance of the transgenic plants to oxidative stress. Methyl viologen was used to induce oxidative stress conditions. Real-time PCR and western blot analysis revealed that TaFBA1 expression was up-regulated by oxidative stress treatments. Under oxidative stress conditions, the transgenic tobacco plants showed a higher germination rate, higher root length and less growth inhibition than wild type (WT. The enhanced oxidative stress tolerance of the transgenic plants was also indicated by lower reactive oxygen species (ROS accumulation, malondialdehyde (MDA content and cell membrane damage under oxidative stress compared with WT. Higher activities of antioxidant enzymes, including superoxide dismutase (SOD, catalase (CAT, ascorbate peroxidase (APX and peroxidase (POD, were observed in the transgenic plants than those in WT, which may be related to the upregulated expression of some antioxidant genes via the overexpression of TaFBA1. In others, some stress responsive elements were found in the promoter region of TaFBA1, and TaFBA1 was located in the nucleus, cytoplasm and plasma membrane. These results suggest that TaFBA1 plays an important role in the oxidative stress tolerance of plants. This is important for understanding the functions of F-box proteins in plants' tolerance to multiple stress conditions.

  16. Proteomic Analyses Reveal the Mechanism of Dunaliella salina Ds-26-16 Gene Enhancing Salt Tolerance in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Yanlong Wang

    Full Text Available We previously screened the novel gene Ds-26-16 from a 4 M salt-stressed Dunaliella salina cDNA library and discovered that this gene conferred salt tolerance to broad-spectrum organisms, including E. coli (Escherichia coli, Haematococcus pluvialis and tobacco. To determine the mechanism of this gene conferring salt tolerance, we studied the proteome of E. coli overexpressing the full-length cDNA of Ds-26-16 using the iTRAQ (isobaric tags for relative and absolute quantification approach. A total of 1,610 proteins were identified, which comprised 39.4% of the whole proteome. Of the 559 differential proteins, 259 were up-regulated and 300 were down-regulated. GO (gene ontology and KEGG (Kyoto encyclopedia of genes and genomes enrichment analyses identified 202 major proteins, including those involved in amino acid and organic acid metabolism, energy metabolism, carbon metabolism, ROS (reactive oxygen species scavenging, membrane proteins and ABC (ATP binding cassette transporters, and peptidoglycan synthesis, as well as 5 up-regulated transcription factors. Our iTRAQ data suggest that Ds-26-16 up-regulates the transcription factors in E. coli to enhance salt resistance through osmotic balance, energy metabolism, and oxidative stress protection. Changes in the proteome were also observed in E. coli overexpressing the ORF (open reading frame of Ds-26-16. Furthermore, pH, nitric oxide and glycerol content analyses indicated that Ds-26-16 overexpression increases nitric oxide content but has no effect on glycerol content, thus confirming that enhanced nitric oxide synthesis via lower intercellular pH was one of the mechanisms by which Ds-26-16 confers salt tolerance to E. coli.

  17. Functional roles of the pepper RING finger protein gene, CaRING1, in abscisic acid signaling and dehydration tolerance.

    Science.gov (United States)

    Lim, Chae Woo; Hwang, Byung Kook; Lee, Sung Chul

    2015-09-01

    Plants are constantly exposed to a variety of biotic and abiotic stresses, which include pathogens and conditions of high salinity, low temperature, and drought. Abscisic acid (ABA) is a major plant hormone involved in signal transduction pathways that mediate the defense response of plants to abiotic stress. Previously, we isolated Ring finger protein gene (CaRING1) from pepper (Capsicum annuum), which is associated with resistance to bacterial pathogens, accompanied by hypersensitive cell death. Here, we report a new function of the CaRING1 gene product in the ABA-mediated defense responses of plants to dehydration stress. The expression of the CaRING1 gene was induced in pepper leaves treated with ABA or exposed to dehydration or NaCl. Virus-induced gene silencing of CaRING1 in pepper plants exhibited low degree of ABA-induced stomatal closure and high levels of transpirational water loss in dehydrated leaves. These led to be more vulnerable to dehydration stress in CaRING1-silenced pepper than in the control pepper, accompanied by reduction of ABA-regulated gene expression and low accumulation of ABA and H2O2. In contrast, CaRING1-overexpressing transgenic plants showed enhanced sensitivity to ABA during the seedling growth and establishment. These plants were also more tolerant to dehydration stress than the wild-type plants because of high ABA accumulation, enhanced stomatal closure and increased expression of stress-responsive genes. Together, these results suggest that the CaRING1 acts as positive factor for dehydration tolerance in Arabidopsis by modulating ABA biosynthesis and ABA-mediated stomatal closing and gene expression.

  18. Drought tolerance and proteomics studies of transgenic wheat containing the maize C4 phosphoenolpyruvate carboxylase (PEPC) gene.

    Science.gov (United States)

    Qin, Na; Xu, Weigang; Hu, Lin; Li, Yan; Wang, Huiwei; Qi, Xueli; Fang, Yuhui; Hua, Xia

    2016-11-01

    Enhancing drought tolerance of crops has been a great challenge in crop improvement. Here, we report the maize phosphoenolpyruvate carboxylase (PEPC) gene was able to confer drought tolerance and increase grain yield in transgenic wheat (Triticum aestivum L.) plants. The improved of drought tolerance was associated with higher levels of proline, soluble sugar, soluble protein, and higher water use efficiency. The transgenic wheat plants had also a more extensive root system as well as increased photosynthetic capacity during stress treatments. The increased grain yield of the transgenic wheat was contributed by improved biomass, larger spike and grain numbers, and heavier 1000-grain weight under drought-stress conditions. Under non-stressed conditions, there were no significant increases in these of the measured traits except for photosynthetic rate when compared with parental wheat. Proteomic research showed that the expression levels of some proteins, including chlorophyll A-B binding protein and pyruvate, phosphate dikinase, which are related to photosynthesis, PAP fibrillin, which is involved in cytoskeleton synthesis, S-adenosylmethionine synthetase, which catalyzes methionine synthesis, were induced in the transgenic wheat under drought stress. Additionally, the expression of glutamine synthetase, which is involved in ammonia assimilation, was induced by drought stress in the wheat. Our study shows that PEPC can improve both stress tolerance and grain yield in wheat, demonstrating the efficacy of PEPC in crop improvement.

  19. Overexpression of the PtSOS2 gene improves tolerance to salt stress in transgenic poplar plants.

    Science.gov (United States)

    Yang, Yang; Tang, Ren-Jie; Jiang, Chun-Mei; Li, Bei; Kang, Tao; Liu, Hua; Zhao, Nan; Ma, Xu-Jun; Yang, Lei; Chen, Shao-Liang; Zhang, Hong-Xia

    2015-09-01

    In higher plants, the salt overly sensitive (SOS) signalling pathway plays a crucial role in maintaining ion homoeostasis and conferring salt tolerance under salinity condition. Previously, we functionally characterized the conserved SOS pathway in the woody plant Populus trichocarpa. In this study, we demonstrate that overexpression of the constitutively active form of PtSOS2 (PtSOS2TD), one of the key components of this pathway, significantly increased salt tolerance in aspen hybrid clone Shanxin Yang (Populus davidiana × Populus bolleana). Compared to the wild-type control, transgenic plants constitutively expressing PtSOS2TD exhibited more vigorous growth and produced greater biomass in the presence of high concentrations of NaCl. The improved salt tolerance was associated with a decreased Na(+) accumulation in the leaves of transgenic plants. Further analyses revealed that plasma membrane Na(+) /H(+) exchange activity and Na(+) efflux in transgenic plants were significantly higher than those in the wild-type plants. Moreover, transgenic plants showed improved capacity in scavenging reactive oxygen species (ROS) generated by salt stress. Taken together, our results suggest that PtSOS2 could serve as an ideal target gene to genetically engineer salt-tolerant trees. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Overexpression of ARGOS Genes Modifies Plant Sensitivity to Ethylene, Leading to Improved Drought Tolerance in Both Arabidopsis and Maize.

    Science.gov (United States)

    Shi, Jinrui; Habben, Jeffrey E; Archibald, Rayeann L; Drummond, Bruce J; Chamberlin, Mark A; Williams, Robert W; Lafitte, H Renee; Weers, Ben P

    2015-09-01

    Lack of sufficient water is a major limiting factor to crop production worldwide, and the development of drought-tolerant germplasm is needed to improve crop productivity. The phytohormone ethylene modulates plant growth and development as well as plant response to abiotic stress. Recent research has shown that modifying ethylene biosynthesis and signaling can enhance plant drought tolerance. Here, we report novel negative regulators of ethylene signal transduction in Arabidopsis (Arabidopsis thaliana) and maize (Zea mays). These regulators are encoded by the ARGOS gene family. In Arabidopsis, overexpression of maize ARGOS1 (ZmARGOS1), ZmARGOS8, Arabidopsis ARGOS homolog ORGAN SIZE RELATED1 (AtOSR1), and AtOSR2 reduced plant sensitivity to ethylene, leading to enhanced drought tolerance. RNA profiling and genetic analysis suggested that the ZmARGOS1 transgene acts between an ethylene receptor and CONSTITUTIVE TRIPLE RESPONSE1 in the ethylene signaling pathway, affecting ethylene perception or the early stages of ethylene signaling. Overexpressed ZmARGOS1 is localized to the endoplasmic reticulum and Golgi membrane, where the ethylene receptors and the ethylene signaling protein ETHYLENE-INSENSITIVE2 and REVERSION-TO-ETHYLENE SENSITIVITY1 reside. In transgenic maize plants, overexpression of ARGOS genes also reduces ethylene sensitivity. Moreover, field testing showed that UBIQUITIN1:ZmARGOS8 maize events had a greater grain yield than nontransgenic controls under both drought stress and well-watered conditions. © 2015 American Society of Plant Biologists. All Rights Reserved.

  1. The role of the F-box gene TaFBA1 from wheat (Triticum aestivum L.) in drought tolerance.

    Science.gov (United States)

    Zhou, Shumei; Sun, Xiudong; Yin, Suhong; Kong, Xiangzhu; Zhou, Shan; Xu, Ying; Luo, Yin; Wang, Wei

    2014-11-01

    Drought is one of the most important factors limiting plant growth and development. We identified a gene in wheat (Triticum aestivum L.) under drought stress named TaFBA1. TaFBA1 encodes a putative 325-amino-acid F-box protein with a conserved N-terminal F-box domain and a C-terminal AMN1 domain. Real-time RT-PCR analysis revealed that TaFBA1 transcript accumulation was upregulated by high-salinity, water stress, and abscisic acid (ABA) treatment. To evaluate the functions of TaFBA1 in the regulation of drought stress responses, we produced transgenic tobacco lines overexpressing TaFBA1. Under water stress conditions, the transgenic tobacco plants had a higher germination rate, higher relative water content, net photosynthesis rate (Pn), less chlorophyll loss, and less growth inhibition than WT. These results demonstrate the high tolerance of the transgenic plants to drought stress compared to the WT. The enhanced oxidative stress tolerance of these plants, which may be involved in their drought tolerance, was indicated by their lower levels of reactive oxygen species (ROS) accumulation, MDA content, and cell membrane damage under drought stress compared to WT. The antioxidant enzyme activities were higher in the transgenic plants than in WT, which may be related to the upregulated expression of some antioxidant genes via overexpression of TaFBA1. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  2. Salicornia europaea L. Na⁺/H⁺ antiporter gene improves salt tolerance in transgenic alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Zhang, L Q; Niu, Y D; Huridu, H; Hao, J F; Qi, Z; Hasi, A

    2014-07-24

    In order to obtain a salt-tolerant perennial alfalfa (Medicago sativa L.), we transferred the halophyte Salicornia europaea L. Na(+)/H(+) antiporter gene, SeNHX1, to alfalfa by using the Agrobacterium-mediated transformation method. The transformants were confirmed by both PCR and RT-PCR analyses. Of 197 plants that were obtained after transformation, 36 were positive by PCR analysis using 2 primer pairs for the CaMV35S-SeNHX1 and SeNHX1-Nos fragments; 6 plants survived in a greenhouse. RT-PCR analysis revealed that SeNHX1 was expressed in 5 plants. The resultant transgenic alfalfa had better salt tolerance. After stress treatment for 21 days with 0.6% NaCl, the chlorophyll and MDA contents in transgenic plants were lower, but proline content and SOD, POD, and CAT activities were higher than those in wild-type plants. These results suggest that the salt tolerance of transgenic alfalfa was improved by the overexpression of the SeNHX1 gene.

  3. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

    Science.gov (United States)

    Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

    2018-04-12

    Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton

  4. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Pu Lu

    2018-04-01

    Full Text Available Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1, a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant

  5. Enhancing expression of SSU1 genes in Saccharomyces uvarum leads to an increase in sulfite tolerance and a transcriptome profile change.

    Science.gov (United States)

    Liu, X Z; Sang, M; Zhang, X A; Zhang, T K; Zhang, H Y; He, X; Li, S X; Sun, X D; Zhang, Z M

    2017-05-01

    Saccharomyces uvarum is a good wine yeast species that may have great potential for the future. However, sulfur tolerance of most S. uvarum strains is very poor. In addition there is still little information about the SSU1 gene of S. uvarum, which encodes a putative transporter conferring sulfite tolerance. In order to analyze the function of the SSU1 gene, two expression vectors that contained different SSU1 genes were constructed and transferred into a sulfite-tolerant S. uvarum strain, A9. Then sulfite tolerance, SO2 production, and PCR, sequencing, RT-qPCR and transcriptome analyses were used to access the function of the S. uvarum SSU1 gene. Our results illustrated that enhancing expression of the SSU1 gene can promote sulfite resistance in S. uvarum, and an insertion fragment ahead of the additional SSU1 gene, as seen in some alleles, could affect the expression of other genes and the sulfite tolerance level of S. uvarum. This is the first report on enhancing the expression of the SSU1 gene of S. uvarum. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Contribution of seedling vigour and anoxia/hypoxia-responsive genes to submergence tolerance in Vietnamese lowland rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Hien Thi Thu Vu

    2016-09-01

    Full Text Available A direct-seeded rice cultivation system has been widely adopted in Asian countries. Optimum germination and vigorous seedling growth under submergence are key traits for the practice of direct seeding. We studied the post-germination seedling vigour in Vietnamese lowland rice accessions based on three bio-parameters, shoot elongation growth under five-day submergence in water-filled test-tubes, seedling recovery rate five days after transferring submerged seedlings to pots with soil and seedling survival rate 21 days after sowing seeds in nursery beds and immediate incubation under submergence. A large diversity was found in seedling vigour thus estimated among the accessions. Significantly high correlations were observed among all three bio-parameters, verifying the contribution of seedling vigour to the manifestation of submergence tolerance at this critical stage of rice development. To examine the roles of anoxia/hypoxia-responsive genes, the expression of 17 candidate genes was studied by reverse transcription polymerase chain reaction (RT-PCR and compared between selected vigorous and non-vigorous groups of accessions. Transcripts of all but two genes showed marked accumulation in submerged seedlings. No differences, however, were found between the two contrasting groups. The observed common and coordinate expression of anoxia/hypoxia-induced genes suggests that they might assume roles in attaining baseline tolerance against submergence stress. It was also suggested that some unknown genetic factors are operating in determining cultivar/genotype-specific levels of submergence tolerance as assessed by post-germination seedling vigour.

  7. Heterologous expression of three Camellia sinensis small heat shock protein genes confers temperature stress tolerance in yeast and Arabidopsis thaliana.

    Science.gov (United States)

    Wang, Mingle; Zou, Zhongwei; Li, Qinghui; Xin, Huahong; Zhu, Xujun; Chen, Xuan; Li, Xinghui

    2017-07-01

    CsHSP17.7, CsHSP18.1, and CsHSP21.8 expressions are induced by heat and cold stresses, and CsHSP overexpression confers tolerance to heat and cold stresses in transgenic Pichia pastoris and Arabidopsis thaliana. Small heat shock proteins (sHSPs) are crucial for protecting plants against biotic and abiotic stresses, especially heat stress. However, knowledge concerning the functions of Camellia sinensis sHSP in heat and cold stresses remains poorly understood. In this study, three C. sinensis sHSP genes (i.e., CsHSP17.7, CsHSP18.1, and CsHSP21.8) were isolated and characterized using suppression subtractive hybridization (SSH) technology. The CsHSPs expression levels in C. sinensis leaves were significantly up-regulated by heat and cold stresses. Phylogenetic analyses revealed that CsHSP17.7, CsHSP18.1, and CsHSP21.8 belong to sHSP Classes I, II, and IV, respectively. Heterologous expression of the three CsHSP genes in Pichia pastoris cells enhanced heat and cold stress tolerance. When exposed to heat and cold treatments, transgenic Arabidopsis thaliana plants overexpressing CsHSP17.7, CsHSP18.1, and CsHSP21.8 had lower malondialdehyde contents, ion leakage, higher proline contents, and transcript levels of stress-related genes (e.g., AtPOD, AtAPX1, AtP5CS2, and AtProT1) compared with the control line. In addition, improved seed germination vigor was also observed in the CsHSP-overexpressing seeds under heat stress. Taken together, our results suggest that the three identified CsHSP genes play key roles in heat and cold tolerance.

  8. 21 CFR 582.2122 - Aluminum calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aluminum calcium silicate. 582.2122 Section 582.2122 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED....2122 Aluminum calcium silicate. (a) Product. Aluminum calcium silicate. (b) Tolerance. 2 percent. (c...

  9. 21 CFR 182.2122 - Aluminum calcium silicate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Aluminum calcium silicate. 182.2122 Section 182.2122 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED....2122 Aluminum calcium silicate. (a) Product. Aluminum calcium silicate. (b) Tolerance. 2 percent. (c...

  10. Seleção de genótipos de Brachiaria Ruziziensis quanto ao alumínio em solução nutritiva: II: Avaliação da tolerância ao alumínio Brachiaria Ruziziensis genotypes selection: II: Evaluation of the aluminum tolerance

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Balbino Miguel

    2011-01-01

    Full Text Available O alumínio, em solos ácidos, é um dos principais responsáveis pela baixa produtividade de culturas. O objetivo deste trabalho foi avaliar a variabilidade genética da Brachiaria ruziziensis para a tolerância ao alumínio. Foram utilizados 10 genótipos da espécie referida, crescidas em vasos com 0, 30 e 60 mg/L de alumínio em solução nutritiva. Foi utilizado o delineamento inteiramente casualizado em esquema fatorial, com seis repetições e parcelas de uma planta por vaso. Foram avaliados: a produção de massa verde da parte aérea e raízes (MVPA e MVR, a produção de matéria seca da parte aérea e raízes (MSPA e MSR, o incremento no crescimento da parte aérea e das raízes (IPA e IR, expresso pela diferença entre o crescimento final e o inicial, e o incremento no número de perfilhos (INP. O aumento nas concentrações de alumínio provocou decréscimos para as médias de todas as características avaliadas, excetuando o IR. A ausência de diferenças do genótipo 8 para seis das sete características analisadas, com exceção da MVPA, demonstra ser ela a mais promissora para estudos posteriores em melhoramento, visando maior produtividade em solos ácidos. Os resultados evidenciaram a existência de variabilidade genética entre os genótipos avaliados para a tolerância ao alumínio tóxico, sendo possível identificar materiais mais produtivos na presença desse metal.In acid soils, the aluminum is responsible for the low cultures productivity. The objective of this work was to evaluate the Brachiaria ruziziensis genetic variability for the aluminum tolerance.10 genotypes of that species were used, grown in vases with 0, 30 and 60 mg/L of aluminum in nutritious solution. A completely randomized design under 10 x 3 factorial, with six replicates. The following variables were evaluated: the green mass production of the aerial part and roots (MVPA and MVR, the dry matter production of the aerial part and roots (MSPA and MSR

  11. Cloning of Ammopiptanthus mongolicus C-repeat-binding factor gene and its cold-induced tolerance in transgenic tobacco

    Directory of Open Access Journals (Sweden)

    Lijiang Gu

    2013-12-01

    Full Text Available C-repeat-binding factors (CBFs are a type of important regulon in stress-related signal transduction pathways that control plant tolerance of abiotic stress. Ammopiptanthus mongolicus is the only evergreen broadleaf shrub in the northwest desert of China. The species shows strong resistance to environmental stress, especially to cold stress. An A. mongolicus CBF1 gene (AmCBF1 was cloned and transformed into tobacco. Expression of AmCBF1 could be detected in A. mongolicus shortly after exposure to low temperature of 4°C. Analysis on ratio of electrolytic leakage, soluble sugar content, free proline content, malondialdehyde (MDA content and peroxidase (POD activity before and after cold treatment (4°C for 24 h indicated AmCBF1 conferred higher cold tolerance to AmCBF1 transgenic tobacco compared with the wild type and empty vector transformed tobacco.

  12. De novo transcriptome characterization and gene expression profiling of the desiccation tolerant moss Bryum argenteum following rehydration.

    Science.gov (United States)

    Gao, Bei; Zhang, Daoyuan; Li, Xiaoshuang; Yang, Honglan; Zhang, Yuanming; Wood, Andrew J

    2015-05-28

    The desiccation-tolerant moss Bryum argenteum is an important component of the Biological Soil Crusts (BSCs) found in the Gurbantunggut desert. Desiccation tolerance is defined as the ability to revive from the air dried state. To elucidate the molecular mechanisms related to desiccation tolerance, we employed RNA-Seq and digital gene expression (DGE) technologies to study the genome-wide expression profiles of the dehydration and rehydration processes in this important desert plant. We applied a two-step approach to investigate the gene expression profile upon rehydration in the moss Bryum argenteum using Illumina HiSeq2000 sequencing platform. First, a total of 57,247 transcript assembly contigs (TACs) were obtained from 54.79 million reads by de novo assembly, with an average length of 863 bp and N50 of 1,372 bp. Among the reconstructed TACs, 36,916 (64.5%) revealed similarity with existing protein sequences in the public databases. 23,509 and 21,607 TACs were assigned GO and KEGG annotation information, respectively. Second, samples were taken from 3 hydration stages: desiccated (Dry), rehydrated 2 h (R2) and rehydrated 24 h (R24), and DEG libraries were constructed for Differentially Expressed Genes (DEGs) discovery. 4,081 and 6,709 DEGs were identified in R2 and R24, compared with Dry, respectively. Compared to the desiccated sample, up-regulated genes after two hours of hydration are primarily related to stress responses. GO function enrichment network, EKGG metabolic pathway and MapMan analysis supports the idea of the rapid recovery of photosynthesis after 24 h of rehydration. We identified 770 transcription factors (TFs) which were classified into 50 TF families. 142 TF transcripts were up-regulated upon rehydration including 23 members of the ERF family. In this study, we constructed a pioneering, high-quality reference transcriptome in B. argenteum and generated three DGE libraries to elucidate the changes of gene expression upon rehydration. Expression

  13. Variation in soil aluminium tolerance genes is associated with local adaptation to soils at the Park Grass Experiment.

    Science.gov (United States)

    Gould, Billie; McCouch, Susan; Geber, Monica

    2014-12-01

    Studies of the wild grass Anthoxanthum odoratum at the long-term Park Grass Experiment (PGE, Harpenden, UK) document a well-known example of rapid plant evolution in response to environmental change. Repeated fertilizer applications have acidified the soil in some experimental plots over the past 150+ years, and Anthoxanthum subpopulations have quickly become locally adapted. Early reciprocal transplants showed subpopulation differentiation specifically in response to soil aluminium (Al) toxicity across the experiment, even at small (30 m) spatial scales. Almost 40 years after its original measurement, we reassessed the degree of local adaptation to soil Al at the PGE using updated phenotyping methods and identified genes with variation linked to the tolerance trait. Root growth assays show that plants are locally adapted to soil Al at both the seedling and adult growth stages, but to a smaller extent than previously inferred. Among a large suite of candidate loci that were previously shown to have Al-sensitive expression differences between sensitive and tolerant plants, three loci contained SNPs that are associated with both Al tolerance and soil acidity: an Al-sensitive malate transporter (ALMT), a tonoplast intrinsic protein (TIP) and the putative homolog of the rice cell-wall modification gene STAR1. Natural genetic variation at these loci is likely to have contributed to the recent rapid evolution at PGE. Continued study of Al tolerance variants in Anthoxanthum will allow us to test hypotheses about the nature and source of genetic variation that enables some species to adapt to soil acidification and other types of rapid environmental change. © 2014 John Wiley & Sons Ltd.

  14. Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L.) varieties differing in drought tolerance.

    Science.gov (United States)

    Jain, Deepti; Chattopadhyay, Debasis

    2010-02-09

    Chickpea (C. arietinum L.) ranks third in food legume crop production in the world. However, drought poses a serious threat to chickpea production, and development of drought-resistant varieties is a necessity. Unfortunately, cultivated chickpea has a high morphological but narrow genetic diversity, and understanding the genetic processes of this plant is hindered by the fact that the chickpea genome has not yet been sequenced and its EST resources are limited. In this study, two chickpea varieties having contrasting levels of drought-tolerance were analyzed for differences in transcript profiling during drought stress treatment by withdrawal of irrigation at different time points. Transcript profiles of ESTs derived from subtractive cDNA libraries constructed with RNA from whole seedlings of both varieties were analyzed at different stages of stress treatment. A series of comparisons of transcript abundance between two varieties at different time points were made. 319 unique ESTs available from different libraries were categorized into eleven clusters according to their comparative expression profiles. Expression analysis revealed that 70% of the ESTs were more than two fold abundant in the tolerant cultivar at any point of the stress treatment of which expression of 33% ESTs were more than two fold high even under the control condition. 53 ESTs that displayed very high fold relative expression in the tolerant variety were screened for further analysis. These ESTs were clustered in four groups according to their expression patterns. Annotation of the highly expressed ESTs in the tolerant cultivar predicted that most of them encoded proteins involved in cellular organization, protein metabolism, signal transduction, and transcription. Results from this study may help in targeting useful genes for improving drought tolerance in chickpea.

  15. Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L. varieties differing in drought tolerance

    Directory of Open Access Journals (Sweden)

    Chattopadhyay Debasis

    2010-02-01

    Full Text Available Abstract Background Chickpea (C. arietinum L. ranks third in food legume crop production in the world. However, drought poses a serious threat to chickpea production, and development of drought-resistant varieties is a necessity. Unfortunately, cultivated chickpea has a high morphological but narrow genetic diversity, and understanding the genetic processes of this plant is hindered by the fact that the chickpea genome has not yet been sequenced and its EST resources are limited. In this study, two chickpea varieties having contrasting levels of drought-tolerance were analyzed for differences in transcript profiling during drought stress treatment by withdrawal of irrigation at different time points. Transcript profiles of ESTs derived from subtractive cDNA libraries constructed with RNA from whole seedlings of both varieties were analyzed at different stages of stress treatment. Results A series of comparisons of transcript abundance between two varieties at different time points were made. 319 unique ESTs available from different libraries were categorized into eleven clusters according to their comparative expression profiles. Expression analysis revealed that 70% of the ESTs were more than two fold abundant in the tolerant cultivar at any point of the stress treatment of which expression of 33% ESTs were more than two fold high even under the control condition. 53 ESTs that displayed very high fold relative expression in the tolerant variety were screened for further analysis. These ESTs were clustered in four groups according to their expression patterns. Conclusions Annotation of the highly expressed ESTs in the tolerant cultivar predicted that most of them encoded proteins involved in cellular organization, protein metabolism, signal transduction, and transcription. Results from this study may help in targeting useful genes for improving drought tolerance in chickpea.

  16. Enhanced cadmium accumulation and tolerance in transgenic tobacco overexpressing rice metal tolerance protein gene OsMTP1 is promising for phytoremediation.

    Science.gov (United States)

    Das, Natasha; Bhattacharya, Surajit; Maiti, Mrinal K

    2016-08-01

    One of the most grievous heavy metal pollutants in the environment is cadmium (Cd), which is not only responsible for the crop yield loss owing to its phytotoxicity, but also for the human health hazards as the toxic elements usually accumulate in the consumable parts of crop plants. In the present study, we aimed to isolate and functionally characterize the OsMTP1 gene from indica rice (Oryza sativa L. cv. IR64) to study its potential application for efficient phytoremediation of Cd. The 1257 bp coding DNA sequence (CDS) of OsMTP1 encodes a ∼46 kDa protein belonging to the cation diffusion facilitator (CDF) or metal tolerance/transport protein (MTP) family. The OsMTP1 transcript in rice plant was found to respond during external Cd stress. Heterologous expression of OsMTP1 in tobacco resulted in the reduction of Cd stress-induced phytotoxic effects, including growth inhibition, lipid peroxidation, and cell death. Compared to untransformed control, the transgenic tobacco plants showed enhanced vacuolar thiol content, indicating vacuolar localization of the sequestered Cd. The transgenic tobacco plants exhibited significantly higher biomass growth (2.2-2.8-folds) and hyperaccumulation of Cd (1.96-2.22-folds) compared to untransformed control under Cd exposure. The transgenic plants also showed moderate tolerance and accumulation of arsenic (As) upon exogenous As stress, signifying broad substrate specificity of OsMTP1. Together, findings of our research suggest that the transgenic tobacco plants overexpressing OsMTP1 with its hyperaccumulating activity and increased growth rate could be useful for future phytoremediation applications to clean up the Cd-contaminated soil. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  17. Cloning of the Lycopene β-cyclase Gene in Nicotiana tabacum and Its Overexpression Confers Salt and Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yanmei Shi

    2015-12-01

    Full Text Available Carotenoids are important pigments in plants that play crucial roles in plant growth and in plant responses to environmental stress. Lycopene β cyclase (β-LCY functions at the branch point of the carotenoid biosynthesis pathway, catalyzing the cyclization of lycopene. Here, a β-LCY gene from Nicotiana tabacum, designated as Ntβ-LCY1, was cloned and functionally characterized. Robust expression of Ntβ-LCY1 was found in leaves, and Ntβ-LCY1 expression was obviously induced by salt, drought, and exogenous abscisic acid treatments. Strong accumulation of carotenoids and expression of carotenoid biosynthesis genes resulted from Ntβ-LCY1 overexpression. Additionally, compared to wild-type plants, transgenic plants with overexpression showed enhanced tolerance to salt and drought stress with higher abscisic acid levels and lower levels of malondialdehyde and reactive oxygen species. Conversely, transgenic RNA interference plants had a clear albino phenotype in leaves, and some plants did not survive beyond the early developmental stages. The suppression of Ntβ-LCY1 expression led to lower expression levels of genes in the carotenoid biosynthesis pathway and to reduced accumulation of carotenoids, chlorophyll, and abscisic acid. These results indicate that Ntβ-LCY1 is not only a likely cyclization enzyme involved in carotenoid accumulation but also confers salt and drought stress tolerance in Nicotiana tabacum.

  18. Integration of gene-based markers in a pearl millet genetic map for identification of candidate genes underlying drought tolerance quantitative trait loci

    Directory of Open Access Journals (Sweden)

    Sehgal Deepmala

    2012-01-01

    Full Text Available Abstract Background Identification of genes underlying drought tolerance (DT quantitative trait loci (QTLs will facilitate understanding of molecular mechanisms of drought tolerance, and also will accelerate genetic improvement of pearl millet through marker-assisted selection. We report a map based on genes with assigned functional roles in plant adaptation to drought and other abiotic stresses and demonstrate its use in identifying candidate genes underlying a major DT-QTL. Results Seventy five single nucleotide polymorphism (SNP and conserved intron spanning primer (CISP markers were developed from available expressed sequence tags (ESTs using four genotypes, H 77/833-2, PRLT 2/89-33, ICMR 01029 and ICMR 01004, representing parents of two mapping populations. A total of 228 SNPs were obtained from 30.5 kb sequenced region resulting in a SNP frequency of 1/134 bp. The positions of major pearl millet linkage group (LG 2 DT-QTLs (reported from crosses H 77/833-2 × PRLT 2/89-33 and 841B × 863B were added to the present consensus function map which identified 18 genes, coding for PSI reaction center subunit III, PHYC, actin, alanine glyoxylate aminotransferase, uridylate kinase, acyl-CoA oxidase, dipeptidyl peptidase IV, MADS-box, serine/threonine protein kinase, ubiquitin conjugating enzyme, zinc finger C- × 8-C × 5-C × 3-H type, Hd3, acetyl CoA carboxylase, chlorophyll a/b binding protein, photolyase, protein phosphatase1 regulatory subunit SDS22 and two hypothetical proteins, co-mapping in this DT-QTL interval. Many of these candidate genes were found to have significant association with QTLs of grain yield, flowering time and leaf rolling under drought stress conditions. Conclusions We have exploited available pearl millet EST sequences to generate a mapped resource of seventy five new gene-based markers for pearl millet and demonstrated its use in identifying candidate genes underlying a major DT-QTL in this species. The reported gene

  19. Overexpression of the Wheat Expansin Gene TaEXPA2 Improved Seed Production and Drought Tolerance in Transgenic Tobacco Plants.

    Science.gov (United States)

    Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei

    2016-01-01

    Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants.

  20. Bistable expression of virulence genes in salmonella leads to the formation of an antibiotic-tolerant subpopulation.

    Directory of Open Access Journals (Sweden)

    Markus Arnoldini

    2014-08-01

    Full Text Available Phenotypic heterogeneity can confer clonal groups of organisms with new functionality. A paradigmatic example is the bistable expression of virulence genes in Salmonella typhimurium, which leads to phenotypically virulent and phenotypically avirulent subpopulations. The two subpopulations have been shown to divide labor during S. typhimurium infections. Here, we show that heterogeneous virulence gene expression in this organism also promotes survival against exposure to antibiotics through a bet-hedging mechanism. Using microfluidic devices in combination with fluorescence time-lapse microscopy and quantitative image analysis, we analyzed the expression of virulence genes at the single cell level and related it to survival when exposed to antibiotics. We found that, across different types of antibiotics and under concentrations that are clinically relevant, the subpopulation of bacterial cells that express virulence genes shows increased survival after exposure to antibiotics. Intriguingly, there is an interplay between the two consequences of phenotypic heterogeneity. The bet-hedging effect that arises through heterogeneity in virulence gene expression can protect clonal populations against avirulent mutants that exploit and subvert the division of labor within these populations. We conclude that bet-hedging and the division of labor can arise through variation in a single trait and interact with each other. This reveals a new degree of functional complexity of phenotypic heterogeneity. In addition, our results suggest a general principle of how pathogens can evade antibiotics: Expression of virulence factors often entails metabolic costs and the resulting growth retardation could generally increase tolerance against antibiotics and thus compromise treatment.

  1. Divergent regulation of CBF regulon on cold tolerance and plant phenotype in cassava overexpressing Arabidopsis CBF3 gene

    Directory of Open Access Journals (Sweden)

    Dong An

    2016-12-01

    Full Text Available Cassava is a tropical origin plant that is sensitive to chilling stress. In order to understand the CBF cold response pathway, a well-recognized regulatory mechanism in temperate plants, in cassava, overexpression of an Arabidopsis CBF3 gene is studied. This gene renders cassava increasingly tolerant to cold and drought stresses but is associated with retarded plant growth, leaf curling, reduced storage root yield, and reduced anthocyanin accumulation in a transcript abundance-dependent manner. Physiological analysis revealed that the transgenic cassava increased proline accumulation, reduced malondialdehyde production, and electrolyte leakage under cold stress. These transgenic lines also showed high relative water content when faced with drought. The expression of partial CBF-targeted genes in response to cold displayed temporal and spatial variations in the wild-type and transgenic plants: highly inducible in leaves and less altered in apical buds. In addition, anthocyanin accumulation was inhibited by downregulating the expression of genes involved in its biosynthesis and by interplaying between the CBF3 and the endogenous transcription factors. Thus, the heterologous CBF3 modulates the expression of stress-related genes and carries out a series of physiological adjustments under stressful conditions, showing a varied regulation pattern of CBF regulon from that of cassava CBFs.

  2. The grapevine VvWRKY2 gene enhances salt and osmotic stress tolerance in transgenic Nicotiana tabacum.

    Science.gov (United States)

    Mzid, Rim; Zorrig, Walid; Ben Ayed, Rayda; Ben Hamed, Karim; Ayadi, Mariem; Damak, Yosra; Lauvergeat, Virginie; Hanana, Mohsen

    2018-06-01

    Our study aims to assess the implication of WRKY transcription factor in the molecular mechanisms of grapevine adaptation to salt and water stresses. In this respect, a full-length VvWRKY2 cDNA, isolated from a Vitis vinifera grape berry cDNA library, was constitutively over-expressed in Nicotiana tabacum seedlings. Our results showed that transgenic tobacco plants exhibited higher seed germination rates and better growth, under both salt and osmotic stress treatments, when compared to wild type plants. Furthermore, our analyses demonstrated that, under stress conditions, transgenic plants accumulated more osmolytes, such as soluble sugars and free proline, while no changes were observed regarding electrolyte leakage, H 2 O 2 , and malondialdehyde contents. The improvement of osmotic adjustment may be an important mechanism underlying the role of VvWRKY 2 in promoting tolerance and adaptation to abiotic stresses. Principal component analysis of our results highlighted a clear partition of plant response to stress. On the other hand, we observed a significant adaptation behaviour response for transgenic lines under stress. Taken together, all our findings suggest that over-expression of VvWRKY2 gene has a compelling role in abiotic stress tolerance and, therefore, would provide a useful strategy to promote abiotic stress tolerance in grape via molecular-assisted breeding and/or new biotechnology tools.

  3. Seleção de populações de Lotus corniculatus L. com maior tolerância ao alumínio em solução nutritiva Selection of populations of Lotus corniculatus L. with increased tolerance to aluminum in nutrient solution

    Directory of Open Access Journals (Sweden)

    Aline Janke

    2010-11-01

    Full Text Available O experimento foi realizado com o objetivo de selecionar genótipos de Lotus corniculatus L. (Draco, São Gabriel e UFRGS mais tolerantes ao alumínio, utilizando-se a técnica de seleção em solução nutritiva. A solução continha 200 µmol/L de cálcio (CaCl2, 100 µmol/L de alumínio (AlCl3 e pH controlado na faixa de 4,1 a 4,3. Realizaram-se dois ciclos de seleção, nos quais as plântulas foram selecionadas pelo comprimento final das radículas. Posteriormente, avaliou-se o ganho genético alcançado nos ciclos de seleção, tanto nas populações originais como nas melhoradas, em um experimento com solução nutritiva com quatro concentrações de alumínio (0, 50, 100 e 150 µmol/L (AlCl3, por meio do crescimento radicular líquido. O uso de solução nutritiva foi eficiente na seleção de plântulas de cornichão tolerantes ao alumínio. Os materiais analisados apresentam diferenças em relação a esta característica, destacando-se o genótipo UFRGS F2, proveniente de dois ciclos de seleção, como o material com maior tolerância ao alumínio.The experiment was carried out to select genotypes of Lotus corniculatus L. (Draco, São Gabriel and UFRGS more tolerant to aluminum, using the technique of selection in nutrient solution. The solution contained 200 µmol/L calcium (CaCl2 and 100 µmol/L aluminum (AlCl3 and a pH controlled in the range from 4.1 to 4.3. It was performed two cycles of selection, in which the seedlings were selected by the root final length. Subsequently, the genetic gain achieved in the cycles of selection was tested, in original and improved populations in an experiment in nutrient solution with four concentrations of aluminum (0, 50, 100 and 150 µmol/L (AlCl3, by liquid root growth. Use of nutritional solution was efficient in the selection of seedlings of birdsfoot trefoil tolerant to aluminum. The materials analyzed differ for this characteristic, with the genotype UFRGS F2, being the most tolerant.

  4. Regulation of gene expression is associated with tolerance of the Arctic copepod Calanus glacialis to CO2-acidified sea water.

    Science.gov (United States)

    Bailey, Allison; De Wit, Pierre; Thor, Peter; Browman, Howard I; Bjelland, Reidun; Shema, Steven; Fields, David M; Runge, Jeffrey A; Thompson, Cameron; Hop, Haakon

    2017-09-01

    Ocean acidification is the increase in seawater p CO 2 due to the uptake of atmospheric anthropogenic CO 2 , with the largest changes predicted to occur in the Arctic seas. For some marine organisms, this change in p CO 2 , and associated decrease in pH, represents a climate change-related stressor. In this study, we investigated the gene expression patterns of nauplii of the Arctic copepod Calanus glacialis cultured at low pH levels. We have previously shown that organismal-level performance (development, growth, respiration) of C. glacialis nauplii is unaffected by low pH. Here, we investigated the molecular-level response to lowered pH in order to elucidate the physiological processes involved in this tolerance. Nauplii from wild-caught C. glacialis were cultured at four pH levels (8.05, 7.9, 7.7, 7.5). At stage N6, mRNA was extracted and sequenced using RNA-seq. The physiological functionality of the proteins identified was categorized using Gene Ontology and KEGG pathways. We found that the expression of 151 contigs varied significantly with pH on a continuous scale (93% downregulated with decreasing pH). Gene set enrichment analysis revealed that, of the processes downregulated, many were components of the universal cellular stress response, including DNA repair, redox regulation, protein folding, and proteolysis. Sodium:proton antiporters were among the processes significantly upregulated, indicating that these ion pumps were involved in maintaining cellular pH homeostasis. C. glacialis significantly alters its gene expression at low pH, although they maintain normal larval development. Understanding what confers tolerance to some species will support our ability to predict the effects of future ocean acidification on marine organisms.

  5. Wheat F-Box Protein Gene TaFBA1 Is Involved in Plant Tolerance to Heat Stress

    Directory of Open Access Journals (Sweden)

    Qinxue Li

    2018-04-01

    Full Text Available Adverse environmental conditions, including high temperature, often affect the growth and production of crops worldwide. F-box protein, a core component of the Skp1-Cullin-F-box (SCF E3 ligase complex, plays an important role in abiotic stress responses. A previously cloned gene from wheat, TaFBA1, encodes a homologous F-box protein. A Yeast two-Hybrid (Y2H assay showed that TaFBA1 interacted with other SCF proteins. We found that the expression of TaFBA1 could be induced by heat stress (45°C. Overexpression of TaFBA1 enhanced heat stress tolerance in transgenic tobacco, because growth inhibition was reduced and photosynthesis increased as compared with those in the wild type (WT plants. Furthermore, the accumulation of H2O2, O2-, and carbonyl protein decreased and cell damage was alleviated in transgenic plants under heat stress, which resulted in less oxidative damage. However, the transgenic plants contained more enzymatic antioxidants after heat stress, which might be related to the regulation of some antioxidant gene expressions. The qRT-PCR analysis showed that the overexpression of TaFBA1 upregulated the expression of genes involved in reactive oxygen species (ROS scavenging, proline biosynthesis, and abiotic stress responses. We identified the interaction of TaFBA1 with Triticum aestivum stress responsive protein 1 (TaASRP1 by Y2H assay and bimolecular fluorescence complementation (BiFC assay. The results suggested that TaFBA1 may improve enzymatic antioxidant levels and regulate gene expression by interacting with other proteins, such as TaASRP1, which leads to the enhanced heat stress tolerance seen in the transgenic plants.

  6. Analysis of Stress-Responsive Gene Expression in Cultivated and Weedy Rice Differing in Cold Stress Tolerance.

    Directory of Open Access Journals (Sweden)

    Caroline Borges Bevilacqua

    Full Text Available Rice (Oryza sativa L. cultivars show impairment of growth in response to environmental stresses such as cold at the early seedling stage. Locally adapted weedy rice is able to survive under adverse environmental conditions, and can emerge in fields from greater soil depth. Cold-tolerant weedy rice can be a good genetic source for developing cold-tolerant, weed-competitive rice cultivars. An in-depth analysis is presented here of diverse indica and japonica rice genotypes, mostly weedy rice, for cold stress response to provide an understanding of different stress adaptive mechanisms towards improvement of the rice crop performance in the field. We have tested a collection of weedy rice genotypes to: 1 classify the subspecies (ssp. grouping (japonica or indica of 21 accessions; 2 evaluate their sensitivity to cold stress; and 3 analyze the expression of stress-responsive genes under cold stress and a combination of cold and depth stress. Seeds were germinated at 25°C at 1.5- and 10-cm sowing depth for 10d. Seedlings were then exposed to cold stress at 10°C for 6, 24 and 96h, and the expression of cold-, anoxia-, and submergence-inducible genes was analyzed. Control plants were seeded at 1.5cm depth and kept at 25°C. The analysis revealed that cold stress signaling in indica genotypes is more complex than that of japonica as it operates via both the CBF-dependent and CBF-independent pathways, implicated through induction of transcription factors including OsNAC2, OsMYB46 and OsF-BOX28. When plants were exposed to cold + sowing depth stress, a complex signaling network was induced that involved cross talk between stresses mediated by CBF-dependent and CBF-independent pathways to circumvent the detrimental effects of stresses. The experiments revealed the importance of the CBF regulon for tolerance to both stresses in japonica and indica ssp. The mechanisms for cold tolerance differed among weedy indica genotypes and also between weedy indica and

  7. Genome-wide association study to identify candidate loci and genes for Mn toxicity tolerance in rice.

    Directory of Open Access Journals (Sweden)

    Asis Shrestha

    Full Text Available Manganese (Mn is an essential micro-nutrient for plants, but flooded rice fields can accumulate high levels of Mn2+ leading to Mn toxicity. Here, we present a genome-wide association study (GWAS to identify candidate loci conferring Mn toxicity tolerance in rice (Oryza sativa L.. A diversity panel of 288 genotypes was grown in hydroponic solutions in a greenhouse under optimal and toxic Mn concentrations. We applied a Mn toxicity treatment (5 ppm Mn2+, 3 weeks at twelve days after transplanting. Mn toxicity caused moderate damage in rice in terms of biomass loss and symptom formation despite extremely high shoot Mn concentrations ranging from 2.4 to 17.4 mg g-1. The tropical japonica subpopulation was more sensitive to Mn toxicity than other subpopulations. Leaf damage symptoms were significantly correlated with Mn uptake into shoots. Association mapping was conducted for seven traits using 416741 single nucleotide polymorphism (SNP markers using a mixed linear model, and detected six significant associations for the traits shoot manganese concentration and relative shoot length. Candidate regions contained genes coding for a heavy metal transporter, peroxidase precursor and Mn2+ ion binding proteins. The significant marker SNP-2.22465867 caused an amino acid change in a gene (LOC_Os02g37170 with unknown function. This study demonstrated significant natural variation in rice for Mn toxicity tolerance and the possibility of using GWAS to unravel genetic factors responsible for such complex traits.

  8. The Cotton WRKY Gene GhWRKY41 Positively Regulates Salt and Drought Stress Tolerance in Transgenic Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Xiaoqian Chu

    Full Text Available WRKY transcription factors constitute a very large family of proteins in plants and participate in modulating plant biological processes, such as growth, development and stress responses. However, the exact roles of WRKY proteins are unclear, particularly in non-model plants. In this study, Gossypium hirsutum WRKY41 (GhWRKY41 was isolated and transformed into Nicotiana benthamiana. Our results showed that overexpression of GhWRKY41 enhanced the drought and salt stress tolerance of transgenic Nicotiana benthamiana. The transgenic plants exhibited lower malondialdehyde content and higher antioxidant enzyme activity, and the expression of antioxidant genes was upregulated in transgenic plants exposed to osmotic stress. A β-glucuronidase (GUS staining assay showed that GhWRKY41 was highly expressed in the stomata when plants were exposed to osmotic stress, and plants overexpressing GhWRKY41 exhibited enhanced stomatal closure when they were exposed to osmotic stress. Taken together, our findings demonstrate that GhWRKY41 may enhance plant tolerance to stress by functioning as a positive regulator of stoma closure and by regulating reactive oxygen species (ROS scavenging and the expression of antioxidant genes.

  9. The Grape VlWRKY3 Gene Promotes Abiotic and Biotic Stress Tolerance in Transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Rongrong Guo

    2018-04-01

    Full Text Available WRKY transcription factors are known to play important roles in plant responses to various abiotic and biotic stresses. The grape WRKY gene, WRKY3 was previously reported to respond to salt and drought stress, as well as methyl jasmonate and ethylene treatments in Vitis labrusca × V. vinifera cv. ‘Kyoho.’ In the current study, WRKY3 from the ‘Kyoho’ grape cultivar was constitutively expressed in Arabidopsis thaliana under control of the cauliflower mosaic virus 35S promoter. The 35S::VlWRKY3 transgenic A. thaliana plants showed improved salt and drought stress tolerance during the germination, seedling and the mature plant stages. Various physiological traits related to abiotic stress responses were evaluated to gain further insight into the role of VlWRKY3, and it was found that abiotic stress caused less damage to the transgenic seedlings than to the wild-type (WT plants. VlWRKY3 over-expression also resulted in altered expression levels of abiotic stress-responsive genes. Moreover, the 35S::VlWRKY3 transgenic A. thaliana lines showed improved resistance to Golovinomyces cichoracearum, but increased susceptibility to Botrytis cinerea, compared with the WT plants. Collectively, these results indicate that VlWRKY3 plays important roles in responses to both abiotic and biotic stress, and modification of its expression may represent a strategy to enhance stress tolerance in crops.

  10. TaCIPK29, a CBL-interacting protein kinase gene from wheat, confers salt stress tolerance in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Xiaomin Deng

    Full Text Available Calcineurin B-like protein-interacting protein kinases (CIPKs have been found to be responsive to abiotic stress. However, their precise functions and the related molecular mechanisms in abiotic stress tolerance are not completely understood, especially in wheat. In the present study, TaCIPK29 was identified as a new member of CIPK gene family in wheat. TaCIPK29 transcript increased after NaCl, cold, methyl viologen (MV, abscisic acid (ABA and ethylene treatments. Over-expression of TaCIPK29 in tobacco resulted in increased salt tolerance, which was demonstrated by higher germination rates, longer root lengths and better growth status of transgenic tobacco plants compared to controls when both were treated with salt stress. Physiological measurements indicated that transgenic tobacco seedlings retained high K(+/Na(+ ratios and Ca(2+ content by up-regulating some transporter genes expression and also possessed lower H2O2 levels and reduced membrane injury by increasing the expression and activities of catalase (CAT and peroxidase (POD under salt stress. Moreover, transgenic lines conferred tolerance to oxidative stress by increasing the activity and expression of CAT. Finally, TaCIPK29 was located throughout cells and it preferentially interacted with TaCBL2, TaCBL3, NtCBL2, NtCBL3 and NtCAT1. Taken together, our results showed that TaCIPK29 functions as a positive factor under salt stress and is involved in regulating cations and reactive oxygen species (ROS homeostasis.

  11. Cellulose synthesis genes CESA6 and CSI1 are important for salt stress tolerance in Arabidopsis.

    Science.gov (United States)

    Zhang, Shuang-Shuang; Sun, Le; Dong, Xinran; Lu, Sun-Jie; Tian, Weidong; Liu, Jian-Xiang

    2016-07-01

    Two salt hypersensitive mutants she1 and she2 were identified through genetic screening. SHE1 encodes a cellulose synthase CESA6 while SHE2 encodes a cellulose synthase-interactive protein CSI1. Both of them are involved in cellulose deposition. Our results demonstrated that the sustained cellulose synthesis is important for salt stress tolerance in Arabidopsis. © 2015 Institute of Botany, Chinese Academy of Sciences.

  12. Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

    Science.gov (United States)

    Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

    2017-04-01

    Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

  13. Whole-genome analysis of herbicide-tolerant mutant rice generated by Agrobacterium-mediated gene targeting.

    Science.gov (United States)

    Endo, Masaki; Kumagai, Masahiko; Motoyama, Ritsuko; Sasaki-Yamagata, Harumi; Mori-Hosokawa, Satomi; Hamada, Masao; Kanamori, Hiroyuki; Nagamura, Yoshiaki; Katayose, Yuichi; Itoh, Takeshi; Toki, Seiichi

    2015-01-01

    Gene targeting (GT) is a technique used to modify endogenous genes in target genomes precisely via homologous recombination (HR). Although GT plants are produced using genetic transformation techniques, if the difference between the endogenous and the modified gene is limited to point mutations, GT crops can be considered equivalent to non-genetically modified mutant crops generated by conventional mutagenesis techniques. However, it is difficult to guarantee the non-incorporation of DNA fragments from Agrobacterium in GT plants created by Agrobacterium-mediated GT despite screening with conventional Southern blot and/or PCR techniques. Here, we report a comprehensive analysis of herbicide-tolerant rice plants generated by inducing point mutations in the rice ALS gene via Agrobacterium-mediated GT. We performed genome comparative genomic hybridization (CGH) array analysis and whole-genome sequencing to evaluate the molecular composition of GT rice plants. Thus far, no integration of Agrobacterium-derived DNA fragments has been detected in GT rice plants. However, >1,000 single nucleotide polymorphisms (SNPs) and insertion/deletion (InDels) were found in GT plants. Among these mutations, 20-100 variants might have some effect on expression levels and/or protein function. Information about additive mutations should be useful in clearing out unwanted mutations by backcrossing. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  14. Genome-wide RNAi screen reveals the E3 SUMO-protein ligase gene SIZ1 as a novel determinant of furfural tolerance in Saccharomyces cerevisiae

    OpenAIRE

    Xiao, Han; Zhao, Huimin

    2014-01-01

    Background Furfural is a major growth inhibitor in lignocellulosic hydrolysates and improving furfural tolerance of microorganisms is critical for rapid and efficient fermentation of lignocellulosic biomass. In this study, we used the RNAi-Assisted Genome Evolution (RAGE) method to select for furfural resistant mutants of Saccharomyces cerevisiae, and identified a new determinant of furfural tolerance. Results By using a genome-wide RNAi (RNA-interference) screen in S. cerevisiae for genes in...

  15. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Science.gov (United States)

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Amit Kumar Chaturvedi

    Full Text Available Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13 showed significantly enhanced salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

  17. The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

    Science.gov (United States)

    Chaturvedi, Amit Kumar; Patel, Manish Kumar; Mishra, Avinash; Tiwari, Vivekanand; Jha, Bhavanath

    2014-01-01

    Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13) showed significantly enhanced salt (NaCl), osmotic (PEG) and metals (Zn++, Cu++ and Cd++) tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl), osmotic (PEG) and metals (Zn++, Cu++ and Cd++) stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA) analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed) condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

  18. Characterization of the HMA7 gene and transcriptomic analysis of candidate genes for copper tolerance in two Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Baloun, J.; Nevrtalová, E.; Kováčová, V.; Hudzieczek, V.; Čegan, R.; Vyskot, B.; Hobza, Roman

    2014-01-01

    Roč. 171, č. 13 (2014), s. 1188-1196 ISSN 0176-1617 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:61389030 Keywords : Copper * Genes coding ROS-eliminating and Cu-transporting proteins * RNA-Seq database Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.557, year: 2014

  19. Two P5CS genes from common bean exhibiting different tolerance ...

    Indian Academy of Sciences (India)

    2013-12-04

    Dec 4, 2013 ... analyses demonstrated that the foreign genes were integrated into Arabidopsis chromosomal DNA and expressed. Single- ... osmotic stress, negatively impacting plant growth and crop ..... Transformed seeds could germinate and grow. ..... Savoure A. 2004 Transcriptional regulation of proline biosynthe-.

  20. Analysis of changes in hepatic gene expression in a murine model of tolerance to acetaminophen hepatotoxicity (autoprotection)

    International Nuclear Information System (INIS)

    O'Connor, Meeghan A.; Koza-Taylor, Petra; Campion, Sarah N.; Aleksunes, Lauren M.; Gu, Xinsheng; Enayetallah, Ahmed E.; Lawton, Michael P.; Manautou, José E.

    2014-01-01

    Pretreatment of mice with a low hepatotoxic dose of acetaminophen (APAP) results in resistance to a subsequent, higher dose of APAP. This mouse model, termed APAP autoprotection was used here to identify differentially expressed genes and cellular pathways that could contribute to this development of resistance to hepatotoxicity. Male C57BL/6J mice were pretreated with APAP (400 mg/kg) and then challenged 48 h later with 600 mg APAP/kg. Livers were obtained 4 or 24 h later and total hepatic RNA was isolated and hybridized to Affymetrix Mouse Genome MU430 2 GeneChip. Statistically significant genes were determined and gene expression changes were also interrogated using the Causal Reasoning Engine (CRE). Extensive literature review narrowed our focus to methionine adenosyl transferase-1 alpha (MAT1A), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), flavin-containing monooxygenase 3 (Fmo3) and galectin-3 (Lgals3). Down-regulation of MAT1A could lead to decreases in S-adenosylmethionine (SAMe), which is known to protect against APAP toxicity. Nrf2 activation is expected to play a role in protective adaptation. Up-regulation of Lgals3, one of the genes supporting the Nrf2 hypothesis, can lead to suppression of apoptosis and reduced mitochondrial dysfunction. Fmo3 induction suggests the involvement of an enzyme not known to metabolize APAP in the development of tolerance to APAP toxicity. Subsequent quantitative RT-PCR and immunochemical analysis confirmed the differential expression of some of these genes in the APAP autoprotection model. In conclusion, our genomics strategy identified cellular pathways that might further explain the molecular basis for APAP autoprotection. - Highlights: • Differential expression of genes in mice resistant to acetaminophen hepatotoxicity. • Increased gene expression of Flavin-containing monooxygenase 3 and Galectin-3. • Decrease in MAT1A expression and compensatory hepatocellular regeneration. • Two distinct gene expression

  1. Analysis of changes in hepatic gene expression in a murine model of tolerance to acetaminophen hepatotoxicity (autoprotection)

    Energy Technology Data Exchange (ETDEWEB)

    O' Connor, Meeghan A., E-mail: meeghan.oconnor@boehringer-ingelheim.com [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Boehringer Ingelheim Pharmaceuticals Inc., 900 Ridgebury Road, Ridgefield, CT 06877-0368 (United States); Koza-Taylor, Petra, E-mail: petra.h.koza-taylor@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Campion, Sarah N., E-mail: sarah.campion@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Aleksunes, Lauren M., E-mail: aleksunes@eohsi.rutgers.edu [Rutgers University, Department of Pharmacology and Toxicology, Environmental and Occupational Health Sciences Institute, Piscataway, NJ 08854 (United States); Gu, Xinsheng, E-mail: xinsheng.gu@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Enayetallah, Ahmed E., E-mail: ahmed.enayetallah@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Lawton, Michael P., E-mail: michael.lawton@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Manautou, José E., E-mail: jose.manautou@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States)

    2014-01-01

    Pretreatment of mice with a low hepatotoxic dose of acetaminophen (APAP) results in resistance to a subsequent, higher dose of APAP. This mouse model, termed APAP autoprotection was used here to identify differentially expressed genes and cellular pathways that could contribute to this development of resistance to hepatotoxicity. Male C57BL/6J mice were pretreated with APAP (400 mg/kg) and then challenged 48 h later with 600 mg APAP/kg. Livers were obtained 4 or 24 h later and total hepatic RNA was isolated and hybridized to Affymetrix Mouse Genome MU430{sub 2} GeneChip. Statistically significant genes were determined and gene expression changes were also interrogated using the Causal Reasoning Engine (CRE). Extensive literature review narrowed our focus to methionine adenosyl transferase-1 alpha (MAT1A), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), flavin-containing monooxygenase 3 (Fmo3) and galectin-3 (Lgals3). Down-regulation of MAT1A could lead to decreases in S-adenosylmethionine (SAMe), which is known to protect against APAP toxicity. Nrf2 activation is expected to play a role in protective adaptation. Up-regulation of Lgals3, one of the genes supporting the Nrf2 hypothesis, can lead to suppression of apoptosis and reduced mitochondrial dysfunction. Fmo3 induction suggests the involvement of an enzyme not known to metabolize APAP in the development of tolerance to APAP toxicity. Subsequent quantitative RT-PCR and immunochemical analysis confirmed the differential expression of some of these genes in the APAP autoprotection model. In conclusion, our genomics strategy identified cellular pathways that might further explain the molecular basis for APAP autoprotection. - Highlights: • Differential expression of genes in mice resistant to acetaminophen hepatotoxicity. • Increased gene expression of Flavin-containing monooxygenase 3 and Galectin-3. • Decrease in MAT1A expression and compensatory hepatocellular regeneration. • Two distinct gene

  2. An efficient and reproducible protocol for the production of salt tolerant transgenic wheat plants expressing the Arabidopsis AtNHX1 gene.

    Science.gov (United States)

    Moghaieb, Reda E A; Sharaf, Ahmed N; Soliman, Mohamed H; El-Arabi, Nagwa I; Momtaz, Osama A

    2014-01-01

    We present an efficient method for the production of transgenic salt tolerant hexaploid wheat plants expressing the Arabidopsis AtNHX1 gene. Wheat mature zygotic embryos were isolated from two hexaploid bread wheat (Triticum aestivum) cultivars (namely: Gemmeiza 9 and Gemmeiza 10) and were transformed with the A. tumefaciens LBA4404 harboring the pBI-121 vector containing the AtNHX1 gene. Transgenic wheat lines that express the gus intron was obtained and used as control. The results confirmed that npt-II gene could be transmitted and expressed in the T2 following 3:1 Mendelian segregation while the control plant couldn't. The data indicate that, the AtNHX1 gene was integrated in a stable manner into the wheat genome and the corresponding transcripts were expressed. The transformation efficiency was 5.7 and 7.5% for cultivars Gemmeiza 10 and Gemmeiza 9, respectively. A greenhouse experiment was conducted to investigate the effect of AtNHX1 gene in wheat salt tolerance. The transgenic wheat lines could maintain high growth rate under salt stress condition (350 mM NaCl) while the control plant couldn't. The results confirmed that Na(+)/H(+) antiporter gene AtNHX1 increased salt tolerance by increasing Na(+) accumulation and keeping K+/Na(+) balance. Thus, transgenic plants showed high tolerance to salt stress and can be considered as a new genetic resource in breeding programs.

  3. Rice Yellow Mottle Virus stress responsive genes from susceptible and tolerant rice genotypes

    Directory of Open Access Journals (Sweden)

    Siré Christelle

    2008-03-01

    Full Text Available Abstract Background The effects of viral infection involve concomitant plant gene variations and cellular changes. A simple system is required to assess the complexity of host responses to viral infection. The genome of the Rice yellow mottle virus (RYMV is a single-stranded RNA with a simple organisation. It is the most well-known monocotyledon virus model. Several studies on its biology, structure and phylogeography have provided a suitable background for further genetic studies. 12 rice chromosome sequences are now available and provide strong support for genomic studies, particularly physical mapping and gene identification. Results The present data, obtained through the cDNA-AFLP technique, demonstrate differential responses to RYMV of two different rice cultivars, i.e. susceptible IR64 (Oryza sativa indica, and partially resistant Azucena (O. s. japonica. This RNA profiling provides a new original dataset that will enable us to gain greater insight into the RYMV/rice interaction and the specificity of the host response. Using the SIM4 subroutine, we took the intron/exon structure of the gene into account and mapped 281 RYMV stress responsive (RSR transcripts on 12 rice chromosomes corresponding to 234 RSR genes. We also mapped previously identified deregulated proteins and genes involved in partial resistance and thus constructed the first global physical map of the RYMV/rice interaction. RSR transcripts on rice chromosomes 4 and 10 were found to be not randomly distributed. Seven genes were identified in the susceptible and partially resistant cultivars, and transcripts were colocalized for these seven genes in both cultivars. During virus infection, many concomitant plant gene expression changes may be associated with host changes caused by the infection process, general stress or defence responses. We noted that some genes (e.g. ABC transporters were regulated throughout the kinetics of infection and differentiated susceptible and

  4. Combining QTL mapping and transcriptome profiling of bulked RILs for identification of functional polymorphism for salt tolerance genes in rice (Oryza sativa L.).

    Science.gov (United States)

    Pandit, Awadhesh; Rai, Vandna; Bal, Subhashis; Sinha, Shikha; Kumar, Vinod; Chauhan, Mahesh; Gautam, Raj K; Singh, Rakesh; Sharma, Prakash C; Singh, Ashok K; Gaikwad, Kishor; Sharma, Tilak R; Mohapatra, Trilochan; Singh, Nagendra K

    2010-08-01

    Identification of genes for quantitative traits is difficult using any single approach due to complex inheritance of the traits and limited resolving power of the individual techniques. Here a combination of genetic mapping and bulked transcriptome profiling was used to narrow down the number of differentially expressed salt-responsive genes in rice in order to identify functional polymorphism of genes underlying the quantitative trait loci (QTL). A population of recombinant inbred lines (RILs) derived from cross between salt-tolerant variety CSR 27 and salt-sensitive variety MI 48 was used to map QTL for salt ion concentrations in different tissues and salt stress susceptibility index (SSI) for spikelet fertility, grain weight, and grain yield. Eight significant QTL intervals were mapped on chromosomes 1, 8, and 12 for the salt ion concentrations and a QTL controlling SSI for spikelet fertility was co-located in one of these intervals on chromosome 8. However, there were total 2,681 genes in these QTL intervals, making it difficult to pinpoint the genes responsible for the functional differences for the traits. Similarly, transcriptome profiling of the seedlings of tolerant and sensitive parents grown under control and salt-stress conditions showed 798 and 2,407 differentially expressed gene probes, respectively. By analyzing pools of RNA extracted from ten each of extremely tolerant and extremely sensitive RILs to normalize the background noise, the number of differentially expressed genes under salt stress was drastically reduced to 30 only. Two of these genes, an integral transmembrane protein DUF6 and a cation chloride cotransporter, were not only co-located in the QTL intervals but also showed the expected distortion of allele frequencies in the extreme tolerant and sensitive RILs, and therefore are suitable for future validation studies and development of functional markers for salt tolerance in rice to facilitate marker-assisted breeding.

  5. Gene flow from GM glyphosate-tolerant to conventional soybeans under field conditions in Japan.

    Science.gov (United States)

    Yoshimura, Yasuyuki; Matsuo, Kazuhito; Yasuda, Koji

    2006-01-01

    Natural out-crossing rates were evaluated for conventional soybeans (Glycine max (L.) Merr.) cultivated adjacent to genetically modified (GM) glyphosate-tolerant soybeans under field conditions during a four-year period in Japan. A total of 107 846 progeny of 2772 plants harvested from conventional varieties were screened for glyphosate herbicide tolerance. The highest out-crossing rates, 0.19% in 2001 and 0.16% in 2002, were observed in adjacent rows 0.7 m from the pollen source. The highest rate in 2004 was 0.052%, which was observed at 2.1 m. No out-crossing was observed in the rows 10.5 m from the pollen source over the four-year period. The farthest distances between receptor and pollen source at which out-crossing was observed were 7 m in 2001, 2.8 m in 2002, and 3.5 m in 2004. The greatest airborne pollen density during the flowering period, determined by Durham pollen samplers located between the rows of each variety, was 0.368 grains.cm(-2).day(-1), with the average value at 0.18 grains.cm(-2).day(-1), indicating that the possibility of out-crossing by wind is minimal. Thrips species and predatory Hemiptera visited the soybean flowers more frequently during the four-year period than any other common pollinators, such as bees.

  6. A bHLH gene from Tamarix hispida improves abiotic stress tolerance by enhancing osmotic potential and decreasing reactive oxygen species accumulation.

    Science.gov (United States)

    Ji, Xiaoyu; Nie, Xianguang; Liu, Yujia; Zheng, Lei; Zhao, Huimin; Zhang, Bing; Huo, Lin; Wang, Yucheng

    2016-02-01

    Basic helix-loop-helix (bHLH) leucine-zipper transcription factors play important roles in abiotic stress responses. However, their specific roles in abiotic stress tolerance are not fully known. Here, we functionally characterized a bHLH gene, ThbHLH1, from Tamarix hispida in abiotic stress tolerance. ThbHLH1 specifically binds to G-box motif with the sequence of 'CACGTG'. Transiently transfected T. hispida plantlets with transiently overexpressed ThbHLH1 and RNAi-silenced ThbHLH1 were generated for gain- and loss-of-function analysis. Transgenic Arabidopsis thaliana lines overexpressing ThbHLH1 were generated to confirm the gain- and loss-of-function analysis. Overexpression of ThbHLH1 significantly elevates glycine betaine and proline levels, increases Ca(2+) concentration and enhances peroxidase (POD) and superoxide dismutase (SOD) activities to decrease reactive oxygen species (ROS) accumulation. Additionally, ThbHLH1 regulates the expression of the genes including P5CS, BADH, CaM, POD and SOD, to activate the above physiological changes, and also induces the expression of stress tolerance-related genes LEAs and HSPs. These data suggest that ThbHLH1 induces the expression of stress tolerance-related genes to improve abiotic stress tolerance by increasing osmotic potential, improving ROS scavenging capability and enhancing second messenger in stress signaling cascades. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Characterization of the HMA7 gene and transcriptomic analysis of candidate genes for copper tolerance in two Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Baloun, Jiří; Nevrtalová, Eva; Kováčová, Viera; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Hobza, Roman

    2014-01-01

    Roč. 171, č. 13 (2014), s. 1188-1196 ISSN 0176-1617 R&D Projects: GA ČR(CZ) GBP501/12/G090; GA MŠk LO1204 Institutional support: RVO:68081707 Keywords : Copper * Genes coding ROS-eliminating and Cu-transporting proteins * RNA-Seq database Subject RIV: BO - Biophysics Impact factor: 2.557, year: 2014

  8. Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances

    Directory of Open Access Journals (Sweden)

    Xiatian eWang

    2015-08-01

    Full Text Available The WRKY transcription factors have been reported to be involved in various plant physiological and biochemical processes. In this study, we successfully assembled ten unigenes from expressed sequence tags (ESTs of wheat and designated them as TaWRKY44–TaWRKY53, respectively. Among these genes, a subgroup I gene, TaWRKY44, was found to be upregulated by treatments with PEG6000, NaCl, 4°C, abscisic acid (ABA, H2O2 and gibberellin (GA. The TaWRKY44-GFP fusion protein was localized to the nucleus of onion epidermal cells, and TaWRKY44 was able to bind to the core DNA sequences of TTGACC and TTAACC in yeast. The N-terminal of TaWRKY44 showed transcriptional activation activity. Expression of TaWRKY44 in tobacco plants conferred drought and salt tolerance and transgenic tobacco exhibited a higher survival rate, relative water content (RWC, soluble sugar, proline and superoxide dismutase (SOD content, as well as higher activities of catalase (CAT and peroxidase (POD, but less ion leakage (IL, lower contents of malondialdehyde (MDA, and H2O2. In addition, expression of TaWRKY44 also increased the seed germination rate in the transgenic lines under osmotic stress conditions while exhibiting a lower H2O2 content and higher SOD, CAT and POD activities. Expression of TaWRKY44 upregulated the expression of some reactive oxygen species (ROS-related genes and stress-responsive genes in tobacco under osmotic stresses. These data demonstrate that TaWRKY44 may act as a positive regulator in drought/salt/osmotic stress responses by either efficient ROS elimination through direct or indirect activation of the cellular antioxidant systems or activation of stress-associated gene expression.

  9. Functional Characterization of Waterlogging and Heat Stresses Tolerance Gene Pyruvate decarboxylase 2 from Actinidia deliciosa

    Directory of Open Access Journals (Sweden)

    Hui-Ting Luo

    2017-11-01

    Full Text Available A previous report showed that both Pyruvate decarboxylase (PDC genes were significantly upregulated in kiwifruit after waterlogging treatment using Illumina sequencing technology, and that the kiwifruit AdPDC1 gene was required during waterlogging, but might not be required during other environmental stresses. Here, the function of another PDC gene, named AdPDC2, was analyzed. The expression of the AdPDC2 gene was determined using qRT-PCR, and the results showed that the expression levels of AdPDC2 in the reproductive organs were much higher than those in the nutritive organs. Waterlogging, NaCl, and heat could induce the expression of AdPDC2. Overexpression of kiwifruit AdPDC2 in transgenic Arabidopsis enhanced resistance to waterlogging and heat stresses in five-week-old seedlings, but could not enhance resistance to NaCl and mannitol stresses at the seed germination stage and in early seedlings. These results suggested that the kiwifruit AdPDC2 gene may play an important role in waterlogging resistance and heat stresses in kiwifruit.

  10. ABI-like transcription factor gene TaABL1 from wheat improves multiple abiotic stress tolerances in transgenic plants.

    Science.gov (United States)

    Xu, Dong-Bei; Gao, Shi-Qing; Ma, You-Zhi; Xu, Zhao-Shi; Zhao, Chang-Ping; Tang, Yi-Miao; Li, Xue-Yin; Li, Lian-Cheng; Chen, Yao-Feng; Chen, Ming

    2014-12-01

    The phytohormone abscisic acid (ABA) plays crucial roles in adaptive responses of plants to abiotic stresses. ABA-responsive element binding proteins (AREBs) are basic leucine zipper transcription factors that regulate the expression of downstream genes containing ABA-responsive elements (ABREs) in promoter regions. A novel ABI-like (ABA-insensitive) transcription factor gene, named TaABL1, containing a conserved basic leucine zipper (bZIP) domain was cloned from wheat. Southern blotting showed that three copies were present in the wheat genome. Phylogenetic analyses indicated that TaABL1 belonged to the AREB subfamily of the bZIP transcription factor family and was most closely related to ZmABI5 in maize and OsAREB2 in rice. Expression of TaABL1 was highly induced in wheat roots, stems, and leaves by ABA, drought, high salt, and low temperature stresses. TaABL1 was localized inside the nuclei of transformed wheat mesophyll protoplast. Overexpression of TaABL1 enhanced responses of transgenic plants to ABA and hastened stomatal closure under stress, thereby improving tolerance to multiple abiotic stresses. Furthermore, overexpression of TaABL1 upregulated or downregulated the expression of some stress-related genes controlling stomatal closure in transgenic plants under ABA and drought stress conditions, suggesting that TaABL1 might be a valuable genetic resource for transgenic molecular breeding.

  11. Neurospora crassa tox-1 Gene Encodes a pH- and Temperature-Tolerant Mini-Cellulase.

    Science.gov (United States)

    Xiao, Yue; Zhang, Qiongsi; Luo, Yiquan; Zhang, Ying; Luo, Xi; Wang, Yuchuan; Cao, Weiguo; Pinto, Vito De; Liu, Qiuyun; Li, Gang

    2016-06-15

    Cellulases that endure extreme conditions are essential in various industrial sectors. This study reports a mini-cellulase gene tox-1 from Neurospora crassa. The gene tox-1 was cloned in Escherichia coli after chimerization with the YebF gene and substitutions of certain isoleucine and valine with leucine residues. The yeast transformants could grow on rice straw-agar medium. The 44-amino acid peptide and its two mutant variants displayed potent cellulase activities in Congo Red assay and enzymatic assays. Conservative replacements with leucine have substantially increased the stabilities and half-lives of the peptides at alkaline pH and low and high temperatures and also the tolerance to organic solvents and surfactants, on the basis of activities toward cellose. The small size of the mini-cellulase would allow for commercially viable automatic chemical peptide synthesis. This work suggests that conservative leucine replacements may serve as a general strategy in the engineering of more robust enzymes with special features with little loss of activities.

  12. An integrated and comparative approach towards identification, characterization and functional annotation of candidate genes for drought tolerance in sorghum (Sorghum bicolor (L.) Moench).

    Science.gov (United States)

    Woldesemayat, Adugna Abdi; Van Heusden, Peter; Ndimba, Bongani K; Christoffels, Alan

    2017-12-22

    Drought is the most disastrous abiotic stress that severely affects agricultural productivity worldwide. Understanding the biological basis of drought-regulated traits, requires identification and an in-depth characterization of genetic determinants using model organisms and high-throughput technologies. However, studies on drought tolerance have generally been limited to traditional candidate gene approach that targets only a single gene in a pathway that is related to a trait. In this study, we used sorghum, one of the model crops that is well adapted to arid regions, to mine genes and define determinants for drought tolerance using drought expression libraries and RNA-seq data. We provide an integrated and comparative in silico candidate gene identification, characterization and annotation approach, with an emphasis on genes playing a prominent role in conferring drought tolerance in sorghum. A total of 470 non-redundant functionally annotated drought responsive genes (DRGs) were identified using experimental data from drought responses by employing pairwise sequence similarity searches, pathway and interpro-domain analysis, expression profiling and orthology relation. Comparison of the genomic locations between these genes and sorghum quantitative trait loci (QTLs) showed that 40% of these genes were co-localized with QTLs known for drought tolerance. The genome reannotation conducted using the Program to Assemble Spliced Alignment (PASA), resulted in 9.6% of existing single gene models being updated. In addition, 210 putative novel genes were identified using AUGUSTUS and PASA based analysis on expression dataset. Among these, 50% were single exonic, 69.5% represented drought responsive and 5.7% were complete gene structure models. Analysis of biochemical metabolism revealed 14 metabolic pathways that are related to drought tolerance and also had a strong biological network, among categories of genes involved. Identification of these pathways, signifies the

  13. An R2R3-MYB gene, LeAN2, positively regulated the thermo-tolerance in transgenic tomato.

    Science.gov (United States)

    Meng, Xia; Wang, Jie-Ru; Wang, Guo-Dong; Liang, Xiao-Qing; Li, Xiao-Dong; Meng, Qing-Wei

    2015-03-01

    LeAN2 is an anthocyanin-associated R2R3-MYB transcription factor, but little is known about its function in imparting thermo-tolerance to higher plants. To examine the function of LeAN2 in the regulation of heat stress in tomato, LeAN2 was isolated and transgenic tomato plants were obtained. Overexpression of LeAN2 under the control of the CaMV35S promoter in tomato induced the up-regulation of several structural genes in the anthocyanin biosynthetic pathway as well as anthocyanin accumulation in transgenic tomato plants. Transgenic tomato plants showed enhanced tolerance to heat stress by maintaining higher fresh weight (FW), net photosynthetic rate (Pn) and maximal photochemical efficiency of photosystem II (PSII) (Fv/Fm) compared with wild-type (WT) plants. Furthermore, transgenic plants showed higher non-enzymatic antioxidant activity, lower levels of reactive oxygen species (ROS), and higher contents of D1 protein than that in WT plants under heat stress. These results indicate that LeAN2 had an important function in heat stress resistance. Copyright © 2014 Elsevier GmbH. All rights reserved.

  14. Overexpression of Arachis hypogaea AREB1 Gene Enhances Drought Tolerance by Modulating ROS Scavenging and Maintaining Endogenous ABA Content

    Directory of Open Access Journals (Sweden)

    Ling Li

    2013-06-01

    Full Text Available AhAREB1 (Arachis hypogaea Abscisic-acid Response Element Binding Protein 1 is a member of the basic domain leucine zipper (bZIP-type transcription factor in peanut. Previously, we found that expression of AhAREB1 was specifically induced by abscisic acid (ABA, dehydration and drought. To understand the drought defense mechanism regulated by AhAREB1, transgenic Arabidopsis overexpressing AhAREB1 was conducted in wild-type (WT, and a complementation experiment was employed to ABA non-sensitivity mutant abi5 (abscisic acid-insensitive 5. Constitutive expression of AhAREB1 confers water stress tolerance and is highly sensitive to exogenous ABA. Microarray and further real-time PCR analysis revealed that drought stress, reactive oxygen species (ROS scavenging, ABA synthesis/metabolism-related genes and others were regulated in transgenic Arabidopsis overexpressing AhAREB1. Accordingly, low level of ROS, but higher ABA content was detected in the transgenic Arabidopsis plants’ overexpression of AhAREB1. Taken together, it was concluded that AhAREB1 modulates ROS accumulation and endogenous ABA level to improve drought tolerance in transgenic Arabidopsis.

  15. A Rice Immunophilin Gene, OsFKBP16-3, Confers Tolerance to Environmental Stress in Arabidopsis and Rice

    Directory of Open Access Journals (Sweden)

    Jun Cheul Ahn

    2013-03-01

    Full Text Available The putative thylakoid lumen immunophilin, FKBP16-3, has not yet been characterized, although this protein is known to be regulated by thioredoxin and possesses a well-conserved CxxxC motif in photosynthetic organisms. Here, we characterized rice OsFKBP16-3 and examined the role of this gene in the regulation of abiotic stress in plants. FKBP16-3s are well conserved in eukaryotic photosynthetic organisms, including the presence of a unique disulfide-forming CxxxC motif in their N-terminal regions. OsFKBP16-3 was mainly expressed in rice leaf tissues and was upregulated by various abiotic stresses, including salt, drought, high light, hydrogen peroxide, heat and methyl viologen. The chloroplast localization of OsFKBP16-3-GFP was confirmed through the transient expression of OsFKBP16-3 in Nicotiana benthamiana leaves. Transgenic Arabidopsis and transgenic rice plants that constitutively expressed OsFKBP16-3 exhibited increased tolerance to salinity, drought and oxidative stresses, but showed no change in growth or phenotype, compared with vector control plants, when grown under non-stressed conditions. This is the first report to demonstrate the potential role of FKBP16-3 in the environmental stress response, which may be regulated by a redox relay process in the thylakoid lumen, suggesting that artificial regulation of FKBP16-3 expression is a candidate for stress-tolerant crop breeding.

  16. Characteristics of Three Thioredoxin Genes and Their Role in Chilling Tolerance of Harvested Banana Fruit.

    Science.gov (United States)

    Wu, Fuwang; Li, Qing; Yan, Huiling; Zhang, Dandan; Jiang, Guoxiang; Jiang, Yueming; Duan, Xuewu

    2016-09-09

    Thioredoxins (Trxs) are small proteins with a conserved redox active site WCGPC and are involved in a wide range of cellular redox processes. However, little information on the role of Trx in regulating low-temperature stress of harvested fruit is available. In this study, three full-length Trx cDNAs, designated MaTrx6, MaTrx9 and MaTrx12, were cloned from banana (Musa acuminata) fruit. Phylogenetic analysis and protein sequence alignments showed that MaTrx6 was grouped to h2 type with a typical active site of WCGPC, whereas MaTrx9 and MaTrx12 were assigned to atypical cys his-rich Trxs (ACHT) and h3 type with atypical active sites of GCAGC and WCSPC, respectively. Subcellular localization indicated that MaTrx6 and MaTrx12 were located in the plasma membrane and cytoplasm, respectively, whereas MaTrx9 showed a dual cytoplasmic and chloroplast localization. Application of ethylene induced chilling tolerance of harvested banana fruit, whereas 1-MCP, an inhibitor of ethylene perception, aggravated the development of chilling injury. RT-qPCR analysis showed that expression of MaTrx12 was up-regulated and down-regulated in ethylene- and 1-MCP-treated banana fruit at low temperature, respectively. Furthermore, heterologous expression of MaTrx12 in cytoplasmic Trx-deficient Saccharomyces cerevisiae strain increased the viability of the strain under H₂O₂. These results suggest that MaTrx12 plays an important role in the chilling tolerance of harvested banana fruit, possibly by regulating redox homeostasis.

  17. Overexpression of a tea flavanone 3-hydroxylase gene confers tolerance to salt stress and Alternaria solani in transgenic tobacco.

    Science.gov (United States)

    Mahajan, Monika; Yadav, Sudesh Kumar

    2014-08-01

    Flavan-3-ols are the major flavonoids present in tea (Camellia sinensis) leaves. These are known to have antioxidant and free radical scavenging properties in vitro. Flavanone 3-hydroxylase is considered to be an important enzyme of flavonoid pathway leading to accumulation of flavan-3-ols in tea. Expression analysis revealed the upregulation in transcript levels of C. sinensis flavanone 3-hydroxylase (CsF3H) encoding gene under salt stress. In this study, the biotechnological potential of CsF3H was evaluated by gene overexpression in tobacco (Nicotiana tabacum cv. Xanthi). Overexpression of CsF3H cDNA increased the content of flavan-3-ols in tobacco and conferred tolerance to salt stress and fungus Alternaria solani infection. Transgenic tobaccos were observed for increase in primary root length, number of lateral roots, chlorophyll content, antioxidant enzyme expression and their activities. Also, they showed lesser malondialdehyde content and electrolyte leakage compared to control tobacco plants. Further, transgenic plants produced higher degree of pectin methyl esterification via decreasing pectin methyl esterase (PME) activity in roots and leaves under unstressed and salt stressed conditions. The effect of flavan-3-ols on pectin methyl esterification under salt stressed conditions was further validated through in vitro experiments in which non-transgenic (wild) tobacco seedlings were exposed to salt stress in presence of flavan-3-ols, epicatechin and epigallocatechin. The in vitro exposed seedlings showed similar trend of increase in pectin methyl esterification through decreasing PME activity as observed in CsF3H transgenic lines. Taken together, overexpression of CsF3H provided tolerance to salt stress and fungus A. solani infection to transgenic tobacco through improved antioxidant system and enhanced pectin methyl esterification.

  18. Tolerance in Drosophila

    OpenAIRE

    Atkinson, Nigel S.

    2009-01-01

    The set of genes that underlie ethanol tolerance (inducible resistance) are likely to overlap with the set of genes responsible for ethanol addiction. Whereas addiction is difficult to recognize in simple model systems, behavioral tolerance is readily identifiable and can be induced in large populations of animals. Thus, tolerance lends itself to analysis in model systems with powerful genetics. Drosophila melanogaster has been used by a variety of laboratories for the identification of genes...

  19. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra.

    Directory of Open Access Journals (Sweden)

    Weidong Gao

    Full Text Available Late embryogenesis abundant (LEA genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA was transformed into Xiaohei poplar (Populussimonii × P. nigra via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR and ribonucleic acid (RNA gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11 showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  20. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra).

    Science.gov (United States)

    Gao, Weidong; Bai, Shuang; Li, Qingmei; Gao, Caiqiu; Liu, Guifeng; Li, Guangde; Tan, Feili

    2013-01-01

    Late embryogenesis abundant (LEA) genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA) was transformed into Xiaohei poplar (Populussimonii × P. nigra) via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR) and ribonucleic acid (RNA) gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA) content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11) showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  1. Trigo duro: tolerância à toxicidade de alumínio, manganês e ferro em soluções nutritivas Durum wheat: tolerance to aluminum, manganese and iron toxicities in nutrient solutions

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1995-01-01

    Full Text Available Avaliou-se o comportamento diferencial de 23 linhagens de trigo duro (Triticum durum L. em compraração com os seguintes cultivares de trigo (T. aestivum L.: IAC-24, BH-1146, Siete Cerros e IAC-60, quanto aos níveis de Al3+ (0;0,2;0,4; 0,6; 0,8 e 1,0 mg/L, de Mn2+ (0,11; 300; 600 c 1.200 mg/L e de Fe2+ (0,56; 5; 10 e 20 mg/L em solução nutritiva. Os cultivares de trigo Siete Cerros (sensível à toxicidade de Al3+, BH-1146, IAC-60 e IAC-24 (tolerantes à toxicidade de Al3+, exibiram crescimento das raízes na presença de 1 mg/L de Al3+, e todas as linhagens de trigo duro avaliadas foram totalmente sensíveis a 0,4 mg/L de Al3+, com paralisação irreversível do crescimento das raízes. O aumento das concentrações de Mn2+(0,11 a 1.200 mg/L e de Fe2+ (0,56 a 20 mg/L nas soluções causou uma redução significativa no comprimento das raízes dos genótipos em estudo. As linhagens de trigo duro I (Avetoro "S" x Anhinga "S" - Purcell "S"/D.67.2, 2 (Cando - Yavaros "S", 6 (Chen "S" e 8 (Carcomum "S" apresentaram-se muito tolerantes à toxicidade de Mn2+ em relação ao controle 'Siete Cerros'. O 'Siete Cerros' e as linhagens de trigo duro 1, 6, 12 (CI 14955 x Yavaros "S"- Gediz "S"/Tropic Bird, 16 e 21 (Swan "S" c 20 (Boyeros "S"/Cocorit-71/5/Crane/Ganso//Marte "S"/3/Tildillo "S"/4/ Memo "S" exibiram tolerância à presença de elevadas quantidades de Fe2+ nas soluções nutritivas.Twenty three durum wheat inbred lines were evaluated with four bread wheat cultivars (IAC-24, BH-1146, Siete Cerros and IAC-60 in three experiments, using nutrient solutions. In the first experiment, the following levels of Al3+ were used: 0; 0.2; 0.4; 0.6; 0.8 and 1.0 mg/L; in the second experiment, the following levels of Mn2+ were used: 0.11; 300; 600 and 1.200 mg/L; and in the third experiment, Fe2+ was used at: 0.56; 5; 10 and 1.200 mg/L. The wheat cultivars Siete Cerros (sensitive to Al3+ toxicity and BH-1146, IAC-24 and IAC-60 (tolerant to Al3+ toxicity

  2. Transgenic barley overexpressing a cytokinin dehydrogenase gene shows greater tolerance to drought stress

    Czech Academy of Sciences Publication Activity Database

    Pospíšilová, H.; Jiskrová, E.; Vojta, P.; Mrízová, K.; Kokáš, F.; Majeská Čudějková, M.; Bergougnoux, V.; Plíhal, O.; Klimešová, J.; Novák, Ondřej; Dzurová, L.; Frébort, I.; Galuszka, P.

    2016-01-01

    Roč. 33, č. 5 (2016), s. 692-705 ISSN 1871-6784 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : ROOT-GROWTH * OXIDASE/DEHYDROGENASE GENES * BETA-GLUCOSIDASE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.813, year: 2016

  3. Gene Expression Analysis of Copper Tolerance and Wood Decay in the Brown Rot Fungus Fibroporia radiculosa

    Science.gov (United States)

    J. D. Tang; L. A. Parker; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; D. D. Nicholas; S. V. Diehl

    2013-01-01

    High-throughput transcriptomics was used to identify Fibroporia radiculosa genes that were differentially regulated during colonization of wood treated with a copper-based preservative. The transcriptome was profiled at two time points while the fungus was growing on wood treated with micronized copper quat (MCQ). A total of 917 transcripts were...

  4. Saussurea involucrata SiDhn2 gene confers tolerance to drought stress in upland cotton

    International Nuclear Information System (INIS)

    Liu, B.; Zhu, J.; Mu, J.; Zhu, J.; Liang, Z.; Zhang, L.

    2017-01-01

    Severe water shortage has long been acknowledged as one major limiting factor for global cotton production, and cultivation of cotton varieties with strong drought resistance is of important economic and social significances. In this study, the Xinjiang upland cotton variety Xinluzao 42 was transformed with the SiDhn2 gene by optimized agrobacterium transformation system. The integration of SiDhn2 gene into cotton genome was confirmed by PCR and Southern blot hybridization, and the drought resistance of transgenic and corresponding receptor cotton plants and their physiological indexes under drought stress were detailedly analyzed. Multiple physiological and biochemical indexes including soluble sugar content, free proline content, chlorophyll content, relative water content, net photosynthetic rate, transpiration rate, intercellular CO/sub 2/ concentration in transgenic cotton expressing SiDhn2 gene under drought stress were significantly higher than those of receptor cotton. More importantly, the transgenic cotton plants exhibited remarkably decreased boll abscission rate and highly increased seed yield, indicating the significant role of SiDhn2 gene in cotton drought resistance and its great application potential in agricultural production. (author)

  5. The Drosophila melanogaster Muc68E Mucin Gene Influences Adult Size, Starvation Tolerance, and Cold Recovery.

    Science.gov (United States)

    Reis, Micael; Silva, Ana C; Vieira, Cristina P; Vieira, Jorge

    2016-07-07

    Mucins have been implicated in many different biological processes, such as protection from mechanical damage, microorganisms, and toxic molecules, as well as providing a luminal scaffold during development. Nevertheless, it is conceivable that mucins have the potential to modulate food absorption as well, and thus contribute to the definition of several important phenotypic traits. Here we show that the Drosophila melanogaster Muc68E gene is 40- to 60-million-yr old, and is present in Drosophila species of the subgenus Sophophora only. The central repeat region of this gene is fast evolving, and shows evidence for repeated expansions/contractions. This and/or frequent gene conversion events lead to the homogenization of its repeats. The amino acid pattern P[ED][ED][ST][ST][ST] is found in the repeat region of Muc68E proteins from all Drosophila species studied, and can occur multiple times within a single conserved repeat block, and thus may have functional significance. Muc68E is a nonessential gene under laboratory conditions, but Muc68E mutant flies are smaller and lighter than controls at birth. However, at 4 d of age, Muc68E mutants are heavier, recover faster from chill-coma, and are more resistant to starvation than control flies, although they have the same percentage of lipids as controls. Mutant flies have enlarged abdominal size 1 d after chill-coma recovery, which is associated with higher lipid content. These results suggest that Muc68E has a role in metabolism modulation, food absorption, and/or feeding patterns in larvae and adults, and under normal and stress conditions. Such biological function is novel for mucin genes. Copyright © 2016 Reis et al.

  6. Expression of three sHSP genes involved in heat pretreatment-induced chilling tolerance in banana fruit.

    Science.gov (United States)

    He, Li-hong; Chen, Jian-ye; Kuang, Jian-fei; Lu, Wang-jin

    2012-07-01

    Banana fruit is highly susceptible to chilling injury. In previous research it was shown that heat pretreatment of banana fruit at 38 °C for 3 days before storage at a chilling temperature of 8 °C for 12 days prevented increases in visible chilling injury index, electrolyte leakage and malondialdehyde content and also decreases in lightness and chroma, indicating that heat pretreatment could effectively alleviate chilling injury of banana fruit. However, little is known about the role of small heat shock proteins (sHSPs) in postharvest chilling tolerance of banana fruit. In the present study, three cytosolic sHSP expression profiles in peel and pulp tissues of banana fruit during heat pretreatment and subsequent chilled storage (8 °C) were investigated in relation to heat pretreatment-induced chilling tolerance. Three full-length cDNAs of cytosolic sHSP genes, including two class I sHSP (CI sHSP) and one class II sHSP (CII sHSP) cDNAs, named Ma-CI sHSP1, Ma-CI sHSP2 and Ma-CII sHSP3 respectively, were isolated and characterised from harvested banana fruit. Accumulation of Ma-CI sHSP1 mRNA transcripts in peel and pulp tissues and Ma-CII sHSP3 mRNA transcripts in peel tissue increased during heat pretreatment. Expression of all three Ma-sHSP genes in peel and pulp tissues was induced during subsequent chilled storage. Furthermore, Ma-CI sHSP1 and Ma-CII sHSP3 mRNA transcripts in pulp tissue and Ma-CI sHSP2 mRNA transcripts in peel and pulp tissues were obviously enhanced by heat pretreatment at days 6 and 9 of subsequent chilled storage. These results suggested that heat pretreatment enhanced the expression of Ma-sHSPs, which might be involved in heat pretreatment-induced chilling tolerance of banana fruit. Copyright © 2012 Society of Chemical Industry.

  7. An InDel in the Promoter of Al-ACTIVATED MALATE TRANSPORTER9 Selected during Tomato Domestication Determines Fruit Malate Contents and Aluminum Tolerance[OPEN

    Science.gov (United States)

    Wang, Xin; Hu, Tixu; Zhang, Fengxia; Wang, Bing; Li, Changxin; Yang, Tianxia; Li, Hanxia; Lu, Yongen; Ye, Zhibiao

    2017-01-01

    Deciphering the mechanism of malate accumulation in plants would contribute to a greater understanding of plant chemistry, which has implications for improving flavor quality in crop species and enhancing human health benefits. However, the regulation of malate metabolism is poorly understood in crops such as tomato (Solanum lycopersicum). Here, we integrated a metabolite-based genome-wide association study with linkage mapping and gene functional studies to characterize the genetics of malate accumulation in a global collection of tomato accessions with broad genetic diversity. We report that TFM6 (tomato fruit malate 6), which corresponds to Al-ACTIVATED MALATE TRANSPORTER9 (Sl-ALMT9 in tomato), is the major quantitative trait locus responsible for variation in fruit malate accumulation among tomato genotypes. A 3-bp indel in the promoter region of Sl-ALMT9 was linked to high fruit malate content. Further analysis indicated that this indel disrupts a W-box binding site in the Sl-ALMT9 promoter, which prevents binding of the WRKY transcription repressor Sl-WRKY42, thereby alleviating the repression of Sl-ALMT9 expression and promoting high fruit malate accumulation. Evolutionary analysis revealed that this highly expressed Sl-ALMT9 allele was selected for during tomato domestication. Furthermore, vacuole membrane-localized Sl-ALMT9 increases in abundance following Al treatment, thereby elevating malate transport and enhancing Al resistance. PMID:28814642

  8. Gut: An underestimated target organ for Aluminum.

    Science.gov (United States)

    Vignal, C; Desreumaux, P; Body-Malapel, M

    2016-06-01

    Since World War II, several factors such as an impressive industrial growth, an enhanced environmental bioavailability and intensified food consumption have contributed to a significant amplification of human exposure to aluminum. Aluminum is particularly present in food, beverages, some drugs and airbone dust. In our food, aluminum is superimposed via additives and cooking utensils. Therefore, the tolerable intake of aluminum is exceeded for a significant part of the world population, especially in children who are more vulnerable to toxic effects of pollutants than adults. Faced with this oral aluminum influx, intestinal tract is an essential barrier, especially as 38% of ingested aluminum accumulates at the intestinal mucosa. Although still poorly documented to date, the impact of oral exposure to aluminum in conditions relevant to real human exposure appears to be deleterious for gut homeostasis. Aluminum ingestion affects the regulation of the permeability, the microflora and the immune function of intestine. Nowadays, several arguments are consistent with an involvement of aluminum as an environmental risk factor for inflammatory bowel diseases. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  9. Metagenomic Profiling of Soil Microbes to Mine Salt Stress Tolerance Genes

    Directory of Open Access Journals (Sweden)

    Vasim Ahmed

    2018-02-01

    Full Text Available Osmotolerance is one of the critical factors for successful survival and colonization of microbes in saline environments. Nonetheless, information about these osmotolerance mechanisms is still inadequate. Exploration of the saline soil microbiome for its community structure and novel genetic elements is likely to provide information on the mechanisms involved in osmoadaptation. The present study explores the saline soil microbiome for its native structure and novel genetic elements involved in osmoadaptation. 16S rRNA gene sequence analysis has indicated the dominance of halophilic/halotolerant phylotypes affiliated to Proteobacteria, Actinobacteria, Gemmatimonadetes, Bacteroidetes, Firmicutes, and Acidobacteria. A functional metagenomics approach led to the identification of osmotolerant clones SSR1, SSR4, SSR6, SSR2 harboring BCAA_ABCtp, GSDH, STK_Pknb, and duf3445 genes. Furthermore, transposon mutagenesis, genetic, physiological and functional studies in close association has confirmed the role of these genes in osmotolerance. Enhancement in host osmotolerance possibly though the cytosolic accumulation of amino acids, reducing equivalents and osmolytes involving BCAA-ABCtp, GSDH, and STKc_PknB. Decoding of the genetic elements prevalent within these microbes can be exploited either as such for ameliorating soils or their genetically modified forms can assist crops to resist and survive in saline environment.

  10. Cross-species multiple environmental stress responses: An integrated approach to identify candidate genes for multiple stress tolerance in sorghum (Sorghum bicolor (L. Moench and related model species.

    Directory of Open Access Journals (Sweden)

    Adugna Abdi Woldesemayat

    Full Text Available Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations.In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO, Trait Ontology (TO, Plant Ontology (PO, Growth Ontology (GRO and Environment Ontology (EO were used to semantically integrate drought related information.Target genes linked to Quantitative Trait Loci (QTLs controlling yield and stress tolerance in sorghum (Sorghum bicolor (L. Moench and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%, salt (32%, cold (20%, heat (8% and oxidative stress (25% were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs

  11. Knock-out of Arabidopsis AtNHX4 gene enhances tolerance to salt stress

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hong-Tao; Liu, Hua; Gao, Xiao-Shu [Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032 (China); Zhang, Hongxia, E-mail: hxzhang@sippe.ac.cn [Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032 (China)

    2009-05-08

    AtNHX4 belongs to the monovalent cation:proton antiporter-1 (CPA1) family in Arabidopsis. Several members of this family have been shown to be critical for plant responses to abiotic stress, but little is known on the biological functions of AtNHX4. Here, we provide the evidence that AtNHX4 plays important roles in Arabidopsis responses to salt stress. Expression of AtNHX4 was responsive to salt stress and abscisic acid. Experiments with CFP-AtNHX4 fusion protein indicated that AtNHX4 is vacuolar localized. The nhx4 mutant showed enhanced tolerance to salt stress, and lower Na{sup +} content under high NaCl stress compared with wild-type plants. Furthermore, heterologous expression of AtNHX4 in Escherichia coli BL21 rendered the transformants hypersensitive to NaCl. Deletion of the hydrophilic C-terminus of AtNHX4 dramatically increased the hypersensitivity of transformants, indicating that AtNHX4 may function in Na{sup +} homeostasis in plant cell, and its C-terminus plays a role in regulating the AtNHX4 activity.

  12. Knock-out of Arabidopsis AtNHX4 gene enhances tolerance to salt stress

    International Nuclear Information System (INIS)

    Li, Hong-Tao; Liu, Hua; Gao, Xiao-Shu; Zhang, Hongxia

    2009-01-01

    AtNHX4 belongs to the monovalent cation:proton antiporter-1 (CPA1) family in Arabidopsis. Several members of this family have been shown to be critical for plant responses to abiotic stress, but little is known on the biological functions of AtNHX4. Here, we provide the evidence that AtNHX4 plays important roles in Arabidopsis responses to salt stress. Expression of AtNHX4 was responsive to salt stress and abscisic acid. Experiments with CFP-AtNHX4 fusion protein indicated that AtNHX4 is vacuolar localized. The nhx4 mutant showed enhanced tolerance to salt stress, and lower Na + content under high NaCl stress compared with wild-type plants. Furthermore, heterologous expression of AtNHX4 in Escherichia coli BL21 rendered the transformants hypersensitive to NaCl. Deletion of the hydrophilic C-terminus of AtNHX4 dramatically increased the hypersensitivity of transformants, indicating that AtNHX4 may function in Na + homeostasis in plant cell, and its C-terminus plays a role in regulating the AtNHX4 activity.

  13. CmWRKY1 Enhances the Dehydration Tolerance of Chrysanthemum through the Regulation of ABA-Associated Genes.

    Directory of Open Access Journals (Sweden)

    Qingqing Fan

    Full Text Available WRKY transcription factors serve as antagonistic or synergistic regulators in a variety of abiotic stress responses in plants. Here, we show that CmWRKY1, a member of the group IIb WRKY family isolated from Chrysanthemum morifolium, exhibits no transcriptional activation in yeast cells. The subcellular localization examination showed that CmWRKY1 localizes to the nucleus in vivo. Furthermore, CmWRKY1-overexpressing transgenic lines exhibit enhanced dehydration tolerance in response to polyethylene glycol (PEG treatment compared with wild-type plants. We further confirmed that the transgenic plants exhibit suppressed expression levels of genes negatively regulated by ABA, such as PP2C, ABI1 and ABI2, and activated expression levels of genes positively regulated by ABA, such as PYL2, SnRK2.2, ABF4, MYB2, RAB18, and DREB1A. Taken together, our results indicate that CmWRKY1 plays an important role in the response to drought in chrysanthemum through an ABA-mediated pathway.

  14. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  15. Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae.

    Science.gov (United States)

    Endo, Ayako; Nakamura, Toshihide; Ando, Akira; Tokuyasu, Ken; Shima, Jun

    2008-04-15

    Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

  16. Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Tokuyasu Ken

    2008-04-01

    Full Text Available Abstract Background Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Results Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Conclusion Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

  17. Transgenic petunia with the iron(III)-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments.

    Science.gov (United States)

    Murata, Yoshiko; Itoh, Yoshiyuki; Iwashita, Takashi; Namba, Kosuke

    2015-01-01

    Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III) to iron(II) and the uptake of iron(II) by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III). Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III)-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III)-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III)-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III) complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III)-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems to diverse

  18. Transgenic petunia with the iron(III-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments.

    Directory of Open Access Journals (Sweden)

    Yoshiko Murata

    Full Text Available Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III to iron(II and the uptake of iron(II by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III. Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems

  19. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    International Nuclear Information System (INIS)

    Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng

    2016-01-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  20. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhenyu, E-mail: wzy72609@163.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhao, Xiuyang, E-mail: xiuzh@psb.vib-ugent.be [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Wang, Bing, E-mail: wangbing@ibcas.ac.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Liu, Erlong, E-mail: liuel14@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Chen, Ni, E-mail: 63710156@qq.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhang, Wei, E-mail: wzhang1216@yahoo.com [Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444 (China); Liu, Heng, E-mail: hengliu@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China)

    2016-04-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  1. The barley MATE gene, HvAACT1, increases citrate efflux and Al3+ tolerance when expressed in wheat and barley

    Science.gov (United States)

    Zhou, Gaofeng; Delhaize, Emmanuel; Zhou, Meixue; Ryan, Peter R.

    2013-01-01

    Background and Aims Aluminium is toxic in acid soils because the soluble Al3+ inhibits root growth. A mechanism of Al3+ tolerance discovered in many plant species involves the release of organic anions from root apices. The Al3+-activated release of citrate from the root apices of Al3+-tolerant genotypes of barley is controlled by a MATE gene named HvAACT1 that encodes a citrate transport protein located on the plasma membrane. The aim of this study was to investigate whether expressing HvAACT1 with a constitutive promoter in barley and wheat can increase citrate efflux and Al3+ tolerance of these important cereal species. Methods HvAACT1 was over-expressed in wheat (Triticum aestivum) and barley (Hordeum vulgare) using the maize ubiquitin promoter. Root apices of transgenic and control lines were analysed for HvAACT1 expression and organic acid efflux. The Al3+ tolerance of transgenic and control lines was assessed in both hydroponic solution and acid soil. Key Results and Conclusions Increased HvAACT1 expression in both cereal species was associated with increased citrate efflux from root apices and enhanced Al3+ tolerance, thus demonstrating that biotechnology can complement traditional breeding practices to increase the Al3+ tolerance of important crop plants. PMID:23798600

  2. Chrysanthemum WRKY gene DgWRKY5 enhances tolerance to salt stress in transgenic chrysanthemum.

    Science.gov (United States)

    Liang, Qian-Yu; Wu, Yin-Huan; Wang, Ke; Bai, Zhen-Yu; Liu, Qing-Lin; Pan, Yuan-Zhi; Zhang, Lei; Jiang, Bei-Bei

    2017-07-06

    WRKY transcription factors play important roles in plant growth development, resistance and substance metabolism regulation. However, the exact function of the response to salt stress in plants with specific WRKY transcription factors remains unclear. In this research, we isolated a new WRKY transcription factor DgWRKY5 from chrysanthemum. DgWRKY5 contains two WRKY domains of WKKYGQK and two C 2 H 2 zinc fingers. The expression of DgWRKY5 in chrysanthemum was up-regulated under various treatments. Meanwhile, we observed higher expression levels in the leaves contrasted with other tissues. Under salt stress, the activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) enzymes in transgenic chrysanthemum were significantly higher than those in WT, whereas the accumulation of H 2 O 2 , O 2 - and malondialdehyde (MDA) was reduced in transgenic chrysanthemum. Several parameters including root length, root length, fresh weight, chlorophyll content and leaf gas exchange parameters in transgenic chrysanthemum were much better compared with WT under salt stress. Moreover, the expression of stress-related genes DgAPX, DgCAT, DgNCED3A, DgNCED3B, DgCuZnSOD, DgP5CS, DgCSD1 and DgCSD2 was up-regulated in DgWRKY5 transgenic chrysanthemum compared with that in WT. These results suggested that DgWRKY5 could function as a positive regulator of salt stress in chrysanthemum.

  3. Identification of stress-induced genes from the drought-tolerant plant Prosopis juliflora (Swartz) DC. through analysis of expressed sequence tags.

    Science.gov (United States)

    George, Suja; Venkataraman, Gayatri; Parida, Ajay

    2007-05-01

    Abiotic stresses such as cold, salinity, drought, wounding, and heavy metal contamination adversely affect crop productivity throughout the world. Prosopis juliflora is a phreatophyte that can tolerate severe adverse environmental conditions such as drought, salinity, and heavy metal contamination. As a first step towards the characterization of genes that contribute to combating abiotic stress, construction and analysis of a cDNA library of P. juliflora genes is reported here. Random expressed sequence tag (EST) sequencing of 1750 clones produced 1467 high-quality reads. These clones were classified into functional categories, and BLAST comparisons revealed that 114 clones were homologous to genes implicated in stress response(s) and included heat shock proteins, metallothioneins, lipid transfer proteins, and late embryogenesis abundant proteins. Of the ESTs analyzed, 26% showed homology to previously uncharacterized genes in the databases. Fifty-two clones from this category were selected for reverse Northern analysis: 21 were shown to be upregulated and 16 downregulated. The results obtained by reverse Northern analysis were confirmed by Northern analysis. Clustering of the 1467 ESTs produced a total of 295 contigs encompassing 790 ESTs, resulting in a 54.2% redundancy. Two of the abundant genes coding for a nonspecific lipid transfer protein and late embryogenesis abundant protein were sequenced completely. Northern analysis (after polyethylene glycol stress) of the 2 genes was carried out. The implications of the analyzed genes in abiotic stress tolerance are also discussed.

  4. Gene cloning and enzymatic characterization of an alkali-tolerant endo-1,4-β-mannanase from Rhizomucor miehei.

    Science.gov (United States)

    Katrolia, Priti; Yan, Qiaojuan; Zhang, Pan; Zhou, Peng; Yang, Shaoqing; Jiang, Zhengqiang

    2013-01-16

    An endo-1,4-β-mannanase gene (RmMan5A) was cloned from the thermophilic fungus Rhizomucor miehei for the first time and expressed in Escherichia coli . The gene had an open reading frame of 1330 bp encoding 378 amino acids and contained four introns. It displayed the highest amino acid sequence identity (42%) with the endo-1,4-β-mannanases from glycoside hydrolase family 5. The purified enzyme was a monomer of 43 kDa. RmMan5A displayed maximum activity at 55 °C and an optimal pH of 7.0. It was thermostable up to 55 °C and alkali-tolerant, displaying excellent stability over a broad pH range of 4.0-10.0, when incubated for 30 min without substrate. The enzyme displayed the highest specificity for locust bean gum (K(m) = 3.78 mg mL⁻¹), followed by guar gum (K(m) = 7.75 mg mL⁻¹) and konjac powder (K(m) = 22.7 mg mL⁻¹). RmMan5A hydrolyzed locust bean gum and konjac powder yielding mannobiose, mannotriose, and a mixture of various mannose-linked oligosaccharides. It was confirmed to be a true endo-acting β-1,4-mannanase, which showed requirement of four mannose residues for hydrolysis, and was also capable of catalyzing transglycosylation reactions. These properties make RmMan5A highly useful in the food/feed, paper and pulp, and detergent industries.

  5. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

    Directory of Open Access Journals (Sweden)

    Bingying Han

    2016-07-01

    Full Text Available Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD. Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis. All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g−1 fresh weight (FW, and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3–5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS, 10 trehalose-6-phosphate phosphatases (TPP, and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1–4 that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1 in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose

  6. Overexpression of a PLDα1 gene from Setaria italica enhances the sensitivity of Arabidopsis to abscisic acid and improves its drought tolerance.

    Science.gov (United States)

    Peng, Yunling; Zhang, Jinpeng; Cao, Gaoyi; Xie, Yuanhong; Liu, Xihui; Lu, Minhui; Wang, Guoying

    2010-07-01

    Phospholipase D (PLD) plays an important role in various physiological processes in plants, including drought tolerance. Here, we report the cloning and characterization of the full-length cDNA of PLDalpha1 from foxtail millet, which is a cereal crop with high water use efficiency. The expression pattern of the SiPLDalpha1 gene in foxtail millet revealed that it is up-regulated under dehydration, ABA and NaCl treatments. Heterologous overexpression of SiPLDalpha1 in Arabidopsis can significantly enhance their sensitivity to ABA, NaCl and mannitol during post-germination growth. Under water deprivation, overexpression of SiPLDalpha1 in Arabidopsis resulted in significantly enhanced tolerance to drought stress, displaying higher biomass and RWC, lower ion leakage and higher survival percentages than the wild type. Further analysis indicated that transgenic plants showed increased transcription of the stress-related genes, RD29A, RD29B, RAB18 and RD22, and the ABA-related genes, ABI1 and NCED3 under dehydration conditions. These results demonstrate that SiPLDalpha1 is involved in plant stress signal transduction, especially in the ABA signaling pathway. Moreover, no obvious adverse effects on growth and development in the 35S::SiPLDalpha1 transgenic plants implied that SiPLDalpha1 is a good candidate gene for improving crop drought tolerance.

  7. Arabidopsis AtbHLH112 regulates the expression of genes involved in abiotic stress tolerance by binding to their E-box and GCG-box motifs.

    Science.gov (United States)

    Liu, Yujia; Ji, Xiaoyu; Nie, Xianguang; Qu, Min; Zheng, Lei; Tan, Zilong; Zhao, Huimin; Huo, Lin; Liu, Shengnan; Zhang, Bing; Wang, Yucheng

    2015-08-01

    Plant basic helix-loop-helix (bHLH) transcription factors play essential roles in abiotic stress tolerance. However, most bHLHs have not been functionally characterized. Here, we characterized the functional role of a bHLH transcription factor from Arabidopsis, AtbHLH112, in response to abiotic stress. AtbHLH112 is a nuclear-localized protein, and its nuclear localization is induced by salt, drought and abscisic acid (ABA). In addition, AtbHLH112 serves as a transcriptional activator, with the activation domain located at its N-terminus. In addition to binding to the E-box motifs of stress-responsive genes, AtbHLH112 binds to a novel motif with the sequence 'GG[GT]CC[GT][GA][TA]C' (GCG-box). Gain- and loss-of-function analyses showed that the transcript level of AtbHLH112 is positively correlated with salt and drought tolerance. AtbHLH112 mediates stress tolerance by increasing the expression of P5CS genes and reducing the expression of P5CDH and ProDH genes to increase proline levels. AtbHLH112 also increases the expression of POD and SOD genes to improve reactive oxygen species (ROS) scavenging ability. We present a model suggesting that AtbHLH112 is a transcriptional activator that regulates the expression of genes via binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  8. The association of SNPs in Hsp90β gene 5' flanking region with thermo tolerance traits and tissue mRNA expression in two chicken breeds.

    Science.gov (United States)

    Chen, Zhuo-Yu; Gan, Jian-Kang; Xiao, Xiong; Jiang, Li-Yan; Zhang, Xi-Quan; Luo, Qing-Bin

    2013-09-01

    Thermo stress induces heat shock proteins (HSPs) expression and HSP90 family is one of them that has been reported to involve in cellular protection against heat stress. But whether there is any association of genetic variation in the Hsp90β gene in chicken with thermo tolerance is still unknown. Direct sequencing was used to detect possible SNPs in Hsp90β gene 5' flanking region in 3 chicken breeds (n = 663). Six mutations, among which 2 SNPs were chosen and genotypes were analyzed with PCR-RFLP method, were found in Hsp90β gene in these 3 chicken breeds. Association analysis indicated that SNP of C.-141G>A in the 5' flanking region of the Hsp90β gene in chicken had some effect on thermo tolerance traits, which may be a potential molecular marker of thermo tolerance, and the genotype GG was the thermo tolerance genotype. Hsp90β gene mRNA expression in different tissues detected by quantitative real-time PCR assay were demonstrated to be tissue dependent, implying that different tissues have distinct sensibilities to thermo stress. Besides, it was shown time specific and varieties differences. The expression of Hsp90β mRNA in Lingshan chickens in some tissues including heart, liver, brain and spleen were significantly higher or lower than that of White Recessive Rock (WRR). In this study, we presume that these mutations could be used in marker assisted selection for anti-heat stress chickens in our breeding program, and WRR were vulnerable to tropical thermo stress whereas Lingshan chickens were well adapted.

  9. Estabelecimento de critérios para selecionar porta-enxertos de macieira tolerantes ao alumínio em solução nutritiva Establishment of criteria to select apple tree rootstocks tolerant to the aluminum in nutritious solution

    Directory of Open Access Journals (Sweden)

    Elaine Cristina Stolf

    2008-06-01

    Full Text Available Dentre todas as fruteiras de clima temperado, a macieira é a que mais atenção tem recebido no sentido de se obterem porta-enxertos com características de boa adaptação, resistência ou sanidade. O desenvolvimento de um método eficiente para caracterizar genótipos com tolerância ao alumínio é o primeiro passo para a realização de estudos de mecanismos genéticos envolvidos na herança desse caráter. Assim, o presente trabalho teve por objetivo avaliar a tolerância ao alumínio dos porta-enxertos de macieira M.9 e Marubakaido em cinco concentrações (0; 50;150; 250 e 350 µM L-1 em solução nutritiva. As estacas de Marubakaido, na concentração intermediária de alumínio apresentaram menor crescimento radicular e aéreo. O M.9 mostrou menor crescimento radicular nas concentrações de 250 e 350 mM de alumínio. As características de crescimento avaliadas permitiram discriminar o porta-enxerto Marubakaido como mais tolerante que o M.9, e a concentração de 350 µM L-1 é a mais eficiente para a discriminação da tolerância ao alumínio aos 15 dias de cultivo em solução nutritiva.Among all of the temperate fruit trees, the apple tree is the one that has attracted more attention when it comes to obtaining rootstocks with characteristics of good adaptation, resistance or sanity. The development of an efficient method to characterize genotypes with tolerance to the aluminum is the first step for the accomplishment of genetic mechanisms studies involved in the inheritance of this character. Thus, the present work aimed to evaluate the tolerance to aluminum of the apple tree rootstocks M.9 and Marubakaido in five concentrations (0, 50, 150, 250 and 350 µM L-1 in nutritious solution. The cuttings of Marubakaido, in the intermediate concentration of aluminum presented smaller root and aerial growth. M.9 showed smaller root growth in the concentrations of 250 and 350 µM of aluminum. The evaluated growth characteristics permitted

  10. Ectopic expression of wheat expansin gene TaEXPA2 improved the salt tolerance of transgenic tobacco by regulating Na+ /K+ and antioxidant competence.

    Science.gov (United States)

    Chen, Yanhui; Han, Yangyang; Kong, Xiangzhu; Kang, Hanhan; Ren, Yuanqing; Wang, Wei

    2017-02-01

    High salinity is one of the most serious environmental stresses that limit crop growth. Expansins are cell wall proteins that regulate plant development and abiotic stress tolerance by mediating cell wall expansion. We studied the function of a wheat expansin gene, TaEXPA2, in salt stress tolerance by overexpressing it in tobacco. Overexpression of TaEXPA2 enhanced the salt stress tolerance of transgenic tobacco plants as indicated by the presence of higher germination rates, longer root length, more lateral roots, higher survival rates and more green leaves under salt stress than in the wild type (WT). Further, when leaf disks of WT plants were incubated in cell wall protein extracts from the transgenic tobacco plants, their chlorophyll content was higher under salt stress, and this improvement from TaEXPA2 overexpression in transgenic tobacco was inhibited by TaEXPA2 protein antibody. The water status of transgenic tobacco plants was improved, perhaps by the accumulation of osmolytes such as proline and soluble sugar. TaEXPA2-overexpressing tobacco lines exhibited lower Na + but higher K + accumulation than WT plants. Antioxidant competence increased in the transgenic plants because of the increased activity of antioxidant enzymes. TaEXPA2 protein abundance in wheat was induced by NaCl, and ABA signaling was involved. Gene expression regulation was involved in the enhanced salt stress tolerance of the TaEXPA2 transgenic plants. Our results suggest that TaEXPA2 overexpression confers salt stress tolerance on the transgenic plants, and this is associated with improved water status, Na + /K + homeostasis, and antioxidant competence. ABA signaling participates in TaEXPA2-regulated salt stress tolerance. © 2016 Scandinavian Plant Physiology Society.

  11. Induction of Immune Tolerance to Foreign Protein via Adeno-Associated Viral Vector Gene Transfer in Mid-Gestation Fetal Sheep

    Science.gov (United States)

    Davey, Marcus G.; Riley, John S.; Andrews, Abigail; Tyminski, Alec; Limberis, Maria; Pogoriler, Jennifer E.; Partridge, Emily; Olive, Aliza; Hedrick, Holly L.; Flake, Alan W.; Peranteau, William H.

    2017-01-01

    A major limitation to adeno-associated virus (AAV) gene therapy is the generation of host immune responses to viral vector antigens and the transgene product. The ability to induce immune tolerance to foreign protein has the potential to overcome this host immunity. Acquisition and maintenance of tolerance to viral vector antigens and transgene products may also permit repeat administration thereby enhancing therapeutic efficacy. In utero gene transfer (IUGT) takes advantage of the immunologic immaturity of the fetus to induce immune tolerance to foreign antigens. In this large animal study, in utero administration of AAV6.2, AAV8 and AAV9 expressing green fluorescent protein (GFP) to ~60 day fetal sheep (term: ~150 days) was performed. Transgene expression and postnatal immune tolerance to GFP and viral antigens were assessed. We demonstrate 1) hepatic expression of GFP 1 month following in utero administration of AAV6.2.GFP and AAV8.GFP, 2) in utero recipients of either AAV6.2.GFP or AAV8.GFP fail to mount an anti-GFP antibody response following postnatal GFP challenge and lack inflammatory cellular infiltrates at the intramuscular site of immunization, 3) a serotype specific anti-AAV neutralizing antibody response is elicited following postnatal challenge of in utero recipients of AAV6.2 or AAV8 with the corresponding AAV serotype, and 4) durable hepatic GFP expression was observed up to 6 months after birth in recipients of AAV8.GFP but expression was lost between 1 and 6 months of age in recipients of AAV6.2.GFP. The current study demonstrates, in a preclinical large animal model, the potential of IUGT to achieve host immune tolerance to the viral vector transgene product but also suggests that a single exposure to the vector capsid proteins at the time of IUGT is inadequate to induce tolerance to viral vector antigens. PMID:28141818

  12. Expression of multiple resistance genes enhances tolerance to environmental stressors in transgenic poplar (Populus × euramericana 'Guariento'.

    Directory of Open Access Journals (Sweden)

    Xiaohua Su

    Full Text Available Commercial and non-commercial plants face a variety of environmental stressors that often cannot be controlled. In this study, transgenic hybrid poplar (Populus × euramericana 'Guariento' harboring five effector genes (vgb, SacB, JERF36, BtCry3A and OC-I were subjected to drought, salinity, waterlogging and insect stressors in greenhouse or laboratory conditions. Field trials were also conducted to investigate long-term effects of transgenic trees on insects and salt tolerance in the transformants. In greenhouse studies, two transgenic lines D5-20 and D5-21 showed improved growth, as evidenced by greater height and basal diameter increments and total biomass relative to the control plants after drought or salt stress treatments. The improved tolerance to drought and salt was primarily attributed to greater instantaneous water use efficiency (WUEi in the transgenic trees. The chlorophyll concentrations tended to be higher in the transgenic lines under drought or saline conditions. Transformed trees in drought conditions accumulated more fructan and proline and had increased Fv/Fm ratios (maximum quantum yield of photosystem II under waterlogging stress. Insect-feeding assays in the laboratory revealed a higher total mortality rate and lower exuviation index of leaf beetle [Plagiodera versicolora (Laicharting] larvae fed with D5-21 leaves, suggesting enhanced insect resistance in the transgenic poplar. In field trials, the dominance of targeted insects on 2-year-old D5-21 transgenic trees was substantially lower than that of the controls, indicating enhanced resistance to Coleoptera. The average height and DBH (diameter at breast height of 2.5-year-old transgenic trees growing in naturally saline soil were 3.80% and 4.12% greater than those of the control trees, but these increases were not significant. These results suggested that multiple stress-resistance properties in important crop tree species could be simultaneously improved, although

  13. The enhancement of tolerance to salt and cold stresses by modifying the redox state and salicylic acid content via the cytosolic malate dehydrogenase gene in transgenic apple plants.

    Science.gov (United States)

    Wang, Qing-Jie; Sun, Hong; Dong, Qing-Long; Sun, Tian-Yu; Jin, Zhong-Xin; Hao, Yu-Jin; Yao, Yu-Xin

    2016-10-01

    In this study, we characterized the role of an apple cytosolic malate dehydrogenase gene (MdcyMDH) in the tolerance to salt and cold stresses and investigated its regulation mechanism in stress tolerance. The MdcyMDH transcript was induced by mild cold and salt treatments, and MdcyMDH-overexpressing apple plants possessed improved cold and salt tolerance compared to wild-type (WT) plants. A digital gene expression tag profiling analysis revealed that MdcyMDH overexpression largely altered some biological processes, including hormone signal transduction, photosynthesis, citrate cycle and oxidation-reduction. Further experiments verified that MdcyMDH overexpression modified the mitochondrial and chloroplast metabolisms and elevated the level of reducing power, primarily caused by increased ascorbate and glutathione, as well as the increased ratios of ascorbate/dehydroascorbate and glutathione/glutathione disulphide, under normal and especially stress conditions. Concurrently, the transgenic plants produced a high H2 O2 content, but a low O2·- production rate was observed compared to the WT plants. On the other hand, the transgenic plants accumulated more free and total salicylic acid (SA) than the WT plants under normal and stress conditions. Taken together, MdcyMDH conferred the transgenic apple plants a higher stress tolerance by producing more reductive redox states and increasing the SA level; MdcyMDH could serve as a target gene to genetically engineer salt- and cold-tolerant trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Enhancing freezing tolerance of Brassica napus L. by overexpression of a stearoyl-acyl carrier protein desaturase gene (SAD) from Sapium sebiferum (L.) Roxb.

    Science.gov (United States)

    Peng, Dan; Zhou, Bo; Jiang, Yueqiao; Tan, XiaoFeng; Yuan, DeYi; Zhang, Lin

    2018-07-01

    Sapium sebiferum (L.) Roxb. is an important woody oil tree and traditional herbal medicine in China. Stearoyl-acyl carrier protein desaturase (SAD) is a dehydrogenase enzyme that plays a key role in the transformation of saturated fatty acids into unsaturated fatty acids in oil; these fatty acids greatly influence the freezing tolerance of plants. However, it remains unclear whether freezing tolerance can be regulated by the expression level of SsSAD in S. sebiferum L. Our research indicated that SsSAD expression in S. sebiferum L. increased under freezing stress. To further confirm this result, we constructed a pEGAD-SsSAD vector and transformed it into B. napus L. W10 by Agrobacterium tumefaciens-mediated transformation. Transgenic plants that overexpressed the SsSAD gene exhibited significantly higher linoleic (18:2) and linolenic acid (18:3) content and advanced freezing tolerance. These results suggest that SsSAD overexpression in B. napus L. can increase the content of polyunsaturated fatty acids (PUFAs) such as linoleic (18:2) and linolenic acid (18:3), which are likely pivotal in improving freezing tolerance in B. napus L. plants. Thus, SsSAD overexpression could be useful in the production of freeze-tolerant varieties of B. napus L. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Overexpression of LOV KELCH protein 2 confers dehydration tolerance and is associated with enhanced expression of dehydration-inducible genes in Arabidopsis thaliana.

    Science.gov (United States)

    Miyazaki, Yuji; Abe, Hiroshi; Takase, Tomoyuki; Kobayashi, Masatomo; Kiyosue, Tomohiro

    2015-05-01

    The overexpression of LKP2 confers dehydration tolerance in Arabidopsis thaliana ; this is likely due to enhanced expression of dehydration-inducible genes and reduced stomatal opening. LOV KELCH protein 2 (LKP2) modulates the circadian rhythm and flowering time in plants. In this study, we observed that LKP2 overexpression enhanced dehydration tolerance in Arabidopsis. Microarray analysis demonstrated that expression of water deprivation-responsive genes was higher in the absence of dehydration stress in transgenic Arabidopsis plants expressing green fluorescent protein-tagged LKP2 (GFP-LKP2) than in control transgenic plants expressing GFP. After dehydration followed by rehydration, GFP-LKP2 plants developed more leaves and roots and exhibited higher survival rates than control plants. In the absence of dehydration stress, four dehydration-inducible genes, namely DREB1A, DREB1B, DREB1C, and RD29A, were expressed in GFP-LKP2 plants, whereas they were not expressed or were expressed at low levels in control plants. Under dehydration stress, the expression of DREB2B and RD29A peaked faster in the GFP-LKP2 plants than in control plants. The stomatal aperture of GFP-LKP2 plants was smaller than that of control plants. These results suggest that the dehydration tolerance of GFP-LKP2 plants is caused by upregulation of DREB1A-C/CBF1-3 and their downstream targets; restricted stomatal opening in the absence of dehydration stress also appears to contribute to the phenotype. The rapid and high expression of DREB2B and its downstream target genes also likely accounts for some features of the GFP-LKP2 phenotype. Our results suggest that LKP2 can be used for biotechnological applications not only to adjust the flowering time control but also to enhance dehydration tolerance.

  16. Gene expression profiling of a Zn-tolerant and a Zn-sensitive Suillus luteus isolate exposed to increased external zinc concentrations

    OpenAIRE

    MULLER, Ludo; Craciun, A. R.; RUYTINX, Joske; LAMBAERTS, Marc; Verbruggen, N.; VANGRONSVELD, Jaco; COLPAERT, Jan

    2007-01-01

    Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in ...

  17. Genetic polymorphisms within exon 3 of heat shock protein 90AA1 gene and its association with heat tolerance traits in Sahiwal cows

    Science.gov (United States)

    Kumar, Rakesh; Gupta, I. D.; Verma, Archana; Verma, Nishant; Vineeth, M. R.

    2015-01-01

    Aim: The present study was undertaken to identify novel single nucleotide polymorphism (SNP) in Exon 3 of HSP90AA1 gene and to analyze their association with respiration rate (RR) and rectal temperature (RT) in Sahiwal cows. Materials and Methods: The present study was carried out in Sahiwal cows (n=100) with the objectives to identify novel SNP in exon 3 of HSP90AA1 gene and to explore the association with heat tolerance traits. CLUSTAL-W multiple sequence analysis was used to identify novel SNPs in exon 3 of HSP90AA1 gene in Sahiwal cows. Gene and genotype frequencies of different genotypes were estimated by standard procedure POPGENE version 1.32 (University of Alberta, Canada). The significant effect of SNP variants on physiological parameters, e.g. RR and RT were analyzed using the General Linear model procedure of SAS Version 9.2. Results: The polymerase chain reaction product with the amplicon size of 450 bp was successfully amplified, covering exon 3 region of HSP90AA1 gene in Sahiwal cows. On the basis of comparative sequence analysis of Sahiwal samples (n=100), transitional mutations were detected at locus A1209G as compared to Bos taurus (NCBI GenBank AC_000178.1). After chromatogram analysis, three genotypes AA, AG, and GG with respective frequencies of 0.23, 0.50, and 0.27 ascertained. RR and RT were recorded once during probable extreme hours in winter, spring, and summer seasons. It was revealed that significant difference (pheat tolerance trait was found in Sahiwal cattle. The homozygotic animals with AA genotype had lower heat tolerance coefficient (HTC) (1.78±0.04a), as compared to both AG and GG genotypes (1.85±0.03b and 1.91±0.02c), respectively. The gene and genotype frequencies for the locus A1209G were ascertained. Conclusions: Novel SNP was found at the A1209G position showed all possible three genotypes (homozygous and heterozygous). Temperature humidity index has a highly significant association with RR, RT, and HTC in all the seasons

  18. MicroRNA160 Modulates Plant Development and Heat Shock Protein Gene Expression to Mediate Heat Tolerance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jeng-Shane Lin

    2018-02-01

    Full Text Available Global warming is causing a negative impact on plant growth and adversely impacts on crop yield. MicroRNAs (miRNAs are critical in regulating the expression of genes involved in plant development as well as defense responses. The effects of miRNAs on heat-stressed Arabidopsis warrants further investigation. Heat stress increased the expression of miR160 and its precursors but considerably reduced that of its targets, ARF10, ARF16, and ARF17. To study the roles of miR160 during heat stress, transgenic Arabidopsis plants overexpressing miR160 precursor a (160OE and artificial miR160 (MIM160, which mimics an inhibitor of miR160, were created. T-DNA insertion mutants of miR160 targets were also used to examine their tolerances to heat stress. Results presented that overexpressing miR160 improved seed germination and seedling survival under heat stress. The lengths of hypocotyl elongation and rachis were also longer in 160OE than the wild-type (WT plants under heat stress. Interestingly, MIM160 plants showed worse adaption to heat. In addition, arf10, arf16, and arf17 mutants presented similar phenotypes to 160OE under heat stress to advance abilities of thermotolerance. Moreover, transcriptome and qRT-PCR analyses revealed that HSP17.6A, HSP17.6II, HSP21, and HSP70B expression levels were regulated by heat in 160OE, MIM160, arf10, arf16, and arf17 plants. Hence, miR160 altered the expression of the heat shock proteins and plant development to allow plants to survive heat stress.

  19. Gene expression profiling of a Zn-tolerant and a Zn-sensitive Suillus luteus isolate exposed to increased external zinc concentrations.

    Science.gov (United States)

    Muller, L A H; Craciun, A R; Ruytinx, J; Lambaerts, M; Verbruggen, N; Vangronsveld, J; Colpaert, J V

    2007-10-01

    Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in different classes of expression pattern, were isolated and sequenced. Thirty-six of the represented genes showed homology to function-known genes, whereas 6 matched unknown protein coding sequences, and 102 were possibly novel. Although relatively few TDFs were found to be responsive to the different zinc treatments, their modulated expression levels may suggest a different transcriptional response to zinc treatments in both isolates. Among the identified genes that could be related to heavy-metal detoxification or the tolerance trait were genes encoding for homologues of a heat-shock protein, a putative metal transporter, a hydrophobin, and several proteins involved in ubiquitin-dependent proteolysis.

  20. Initial root length in wheat is highly correlated with acid soil tolerance in the field

    Directory of Open Access Journals (Sweden)

    Jorge Fernando Pereira

    Full Text Available ABSTRACT: In acid soils, toxic aluminum ions inhibit plant root growth. In order to discriminate aluminum (Al tolerance, trustful screening techniques are required. In this study, 20 wheat cultivars, showing different levels of Al tolerance, were evaluated in a short-term soil experiment to access their relative root length (RRL. Moreover, the alleles of two important genes (TaALMT1 and TaMATE1B for Al tolerance in wheat were discriminated. Both of these genes encode membrane transporters responsible for the efflux of organic acids by the root apices that are thought to confer tolerance by chelating Al. Genotypes showing TaALMT1 alleles V and VI and an insertion at the TaMATE1B promoter were among the ones showing greater RRL. Mechanisms of Al tolerance, which are not associated with organic acid efflux, can be potentially present in two cultivars showing greater RRL among the ones carrying inferior TaALMT1 and TaMATE1B alleles. The RRL data were highly correlated with wheat performance in acid soil at three developmental stages, tillering (r = −0.93, p < 0.001, silking (r = −0.91, p < 0.001 and maturation (r = −0.90, p < 0.001, as well as with the classification index of aluminum toxicity in the field (r = −0.92, p < 0.001. Since the RRL was obtained after only six days of growth and it is highly correlated with plant performance in acid soil under field conditions, the short-term experiment detailed here is an efficient and rapid method for reliable screening of wheat Al tolerance.

  1. An insertional mutagenesis programme with an enhancer trap for the identification and tagging of genes involved in abiotic stress tolerance in the tomato wild-related species Solanum pennellii

    OpenAIRE

    Atarés Huerta, Alejandro; Moyano, Elena; Morales, Belén; Schleicher, Peter; García Abellán, José Osvaldo; ANTÓN MARTÍNEZ, MARÍA TERESA; García Sogo, Begoña; Pérez Martin, Fernando; Lozano, Rafael; Borja Flores, Francisco; Moreno Ferrero, Vicente; BOLARIN JIMENEZ, MARIA DEL CARMEN; Pineda Chaza, Benito José

    2011-01-01

    [EN] Salinity and drought have a huge impact on agriculture since there are few areas free of these abiotic stresses and the problem continues to increase. In tomato, the most important horticultural crop worldwide, there are accessions of wild-related species with a high degree of tolerance to salinity and drought. Thus, the finding of insertional mutants with other tolerance levels could lead to the identification and tagging of key genes responsible for abiotic stress tolerance. To this en...

  2. Ectopic overexpression of WsSGTL1, a sterol glucosyltransferase gene in Withania somnifera, promotes growth, enhances glycowithanolide and provides tolerance to abiotic and biotic stresses.

    Science.gov (United States)

    Saema, Syed; Rahman, Laiq Ur; Singh, Ruchi; Niranjan, Abhishek; Ahmad, Iffat Zareen; Misra, Pratibha

    2016-01-01

    Overexpression of sterol glycosyltransferase (SGTL1) gene of Withania somnifera showing its involvement in glycosylation of withanolide that leads to enhanced growth and tolerance to biotic and abiotic stresses. Withania somnifera is widely used in Ayurvedic medicines for over 3000 years due to its therapeutic properties. It contains a variety of glycosylated steroids called withanosides that possess neuroregenerative, adaptogenic, anticonvulsant, immunomodulatory and antioxidant activities. The WsSGTL1 gene specific for 3β-hydroxy position has a catalytic specificity to glycosylate withanolide and sterols. Glycosylation not only stabilizes the products but also alters their physiological activities and governs intracellular distribution. To understand the functional significance and potential of WsSGTL1 gene, transgenics of W. somnifera were generated using Agrobacterium tumefaciens-mediated transformation. Stable integration and overexpression of WsSGTL1 gene were confirmed by Southern blot analysis followed by quantitative real-time PCR. The WsGTL1 transgenic plants displayed number of alterations at phenotypic and metabolic level in comparison to wild-type plants which include: (1) early and enhanced growth with leaf expansion and increase in number of stomata; (2) increased production of glycowithanolide (majorly withanoside V) and campesterol, stigmasterol and sitosterol in glycosylated forms with reduced accumulation of withanolides (withaferin A, withanolide A and withanone); (3) tolerance towards biotic stress (100 % mortality of Spodoptera litura), improved survival capacity under abiotic stress (cold stress) and; (4) enhanced recovery capacity after cold stress, as indicated by better photosynthesis performance, chlorophyll, anthocyanin content and better quenching regulation of PSI and PSII. Our data demonstrate overexpression of WsSGTL1 gene which is responsible for increase in glycosylated withanolide and sterols, and confers better growth and

  3. Identification of Differentially Expressed Genes Related to Dehydration Resistance in a Highly Drought-Tolerant Pear, Pyrus betulaefolia, as through RNA-Seq.

    Science.gov (United States)

    Li, Kong-Qing; Xu, Xiao-Yong; Huang, Xiao-San

    2016-01-01

    Drought is a major abiotic stress that affects plant growth, development and productivity. Pear is one of the most important deciduous fruit trees in the world, but the mechanisms of drought tolerance in this plant are still unclear. To better understand the molecular basis regarding drought stress response, RNA-seq was performed on samples collected before and after dehydration in Pyrus betulaefolia. In total, 19,532 differentially expressed genes (DEGs) were identified. These genes were annotated into 144 Gene Ontology (GO) terms and 18 clusters of orthologous groups (COG) involved in 129 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. These DEGs comprised 49 (26 up-regulated, 23 down-regulated), 248 (166 up-regulated, 82 down-regulated), 3483 (1295 up-regulated, 2188 down-regulated), 1455 (1065 up-regulated, 390 down-regulated) genes from the 1 h, 3 h and 6 h dehydration-treated samples and a 24 h recovery samples, respectively. RNA-seq was validated by analyzing the expresson patterns of randomly selected 16 DEGs by quantitative real-time PCR. Photosynthesis, signal transduction, innate immune response, protein phosphorylation, response to water, response to biotic stimulus, and plant hormone signal transduction were the most significantly enriched GO categories amongst the DEGs. A total of 637 transcription factors were shown to be dehydration responsive. In addition, a number of genes involved in the metabolism and signaling of hormones were significantly affected by the dehydration stress. This dataset provides valuable information regarding the Pyrus betulaefolia transcriptome changes in response to dehydration and may promote identification and functional analysis of potential genes that could be used for improving drought tolerance via genetic engineering of non-model, but economically-important, perennial species.

  4. Heterologous expression of the wheat aquaporin gene TaTIP2;2 compromises the abiotic stress tolerance of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Chunhui Xu

    Full Text Available Aquaporins are channel proteins which transport water across cell membranes. We show that the bread wheat aquaporin gene TaTIP2;2 maps to the long arm of chromosome 7b and that its product localizes to the endomembrane system. The gene is expressed constitutively in both the root and the leaf, and is down-regulated by salinity and drought stress. Salinity stress induced an increased level of C-methylation within the CNG trinucleotides in the TaTIP2;2 promoter region. The heterologous expression of TaTIP2;2 in Arabidopsis thaliana compromised its drought and salinity tolerance, suggesting that TaTIP2;2 may be a negative regulator of abiotic stress. The proline content of transgenic A. thaliana plants fell, consistent with the down-regulation of P5CS1, while the expression of SOS1, SOS2, SOS3, CBF3 and DREB2A, which are all stress tolerance-related genes acting in an ABA-independent fashion, was also down-regulated. The supply of exogenous ABA had little effect either on TaTIP2;2 expression in wheat or on the phenotype of transgenic A. thaliana. The expression level of the ABA signalling genes ABI1, ABI2 and ABF3 remained unaltered in the transgenic A. thaliana plants. Thus TaTIP2;2 probably regulates the response to stress via an ABA-independent pathway(s.

  5. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    International Nuclear Information System (INIS)

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

    2008-01-01

    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

  6. Ectopic over-expression of peroxisomal ascorbate peroxidase (SbpAPX) gene confers salt stress tolerance in transgenic peanut (Arachis hypogaea).

    Science.gov (United States)

    Singh, Natwar; Mishra, Avinash; Jha, Bhavanath

    2014-08-15

    Peroxisomal ascorbate peroxidase gene (SbpAPX) of an extreme halophyte Salicornia brachiata imparts abiotic stress endurance and plays a key role in the protection against oxidative stress. The cloned SbpAPX gene was transformed to local variety of peanut and about 100 transgenic plants were developed using optimized in vitro regeneration and Agrobacterium mediated genetic transformation method. The T0 transgenic plants were confirmed for the gene integration; grown under controlled condition in containment green house facility; seeds were harvested and T1 plants were raised. Transgenic plants (T1) were further confirmed by PCR using gene specific primers and histochemical GUS assay. About 40 transgenic plants (T1) were selected randomly and subjected for salt stress tolerance study. Transgenic plants remained green however non-transgenic plants showed bleaching and yellowish leaves under salt stress conditions. Under stress condition, transgenic plants continued normal growth and completed their life cycle. Transgenic peanut plants exhibited adequate tolerance under salt stress condition and thus could be explored for the cultivation in salt affected areas for the sustainable agriculture. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

  8. Overexpression of ARGOS Genes Modifies Plant Sensitivity to Ethylene, Leading to Improved Drought Tolerance in Both Arabidopsis and Maize[OPEN

    Science.gov (United States)

    Shi, Jinrui; Habben, Jeffrey E.; Archibald, Rayeann L.; Drummond, Bruce J.; Chamberlin, Mark A.; Williams, Robert W.; Lafitte, H. Renee; Weers, Ben P.

    2015-01-01

    Lack of sufficient water is a major limiting factor to crop production worldwide, and the development of drought-tolerant germplasm is needed to improve crop productivity. The phytohormone ethylene modulates plant growth and development as well as plant response to abiotic stress. Recent research has shown that modifying ethylene biosynthesis and signaling can enhance plant drought tolerance. Here, we report novel negative regulators of ethylene signal transduction in Arabidopsis (Arabidopsis thaliana) and maize (Zea mays). These regulators are encoded by the ARGOS gene family. In Arabidopsis, overexpression of maize ARGOS1 (ZmARGOS1), ZmARGOS8, Arabidopsis ARGOS homolog ORGAN SIZE RELATED1 (AtOSR1), and AtOSR2 reduced plant sensitivity to ethylene, leading to enhanced drought tolerance. RNA profiling and genetic analysis suggested that the ZmARGOS1 transgene acts between an ethylene receptor and CONSTITUTIVE TRIPLE RESPONSE1 in the ethylene signaling pathway, affecting ethylene perception or the early stages of ethylene signaling. Overexpressed ZmARGOS1 is localized to the endoplasmic reticulum and Golgi membrane, where the ethylene receptors and the ethylene signaling protein ETHYLENE-INSENSITIVE2 and REVERSION-TO-ETHYLENE SENSITIVITY1 reside. In transgenic maize plants, overexpression of ARGOS genes also reduces ethylene sensitivity. Moreover, field testing showed that UBIQUITIN1:ZmARGOS8 maize events had a greater grain yield than nontransgenic controls under both drought stress and well-watered conditions. PMID:26220950

  9. De Novo Transcriptome Assembly and Identification of Gene Candidates for Rapid Evolution of Soil Al Tolerance in Anthoxanthum odoratum at the Long-Term Park Grass Experiment.

    Science.gov (United States)

    Gould, Billie; McCouch, Susan; Geber, Monica

    2015-01-01

    Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE) provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE), cell wall modification (OsSTAR1), and internal Al detoxification (OsNRAT1) in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE.

  10. De Novo Transcriptome Assembly and Identification of Gene Candidates for Rapid Evolution of Soil Al Tolerance in Anthoxanthum odoratum at the Long-Term Park Grass Experiment.

    Directory of Open Access Journals (Sweden)

    Billie Gould

    Full Text Available Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE, cell wall modification (OsSTAR1, and internal Al detoxification (OsNRAT1 in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE.

  11. Association of an SNP in a novel DREB2-like gene SiDREB2 with stress tolerance in foxtail millet [Setaria italica (L.)].

    Science.gov (United States)

    Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj

    2011-06-01

    The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable

  12. Overexpression of the OsIMP Gene Increases the Accumulation of Inositol and Confers Enhanced Cold Tolerance in Tobacco through Modulation of the Antioxidant Enzymes’ Activities

    Directory of Open Access Journals (Sweden)

    Rong-Xiang Zhang

    2017-07-01

    Full Text Available Inositol is a cyclic polyol that is involved in various physiological processes, including signal transduction and stress adaptation in plants. l-myo-inositol monophosphatase (IMPase is one of the metal-dependent phosphatase family members and catalyzes the last reaction step of biosynthesis of inositol. Although increased IMPase activity induced by abiotic stress has been reported in chickpea plants, the role and regulation of the IMP gene in rice (Oryza sativa L. remains poorly understood. In the present work, we obtained a full-length cDNA sequence coding IMPase in the cold tolerant rice landraces in Gaogonggui, which is named as OsIMP. Multiple alignment results have displayed that this sequence has characteristic signature motifs and conserved enzyme active sites of the phosphatase super family. Phylogenetic analysis showed that IMPase is most closely related to that of the wild rice Oryza brachyantha, while transcript analysis revealed that the expression of the OsIMP is significantly induced by cold stress and exogenous abscisic acid (ABA treatment. Meanwhile, we cloned the 5’ flanking promoter sequence of the OsIMP gene and identified several important cis-acting elements, such as LTR (low-temperature responsiveness, TCA-element (salicylic acid responsiveness, ABRE-element (abscisic acid responsiveness, GARE-motif (gibberellin responsive, MBS (MYB Binding Site and other cis-acting elements related to defense and stress responsiveness. To further investigate the potential function of the OsIMP gene, we generated transgenic tobacco plants overexpressing the OsIMP gene and the cold tolerance test indicated that these transgenic tobacco plants exhibit improved cold tolerance. Furthermore, transgenic tobacco plants have a lower level of hydrogen peroxide (H2O2 and malondialdehyde (MDA, and a higher content of total chlorophyll as well as increased antioxidant enzyme activities of superoxide dismutase (SOD, catalase (CAT and peroxidase (POD

  13. Polyamine regulates tolerance to water stress in leaves of white clover associated with antioxidant defense and dehydrin genes via involvement in calcium messenger system and hydrogen peroxide signaling

    Directory of Open Access Journals (Sweden)

    Zhou eLi

    2015-10-01

    Full Text Available Endogenous polyamine (PA may play a critical role in tolerance to water stress in plants acting as a signaling molecule activator. Water stress caused increases in endogenous PA content in leaves, including putrescine (Put, spermidine (Spd, and spermine (Spm. Exogenous application of Spd could induce the instantaneous H2O2 burst and accumulation of cytosolic free Ca2+, and activate NADPH oxidase and CDPK gene expression in cells. To a great extent, PA biosynthetic inhibitor reduced the water stress-induced H2O2 accumulation, free cytosolic Ca2+ release, antioxidant enzyme activities and genes expression leading to aggravate water stress-induced oxidative damage, while these suppressing effects were alleviated by the addition of exogenous Spd, indicating PA was involved in water stress-induced H2O2 and cytosolic free Ca2+ production as well as stress tolerance. Dehydrin genes (Y2SK, Y2K, and SK2 were showed to be highly responsive to exogenous Spd. PA-induced antioxidant defense and dehydrin genes expression could be blocked by the scavenger of H2O2 and the inhibitors of H2O2 generation or Ca2+ channels blockers, a calmodulin antagonist, as well as the inhibitor of CDPK. These findings suggested that PA regulated tolerance to water stress in white clover associated with antioxidant defenses and dehydrins via involvement in the calcium messenger system and H2O2 signaling pathways. PA-induced H2O2 production required Ca2+ release, while PA-induced Ca2+ release was also essential for H2O2 production, suggesting an interaction between PA-induced H2O2 and Ca2+ signaling.

  14. Overexpression of a 9-cis-Epoxycarotenoid Dioxygenase Gene in Nicotiana plumbaginifolia Increases Abscisic Acid and Phaseic Acid Levels and Enhances Drought Tolerance1

    Science.gov (United States)

    Qin, Xiaoqiong; Zeevaart, Jan A.D.

    2002-01-01

    The plant hormone abscisic acid (ABA) plays important roles in seed maturation and dormancy and in adaptation to a variety of environmental stresses. An effort to engineer plants with elevated ABA levels and subsequent stress tolerance is focused on the genetic manipulation of the cleavage reaction. It has been shown in bean (Phaseolus vulgaris) that the gene encoding the cleavage enzyme (PvNCED1) is up-regulated by water stress, preceding accumulation of ABA. Transgenic wild tobacco (Nicotiana plumbaginifolia Viv.) plants were produced that overexpress the PvNCED1 gene either constitutively or in an inducible manner. The constitutive expression of PvNCED1 resulted in an increase in ABA and its catabolite, phaseic acid (PA). When the PvNCED1 gene was driven by the dexamethasone (DEX)-inducible promoter, a transient induction of PvNCED1 message and accumulation of ABA and PA were observed in different lines after application of DEX. Accumulation of ABA started to level off after 6 h, whereas the PA level continued to increase. In the presence of DEX, seeds from homozygous transgenic line TN1 showed a 4-d delay in germination. After spraying with DEX, the detached leaves from line TN1 had a drastic decrease in their water loss relative to control leaves. These plants also showed a marked increase in their tolerance to drought stress. These results indicate that it is possible to manipulate ABA levels in plants by overexpressing the key regulatory gene in ABA biosynthesis and that stress tolerance can be improved by increasing ABA levels. PMID:11842158

  15. Overexpression of a 9-cis-epoxycarotenoid dioxygenase gene in Nicotiana plumbaginifolia increases abscisic acid and phaseic acid levels and enhances drought tolerance.

    Science.gov (United States)

    Qin, Xiaoqiong; Zeevaart, Jan A D

    2002-02-01

    The plant hormone abscisic acid (ABA) plays important roles in seed maturation and dormancy and in adaptation to a variety of environmental stresses. An effort to engineer plants with elevated ABA levels and subsequent stress tolerance is focused on the genetic manipulation of the cleavage reaction. It has been shown in bean (Phaseolus vulgaris) that the gene encoding the cleavage enzyme (PvNCED1) is up-regulated by water stress, preceding accumulation of ABA. Transgenic wild tobacco (Nicotiana plumbaginifolia Viv.) plants were produced that overexpress the PvNCED1 gene either constitutively or in an inducible manner. The constitutive expression of PvNCED1 resulted in an increase in ABA and its catabolite, phaseic acid (PA). When the PvNCED1 gene was driven by the dexamethasone (DEX)-inducible promoter, a transient induction of PvNCED1 message and accumulation of ABA and PA were observed in different lines after application of DEX. Accumulation of ABA started to level off after 6 h, whereas the PA level continued to increase. In the presence of DEX, seeds from homozygous transgenic line TN1 showed a 4-d delay in germination. After spraying with DEX, the detached leaves from line TN1 had a drastic decrease in their water loss relative to control leaves. These plants also showed a marked increase in their tolerance to drought stress. These results indicate that it is possible to manipulate ABA levels in plants by overexpressing the key regulatory gene in ABA biosynthesis and that stress tolerance can be improved by increasing ABA levels.

  16. Overexpression of the OsIMP Gene Increases the Accumulation of Inositol and Confers Enhanced Cold Tolerance in Tobacco through Modulation of the Antioxidant Enzymes' Activities.

    Science.gov (United States)

    Zhang, Rong-Xiang; Qin, Li-Jun; Zhao, De-Gang

    2017-07-20

    Inositol is a cyclic polyol that is involved in various physiological processes, including signal transduction and stress adaptation in plants. l- myo -inositol monophosphatase (IMPase) is one of the metal-dependent phosphatase family members and catalyzes the last reaction step of biosynthesis of inositol. Although increased IMPase activity induced by abiotic stress has been reported in chickpea plants, the role and regulation of the IMP gene in rice ( Oryza sativa L.) remains poorly understood. In the present work, we obtained a full-length cDNA sequence coding IMPase in the cold tolerant rice landraces in Gaogonggui, which is named as OsIMP . Multiple alignment results have displayed that this sequence has characteristic signature motifs and conserved enzyme active sites of the phosphatase super family. Phylogenetic analysis showed that IMPase is most closely related to that of the wild rice Oryza brachyantha , while transcript analysis revealed that the expression of the OsIMP is significantly induced by cold stress and exogenous abscisic acid (ABA) treatment. Meanwhile, we cloned the 5' flanking promoter sequence of the OsIMP gene and identified several important cis -acting elements, such as LTR (low-temperature responsiveness), TCA-element (salicylic acid responsiveness), ABRE-element (abscisic acid responsiveness), GARE-motif (gibberellin responsive), MBS (MYB Binding Site) and other cis -acting elements related to defense and stress responsiveness. To further investigate the potential function of the OsIMP gene, we generated transgenic tobacco plants overexpressing the OsIMP gene and the cold tolerance test indicated that these transgenic tobacco plants exhibit improved cold tolerance. Furthermore, transgenic tobacco plants have a lower level of hydrogen peroxide (H₂O₂) and malondialdehyde (MDA), and a higher content of total chlorophyll as well as increased antioxidant enzyme activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD

  17. Transcriptomic profiling to identify genes involved in Fusarium mycotoxin Deoxynivalenol and Zearalenone tolerance in the mycoparasitic fungus Clonostachys rosea

    DEFF Research Database (Denmark)

    Kosawang, Chatchai; Karlsson, Magnus; Jensen, Dan Funck

    2014-01-01

    a number of ATP-Binding Cassette (ABC) transporter transcripts were highly frequent in the ZEA-induced library. Subsequent bioinformatics analysis predicted that all transcripts with similarity to ABC transporters could be ascribed to only 2 ABC transporters genes, and phylogenetic analysis...... of the predicted ABC transporters suggested that they belong to group G (pleiotropic drug transporters) of the fungal ABC transporter gene family. This is the first report suggesting involvement of ABC transporters in ZEA tolerance. Expression patterns of a selected set of DON- and ZEA-induced genes were validated...... and ZEA in the mycoparasitic fungus C. rosea. Whilst metabolic readjustment is potentially the key to withstanding DON, the fungus produces ZHD101 to detoxify ZEA and ABC transporters to transport ZEA or its degradation products out from the fungal cell....

  18. Expression of lycopene biosynthesis genes fused in line with Shine-Dalgarno sequences improves the stress-tolerance of Lactococcus lactis.

    Science.gov (United States)

    Dong, Xiangrong; Wang, Yanping; Yang, Fengyuan; Zhao, Shanshan; Tian, Bing; Li, Tao

    2017-01-01

    Lycopene biosynthetic genes from Deinococcus radiodurans were co-expressed in Lactococcus lactis to produce lycopene and improve its tolerance to stress. Lycopene-related genes from D. radiodurans, DR1395 (crtE), DR0862 (crtB), and DR0861 (crtI), were fused in line with S hine-Dalgarno (SD) sequences and co-expressed in L. lactis. The recombinant strain produced 0.36 mg lycopene g -1  dry cell wt after 48 h fermentation. The survival rate to UV irradiation of the recombinant strain was higher than that of the non-transformed strain. The L. lactis with co-expressed genes responsible for lycopene biosynthesis from D. radiodurans produced lycopene and exhibited increased resistance to UV stress, suggesting that the recombinant strain has important application potential in food industry.

  19. Constitutive Expression of a miR319 Gene Alters Plant Development and Enhances Salt and Drought Tolerance in Transgenic Creeping Bentgrass1[W][OA

    Science.gov (United States)

    Zhou, Man; Li, Dayong; Li, Zhigang; Hu, Qian; Yang, Chunhua; Zhu, Lihuang; Luo, Hong

    2013-01-01

    MicroRNA319 (miR319) is one of the first characterized and conserved microRNA families in plants and has been demonstrated to target TCP (for TEOSINTE BRANCHED/CYCLOIDEA/PROLIFERATING CELL FACTORS [PCF]) genes encoding plant-specific transcription factors. MiR319 expression is regulated by environmental stimuli, suggesting its involvement in plant stress response, although experimental evidence is lacking and the underlying mechanism remains elusive. This study investigates the role that miR319 plays in the plant response to abiotic stress using transgenic creeping bentgrass (Agrostis stolonifera) overexpressing a rice (Oryza sativa) miR319 gene, Osa-miR319a. We found that transgenic plants overexpressing Osa-miR319a displayed morphological changes and exhibited enhanced drought and salt tolerance associated with increased leaf wax content and water retention but reduced sodium uptake. Gene expression analysis indicated that at least four putative miR319 target genes, AsPCF5, AsPCF6, AsPCF8, and AsTCP14, and a homolog of the rice NAC domain gene AsNAC60 were down-regulated in transgenic plants. Our results demonstrate that miR319 controls plant responses to drought and salinity stress. The enhanced abiotic stress tolerance in transgenic plants is related to significant down-regulation of miR319 target genes, implying their potential for use in the development of novel molecular strategies to genetically engineer crop species for enhanced resistance to environmental stress. PMID:23292790

  20. The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco

    Directory of Open Access Journals (Sweden)

    Yadav Narendra

    2012-10-01

    Full Text Available Abstract Background Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1 gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. Results The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC, chlorophyll, K+/Na+ ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na+ content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na+ content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na+ loading to xylem from root and leaf tissues. Transgenic lines also showed increased K+ and Ca2+ content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Conclusions Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na+ efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na+ content in different organs and also affect the other

  1. The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na(+) loading in xylem and confers salt tolerance in transgenic tobacco.

    Science.gov (United States)

    Yadav, Narendra Singh; Shukla, Pushp Sheel; Jha, Anupama; Agarwal, Pradeep K; Jha, Bhavanath

    2012-10-11

    Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1) gene encodes a plasma membrane Na(+)/H(+) antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC), chlorophyll, K(+)/Na(+) ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT) plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS) and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na(+) content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na(+) content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na(+) loading to xylem from root and leaf tissues. Transgenic lines also showed increased K(+) and Ca(2+) content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na(+) efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na(+) content in different organs and also affect the other transporters activity indirectly. These

  2. The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco

    Science.gov (United States)

    2012-01-01

    Background Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1) gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. Results The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC), chlorophyll, K+/Na+ ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT) plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS) and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na+ content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na+ content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na+ loading to xylem from root and leaf tissues. Transgenic lines also showed increased K+ and Ca2+ content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Conclusions Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na+ efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na+ content in different organs and also affect the other transporters activity indirectly

  3. ALUMINUM BOX BUNDLING PRESS

    Directory of Open Access Journals (Sweden)

    Iosif DUMITRESCU

    2015-05-01

    Full Text Available In municipal solid waste, aluminum is the main nonferrous metal, approximately 80- 85% of the total nonferrous metals. The income per ton gained from aluminum recuperation is 20 times higher than from glass, steel boxes or paper recuperation. The object of this paper is the design of a 300 kN press for aluminum box bundling.

  4. A receptor-like kinase gene (GbRLK) from Gossypium barbadense enhances salinity and drought-stress tolerance in Arabidopsis.

    Science.gov (United States)

    Zhao, Jun; Gao, Yulong; Zhang, Zhiyuan; Chen, Tianzi; Guo, Wangzhen; Zhang, Tianzhen

    2013-08-06

    Cotton (Gossypium spp.) is widely cultivated due to the important economic value of its fiber. However, extreme environmental degradation impedes cotton growth and production. Receptor-like kinase (RLK) proteins play important roles in signal transduction and participate in a diverse range of processes in response to plant hormones and environmental cues. Here, we introduced an RLK gene (GbRLK) from cotton into Arabidopsis and investigated its role in imparting abiotic stress tolerance. GbRLK transcription was induced by exogenously supplied abscisic acid (ABA), salicylic acid, methyl jasmonate, mock drought conditions and high salinity. We cloned the promoter sequence of this gene via self-formed adaptor PCR. Sequence analysis revealed that the promoter region contains many cis-acting stress-responsive elements such as ABRE, W-Box, MYB-core, W-Box core, TCA-element and others. We constructed a vector containing a 1,890-bp sequence in the 5' region upstream of the initiation codon of this promoter and transformed it into Arabidopsis thaliana. GUS histochemical staining analysis showed that GbRLK was expressed mainly in leaf veins, petioles and roots of transgenic Arabidopsis, but not in the cotyledons or root hairs. GbRLK promoter activity was induced by ABA, PEG, NaCl and Verticillium dahliae. Transgenic Arabidopsis with constitutive overexpression of GbRLK exhibited a reduced rate of water loss in leaves in vitro, along with improved salinity and drought tolerance and increased sensitivity to ABA compared with non-transgenic Col-0 Arabidopsis. Expression analysis of stress-responsive genes in GbRLK Arabidopsis revealed that there was increased expression of genes involved in the ABA-dependent signaling pathway (AtRD20, AtRD22 and AtRD26) and antioxidant genes (AtCAT1, AtCCS, AtCSD2 and AtCSD1) but not ion transporter genes (AtNHX1, AtSOS1). GbRLK is involved in the drought and high salinity stresses pathway by activating or participating in the ABA signaling

  5. A ThDREB gene from Tamarix hispida improved the salt and drought tolerance of transgenic tobacco and T. hispida.

    Science.gov (United States)

    Yang, Guiyan; Yu, Lili; Zhang, Kaimin; Zhao, Yulin; Guo, Yucong; Gao, Caiqiu

    2017-04-01

    Dehydration-responsive element-binding (DREB) transcription factors are important abiotic stress tolerance related genes, and some reports on the roles of DREB have primarily addressed herbal plants. To explore the abiotic stress tolerance role of DREB (ThDREB) from Tamarix hispida, a ThDREB gene with a complete ORF of 783 bp that encodes a 28.74 kDa protein with 260 amino acids, was isolated and functionally annotated. ThDREB expression was highly induced by NaCl, PEG, NaHCO 3 and CdCl 2 treatments, and the highest expression level (369.2-fold of control) was found for the roots that were under NaCl stress for 6 h. The tobacco plants that were transformed by ThDREB were conferred with higher germination rates, fresh weights and root lengths than the wild type (WT) tobacco plants under NaCl and mannitol treatments. The total chlorophyll content (tcc), superoxide dismutase (SOD) and peroxidase (POD) activities were also higher in the transgenic lines in comparison with the WT, and the malondialdehyde (MDA) and H 2 O 2 content, electrolyte leakage (EL) rate and ROS as tracked by staining were generated to a lesser degree in ThDREB transgenic plants than in the WT under NaCl and mannitol stress. Furthermore, the transient overexpression analysis of ThDREB in T. hispida also improved plant salt and drought tolerance in comparison with the empty vector-transformed lines. Our results indicated that ThDREB expression could effectively improve tolerance to salt and drought stress by enhancing the antioxidase activity that keeps the ROS at a low accumulation level and makes them easy to scavenge. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. Brassinosteroids-Induced Systemic Stress Tolerance was Associated with Increased Transcripts of Several Defence-Related Genes in the Phloem in Cucumis sativus.

    Directory of Open Access Journals (Sweden)

    Pingfang Li

    Full Text Available Brassinosteroids (BRs, a group of naturally occurring plant steroidal compounds, are essential for plant growth, development and stress tolerance. Recent studies showed that BRs could induce systemic tolerance to biotic and abiotic stresses; however, the molecular mechanisms by which BRs signals lead to responses in the whole plant are largely unknown. In this study, 24-epibrassinosteroid (EBR-induced systemic tolerance in Cucumis sativus L. cv. Jinyan No. 4 was analyzed through the assessment of symptoms of photooxidative stress by chlorophyll fluorescence imaging pulse amplitude modulation. Expression of defense/stress related genes were induced in both treated local leaves and untreated systemic leaves by local EBR application. With the suppressive subtractive hybridization (SSH library using cDNA from the phloem sap of EBR-treated plants as the tester and distilled water (DW-treated plants as the driver, 14 transcripts out of 260 clones were identified. Quantitative Real Time-Polymerase Chain Reaction (RT-qPCR validated the specific up-regulation of these transcripts. Of the differentially expressed transcripts with known functions, transcripts for the selected four cDNAs, which encode an auxin-responsive protein (IAA14, a putative ankyrin-repeat protein, an F-box protein (PP2, and a major latex, pathogenesis-related (MLP-like protein, were induced in local leaves, systemic leaves and roots after foliar application of EBR onto mature leaves. Our results demonstrated that EBR-induced systemic tolerance is accompanied with increased transcript of genes in the defense response in other organs. The potential role of phloem mRNAs as signaling components in mediating BR-regulated systemic resistance is discussed.

  7. GhWRKY25, a group I WRKY gene from cotton, confers differential tolerance to abiotic and biotic stresses in transgenic Nicotiana benthamiana.

    Science.gov (United States)

    Liu, Xiufang; Song, Yunzhi; Xing, Fangyu; Wang, Ning; Wen, Fujiang; Zhu, Changxiang

    2016-09-01

    WRKY transcription factors are involved in various processes, ranging from plant growth to abiotic and biotic stress responses. Group I WRKY members have been rarely reported compared with group II or III members, particularly in cotton (Gossypium hirsutum). In this study, a group I WRKY gene, namely, GhWRKY25, was cloned from cotton and characterized. Expression analysis revealed that GhWRKY25 can be induced or deduced by the treatments of abiotic stresses and multiple defense-related signaling molecules. Overexpression of GhWRKY25 in Nicotiana benthamiana reduced plant tolerance to drought stress but enhanced tolerance to salt stress. Moreover, more MDA and ROS accumulated in transgenic plants after drought treatment with lower activities of SOD, POD, and CAT. Our study further demonstrated that GhWRKY25 overexpression in plants enhanced sensitivity to the fungal pathogen Botrytis cinerea by reducing the expression of SA or ET signaling related genes and inducing the expression of genes involved in the JA signaling pathway. These results indicated that GhWRKY25 plays negative or positive roles in response to abiotic stresses, and the reduced pathogen resistance may be related to the crosstalk of the SA and JA/ET signaling pathways.

  8. A novel vacuolar membrane H+-ATPase c subunit gene (ThVHAc1) from Tamarix hispida confers tolerance to several abiotic stresses in Saccharomyces cerevisiae.

    Science.gov (United States)

    Gao, Caiqiu; Wang, Yucheng; Jiang, Bo; Liu, Guifeng; Yu, Lili; Wei, Zhigang; Yang, Chuanping

    2011-02-01

    Plant vacuolar H(+)-ATPase (V-ATPase) plays an important role in response to different adverse environmental conditions. In the present study, we cloned and characterized a V-ATPase c subunit gene (ThVHAc1) from Tamarix hispida. The deduced ThVHAc1 amino acid sequence lacks a signal peptide and ThVHAc1 is a highly hydrophobic protein with four transmembrane regions. A transient expression assay showed that the ThVHAc1-GFP fusion protein is expressed on onion epidermal endomembrane cells. Real-time RT-PCR demonstrated that ThVHAc1 gene expression was induced by NaCl, NaHCO(3), PEG and CdCl(2) stress in T. hispida roots, stems and leaves. Exogenous application of abscisic acid (ABA) also stimulated ThVHAc1 transcript levels in the absence of stress, suggesting that ThVHAc1 is involved in ABA-dependent stress signaling pathway. Furthermore, the transgenic yeast expressing ThVHAc1 increased salt, drought, ultraviolet (UV), oxidative, heavy metal, cold and high temperature tolerance. Our results suggested that the ThVHAc1 gene from T. hispida serves a stress tolerance role in the species.

  9. Melatonin Attenuates Potato Late Blight by Disrupting Cell Growth, Stress Tolerance, Fungicide Susceptibility and Homeostasis of Gene Expression in Phytophthora infestans

    Directory of Open Access Journals (Sweden)

    Shumin Zhang

    2017-11-01

    Full Text Available Phytophthora infestans (P. infestans is the causal agent of potato late blight, which caused the devastating Irish Potato Famine during 1845-1852. Until now, potato late blight is still the most serious threat to potato growth and has caused significant economic losses worldwide. Melatonin can induce plant innate immunity against pathogen infection, but the direct effects of melatonin on plant pathogens are poorly understood. In this study, we investigated the direct effects of melatonin on P. infestans. Exogenous melatonin significantly attenuated the potato late blight by inhibiting mycelial growth, changing cell ultrastructure, and reducing stress tolerance of P. infestans. Notably, synergistic anti-fungal effects of melatonin with fungicides on P. infestans suggest that melatonin could reduce the dose levels and enhance the efficacy of fungicide against potato late blight. A transcriptome analysis was carried out to mine downstream genes whose expression levels were affected by melatonin. The analysis of the transcriptome suggests that 66 differentially expressed genes involved in amino acid metabolic processes were significantly affected by melatonin. Moreover, the differentially expressed genes associated with stress tolerance, fungicide resistance, and virulence were also affected. These findings contribute to a new understanding of the direct functions of the melatonin on P. infestans and provide a potential ecofriendly biocontrol approach using a melatonin-based paradigm and application to prevent potato late blight.

  10. Engineering drought tolerant tomato plants over-expressing BcZAT12 gene encoding a C₂H₂ zinc finger transcription factor.

    Science.gov (United States)

    Rai, Avinash Chandra; Singh, Major; Shah, Kavita

    2013-01-01

    Efficient genetic transformation of cotyledonary explants of tomato (Solanum lycopersicum, cv. H-86, Kashi vishesh) was obtained. Disarmed Agrobacterium tumifaciens strain GV 3101 was used in conjugation with binary vector pBinAR containing a construct consisting of the coding sequence of the BcZAT12 gene under the regulatory control of the stress inducible Bclea1a promoter. ZAT12 encodes a C₂H₂ zinc finger protein which confers multiple abiotic stress tolerance to plants. Integration of ZAT12 gene into nuclear genome of individual kanamycin resistant transformed T₀ tomato lines was confirmed by Southern blot hybridization with segregation analysis of T(1) plants showing Mendelian inheritance of the transgene. Expression of ZAT12 in drought-stressed transformed tomato lines was verified in T₂ generation plants using RT-PCR. Of the six transformed tomato lines (ZT1-ZT6) the transformants ZT1 and ZT5 showed maximum expression of BcZAT12 gene transcripts when exposed to 7 days drought stress. Analysis of relative water content (RWC), electrolyte leakage (EL), chlorophyll colour index (CCI), H₂O₂ level and catalase activity suggested that tomato BcZAT12 transformants ZT1 and ZT5 have significantly increased levels of drought tolerance. These results suggest that BcZAT12 transformed tomato cv. H-86 has real potential for molecular breeding programs aimed at augmenting yield of tomato in regions affected with drought stress. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Effects of aluminum and manganese on the growth of ectomycorrhizal fungi.

    Science.gov (United States)

    Thompson, G W; Medve, R J

    1984-09-01

    Cenococcum graniforme, Suillus luteus, Thelephora terrestris, and three isolates of Pisolithus tinctorius were cultured on modified Melin-Norkrans medium at pH 3.4 and adjusted to 0 to 500 ppm (0 to 500 mug/ml) of aluminum or manganese sulfate. Except for T. terrestris, which was intolerant of aluminum at 150 and 250 to 500 ppm, and P. tinctorius isolate 250, which was intolerant of aluminum at 450 ppm, all fungi showed some growth at all concentrations of aluminum. S. luteus was the most tolerant to aluminum. Manganese was less fungitoxic than aluminum, with all fungi showing at least 65% growth at 500 ppm as compared with the control. C. graniforme was not inhibited at any concentration of manganese, and S. luteus was only affected at 500 ppm. P. tinctorius isolate 230 showed no significant variation in growth when subjected to various concentrations of three forms of manganese salts. Significant differences in growth were detected in response to three aluminum salts, but no detectable pattern was apparent. Genotypic responses to aluminum and manganese were evident for P. tinctorius. Isolates 210 and 230 were more tolerant to manganese than was isolate 250. Aluminum tolerance was in the order of isolate 230 > 210 > 250. Results of in vitro studies concerning tolerance responses of ectomycorrhizal fungi to aluminum and manganese were not consistent with field observations of the successional sequence of these fungi on acid coal spoils.

  12. Effects of aluminum and manganese on the growth of ectomycorrhizal fungi

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, G.W.; Medve, R.J.

    1984-09-01

    Cenococcum graniforme, Suillus luteus, Thelephora terrestris, and three isolates of Pisolithus tinctorius were cultured on modified Melin-Norkrans medium at pH 3.4 and adjusted to 0 to 500 ppm (0 to 500 ..mu..g/ml) of aluminum or manganese sulfate. Except for T. terrestris, which was intolerant of aluminum at 150 and 250 to 500 ppm, and P. tinctorius isolate 250, which was intolerant of aluminum at 450 ppm, all fungi showed some growth at all concentrations of aluminum. S. luteus was the most tolerant to aluminum. Manganese was less fungitoxic than aluminum, with all fungi showing at least 65% growth at 500 ppm as compared with the control. C graniforme was not inhibited at any concentration of manganese, and S. luteus was only affected at 500 ppm. P. tinctorius isolate 230 showed no significant variation in growth when subjected to various concentrations of three forms of manganese salts. Significant differences in growth were detected in response to three aluminum salts, but no detectable pattern was apparent. Genotypic responses to aluminum and manganese were evident for P. tinctorius. Isolates 210 and 230 were more tolerant to manganese than was isolate 250. Aluminum tolerance was in the order of isolate 230 > 210 > 250. Results of in vitro studies concerning tolerance responses of ectomycorrhizal fungi to aluminum and manganese were not consistent with field observations of the successional sequence of these fungi on acid coal spoils. 43 references, 3 tables.

  13. Comprehensive gene expression analysis of the NAC gene family under normal growth conditions, hormone treatment, and drought stress conditions in rice using near-isogenic lines (NILs) generated from crossing Aday Selection (drought tolerant) and IR64.

    Science.gov (United States)

    Nuruzzaman, Mohammed; Sharoni, Akhter Most; Satoh, Kouji; Moumeni, Ali; Venuprasad, Ramiah; Serraj, Rachid; Kumar, Arvind; Leung, Hei; Attia, Kotb; Kikuchi, Shoshi

    2012-05-01

    The NAC (NAM, ATAF1/2 and CUC2) genes are plant-specific transcriptional factors known to play diverse roles in various plant developmental processes. We describe the rice (Oryza sativa) OsNAC genes expression profiles (GEPs) under normal and water-deficit treatments (WDTs). The GEPs of the OsNAC genes were analyzed in 25 tissues covering the entire life cycle of Minghui 63. High expression levels of 17 genes were demonstrated in certain tissues under normal conditions suggesting that these genes may play important roles in specific organs. We determined that 16 genes were differentially expressed under at least 1 phytohormone (NAA, GA3, KT, SA, ABA, and JA) treatment. To investigate the GEPs in the root, leaf, and panicle of three rice genotypes [e.g., 2 near-isogenic lines (NILs) and IR64], we used two NILs from a common genetic combination backcross developed by Aday Selection and IR64. WDTs were applied using the fraction of transpirable soil water at severe, mild, and control conditions. Transcriptomic analysis using a 44K oligoarray from Agilent was performed on all the tissue samples. We identified common and specific genes in all tissues from the two NILs under both WDTs, and the majority of the OsNAC genes that were activated were in the drought-tolerant IR77298-14-1-2-B-10 line compared with the drought-susceptible IR77298-14-1-2-B-13 or IR64. In IR77298-14-1-2-B-10, seventeen genes were very specific in their expression levels. Approximately 70 % of the genes from subgroups SNAC and NAM/CUC3 were activated in the leaf, but 37 % genes from subgroup SND were inactivated in the root compared with the control under severe stress conditions. These results provide a useful reference for the cloning of candidate genes from the specific subgroup for further functional analysis.

  14. [Process and mechanism of plants in overcoming acid soil aluminum stress].

    Science.gov (United States)

    Zhao, Tian-Long; Xie, Guang-Ning; Zhang, Xiao-Xia; Qiu, Lin-Quan; Wang, Na; Zhang, Su-Zhi

    2013-10-01

    Aluminum (Al) stress is one of the most important factors affecting the plant growth on acid soil. Currently, global soil acidification further intensifies the Al stress. Plants can detoxify Al via the chelation of ionic Al and organic acids to store the ionic Al in vacuoles and extrude it from roots. The Al extrusion is mainly performed by the membrane-localized anion channel proteins Al(3+)-activated malate transporter (ALMT) and multi-drug and toxin extrusion (MATE). The genes encoding ABC transporter and zinc-finger protein conferred plant Al tolerance have also been found. The identification of these Al-resistant genes makes it possible to increase the Al resistance of crop plants and enhance their production by the biological methods such as gene transformation and mark-associated breeding. The key problems needed to be solved and the possible directions in the researches of plant Al stress resistance were proposed.

  15. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang

    2013-11-01

    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  16. Ectopic expression of TaOEP16-2-5B, a wheat plastid outer envelope protein gene, enhances heat and drought stress tolerance in transgenic Arabidopsis plants.

    Science.gov (United States)

    Zang, Xinshan; Geng, Xiaoli; Liu, Kelu; Wang, Fei; Liu, Zhenshan; Zhang, Liyuan; Zhao, Yue; Tian, Xuejun; Hu, Zhaorong; Yao, Yingyin; Ni, Zhongfu; Xin, Mingming; Sun, Qixin; Peng, Huiru

    2017-05-01

    Abiotic stresses, such as heat and drought, are major environmental factors restricting crop productivity and quality worldwide. A plastid outer envelope protein gene, TaOEP16-2, was identified from our previous transcriptome analysis [1,2]. In this study, the isolation and functional characterization of the TaOEP16-2 gene was reported. Three homoeologous sequences of TaOEP16-2 were isolated from hexaploid wheat, which were localized on the chromosomes 5A, 5B and 5D, respectively. These three homoeologues exhibited different expression patterns under heat stress conditions, TaOEP16-2-5B was the dominant one, and TaOEP16-2-5B was selected for further analysis. Compared with wild type (WT) plants, transgenic Arabidopsis plants overexpressing the TaOEP16-2-5B gene exhibited enhanced tolerance to heat stress, which was supported by improved survival rate, strengthened cell membrane stability and increased sucrose content. It was also found that TaOEP16-2 was induced by drought stress and involved in drought stress tolerance. TaOEP16-2-5B has the same function in ABA-controlled seed germination as AtOEP16-2. Our results suggest that TaOEP16-2-5B plays an important role in heat and drought stress tolerance, and could be utilized in transgenic breeding of wheat and other crop plants. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Reducing cytoplasmic polyamine oxidase activity in Arabidopsis increases salt and drought tolerance by reducing reactive oxygen species production and increasing defense gene expression

    Directory of Open Access Journals (Sweden)

    G.H.M. eSagor

    2016-02-01

    Full Text Available The link between polyamine oxidases (PAOs, which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5 or the peroxisomal PAO pathway (pao2 pao3 pao4 silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5 decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81% and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions.

  18. Graphene-aluminum nanocomposites

    International Nuclear Information System (INIS)

    Bartolucci, Stephen F.; Paras, Joseph; Rafiee, Mohammad A.; Rafiee, Javad; Lee, Sabrina; Kapoor, Deepak; Koratkar, Nikhil

    2011-01-01

    Highlights: → We investigated the mechanical properties of aluminum and aluminum nanocomposites. → Graphene composite had lower strength and hardness compared to nanotube reinforcement. → Processing causes aluminum carbide formation at graphene defects. → The carbides in between grains is a source of weakness and lowers tensile strength. - Abstract: Composites of graphene platelets and powdered aluminum were made using ball milling, hot isostatic pressing and extrusion. The mechanical properties and microstructure were studied using hardness and tensile tests, as well as electron microscopy, X-ray diffraction and differential scanning calorimetry. Compared to the pure aluminum and multi-walled carbon nanotube composites, the graphene-aluminum composite showed decreased strength and hardness. This is explained in the context of enhanced aluminum carbide formation with the graphene filler.

  19. Studying the possibility of isolating and characterizing genes responsible for salinity tolerance in some gamma irradiation-induced potato mutants

    Energy Technology Data Exchange (ETDEWEB)

    Al-Daoude, A; Al-Safadi, B; Al-Nabulsi, I; Mir Ali, N [Atomic Energy Commission, Damascus (Syrian Arab Republic), Dept. of Molecular Biology and Biotechnology

    2008-07-15

    Random Amplified Polymorphic DNA(RAPD) and Inter-Simple Sequence Repeat (ISSR) were deployed to study the genetic relatedness of nineteen different potato lines previously obtained by gamma irradiation and believed to be salt tolerant. The lines which belong to three different cultivars, Spunta, Draga and Diamant were confirmed to be salt tolerant in comparison with their controls. Twenty seven random primers and twenty five ISSR oligonucleotides were utilized to determine the genetic relatedness and to amplify DNA fragments involved in salt tolerance. ISSR clustering and Percent disagreement values (PDV) resembled that of the RAPDs for all studied lines. Consequently, RAPD and ISSR were reliable and could be used to determine the genetic relatedness of potato lines belonging to the same cultivar. Moreover, twenty unique DNA fragments were amplified using RAPD or ISSR in the tolerant mutant lines but not in their respective controls. The fragments were gel excised, reamplified and cloned in a cloning vector using QIAGEN A-addition and PCR cloning Kits. However, Blast data base search with the fragments sequences did not reveal any significant homology indicating the weakness of both the RAPD and ISSR techniques in identifying specific targets.(Authors)

  20. Studying the possibility of isolating and characterizing genes responsible for salinity tolerance in some gamma irradiation-induced potato mutants

    International Nuclear Information System (INIS)

    Al-Daoude, A.; Al-Safadi, B.; Al-Nabulsi, I.; Mir Ali, N.

    2008-07-01

    Random Amplified Polymorphic DNA(RAPD) and Inter-Simple Sequence Repeat (ISSR) were deployed to study the genetic relatedness of nineteen different potato lines previously obtained by gamma irradiation and believed to be salt tolerant. The lines which belong to three different cultivars, Spunta, Draga and Diamant were confirmed to be salt tolerant in comparison with their controls. Twenty seven random primers and twenty five ISSR oligonucleotides were utilized to determine the genetic relatedness and to amplify DNA fragments involved in salt tolerance. ISSR clustering and Percent disagreement values (PDV) resembled that of the RAPDs for all studied lines. Consequently, RAPD and ISSR were reliable and could be used to determine the genetic relatedness of potato lines belonging to the same cultivar. Moreover, twenty unique DNA fragments were amplified using RAPD or ISSR in the tolerant mutant lines but not in their respective controls. The fragments were gel excised, reamplified and cloned in a cloning vector using QIAGEN A-addition and PCR cloning Kits. However, Blast data base search with the fragments sequences did not reveal any significant homology indicating the weakness of both the RAPD and ISSR techniques in identifying specific targets.(Authors)

  1. Expression of genes involved in lipid metabolism in men with impaired glucose tolerance : impact of insulin stimulation and weight loss

    NARCIS (Netherlands)

    Konings, E.; Corpeleijn, E.; Bouwman, F.G.; Mariman, E.C.; Blaak, E.E.

    2010-01-01

    Background: The impaired glucose tolerance (IGT) state is characterized by insulin resistance. Disturbances in fatty acid (FA) metabolism may underlie this reduced insulin sensitivity. The aim of this study was to investigate whether the prediabetic state is accompanied by changes in the expression

  2. Over-expression of VvWRKY1 in grapevines induces expression of jasmonic acid pathway-related genes and confers higher tolerance to the downy mildew.

    Directory of Open Access Journals (Sweden)

    Chloé Marchive

    Full Text Available Most WRKY transcription factors activate expression of defence genes in a salicylic acid- and/or jasmonic acid-dependent signalling pathway. We previously identified a WRKY gene, VvWRKY1, which is able to enhance tolerance to fungal pathogens when it is overexpressed in tobacco. The present work analyzes the effects of VvWRKY1 overexpression in grapevine. Microarray analysis showed that genes encoding defence-related proteins were up-regulated in the leaves of transgenic 35S::VvWRKY1 grapevines. Quantitative RT-PCR analysis confirmed that three genes putatively involved in jasmonic acid signalling pathway were overexpressed in the transgenic grapes. The ability of VvWRKY1 to trans-activate the promoters of these genes was demonstrated by transient expression in grape protoplasts. The resistance to the causal agent of downy mildew, Plasmopara viticola, was enhanced in the transgenic plants. These results show that VvWRKY1 can increase resistance of grapevine against the downy mildew through transcriptional reprogramming leading to activation of the jasmonic acid signalling pathway.

  3. The garlic NF-YC gene, AsNF-YC8, positively regulates non-ionic hyperosmotic stress tolerance in tobacco.

    Science.gov (United States)

    Sun, Xiudong; Lian, Haifeng; Liu, Xingchen; Zhou, Shumei; Liu, Shiqi

    2017-05-01

    To investigate the relationship between nuclear factor Y (NF-Y) and stress tolerance in garlic, we cloned a NF-Y family gene AsNF-YC8 from garlic, which was largely upregulated at dehydrate stage. Expression pattern analyses in garlic revealed that AsNF-YC8 is induced through abscisic acid (ABA) and abiotic stresses, such as NaCl and PEG. Compared with wild-type plants, the overexpressing-AsNF-YC8 transgenic tobacco plants showed higher seed germination rates, longer root length and better plant growth under salt and drought stresses. Under drought stress, the transgenic plants maintained higher relative water content (RWC), net photosynthesis, lower levels of malondialdehyde (MDA), and less ion leakage (IL) than wild-type control plants. These results indicate the high tolerance of the transgenic plants to drought stress compared to the WT. The transgenic tobacco lines accumulated less reactive oxygen species (ROS) and exhibited higher antioxidative enzyme activities compared with wild-type (WT) plants under drought stress, which suggested that the overexpression of AsNF-YC8 improves the antioxidant defense system by regulating the activities of these antioxidant enzymes, which in turn protect transgenic lines against drought stress. These results suggest that AsNF-YC8 plays an important role in tolerance to drought and salt stresses.

  4. Ectopically expressing MdPIP1;3, an aquaporin gene, increased fruit size and enhanced drought tolerance of transgenic tomatoes.

    Science.gov (United States)

    Wang, Lin; Li, Qing-Tian; Lei, Qiong; Feng, Chao; Zheng, Xiaodong; Zhou, Fangfang; Li, Lingzi; Liu, Xuan; Wang, Zhi; Kong, Jin

    2017-12-19

    Water deficit severely reduces apple growth and production, is detrimental to fruit quality and size. This problem is exacerbated as global warming is implicated in producing more severe drought stress. Thus water-efficiency has becomes the major target for apple breeding. A desired apple tree can absorb and transport water efficiently, which not only confers improved drought tolerance, but also guarantees fruit size for higher income returns. Aquaporins, as water channels, control water transportation across membranes and can regulate water flow by changing their amount and activity. The exploration of molecular mechanism of water efficiency and the gene wealth will pave a way for molecular breeding of drought tolerant apple tree. In the current study, we screened out a drought inducible aquaporin gene MdPIP1;3, which specifically enhanced its expression during fruit expansion in 'Fuji' apple (Malus domestica Borkh. cv. Red Fuji). It localized on plasma membranes and belonged to PIP1 subfamily. The tolerance to drought stress enhanced in transgenic tomato plants ectopically expressing MdPIP1;3, showing that the rate of losing water in isolated transgenic leaves was slower than wild type, and stomata of transgenic plants closed sensitively to respond to drought compared with wild type. Besides, length and diameter of transgenic tomato fruits increased faster than wild type, and in final, fruit sizes and fresh weights of transgenic tomatoes were bigger than wild type. Specially, in cell levels, fruit cell size from transgenic tomatoes was larger than wild type, showing that cell number per mm 2 in transgenic fruits was less than wild type. Altogether, ectopically expressing MdPIP1;3 enhanced drought tolerance of transgenic tomatoes partially via reduced water loss controlled by stomata closure in leaves. In addition, the transgenic tomato fruits are larger and heavier with larger cells via more efficient water transportation across membranes. Our research will

  5. Antioxidant enzymatic activities and gene expression associated with heat tolerance in the stems and roots of two cucurbit species ("Cucurbita maxima" and "Cucurbita moschata") and their interspecific inbred line "Maxchata".

    Science.gov (United States)

    Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2013-12-10

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant "C. moschata", thermolabile "C. maxima" and moderately heat-tolerant interspecific inbred line "Maxchata" genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. "C. moschata" exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2(-)) and malondialdehyde (MDA) contents in the roots compared to stems, followed by "Maxchata". The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among "C. maxima" and "Maxchata", most of these genes were highly induced under heat stress in "Maxchata", which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  6. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata”) and Their Interspecific Inbred Line “Maxchata”

    Science.gov (United States)

    Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2013-01-01

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2−) and malondialdehyde (MDA) contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration. PMID:24336062

  7. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata” and Their Interspecific Inbred Line “Maxchata”

    Directory of Open Access Journals (Sweden)

    Neelam Ara

    2013-12-01

    Full Text Available The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C and severe (42 °C heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2, superoxide (O2− and malondialdehyde (MDA contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD, ascorbate peroxidase (APX, catalase (CAT and peroxidase (POD were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  8. Expression of TPS1 gene from Saccharomycopsis fibuligera A11 in Saccharomyces sp. W0 enhances trehalose accumulation, ethanol tolerance, and ethanol production.

    Science.gov (United States)

    Cao, Tian-Shu; Chi, Zhe; Liu, Guang-Lei; Chi, Zhen-Ming

    2014-01-01

    It has been reported that trehalose plays an important role in stress tolerance in yeasts. Therefore, in order to construct a stably recombinant Saccharomyces sp. W0 with higher ethanol tolerance, the TPS1 gene encoding 6-phosphate-trehalose synthase cloned from Saccharomycopsis fibuligera A11 was ligated into the 18S rDNA integration vector pMIRSC11 and integrated into chromosomal DNA of Saccharomyces sp. W0. The transformant Z8 obtained had the content of 6.23 g of trehalose/100 g of cell dry weight, while Saccharomyces sp. W0 only contained 4.05 g of trehalose/100 g of cell dry weight. The transformant Z8 also had higher ethanol tolerance (cell survival was 25.1 % at 18 ml of ethanol/100 ml of solution) and trehalose-6-phosphate synthase (Tps1) activity (1.3 U/mg) and produced more ethanol (16.4 ml of ethanol/100 ml of medium) than Saccharomyces sp. W0 (cell survival was 12.1 % at 18 ml of ethanol/100 ml of solution, Tps1 activity was 0.8 U/mg and the produced ethanol concentration was 14.2 ml of ethanol/100 ml of medium) under the same conditions. The results show that trehalose indeed can play an important role in ethanol tolerance and ethanol production by Saccharomyces sp. W0.

  9. Variation in salinity tolerance of four lowland genotypes of quinoa (Chenopodium quinoa Willd.) as assessed by growth, physiological traits, and sodium transporter gene expression.

    Science.gov (United States)

    Ruiz-Carrasco, Karina; Antognoni, Fabiana; Coulibaly, Amadou Konotie; Lizardi, Susana; Covarrubias, Adriana; Martínez, Enrique A; Molina-Montenegro, Marco A; Biondi, Stefania; Zurita-Silva, Andrés

    2011-11-01

    Chenopodium quinoa (Willd.) is an Andean plant showing a remarkable tolerance to abiotic stresses. In Chile, quinoa populations display a high degree of genetic distancing, and variable tolerance to salinity. To investigate which tolerance mechanisms might account for these differences, four genotypes from coastal central and southern regions were compared for their growth, physiological, and molecular responses to NaCl at seedling stage. Seeds were sown on agar plates supplemented with 0, 150 or 300mM NaCl. Germination was significantly reduced by NaCl only in accession BO78. Shoot length was reduced by 150mM NaCl in three out of four genotypes, and by over 60% at 300mM (except BO78 which remained more similar to controls). Root length was hardly affected or even enhanced at 150mM in all four genotypes, but inhibited, especially in BO78, by 300mM NaCl. Thus, the root/shoot ratio was differentially affected by salt, with the highest values in PRJ, and the lowest in BO78. Biomass was also less affected in PRJ than in the other accessions, the genotype with the highest increment in proline concentration upon salt treatment. Free putrescine declined dramatically in all genotypes under 300mM NaCl; however (spermidine+spermine)/putrescine ratios were higher in PRJ than BO78. Quantitative RT-PCR analyses of two sodium transporter genes, CqSOS1 and CqNHX, revealed that their expression was differentially induced at the shoot and root level, and between genotypes, by 300mM NaCl. Expression data are discussed in relation to the degree of salt tolerance in the different accessions. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  10. Linking stomatal traits and expression of slow anion channel genes HvSLAH1 2 HvSLAC1 with grain yield for increasing salinity tolerance in barley

    Directory of Open Access Journals (Sweden)

    Xiaohui eLiu

    2014-11-01

    Full Text Available Soil salinity is an environmental and agricultural problem in many parts of the world. One of the keys to breeding barley for adaptation to salinity lies in a better understanding of the genetic control of stomatal regulation. We have employed a range of physiological and molecular techniques (stomata assay, gas exchange, phylogenetic analysis, QTL analysis, and gene expression to investigate stomatal behaviour and genotypic variation in barley cultivars and a genetic population in four experimental trials. A set of relatively efficient and reliable methods were developed for the characterisation of stomatal behaviour of large numbers of varieties and genetic lines. Furthermore, we have found a large genetic variation of gas exchange and stomatal traits in barley in response to salinity stress. Salt-tolerant CM72 showed significantly larger stomatal aperture in 200 mM NaCl treatment than that of salt-sensitive Gairdner. Stomatal traits such as aperture width/length were found to significantly correlate with grain yield in salt treatment. Phenotypic characterisation and QTL analysis of a segregating double haploid population of the CM72/Gairdner resulted in the identification of significant stomatal traits-related QTLs for salt tolerance. Moreover, expression analysis of the slow anion channel genes HvSLAH1 and HvSLAC1 demonstrated that their up-regulation is linked to high barley grain yield in the field.

  11. A novel cold-regulated gene from Phlox subulata, PsCor413im1, enhances low temperature tolerance in Arabidopsis.

    Science.gov (United States)

    Zhou, Aimin; Sun, Hongwei; Feng, Shuang; Zhou, Mi; Gong, Shufang; Wang, Jingang; Zhang, Shuzhen

    2018-01-08

    Low temperature stress adversely affects plant growth, development, and crop productivity. Analysis of the function of genes in the response of plants to low temperature stress is essential for understanding the mechanism of chilling and freezing tolerance. In this study, PsCor413im1, a novel cold-regulated gene isolated from Phlox subulata, was transferred to Arabidopsis to investigate its function under low temperature stress. Real-time quantitative PCR analysis revealed that PsCor413im1 expression was induced by cold and abscisic acid. Subcellular localization revealed that PsCor413im1-GFP fusion protein was localized to the periphery of the chloroplast, consistent with the localization of chloroplast inner membrane protein AtCor413im1, indicating that PsCor413im1 is a chloroplast membrane protein. Furthermore, the N-terminal of PsCor413im1 was determined to be necessary for its localization. Compared to the wild-type plants, transgenic plants showed higher germination and survival rates under cold and freezing stress. Moreover, the expression of AtCor15 in transgenic plants was higher than that in the wild-type plants under cold stress. Taken together, our results suggest that the overexpression of PsCor413im1 enhances low temperature tolerance in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Metabolic engineering of the chloroplast genome reveals that the yeast ArDH gene confers enhanced tolerance to salinity and drought in plants

    Directory of Open Access Journals (Sweden)

    Muhammad Sarwar Khan

    2015-09-01

    Full Text Available Osmoprotectants stabilize proteins and membranes against the denaturing effect of high concentrations of salts and other harmful solutes. In yeast, arabitol dehydrogenase (ArDH reduces D-ribulose to D-arabitol where D-ribulose is derived by dephosphorylating D-ribulose-5-PO4 in the oxidized pentose pathway. Osmotolerance in plants could be developed through metabolic engineering of chloroplast genome by introducing genes encoding polyols. Here, we report that ArDH expression in chloroplasts confers tolerance to NaCl (up to 400 mM. Transgenic plants compared to wild type survived for four to five weeks on 400 mM NaCl. Nevertheless, plants remained green and grew normal on concentrations up to 350 mM NaCl. Further, a-week-old seedlings were also challenged with poly ethylene glycol (PEG, up to 6% in the liquid medium, considering that membranes and proteins are protected under stress conditions due to accumulation of arabitol in chloroplasts. Seedlings were tolerant to 6% PEG, suggesting that ARDH enzyme maintains integrity of membranes in chloroplasts under drought conditions via metabolic engineering. Hence, the gene could be expressed in agronomic plants to withstand abiotic stresses.

  13. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Science.gov (United States)

    Lawson, Bianca; Clulow, Simon; Mahony, Michael J; Clulow, John

    2013-01-01

    Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60%) over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+)-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research directions for

  14. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Directory of Open Access Journals (Sweden)

    Bianca Lawson

    Full Text Available Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60% over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research

  15. TaCHP: a wheat zinc finger protein gene down-regulated by abscisic acid and salinity stress plays a positive role in stress tolerance.

    Science.gov (United States)

    Li, Cuiling; Lv, Jian; Zhao, Xin; Ai, Xinghui; Zhu, Xinlei; Wang, Mengcheng; Zhao, Shuangyi; Xia, Guangmin

    2010-09-01

    The plant response to abiotic stresses involves both abscisic acid (ABA)-dependent and ABA-independent signaling pathways. Here we describe TaCHP, a CHP-rich (for cysteine, histidine, and proline rich) zinc finger protein family gene extracted from bread wheat (Triticum aestivum), is differentially expressed during abiotic stress between the salinity-sensitive cultivar Jinan 177 and its tolerant somatic hybrid introgression cultivar Shanrong No.3. TaCHP expressed in the roots of seedlings at the three-leaf stage, and the transcript localized within the cells of the root tip cortex and meristem. TaCHP transcript abundance was higher in Shanrong No.3 than in Jinan 177, but was reduced by the imposition of salinity or drought stress, as well as by the exogenous supply of ABA. When JN17, a salinity hypersensitive wheat cultivar, was engineered to overexpress TaCHP, its performance in the face of salinity stress was improved, and the ectopic expression of TaCHP in Arabidopsis (Arabidopsis thaliana) also improved the ability of salt tolerance. The expression level of a number of stress reporter genes (AtCBF3, AtDREB2A, AtABI2, and AtABI1) was raised in the transgenic lines in the presence of salinity stress, while that of AtMYB15, AtABA2, and AtAAO3 was reduced in its absence. The presence in the upstream region of the TaCHP open reading frame of the cis-elements ABRE, MYBRS, and MYCRS suggests that it is a component of the ABA-dependent and -independent signaling pathways involved in the plant response to abiotic stress. We suggest that TaCHP enhances stress tolerance via the promotion of CBF3 and DREB2A expression.

  16. Characterization of pbt genes conferring increased Pb(2+) and Cd(2+) tolerance upon Achromobacter xylosoxidans A8

    Czech Academy of Sciences Publication Activity Database

    Hložková, K.; Šuman, J.; Strnad, Hynek; Ruml, T.; Pačes, Václav; Kotrba, P.

    2013-01-01

    Roč. 164, č. 10 (2013), s. 1009-1018 ISSN 1769-7123 R&D Projects: GA MŠk(CZ) 1M0520 Grant - others:GA ČR(CZ) GAP504/11/0484 Program:GA Institutional support: RVO:68378050 Keywords : Achromobacter xylosoxidans * metal tolerance * lead * cadmium * zinc * P1-type ATPase * MerR family * transcriptional control Subject RIV: EB - Genetics ; Molecular Biology

  17. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  18. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.

    Science.gov (United States)

    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil

    2015-07-01

    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  19. Plant Adaptation to Acid Soils: The Molecular Basis for Crop Aluminum Resistance.

    Science.gov (United States)

    Kochian, Leon V; Piñeros, Miguel A; Liu, Jiping; Magalhaes, Jurandir V

    2015-01-01

    Aluminum (Al) toxicity in acid soils is a significant limitation to crop production worldwide, as approximately 50% of the world's potentially arable soil is acidic. Because acid soils are such an important constraint to agriculture, understanding the mechanisms and genes conferring resistance to Al toxicity has been a focus of intense research interest in the decade since the last article on crop acid soil tolerance was published in this journal. An impressive amount of progress has been made during that time that has greatly increased our understanding of the diversity of Al resistance genes and mechanisms, how resistance gene expression is regulated and triggered by Al and Al-induced signals, and how the proteins encoded by these genes function and are regulated. This review examines the state of our understanding of the physiological, genetic, and molecular bases for crop Al tolerance, looking at the novel Al resistance genes and mechanisms that have been identified over the past ten years. Additionally, it examines how the integration of molecular and genetic analyses of crop Al resistance is starting to be exploited for the improvement of crop plants grown on acid soils via both molecular-assisted breeding and biotechnology approaches.

  20. BONDING ALUMINUM METALS

    Science.gov (United States)

    Noland, R.A.; Walker, D.E.

    1961-06-13

    A process is given for bonding aluminum to aluminum. Silicon powder is applied to at least one of the two surfaces of the two elements to be bonded, the two elements are assembled and rubbed against each other at room temperature whereby any oxide film is ruptured by the silicon crystals in the interface; thereafter heat and pressure are applied whereby an aluminum-silicon alloy is formed, squeezed out from the interface together with any oxide film, and the elements are bonded.

  1. Aluminum powder metallurgy processing

    Energy Technology Data Exchange (ETDEWEB)

    Flumerfelt, J.F.

    1999-02-12

    The objective of this dissertation is to explore the hypothesis that there is a strong linkage between gas atomization processing conditions, as-atomized aluminum powder characteristics, and the consolidation methodology required to make components from aluminum powder. The hypothesis was tested with pure aluminum powders produced by commercial air atomization, commercial inert gas atomization, and gas atomization reaction synthesis (GARS). A comparison of the GARS aluminum powders with the commercial aluminum powders showed the former to exhibit superior powder characteristics. The powders were compared in terms of size and shape, bulk chemistry, surface oxide chemistry and structure, and oxide film thickness. Minimum explosive concentration measurements assessed the dependence of explosibility hazard on surface area, oxide film thickness, and gas atomization processing conditions. The GARS aluminum powders were exposed to different relative humidity levels, demonstrating the effect of atmospheric conditions on post-atomization processing conditions. The GARS aluminum powders were exposed to different relative humidity levels, demonstrating the effect of atmospheric conditions on post-atomization oxidation of aluminum powder. An Al-Ti-Y GARS alloy exposed in ambient air at different temperatures revealed the effect of reactive alloy elements on post-atomization powder oxidation. The pure aluminum powders were consolidated by two different routes, a conventional consolidation process for fabricating aerospace components with aluminum powder and a proposed alternative. The consolidation procedures were compared by evaluating the consolidated microstructures and the corresponding mechanical properties. A low temperature solid state sintering experiment demonstrated that tap densified GARS aluminum powders can form sintering necks between contacting powder particles, unlike the total resistance to sintering of commercial air atomization aluminum powder.

  2. A novel Zea mays ssp. mexicana L. MYC-type ICE-like transcription factor gene ZmmICE1, enhances freezing tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Lu, Xiang; Yang, Lei; Yu, Mengyuan; Lai, Jianbin; Wang, Chao; McNeil, David; Zhou, Meixue; Yang, Chengwei

    2017-04-01

    The annual Zea mays ssp. mexicana L., a member of the teosinte group, is a close wild relative of maize and thus can be effectively used in maize improvement. In this study, an ICE-like gene, ZmmICE1, was isolated from a cDNA library of RNA-Seq from cold-treated seedling tissues of Zea mays ssp. mexicana L. The deduced protein of ZmmICE1 contains a highly conserved basic helix-loop-helix (bHLH) domain and C-terminal region of ICE-like proteins. The ZmmICE1 protein localizes to the nucleus and shows sumoylation when expressed in an Escherichia coli reconstitution system. In addition, yeast one hybrid assays indicated that ZmmICE1 has transactivation activities. Moreover, ectopic expression of ZmmICE1 in the Arabidopsis ice1-2 mutant increased freezing tolerance. The ZmmICE1 overexpressed plants showed lower electrolyte leakage (EL), reduced contents of malondialdehyde (MDA). The expression of downstream cold related genes of Arabidopsis C-repeat-binding factors (AtCBF1, AtCBF2 and AtCBF3), cold-responsive genes (AtCOR15A and AtCOR47), kinesin-1 member gene (AtKIN1) and responsive to desiccation gene (AtRD29A) was significantly induced when compared with wild type under low temperature treatment. Taken together, these results indicated that ZmmICE1 is the homolog of Arabidopsis inducer of CBF expression genes (AtICE1/2) and plays an important role in the regulation of freezing stress response. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  3. Exploiting transcriptome data for the development and characterization of gene-based SSR markers related to cold tolerance in oil palm (Elaeis guineensis).

    Science.gov (United States)

    Xiao, Yong; Zhou, Lixia; Xia, Wei; Mason, Annaliese S; Yang, Yaodong; Ma, Zilong; Peng, Ming

    2014-12-19

    The oil palm (Elaeis guineensis, 2n = 32) has the highest oil yield of any crop species, as well as comprising the richest dietary source of provitamin A. For the tropical species, the best mean growth temperature is about 27°C, with a minimal growth temperature of 15°C. Hence, the plantation area is limited into the geographical ranges of 10°N to 10°S. Enhancing cold tolerance capability will increase the total cultivation area and subsequently oil productivity of this tropical species. Developing molecular markers related to cold tolerance would be helpful for molecular breeding of cold tolerant Elaeis guineensis. In total, 5791 gene-based SSRs were identified in 51,452 expressed sequences from Elaeis guineensis transcriptome data: approximately one SSR was detected per 10 expressed sequences. Of these 5791 gene-based SSRs, 916 were derived from expressed sequences up- or down-regulated at least two-fold in response to cold stress. A total of 182 polymorphic markers were developed and characterized from 442 primer pairs flanking these cold-responsive SSR repeats. The polymorphic information content (PIC) of these polymorphic SSR markers across 24 lines of Elaeis guineensis varied from 0.08 to 0.65 (mean = 0.31 ± 0.12). Using in-silico mapping, 137 (75.3%) of the 182 polymorphic SSR markers were located onto the 16 Elaeis guineensis chromosomes. Total coverage of 473 Mbp was achieved, with an average physical distance of 3.4 Mbp between adjacent markers (range 96 bp - 20.8 Mbp). Meanwhile, Comparative analysis of transcriptome under cold stress revealed that one ICE1 putative ortholog, five CBF putative orthologs, 19 NAC transcription factors and four cold-induced orhologs were up-regulated at least two fold in response to cold stress. Interestingly, 5' untranslated region of both Unigene21287 (ICE1) and CL2628.Contig1 (NAC) both contained an SSR markers. In the present study, a series of SSR markers were developed based on sequences

  4. Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera

    Directory of Open Access Journals (Sweden)

    Zhou Li

    2018-05-01

    Full Text Available Gamma-aminobutyric acid (GABA may play a positive role in regulating plant tolerance to drought or heat stress. The objectives of this study were to investigate the physiological effects of GABA on tolerance of creeping bentgrass (Agrostis stolonifera to heat and drought stress and to determine whether enhanced heat and drought tolerance due to GABA treatment was associated with the up-regulation of selected genes and transcriptional factors involved in stress protection. Creeping bentgrass (cultivar “Penncross” plants were treated with 0.5 mM GABA or water (untreated control as a foliar spray and were subsequently exposed to heat stress (35/30 °C, day/night, drought stress by withholding irrigation, or non-stress conditions in controlled-environment growth chambers. Exogenous application of GABA significantly improved plant tolerance to heat and drought stress, as reflected by increased leaf water content, cell membrane stability, and chlorophyll content. The analysis of gene transcript level revealed that exogenous GABA up-regulated the expression of ABF3, POD, APX, HSP90, DHN3, and MT1 during heat stress and the expression of CDPK26, MAPK1, ABF3, WRKY75, MYB13, HSP70, MT1, 14-3-3, and genes (SOD, CAT, POD, APX, MDHAR, DHAR, and GR encoding antioxidant enzymes during drought stress. The up-regulation of the aforementioned stress-protective genes and transcriptional factors could contribute to improved heat and drought tolerance in creeping bentgrass.

  5. Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA) Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera).

    Science.gov (United States)

    Li, Zhou; Peng, Yan; Huang, Bingru

    2018-05-31

    Gamma-aminobutyric acid (GABA) may play a positive role in regulating plant tolerance to drought or heat stress. The objectives of this study were to investigate the physiological effects of GABA on tolerance of creeping bentgrass ( Agrostis stolonifera ) to heat and drought stress and to determine whether enhanced heat and drought tolerance due to GABA treatment was associated with the up-regulation of selected genes and transcriptional factors involved in stress protection. Creeping bentgrass (cultivar "Penncross") plants were treated with 0.5 mM GABA or water (untreated control) as a foliar spray and were subsequently exposed to heat stress (35/30 °C, day/night), drought stress by withholding irrigation, or non-stress conditions in controlled-environment growth chambers. Exogenous application of GABA significantly improved plant tolerance to heat and drought stress, as reflected by increased leaf water content, cell membrane stability, and chlorophyll content. The analysis of gene transcript level revealed that exogenous GABA up-regulated the expression of ABF3 , POD , APX , HSP90 , DHN3 , and MT1 during heat stress and the expression of CDPK26 , MAPK1 , ABF3 , WRKY75 , MYB13 , HSP70 , MT1 , 14-3-3 , and genes ( SOD , CAT , POD , APX , MDHAR , DHAR , and GR ) encoding antioxidant enzymes during drought stress. The up-regulation of the aforementioned stress-protective genes and transcriptional factors could contribute to improved heat and drought tolerance in creeping bentgrass.

  6. Co-silencing of tomato S-adenosylhomocysteine hydrolase genes confers increased immunity against Pseudomonas syringae pv. tomato DC3000 and enhanced tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    Li Xiao Hui

    2015-09-01

    Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.

  7. Improvement of stress tolerance and leavening ability under multiple baking-associated stress conditions by overexpression of the SNR84 gene in baker's yeast.

    Science.gov (United States)

    Lin, Xue; Zhang, Cui-Ying; Bai, Xiao-Wen; Feng, Bing; Xiao, Dong-Guang

    2015-03-16

    During the bread-making process, industrial baker's yeast cells are exposed to multiple baking-associated stresses, such as elevated high-temperature, high-sucrose and freeze-thaw stresses. There is a high demand for baker's yeast strains that could withstand these stresses with high leavening ability. The SNR84 gene encodes H/ACA snoRNA (small nucleolar RNA), which is known to be involved in pseudouridylation of the large subunit rRNA. However, the function of the SNR84 gene in baker's yeast coping with baking-associated stresses remains unclear. In this study, we explored the effect of SNR84 overexpression on baker's yeast which was exposed to high-temperature, high-sucrose and freeze-thaw stresses. These results suggest that overexpression of the SNR84 gene conferred tolerance of baker's yeast cells to high-temperature, high-sucrose and freeze-thaw stresses and enhanced their leavening ability in high-sucrose and freeze-thaw dough. These findings could provide a valuable insight for breeding of novel stress-resistant baker's yeast strains that are useful for baking. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Overexpression of SoCYP85A1, a Spinach Cytochrome p450 Gene in Transgenic Tobacco Enhances Root Development and Drought Stress Tolerance

    Directory of Open Access Journals (Sweden)

    Fangmeng Duan

    2017-11-01

    Full Text Available Brassinosteroids (BRs play an essential role in plant growth, development, and responses to diverse abiotic stresses. However, previous studies mainly analyzed how exogenous BRs influenced plant physiological reactions to drought stress, therefore, genetic evidences for the endogenous BRs-mediated regulation of plant responses still remain elusive. In this study, a key BRs biosynthetic gene, SoCYP85A1 was cloned from Spinacia oleracea, which has a complete open reading frame of 1,392 bp encoding a 464 amino acid peptide and shares high sequence similarities with CYP85A1 from other plants. The expression of SoCYP85A1 which was higher in leaf compared with root and stem, was induced by treatments of PEG6000, abscisic acid (ABA, low temperature and high salt. Increases in both SoCYP85A1 transcripts and endogenous BRs in transgenic tobacco which resulted in longer primary root and more lateral roots enhanced drought tolerance compared with wild types. The transgenic tobacco accumulated much lower levels of reactive oxygen species and malondialdehyde (MDA than wild types did, accompanied by significantly higher content of proline and notably enhanced activities of antioxidant enzymes. Besides, transcriptional expressions of six stress-responsive genes were regulated to higher levels in transgenic lines under drought stress. Taken together, our results demonstrated that SoCYP85A1 involves in response to drought stress by promoting root development, scavenging ROS, and regulating expressions of stress-responsive genes.

  9. Effects of a healthy Nordic diet on gene expression changes in peripheral blood mononuclear cells in response to an oral glucose tolerance test in subjects with metabolic syndrome

    DEFF Research Database (Denmark)

    Leder, Lena; Kolehmainen, Marjukka; Narverud, Ingunn

    2016-01-01

    BACKGROUND: Diet has a great impact on the risk of developing features of metabolic syndrome (MetS), type 2 diabetes mellitus (T2DM), and cardiovascular diseases (CVD). We evaluated whether a long-term healthy Nordic diet (ND) can modify the expression of inflammation and lipid metabolism......-related genes in peripheral blood mononuclear cells (PBMCs) during a 2-h oral glucose tolerance test (OGTT) in individuals with MetS. METHODS: A Nordic multicenter randomized dietary study included subjects (n = 213) with MetS, randomized to a ND group or a control diet (CD) group applying an isocaloric study......, and the mRNA gene expression analysis was measured by quantitative real-time polymerase chain reaction (qPCR). We analyzed the mRNA expression changes of 44 genes before and after a 2hOGTT at the beginning and the end of the intervention. RESULTS: The healthy ND significantly down-regulated the expression...

  10. Overexpression of wheat ferritin gene TaFER-5B enhances tolerance to heat stress and other abiotic stresses associated with the ROS scavenging.

    Science.gov (United States)

    Zang, Xinshan; Geng, Xiaoli; Wang, Fei; Liu, Zhenshan; Zhang, Liyuan; Zhao, Yue; Tian, Xuejun; Ni, Zhongfu; Yao, Yingyin; Xin, Mingming; Hu, Zhaorong; Sun, Qixin; Peng, Huiru

    2017-01-14

    The yield of wheat (Triticum aestivum L.), an important crop, is adversely affected by heat stress in many regions of the world. However, the molecular mechanisms underlying thermotolerance are largely unknown. A novel ferritin gene, TaFER, was identified from our previous heat stress-responsive transcriptome analysis of a heat-tolerant wheat cultivar (TAM107). TaFER was mapped to chromosome 5B and named TaFER-5B. Expression pattern analysis revealed that TaFER-5B was induced by heat, polyethylene glycol (PEG), H 2 O 2 and Fe-ethylenediaminedi(o-hydroxyphenylacetic) acid (Fe-EDDHA). To confirm the function of TaFER-5B in wheat, TaFER-5B was transformed into the wheat cultivar Jimai5265 (JM5265), and the transgenic plants exhibited enhanced thermotolerance. To examine whether the function of ferritin from mono- and dico-species is conserved, TaFER-5B was transformed into Arabidopsis, and overexpression of TaFER-5B functionally complemented the heat stress-sensitive phenotype of a ferritin-lacking mutant of Arabidopsis. Moreover, TaFER-5B is essential for protecting cells against heat stress associated with protecting cells against ROS. In addition, TaFER-5B overexpression also enhanced drought, oxidative and excess iron stress tolerance associated with the ROS scavenging. Finally, TaFER-5B transgenic Arabidopsis and wheat plants exhibited improved leaf iron content. Our results suggest that TaFER-5B plays an important role in enhancing tolerance to heat stress and other abiotic stresses associated with the ROS scavenging.

  11. Bacillus amyloliquefaciens Confers Tolerance to Various Abiotic Stresses and Modulates Plant Response to Phytohormones through Osmoprotection and Gene Expression Regulation in Rice

    Directory of Open Access Journals (Sweden)

    Shalini Tiwari

    2017-08-01

    Full Text Available Being sessile in nature, plants have to withstand various adverse environmental stress conditions including both biotic and abiotic stresses. Comparatively, abiotic stresses such as drought, salinity, high temperature, and cold pose major threat to agriculture by negatively impacting plant growth and yield worldwide. Rice is one of the most widely consumed staple cereals across the globe, the production and productivity of which is also severely affected by different abiotic stresses. Therefore, several crop improvement programs are directed toward developing stress tolerant rice cultivars either through marker assisted breeding or transgenic technology. Alternatively, some known rhizospheric competent bacteria are also known to improve plant growth during abiotic stresses. A plant growth promoting rhizobacteria (PGPR, Bacillus amyloliquefaciens NBRI-SN13 (SN13 was previously reported by our lab to confer salt stress tolerance to rice seedlings. However, the present study investigates the role of SN13 in ameliorating various abiotic stresses such as salt, drought, desiccation, heat, cold, and freezing on a popular rice cv. Saryu-52 under hydroponic growth conditions. Apart from this, seedlings were also exogenously supplied with abscisic acid (ABA, salicylic acid (SA, jasmonic acid (JA and ethephon (ET to study the role of SN13 in phytohormone-induced stress tolerance as well as its role in abiotic and biotic stress cross-talk. All abiotic stresses and phytohormone treatments significantly affected various physiological and biochemical parameters like membrane integrity and osmolyte accumulation. SN13 also positively modulated stress-responsive gene expressions under various abiotic stresses and phytohormone treatments suggesting its multifaceted role in cross-talk among stresses and phytohormones in response to PGPR. To the best of our knowledge, this is the first report on detailed analysis of plant growth promotion and stress alleviation by a

  12. Anodizing Aluminum with Frills.

    Science.gov (United States)

    Doeltz, Anne E.; And Others

    1983-01-01

    "Anodizing Aluminum" (previously reported in this journal) describes a vivid/relevant laboratory experience for general chemistry students explaining the anodizing of aluminum in sulfuric acid and constrasting it to electroplating. Additions to this procedure and the experiment in which they are used are discussed. Reactions involved are…

  13. Is the Aluminum Hypothesis Dead?

    Science.gov (United States)

    2014-01-01

    The Aluminum Hypothesis, the idea that aluminum exposure is involved in the etiology of Alzheimer disease, dates back to a 1965 demonstration that aluminum causes neurofibrillary tangles in the brains of rabbits. Initially the focus of intensive research, the Aluminum Hypothesis has gradually been abandoned by most researchers. Yet, despite this current indifference, the Aluminum Hypothesis continues to attract the attention of a small group of scientists and aluminum continues to be viewed with concern by some of the public. This review article discusses reasons that mainstream science has largely abandoned the Aluminum Hypothesis and explores a possible reason for some in the general public continuing to view aluminum with mistrust. PMID:24806729

  14. Metagenomic identification of a novel salt tolerance gene from the human gut microbiome which encodes a membrane protein with homology to a brp/blh-family β-carotene 15,15'-monooxygenase.

    Directory of Open Access Journals (Sweden)

    Eamonn P Culligan

    Full Text Available The human gut microbiome consists of at least 3 million non-redundant genes, 150 times that of the core human genome. Herein, we report the identification and characterisation of a novel stress tolerance gene from the human gut metagenome. The locus, assigned brpA, encodes a membrane protein with homology to a brp/blh-family β-carotene monooxygenase. Cloning and heterologous expression of brpA in Escherichia coli confers a significant salt tolerance phenotype. Furthermore, when cultured in the presence of exogenous β-carotene, cell pellets adopt a red/orange pigmentation indicating the incorporation of carotenoids in the cell membrane.

  15. The aluminum smelting process.

    Science.gov (United States)

    Kvande, Halvor

    2014-05-01

    This introduction to the industrial primary aluminum production process presents a short description of the electrolytic reduction technology, the history of aluminum, and the importance of this metal and its production process to modern society. Aluminum's special qualities have enabled advances in technologies coupled with energy and cost savings. Aircraft capabilities have been greatly enhanced, and increases in size and capacity are made possible by advances in aluminum technology. The metal's flexibility for shaping and extruding has led to architectural advances in energy-saving building construction. The high strength-to-weight ratio has meant a substantial reduction in energy consumption for trucks and other vehicles. The aluminum industry is therefore a pivotal one for ecological sustainability and strategic for technological development.

  16. SlbZIP38, a Tomato bZIP Family Gene Downregulated by Abscisic Acid, Is a Negative Regulator of Drought and Salt Stress Tolerance

    Science.gov (United States)

    Pan, Yanglu; Hu, Xin; Li, Chunyan; Xu, Xing; Su, Chenggang; Li, Jinhua; Song, Hongyuan; Zhang, Xingguo; Pan, Yu

    2017-01-01

    The basic leucine zipper (bZIP) transcription factors have crucial roles in plant stress responses. In this study, the bZIP family gene SlbZIP38 (GenBank accession No: XM004239373) was isolated from a tomato (Solanum lycopersicum cv. Ailsa Craig) mature leaf cDNA library. The DNA sequence of SlbZIP38 encodes a protein of 484 amino acids, including a highly conserved bZIP DNA-binding domain in the C-terminal region. We found that SlbZIP38 was differentially expressed in various organs of the tomato plant and was downregulated by drought, salt stress, and abscisic acid (ABA). However, overexpression of SlbZIP38 significantly decreased drought and salt stress tolerance in tomatoes (Ailsa Craig). The findings that SlbZIP38 overexpression reduced the chlorophyll and free proline content in leaves but increased the malondialdehyde content may explain the reduced drought and salt tolerance observed in these lines. These results suggest that SlbZIP38 is a negative regulator of drought and salt resistance that acts by modulating ABA signaling. PMID:29261143

  17. Constitutive and stress-inducible overexpression of a native aquaporin gene (MusaPIP2;6) in transgenic banana plants signals its pivotal role in salt tolerance.

    Science.gov (United States)

    Sreedharan, Shareena; Shekhawat, Upendra K Singh; Ganapathi, Thumballi R

    2015-05-01

    High soil salinity constitutes a major abiotic stress and an important limiting factor in cultivation of crop plants worldwide. Here, we report the identification and characterization of a aquaporin gene, MusaPIP2;6 which is involved in salt stress signaling in banana. MusaPIP2;6 was firstly identified based on comparative analysis of stressed and non-stressed banana tissue derived EST data sets and later overexpression in transgenic banana plants was performed to study its tangible functions in banana plants. The overexpression of MusaPIP2;6 in transgenic banana plants using constitutive or inducible promoter led to higher salt tolerance as compared to equivalent untransformed control plants. Cellular localization assay performed using transiently transformed onion peel cells indicated that MusaPIP2;6 protein tagged with green fluorescent protein was translocated to the plasma membrane. MusaPIP2;6-overexpressing banana plants displayed better photosynthetic efficiency and lower membrane damage under salt stress conditions. Our results suggest that MusaPIP2;6 is involved in salt stress signaling and tolerance in banana.

  18. The wheat NHX antiporter gene TaNHX2 confers salt tolerance in transgenic alfalfa by increasing the retention capacity of intracellular potassium.

    Science.gov (United States)

    Zhang, Yan-Min; Zhang, Hong-Mei; Liu, Zi-Hui; Li, Hui-Cong; Guo, Xiu-Lin; Li, Guo-Liang

    2015-02-01

    Previous studies have shown that TaNHX2 transgenic alfalfa (Medicago sativa L.) accumulated more K(+) and less Na(+) in leaves than did the wild-type plants. To investigate whether the increased K(+) accumulation in transgenic plants is attributed to TaNHX2 gene expression and whether the compartmentalization of Na(+) into vacuoles or the intracellular compartmentalization of potassium is the critical mechanism for TaNHX2-dependent salt tolerance in transgenic alfalfa, aerated hydroponic culture was performed under three different stress conditions: control condition (0.1 mM Na(+) and 6 mM K(+) inside culture solution), K(+)-sufficient salt stress (100 mM NaCl and 6 mM K(+)) and K(+)-insufficient salt stress (100 mM NaCl and 0.1 mM K(+)). The transgenic alfalfa plants had lower K(+) efflux through specific K(+) channels and higher K(+) absorption through high-affinity K(+) transporters than did the wild-type plants. Therefore, the transgenic plants had greater K(+) contents and [K(+)]/[Na(+)] ratios in leaf tissue and cell sap. The intracellular compartmentalization of potassium is critical for TaNHX2-induced salt tolerance in transgenic alfalfa.

  19. MaHog1, a Hog1-type mitogen-activated protein kinase gene, contributes to stress tolerance and virulence of the entomopathogenic fungus Metarhizium acridum.

    Science.gov (United States)

    Jin, Kai; Ming, Yue; Xia, Yu Xian

    2012-12-01

    Fungal biocontrol agents have great potential in integrated pest management. However, poor efficacy and sensitivity to various adverse factors have hampered their wide application. In eukaryotic cells, Hog1 kinase plays a critical role in stress responses. In this study, MaHog1 (GenBank accession no. EFY85878), encoding a member of the Hog1/Sty1/p38 mitogen-activated protein kinase family in Metarhizium (Me.) acridum, was identified. Targeted gene disruption was used to analyse the role of MaHog1 in virulence and tolerance of adverse factors. Mutants with MaHog1 depletion showed increased sensitivity to high osmotic stress, high temperature and oxidative stress, and exhibited remarkable resistance to cell wall-disturbing agents. These results suggest that Hog1 kinase has a conserved function in regulating multistress responses among fungi, and that MaHog1 might influence cell wall biogenesis in Me. acridum. Bioassays conducted with topical inoculation and intrahaemocoel injection revealed that MaHog1 is required for both penetration and postpenetration development of Me. acridum. MaHog1 disruption resulted in a significant reduction in virulence, likely due to the combination of a decrease in conidial germination, a reduction in appressorium formation and a decline in growth rate in insect haemolymph, which might be caused by impairing fungal tolerance of various stresses during infection.

  20. OsLEA3-2, an abiotic stress induced gene of rice plays a key role in salt and drought tolerance.

    Directory of Open Access Journals (Sweden)

    Jianli Duan

    Full Text Available Late embryogenesis abundant (LEA proteins are involved in tolerance to drought, cold and high salinity in many different organisms. In this report, a LEA protein producing full-length gene OsLEA3-2 was identified in rice (Oryza sativa using the Rapid Amplification of cDNA Ends (RACE method. OsLEA3-2 was found to be only expressed in the embryo and can be induced by abiotic stresses. The coding protein localizes to the nucleus and overexpression of OsLEA3-2 in yeast improved growth performance compared with control under salt- and osmotic-stress conditions. OsLEA3-2 was also inserted into pHB vector and overexpressed in Arabidopsis and rice. The transgenic Arabidopsis seedlings showed better growth on MS media supplemented with 150 mM mannitol or 100 mM NaCl as compared with wild type plants. The transgenic rice also showed significantly stronger growth performance than control under salinity or osmotic stress conditions and were able to recover after 20 days of drought stress. In vitro analysis showed that OsLEA3-2 was able to protect LDH from aggregation on freezing and inactivation on desiccation. These results indicated that OsLEA3-2 plays an important role in tolerance to abiotic stresses.

  1. Mechanism of Gene Expression of Arabidopsis Glutathione S-Transferase, AtGST1, and AtGST11 in Response to Aluminum Stress1

    Science.gov (United States)

    Ezaki, Bunichi; Suzuki, Masakatsu; Motoda, Hirotoshi; Kawamura, Masako; Nakashima, Susumu; Matsumoto, Hideaki

    2004-01-01

    The gene expression of two Al-induced Arabidopsis glutathione S-transferase genes, AtGST1 and AtGST11, was analyzed to investigate the mechanism underlying the response to Al stress. An approximately 1-kb DNA fragment of the 5′-upstream region of each gene was fused to a β-glucuronidase (GUS) reporter gene (pAtGST1::GUS and pAtGST11::GUS) and introduced into Arabidopsis ecotype Landsberg erecta. The constructed transgenic lines showed a time-dependent gene expression to a different degree in the root and/or leaf by Al stress. The pAtGST1::GUS gene was induced after a short Al treatment (maximum expression after a 2-h exposure), while the pAtGST11::GUS gene was induced by a longer Al treatment (approximately 8 h for maximum expression). Since the gene expression was observed in the leaf when only the root was exposed to Al stress, a signaling system between the root and shoot was suggested in Al stress. A GUS staining experiment using an adult transgenic line carrying the pAtGST11::GUS gene supported this suggestion. Furthermore, Al treatment simultaneously with various Ca depleted conditions in root region enhanced the gene expression of the pAtGST11::GUS in the shoot region. This result suggested that the degree of Al toxicity in the root reflects the gene response of pAtGST11::GUS in the shoot via the deduced signaling system. Both transgenic lines also showed an increase of GUS activity after cold stress, heat stress, metal toxicity, and oxidative damages, suggesting a common induction mechanism in response to the tested stresses including Al stress. PMID:15047894

  2. A novel cold-regulated gene from Camellia sinensis, CsCOR1, enhances salt- and dehydration-tolerance in tobacco

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xian-Wen, E-mail: xianwenli01@sina.com [College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science, Xinyang Normal University, Xinyang 464000 (China); Key Laboratory of Horticultural Plant Biology of the Ministry of Education, Huazhong Agricultural University, Wuhan 430070 (China); Feng, Zhi-Guo; Yang, Hui-Min; Zhu, Xiao-Pei [College of Life Science, Xinyang Normal University, Xinyang 464000 (China); Liu, Jun, E-mail: liujun@mail.hzau.edu.cn [College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Key Laboratory of Horticultural Plant Biology of the Ministry of Education, Huazhong Agricultural University, Wuhan 430070 (China); Yuan, Hong-Yu, E-mail: yhongyu92@163.com [College of Life Science, Xinyang Normal University, Xinyang 464000 (China)

    2010-04-02

    In present research, the full-length cDNA and the genomic sequence of a novel cold-regulated gene, CsCOR1, were isolated from Camellia sinensis L. The deduced protein CsCOR1 contains a hydrophobic N-terminus as a signal peptide and a hydrophilic C-terminal domain that is rich in glycine, arginine and proline. Two internal repetitive tridecapeptide fragments (HSVTAGRGGYNRG) exist in the middle of the C-terminal domain and the two nucleotide sequences encoding them are identical. CsCOR1 was localized in the cell walls of transgenic-tobaccos via CsCOR1::GFP fusion approach. The expression of CsCOR1 in tea leaves was enhanced dramatically by both cold- and dehydration-stress. And overexpression of CsCOR1 in transgenic-tobaccos improved obviously the tolerance to salinity and dehydration.

  3. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone’s level of tolerance

    Science.gov (United States)

    As many of the tolerant cacao clones are slowly losing the tolerance against Frosty pod rot (FPR) caused by Moniliophthora roreri, the knowledge of this tolerance at the molecular level can help to generate more stable tolerant clone against FPR. RNA-Seq analysis was carried out to obtain a comparat...

  4. Plastid-expressed betaine aldehyde dehydrogenase gene in carrot cultured cells, roots, and leaves confers enhanced salt tolerance.

    Science.gov (United States)

    Kumar, Shashi; Dhingra, Amit; Daniell, Henry

    2004-09-01

    Salinity is one of the major factors that limits geographical distribution of plants and adversely affects crop productivity and quality. We report here high-level expression of betaine aldehyde dehydrogenase (BADH) in cultured cells, roots, and leaves of carrot (Daucus carota) via plastid genetic engineering. Homoplasmic transgenic plants exhibiting high levels of salt tolerance were regenerated from bombarded cell cultures via somatic embryogenesis. Transformation efficiency of carrot somatic embryos was very high, with one transgenic event per approximately seven bombarded plates under optimal conditions. In vitro transgenic carrot cells transformed with the badh transgene were visually green in color when compared to untransformed carrot cells, and this offered a visual selection for transgenic lines. BADH enzyme activity was enhanced 8-fold in transgenic carrot cell cultures, grew 7-fold more, and accumulated 50- to 54-fold more betaine (93-101 micromol g(-1) dry weight of beta-Ala betaine and Gly betaine) than untransformed cells grown in liquid medium containing 100 mm NaCl. Transgenic carrot plants expressing BADH grew in the presence of high concentrations of NaCl (up to 400 mm), the highest level of salt tolerance reported so far among genetically modified crop plants. BADH expression was 74.8% in non-green edible parts (carrots) containing chromoplasts, and 53% in proplastids of cultured cells when compared to chloroplasts (100%) in leaves. Demonstration of plastid transformation via somatic embryogenesis utilizing non-green tissues as recipients of foreign DNA for the first time overcomes two of the major obstacles in extending this technology to important crop plants.

  5. Overexpression of Nictaba-Like Lectin Genes from Glycine max Confers Tolerance towards Pseudomonas syringae Infection, Aphid Infestation and Salt Stress in Transgenic Arabidopsis Plants

    Directory of Open Access Journals (Sweden)

    Sofie Van Holle

    2016-10-01

    Full Text Available Plants have evolved a sophisticated immune system that allows them to recognize invading pathogens by specialized receptors. Carbohydrate-binding proteins or lectins are part of this immune system and especially the lectins that reside in the nucleocytoplasmic compartment are known to be implicated in biotic and abiotic stress responses. The class of Nictaba-like lectins (NLL groups all proteins with homology to the tobacco (Nicotiana tabacum lectin, known as a stress-inducible lectin. Here we focus on two Nictaba homologs from soybean (Glycine max, referred to as GmNLL1 and GmNLL2. Confocal laser scanning microscopy of fusion constructs with the green fluorescent protein either transiently expressed in Nicotiana benthamiana leaves or stably transformed in tobacco BY-2 suspension cells revealed a nucleocytoplasmic localization for the GmNLLs under study. RT-qPCR analysis of the transcript levels for the Nictaba-like lectins in soybean demonstrated that the genes are expressed in several tissues throughout the development of the plant. Furthermore, it was shown that salt treatment, Phytophthora sojae infection and Aphis glycines infestation trigger the expression of particular NLL genes. Stress experiments with Arabidopsis lines overexpressing the NLLs from soybean yielded an enhanced tolerance of the plant towards bacterial infection (Pseudomonas syringae, insect infestation (Myzus persicae and salinity. Our data showed a better performance of the transgenic lines compared to wild type plants, indicating that the NLLs from soybean are implicated in the stress response. These data can help to further elucidate the physiological importance of the Nictaba-like lectins from soybean, which can ultimately lead to the design of crop plants with a better tolerance to changing environmental conditions.

  6. Arabidopsis Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Gene Raf43 Is Required for Tolerance to Multiple Abiotic Stresses.

    Directory of Open Access Journals (Sweden)

    Nasar Virk

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are critical signaling modules that mediate the transduction of extracellular stimuli into intracellular response. A relatively large number of MAPKKKs have been identified in a variety of plant genomes but only a few of them have been studied for their biological function. In the present study, we identified an Arabidopsis Raf-like MAPKKK gene Raf43 and studied its function in biotic and abiotic stress response using a T-DNA insertion mutant raf43-1 and two Raf43-overexpressing lines Raf43-OE#1 and Raf43-OE#13. Expression of Raf43 was induced by multiple abiotic and biotic stresses including treatments with drought, mannitol and oxidative stress or defense signaling molecule salicylic acid and infection with necrotrophic fungal pathogen Botrytis cinerea. Seed germination and seedling root growth of raf43-1 were significantly inhibited on MS medium containing mannitol, NaCl, H2O2 or methyl viologen (MV while seed germination and seedling root growth of the Raf43-OE#1 and Raf43-OE#13 lines was similar to wild type Col-0 under the above stress conditions. Soil-grown raf43-1 plants exhibited reduced tolerance to MV, drought and salt stress. Abscisic acid inhibited significantly seed germination and seedling root growth of the raf43-1 line but had no effect on the two Raf43-overexpressing lines. Expression of stress-responsive RD17 and DREB2A genes was significantly down-regulated in raf43-1 plants. However, the raf43-1 and Raf43-overexpressing plants showed similar disease phenotype to the wild type plants after infection with B. cinerea or Pseudomonas syringae pv. tomato DC3000. Our results demonstrate that Raf43, encoding for a Raf-like MAPKKK, is required for tolerance to multiple abiotic stresses in Arabidopsis.

  7. The SbASR-1 gene cloned from an extreme halophyte Salicornia brachiata enhances salt tolerance in transgenic tobacco.

    Science.gov (United States)

    Jha, Bhavanath; Lal, Sanjay; Tiwari, Vivekanand; Yadav, Sweta Kumari; Agarwal, Pradeep K

    2012-12-01

    Salinity severely affects plant growth and development. Plants evolved various mechanisms to cope up stress both at molecular and cellular levels. Halophytes have developed better mechanism to alleviate the salt stress than glycophytes, and therefore, it is advantageous to study the role of different genes from halophytes. Salicornia brachiata is an extreme halophyte, which grows luxuriantly in the salty marshes in the coastal areas. Earlier, we have isolated SbASR-1 (abscisic acid stress ripening-1) gene from S. brachiata using cDNA subtractive hybridisation library. ASR-1 genes are abscisic acid (ABA) responsive, whose expression level increases under abiotic stresses, injury, during fruit ripening and in pollen grains. The SbASR-1 transcript showed up-regulation under salt stress conditions. The SbASR-1 protein contains 202 amino acids of 21.01-kDa molecular mass and has 79 amino acid long signatures of ABA/WDS gene family. It has a maximum identity (73 %) with Solanum chilense ASR-1 protein. The SbASR-1 has a large number of disorder-promoting amino acids, which make it an intrinsically disordered protein. The SbASR-1 gene was over-expressed under CaMV 35S promoter in tobacco plant to study its physiological functions under salt stress. T(0) transgenic tobacco seeds showed better germination and seedling growth as compared to wild type (Wt) in a salt stress condition. In the leaf tissues of transgenic lines, Na(+) and proline contents were significantly lower, as compared to Wt plant, under salt treatment, suggesting that transgenic plants are better adapted to salt stress.

  8. Ranking of persister genes in the same Escherichia coli genetic background demonstrates varying importance of individual persister genes in tolerance to different antibiotics

    Directory of Open Access Journals (Sweden)

    Nan eWu

    2015-09-01

    Full Text Available Despite the identification of many genes and pathways involved in the persistence phenomenon of bacteria, the relative importance of these genes in a single organism remains unclear. Here, using Escherichia coli as a model, we generated mutants of 21 known candidate persister genes and compared the relative importance of these mutants in persistence to various antibiotics (ampicillin, gentamicin, norfloxacin, and trimethoprim at different times. We found that oxyR, dnaK, sucB, relA, rpoS, clpB, mqsR, and recA were prominent persister genes involved in persistence to multiple antibiotics. These genes map to the following pathways: antioxidative defense pathway (oxyR, global regulators (dnaK, clpB, and rpoS, energy production (sucB, stringent response (relA, toxin–antitoxin (TA module (mqsR, and SOS response (recA. Among the TA modules, the ranking order was mqsR, lon, relE, tisAB, hipA, and dinJ. Intriguingly, rpoS deletion caused a defect in persistence to gentamicin but increased persistence to ampicillin and norfloxacin. Mutants demonstrated dramatic differences in persistence to different antibiotics at different time points: some mutants (oxyR, dnaK, phoU, lon, recA, mqsR, and tisAB displayed defect in persistence from early time points, while other mutants (relE, smpB, glpD, umuD, and tnaA showed defect only at later time points. These results indicate that varying hierarchy and importance of persister genes exist and that persister genes can be divided into those involved in shallow persistence and those involved in deep persistence. Our findings suggest that the persistence phenomenon is a dynamic process with different persister genes playing roles of variable significance at different times. These findings have implications for improved understanding of persistence phenomenon and developing new drugs targeting persisters for more effective cure of persistent infections.

  9. A Novel Wheat C-bZIP Gene, TabZIP14-B, Participates in Salt and Freezing Tolerance in Transgenic Plants

    Directory of Open Access Journals (Sweden)

    Lina Zhang

    2017-05-01

    Full Text Available The group C-bZIP transcription factors (TFs are involved in diverse biological processes, such as the regulation of seed storage protein (SSP production and the responses to pathogen challenge and abiotic stress. However, our knowledge of the abiotic functions of group C-bZIP genes in wheat remains limited. Here, we present the function of a novel TabZIP14-B gene in wheat. This gene belongs to the group C-bZIP TFs and contains six exons and five introns; three haplotypes were identified among accessions of tetraploid and hexaploid wheat. A subcellular localization analysis indicated that TabZIP14-B was targeted to the nucleus of tobacco epidermal cells. A transactivation assay demonstrated that TabZIP14-B showed transcriptional activation ability and was capable of binding the abscisic acid (ABA responsive element (ABRE in yeast. RT-qPCR revealed that TabZIP14-B was expressed in the roots, stems, leaves, and young spikes and was up-regulated by exogenous ABA, salt, low-temperature, and polyethylene glycol (PEG stress treatments. Furthermore, Arabidopsis plants overexpressing TabZIP14-B exhibited enhanced tolerance to salt, freezing stresses and ABA sensitivity. Overexpression of TabZIP14-B resulted in increased expression of the AtRD29A, AtCOR47, AtRD20, AtGSTF6, and AtRAB18 genes and changes in several physiological characteristics. These results suggest that TabZIP14-B could function as a positive regulator in mediating the abiotic stress response.

  10. Identification of aluminum-regulated genes by cDNA-AFLP analysis of roots in two contrasting genotypes of highbush blueberry (Vaccinium corymbosum L.).

    Science.gov (United States)

    Inostroza-Blancheteau, Claudio; Aquea, Felipe; Reyes-Díaz, Marjorie; Alberdi, Miren; Arce-Johnson, Patricio

    2011-09-01

    To investigate the molecular mechanisms of Al(3+)-stress in blueberry, a cDNA-amplified fragment length polymorphism (cDNA-AFLP) analysis was employed to identify Al-regulated genes in roots of contrasting genotypes of highbush blueberry (Brigitta, Al(3+)-resistant and Bluegold, Al(3+)-sensitive). Plants grown in hydroponic culture were treated with 0 and 100 μM Al(3+) and collected at different times over 48 h. Seventy transcript-derived fragments (TDFs) were identified as being Al(3+) responsive, 31 of which showed significant homology to genes with known or putative functions. Twelve TDFs were homologous to uncharacterized genes and 27 did not have significant matches. The expression pattern of several of the genes with known functions in other species was confirmed by quantitative relative real-time RT-PCR. Twelve genes of known or putative function were related to cellular metabolism, nine associated to stress responses and other transcription and transport facilitation processes. Genes involved in signal transduction, photosynthetic and energy processes were also identified, suggesting that a multitude of processes are implicated in the Al(3+)-stress response as reported previously for other species. The Al(3+)-stress response genes identified in this study could be involved in Al(3+)-resistance in woody plants.

  11. X-ray thickness measurement of aluminum alloys

    International Nuclear Information System (INIS)

    Albert, J.J.

    1976-01-01

    The theory of x-ray thickness gauging is extended to reveal the conditions under which a fixed anode voltage is ideal. A mathematical model of an alloy and computations reveal that two voltages can be used to measure the aluminum alloys with an error of roughly 1 percent, determined by the tolerance on manganese content rather than the large errors ordinarily a consequence of the tolerances on copper and zinc content. Implementation is discussed

  12. Interpopulation differences in expression of candidate genes for salinity tolerance in winter migrating anadromous brown trout ( Salmo trutta L.)

    DEFF Research Database (Denmark)

    Larsen, Peter Foged; Eg Nielsen, Einar; Koed, Anders

    2008-01-01

    Background: Winter migration of immature brown trout (Salmo trutta) into freshwater rivers has been hypothesized to result from physiologically stressful combinations of high salinity and low temperature in the sea. Results: We sampled brown trout from two Danish populations entering different...... conditions in the sea drive sea-run brown trout into freshwater rivers in winter. However, our results also demonstrate intra-specific differences in expression of important stress and osmoregulative genes most likely reflecting adaptive differences between trout populations on a regional scale, thus...... was found in trout from the river entering high saline conditions, while a temperature independent up-regulation of both genes in full-strength seawater was found for trout entering marine conditions with lower salinities. Conclusion: Overall our results support the hypothesis that physiologically stressful...

  13. Interpopulation differences in expression of candidate genes for salinity tolerance in winter migrating anadromous brown trout (Salmo trutta L.

    Directory of Open Access Journals (Sweden)

    Thomsen Dennis S

    2008-01-01

    Full Text Available Abstract Background Winter migration of immature brown trout (Salmo trutta into freshwater rivers has been hypothesized to result from physiologically stressful combinations of high salinity and low temperature in the sea. Results We sampled brown trout from two Danish populations entering different saline conditions and quantified expression of the hsp70 and Na/K-ATPases α 1b genes following acclimation to freshwater and full-strength seawater at 2°C and 10°C. An interaction effect of low temperature and high salinity on expression of both hsp70 and Na/K-ATPase α 1b was found in trout from the river entering high saline conditions, while a temperature independent up-regulation of both genes in full-strength seawater was found for trout entering marine conditions with lower salinities. Conclusion Overall our results support the hypothesis that physiologically stressful conditions in the sea drive sea-run brown trout into freshwater rivers in winter. However, our results also demonstrate intra-specific differences in expression of important stress and osmoregulative genes most likely reflecting adaptive differences between trout populations on a regional scale, thus strongly suggesting local adaptations driven by the local marine environment.

  14. Crescimento em vasos, de cultivares de soja e de trigo em função da saturação de alumínio Tolerance of soybean and wheat varieties in sub-soil high in exchangeable aluminum

    Directory of Open Access Journals (Sweden)

    H.A.A. Mascarenhas

    1995-08-01

    parameter measured (height of the plant, number of nodes, lenght of internodes, number of trifoliate leaves, dry matter weights of shoots and roots there were no significant differences within each variety for the concentration of aluminum saturation, showing that the three varieties were tolerant to Al. These results were confirmed with two wheat varieties BH-1146 (tolerant to Al and Siete Cerros (susceptible which were sown in the same pots. The variety BH-1146 did no show root lenght differences for the Al saturation treaments confirming its tolerance. On the other hand the cultivar Siete Cerros showed increase hi root lenght as the Al saturation was reduced, showing its suscebility.

  15. Gene manipulation for salt tolerance and blast resistance through in vitro techniques in rice (Oryza sativa L.)

    International Nuclear Information System (INIS)

    Reddy, G.M.

    1990-01-01

    Full text: Rice calli generally lose regenerating ability in about 90 days. However, plant regeneration (60-70%) from 1500 day old embryo calli of 'Thellahamsa' cultivar has been established with 3% sorbitol/mannitol on LS media for efficient genetic manipulation at the cellular level. Matured embryo calli of four susceptible cultivars, 'Tellahamsa', 'Jaya', 'HR-2' and 'Zenith' were irradiated (0.1-0.5 kR) and challenged with Pyricularia oryzae spore suspensions (10 5 /ml) and with the major toxin d-picolinic acid (125-200 ppm). A total of 514 plants were regenerated from the resistant calli. The TC-2 plants exhibited varying degrees of resistance (66-78%). The genetic basis of resistance of regenerated plants and their progeny may help in understanding the mechanism. Rice embryo calli of nine scented and non-scented cultivars were challenged with NaCI (0.5-2%) and 25-50% sea water with or without proline. A total of 222 plants were regenerated. The progeny of TC-2 plants were evaluated with normal and saline soil (EC 13.5 ds/m) for yield parameters. These studies suggested that stable tolerant TC-2 plants under stress exhibited superior yield parameters and the salinity index ranged from 89.4-98.4. (author)

  16. Gene manipulation for salt tolerance and blast resistance through in vitro techniques in rice (Oryza sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, G M [Department of Genetics, Osmania University, Hyderabad (India)

    1990-01-01

    Full text: Rice calli generally lose regenerating ability in about 90 days. However, plant regeneration (60-70%) from 1500 day old embryo calli of 'Thellahamsa' cultivar has been established with 3% sorbitol/mannitol on LS media for efficient genetic manipulation at the cellular level. Matured embryo calli of four susceptible cultivars, 'Tellahamsa', 'Jaya', 'HR-2' and 'Zenith' were irradiated (0.1-0.5 kR) and challenged with Pyricularia oryzae spore suspensions (10{sup 5}/ml) and with the major toxin d-picolinic acid (125-200 ppm). A total of 514 plants were regenerated from the resistant calli. The TC-2 plants exhibited varying degrees of resistance (66-78%). The genetic basis of resistance of regenerated plants and their progeny may help in understanding the mechanism. Rice embryo calli of nine scented and non-scented cultivars were challenged with NaCI (0.5-2%) and 25-50% sea water with or without proline. A total of 222 plants were regenerated. The progeny of TC-2 plants were evaluated with normal and saline soil (EC 13.5 ds/m) for yield parameters. These studies suggested that stable tolerant TC-2 plants under stress exhibited superior yield parameters and the salinity index ranged from 89.4-98.4. (author)

  17. A R2R3-MYB transcription factor gene in common wheat (namely TaMYBsm1) involved in enhancement of drought tolerance in transgenic Arabidopsis.

    Science.gov (United States)

    Li, Meng-Jun; Qiao, Yu; Li, Ya-Qing; Shi, Zhan-Liang; Zhang, Nan; Bi, Cai-Li; Guo, Jin-Kao

    2016-11-01

    We isolated the TaMYBsm1 genes, encoding R2R3-type MYB proteins in common wheat, aimed to uncover the possible molecular mechanisms related to drought response. The TaMYBsm1 genes, TaMYBsm1-A, TaMYBsm1-B and TaMYBsm1-D, were isolated and analyzed from the common wheat cultivar Shimai 15. Their expression patterns under PEG 6000 and mannitol were monitored by semi-quantitative RT-PCR and β-glucuronidase (Gus) assay. The function of TaMYBsm1-D under drought stress in transgenic Arabidopsis plants was investigated, and the germination rate, water loss rate, as well as the proline and malondialdehyde (MDA) content were compared with that in wild type (WT) plants. The expression of three downstream genes (DREB2A, P5CS1 and RD29A) in TaMYBsm1-D transgenic plants was analyzed. The R2R3-MYB domains of the MYBsm1 proteins were highly conserved in plants. In addition, the TaMYBsm1 proteins were targeted to the nucleus and contained transcriptional activation domains (TADs). Gus assay and semi-quantitative RT-PCR analysis demonstrated that the TaMYBsm1 genes were up-regulated when the wheat was treated by PEG and mannitol. Compared with WT plants, the germination rates were much higher, but the water loss rates were much lower in TaMYBsm1-D overexpression plants. TaMYBsm1-D transgenic plants showed distinct higher proline contents but a lower MDA content than the WT plants. The three downstream genes were highly expressed in TaMYBsm1-D transgenic plants. We concluded from these results that TaMYBsm1 genes play an important role in plant drought stress tolerance through up-regulation of DREB2A, P5CS1 and RD29A. The increase of proline content and decrease of MDA content may also be involved in the drought response.

  18. Phytohormones and induction of plant-stress tolerance and defense genes by seed and foliar inoculation with Azospirillum brasilense cells and metabolites promote maize growth.

    Science.gov (United States)

    Fukami, Josiane; Ollero, Francisco Javier; Megías, Manuel; Hungria, Mariangela

    2017-12-01

    seeds or by leaf spray, as well as of leaf spraying of Azospirillum metabolites, are strongly correlated with the synthesis of phytohormones and by eliciting genes related to plant-stress tolerance and defense against pathogens.

  19. A temperature-tolerant multiplex elements and genes screening system for genetically modified organisms based on dual priming oligonucleotide primers and capillary electrophoresis.

    Science.gov (United States)

    Fu, Wei; Wei, Shuang; Wang, Chenguang; Du, Zhixin; Zhu, Pengyu; Wu, Xiyang; Wu, Gang; Zhu, Shuifang

    2017-08-15

    High throughput screening systems are the preferred solution to meet the urgent requirement of increasing number of genetically modified organisms (GMOs). In this study, we have successfully developed a multiplex GMO element screening system with dual priming oligonucleotide (DPO) primers. This system can detect the cauliflower mosaic virus 35S (CaMV 35S), terminator of nopaline synthase gene (NOS), figwort mosaic virus 35S (FMV 35S) promoter, neomycin phosphotransferaseII (NPTII), Bt Cry 1Ab, phosphinothricin acetyltransferase genes (bar) and Streptomyces viridochromogenes (pat) simultaneously, which covers more than 90% of all authorized GMO species worldwide. This system exhibits a high tolerance to annealing temperatures, high specificity and a limit of detection equal to conventional PCR. A total of 214 samples from markets, national entry-exit agencies, the Institute for Reference Materials and Measurement (IRMM) and the American Oil Chemists' Society (AOCS) were also tested for applicability. This screening system is therefore suitable for GMO screening. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Overexpression of HARDY, an AP2/ERF gene from Arabidopsis, improves drought and salt tolerance by reducing transpiration and sodium uptake in transgenic Trifolium alexandrinum L.

    Science.gov (United States)

    Abogadallah, Gaber M; Nada, Reham M; Malinowski, Robert; Quick, Paul

    2011-06-01

    Trifolium alexandrinum L. was transformed with the Arabidopsis HARDY gene that belongs to the stress-related AP2/ERF (APETALA2/ethylene responsive element binding factors) superfamily of transcription factors. The fresh weights of the transgenic lines L2 and L3 were improved by 42 and 55% under drought stress and by 38 and 95% under salt stress compared to the wild type, respectively. The dry weights were similarly improved. Overexpression of HARDY improved the instantaneous water use efficiency (WUE) under drought stress by reducing transpiration (E) and under salt stress by improving photosynthesis (A), through reducing Na+ accumulation in leaves, and reducing E. However, HARDY improved the growth of drought-stressed transgenic plants as compared to the wild type by delaying water depletion from soil and preventing rapid decline in A. L2 and L3 had thicker stems and in case of L3, more xylem rows per vascular bundle, which may have made L3 more resistant to lodging in the field. Field performance of L2 and L3 under combined drought and salt stress was significantly better than that of the wild type in terms of fresh and dry weights (40%, 46% and 31%, 40%, respectively). The results provide further evidence for the efficiency of overexpression of a single gene in improving tolerance to abiotic stress under field conditions.

  1. Studies of the Pro12Ala polymorphism of the peroxisome proliferator-activated receptor-gamma2 (PPAR-gamma2) gene in relation to insulin sensitivity among glucose tolerant caucasians

    DEFF Research Database (Denmark)

    Ek, J; Andersen, G; Urhammer, S A

    2001-01-01

    We examined whether the Pro12-Ala polymorphism of the human peroxisome proliferator-activated receptor-gamma2 (PPAR-gamma2) gene was related to altered insulin sensitivity among glucose-tolerant subjects or a lower accumulated incidence or prevalence of IGT and Type II (non-insulin-dependent) dia......-insulin-dependent) diabetes mellitus among Scandinavian Caucasians....

  2. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  3. Advances in aluminum anodizing

    Science.gov (United States)

    Dale, K. H.

    1969-01-01

    White anodize is applied to aluminum alloy surfaces by specific surface preparation, anodizing, pigmentation, and sealing techniques. The development techniques resulted in alloys, which are used in space vehicles, with good reflectance values and excellent corrosive resistance.

  4. Corrosion Inhibitors for Aluminum.

    Science.gov (United States)

    Muller, Bodo

    1995-01-01

    Describes a simple and reliable test method used to investigate the corrosion-inhibiting effects of various chelating agents on aluminum pigments in aqueous alkaline media. The experiments that are presented require no complicated or expensive electronic equipment. (DDR)

  5. Corrosion Protection of Aluminum

    Science.gov (United States)

    Dalrymple, R. S.; Nelson, W. B.

    1963-07-01

    Treatment of aluminum-base metal surfaces in an autoclave with an aqueous chromic acid solution of 0.5 to 3% by weight and of pH below 2 for 20 to 50 hrs at 160 to 180 deg C produces an extremely corrosion-resistant aluminum oxidechromium film on the surface. A chromic acid concentration of 1 to 2% and a pH of about 1 are preferred.

  6. Genome-wide association analysis for heat tolerance at flowering detected a large set of genes involved in adaptation to thermal and other stresses.

    Directory of Open Access Journals (Sweden)

    Tanguy Lafarge

    Full Text Available Fertilization sensitivity to heat in rice is a major issue within climate change scenarios in the tropics. A panel of 167 indica landraces and improved varieties was phenotyped for spikelet sterility (SPKST under 38°C during anthesis and for several secondary traits potentially affecting panicle micro-climate and thus the fertilization process. The panel was genotyped with an average density of one marker per 29 kb using genotyping by sequencing. Genome-wide association analyses (GWAS were conducted using three methods based on single marker regression, haplotype regression and simultaneous fitting of all markers, respectively. Fourteen loci significantly associated with SPKST under at least two GWAS methods were detected. A large number of associations was also detected for the secondary traits. Analysis of co-localization of SPKST associated loci with QTLs detected in progenies of bi-parental crosses reported in the literature allowed to narrow -down the position of eight of those QTLs, including the most documented one, qHTSF4.1. Gene families underlying loci associated with SPKST corresponded to functions ranging from sensing abiotic stresses and regulating plant response, such as wall-associated kinases and heat shock proteins, to cell division and gametophyte development. Analysis of diversity at the vicinity of loci associated with SPKST within the rice three thousand genomes, revealed widespread distribution of the favourable alleles across O. sativa genetic groups. However, few accessions assembled the favourable alleles at all loci. Effective donors included the heat tolerant variety N22 and some Indian and Taiwanese varieties. These results provide a basis for breeding for heat tolerance during anthesis and for functional validation of major loci governing this trait.

  7. Chrysanthemum WRKY gene CmWRKY17 negatively regulates salt stress tolerance in transgenic chrysanthemum and Arabidopsis plants.

    Science.gov (United States)

    Li, Peiling; Song, Aiping; Gao, Chunyan; Wang, Linxiao; Wang, Yinjie; Sun, Jing; Jiang, Jiafu; Chen, Fadi; Chen, Sumei

    2015-08-01

    CmWRKY17 was induced by salinity in chrysanthemum, and it might negatively regulate salt stress in transgenic plants as a transcriptional repressor. WRKY transcription factors play roles as positive or negative regulators in response to various stresses in plants. In this study, CmWRKY17 was isolated from chrysanthemum (Chrysanthemum morifolium). The gene encodes a 227-amino acid protein and belongs to the group II WRKY family, but has an atypical WRKY domain with the sequence WKKYGEK. Our data indicated that CmWRKY17 was localized to the nucleus in onion epidermal cells. CmWRKY17 showed no transcriptional activation in yeast; furthermore, luminescence assay clearly suggested that CmWRKY17 functions as a transcriptional repressor. DNA-binding assay showed that CmWRKY17 can bind to W-box. The expression of CmWRKY17 was induced by salinity in chrysanthemum, and a higher expression level was observed in the stem and leaf compared with that in the root, disk florets, and ray florets. Overexpression of CmWRKY17 in chrysanthemum and Arabidopsis increased the sensitivity to salinity stress. The activities of superoxide dismutase and peroxidase and proline content in the leaf were significantly lower in transgenic chrysanthemum than those in the wild type under salinity stress, whereas electrical conductivity was increased in transgenic plants. Expression of the stress-related genes AtRD29, AtDREB2B, AtSOS1, AtSOS2, AtSOS3, and AtNHX1 was reduced in the CmWRKY17 transgenic Arabidopsis compared with that in the wild-type Col-0. Collectively, these data suggest that CmWRKY17 may increase the salinity sensitivity in plants as a transcriptional repressor.

  8. Transcriptome responses to aluminum stress in roots of aspen (Populus tremula

    Directory of Open Access Journals (Sweden)

    Grisel Nadine

    2010-08-01

    Full Text Available Abstract Background Ionic aluminum (mainly Al3+ is rhizotoxic and can be present in acid soils at concentrations high enough to inhibit root growth. Many forest tree species grow naturally in acid soils and often tolerate high concentrations of Al. Previously, we have shown that aspen (Populus tremula releases citrate and oxalate from roots in response to Al exposure. To obtain further insights into the root responses of aspen to Al, we investigated root gene expression at Al conditions that inhibit root growth. Results Treatment of the aspen roots with 500 μM Al induced a strong inhibition of root growth within 6 h of exposure time. The root growth subsequently recovered, reaching growth rates comparable to that of control plants. Changes in gene expression were determined after 6 h, 2 d, and 10 d of Al exposure. Replicated transcriptome analyses using the Affymetrix poplar genome array revealed a total of 175 significantly up-regulated and 69 down-regulated genes, of which 70% could be annotated based on Arabidopsis genome resources. Between 6 h and 2 d, the number of responsive genes strongly decreased from 202 to 26, and then the number of changes remained low. The responses after 6 h were characterized by genes involved in cell wall modification, ion transport, and oxidative stress. Two genes with prolonged induction were closely related to the Arabidopsis Al tolerance genes ALS3 (for Al sensitive 3 and MATE (for multidrug and toxin efflux protein, mediating citrate efflux. Patterns of expression in different plant organs and in response to Al indicated that the two aspen genes are homologs of the Arabidopsis ALS3 and MATE. Conclusion Exposure of aspen roots to Al results in a rapid inhibition of root growth and a large change in root gene expression. The subsequent root growth recovery and the concomitant reduction in the number of responsive genes presumably reflect the success of the roots in activating Al tolerance mechanisms. The

  9. Transcriptome-Based Identification of the Desiccation Response Genes in Marine Red Algae Pyropia tenera (Rhodophyta) and Enhancement of Abiotic Stress Tolerance by PtDRG2 in Chlamydomonas.

    Science.gov (United States)

    Im, Sungoh; Lee, Ha-Nul; Jung, Hyun Shin; Yang, Sunghwan; Park, Eun-Jeong; Hwang, Mi Sook; Jeong, Won-Joong; Choi, Dong-Woog

    2017-06-01

    Pyropia tenera (Kjellman) are marine red algae that grow in the intertidal zone and lose more than 90% of water during hibernal low tides every day. In order to identify the desiccation response gene (DRG) in P. tenera, we generated 1,444,210 transcriptome sequences using the 454-FLX platform from the gametophyte under control and desiccation conditions. De novo assembly of the transcriptome reads generated 13,170 contigs, covering about 12 Mbp. We selected 1160 differentially expressed genes (DEGs) in response to desiccation stress based on reads per kilobase per million reads (RPKM) expression values. As shown in green higher plants, DEGs under desiccation are composed of two groups of genes for gene regulation networks and functional proteins for carbohydrate metabolism, membrane perturbation, compatible solutes, and specific proteins similar to higher plants. DEGs that show no significant homology with known sequences in public databases were selected as DRGs in P. tenera. PtDRG2 encodes a novel polypeptide of 159 amino acid residues locating chloroplast. When PtDRG2 was overexpressed in Chlamydomonas, the PtDRG2 confer mannitol and salt tolerance in transgenic cells. These results suggest that Pyropia may possess novel genes that differ from green plants, although the desiccation tolerance mechanism in red algae is similar to those of higher green plants. These transcriptome sequences will facilitate future studies to understand the common processes and novel mechanisms involved in desiccation stress tolerance in red algae.

  10. A Medicago truncatula EF-hand family gene, MtCaMP1, is involved in drought and salt stress tolerance.

    Directory of Open Access Journals (Sweden)

    Tian-Zuo Wang

    Full Text Available BACKGROUND: Calcium-binding proteins that contain EF-hand motifs have been reported to play important roles in transduction of signals associated with biotic and abiotic stresses. To functionally characterize genes of EF-hand family in response to abiotic stress, an MtCaMP1 gene belonging to EF-hand family from legume model plant Medicago truncatula was isolated and its function in response to drought and salt stress was investigated by expressing MtCaMP1 in Arabidopsis. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic Arabidopsis seedlings expressing MtCaMP1 exhibited higher survival rate than wild-type seedlings under drought and salt stress, suggesting that expression of MtCaMP1 confers tolerance of Arabidopsis to drought and salt stress. The transgenic plants accumulated greater amounts of Pro due to up-regulation of P5CS1 and down-regulation of ProDH than wild-type plants under drought stress. There was a less accumulation of Na(+ in the transgenic plants than in WT plants due to reduced up-regulation of AtHKT1 and enhanced regulation of AtNHX1 in the transgenic plants compared to WT plants under salt stress. There was a reduced accumulation of H2O2 and malondialdehyde in the transgenic plants than in WT plants under both drought and salt stress. CONCLUSIONS/SIGNIFICANCE: The expression of MtCaMP1 in Arabidopsis enhanced tolerance of the transgenic plants to drought and salt stress by effective osmo-regulation due to greater accumulation of Pro and by minimizing toxic Na(+ accumulation, respectively. The enhanced accumulation of Pro and reduced accumulation of Na(+ under drought and salt stress would protect plants from water default and Na(+ toxicity, and alleviate the associated oxidative stress. These findings demonstrate that MtCaMP1 encodes a stress-responsive EF-hand protein that plays a regulatory role in response of plants to drought and salt stress.

  11. ALUMINUM AND CHROMIUM LEACHING WORKSHOP WHITEPAPER

    International Nuclear Information System (INIS)

    McCabe, D; Jeff Pike, J; Bill Wilmarth, B

    2007-01-01

    A workshop was held on January 23-24, 2007 to discuss the status of processes to leach constituents from High Level Waste (HLW) sludges at the Hanford and Savannah River Sites. The objective of the workshop was to examine the needs and requirements for the HLW flowsheet for each site, discuss the status of knowledge of the leaching processes, communicate the research plans, and identify opportunities for synergy to address knowledge gaps. The purpose of leaching of non-radioactive constituents from the sludge waste is to reduce the burden of material that must be vitrified in the HLW melter systems, resulting in reduced HLW glass waste volume, reduced disposal costs, shorter process schedules, and higher facility throughput rates. The leaching process is estimated to reduce the operating life cycle of SRS by seven years and decrease the number of HLW canisters to be disposed in the Repository by 1000 [Gillam et al., 2006]. Comparably at Hanford, the aluminum and chromium leaching processes are estimated to reduce the operating life cycle of the Waste Treatment Plant by 20 years and decrease the number of canisters to the Repository by 15,000-30,000 [Gilbert, 2007]. These leaching processes will save the Department of Energy (DOE) billions of dollars in clean up and disposal costs. The primary constituents targeted for removal by leaching are aluminum and chromium. It is desirable to have some aluminum in glass to improve its durability; however, too much aluminum can increase the sludge viscosity, glass viscosity, and reduce overall process throughput. Chromium leaching is necessary to prevent formation of crystalline compounds in the glass, but is only needed at Hanford because of differences in the sludge waste chemistry at the two sites. Improving glass formulations to increase tolerance of aluminum and chromium is another approach to decrease HLW glass volume. It is likely that an optimum condition can be found by both performing leaching and improving

  12. Low-P tolerance mechanisms and differential gene expression in contrasting wheat genotypes Mecanismos de tolerância à deficiência de fósforo e expressão diferenciada de genes em genótipos de trigo contrastantes

    Directory of Open Access Journals (Sweden)

    Laize Fraga Espindula

    2009-09-01

    Full Text Available The objectives of this study were to determine low-P tolerance mechanisms in contrasting wheat genotypes and to evaluate the association of these mechanisms to differential gene expression. Wheat seedlings of cultivars Toropi (tolerant to low-P availability and Anahuac (sensitive were evaluated. Seedlings were hydroponically grown in the absence or presence of P (1.0 mmol L-1 during three different time periods: 24, 120 and 240 hours. Free phosphate (Pi and total P contents were measured in shoots and roots. The experiment's design was in randomized blocks with three replicates, each formed by ten plants. The relative expression of genes encoding the malate transporter TaALMT1 and the transcription factor PTF1 was evaluated. Phosphorus starvation beyond ten days increased the expression of TaALMT1 only in 'Toropi'. PTF1's expression was early induced in both genotypes under P starvation, but remained significant after ten days only in 'Toropi'. Shoot Pi concentration in 'Toropi' was independent from P availability; under starvation, 'Toropi' favored the maintenance of shoot Pi concentration. The low-P tolerance of Toropi cultivar at initial growth stages is mainly due to its ability to maintain constant the Pi shoot level.Os objetivos deste estudo foram determinar os mecanismos da tolerância à deficiência de P em genótipos de trigo contrastantes e avaliar a associação desses mecanismos à expressão diferenciada de genes. Foram avaliadas plântulas das cultivares de trigo Toropi (tolerante à deficiência de P e Anahuac (sensível. As plântulas foram cultivadas em hidroponia, na ausência ou presença (1,0 mmol L-1 de P, durante três períodos de tempo: 24, 120 e 240 horas. Os teores de fosfato livre (Pi e P total foram medidos na parte aérea e nas raízes. O delineamento experimental foi em blocos ao acaso com três repetições, cada uma formada por dez plantas. Foi avaliada a expressão relativa dos genes que codificam o

  13. Crafting tolerance

    DEFF Research Database (Denmark)

    Kirchner, Antje; Freitag, Markus; Rapp, Carolin

    2011-01-01

    Ongoing changes in social structures, orientation, and value systems confront us with the growing necessity to address and understand transforming patterns of tolerance as well as specific aspects, such as social tolerance. Based on hierarchical analyses of the latest World Values Survey (2005......–08) and national statistics for 28 countries, we assess both individual and contextual aspects that influence an individual's perception of different social groupings. Using a social tolerance index that captures personal attitudes toward these groupings, we present an institutional theory of social tolerance. Our...

  14. Mechanism analysis of acid tolerance response of bifidobacterium longum subsp. longum BBMN 68 by gene expression profile using RNA-sequencing.

    Directory of Open Access Journals (Sweden)

    Junhua Jin

    Full Text Available To analyze the mechanism of the acid tolerance response (ATR in Bifidobacterium longum subsp. longum BBMN68, we optimized the acid-adaptation condition to stimulate ATR effectively and analyzed the change of gene expression profile after acid-adaptation using high-throughput RNA-Seq. After acid-adaptation at pH 4.5 for 2 hours, the survival rate of BBMN68 at lethal pH 3.5 for 120 min was increased by 70 fold and the expression of 293 genes were upregulated by more than 2 fold, and 245 genes were downregulated by more than 2 fold. Gene expression profiling of ATR in BBMN68 suggested that, when the bacteria faced acid stress, the cells strengthened the integrity of cell wall and changed the permeability of membrane to keep the H(+ from entering. Once the H(+ entered the cytoplasm, the cells showed four main responses: First, the F(0F(1-ATPase system was initiated to discharge H(+. Second, the ability to produce NH(3 by cysteine-cystathionine-cycle was strengthened to neutralize excess H(+. Third, the cells started NER-UVR and NER-VSR systems to minimize the damage to DNA and upregulated HtpX, IbpA, and γ-glutamylcysteine production to protect proteins against damage. Fourth, the cells initiated global response signals ((pppGpp, polyP, and Sec-SRP to bring the whole cell into a state of response to the stress. The cells also secreted the quorum sensing signal (AI-2 to communicate between intraspecies cells by the cellular signal system, such as two-component systems, to improve the overall survival rate. Besides, the cells varied the pathways of producing energy by shifting to BCAA metabolism and enhanced the ability to utilize sugar to supply sufficient energy for the operation of the mechanism mentioned above. Based on these reults, it was inferred that, during industrial applications, the acid resistance of bifidobacteria could be improved by adding BCAA, γ-glutamylcysteine, cysteine, and cystathionine into the acid-stress environment.

  15. Genome-wide analysis of autophagy-associated genes in foxtail millet (Setaria italica L.) and characterization of the function of SiATG8a in conferring tolerance to nitrogen starvation in rice.

    Science.gov (United States)

    Li, Weiwei; Chen, Ming; Wang, Erhui; Hu, Liqin; Hawkesford, Malcolm J; Zhong, Li; Chen, Zhu; Xu, Zhaoshi; Li, Liancheng; Zhou, Yongbin; Guo, Changhong; Ma, Youzhi

    2016-10-12

    Autophagy is a cellular degradation process that is highly evolutionarily-conserved in yeast, plants, and animals. In plants, autophagy plays important roles in regulating intracellular degradation and recycling of amino acids in response to nutrient starvation, senescence, and other environmental stresses. Foxtail millet (Setaria italica) has strong resistance to stresses and has been proposed as an ideal material for use in the study of the physiological mechanisms of abiotic stress tolerance in plants. Although the genome sequence of foxtail millet (Setaria italica) is available, the characteristics and functions of abiotic stress-related genes remain largely unknown for this species. A total of 37 putative ATG (autophagy-associated genes) genes in the foxtail millet genome were identified. Gene duplication analysis revealed that both segmental and tandem duplication events have played significant roles in the expansion of the ATG gene family in foxtail millet. Comparative synteny mapping between the genomes of foxtail millet and rice suggested that the ATG genes in both species have common ancestors, as their ATG genes were primarily located in similar syntenic regions. Gene expression analysis revealed the induced expression of 31 SiATG genes by one or more phytohormone treatments, 26 SiATG