WorldWideScience

Sample records for aluminum tolerance genes

  1. Prospecting sugarcane genes involved in aluminum tolerance

    Directory of Open Access Journals (Sweden)

    Rodrigo D. Drummond

    2001-12-01

    Full Text Available Aluminum is one of the major factors that affect plant development in acid soils, causing a substantial reduction in yield in many crops. In South America, about 66% of the land surface is made up of acid soils where high aluminum saturation is one of the main limiting factors for agriculture. The biochemical and molecular basis of aluminum tolerance in plants is far from being completely understood despite a growing number of studies, and in the specific case of sugarcane there are virtually no reports on the effects of gene regulation on aluminum stress. The objective of the work presented in this paper was to prospect the sugarcane expressed sequence tag (SUCEST data bank for sugarcane genes related to several biochemical pathways known to be involved in the responses to aluminum toxicity in other plant species and yeast. Sugarcane genes similar to most of these genes were found, including those coding for enzymes that alleviate oxidative stress or combat infection by pathogens and those which code for proteins responsible for the release of organic acids and signal transducers. The role of these genes in aluminum tolerance mechanisms is reviewed. Due to the high level of genomic conservation in related grasses such as maize, barley, sorghum and sugarcane, these genes may be valuable tools which will help us to better understand and to manipulate aluminum tolerance in these species.Alumínio (Al é um dos principais fatores que afetam o desenvolvimento de plantas em solos ácidos, reduzindo substancialmente a produtividade agrícola. Na América do Sul, cerca de 66% da superfície do solo apresenta acidez, onde a alta saturação de alumínio é uma das maiores limitações à prática agrícola. Apesar do crescente número de estudos, uma compreensão completa das bases bioquímicas e moleculares da tolerância ao alumínio em plantas está longe de ser alcançada. No caso da cana-de-açúcar, não há nada publicado sobre a regulação g

  2. Association and linkage analysis of aluminum tolerance genes in maize.

    Directory of Open Access Journals (Sweden)

    Allison M Krill

    Full Text Available BACKGROUND: Aluminum (Al toxicity is a major worldwide constraint to crop productivity on acidic soils. Al becomes soluble at low pH, inhibiting root growth and severely reducing yields. Maize is an important staple food and commodity crop in acidic soil regions, especially in South America and Africa where these soils are very common. Al exclusion and intracellular tolerance have been suggested as two important mechanisms for Al tolerance in maize, but little is known about the underlying genetics. METHODOLOGY: An association panel of 282 diverse maize inbred lines and three F2 linkage populations with approximately 200 individuals each were used to study genetic variation in this complex trait. Al tolerance was measured as net root growth in nutrient solution under Al stress, which exhibited a wide range of variation between lines. Comparative and physiological genomics-based approaches were used to select 21 candidate genes for evaluation by association analysis. CONCLUSIONS: Six candidate genes had significant results from association analysis, but only four were confirmed by linkage analysis as putatively contributing to Al tolerance: Zea mays AltSB like (ZmASL, Zea mays aluminum-activated malate transporter2 (ALMT2, S-adenosyl-L-homocysteinase (SAHH, and Malic Enzyme (ME. These four candidate genes are high priority subjects for follow-up biochemical and physiological studies on the mechanisms of Al tolerance in maize. Immediately, elite haplotype-specific molecular markers can be developed for these four genes and used for efficient marker-assisted selection of superior alleles in Al tolerance maize breeding programs.

  3. Overexpression of Citrus junos mitochondrial citrate synthase gene in Nicotiana benthamiana confers aluminum tolerance.

    Science.gov (United States)

    Deng, Wei; Luo, Keming; Li, Zhengguo; Yang, Yingwu; Hu, Nan; Wu, Yu

    2009-07-01

    Aluminum (Al) toxicity is one of the major factors that limit plant growth in acid soils. Al-induced release of organic acids into rhizosphere from the root apex has been identified as a major Al-tolerance mechanism in many plant species. In this study, Al tolerance of Yuzu (Citrus Junos Sieb. ex Tanaka) was tested on the basis of root elongation and the results demonstrated that Yuzu was Al tolerant compared with other plant species. Exposure to Al triggered the exudation of citrate from the Yuzu root. Thus, the mechanism of Al tolerance in Yuzu involved an Al-inducible increase in citrate release. Aluminum also elicited an increase of citrate content and increased the expression level of mitochondrial citrate synthase (CjCS) gene and enzyme activity in Yuzu. The CjCS gene was cloned from Yuzu and overexpressed in Nicotiana benthamiana using Agrobacterium tumefaciens-mediated methods. Increased expression level of the CjCS gene and enhanced enzyme activity were observed in transgenic plants compared with the wild-type plants. Root growth experiments showed that transgenic plants have enhanced levels of Al tolerance. The transgenic Nicotiana plants showed increased levels of citrate in roots compared to wild-type plants. The exudation of citrate from roots of the transgenic plants significantly increased when exposed to Al. The results with transgenic plants suggest that overexpression of mitochondrial CS can be a useful tool to achieve Al tolerance.

  4. Overexpression of a soybean ariadne-like ubiquitin ligase gene GmARI1 enhances aluminum tolerance in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Xiaolian Zhang

    Full Text Available Ariadne (ARI subfamily of RBR (Ring Between Ring fingers proteins have been found as a group of putative E3 ubiquitin ligases containing RING (Really Interesting New Gene finger domains in fruitfly, mouse, human and Arabidopsis. Recent studies showed several RING-type E3 ubiquitin ligases play important roles in plant response to abiotic stresses, but the function of ARI in plants is largely unknown. In this study, an ariadne-like E3 ubiquitin ligase gene was isolated from soybean, Glycine max (L. Merr., and designated as GmARI1. It encodes a predicted protein of 586 amino acids with a RBR supra-domain. Subcellular localization studies using Arabidopsis protoplast cells indicated GmARI protein was located in nucleus. The expression of GmARI1 in soybean roots was induced as early as 2-4 h after simulated stress treatments such as aluminum, which coincided with the fact of aluminum toxicity firstly and mainly acting on plant roots. In vitro ubiquitination assay showed GmARI1 protein has E3 ligase activity. Overexpression of GmARI1 significantly enhanced the aluminum tolerance of transgenic Arabidopsis. These findings suggest that GmARI1 encodes a RBR type E3 ligase, which may play important roles in plant tolerance to aluminum stress.

  5. Overexpression of a soybean ariadne-like ubiquitin ligase gene GmARI1 enhances aluminum tolerance in Arabidopsis.

    Science.gov (United States)

    Zhang, Xiaolian; Wang, Ning; Chen, Pei; Gao, Mengmeng; Liu, Juge; Wang, Yufeng; Zhao, Tuanjie; Li, Yan; Gai, Junyi

    2014-01-01

    Ariadne (ARI) subfamily of RBR (Ring Between Ring fingers) proteins have been found as a group of putative E3 ubiquitin ligases containing RING (Really Interesting New Gene) finger domains in fruitfly, mouse, human and Arabidopsis. Recent studies showed several RING-type E3 ubiquitin ligases play important roles in plant response to abiotic stresses, but the function of ARI in plants is largely unknown. In this study, an ariadne-like E3 ubiquitin ligase gene was isolated from soybean, Glycine max (L.) Merr., and designated as GmARI1. It encodes a predicted protein of 586 amino acids with a RBR supra-domain. Subcellular localization studies using Arabidopsis protoplast cells indicated GmARI protein was located in nucleus. The expression of GmARI1 in soybean roots was induced as early as 2-4 h after simulated stress treatments such as aluminum, which coincided with the fact of aluminum toxicity firstly and mainly acting on plant roots. In vitro ubiquitination assay showed GmARI1 protein has E3 ligase activity. Overexpression of GmARI1 significantly enhanced the aluminum tolerance of transgenic Arabidopsis. These findings suggest that GmARI1 encodes a RBR type E3 ligase, which may play important roles in plant tolerance to aluminum stress.

  6. An ALMT1 gene cluster controlling aluminium (aluminum) tolerance at the Alt4 locus of rye (Secale cereale L.)

    Science.gov (United States)

    Aluminium toxicity is a major problem in agriculture worldwide. Among the cultivated triticeae, rye (Secale cereale L.) is one of the most Al-tolerant and represents an important potential source of Al-tolerance for improvement of wheat. The Alt4 Al-tolerance locus of rye contains a cluster of genes...

  7. Aluminum tolerance association mapping in triticale

    Directory of Open Access Journals (Sweden)

    Niedziela Agnieszka

    2012-02-01

    Full Text Available Abstract Background Crop production practices and industrialization processes result in increasing acidification of arable soils. At lower pH levels (below 5.0, aluminum (Al remains in a cationic form that is toxic to plants, reducing growth and yield. The effect of aluminum on agronomic performance is particularly important in cereals like wheat, which has promoted the development of programs directed towards selection of tolerant forms. Even in intermediately tolerant cereals (i.e., triticale, the decrease in yield may be significant. In triticale, Al tolerance seems to be influenced by both wheat and rye genomes. However, little is known about the precise chromosomal location of tolerance-related genes, and whether wheat or rye genomes are crucial for the expression of that trait in the hybrid. Results A mapping population consisting of 232 advanced breeding triticale forms was developed and phenotyped for Al tolerance using physiological tests. AFLP, SSR and DArT marker platforms were applied to obtain a sufficiently large set of molecular markers (over 3000. Associations between the markers and the trait were tested using General (GLM and Multiple (MLM Linear Models, as well as the Statistical Machine Learning (SML approach. The chromosomal locations of candidate markers were verified based on known assignments of SSRs and DArTs or by using genetic maps of rye and triticale. Two candidate markers on chromosome 3R and 9, 15 and 11 on chromosomes 4R, 6R and 7R, respectively, were identified. The r2 values were between 0.066 and 0.220 in most cases, indicating a good fit of the data, with better results obtained with the GML than the MLM approach. Several QTLs on rye chromosomes appeared to be involved in the phenotypic expression of the trait, suggesting that rye genome factors are predominantly responsible for Al tolerance in triticale. Conclusions The Diversity Arrays Technology was applied successfully to association mapping studies

  8. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes

    2002-01-01

    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  9. Regulation of galactolipid biosynthesis by overexpression of the rice MGD gene contributes to enhanced aluminum tolerance in tobacco

    Directory of Open Access Journals (Sweden)

    Meijuan eZhang

    2016-03-01

    Full Text Available Membrane lipid alterations affect Al tolerance in plants, but little is known about the regulation of membrane lipid metabolism in response to Al stress. Transgenic tobacco (Nicotiana tabacum overexpressing rice monogalactosyldiacylglycerol (MGDG synthase (OsMGD gene and wild-type tobacco plants were exposed to AlCl3, and the impact of Al toxicity on root growth, Al accumulation, plasma membrane integrity, lipid peroxidation and membrane lipid composition were investigated. Compared with the wild type, the transgenic plants exhibited rapid regrowth of roots after removal of Al and less damage to membrane integrity and lipid peroxidation under Al stress, meanwhile, the Al accumulation showed no difference between wild-type and transgenic plants. Lipid analysis showed that Al treatment dramatically decreased the content of MGDG and the ratio of MGDG to digalactosyldiacylglycerol (DGDG in wild-type plants, while it was unchanged in transgenic plants. The stable of MGDG level and the ratio of MGDG/DGDG contribute to maintain the membrane stability and permeability. Moreover, Al caused a significant increase in phospholipids in wild-type plants, resulting in a high proportion of phospholipids and low proportion of galactolipids, but these proportions were unaffected in transgenic plants. The high proportion of phospholipids could contribute to a higher rate of Al3+ binding in the membrane and thereby leads to more membrane perturbation and damage. These results show that the regulation of galactolipid biosynthesis could play an important role in maintaining membrane structure and function under Al stress.

  10. Proteomics of aluminum tolerance in plants.

    Science.gov (United States)

    Zheng, Lu; Lan, Ping; Shen, Ren Fang; Li, Wen Feng

    2014-03-01

    Aluminum (Al) toxicity is a major constraint for plant root development and growth as well as crop yield in acidic soils, which constitute approximately 40% of the potentially arable lands worldwide. The mechanisms of Al tolerance in plants are not well understood. As a whole systems approach, proteomic techniques have proven to be crucial as a complementary strategy to explore the mechanism in Al toxicity. Review here focuses on the potential of proteomics to unravel the common and plant species-specific changes at proteome level under Al stress, via comparative analysis of the Al-responsive proteins uncovered by recent proteomic studies using 2DE. Understanding the mechanisms of Al tolerance in plants is critical to generate Al resistance crops for developing sustainable agriculture practices, thereby contributing to food security worldwide.

  11. Overexpression of a Soybean Ariadne-Like Ubiquitin Ligase Gene GmARI1 Enhances Aluminum Tolerance in Arabidopsis

    OpenAIRE

    Xiaolian Zhang; Ning Wang; Pei Chen; Mengmeng Gao; Juge Liu; Yufeng Wang; Tuanjie Zhao; Yan Li; Junyi Gai

    2014-01-01

    Ariadne (ARI) subfamily of RBR (Ring Between Ring fingers) proteins have been found as a group of putative E3 ubiquitin ligases containing RING (Really Interesting New Gene) finger domains in fruitfly, mouse, human and Arabidopsis. Recent studies showed several RING-type E3 ubiquitin ligases play important roles in plant response to abiotic stresses, but the function of ARI in plants is largely unknown. In this study, an ariadne-like E3 ubiquitin ligase gene was isolated from soybean, Glycine...

  12. Toxicity and tolerance of aluminum in plants: tailoring plants to suit to acid soils.

    Science.gov (United States)

    Sade, Hemalatha; Meriga, Balaji; Surapu, Varalakshmi; Gadi, Jogeswar; Sunita, M S L; Suravajhala, Prashanth; Kavi Kishor, P B

    2016-04-01

    Aluminum (Al) stress is one of the serious limiting factors in plant productivity in acidic soils, which constitute about 50 % of the world's potentially arable lands and causes anywhere between 25 and 80 % of yield losses depending upon the species. The mechanism of Al toxicity and tolerance has been examined in plants, which is vital for crop improvement and enhanced food production in the future. Two mechanisms that facilitate Al tolerance in plants are Al exclusion from the roots and the ability to tolerate Al in the symplast or both. Although efforts have been made to unravel Al-resistant factors, many aspects remain unclear. Certain gene families such as MATE, ALMT, ASR, and ABC transporters have been implicated in some plants for resistance to Al which would enhance the opportunities for creating crop plants suitable to grow in acidic soils. Though QTLs have been identified related to Al-tolerance, no crop plant that is tolerant to Al has been evolved so far using breeding or molecular approaches. The remarkable changes that plants experience at the physiological, biochemical and molecular level under Al stress, the vast array of genes involved in Al toxicity-tolerance, the underlying signaling events and the holistic image of the molecular regulation, and the possibility of creating transgenics for Al tolerance are discussed in this review.

  13. Rice's Salt Tolerance Gene Cloned

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    @@ In cooperation with US colleagues, CAS researchers have made significant progress in their studies into functional genes for key agronomic traits by cloning SKC1, a salt-tolerant functional gene of rice and making clear its biological functions and mechanisms. This pioneering work,which was reported in the Oct. issue of Nature Genetics (37:1141-1146), is believed to hold promise to increase the output of the crop plant in this country.

  14. Brassica oleracea MATE encodes a citrate transporter and enhances aluminum tolerance in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Xinxin; Li, Ren; Shi, Jin; Wang, Jinfang; Sun, Qianqian; Zhang, Haijun; Xing, Yanxia; Qi, Yan; Zhang, Na; Guo, Yang-Dong

    2014-08-01

    The secretion of organic acid anions from roots is an important mechanism for plant aluminum (Al) tolerance. Here we report cloning and characterizing BoMATE (KF031944), a multidrug and toxic compound extrusion (MATE) family gene from cabbage (Brassica oleracea). The expression of BoMATE was more abundant in roots than in shoots, and it was highly induced by Al treatment. The (14)C-citrate efflux experiments in oocytes demonstrated that BoMATE is a citrate transporter. Electrophysiological analysis and SIET analysis of Xenopus oocytes expressing BoMATE indicated BoMATE is activated by Al. Transient expression of BoMATE in onion epidermal cells demonstrated that it localized to the plasma membrane. Compared with the wild-type Arabidopsis, the transgenic lines constitutively overexpressing BoMATE enhanced Al tolerance and increased citrate secretion. In addition, Arabidopsis transgenic lines had a lower K(+) efflux and higher H(+) efflux, in the presence of Al, than control wild type in the distal elongation zone (DEZ). This is the first direct evidence that MATE protein is involved in the K(+) and H(+) flux in response to Al treatment. Taken together, our results show that BoMATE is an Al-induced citrate transporter and enhances aluminum tolerance in Arabidopsis thaliana.

  15. Rapid screening for aluminum tolerance in maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Carlos Daniel Giaveno

    2000-12-01

    Full Text Available A significant decrease in maize grain yield due to aluminum toxicity is considered to be one of the most important agricultural problems for tropical regions. Genetic improvement is a useful approach to increase maize yield in acid soils, but this requires a rapid and reliable method to discriminate between genotypes. In our work we investigated the feasibility of using hematoxylin staining (HS to detect Al-tolerant plants at the seedling stage. The original population along with two populations obtained after one cycle of divergent selection were evaluated by net root growth (NRG and HS after 7 days in nutrient solution. Results showed a negative correlation between NRG and HS in all populations, in which sensitive plants, characterized by low NRG, exhibited more intense staining than tolerant plants. These results indicate that HS is a useful procedure for selecting Al-tolerant maize seedlings.A importante diminuição nos rendimentos de milho causados pela toxidez produzida pelo alumínio é considerada um dos mais importantes problemas nas regiões tropicais. O melhoramento genético é uma metodologia útil para aumentar os rendimentos do milho em solos ácidos, requerendo um método rápido e seguro que permita diferenciar os diferentes genótipos. O objetivo deste trabalho foi avaliar a possibilidade de utilizar a técnica da coloração com hematoxilina (HS na detecção de plântulas tolerantes ao alumínio. Duas populações obtidas de um ciclo de seleção divergente e a original, foram avaliadas depois de sete dias em solução nutritiva utilizando os parâmetros NRG (crescimento líquido da raiz principal e HS. Os resultados apresentaram uma correlação negativa entre NRG e HS em todas as populações devido ao fato de que as plântulas suscetíveis, caracterizadas por um baixo NRG, apresentaram uma coloração mais intensa do que as tolerantes. Nossos resultados permitem concluir que a técnica de coloração com hematoxilina

  16. Melhoramento do trigo: I. Hereditariedade da tolerância à toxicidade do alumínio Wheat breeding: I - Inheritance of tolerance to aluminum toxicity in wheat

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1981-01-01

    áveis pela tolerância a essas concentrações mostrou uma quebra gradual da dominância à medida que a concentração de alumínio foi aumentada.Four wheat cultivars showing different reactions to Al toxicity under field conditions and presenting a great variation in plant height were screened in nutrient solution with different concentrations of aluminum. The tall Brazilian cultivar, 'BH-1146' was tolerant to 10 ppm of Al; 'Atlas-66' developed in North Carolina was tolerant to 6 ppm but moderately tolerant to 10 ppm of aluminum. The dwarf cultivar Tordo, a Tom Thumb source of dwarfism, was tolerant to 2 ppm but totally sensitive at 6 ppm. The Mexican semidwarf cultivar Siete Cerros, a Niorin-10 derivative, was sensitive to 2 ppm of Al. Parents, F1 and F2 generations from the crosses between tolerant ('BH-1146' and 'Atlas-66' and sensitive ('Tordo' and 'Siete Cerros' cultivars to 6 ppm were screened under 3 ppm and the same genotypes plus the backcrosses to both types of parents (BCª and BCb were screened at 6 ppm. Parents, F1 and F2 progenies from BCª and BCb involving the cross BH-1146/Siete Cerros were retested under 3 and 6 ppm of Al. Parents, F1 and F2 for the cross between 'BH-1146' and 'Atlas-66' were screened under 6 and 10 ppm of Al. At 2 and 3 ppm of Al, parents, F1 and F2 from the cross Tordo/Siete Cerros were studied. The results obtained suggest that 'BH-1146' differs from Atlas-66, Siete Cerros and Tordo by one pair of dominant gene. This pair of gene was efficient even at 10 ppm of aluminum, so should be used in a breeding program towards aluminum tolerance when high levels of this element are involved. The cultivar Atlas-66 showed to have two pairs of dominant genes for Al tolerance but when the aluminum concentration increased from 3 and 6 to 10 ppm these pairs of genes became less efficient. 'Tordo' differs from 'Siete Cerros' by a pair of dominant gene for tolerance at 2 ppm of Al. So 'Tordo' would be useful as a source of tolerance when low levels of

  17. Global Transcriptome Analysis Reveals Distinct Aluminum-Tolerance Pathways in the Al-Accumulating Species Hydrangea macrophylla and Marker Identification.

    Directory of Open Access Journals (Sweden)

    Haixia Chen

    Full Text Available Hydrangea (Hydrangea macrophylla is a well known Al-accumulating plant, showing a high level of aluminum (Al tolerance and accumulation. Although the physiological mechanisms for detoxification of Al and the roles of Al in blue hydrangea sepals have been reported, the molecular mechanisms of Al tolerance and accumulation are poorly understood in hydrangea. In this study, we conducted a genome-wide transcriptome analysis of Al-response genes in the roots and leaves of hydrangea by RNA sequencing (RNA-seq. The assembly of hydrangea transcriptome provides a rich source for gene identification and mining molecular markers, including single nucleotide polymorphism (SNP and simple sequence repeat (SSR. A total of 401,215 transcripts with an average length of 810.77 bp were assembled, generating 256,127 unigenes. After annotation, 4,287 genes in the roots and 730 genes in the leaves were up-regulated by Al exposure, while 236 genes in the roots and 719 genes in the leaves were down-regulated, respectively. Many transporters, including MATE and ABC families, were involved in the process of Al-citrate complex transporting from the roots in hydrangea. A plasma membrane Al uptake transporter, Nramp aluminum transporter was up-regulated in roots and leaves under Al stress, indicating it may play an important role in Al tolerance by reducing the level of toxic Al. Although the exact roles of these candidate genes remain to be examined, these results provide a platform for further functional analysis of the process of detoxification of Al in hydrangea.

  18. Molecular Characterization of Aluminium (aluminum) Tolerance in Rye

    Science.gov (United States)

    Aluminium (Al) toxicity, affecting around half of the world’s arable land, severely hinders the ability of crop plants to utilize moisture and nutrients by restricting root growth and function. Among the cultivated cereals, rye is the most Al-tolerant and represents an important potential source of ...

  19. Molecular Characterization of Atlas 66-Derived Wheat Near-Isogenic Lines Contrasting in Aluminum (Al) Tolerance

    Institute of Scientific and Technical Information of China (English)

    GUO Pei-guo; BAI Gui-hua; LI Rong-hua; Brett Carver; Michael Baum

    2007-01-01

    Aluminum (Al) toxicity is the major limiting factor for wheat growth in acidic soils. Genetic improvement of Al tolerance is one of the most cost-effective solutions to improve wheat productivity. The objective of this study was to characterize near isogenic lines (NILs) contrasting in Al tolerance derived from Atlas 66 in the backgrounds of Al-sensitive cultivars Chisholm and Century using amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR). A total of 200 AFLP and 88 SSR primer pairs were screened and 12 markers (11 AFLPs and one SSR) were associated with Altolerance in NILs of at least one recurrent parental background. Among them, nine were linked to Al tolerance in the Chisholm-derived NILs, seven were associated with Al-tolerance in the Century-derived NILs, and three AFLPs derived from the primer combinations of pAG/mGCAG, pCAG/mAGC and pGTG/mGCG, and one SSR, Xwmc331 on chromosome4D, associated with Al tolerance in NILs of both recurrent parental backgrounds. Those common markers across two backgrounds may be the major marker loci associated with Al-tolerance in Atlas 66 and could be useful for marker-assisted breeding to improve Al tolerance in wheat. In addition, evaluation of Al tolerance among different genotypes using hematoxylin stain and relative root growth revealed that Atlas 66 was more tolerant to Al stress than the NILs, therefore suggested that the Al-tolerant NILs might not carry all Al-tolerance loci from Atlas 66 and inheritance of Al tolerance in Atlas 66 is more likely multigenic.

  20. Damage Tolerance Behavior of Friction Stir Welds in Aluminum Alloys

    Science.gov (United States)

    McGill, Preston; Burkholder, Jonathan

    2012-01-01

    Friction stir welding is a solid state welding process used in the fabrication of various aerospace structures. Self-reacting and conventional friction stir welding are variations of the friction stir weld process employed in the fabrication of cryogenic propellant tanks which are classified as pressurized structure in many spaceflight vehicle architectures. In order to address damage tolerance behavior associated with friction stir welds in these safety critical structures, nondestructive inspection and proof testing may be required to screen hardware for mission critical defects. The efficacy of the nondestructive evaluation or the proof test is based on an assessment of the critical flaw size. Test data describing fracture behavior, residual strength capability, and cyclic mission life capability of friction stir welds at ambient and cryogenic temperatures have been generated and will be presented in this paper. Fracture behavior will include fracture toughness and tearing (R-curve) response of the friction stir welds. Residual strength behavior will include an evaluation of the effects of lack of penetration on conventional friction stir welds, the effects of internal defects (wormholes) on self-reacting friction stir welds, and an evaluation of the effects of fatigue cycled surface cracks on both conventional and selfreacting welds. Cyclic mission life capability will demonstrate the effects of surface crack defects on service load cycle capability. The fracture data will be used to evaluate nondestructive inspection and proof test requirements for the welds.

  1. Research Progresses in Aluminum Toxicity and Mechanisms of Tolerance in Citrus%柑橘铝毒害及其耐铝机制研究进展

    Institute of Scientific and Technical Information of China (English)

    刘召亮; 闫承璞; 万水林; 胡钟东; 何新华

    2016-01-01

    铝毒害是酸性土壤中作物生长的主要限制因素。柑橘是生长在酸性或强酸性土壤中的亚热带果树,容易受到铝毒害的危害,使其果实品质和产量下降。近十年来,国内外在柑橘铝毒害方面已有较深入的研究。首次概述柑橘铝毒害症状、铝毒害对柑橘矿质元素吸收、光合作用的影响、柑橘品种间耐铝差异、柑橘耐铝机制、耐铝响应基因鉴定等方面的最新研究进展,并展望未来的研究方向。%Aluminum toxicity is a major limiting factor in crop growth in acid soil.Citrus as a predominant subtropical fruit tree grown in acid or strongly acid soil,is vulnerable to aluminum toxicity,which results in de⁃crease of fruit quality and yield.Over the past decade,reseach on Al toxicity and aluminum tolerance mecha⁃nism in citrus has achieved great progresses. This paper reviews the symptoms of citrus aluminum toxicity,its effect on absorption of mineral elements and photosynthesis,difference in resistance to aluminum of citrus vari⁃eties,mechanism of aluminum tolerance in citrus,indentification of aluminum response gene,etc.And the pros⁃pect of further research is also briefly discussed.

  2. Quantitative iTRAQ Proteomics Revealed Possible Roles for Antioxidant Proteins in Sorghum Aluminum Tolerance

    Science.gov (United States)

    Zhou, Dangwei; Yang, Yong; Zhang, Jinbiao; Jiang, Fei; Craft, Eric; Thannhauser, Theodore W.; Kochian, Leon V.; Liu, Jiping

    2017-01-01

    Aluminum (Al) toxicity inhibits root growth and limits crop yields on acid soils worldwide. However, quantitative information is scarce on protein expression profiles under Al stress in crops. In this study, we report on the identification of potential Al responsive proteins from root tips of Al sensitive BR007 and Al tolerant SC566 sorghum lines using a strategy employing iTRAQ and 2D-liquid chromatography (LC) coupled to MS/MS (2D-LC-MS/MS). A total of 771 and 329 unique proteins with abundance changes of >1.5 or sorghum. PMID:28119720

  3. Genetic variability and inheritance to aluminum tolerance in nutrient solution in triticale

    Directory of Open Access Journals (Sweden)

    Allan Henrique Silva

    2014-03-01

    Full Text Available Triticale has shown different behavior to aluminum toxicity (A1(3+ when applied nutrient solution. This study had the objective of evaluating 19 triticale lines inserted at International Maize and Wheat Improvement Center (CIMMYT, IAC-5 cultivar and two control cultivars of wheat in the presence of 0, 3, 6, 9, 12 and 15 mg L- 1 of Al3+. Afterwards, four genotypes being two tolerant and two sensitive were chosen to obtain the F1's, F2's, RC1's and RC2's generations, in all possible crossing. The seedlings were submitted to 6 mg L- 1 of Al3+ and analyzed later on (tolerant and sensitive by the chi-square method. The root growth was also obtained to estimate the genetic parameters involved in the character control. The trials were carried out in laboratories, in nutritive solution. The genotypes were tolerant to 15 mg L- 1 of Al3+, exception the line 14 (P3, sensitive to 3 mg L- 1 of Al3+ and the line 13, 17 and the cultivar IAC-5 (P4, sensitive to 6 mg L- 1 of Al3+, the line 15 sensitive to 12 mg L- 1 of Al3+ and the lines 16 and 18 sensitive to 15 mg L- 1 of Al3+. It was concluded that the inheritance to tolerance to aluminum toxicity is dominant and governed by a pair of alleles. The genetic parameters involved in the root growth control in solution containing 6 mg L- 1 of Al3+ also revealed simple inheritance, suggesting a selection in the first segregating generations.

  4. Bacterial and fungal communities in bulk soil and rhizospheres of aluminum-tolerant and aluminum-sensitive maize (Zea mays L.) lines cultivated in unlimed and limed Cerrado soil.

    Science.gov (United States)

    Da Mota, Fabio Faria; Gomes, Eliane Aparecida; Marriel, Ivanildo Evodio; Paiva, Edilson; Seldin, Lucy

    2008-05-01

    Liming of acidic soils can prevent aluminum toxicity and improve crop production. Some maize lines show aluminum (Al) tolerance, and exudation of organic acids by roots has been considered to represent an important mechanism involved in the tolerance. However, there is no information about the impact of liming on the structures of bacterial and fungal communities in Cerrado soil, nor if there are differences between the microbial communities from the rhizospheres of Al-tolerant and Al-sensitive maize lines. This study evaluated the effects of liming on the structure of bacterial and fungal communities in bulk soil and rhizospheres of Al-sensitive and Al-tolerant maize (Zea mays L.) lines cultivated in Cerrado soil by PCR-DGGE, 30 and 90 days after sowing. Bacterial fingerprints revealed that the bacterial communities from rhizospheres were more affected by aluminum stress in soil than by the maize line (Al-sensitive or Al-tolerant). Differences in bacterial communities were also observed over time (30 and 90 days after sowing), and these occurred mainly in the Actinobacteria. Conversely, fungal communities from the rhizosphere were weakly affected either by liming or by the rhizosphere, as observed from the DGGE profiles. Furthermore, only a few differences were observed in the DGGE profiles of the fungal populations during plant development when compared with bacterial communities. Cloning and sequencing of 16S rRNA gene fragments obtained from dominant DGGE bands detected in the bacterial profiles of the Cerrado bulk soil revealed that Actinomycetales and Rhizobiales were among the dominant ribotypes.

  5. Association mapping provides insights into the origin and the fine structure of the sorghum aluminum tolerance locus, AltSB

    Science.gov (United States)

    Root damage caused by aluminum (Al) toxicity is a major cause of grain yield reduction on acid soils, which are prevalent in tropical and subtropical regions of the world where food security is most tenuous. In sorghum, Al tolerance is conferred by SbMATE, an Al-activated root citrate efflux transpo...

  6. Cowpea symbiotic efficiency, pH and aluminum tolerance in nitrogen-fixing bacteria

    Directory of Open Access Journals (Sweden)

    Bruno Lima Soares

    2014-06-01

    Full Text Available Cowpea (Vigna unguiculata cultivation in northern and northeastern Brazil provides an excellent source of nutrients and carbohydrates for the poor and underprivileged. Production surplus leads to its consumption in other regions of Brazil and also as an export commodity. Its capacity to establish relationships with atmospheric nitrogen-fixing bacteria is crucial to the reduction of production costs and the environmental impact of nitrogen fertilizers. This study assessed the symbiotic efficiency of new strains of symbiotic nitrogen-fixing bacteria with cowpea and their tolerance to pH and aluminum. Twenty-seven strains of bacteria from different soils were evaluated under axenic conditions. These strains were compared to the following inoculant strains: INPA03-11B, UFLA03-84 and BR3267 and two controls that were not inoculated (with and without mineral nitrogen. Six strains and the three strains approved as inoculants were selected to increase the dry weight production of the aerial part (DWAP and were tested in pots with soil that had a high-density of nitrogen-fixing native rhizobia. In this experiment, three strains (UFLA03-164, UFLA03-153, and UFLA03-154 yielded higher DWAP values. These strains grow at pH levels of 5.0, 6.0, 6.8 and at high aluminum concentration levels, reaching 10(9 CFU mL-1. In particular UFLA03-84, UFLA03-153, and UFLA03-164 tolerate up to 20 mmol c dm-3 of Al+3. Inoculation with rhizobial strains, that had been carefully selected according to their ability to nodulate and fix N2, combined with their ability to compete in soils that are acidic and contain high levels of Al, is a cheaper and more sustainable alternative that can be made available to farmers than mineral fertilizers.

  7. Physical analysis of the complex rye (Secale cereale L.) Alt4 aluminium (aluminum) tolerance locus using a whole-genome BAC library of rye cv. Blanco.

    Science.gov (United States)

    Shi, B-J; Gustafson, J P; Button, J; Miyazaki, J; Pallotta, M; Gustafson, N; Zhou, H; Langridge, P; Collins, N C

    2009-08-01

    Rye is a diploid crop species with many outstanding qualities, and is important as a source of new traits for wheat and triticale improvement. Rye is highly tolerant of aluminum (Al) toxicity, and possesses a complex structure at the Alt4 Al tolerance locus not found at the corresponding locus in wheat. Here we describe a BAC library of rye cv. Blanco, representing a valuable resource for rye molecular genetic studies, and assess the library's suitability for investigating Al tolerance genes. The library provides 6 x genome coverage of the 8.1 Gb rye genome, has an average insert size of 131 kb, and contains only ~2% of empty or organelle-derived clones. Genetic analysis attributed the Al tolerance of Blanco to the Alt4 locus on the short arm of chromosome 7R, and revealed the presence of multiple allelic variants (haplotypes) of the Alt4 locus in the BAC library. BAC clones containing ALMT1 gene clusters from several Alt4 haplotypes were identified, and will provide useful starting points for exploring the basis for the structural variability and functional specialization of ALMT1 genes at this locus.

  8. A damage tolerance comparison of 7075-T6 aluminum alloy and IM7/977-2 carbon/epoxy

    Science.gov (United States)

    Nettles, Alan T.; Lance, David G.; Hodge, Andrew J.

    1991-01-01

    A comparison of low velocity impact damage between one of the strongest aluminum alloys, to a new, damage tolerant resin system as a matrix for high strength carbon fibers was examined in this study. The aluminum and composite materials were used as face sheets on a 0.13 g/cu cm aluminum honeycomb. Four levels of impact energy were used; 2.6 J, 5.3 J, 7.8 J and 9.9 J. The beams were compared for static strength and fatique life by use of the four-point bend flexure test. It was found that in the undamaged state the specific strength of the composite face sheets was about twice that of the aluminum face sheets. A sharp drop in strength was observed for the composite specimens impacted at the lowest (2.6J) energy level, but the overall specific strength was still higher than for the aluminum specimens. At all impact energy levels tested, the static specific strength of the composite face sheets were significantly higher than the aluminum face sheets. The fatigue life of the most severely damaged composite specimen was about 17 times greater than the undamaged aluminum specimens when cycled at 1 Hz between 20 percent and 85 percent of ultimate breaking load.

  9. Response and tolerance of root border cells to aluminum toxicity in soybean seedlings.

    Science.gov (United States)

    Cai, Miao-Zhen; Wang, Fang-Mei; Li, Rong-Feng; Zhang, Shu-Na; Wang, Ning; Xu, Gen-Di

    2011-07-01

    Root border cells (RBCs) and their secreted mucilage are suggested to participate in the resistance against toxic metal cations, including aluminum (Al), in the rhizosphere. However, the mechanisms by which the individual cell populations respond to Al and their role in Al resistance still remain unclear. In this research, the response and tolerance of RBCs to Al toxicity were investigated in the root tips of two soybean cultivars [Zhechun No. 2 (Al-tolerant cultivar) and Huachun No. 18 (Al-sensitive cultivar)]. Al inhibited root elongation and increased pectin methylesterase (PME) activity in the root tip. Removal of RBCs from the root tips resulted in a more severe inhibition of root elongation, especially in Huachun No. 18. Increasing Al levels and treatment time decreased the relative percent viability of RBCs in situ and in vitro in both soybean cultivars. Al application significantly increased mucilage layer thickness around the detached RBCs of both cultivars. Additionally, a significantly higher relative percent cell viability of attached and detached RBCs and thicker mucilage layers were observed in Zhechun No. 2. The higher viability of attached and detached RBCs, as well as the thickening of the mucilage layer in separated RBCs, suggest that RBCs play an important role in protecting root apices from Al toxicity.

  10. Tagging Salt Tolerant Gene Using PCR Markers in Soybean

    Institute of Scientific and Technical Information of China (English)

    GUO Bei; QIU Li-juan; SHAO Gui-hua; CHANG Ru-zhen; LIU Li-hong; XU Zhan-you; LI Xiang-hua; SUN Jian-ying

    2001-01-01

    The purpose of this study was to screen and identify PCR markers associated with salt tolerant gene in soybean( Glycine soja L. ) so that salt tolerance can be identified efficiently and accurately. Between these tolerant and sensitivity to salt and three crosses were tested in this experiment. By BSA method, two codominant PCR markers were identified through the salt tolerant (sensitive) cuitivars bulks and the salt tolerant (sensitive) individual bulks of a F2 population. There was a 600bp band in the sensitive individuals and a 700bp band or two 700bp/600bp bands in the tolerant individuals. The markers were closely linked with salt tolerant/sensitive alleles. Moreover the markers were tested in the other two F2 populations from "salt tolerant cultivar × sensitive cuitivar" and confirmed by 12 salt tolerance cultivars and 13 salt sensitive cultivars with different genetic background. It indicated that the markers (700bp and 600bp) could be applied in salt tolerant identification of the soybean germplasm resources, and markers-assisted selection in salt tolerant breeding of soybean. The markers, its obtained method and application were patented for invention in 1998.

  11. Damage Tolerance Assessment of Friction Pull Plug Welds in an Aluminum Alloy

    Science.gov (United States)

    McGill, Preston; Burkholder, Jonathan

    2012-01-01

    Friction stir welding is a solid state welding process used in the fabrication of cryogenic propellant tanks. Self-reacting friction stir welding is one variation of the friction stir weld process being developed for manufacturing tanks. Friction pull plug welding is used to seal the exit hole that remains in a circumferential self-reacting friction stir weld. A friction plug weld placed in a self-reacting friction stir weld results in a non-homogenous weld joint where the initial weld, plug weld, their respective heat affected zones and the base metal all interact. The welded joint is a composite plastically deformed material system with a complex residual stress field. In order to address damage tolerance concerns associated with friction plug welds in safety critical structures, such as propellant tanks, nondestructive inspection and proof testing may be required to screen hardware for mission critical defects. The efficacy of the nondestructive evaluation or the proof test is based on an assessment of the critical flaw size. Test data relating residual strength capability to flaw size in an aluminum alloy friction plug weld will be presented.

  12. Physiological characterization of aluminum tolerance and accumulation in tartary and wild buckwheat.

    Science.gov (United States)

    Wang, Hua; Chen, Rong Fu; Iwashita, Takashi; Shen, Ren Fang; Ma, Jian Feng

    2015-01-01

    Ionic aluminum (Al) is toxic for plant growth, but some plant species are able to accumulate Al at high concentrations without showing toxicity symptoms. In order to determine whether other species in the genus Fagopyrum are able to accumulate Al like common buckwheat (Fagopyrum esculentum), we investigated the external and internal detoxification mechanisms of Al in two self-compatible species: tartary (Fagopyrum tataricum) and wild buckwheat (Fagopyrum homotropicum). Both tartary and wild buckwheat showed high Al tolerance comparable to common buckwheat. Furthermore, these two species also secreted oxalate rapidly from the roots in response to Al in a time-dependent manner. Both tartary and wild buckwheat accumulated > 1 mg g(-1) Al in the leaves after short-term exposure to Al. Analysis with (27) Al-nuclear magnetic resonance (NMR) revealed that Al was present in the form of Al-oxalate (1 : 3 ratio) in the roots and leaves, but in the form of Al-citrate (1 : 1 ratio) in the xylem sap in both species. These results indicate that similar to common buckwheat, both tartary and wild buckwheat detoxify Al externally and internally, respectively, by secreting oxalate from the roots and by forming the Al-oxalate complex, which is a nonphytotoxic form. These features of Al response and accumulation may be conserved in genus Fagopyrum.

  13. Tolerant Mechanism and Chromosome Location of Gene Controlling Sprouting Tolerance in Aegilops Tauschii Cosson

    Institute of Scientific and Technical Information of China (English)

    LAN Xiu-jin; ZHENG You-liang; LIU Deng-cai; WEI Yu-ming; YAN Ze-hong; ZHOU Yong-hong

    2002-01-01

    An artificial amphiploid RSP (2n = 42, AABBDD) between tetraploid landrace Ailanmai(Triticum turgidum L., 2n= 28, AABB) and Aegilops tauschii (DD, 2n = 14) expressed high tolerance to preharvest sprouting which derived from Ae. tauschii. Tolerance to preharvest sprouting of RSP was examined by four ways in six varying periods after anthesis. The germination percentages of preharvest intact spikes were only 6.06 % in its high peak period of germination. Its tolerance was mainly decided by the seed a recessive trait which was controlled by one gene, located on chromosome 2D.

  14. Trichoderma genes in plants for stress tolerance- status and prospects.

    Science.gov (United States)

    Nicolás, Carlos; Hermosa, Rosa; Rubio, Belén; Mukherjee, Prasun K; Monte, Enrique

    2014-11-01

    Many filamentous fungi from the genus Trichoderma are well known for their anti-microbial properties. Certain genes from Trichoderma spp. have been identified and transferred to plants for improving biotic and abiotic stress tolerance, as well for applications in bioremediation. Several Trichoderma genomes have been sequenced and many are in the pipeline, facilitating high throughput gene analysis and increasing the availability of candidate transgenes. This, coupled with improved plant transformation systems, is expected to usher in a new era in plant biotechnology where several genes from these antagonistic fungi can be transferred into plants to achieve enhanced stress tolerance, bioremediation activity, herbicide tolerance, and reduction of phytotoxins. In this review, we illustrate the major achievements made by transforming plants with Trichoderma genes as well as their possible mode of action. Moreover, examples of efficient application of genetically modified plants as biofactories to produce active Trichoderma enzymes are indicated.

  15. Evaluation on Chinese Bread Wheat Landraces for Low pH and Aluminum Tolerance Using Hydroponic Screening

    Institute of Scientific and Technical Information of China (English)

    DAI Shou-fen; YAN Ze-hong; LIU Deng-cai; ZHANG Lian-quan; WEI Yu-ming; ZHENG You-liang

    2009-01-01

    Aluminum (A1) toxicity often takes place in acidic soils with a pH of 5.5 or lower. Breeding and cultivation of A1 tolerance wheat can partially protect wheat escaping from AI toxicity. The scarcity of the tolerant sources impedes the wheat breeding.In order to find new AI tolerance sources, we screened 173 bread wheat landraces from Tibet of China using hydroponic screening. It was indicated that: (1) There were diversities on the root regenerate length (RRL). The RRL of a large of landraces were longer than 7.00 cm in pH 7 (58.38%) and pH 4.5 (66.47%), but shorter than 5.00 cm in pH 4.5 +50 μM Al3+(80.93%). The low pH showed either promotion or restraining effects depend on landraces, but AI toxicity under low pH only showed restraining effects on the root elongation. (2) There were also diversities on root tolerance index of low pH (RTI 1) or root aluminum tolerance index (RTI2) among cultivars. The RTI1 varied from a narrow range but with relatively high value (0.8722-1.2953) in comparison with that of RTI2 (0.3829-1.0058), and the RTI1 of approximately 60% landraces was higher than 1.0000, the RTI2 of only 19.07% landraces was higher than 0.7000, suggesting that A1 toxicity acted as an important factor for the reduction of the root elongation under acidic soils. (3) The RTI 1 of many wheats was higher than 1.0000, and As2256 and As2295 were the most tolerant for low pH, with RTI1 1.2953 and 1.2925, respectively. (4) Based on RTI2, seven wheats showed similar or higher tolerance to AI toxicity than Chinese Spring (CS), a known tolerance wheat. Much better tolerance existed in landraces of As1543 and As1242, which can be used as the new parents for AI tolerant breeding.

  16. High Aluminum Tolerance of Rhodotorula sp.RS1 is Associated with Thickening of the Cell Wall Rather than Chelation of Aluminum Ions*1

    Institute of Scientific and Technical Information of China (English)

    WANG Chao; ZHAO Xue-Qiang; T.AIZAWA; M.SUNAIRI; SHEN Ren-Fang

    2013-01-01

    Aluminum (Al) is very toxic to many living organisms,including plants,animals and microorganisms.However,despite many studies on Al tolerance in plants,little has been reported concerning these mechanisms in microorganisms.In this study,a red yeast,which could tolerate Al3+ concentrations as high as 200 mmol L-1,was isolated from acidic soils,identified as Rhodotorula sp.and designated as RS1.As the medium compositions can greatly affect the responses of microorganisms to Al,two culture mediums,glucose medium (GM) and lysogeny broth medium containing soil extract (S-LBM),were used.During growth of RS1,the pH of medium decreased in GM but increased in S-LBM.These changes in the pH of the media were not induced by Al addition.No or little secretion of organic acids was observed in RS1 growth media.Importantly,the thickness of the cell walls and the ratio of cell wall to biomass of RS1 significantly increased in GM with high Al3+ concentrations.In the presence of 100 mmol Al L-1,78.0% of the total Al of whole cells was present in the thickened cell walls.The Al in cell walls was mostly bound to OH,amide and CO groups of polysaccharides.These results suggest that thickening of the cell wall in response to the high Al3+ concentrations may play an important role in the high tolerance of RS1 to Al and that pH increase of the medium and chelation of Al ions are not involved in Al tolerance of this organism.

  17. Comparative mapping of QTLs for AI tolerance in rice and identification of positional Al-induced genes

    Institute of Scientific and Technical Information of China (English)

    毛传澡; 杨玲; 郑炳松; 吴运荣; 刘非燕; 易可可; 吴平

    2004-01-01

    Aluminum (A1) toxicity is the major factor limiting crop productivity in acid soils. In this study, a recombinant inbreed line (RIL) population derived from a cross between an A1 sensitive lowland indica rice variety IR1552 and an A1 tolerant upland japonica rice variety Azucena, was used for mapping quantitative trait loci (QTLs) for A1 tolerance. Three QTLs for relative root length (RRL) were detected on chromosome 1,9, 12, respectively, and 1 QTL for root length under A1 stress is identical on chromosome 1 after one week and two weeks stress. Comparison of QTLs on chromosome 1 from different studies indicated an identical interval between C86 and RZ801 with gene(s) for A1 tolerance. This interval provides an important start point for isolating genes responsible for A1 tolerance and understanding the genetic nature of Al tolerance in rice. Four A1 induced ESTs located in this interval were screened by reverse Northern analysis and confirmed by Northern analysis. They would be candidate genes for the QTL.

  18. Comparative mapping of QTLs for Al tolerance in rice and identification of positional Al-induced genes

    Institute of Scientific and Technical Information of China (English)

    毛传澡; 杨玲; 郑炳松; 吴运荣; 刘非燕; 易可可; 吴平

    2004-01-01

    Aluminum (Al) toxicity is the major factor limiting crop productivity in acid soils. In this study, a recombinant inbreed line (RIL) population derived from a cross between an A1 sensitive lowland indica rice variety IR1552 and an Al tolerant upland japonica rice variety Azucena, was used for mapping quantitative trait loci (QTLs) for A1 tolerance. Three QTLs for relative root length (RRL) were detected on chromosome 1, 9, 12, respectively, and I QTL for root length under Al stress is identical on chromosome I after one week and two weeks stress. Comparison of QTLs on chromosome 1 from different studies indicated an identical interval between C86 and RZ801 with gene(s) for Al tolerance. This interval provides an important start point for isolating genes responsible for A1 tolerance and understanding the genetic nature of Al tolerance in rice. Four Al induced ESTs located in this interval were screened by reverse Northern analysis and confirmed by Northern analysis. They would be candidate genes for the QTL.

  19. Aluminum-Tolerant Pisolithus Ectomycorrhizas Confer Increased Growth, Mineral Nutrition, and Metal Tolerance to Eucalyptus in Acidic Mine Spoil

    Directory of Open Access Journals (Sweden)

    Louise Egerton-Warburton

    2015-01-01

    Full Text Available Ectomycorrhizal fungi (ECM may increase the tolerance of their host plants to Al toxicity by immobilizing Al in fungal tissues and/or improving plant mineral nutrition. Although these benefits have been demonstrated in in vitro (pure culture or short-term nutrient solution (hydroponic experiments, fewer studies have examined these benefits in the field. This study examined the growth, mineral nutrition, and Al levels in two Eucalyptus species inoculated with three Pisolithus ecotypes that varied in Al tolerance (in vitro and grown in mine spoil in the greenhouse and field. All three ecotypes of Pisolithus improved Eucalyptus growth and increased host plant tolerance to Al in comparison to noninoculated plants. However, large variations in plant growth and mineral nutrition were detected among the Pisolithus-inoculated plants; these differences were largely explained by the functional properties of the Pisolithus inoculum. Seedlings inoculated with the most Al-tolerant Pisolithus inoculum showed significantly higher levels of N, P, Ca, Mg, and K and lower levels of Al than seedlings inoculated with Al-sensitive ecotypes of Pisolithus. These findings indicate an agreement between the fungal tolerance to Al in vitro and performance in symbiosis, indicating that both ECM-mediated mineral nutrient acquisition and Al accumulation are important in increasing the host plant Al tolerance.

  20. The PSE1 gene modulates lead tolerance in Arabidopsis

    Science.gov (United States)

    Fan, Tingting; Yang, Libo; Wu, Xi; Ni, Jiaojiao; Jiang, Haikun; Zhang, Qi’an; Fang, Ling; Sheng, Yibao; Ren, Yongbing; Cao, Shuqing

    2016-01-01

    Lead (Pb) is a dangerous heavy metal contaminant with high toxicity to plants. However, the regulatory mechanism of plant Pb tolerance is poorly understood. Here, we showed that the PSE1 gene confers Pb tolerance in Arabidopsis. A novel Pb-sensitive mutant pse1-1 (Pb-sensitive1) was isolated by screening T-DNA insertion mutants. PSE1 encodes an unknown protein with an NC domain and was localized in the cytoplasm. PSE1 was induced by Pb stress, and the pse1-1 loss-of-function mutant showed enhanced Pb sensitivity; overexpression of PSE1 resulted in increased Pb tolerance. PSE1-overexpressing plants showed increased Pb accumulation, which was accompanied by the activation of phytochelatin (PC) synthesis and related gene expression. In contrast, the pse1-1 mutant showed reduced Pb accumulation, which was associated with decreased PC synthesis and related gene expression. In addition, the expression of PDR12 was also increased in PSE1-overexpressing plants subjected to Pb stress. Our results suggest that PSE1 regulates Pb tolerance mainly through glutathione-dependent PC synthesis by activating the expression of the genes involved in PC synthesis and at least partially through activating the expression of the ABC transporter PDR12/ABCG40. PMID:27335453

  1. Comparative Investigation of Copper Tolerance and Identification of Putative Tolerance Related Genes in Tardigrades

    Science.gov (United States)

    Hygum, Thomas L.; Fobian, Dannie; Kamilari, Maria; Jørgensen, Aslak; Schiøtt, Morten; Grosell, Martin; Møbjerg, Nadja

    2017-01-01

    Tardigrades are microscopic aquatic animals renowned for their tolerance toward extreme environmental conditions. The current study is the first to investigate their tolerance toward heavy metals and we present a novel tardigrade toxicant tolerance assay based on activity assessments as a measure of survival. Specifically, we compare tolerance toward copper in four species representing different evolutionary lineages, habitats and adaptation strategies, i.e., a marine heterotardigrade, Echiniscoides sigismundi, a limno-terrestrial heterotardigrade, Echiniscus testudo, a limno-terrestrial eutardigrade, Ramazzottius oberhaeuseri, and a marine eutardigrade, Halobiotus crispae. The latter was sampled at a time of year, when the population is predominantly represented by aberrant P1 cysts, while the other species were in normal active states prior to exposure. Based on volume measurements and a general relation between body mass and copper tolerance, expected tardigrade EC50 values were estimated at 0.5–2 μg l−1. Following 24 h of exposure, tolerance was high with no apparent link to lineage or habitat. EC50s (95% CI), 24 h after exposure, were estimated at 178 (168–186) and 310 (295–328) μg l−1, respectively, for E. sigismundi and R. oberhaeuseri, whereas E. testudo and H. crispae were less affected. Highest tolerance was observed in H. crispae with a mean ± s.e.m. activity of 77 ± 2% (n = 3) 24 h after removal from ~3 mg l−1 copper, suggesting that tardigrade cysts have increased tolerance toward toxicants. In order to identify putative tolerance related genes, an E. sigismundi transcriptome was searched for key enzymes involved in osmoregulation, antioxidant defense and copper metabolism. We found high expression of Na/K ATPase and carbonic anhydrase, known targets for copper. Our transcriptome, furthermore, revealed high expression of antioxidant enzymes, copper transporters, ATOX1, and a Cu-ATPase. In summary, our results indicate that tardigrades

  2. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  3. Associated mechanisms of aluminum tolerance in plants/ Mecanismos associados à tolerância ao alumínio em plantas

    Directory of Open Access Journals (Sweden)

    Cecília Estima Sacramento dos Reis

    2007-10-01

    Full Text Available Aluminum toxicity is one of the major limiting factor regarding plant development in acid soils. The use of liming for correcting soil pH is not viable for some of acid soil areas (technique or economic reasons, making the development of Al tolerant genotypes the best alternative. Thus, the tolerance mechanisms as well as the genetic basis of Al tolerance has deserved special attention in the scientific community. In the last years, a significant progress has been achieved towards these goals, as well as in developing cultivars adapted to acid soils. The Al tolerance mechanisms are divided basically in two classes: the exclusion mechanisms that act after absorption or blocking its entry in the root system and those involved in detoxification, complexing the Al in specific organelles, mainly in the vacuoles. In many species, physiological mechanisms have been reported as responsible for the activation of organic acids (mainly citrate and malate that act as Al quelating agents, however many process are not yet understood and cleared. Currently, the basis for the internal detoxification is becoming clear through organic acid complexes and there sequestering by the vacuoles. Other potential mechanisms are the target for discussions.A toxicidade do alumínio é um dos principais fatores limitantes do desenvolvimento das plantas em solos ácidos. Pelo fato da utilização de corretivos da acidez do solo não ser a estratégia mais viável em muitas situações com solos ácidos (por razões técnicas e econômicas, o desenvolvimento de genótipos tolerantes ao Al tem sido o caminho mais focado, assim a investigação dos mecanismos de tolerância bem como as bases genéticas da tolerância ao Al têm merecido atenção especial pela pesquisa científica. Nos últimos anos, foi gerado um significativo progresso no entendimento das bases dos mecanismos de tolerância ao Al, assim como no desenvolvimento de cultivares mais adaptados as condições de

  4. Cold tolerance of potato plants transformed with yeast invertase gene

    Directory of Open Access Journals (Sweden)

    Alexander N. Deryaabin

    2013-12-01

    Full Text Available Our study was carried out with potato plants (Solanum tuberosun L.,cv. Désirée transformed with the yeast invertase gene under the control of the B33 class I patatin promoter and with the proteinase inhibitor II leader peptide sequence providing for the apoplastic enzyme localization (B33-inv plants and with the plants transformed with the reporter gene encoding bb-glucuronidase under the control of the 35S CaMV promoter (control plants. Exposure to 5°C during 6 days caused an increase in invertase activity and sugar content in B33-inv leaves in comparison with the control plants. Cell membranes of B33-inv plant cells showed greater cold tolerance under low temperature conditions than control plants that was recorded by electrolyte release. We supposed that higher cold tolerance of B33-inv plants was caused by stabilizing effect of sugar on the membranes, because B33-inv plants differ from the control plants in higher invertase activity, induced by expression of yeast invertase gene, and high content of sugars.

  5. Functional Identification and Characterization of Genes Cloned from Halophyte Seashore Paspalum Conferring Salinity and Cadmium Tolerance

    Directory of Open Access Journals (Sweden)

    Yu eChen

    2016-02-01

    Full Text Available Salinity-affected and heavy metal-contaminated soils limit the growth of glycophytic plants. Identifying genes responsible for superior tolerance to salinity and heavy metals in halophytes has great potential for use in developing salinity- and Cd-tolerant glycophytes. The objective of this study was to identify salinity- and Cd-tolerance related genes in seashore paspalum (Paspalum vaginatum, a halophytic perennial grass species, using the yeast cDNA expression library screening method. Based on the Gateway-compatible vector system, a high quality entry library was constructed, which contained 9.9×106 clones with an average inserted fragments length of 1.48 kb representing a 100% full-length rate. The yeast expression libraries were screened in a salinity-sensitive and a Cd-sensitive yeast mutant. The screening yielded 32 salinity-tolerant clones harboring 18 salinity-tolerance genes and 20 Cd-tolerant clones, including 5 Cd-tolerance genes. qPCR analysis confirmed that most of the 18 salinity-tolerance and 5 Cd-tolerance genes were up-regulated at the transcript level in response to salinity or Cd stress in seashore paspalum. Functional analysis indicated that salinity-tolerance genes from seashore paspalum could be mainly involved in photosynthetic metabolism, antioxidant systems, protein modification, iron transport, vesicle traffic, and phospholipid biosynthesis. Cd-tolerance genes from seashore paspalum could be associated with regulating pathways involved in phytochelatin synthesis, HSFA4-relsted stress protection, CYP450 complex and sugar metabolism. The 18 salinity-tolerance genes and 5 Cd-tolerance genes could be potentially used as candidate genes for genetic modification of glycophytic grass species to improve salinity and Cd tolerance and for further analysis of molecular mechanisms regulating salinity and Cd tolerance.

  6. Functional Identification and Characterization of Genes Cloned from Halophyte Seashore Paspalum Conferring Salinity and Cadmium Tolerance

    Science.gov (United States)

    Chen, Yu; Chen, Chuanming; Tan, Zhiqun; Liu, Jun; Zhuang, Lili; Yang, Zhimin; Huang, Bingru

    2016-01-01

    Salinity-affected and heavy metal-contaminated soils limit the growth of glycophytic plants. Identifying genes responsible for superior tolerance to salinity and heavy metals in halophytes has great potential for use in developing salinity- and Cd-tolerant glycophytes. The objective of this study was to identify salinity- and Cd-tolerance related genes in seashore paspalum (Paspalum vaginatum), a halophytic perennial grass species, using yeast cDNA expression library screening method. Based on the Gateway-compatible vector system, a high-quality entry library was constructed, which contained 9.9 × 106 clones with an average inserted fragment length of 1.48 kb representing a 100% full-length rate. The yeast expression libraries were screened in a salinity-sensitive and a Cd-sensitive yeast mutant. The screening yielded 32 salinity-tolerant clones harboring 18 salinity-tolerance genes and 20 Cd-tolerant clones, including five Cd-tolerance genes. qPCR analysis confirmed that most of the 18 salinity-tolerance and five Cd-tolerance genes were up-regulated at the transcript level in response to salinity or Cd stress in seashore paspalum. Functional analysis indicated that salinity-tolerance genes from seashore paspalum could be involved mainly in photosynthetic metabolism, antioxidant systems, protein modification, iron transport, vesicle traffic, and phospholipid biosynthesis. Cd-tolerance genes could be associated with regulating pathways that are involved in phytochelatin synthesis, HSFA4-related stress protection, CYP450 complex, and sugar metabolism. The 18 salinity-tolerance genes and five Cd-tolerance genes could be potentially used as candidate genes for genetic modification of glycophytic grass species to improve salinity and Cd tolerance and for further analysis of molecular mechanisms regulating salinity and Cd tolerance. PMID:26904068

  7. Rice-arsenate interactions in hydroponics: a three-gene model for tolerance.

    Science.gov (United States)

    Norton, Gareth J; Nigar, Meher; Williams, Paul N; Dasgupta, Tapash; Meharg, Andrew A; Price, Adam H

    2008-01-01

    In this study, the genetic mapping of the tolerance of root growth to 13.3 muM arsenate [As(V)] using the BalaxAzucena population is improved, and candidate genes for further study are identified. A remarkable three-gene model of tolerance is advanced, which appears to involve epistatic interaction between three major genes, two on chromosome 6 and one on chromosome 10. Any combination of two of these genes inherited from the tolerant parent leads to the plant having tolerance. Lists of potential positional candidate genes are presented. These are then refined using whole genome transcriptomics data and bioinformatics. Physiological evidence is also provided that genes related to phosphate transport are unlikely to be behind the genetic loci conferring tolerance. These results offer testable hypotheses for genes related to As(V) tolerance that might offer strategies for mitigating arsenic (As) accumulation in consumed rice.

  8. Regeneration of transgenic loblolly pine expressing genes for salt tolerance

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Salinity stress is one of the most serious factors limiting the distribution and productivity of crops and forest trees. The detrimental effects of salt on plants are a consequence of both a water deficit resulting in osmotic stress and the effects of excess sodium ions on critical biochemical process. A novel approach to improve salt tolerance has been established by using the technology of plant genetic transformation and using loblolly pine (Pinus taeda L.) as a model plant. Mature zygotic embryos of loblolly pine were infected with Agrobacterium tumefaciens strain LBA 4404 harbouring the plasmid pBIGM which carrying the mannitol-1-phosphate dehydrogenase (Mt1D) and glucitol-6-phosphate dehydrogenase (GutD). Organogenic transgenic calli and transgenic regenerated plantlets were produced on selection medium containing 15mg/L kanamycin and confirmed by Southern blot analysis of genomic DNA. Salt tolerance assays demonstrated that the salt tolerance of transgenic calli and regenerated plantlets were increased. These results suggested that an efficient Agrobacterium tumefaciens-mediated transformation protocol for stable integration of foreign genes into loblolly pine has been developed and this could be useful for the future studies on engineering breeding of conifers.

  9. Gene Networks in Plant Ozone Stress Response and Tolerance

    Institute of Scientific and Technical Information of China (English)

    Agnieszka Ludwikow; Jan Sadowski

    2008-01-01

    For many plant species ozone stress has become much more severe in the last decade. The accumulating evidence for the significant effects of ozone pollutant on crop and forest yield situate ozone as one of the most important environmental stress factors that limits plant productivity woddwide. Today, transcdptomic approaches seem to give the best coverage of genome level responses. Therefore, microarray serves as an invaluable tool for global gene expression analyses, unravelling new information about gene pathways, in-species and crose-species gene expression comparison, and for the characterization of unknown relationships between genes. In this review we summadze the recent progress in the transcdptomics of ozone to demonstrate the benefits that can be harvested from the application of integrative and systematic analytical approaches to study ozone stress response. We focused our consideration on microarray analyses identifying gene networks responsible for response and tolerance to elevated ozone concentration. From these analyses it is now possible to notice how plant ozone defense responses depend on the interplay between many complex signaling pathways and metabolite signals.

  10. CONTROLE GENÉTICO DA TOLERÂNCIA DO TRIGO À TOXICIDADE DE ALUMÍNIO EM SOLUÇÕES NUTRITIVAS GENETIC CONTROL OF ALUMINUM TOXICITY TOLERANCE IN WHEAT IN NUTRIENT SOLUTIONS

    Directory of Open Access Journals (Sweden)

    CARLOS EDUARDO DE OLIVEIRA CAMARGO

    1998-01-01

    Full Text Available O cultivar IAC-227 (P1, de porte alto e tolerante à toxicidade de alumínio, foi cruzado com os genótipos mexicanos de porte semi-anão: CMH 79.481/CMH 77A.917 (P2, sensível à toxicidade de alumínio, e CMH 80A.747 (P3, tolerante. Plântulas dos parentais e da geração F1, bem como das gerações F2 e F3 dos cruzamentos P1 x P2 e P1 x P3 , e da geração F2 dos retrocruzamentos (P1 x P2 x P1, (P1 x P2 x P2, (P1 x P3 x P1 e (P1 x P3 x P3, foram avaliadas em soluções nutritivas de tratamento contendo 3 mg.L-1 de Al3+. A tolerância à toxicidade de alumínio foi medida pela capacidade de crescimento da raiz primária central em solução nutritiva completa, após um tratamento de 48 horas em solução contendo 3 mg.L-1 de Al3+. O cultivar IAC-227 diferiu do genótipo CMH 79.481/CMH 77A.917 por um par de alelos dominantes para tolerância à presença dessa concentração de alumínio nas soluções nutritivas. Os genótipos IAC-227 e CMH 80A.747 não diferiram quanto ao número de pares de alelos para tolerância. O CMH 80A.747 pode ser utilizado como fonte genética dessa tolerância, além de outras características agronômicas em programas de melhoramento.The tall cultivar IAC-227 (P1, tolerant to aluminum toxicity was crossed with the semidwarf Mexican genotypes: CMH 79.481/CMH 77A.917 (P2, sensitive to aluminum toxicity and CMH 80A.747 (P3, tolerant. Parents and F1 seedlings as well as F2 and F3 generations from the crosses P1 x P2 and P1 x P3 and F2 generation from the backcrosses (P1 x P2 x P1, (P1 x P2 x P2, (P1 x P3 x P1 and (P1 x P3 x P3 were evaluated in nutrient solutions containing 3 mg.L-1 of Al3+. It was considered tolerant the plant that showed root regrowth of the central primary root in the complete nutrient solution after a treatment of 48 hours in a solution containing 3 mg.L-1 of Al3+. The cultivar IAC-227 differed from the genotype CMH 79.481/CMH 77A.917 by one pair of dominant genes for the tolerance to the presence

  11. big bang gene modulates gut immune tolerance in Drosophila

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y.; Boulianne, Gabrielle L.; Hoffmann, Jules A.; Matt, Nicolas; Reichhart, Jean-Marc

    2013-01-01

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases. PMID:23378635

  12. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  13. TrgI, toluene repressed gene I, a novel gene involved in toluene-tolerance in Pseudomonas putida S12

    NARCIS (Netherlands)

    Volkers, R.J.M.; Ballerstedt, H.; Ruijssenaars, H.; Bont, J.A.M. de; Winde, J.H. de; Wery, J.

    2009-01-01

    Pseudomonas putida S12 is well known for its remarkable solvent tolerance. Transcriptomics analysis of this bacterium grown in toluene-containing chemostats revealed the differential expression of 253 genes. As expected, the genes encoding one of the major solvent tolerance mechanisms, the solvent e

  14. Mapping Quantitative Trait Loci Associated with Aluminum Toxin Tolerance in NJRIKY Recombinant Inbred Line Population of Soybean(Glycine max)

    Institute of Scientific and Technical Information of China (English)

    Bo Qi; Paul Korir; Tuanjie Zhao; Deyue Yu; Shouyi Chen; Junyi Gai

    2008-01-01

    To investigate the genetic mechanism of AI-tolerance in soybean,a recombinant inbred line population (RIL) with 184 F2:7:11 lines derived from the cross of Kefeng No.1 x Nannong 1138-2 (AI-tolerant x AI-sensitive) were tested in pot experimentwith sand culture medium in net room in Nanjing.Four traits,i.e.plant height,number of leaves,shoot dry weight and root dry weight at seedling stage,were evaluated and used to calculate the average membership index (FAi) as the indicator of AI-tolerance.The composite interval mapping (ClM) under WinQTL Cartographer v.2.5 detected five QTLs (i.e.qFAiol,qFAi-2,qFAi-3,qFAi-4 and qFAi-5),explaining 5.20%-9.07% of the total phenotypic variation individually.While with the multiple interval mapping (MIM) of the same software,five QTLs (qFAi-1,qFAi-5,qFAi-6,qFAi-7,and qFAi-8) explaining 5.7%-24.60% of the total phenotypic variation individually were mapped.Here qFAi-1 and qFAi-5 were detected by both CIM and MIM with the locations in a same flanking marker region,GMKF046-GMKF080 on B1 and satt278-sat_95 on L,respectively.While qFAi-2 under CIM and qFAi-6 under MIM both on D1b2 were located in neighboring regions with their confidence intervals overlapped and might be the same locus.Segregation analysis under major gene plus polygene inheritance model showed that Al-tolerance was controlled by two major genes (h2mg =33.05%) plus polygenes (h2pg=52.73%).Both QTL mapping and segregation analysis confirmed two QTLs responsible for Al-tolerance with relatively low heritability,and there might be a third QTL,confounded with the polygenes in segregation analysis.

  15. Tolerance

    NARCIS (Netherlands)

    Doorn, van M.

    2012-01-01

    Tolerance entails acceptance of the very things one disagrees with, disapproves of or dislikes. Tolerance can be seen as ‘a flawed virtue’ (Schuyt, 2001), because it concerns acceptance of the differences between others and ourselves we would rather fight, ignore or overcome. Although tolerance carr

  16. Transcriptome Sequencing Identified Genes and Gene Ontologies Associated with Early Freezing Tolerance in Maize

    Science.gov (United States)

    Li, Zhao; Hu, Guanghui; Liu, Xiangfeng; Zhou, Yao; Li, Yu; Zhang, Xu; Yuan, Xiaohui; Zhang, Qian; Yang, Deguang; Wang, Tianyu; Zhang, Zhiwu

    2016-01-01

    Originating in a tropical climate, maize has faced great challenges as cultivation has expanded to the majority of the world's temperate zones. In these zones, frost and cold temperatures are major factors that prevent maize from reaching its full yield potential. Among 30 elite maize inbred lines adapted to northern China, we identified two lines of extreme, but opposite, freezing tolerance levels—highly tolerant and highly sensitive. During the seedling stage of these two lines, we used RNA-seq to measure changes in maize whole genome transcriptome before and after freezing treatment. In total, 19,794 genes were expressed, of which 4550 exhibited differential expression due to either treatment (before or after freezing) or line type (tolerant or sensitive). Of the 4550 differently expressed genes, 948 exhibited differential expression due to treatment within line or lines under freezing condition. Analysis of gene ontology found that these 948 genes were significantly enriched for binding functions (DNA binding, ATP binding, and metal ion binding), protein kinase activity, and peptidase activity. Based on their enrichment, literature support, and significant levels of differential expression, 30 of these 948 genes were selected for quantitative real-time PCR (qRT-PCR) validation. The validation confirmed our RNA-Seq-based findings, with squared correlation coefficients of 80% and 50% in the tolerance and sensitive lines, respectively. This study provided valuable resources for further studies to enhance understanding of the molecular mechanisms underlying maize early freezing response and enable targeted breeding strategies for developing varieties with superior frost resistance to achieve yield potential. PMID:27774095

  17. Alcohol-induced histone acetylation reveals a gene network involved in alcohol tolerance.

    Directory of Open Access Journals (Sweden)

    Alfredo Ghezzi

    Full Text Available Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol.

  18. Tolerância ao alumínio em cultivares de aveia branca sob cultivo hidropônico Tolerance to the aluminum in oat cultivars under hydroponic culture

    Directory of Open Access Journals (Sweden)

    José Antonio Gonzalez da Silva

    2007-01-01

    Full Text Available O emprego do cultivo hidropônico para avaliar a tolerância à toxicidade pelo alumínio em genótipos de aveia pode ser feito por meio da medida da retomada do crescimento de raiz. Avaliaram-se 12 cultivares de aveia branca indicadas para o cultivo no Sul do Brasil com o intuito de caracterizar a tolerância ao alumínio, de maneira a ser estrategicamente recomendadas e/ou incluídas em blocos de cruzamento na obtenção de constituições genéticas de elevado potencial produtivo e tolerante ao íon metálico. Foram utilizadas doses de 10, 15 e 20 mg L-1 de alumínio na solução hidropônica e o delineamento experimental adotado foi o completamente casualizado, com três repetições, seguindo o esquema fatorial (12 x 3. As doses empregadas são altamente eficientes na identificação de genótipos de aveia tolerantes e sensíveis ao alumínio tóxico. As cultivares UPF 16, URS 21, UFRGS 14, UPF 19 e UFRGS 17 expressam tolerância.The use of hidroponic culture to evaluate tolerance to aluminum toxicity in oat genotypes can be performed by measuring root regrowth, allowing phenotypically to discriminate tolerant genetic constitutions sensitivity. Twelve white oat cultivars indicated for cultivation in Southern Brazil were evaluated aiming at to characterize their aluminum tolerance, in order to use them as parents in crosses or to recommend them for in cultivation regions. Aluminum concentration of 10, 15 and 20 mg L-1 were used in the hydroponic solution arranged in complete randomized blocks with three replications in 12 x 3 factorial designs. Concentrations of 10, 15 and 20 mg L-1 were highly efficient for the identification of tolerant and sensitive oat genotypes. Cultivars UPF 16, URS 21, UFRGS 14, UPF 19 and UFRGS 17 showed aluminum.

  19. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated...... by the desire to experiment and to become otherwise. The objective is to discuss what gets lost, conceptually as well as politically, when we neglect the subsistence of active tolerance within other practices of tolerance, and to develop a theory of active tolerance in which tolerance's mobilizing character...... is linked to a different set of circumstances than the ones suggested by existing models in contemporary democratic theory. Reorienting the discussion of tolerance, the book raises the question of how to disclose new possibilities within our given context of affect and perception. Once we move away from...

  20. 酸性土壤中耐铝细菌的筛选鉴定及其耐铝能力分析%Isolation and identification of aluminum-tolerant bacteria and analysis of their aluminum-tolerance

    Institute of Scientific and Technical Information of China (English)

    王阁奇; 年洪娟; 赵丽伟; 陈丽梅

    2012-01-01

    Thirteen aluminum (Al) -tolerant bacteria strains were screened and isolated from acid soils using the S-LB medium containing 1 mmol/L Al3 + . Of the thirteen strains, six were selected to perform morphological analysis. The results indicated that the cells of all these strains were rod. One had Gram-positive reaction while the other five had Gram-negative reactions. 16S rDNAs from these strains were amplified with general primers of bacteria to conduct sequence analysis. The obtained sequences were compared with the known sequences in GenBank. The phylogenetic tree was constructed with MEGA 4.0 software according to Neighbor-joining method. The result showed that the isolated strains were closest relative with Enterobacter endosymbiont, Serratia marcescens, Pantoea agglomerans, Enterobacter aerogenes, Bacillus subtilis and Enterobacter asburiae, respectively. All these strains could grow on LB solid medium ( pH 4.5) containing 2 mmol/L Al3 +, suggesting that they had ability to tolerate higher concentrations of Al3+. These strains will be very good materials for the future researches on Al-tolerant mechanism in bacteria.%以含有1 mmol/L Al3+的S-LB培养基作为筛选培养基,从酸性土壤中分离到13株耐铝的细菌菌株,选取其中6株进行形态学分析,结果观察到这些菌株的菌体均呈杆状,其中1株为革兰阳性反应,其余5株为革兰阴性反应.以细菌通用引物扩增这些菌株的16S rDNA并测序,将得到的序列与GenBank中的序列进行BLAST比对,利用MEGA 4.0软件,按照Neighbor-joining法构建系统进化树,这6个菌株分别与Enterobacter endosymbiont、Serratia marcescens、Pantoea agglomerans、Enterobacter aerogenes、Bacillus subtilis和Enterobacter asburiae的亲缘关系最近.将这些菌株接种到加有2 mmol/L Al3+、pH 4.5的S-LB固体培养基上培养时,它们都能生长,说明这些菌株具有较好的耐铝能力,这些菌株为进一步研究细菌的耐铝机制提供了极好的材料.

  1. Quantitative transcription dynamic analysis reveals candidate genes and key regulators for ethanol tolerance in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Ma Menggen

    2010-06-01

    Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance

  2. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    OpenAIRE

    Bingfu eGuo; Yong eGuo; Huilong eHong; Longguo eJin; Lijuan eZhang; Ru-Zhen eChang; Wei eLu; Min eLin; Li-Juan eQiu

    2015-01-01

    Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

  3. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  4. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

    Directory of Open Access Journals (Sweden)

    Yoshiki eNakahara

    2015-10-01

    Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  5. Investigations of Aluminum-Doped Self-Healing Zircaloy Surfaces in Context of Accident-Tolerant Fuel Cladding Research

    Science.gov (United States)

    Carr, James; Vasudevamurthy, Gokul; Snead, Lance; Hinderliter, Brian; Massey, Caleb

    2016-06-01

    We present here some important results investigating aluminum as an effective surface dopant for increased oxidation resistance of zircaloy nuclear fuel cladding. At first, the transport behavior of aluminum into reactor grade zircaloy was studied using simple diffusion couples at temperatures greater than 770 K. The experiments revealed the formation of tens of microns thick graded Zr-Al layers. The activation energy of aluminum in zircaloy was found to be ~175 kJ/mol (~1.8 eV), indicating the high mobility of aluminum in zircaloy. Subsequently, aluminum sputter-coated zircaloy coupons were heat-treated to achieve surface doping and form compositionally graded layers. These coupons were then tested in steam environments at 1073 and 1273 K. The microstructure of the as-fabricated and steam-corroded specimens was compared to those of pure zircaloy control specimens. Analysis of data revealed that aluminum effectively competed with zircaloy for oxygen up until 1073 K blocking oxygen penetration, with no traces of large scale spalling, indicating mechanically stable interfaces and surfaces. At the highest steam test temperatures, aluminum was observed to segregate from the Zr-Al alloy under layers and migrate to the surface forming discrete clusters. Although this is perceived as an extremely desirable phenomenon, in the current experiments, oxygen was observed to penetrate into the zirconium-rich under layers, which could be attributed to formation of surface defects such as cracks in the surface alumina layers.

  6. Transformation of japonica rice with RHL gene and salt tolerance of the transgenic rice plant

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Overexpression of the yeast HAL2 gene increases salt tolerance of yeast and plant. Rice HAL2-like (RHL) gene was introduced into a japonica rice cultivar HJ19 with Agrobacterium tumefaciens-mediated transformation. Transgenic plants in R0 generation were selected on the principle of GUS-positive, RHL gene PCR-positive and normal growth. Hygromycin-resistant plants of some transgenic lines in R1 generation increased salt tolerance during the seedling and booting stage, being less damaged in the cytomembrane and stronger in leaf tissue viability under salt stress during booting period. Southern analysis of transgenic lines tolerant to salt in R1 generation showed that the RHL gene expression cassette had been successfully integrated into rice genome. Moreover, gene engineering breeding methodology and really salt-tolerant rice cultivar were discussed.

  7. 傅里叶变换红外光谱法研究蚕豆耐铝性%Study on aluminum tolerance of broadbeans by FTIR spectra

    Institute of Scientific and Technical Information of China (English)

    王赢; 罗义勇; 张亚楠; 黄庶识; 郝永生; 陈丽梅; 李昆志

    2011-01-01

    Fourier transform infrared spectroscopy (FTIR) spectra of roots, stems, leaves of Yunnan broadbeans (Vicia faba L. ) 83324 and 8363 were studied through kBr pellet method,which were treated by different concentrations of aluminum. Results showed that lower concentration of aluminum can make the characteristic peaks (3 375, 2 928, 1 645, 1 428, 1 245, 1 060 cm-1) of broadbean 8363 descended, which indicated that the aluminum resistance of broadbean 8363 was lower than that of broadbean 83324. Also, this experiment provided references and methods for studying the aluminum tolerance mechanism of Brodbeans. Moreover, root elongation experiment and chrome azurol dyeing experiment showed that aluminum can poison broadbean 8363 more easily,which verified the results of FT1R. All results indicated that FTIR might be a new, rapid and accurate method in investigating the difference of aluminum tolerance among different kinds of broadbeans.%利用KBr压片法,研究不同浓度铝溶液处理下云南蚕豆(Vicia faba Linn)品种83324和8363根、茎、叶的傅里叶变换红外光谱(FTIR)图谱.结果表明:相对于蚕豆83324,较低浓度的铝溶液便能使蚕豆8363的特征峰(3 375、2 928、1 645、1 428、1 245和1 060 cm-1)下降,表明蚕豆8363的耐铝性低于蚕豆83324.此外,蚕豆根伸长试验和铬天青染色试验结果均表明铝更容易毒害蚕豆8363的根部,进一步验证了傅里叶红外光谱的结果.研究结果表明,FTIR法可以作为一种鉴定不同蚕豆品种耐铝性差异的新型快速检验方法.

  8. Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.

    Science.gov (United States)

    An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja

    2015-03-01

    Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid.

  9. Detection of drought tolerant genes within seedling apple rootstocks in Syria

    Science.gov (United States)

    This investigation was conducted to detect the drought tolerant genes (four genes) within seedling apple rootstocks derived from five apple genotypes, including Syrian apple cultivars. The results showed that the gene MdPepPro (a cyclophilin) was found in all studied genotypes and their progenies e...

  10. Differentially Expressed Genes between Two Barley Cultivars Contrasting in Drought Tolerance

    Institute of Scientific and Technical Information of China (English)

    P.G. Guo; M. Baum; R.H. Li; S. Grando; R.K. Varshney; J. Valkoun; S. Ceccarelli; A. Grane

    2007-01-01

    @@ Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas. A number of genes have been described that respond to drought at the transcriptional level (Seki et al., 2002; Cheong et al.,2003).

  11. Role of Metabolic Genes in Blood Aluminum Concentrations of Jamaican Children with and without Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Mohammad H. Rahbar

    2016-11-01

    Full Text Available Aluminum is a neurotoxic metal with known health effects in animals and humans. Glutathione-S-transferase (GST genes and enzymes play a major role in detoxification of several heavy metals. Besides a direct relationship with oxidative stress; aluminum decreases GST enzyme activities. Using data from 116 Jamaican children; age 2–8 years; with Autism Spectrum Disorder (ASD and 116 sex- and age-matched typically developing (TD children; we investigated the association of polymorphisms in three GST genes (GSTP1; GSTM1; and GSTT1 with mean blood aluminum concentrations in children with and without ASD. Using log-transformed blood aluminum concentration as the dependent variable in a linear regression model; we assessed the additive and interactive effects of ASD status and polymorphisms in the three aforementioned GST genes in relation to blood aluminum concentrations. Although none of the additive effects were statistically significant (all p > 0.16; we observed a marginally significant interaction between GSTP1 Ile105Val (rs1695 and ASD status (p = 0.07; even after controlling for parental education level and consumption of avocado; root vegetables; and tuna (canned fish. Our findings indicate a significantly lower (p < 0.03 adjusted geometric mean blood aluminum concentration for TD children who had the Val/Val genotype (14.57 µg/L; compared with those with Ile/Ile or Ile/Val genotypes who had an adjusted geometric mean of 23.75 µg/L. However; this difference was not statistically significant among the ASD cases (p = 0.76. Our findings indicate that ASD status may be a potential effect modifier when assessing the association between GSTP1 rs1695 and blood aluminum concentrations among Jamaican children. These findings require replication in other populations.

  12. Role of Metabolic Genes in Blood Aluminum Concentrations of Jamaican Children with and without Autism Spectrum Disorder.

    Science.gov (United States)

    Rahbar, Mohammad H; Samms-Vaughan, Maureen; Pitcher, Meagan R; Bressler, Jan; Hessabi, Manouchehr; Loveland, Katherine A; Christian, MacKinsey A; Grove, Megan L; Shakespeare-Pellington, Sydonnie; Beecher, Compton; McLaughlin, Wayne; Boerwinkle, Eric

    2016-11-08

    Aluminum is a neurotoxic metal with known health effects in animals and humans. Glutathione-S-transferase (GST) genes and enzymes play a major role in detoxification of several heavy metals. Besides a direct relationship with oxidative stress; aluminum decreases GST enzyme activities. Using data from 116 Jamaican children; age 2-8 years; with Autism Spectrum Disorder (ASD) and 116 sex- and age-matched typically developing (TD) children; we investigated the association of polymorphisms in three GST genes (GSTP1; GSTM1; and GSTT1) with mean blood aluminum concentrations in children with and without ASD. Using log-transformed blood aluminum concentration as the dependent variable in a linear regression model; we assessed the additive and interactive effects of ASD status and polymorphisms in the three aforementioned GST genes in relation to blood aluminum concentrations. Although none of the additive effects were statistically significant (all p > 0.16); we observed a marginally significant interaction between GSTP1 Ile105Val (rs1695) and ASD status (p = 0.07); even after controlling for parental education level and consumption of avocado; root vegetables; and tuna (canned fish). Our findings indicate a significantly lower (p < 0.03) adjusted geometric mean blood aluminum concentration for TD children who had the Val/Val genotype (14.57 µg/L); compared with those with Ile/Ile or Ile/Val genotypes who had an adjusted geometric mean of 23.75 µg/L. However; this difference was not statistically significant among the ASD cases (p = 0.76). Our findings indicate that ASD status may be a potential effect modifier when assessing the association between GSTP1 rs1695 and blood aluminum concentrations among Jamaican children. These findings require replication in other populations.

  13. Meta-analysis and candidate gene mining of low-phosphorus tolerance in maize

    Institute of Scientific and Technical Information of China (English)

    Hongwei Zhang; Mohammed Shalim Uddin; Cheng Zou; Chuanxiao Xie; Yunbi Xu; WenXue Li

    2014-01-01

    Plants with tolerance to low-phosphorus (P) can grow better under low-P conditions, and understanding of genetic mechanisms of low-P tolerance can not only facilitate identifying relevant genes but also help to develop low-P tolerant cultivars. QTL meta-analysis was conducted after a comprehensive review of the reports on QTL mapping for low-P tolerance-related traits in maize. Meta-analysis pro-duced 23 consensus QTL (cQTL), 17 of which located in similar chromosome regions to those previously reported to influence root traits. Meanwhile, candidate gene mining yielded 215 genes, 22 of which located in the cQTL regions. These 22 genes are homologous to 14 functionally character-ized genes that were found to participate in plant low-P tolerance, including genes encoding miR399s, Pi transporters and purple acid phosphatases. Four cQTL loci (cQTL2-1, cQTL5-3, cQTL6-2, and cQTL10-2) may play important roles for low-P tolerance because each contains more original QTL and has better consistency across previous reports.

  14. Comparison of genome-wide selection strategies to identify furfural tolerance genes in Escherichia coli.

    Science.gov (United States)

    Glebes, Tirzah Y; Sandoval, Nicholas R; Gillis, Jacob H; Gill, Ryan T

    2015-01-01

    Engineering both feedstock and product tolerance is important for transitioning towards next-generation biofuels derived from renewable sources. Tolerance to chemical inhibitors typically results in complex phenotypes, for which multiple genetic changes must often be made to confer tolerance. Here, we performed a genome-wide search for furfural-tolerant alleles using the TRackable Multiplex Recombineering (TRMR) method (Warner et al. (2010), Nature Biotechnology), which uses chromosomally integrated mutations directed towards increased or decreased expression of virtually every gene in Escherichia coli. We employed various growth selection strategies to assess the role of selection design towards growth enrichments. We also compared genes with increased fitness from our TRMR selection to those from a previously reported genome-wide identification study of furfural tolerance genes using a plasmid-based genomic library approach (Glebes et al. (2014) PLOS ONE). In several cases, growth improvements were observed for the chromosomally integrated promoter/RBS mutations but not for the plasmid-based overexpression constructs. Through this assessment, four novel tolerance genes, ahpC, yhjH, rna, and dicA, were identified and confirmed for their effect on improving growth in the presence of furfural.

  15. Elevation of arginine decarboxylase-dependent putrescine production enhances aluminum tolerance by decreasing aluminum retention in root cell walls of wheat.

    Science.gov (United States)

    Yu, Yan; Jin, Chongwei; Sun, Chengliang; Wang, Jinghong; Ye, Yiquan; Lu, Lingli; Lin, Xianyong

    2015-12-15

    Aluminum (Al) stress induces putrescine (Put) accumulation in several plants and this response is proposed to alleviate Al toxicity. However, the mechanisms underlying this alleviation remain largely unknown. Here, we show that exposure to Al clearly increases Put accumulation in the roots of wheat plants (Triticum aestivum L. 'Xi Aimai-1') and that this was accompanied by significant increase in the activity of arginine decarboxylase (ADC), a Put producing enzyme. Application of an ADC inhibitor (d-arginine) terminated the Al-induced Put accumulation, indicating that increased ADC activity may be responsible for the increase in Put accumulation in response to Al. The d-arginine treatment also increased the Al-induced accumulation of cell wall polysaccharides and the degree of pectin demethylation in wheat roots. Thus, it elevated Al retention in cell walls and exacerbated Al accumulation in roots, both of which aggravate Al toxicity in wheat plants. The opposite effects were true for exogenous Put application. These results suggest that ADC-dependent Put accumulation plays important roles in providing protection against Al toxicity in wheat plants through decreasing cell wall polysaccharides and increasing the degree of pectin methylation, thus decreasing Al retention in the cell walls.

  16. Mapping regulatory genes as candidates for cold and drought stress tolerance in barley.

    Science.gov (United States)

    Tondelli, A; Francia, E; Barabaschi, D; Aprile, A; Skinner, J S; Stockinger, E J; Stanca, A M; Pecchioni, N

    2006-02-01

    Cereal crop yield is greatly affected in many growing areas by abiotic stresses, mainly low temperature and drought. In order to find candidates for the tolerance genes for these stresses, 13 genes encoding for transcription factors and upstream regulators were screened by amplification and SSCP on six parental genotypes of three barley mapping populations ('Nure' x 'Tremois', 'Proctor' x 'Nudinka', and 'Steptoe' x 'Morex'), and mapped as newly developed STS, SNP, and SSCP markers. A new consensus function map was then drawn using the three maps above, including 16 regulatory candidate genes (CGs). The positions of barley cold and drought tolerance quantitative trait loci (QTLs) presently described in the literature were added to the consensus map to find positional candidates from among the mapped genes. A cluster of six HvCBF genes co-mapped with the Fr-H2 cold tolerance QTL, while no QTLs for the same trait were positioned on chromosome 7H, where two putative barley regulators of CBF expression, ICE1 and FRY1, found by homology search, were mapped in this work. These observations suggest that CBF gene(s) themselves, rather than their two regulators, are at present the best candidates for cold tolerance. Four out of 12 drought tolerance QTLs of the consensus map are associated with regulatory CGs, on chromosomes 2H, 5H, and 7H, and two QTLs with effector genes, on chromosomes 5H and 6H. The results obtained could be used to guide MAS applications, allowing introduction into an ideal genotype of favourable alleles of tolerance QTLs.

  17. Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.

    Science.gov (United States)

    Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel

    2014-09-01

    Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms.

  18. Network Candidate Genes in Breeding for Drought Tolerant Crops

    OpenAIRE

    Christoph Tim Krannich; Lisa Maletzki; Christina Kurowsky; Renate Horn

    2015-01-01

    Climate change leading to increased periods of low water availability as well as increasing demands for food in the coming years makes breeding for drought tolerant crops a high priority. Plants have developed diverse strategies and mechanisms to survive drought stress. However, most of these represent drought escape or avoidance strategies like early flowering or low stomatal conductance that are not applicable in breeding for crops with high yields under drought conditions. Even though a gr...

  19. Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa

    Science.gov (United States)

    Basyuni, M.; Sumardi

    2017-01-01

    This study descibes bioinformatics approach on the analyze of the salt tolerance genes in mangrove plant, Rhizophora stylosa on DDBJ/EMBL/GenBank as well as similarity, phylogenetic, potential peptide, and subcellular localization. The DNA sequence between salt tolerance gene from R. stylosa exhibited 42-11% between themselves The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the salt-tolerant genes in R. stylosa, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, first branch of Cu/Zn SOD and reverse transcriptase genes, the second branch consists of the majority genes and the last group was MAP3K alpha protein kinase only. The present study, therefore, suggested that salt tolerance genes form distinct clusters in the tree.

  20. Tolerância de cultivares de trigo a diferentes níveis de alumínio em solução nutritiva e no solo Tolerance op wheat cultivars to different levels of aluminum toxicity

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1981-01-01

    Full Text Available Foram estudados dez cultivares de trigo em soluções nutritivas contendo cinco diferentes níveis de alumínio tóxico. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após um período prévio de 48 horas em solução contendo uma concentração conhecida de alumínio. Os cultivares Siete Cerros e Tobari-66 foram sensíveis, respectivamente, a 1 e 3 ppm de alumínio. 'Alondra-S-46', 'Alondra-S-45' e 'IAC-17' foram sensíveis a 6 ppm; 'BH-1146', 'IAC-5', 'IAC-18', 'IAC-13' e 'Londrina' foram tolerantes a 10 ppm, porém 'BH-1146', 'IAC-18' e 'IAC-13' foram mais tolerantes que 'IAC-5' e 'Londrina'. Os cultivares BH-1146, IAC-17, Alondra-S-46, Tobari-66 e Siete Cerros foram cultivados em vasos contendo solo ácido mostrando a presença de alumínio. Metade do número de vasos recebeu uma aplicação de calcário. Os resultados desse experimento mostraram que o cultivar BH-1146 diferiu significativamente em produção de grãos por planta de 'Tobari-66', 'Alondra-S-46', 'IAC-17' e 'Siete Cerros'. Esse resultado confirmou a tolerância ao alumínio do cultivar BH-1146, observada quando se empregou solução nutritiva com a presença desse elemento.Ten wheat cultivars were studied to aluminum toxicity using five different levels of this element. The tolerance was measured taking into account the root growth in a aluminum-free complete nutrient solution after a previous Al treatment. With toxic amounts of Al, the primary roots did not grow at all and remained thickned at the tip as a typical Al injury. The wheat cultivars Siete Cerros and Tobari-66 were sensitive to 1 and 3 ppm of aluminum, respectively. The cultivars Alondra-S-46, Alondra-S-45 and IAC-17 were sensitive to 6 ppm. The cultivars BH-1146, IAC-5, IAC-18, IAC-13 and Londrina showed tolerance to 10 ppm but BH-1146, IAC-18 and IAC-13 were more tolerant than IAC-5 and Londrina. The cultivars BH-1146, IAC-17, Alondra-S-46

  1. The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms.

    Science.gov (United States)

    Nilsson, Martin; Rybtke, Morten; Givskov, Michael; Høiby, Niels; Twetman, Svante; Tolker-Nielsen, Tim

    2016-09-01

    Microbial biofilms are tolerant to antibiotic treatment and therefore cause problematic infections. Knowledge about the molecular mechanisms underlying biofilm-associated antimicrobial tolerance will aid the development of antibiofilm drugs. Screening of a Streptococcus mutans transposon mutant library for genes that are important for biofilm-associated antimicrobial tolerance provided evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The minimum bactericidal concentration for biofilm cells (MBC-B) for a dltA transposon mutant was eight-fold lower than that of the wild-type. The minimum bactericidal concentration for planktonic cells (MBC-P) was only slightly reduced, indicating that the mechanism involved in the observed antimicrobial tolerance has a predominant role specifically in biofilms. Experiments with a knockout dltA mutant and complemented strain confirmed that the dlt genes in S. mutans play a role in biofilm-associated tolerance to gentamicin. Confocal laser scanning microscopy analyses of biofilms grown on glass slides showed that the dltA mutant produced roughly the same amount of biofilm as the wild-type, indicating that the reduced antimicrobial tolerance of the dltA mutant is not due to a defect in biofilm formation. The products of the dlt genes have been shown to mediate alanylation of teichoic acids, and in accordance the dltA mutant showed a more negatively charged surface than the wild-type, which likely is an important factor in the reduced tolerance of the dltA mutant biofilms towards the positively charged gentamicin.

  2. Characterization of the Shewanella oneidensis Fur gene: roles in iron and acid tolerance response

    OpenAIRE

    Wu Liyou; Luo Feng; Harris Daniel P; Yang Yunfeng; Parsons Andrea B; Palumbo Anthony V; Zhou Jizhong

    2008-01-01

    Abstract Background Iron homeostasis is a key metabolism for most organisms. In many bacterial species, coordinate regulation of iron homeostasis depends on the protein product of a Fur gene. Fur also plays roles in virulence, acid tolerance, redox-stress responses, flagella chemotaxis and metabolic pathways. Results We conducted physiological and transcriptomic studies to characterize Fur in Shewanella oneidensis, with regard to its roles in iron and acid tolerance response. A S. oneidensisf...

  3. Trigo duro: tolerância à toxicidade do alumínio em soluções nutritivas e no solo Durum wheat: tolerance to aluminum toxicity in nutrient solution and in the soil

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1992-01-01

    Full Text Available Estudou-se o comportamento de 23 linhagens e cultivares de trigo duro (Triticum durum L., introduzidos do Centro Internacional de Melhoramento de Milho e Trigo (CIMMYT, México, juntamente com um cultivar de triticale e seis de trigo (Triticum aestivum L, em soluções nutritivas contendo seis concentrações de Al3+ (0, 1, 2, 3, 4 e 6 mg/litro, à temperatura constante de 25 ± 1°C, e pH 4,0. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após 48 horas em solução contendo uma concentração conhecida de alumínio. Todos os germoplasmas de trigo duro estudados e os cultivares de trigo Siete Cerros e Anahuac foram sensíveis à concentração de 1 mg/litro de Al3+. O cultivar de trigo Alondra-S-46 mostrou-se sensível a 4mg/litro de Al3+; o de triticale Chiva e os de trigo BH-1146, IAC-24 e IAC-60 exibiram tolerância à presença de 6 mg/litro de Al3+ nas soluções. Os mesmos genótipos foram também estudados em experimentos em solo ácido (V% = 14 e H + Al = 8,9 meq/100cm³ e em solo corrigido (V% = 65 e H + AI = 2,9 meq/100cm³. As produções de trigo duro em solo ácido foram baixas, variando de 939 a 2.243 kg/ha, comparadas com as dos cultivares de trigo e triticale tolerantes ao Al3+, as quais variaram de 3.584 a 4.922 kg/ha. No experimento em solo corrigido, a melhor linhagem de trigo duro (Avetoro "S" x Anhinga "S" - Pelicano "S" x D 67.2 produziu 4.128 kg/ha, em comparação com o triticale Chiva, 4547 kg/ha, e o melhor trigo IAC-24, 4.906 kg/ha. Esses resultados confirmaram a necessidade de ser incorporada tolerância ao Al3+ nos genótipos de trigo duro visando a seu cultivo em solos ácidos.Twenty three durum wheat inbred lines, one triticale and six bread wheat cultivars were studied in aerated nutrient solutions for aluminum tolerance with six different levels of aluminum (0, 1, 2, 3,4 and 6 mg/I, under constant temperature, 25 ± 1°C and pH 4.0. Aluminum

  4. Abiotic Stress Tolerance: From Gene Discovery in Model Organisms to Crop Improvement

    Institute of Scientific and Technical Information of China (English)

    Ray Bressan; Hans Bohnert; Jian-Kang Zhu

    2009-01-01

    Productive and sustainable agriculture necessitates growing plants in sub-optimal environments with less input of precious resources such as fresh water. For a better understanding and rapid improvement of abiotic stress tolerance, it is important to link physiological and biochemical work to molecular studies in genetically tractable model organisms. With the use of several technologies for the discovery of stress tolerance genes and their appropriate alleles,transgenic approaches to improving stress tolerance in crops remarkably parallels breeding principles with a greatly expanded germplasm base and will succeed eventually.

  5. Transcriptome profiling of genes and pathways associated with arsenic toxicity and tolerance in Arabidopsis

    Science.gov (United States)

    2014-01-01

    Background Arsenic (As) is a toxic metalloid found ubiquitously in the environment and widely considered an acute poison and carcinogen. However, the molecular mechanisms of the plant response to As and ensuing tolerance have not been extensively characterized. Here, we report on transcriptional changes with As treatment in two Arabidopsis accessions, Col-0 and Ws-2. Results The root elongation rate was greater for Col-0 than Ws-2 with As exposure. Accumulation of As was lower in the more tolerant accession Col-0 than in Ws-2. We compared the effect of As exposure on genome-wide gene expression in the two accessions by comparative microarray assay. The genes related to heat response and oxidative stresses were common to both accessions, which indicates conserved As stress-associated responses for the two accessions. Most of the specific response genes encoded heat shock proteins, heat shock factors, ubiquitin and aquaporin transporters. Genes coding for ethylene-signalling components were enriched in As-tolerant Col-0 with As exposure. A tolerance-associated gene candidate encoding Leucine-Rich Repeat receptor-like kinase VIII (LRR-RLK VIII) was selected for functional characterization. Genetic loss-of-function analysis of the LRR-RLK VIII gene revealed altered As sensitivity and the metal accumulation in roots. Conclusions Thus, ethylene-related pathways, maintenance of protein structure and LRR-RLK VIII-mediated signalling may be important mechanisms for toxicity and tolerance to As in the species. Here, we provide a comprehensive survey of global transcriptional regulation for As and identify stress- and tolerance-associated genes responding to As. PMID:24734953

  6. Genome-wide mapping of furfural tolerance genes in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Tirzah Y Glebes

    Full Text Available Advances in genomics have improved the ability to map complex genotype-to-phenotype relationships, like those required for engineering chemical tolerance. Here, we have applied the multiSCale Analysis of Library Enrichments (SCALEs; Lynch et al. (2007 Nat. Method. approach to map, in parallel, the effect of increased dosage for >10(5 different fragments of the Escherichia coli genome onto furfural tolerance (furfural is a key toxin of lignocellulosic hydrolysate. Only 268 of >4,000 E. coli genes (∼ 6% were enriched after growth selections in the presence of furfural. Several of the enriched genes were cloned and tested individually for their effect on furfural tolerance. Overexpression of thyA, lpcA, or groESL individually increased growth in the presence of furfural. Overexpression of lpcA, but not groESL or thyA, resulted in increased furfural reduction rate, a previously identified mechanism underlying furfural tolerance. We additionally show that plasmid-based expression of functional LpcA or GroESL is required to confer furfural tolerance. This study identifies new furfural tolerant genes, which can be applied in future strain design efforts focused on the production of fuels and chemicals from lignocellulosic hydrolysate.

  7. Genome-wide mapping of furfural tolerance genes in Escherichia coli.

    Science.gov (United States)

    Glebes, Tirzah Y; Sandoval, Nicholas R; Reeder, Philippa J; Schilling, Katherine D; Zhang, Min; Gill, Ryan T

    2014-01-01

    Advances in genomics have improved the ability to map complex genotype-to-phenotype relationships, like those required for engineering chemical tolerance. Here, we have applied the multiSCale Analysis of Library Enrichments (SCALEs; Lynch et al. (2007) Nat. Method.) approach to map, in parallel, the effect of increased dosage for >10(5) different fragments of the Escherichia coli genome onto furfural tolerance (furfural is a key toxin of lignocellulosic hydrolysate). Only 268 of >4,000 E. coli genes (∼ 6%) were enriched after growth selections in the presence of furfural. Several of the enriched genes were cloned and tested individually for their effect on furfural tolerance. Overexpression of thyA, lpcA, or groESL individually increased growth in the presence of furfural. Overexpression of lpcA, but not groESL or thyA, resulted in increased furfural reduction rate, a previously identified mechanism underlying furfural tolerance. We additionally show that plasmid-based expression of functional LpcA or GroESL is required to confer furfural tolerance. This study identifies new furfural tolerant genes, which can be applied in future strain design efforts focused on the production of fuels and chemicals from lignocellulosic hydrolysate.

  8. Enhanced salt tolerance of alfalfa (Medicago sativa) by rstB gene transformation.

    Science.gov (United States)

    Zhang, Wan-Jun; Wang, Tao

    2015-05-01

    Generating salt tolerance forage plant is essential for use of the land affected by high salinity. A salt tolerance gene rstB was used as a selectable marker gene in Agrobacterium-mediated transformation of tobacco under a selective regime of 170mM NaCl. The transgenic plants showed clear improvement in salt tolerance. To improve salt tolerance of alfalfa (Medicago sativa L.), rstB gene was introduced into alfalfa genome by Agrobacterium-mediated transformation. No abnormal phenotype was observed among the transgenic plants when compared with wild type (wt) plants. Significant enhancement of resistance to salt-shock treatment was noted on the rstB transgenic (T0) plants. Transgenic second-generation (T1) seeds showed improved germination rate and seedling growth under salt-stress condition. Hindered Na(+) accumulation, but enhanced Ca(2+) accumulation was observed on the rstB T1 plants when subjected to salt-stresses. Enhanced calcium accumulation in transgenic plants was also verified by cytohistochemical localization of calcium. Under salt-stress of 50mM NaCl, about 15% of the transgenic plants finished their life-cycle but the wt plants had no flower formation. The results demonstrated that the expression of rstB gene improved salt tolerance in transgenic alfalfa.

  9. Barley Genes as Tools to Confer Abiotic Stress Tolerance in Crops.

    Science.gov (United States)

    Gürel, Filiz; Öztürk, Zahide N; Uçarlı, Cüneyt; Rosellini, Daniele

    2016-01-01

    Barley is one of the oldest cultivated crops in the world with a high adaptive capacity. The natural tolerance of barley to stress has led to increasing interest in identification of stress responsive genes through small/large-scale omics studies, comparative genomics, and overexpression of some of these genes by genetic transformation. Two major categories of proteins involved in stress tolerance are transcription factors (TFs) responsible from the re-programming of the metabolism in stress environment, and genes encoding Late Embryogenesis Abundant (LEA) proteins, antioxidant enzymes, osmolytes, and transporters. Constitutive overexpression of several barley TFs, such as C-repeat binding factors (HvCBF4), dehydration-responsive element-binding factors (HvDREB1), and WRKYs (HvWRKY38), in transgenic plants resulted in higher tolerance to drought and salinity, possibly by effectively altering the expression levels of stress tolerance genes due to their higher DNA binding affinity. Na(+)/H(+) antiporters, channel proteins, and lipid transporters can also be the strong candidates for engineering plants for tolerance to salinity and low temperatures.

  10. Barley genes as a tool to confer abiotic stress tolerance in crops

    Directory of Open Access Journals (Sweden)

    Filiz Gürel

    2016-08-01

    Full Text Available Barley is one of the oldest cultivated crops in the world with a high adaptive capacity. The natural tolerance of barley to stress has led to increasing interest in identification of stress responsive genes through small/large-scale omics studies, comparative genomics, and overexpression of some of these genes by genetic transformation. Two major categories of proteins involved in stress tolerance are transcription factors (TFs responsible from the re-programming of the metabolism in stress environment, and genes encoding Late Embryogenesis Abundant (LEA proteins, antioxidant enzymes, osmolytes and transporters. Constitutive overexpression of several barley TFs, such as C-repeat binding factors (HvCBF4, dehydration-responsive element-binding factors (HvDREB1 and WRKYs (HvWRKY38, in transgenic plants resulted in higher tolerance to drought and salinity, possibly by effectively altering the expression levels of stress tolerance genes due to their higher DNA binding affinity. Na+/H+ antiporters, channel proteins, and lipid transporters can also be the strong candidates for engineering plants for tolerance to salinity and low temperatures.

  11. Tolerância de genótipos de cereais de inverno ao alumínio em cultivo hidropônico e em campo Tolerance of small graine cereal genotypes to aluminum on hydroponic and field cultivation

    Directory of Open Access Journals (Sweden)

    Roberto Portaluppi

    2010-02-01

    Full Text Available O objetivo deste trabalho foi determinar a capacidade de crescimento radicular de 75 genótipos de cereais de inverno em cultivo hidropônico, em diferentes concentrações de alumínio, avaliar a relação entre o grau de tolerância/sensibilidade, em solução hidropônica, e a resistência/suscetibilidade ao crestamento em campo. Os cereais cevada, triticale, centeio, trigo e Aegilops tauschii foram avaliados em hidroponia, com concentrações de Al3+ que variaram entre 0,5 (cevada, 2 e 6 (triticale, 6 e 10 (centeio e 2 mg L-1 (trigo e Ae. tauschii. Os delineamentos experimentais foram inteiramente casualizados. Em campo, foram avaliados os mesmos genótipos, exceto Ae. tauschii, em solo com pH 4,4 e 4,85, corrigido a 1/2 e 1/4 do índice SMP. Utilizou-se uma escala de notas com variação de escores de 0,5 (altamente resistente a 5 (altamente suscetível. Foi observada elevada relação entre a tolerância ao alumínio em hidroponia e a resistência ao crestamento em campo. A seleção de cereais em meio hidropônico pode ser considerada eficiente como ferramenta de apoio aos programas de melhoramento genético para essa característica.The objective of this work was to determine the root growth capacity of 75 genotypes of small graine cereals in hydroponic culture under different aluminum concentrations, and to assess the relationship betwen the level of tolerance/sensitivity in hydroponic solution and the resistance/susceptibility index in the field. Barley, triticale, rye, wheat and Aegilops tauschii were evaluated in hydroponics, with Al3+ concentrations that varied between 0.5 (barley, 2 and 6 (triticale, 6 and 10 (rye and 2 mg L-1 (wheat and Ae. tauschii. The experiments' designs were completely randomized. In the field trial, the same genotypes were assessed, except for Ae. tauschii, in soil with pH 4.4 and 4.85 adjusted to 1/2 and 1/4 of the SMP index. A score scale ranging from 0.5 (highly resistant to 5 (highly susceptible was used

  12. TNF gene expression in macrophage activation and endotoxin tolerance

    OpenAIRE

    Chow, Nancy Ann-Marie

    2013-01-01

    TNF is an inflammatory cytokine that plays a critical role in the acute phase response to infection, and its dysregulation has been implicated in the pathology of several inflammatory and autoimmune disorders. TNF gene expression is regulated in a cell type- and inducer-specific manner that involves chromatin alterations at both the TNF promoter and distal DNase I hypersensitive (DH) sites within the TNF/LT locus. While the mechanisms underlying TNF gene activation in monocytes/macrophages an...

  13. Overexpression of SOS (Salt Overly Sensitive)Genes Increases Salt Tolerance in Transgenic Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Qing Yang; Zhi-Zhong Chen; Xiao-Feng Zhoua; Hai-Bo Yin; Xia Li; Xiu-Fang Xin; Xu-Hui Hong; Jian-Kang Zhu; Zhizhong Gong

    2009-01-01

    Soil salinity is a major abiotic stress that decreases plant growth and productivity. Recently, it was reported that plants overexpressing AtNHX1 or SOS1 have significantly increased salt tolerance. To test whether overexpression of multiple genes can improve plant salt tolerance even more, we produced six different transgenic Arabidopsis plants that overexpress AtNHX1, SOS3, AtNHXl + SOS3, SOS1, SOS2 + SOS3, or SOS1 + SOS2 + SOS3. Northern blot analyses confirmed the presence of high levels of the relevant gene transcripts in transgenic plants. Transgenic Arabidopsis plants overexpressing AtNHX1 alone did not present any significant increase in salt tolerance, contrary to earlier reports. We found that transgenic plants overexpressing SOS3 exhibit increased salt tolerance similar to plants overexpressing SOS1. Moreover, salt tolerance of transgenic plants overexpressing AtNHXl + SOS3, 50S2 + SOS3, or SOS1 + SOS2 +SOS3, respectively, appeared similar to the tolerance of transgenic plants overexpressing either SOS1 or SOS3 alone.

  14. Developing transgenic maize (Zea mays L.) with insect resistance and glyphosate tolerance by fusion gene transformation

    Institute of Scientific and Technical Information of China (English)

    SUN He; LANG Zhi-hong; LU Wei; ZHANG Jie; HE Kang-lai; ZHU Li; LIN Min; HUANG Da-fang

    2015-01-01

    Using linker peptide LP4/2A for multiple gene transformation is considered to be an effective method to stack or pyramid several traits in plants. Bacil us thuringiensis (Bt) cry gene and epsps (5-enolpyruvylshikimate-3-phosphate synthase) gene are two important genes for culturing pest-resistant and glyphosate-tolerant crops. We used linker peptide LP4/2A to connect the Bt cry1Ah gene with the 2mG2-epsps gene and combined the wide-used manA gene as a selective marker to construct one coordinated expression vector cal ed p2EPUHLAGN. The expression vector was transferred into maize by Agrobacterium tumefaciens-mediated transformation, and 60 plants were obtained, 40%of which were positive transformants. Molecular detection demonstrated that the two genes in the fusion vector were expressed simultaneously and spliced correctly in translation processing;meanwhile bioassay detection proved the transgenic maize had preferable pest resistance and glyphosate tolerance. Therefore, linker peptide LP4/2A provided a simple and reliable strategy for producing gene stacking in maize and the result showed that the fusion gene transformation system of LP4/2A was feasible in monocot plants.

  15. Differential expression of salt tolerance related genes in Brassica campestris L. ssp. chinensis (L.) Makino var. communis Tsen et Lee

    Institute of Scientific and Technical Information of China (English)

    Yang QIU; Xi-xiang LI; Hai-ying ZHI; Di SHEN; Peng LU

    2009-01-01

    We examined salt tolerance responsive genes in Pak-choi under salt stress and analyze their potential function. The mRNA differential display was used to screen the transcript derived fragments (TDFs) related to salinity tolerance in tolerant and moderately tolerant Pak-choi germplasm. Seventy-eight primer combinations generated 101 differential cDNA fragments, which were divided into 10 expression types. Seven cDNA sequences (GenBank accession Nos. DQ006915-DQ006921) obtained and sequenced were highly homologous to some known expression genes or the genes related to the signaling pathways in plants under different abiotic stress.

  16. Tracking the evolution of a cold stress associated gene family in cold tolerant grasses

    DEFF Research Database (Denmark)

    Sandve, Simen R; Rudi, Heidi; Asp, Torben

    2008-01-01

    Background Grasses are adapted to a wide range of climatic conditions. Species of the subfamily Pooideae, which includes wheat, barley and important forage grasses, have evolved extreme frost tolerance. A class of ice binding proteins that inhibit ice re-crystallisation, specific to the Pooideae...... to the repeat motifs of the IRI-domain in cold tolerant grasses. Finally we show that the LRR-domain of carrot and grass IRI proteins both share homology to an Arabidopsis thaliana LRR-trans membrane protein kinase (LRR-TPK). Conclusion The diverse IRI-like genes identified in this study tell a tale...... of a complex evolutionary history including birth of an ice binding domain, a burst of gene duplication events after cold tolerant grasses radiated from rice, protein domain structure differentiation between paralogs, and sub- and/or neofunctionalisation of IRI-like proteins. From our sequence analysis we...

  17. Effects of short-term acid and aluminum exposure on the parr-smolt transformation in Atlantic salmon (Salmo salar): Disruption of seawater tolerance and endocrine status

    Science.gov (United States)

    Monette, M.Y.; Bjornsson, Bjorn Thrandur; McCormick, S.D.

    2008-01-01

    Episodic acidification resulting in increased acidity and inorganic aluminum (Ali) is known to interfere with the parr-smolt transformation of Atlantic salmon (Salmo salar), and has been implicated as a possible cause of population decline. To determine the extent and mechanism(s) by which short-term acid/Al exposure compromises smolt development, Atlantic salmon smolts were exposed to either control (pH 6.7-6.9) or acid/Al (pH 5.4-6.3, 28-64 ??g l-1 Ali) conditions for 2 and 5 days, and impacts on freshwater (FW) ion regulation, seawater (SW) tolerance, plasma hormone levels and stress response were examined. Gill Al concentrations were elevated in all smolts exposed to acid/Al relative to controls confirming exposure to increased Ali. There was no effect of acid/Al on plasma ion concentrations in FW however, smolts exposed to acid/Al followed by a 24 h SW challenge exhibited greater plasma Cl- levels than controls, indicating reduced SW tolerance. Loss of SW tolerance was accompanied by reductions in gill Na+,K+-ATPase (NKA) activity and Na+,K+,2Cl- (NKCC) cotransporter protein abundance. Acid/Al exposure resulted in decreased plasma insulin-like growth factor (IGF-I) and 3,3???,5???-triiodo-l-thyronine (T3) levels, whereas no effect of treatment was seen on plasma cortisol, growth hormone (GH), or thyroxine (T4) levels. Acid/Al exposure resulted in increased hematocrit and plasma glucose levels in FW, but both returned to control levels after 24 h in SW. The results indicate that smolt development and SW tolerance are compromised by short-term exposure to acid/Al in the absence of detectable impacts on FW ion regulation. Loss of SW tolerance during short-term acid/Al exposure likely results from reductions in gill NKA and NKCC, possibly mediated by decreases in plasma IGF-I and T3. ?? 2008 Elsevier Inc.

  18. Identification of a novel gene (Hsdr4) involved in water-stress tolerance in wild barley.

    Science.gov (United States)

    Suprunova, Tatiana; Krugman, Tamar; Distelfeld, Assaf; Fahima, Tzion; Nevo, Eviatar; Korol, Abraham

    2007-05-01

    Drought is one of the most severe stresses limiting plant growth and yield. Genes involved in water stress tolerance of wild barley (Hordeum spontaneoum), the progenitor of cultivated barley, were investigated using genotypes contrasting in their response to water stress. Gene expression profiles of water-stress tolerant vs. water-stress sensitive wild barley genotypes, under severe dehydration stress applied at the seedling stage, were compared using cDNA-AFLP analysis. Of the 1100 transcript-derived fragments (TDFs) amplified about 70 displayed differential expression between control and stress conditions. Eleven of them showed clear difference (up- or down-regulation) between tolerant and susceptible genotypes. These TDFs were isolated, sequenced and tested by RT-PCR. The differential expression of seven TDFs was confirmed by RT-PCR, and TDF-4 was selected as a promising candidate gene for water-stress tolerance. The corresponding gene, designated Hsdr4 (Hordeum spontaneum dehydration-responsive), was sequenced and the transcribed and flanking regions were determined. The deduced amino acid sequence has similarity to the rice Rho-GTPase-activating protein-like with a Sec14 p-like lipid-binding domain. Analysis of Hsdr4 promoter region that was isolated by screening a barley BAC library, revealed a new putative miniature inverted-repeat transposable element (MITE), and several potential stress-related binding sites for transcription factors (MYC, MYB, LTRE, and GT-1), suggesting a role of the Hsdr4 gene in plant tolerance to dehydration stress. Furthermore, the Hsdr4 gene was mapped using wild barley mapping population to the long arm of chromosome 3H between markers EBmac541 and EBmag705, within a region that previously was shown to affect osmotic adaptation in barley.

  19. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    Directory of Open Access Journals (Sweden)

    Bingfu eGuo

    2015-10-01

    Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

  20. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xiaojuan, E-mail: xiaojuanwang@lzu.edu.cn [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Song, Yu [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Environment Management College of China, Qinhuangdao 066004 (China); Ma Yanhua [Hebei Normal University of Science and Technology, Qinhuangdao 066004 (China); Zhuo Renying [Key Lab of Tree Genomics, Research Institute of Subtropical of Forest, Chinese Academy of Forest, Fuyang 311400 (China); Jin Liang [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China)

    2011-12-15

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: > Evaluate Cd tolerance in wide sources of alfalfa accessions. > Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. > Cloned differentially expressed metallothionein (MT) genes. > Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. > MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  1. New Genes Involved in Osmotic Stress Tolerance in Saccharomyces cerevisiae

    Science.gov (United States)

    Gonzalez, Ramon; Morales, Pilar; Tronchoni, Jordi; Cordero-Bueso, Gustavo; Vaudano, Enrico; Quirós, Manuel; Novo, Maite; Torres-Pérez, Rafael; Valero, Eva

    2016-01-01

    Adaptation to changes in osmolarity is fundamental for the survival of living cells, and has implications in food and industrial biotechnology. It has been extensively studied in the yeast Saccharomyces cerevisiae, where the Hog1 stress activated protein kinase was discovered about 20 years ago. Hog1 is the core of the intracellular signaling pathway that governs the adaptive response to osmotic stress in this species. The main endpoint of this program is synthesis and intracellular retention of glycerol, as a compatible osmolyte. Despite many details of the signaling pathways and yeast responses to osmotic challenges have already been described, genome-wide approaches are contributing to refine our knowledge of yeast adaptation to hypertonic media. In this work, we used a quantitative fitness analysis approach in order to deepen our understanding of the interplay between yeast cells and the osmotic environment. Genetic requirements for proper growth under osmotic stress showed both common and specific features when hypertonic conditions were induced by either glucose or sorbitol. Tolerance to high-glucose content requires mitochondrial function, while defective protein targeting to peroxisome, GID-complex function (involved in negative regulation of gluconeogenesis), or chromatin dynamics, result in poor survival to sorbitol-induced osmotic stress. On the other side, the competitive disadvantage of yeast strains defective in the endomembrane system is relieved by hypertonic conditions. This finding points to the Golgi-endosome system as one of the main cell components negatively affected by hyperosmolarity. Most of the biological processes highlighted in this analysis had not been previously related to osmotic stress but are probably relevant in an ecological and evolutionary context. PMID:27733850

  2. Salt tolerance of transgenic rice (Oryza sativa L.) with mtlD gene and gutD gene

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Southern blot analysis indicated that mtlD gene (encoding mannitol-1-phosphate dehydrogenase) and gutD gene (encoding glucitol-6-phosphate dehydrogenase) had been integrated into the rice genome mediated by Agrobacterium tumefaciens LBA4404(pBIGM). The expression of the above two genes in transgenic rice plants was demonstrated by Northern blot analysis and enzymatic activity assay. Analysis of sugar alcohol showed that transgenic rice plants could produce and accumulate mannitol and sorbitol. The salt tolerance of transgenic plants was much higher than that of their controls.

  3. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.

    Science.gov (United States)

    Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A

    2014-09-01

    An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones.

  4. Identification of Molecular Marker Linked to Salt Tolerance Gene in Alfalfa

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The study has established the F2 offspring obtained by crossing salt-tolerant with salt-sensitive alfalfa, and appraised the salt-tolerant F2 offspring seedling was evaluated in pot culture. With the F2 segregated population, the research has obtained a molecular marker linked with salt-tolerant genes of alfalfa using the improved BSA combined with RAPD. The RAPD PCR products were excised from the agarose gel and purified using a kit, then were mixed with pMD-18T vector and sequenced. Sequencing result indicated the RAPD marker was 1 438 bp in length. Similarity researches using blast in Genbank indicated that the nucleotide sequence of the RAPD marker showed 93% and 91% similarity with mth2-6el8 gene fragment (347 bp) and mth2-33122 gene fragment (334 bp) of Medicago truncatula respectively. Medicago truncatula is a close relative of alfalfa and Mth2-6e18 is a molecular marker of the gene coding for a cysteine protease which was salt inducible in some plants. These results indicated the RAPD marker was possibly related to cysteine protease genes in alfalfa.

  5. A novel gene OsAHL1 improves both drought avoidance and drought tolerance in rice

    OpenAIRE

    Liguo Zhou; Zaochang Liu; Yunhua Liu; Deyan Kong; Tianfei Li; Shunwu Yu; Hanwei Mei; Xiaoyan Xu; Hongyan Liu; Liang Chen; Lijun Luo

    2016-01-01

    A novel gene, OsAHL1, containing an AT-hook motif and a PPC domain was identified through genome-wide profiling and analysis of mRNAs by comparing the microarray of drought-challenged versus normally watered rice. The results indicated OsAHL1 has both drought avoidance and drought tolerance that could greatly improve drought resistance of the rice plant. Overexpression of OsAHL1 enhanced multiple stress tolerances in rice plants during both seedling and panicle development stages. Functional ...

  6. Field tolerance to fungal pathogens of Brassica napus constitutively expressing a chimeric chitinase gene

    Energy Technology Data Exchange (ETDEWEB)

    Grison, R.; Grezes-Besset, B.; Lucante, N. [Rustica Prograin Genetique, Mondonville (France)] [and others

    1996-05-01

    Constitutive overexpression of a protein involved in plant defense mechanisms to disease is one of the strategies proposed to increase plant tolerance to fungal pathogens. A hybrid endochitinase gene under a constitutive promoter was introduced by Agrobacterium-mediated transformation into a winter-type oilseed rape (Brassica napus var. oleifera) inbred line. Progeny from transformed plants was challenged using three different fungal pathogens (Cylindrosporium concentricum, Phoma lingam, Sclerotinia sclerotiorum) in field trials at two different geographical locations. These plants exhibited an increased tolerance to disease as compared with the nontransgenic parental plants. 31 refs., 1 fig., 2 tabs.

  7. Identification of cold tolerance genes from leaves of mangrove plant Kandelia obovata by suppression subtractive hybridization.

    Science.gov (United States)

    Fei, Jiao; Wang, You-Shao; Jiang, Zhao-Yu; Cheng, Hao; Zhang, Jian-Dong

    2015-10-01

    Low temperature is a major abiotic stress that seriously limits mangrove productivity and distribution, the molecular mechanisms of cold tolerance involved in mangroves are still poorly understood at present. It was used to identify the potential cold-related genes in Kandelia obovata (K. obovata) by suppression subtractive hybridization. 334 cold-related expressed sequence tags (ESTs) out of 670 clones were isolated and sequenced. Among these ESTs, 143 unique cDNAs were identified and classified into ten groups, such as metabolism, energy, cell rescue and defense, transcription and photosynthesis according to NCBI blast. Based on bioinformatics analysis, these ESTs were mainly related to response to stimulus and metabolic process, and were included to 72 KEGG pathways. Two selected genes (e.g., aquaporin gene and zinc family protein gene) from the library were further analyzed by quantitative real-time PCR analysis. Both the two genes were found to be transcriptionally up-regulated under cold stress, which partly approve the construction of the subtractive cDNA library. The diversity of the putative functions of these genes indicated that cold stress resulted in a complex response in K. obovata. Further investigation on the functions and potential pathways of these genes will facilitate the understanding of the molecular adaptations to cold tolerance in mangrove plants.

  8. Genomewide analysis of MATE-type gene family in maize reveals microsynteny and their expression patterns under aluminum treatment

    Indian Academy of Sciences (India)

    HUASHENG ZHU; JIANDONG WU; YINGLI JIANG; JING JIN; WEI ZHOU; YU WANG; GUOMIN HAN; YANG ZHAO; BEIJIU CHENG

    2016-09-01

    Multidrug and toxic compound extrusion (MATE) proteins are a group of secondary active transporters, which widely exist in all living organisms and play important role in the detoxication of endogenous secondary metabolites and exogenous agents. However, to date, no systematic and comprehensive study of this family is reported in maize. Here, a total of 49 MATE genes (ZmMATE) were identified and divided into seven groups by phylogenetic analysis. Conserved intro–exon structures and motif compositions were investigated in these genes. Results by gene locations indicated that these genes were unevenly distributed among all 10 chromosomes. Tandem and segmental duplications appeared to contribute to the expansion and evolution of this gene family. The Ka / Ks ratios suggested that the ZmMATE has undergone large-scale purifying selection on the maize genome. Interspecies microsynteny analysis revealed that there were independent gene duplication events of 10 ZmMATE. In addition, most maize MATE genes exhibited different expression profiles in diverse tissues and developmental stages. Sixteen MATE genes were chosen for further quantitative real-time polymerase chain reaction analysis showed differential expression patterns in response to aluminum treatment. These results provide a useful clue for future studies on the identification of MATE genes and functional analysis of MATE proteins in maize

  9. The BnALMT1 and BnALMT2 genes from rape encode aluminum-activated malate transporters that enhance the aluminum resistance of plant cells.

    Science.gov (United States)

    Ligaba, Ayalew; Katsuhara, Maki; Ryan, Peter R; Shibasaka, Mineo; Matsumoto, Hideaki

    2006-11-01

    The release of organic anions from roots can protect plants from aluminum (Al) toxicity and help them overcome phosphorus (P) deficiency. Our previous findings showed that Al treatment induced malate and citrate efflux from rape (Brassica napus) roots, and that P deficiency did not induce the efflux. Since this response is similar to the malate efflux from wheat (Triticum aestivum) that is controlled by the TaALMT1 gene, we investigated whether homologs of TaALMT1 are present in rape and whether they are involved in the release of organic anions. We isolated two TaALMT1 homologs from rape designated BnALMT1 and BnALMT2 (B. napus Al-activated malate transporter). The expression of these genes was induced in roots, but not shoots, by Al treatment but P deficiency had no effect. Several other cations (lanthanum, ytterbium, and erbium) also increased BnALMT1 and BnALMT2 expression in the roots. The function of the BnALMT1 and BnALMT2 proteins was investigated by heterologous expression in cultured tobacco (Nicotiana tabacum) cells and in Xenopus laevis oocytes. Both transfection systems showed an enhanced capacity for malate efflux but not citrate efflux, when exposed to Al. Smaller malate fluxes were also activated by ytterbium and erbium treatment. Transgenic tobacco cells grew significantly better than control cells following an 18 h treatment with Al, indicating that the expression of BnALMT1 and BnALMT2 increased the resistance of these plant cells to Al stress. This report demonstrates that homologs of the TaALMT1 gene from wheat perform similar functions in other species.

  10. Functional genomics of maize submergence tolerance and cloning of the related gene Sicyp51

    Institute of Scientific and Technical Information of China (English)

    TANG Wanhu; ZHANG Zuxin; ZOU Xiling; ZHENG Yonglian

    2005-01-01

    In this study, SSH (Suppression Subtractive Hybridization) and cDNA microarray were used to identify genes associated with waterlogging response of maize roots. Mo17 and Hz32 are two maize inbred lines with differential tolerance to hypoxia. Seedlings of the inbred lines with two leaves were submerged in hypoxia buffer. SSH libraries were constructed with cDNA samples from roots. Both forward and reverse subtractions were performed for each inbred line, and 105 positive clones induced by hypoxia were selected by differential screening. The treated and control message RNA were hybridized with the cDNA microarray of Mo17, sequentially, 57 of 3-fold differentially expressed clones were obtained. A total of 162 positive clones were all sequenced. Bioinformatics analysis showed these positive clones represent 85 TUGs, including genes involved in several biochemistry pathways, such as glycolysis, protection, signal transduction, cell construction and energy metabolism and 41 EST with unknown function. Comparison between Mo17 and Hz32 indicates that genes related to hypoxia tolerance have different expression patterns in submerged roots. Several positive clones' expression patterns were revealed by Northern or RT-PCR, and a new gene (Sicyp51), which may contribute to hypoxia tolerance, was identified.

  11. Over-expression of OsDREB genes lead to enhanced drought tolerance in rice.

    Science.gov (United States)

    Chen, Jian-Qiang; Meng, Xiu-Ping; Zhang, Yun; Xia, Mian; Wang, Xi-Ping

    2008-12-01

    The DREB transcription factors, which specifically interact with C-repeat/DRE (A/GCCGAC), play an important role in plant abiotic stress tolerance by controlling the expression of many cold or/and drought-inducible genes in an ABA-independent pathway. We have isolated three novel rice DREB genes, OsDREB1E, OsDREB1G, and OsDREB2B, which are homologous to Arabidopsis DREB genes. The yeast one-hybrid assay indicated that OsDREB1E, OsDREB1G, and OsDREB2B can specifically bind to the C-repeat/DRE element. To elucidate the function of respective OsDREB genes, we have stably introduced these to rice by Agrobacterium-mediated transformation. Transgenic rice plants analysis revealed that over-expression of OsDREB1G and OsDREB2B in rice significantly improved their tolerance to water deficit stress, while over-expression of OsDREB1E could only slightly improved the tolerance to water deficit stress, suggesting that the OsDREBs might participate in the stress response pathway in different manners.

  12. Overexpression of phospholipase Dα gene enhances drought and salt tolerance of Populus tomentosa

    Institute of Scientific and Technical Information of China (English)

    ZHANG TingTing; SONG YunZhi; LIU YuDong; GUO XingQi; ZHU ChangXiang; WEN FuJiang

    2008-01-01

    The cDNA of AtPLDα (Arabidopsis thaliana Phospholipase Da) gene was introduced into P. tomentosa (Populus tomentosa) under the control of the Cauliflower mosaic virus 35S promoter. Southern and Northern blot analyses suggested that the AtPLDα gene has been transferred into the P. tomentosa genome. No obvious morphological or developmental difference was observed between the transgenic and wild-type (WT) plants. Drought and salt tolerance and gene expression of seedlings of several transgenic lines and WT plants (control) were studied. The results showed that the rhizogenesis rate and the average root-length of transgenic lines were significantly higher than WT plants after mannitol and NaCl treatment under the same growth conditions. Northern blot analysis indicated that the higher the PLDα expression in the transgenic plants, the more tolerant the transgenic plants are to drought and salt treatment. Meanwhile, another group of these transgenic lines and WT plants (control) were treated with PEG6000 and NaCI separately. The contents of chlorophylls and the activities of some antioxidant enzymes (superoxide dismutase, guaiacol peroxidase and catalase) as well as malondialdehyde and relative electrical conductivity were analyzed. Altogether, our results demonstrated that overexpression of the PLDα gene can enhance the drought and salt tolerance in transgenic P. tomentosa plants.

  13. Identification of Quantitative Trait Loci (QTL) and Candidate Genes for Cadmium Tolerance in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Gancho [West Virginia University; Yin, Tongming [ORNL; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Stephen P [West Virginia University

    2012-01-01

    Knowledge of genetic variation in response of Populus to heavy metals like cadmium (Cd) is an important step in understanding the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa and Populus deltoides was characterized for Cd exposure. The pedigree showed significant variation for Cd tolerance thus enabling the identification of relatively tolerant and susceptible genotypes for intensive characterization. A total of 16 QTLs at logarithm of odds (LOD) ratio > 2.5, were found to be associated with total dry weight, its components, and root volume. Four major QTLs for total dry weight were mapped to different linkage groups in control (LG III) and Cd conditions (LG XVI) and had opposite allelic effects on Cd tolerance, suggesting that these genomic regions were differentially controlled. The phenotypic variation explained by Cd QTL for all traits under study varied from 5.9% to 11.6% and averaged 8.2% across all QTL. Leaf Cd contents also showed significant variation suggesting the phytoextraction potential of Populus genotypes, though heritability of this trait was low (0.22). A whole-genome microarray study was conducted by using two genotypes with extreme responses for Cd tolerance in the above study and differentially expressed genes were identified. Candidate genes including CAD2 (CADMIUM SENSITIVE 2), HMA5 (HEAVY METAL ATPase5), ATGTST1 (Arabidopsis thaliana Glutathione S-Transferase1), ATGPX6 (Glutathione peroxidase 6), and ATMRP 14 (Arabidopsis thaliana Multidrug Resistance associated Protein 14) were identified from QTL intervals and microarray study. Functional characterization of these candidate genes could enhance phytoremediation capabilities of Populus.

  14. Gene array analysis of a rat model of liver transplant tolerance identifies increased complement C3 and the STAT-1/IRF-1 pathway during tolerance induction.

    Science.gov (United States)

    Cordoba, Shaun P; Wang, Chuanmin; Williams, Rohan; Li, Jian; Smit, Lynn; Sharland, Alexandra; Allen, Richard; McCaughan, Geoffrey; Bishop, Alex

    2006-04-01

    This study aimed to define the molecular mechanism during induction of spontaneous liver transplant tolerance using microarrays and to focus on molecular pathways associated with tolerance by meta-analysis with published studies. The differences in the early immune response between PVG to DA liver transplant recipients that are spontaneously tolerant (TOL) and PVG to Lewis liver transplants that reject (REJ) were examined. Spleens from TOL and REJ on days 1 and 3 were compared by 2 color microarray. Forty-six of 199 genes differentially expressed between TOL and REJ had an immunological function. More immune genes were increased in TOL vs. REJ on day 1, including STAT-1, IRF-1 and complement C3. Differential expression of selected genes was confirmed by quantitative RT-PCR. The results were compared to two published high-throughput studies of rat liver transplant tolerance and showed that C3 was increased in all three models, while STAT-1 and IRF-1 were increased in two models. The early increases in immune genes in TOL confirmed previous reports of an active early immune response in TOL. In conclusion, the increase in STAT-1, IRF-1 and complement component C3 in several models of liver transplant tolerance suggests that the STAT-1/IRF-1 apoptotic pathway and C3 may be involved in the tolerogenic mechanism.

  15. Transgenic alfalfa plants expressing the sweetpotato Orange gene exhibit enhanced abiotic stress tolerance.

    Directory of Open Access Journals (Sweden)

    Zhi Wang

    Full Text Available Alfalfa (Medicago sativa L., a perennial forage crop with high nutritional content, is widely distributed in various environments worldwide. We recently demonstrated that the sweetpotato Orange gene (IbOr is involved in increasing carotenoid accumulation and enhancing resistance to multiple abiotic stresses. In this study, in an effort to improve the nutritional quality and environmental stress tolerance of alfalfa, we transferred the IbOr gene into alfalfa (cv. Xinjiang Daye under the control of an oxidative stress-inducible peroxidase (SWPA2 promoter through Agrobacterium tumefaciens-mediated transformation. Among the 11 transgenic alfalfa lines (referred to as SOR plants, three lines (SOR2, SOR3, and SOR8 selected based on their IbOr transcript levels were examined for their tolerance to methyl viologen (MV-induced oxidative stress in a leaf disc assay. The SOR plants exhibited less damage in response to MV-mediated oxidative stress and salt stress than non-transgenic plants. The SOR plants also exhibited enhanced tolerance to drought stress, along with higher total carotenoid levels. The results suggest that SOR alfalfa plants would be useful as forage crops with improved nutritional value and increased tolerance to multiple abiotic stresses, which would enhance the development of sustainable agriculture on marginal lands.

  16. Water-deficit inducible expression of a cytokinin biosynthetic gene IPT improves drought tolerance in cotton.

    Directory of Open Access Journals (Sweden)

    Sundaram Kuppu

    Full Text Available Water-deficit stress is a major environmental factor that limits agricultural productivity worldwide. Recent episodes of extreme drought have severely affected cotton production in the Southwestern USA. There is a pressing need to develop cotton varieties with improved tolerance to water-deficit stress for sustainable production in water-limited regions. One approach to engineer drought tolerance is by delaying drought-induced senescence via up-regulation of cytokinin biosynthesis. The isopentenyltransferase gene (IPT that encodes a rate limiting enzyme in cytokinin biosynthesis, under the control of a water-deficit responsive and maturation specific promoter P(SARK was introduced into cotton and the performance of the P(SARK::IPT transgenic cotton plants was analyzed in the greenhouse and growth chamber conditions. The data indicate that P(SARK::IPT-transgenic cotton plants displayed delayed senescence under water deficit conditions in the greenhouse. These plants produced more root and shoot biomass, dropped fewer flowers, maintained higher chlorophyll content, and higher photosynthetic rates under reduced irrigation conditions in comparison to wild-type and segregated non-transgenic lines. Furthermore, P(SARK::IPT-transgenic cotton plants grown in growth chamber condition also displayed greater drought tolerance. These results indicate that water-deficit induced expression of an isopentenyltransferase gene in cotton could significantly improve drought tolerance.

  17. Expression of genes related to tolerance to low temperature for maize seed germination.

    Science.gov (United States)

    Silva-Neta, I C; Pinho, E V; Veiga, A D; Pìnho, R G; Guimarães, R M; Caixeta, F; Santos, H O; Marques, T L

    2015-01-01

    The aim of this study was to characterize maize lines tolerant to cold temperatures during the germination process. Seeds from lines with different levels of tolerance to low temperatures were used; 3 lines were classified as tolerant and 3 as susceptible to low germination temperatures. A field was set up to multiply seeds from selected lines. After the seeds were harvested and classified, we conducted physiological tests and analyzed fatty acid content of palmitic, stearic, oleic, linoleic, linolenic, and eicosenoic acids. In proteomic analysis, the expression of heat-resistant proteins, including catalase, peroxidase, esterase, superoxide dismutase, and α-amylase, were evaluated. Transcript analysis was used to measure the expression of the genes AOX1, AOX2, ZmMPK-17, and ZmAN-13. The material showing the highest susceptibility to low germination temperatures contained high saturated fatty acid content. Expression of α-amylase in seeds soaked for 72 h at a temperature of 10°C was lower than expression of α-amylase when soaked at 25°C for the same amount of time. We observed variation in the expression of heat-resistant proteins in seeds of the lines evaluated. The genes AOX and Zm-AN13 were promising for use in identifying maize materials that are tolerant to low germination temperatures.

  18. Enhancing the aluminium tolerance of barley by expressing the citrate transporter genes SbMATE and FRD3.

    Science.gov (United States)

    Zhou, Gaofeng; Pereira, Jorge F; Delhaize, Emmanuel; Zhou, Meixue; Magalhaes, Jurandir V; Ryan, Peter R

    2014-06-01

    Malate and citrate efflux from root apices is a mechanism of Al(3+) tolerance in many plant species. Citrate efflux is facilitated by members of the MATE (multidrug and toxic compound exudation) family localized to the plasma membrane of root cells. Barley (Hordeum vulgare) is among the most Al(3+)-sensitive cereal species but the small genotypic variation in tolerance that is present is correlated with citrate efflux via a MATE transporter named HvAACT1. This study used a biotechnological approach to increase the Al(3+) tolerance of barley by transforming it with two MATE genes that encode citrate transporters: SbMATE is the major Al(3+)-tolerance gene from sorghum whereas FRD3 is involved with Fe nutrition in Arabidopsis. Independent transgenic and null T3 lines were generated for both transgenes. Lines expressing SbMATE showed Al(3+)-activated citrate efflux from root apices and greater tolerance to Al(3+) toxicity than nulls in hydroponic and short-term soil trials. Transgenic lines expressing FRD3 exhibited similar phenotypes except citrate release from roots occurred constitutively. The Al(3+) tolerance of these lines was compared with previously generated transgenic barley lines overexpressing the endogenous HvAACT1 gene and the TaALMT1 gene from wheat. Barley lines expressing TaALMT1 showed significantly greater Al(3+) tolerance than all lines expressing MATE genes. This study highlights the relative efficacy of different organic anion transport proteins for increasing the Al(3+) tolerance of an important crop species.

  19. A novel gene OsAHL1 improves both drought avoidance and drought tolerance in rice

    Science.gov (United States)

    Zhou, Liguo; Liu, Zaochang; Liu, Yunhua; Kong, Deyan; Li, Tianfei; Yu, Shunwu; Mei, Hanwei; Xu, Xiaoyan; Liu, Hongyan; Chen, Liang; Luo, Lijun

    2016-01-01

    A novel gene, OsAHL1, containing an AT-hook motif and a PPC domain was identified through genome-wide profiling and analysis of mRNAs by comparing the microarray of drought-challenged versus normally watered rice. The results indicated OsAHL1 has both drought avoidance and drought tolerance that could greatly improve drought resistance of the rice plant. Overexpression of OsAHL1 enhanced multiple stress tolerances in rice plants during both seedling and panicle development stages. Functional studies revealed that OsAHL1 regulates root development under drought condition to enhance drought avoidance, participates in oxidative stress response and also regulates the content of chlorophyll in rice leaves. OsAHL1 specifically binds to the A/T rich sequence region of promoters or introns, and hence directly regulates the expression of many stress related downstream genes. PMID:27453463

  20. Acquiring transgenic tobacco plants with insect resistance and glyphosate tolerance by fusion gene transformation.

    Science.gov (United States)

    Sun, He; Lang, Zhihong; Zhu, Li; Huang, Dafang

    2012-10-01

    The advantages of gene 'stacking' or 'pyramiding' are obvious in genetically modified (GM) crops, and several different multi-transgene-stacking methods are available. Using linker peptides for multiple gene transformation is considered to be a good method to meet a variety of needs. In our experiment, the Bt cry1Ah gene, which encodes the insect-resistance protein, and the mG ( 2 ) -epsps gene, which encodes the glyphosate-tolerance protein, were connected by a 2A or LP4/2A linker. Linker 2A is a peptide from the foot-and-mouth disease virus (FMDV) that has self-cleavage activity. LP4 is a peptide from Raphanus sativus seeds that has a recognition site and is cleaved by a protease. LP4/2A is a hybrid peptide that contains the first 9 amino acids of LP4 and 20 amino acids from 2A. We used the linker peptide to construct four coordinated expression vectors: pHAG, pHLAG, pGAH and pGLAH. Two single gene expression vectors, pSAh and pSmG(2), were used as controls. The six expression vectors and the pCAMBIA2301 vector were transferred into tobacco by Agrobacterium tumefaciens-mediated transformation, and 529 transformants were obtained. Molecular detection and bioassay detection data demonstrated that the transgenic tobaccos possessed good pest resistance and glyphosate tolerance. The two genes in the fusion vector were expressed simultaneously. The plants with the genes linked by the LP4/2A peptide showed better pest resistance and glyphosate tolerance than the plants with the genes linked by 2A. The expression level of the two genes linked by LP4/2A was not significantly different from the single gene vector. Key message The expression level of the two genes linked by LP4/2A was higher than those linked by 2A and was not significantly different from the single gene vector.

  1. Characterization of gene expression associated with drought avoidance and tolerance traits in a perennial grass species.

    Directory of Open Access Journals (Sweden)

    Peng Zhou

    Full Text Available To understand molecular mechanisms of perennial grass adaptation to drought stress, genes associated with drought avoidance or tolerance traits were identified and their expression patterns were characterized in C4 hybrid bermudagrass [Cynodon dactylon (L. Pers.×C. transvaalensis Burtt Davy, cv. Tifway] and common bermudagrass (C. dactylon, cv. C299. Plants of drought-tolerant 'Tifway' and drought-sensitive 'C299' were exposed to drought for 5 d (mild stress and 10 d (severe stress by withholding irrigation in a growth chamber. 'Tifway' maintained significantly lower electrolyte leakage and higher relative water content than 'C299' at both 5 and 10 d of drought stress. Four cDNA libraries via suppression subtractive hybridization analysis were constructed and identified 277 drought-responsive genes in the two genotypes at 5 and 10 d of drought stress, which were mainly classified into the functional categories of stress defense, metabolism, osmoregulation, membrane system, signal and regulator, structural protein, protein synthesis and degradation, and energy metabolism. Quantitative-PCR analysis confirmed the expression of 36 drought up-regulated genes that were more highly expressed in drought-tolerant 'Tifway' than drought-sensitive 'C299', including those for drought avoidance traits, such as cuticle wax formation (CER1 and sterol desaturase, for drought tolerance traits, such as dehydration-protective proteins (dehydrins, HVA-22-like protein and oxidative stress defense (superoxide dismutase, dehydroascorbate reductase, 2-Cys peroxiredoxins, and for stress signaling (EREBP-4 like protein and WRKY transcription factor. The results suggest that the expression of genes for stress signaling, cuticle wax accumulation, antioxidant defense, and dehydration-protective protein accumulation could be critically important for warm-season perennial grass adaptation to long-term drought stress.

  2. Systematic mining of salt-tolerant genes in halophyte-Zoysia matrella through cDNA expression library screening.

    Science.gov (United States)

    Chen, Yu; Zong, Junqin; Tan, Zhiqun; Li, Lanlan; Hu, Baoyun; Chen, Chuanming; Chen, Jingbo; Liu, Jianxiu

    2015-04-01

    Though a large number of salt-tolerant genes were identified from Glycophyte in previous study, genes involved in salt-tolerance of halophyte were scarcely studied. In this report, an important halophyte turfgrass, Zoysia matrella, was used for systematic excavation of salt-tolerant genes using full-length cDNA expression library in yeast. Adopting the Gateway-compatible vector system, a high quality entry library was constructed, containing 3 × 10(6) clones with an average inserted fragments length of 1.64 kb representing a 100% full-length rate. The yeast expression library was screened in a salt-sensitive yeast mutant. The screening yielded dozens of salt-tolerant clones harboring 16 candidate salt-tolerant genes. Under salt-stress condition, these 16 genes exhibited different transcription levels. According to the results, we concluded that the salt-tolerance of Z. matrella might result from known genes involved in ion regulation, osmotic adjustment, as well as unknown pathway associated with protein folding and modification, RNA metabolism, and mitochondrial membrane translocase, etc. In addition, these results shall provide new insight for the future researches with respect to salt-tolerance.

  3. Oral Tolerance: A New Tool for the Treatment of Gastrointestinal Inflammatory Disorders and Liver-Directed Gene Therapy

    Directory of Open Access Journals (Sweden)

    Yaron Ilan

    1999-01-01

    Full Text Available Oral tolerance is a method of downregulating an immune response by feeding antigens. The use of oral tolerance toward adenoviruses and colitis-extracted proteins for long term gene therapy and alleviation of experimental colitis, and the mechanisms of tolerance induction are presented. Adenoviruses are efficient vectors in liver-directed gene therapy; however, the antiviral immune response precludes the ability to achieve long term gene expression and prohibits the ability to reinject the recombinant virus. Oral tolerance induction via feeding of viral-extracted proteins prevented the antiadenoviral humoral and cellular immune responses, thus enabling long term gene therapy using these viruses. Moreover, pre-existing immune response to the virus was overcome by tolerance induction, enabling prolonged gene expression in a presensitized host. Inflammatory bowel diseases are immune-mediated disorders where an imbalance between proinflammatory (T helper cell type 1 and anti-inflammatory (T helper cell type 2 cytokines are thought to play a role in the pathogenesis. In the experimental colitis model, the feeding of colitis-extracted proteins downregulated the anticolon immune response. Tolerance induction toward colitis-extracted proteins ameliorated colonic inflammation as shown by decreased diarrhea and reduction of colonic ulcerations, intestinal and peritoneal adhesions, wall thickness and edema. Histological parameters for colitis were markedly improved in tolerized animals. In both models, tolerized animals developed an increase in transforming growth factor-beta, interleukin-4 and interleukin-10, and a decrease in the mRNA of interferon-gamma lymphocytes and serum levels. Adoptive transfer of tolerized lymphocytes enabled the transfer of tolerance toward adenoviruses and colon-extracted proteins. Thus, oral tolerance induces suppressor lymphocytes that mediate immune response downregulation by induction of a shift from a proinflammatory T

  4. Low cadmium (LCD), a novel gene related to cadmium tolerance and accumulation in rice.

    Science.gov (United States)

    Shimo, Hugo; Ishimaru, Yasuhiro; An, Gynheung; Yamakawa, Takashi; Nakanishi, Hiromi; Nishizawa, Naoko K

    2011-11-01

    The contamination of food crops by cadmium (Cd) is a major concern in food production because it can reduce crop yields and threaten human health. In this study, knockout rice plants (Oryza sativa) tagged with the gene trap vector pGA2707 were screened for Cd tolerance, and the tolerant line lcd was obtained. The lcd mutant showed tolerance to Cd on agar plates and in hydroponic culture during early plant development. Metal concentration measurements in hydroponically grown plants revealed significantly less Cd in the shoots of lcd plants compared with wild-type (WT) shoots. When cultured in the field in soil artificially contaminated with low levels of Cd, lcd showed no significant difference in the Cd content of its leaf blades; however, the Cd concentration in the grains was 55% lower in 2009 and 43% lower in 2010. There were no significant differences in plant dry weight or seed yield between lcd and wild-type plants. LCD, a novel gene, is not homologous to any other known gene. LCD localized to the cytoplasm and nucleus, and was expressed mainly in the vascular tissues in the roots and phloem companion cells in the leaves. These data indicate that lcd may be useful for understanding Cd transport mechanisms and is a promising candidate rice line for use in combating the threat of Cd to human health.

  5. Stress Responsive Zinc-finger Protein Gene of Populus euphratica in Tobacco Enhances Salt Tolerance

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The Populus euphratica stress responsive zinc-finger protein gene PSTZ, which encodes a protein including typical Cys2/His2 zinc finger structure, was isolated by reverse transcription-polymerase chain reaction from P. euphratica.Northern hybridization revealed that its expression was induced under drought and salt stress conditions. To examine its function, cDNA of the PSTZ gene, driven by the cauliflower mosaic virus 35S promoter, was cloned into a plant expression vector pBin438 and introduced into tobacco plants. Transgenic tobacco showed an enhanced salt tolerance, suggesting that PSTZ may play a role in plant responsiveness to salt stress.

  6. Plastid-expressed 5-enolpyruvylshikimate-3-phosphate synthase genes provide high level glyphosate tolerance in tobacco.

    Science.gov (United States)

    Ye, G N; Hajdukiewicz, P T; Broyles, D; Rodriguez, D; Xu, C W; Nehra, N; Staub, J M

    2001-02-01

    Plastid transformation (transplastomic) technology has several potential advantages for biotechnological applications including the use of unmodified prokaryotic genes for engineering, potential high-level gene expression and gene containment due to maternal inheritance in most crop plants. However, the efficacy of a plastid-encoded trait may change depending on plastid number and tissue type. We report a feasibility study in tobacco plastids to achieve high-level herbicide resistance in both vegetative tissues and reproductive organs. We chose to test glyphosate resistance via over-expression in plastids of tolerant forms of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Immunological, enzymatic and whole-plant assays were used to prove the efficacy of three different prokaryotic (Achromobacter, Agrobacterium and Bacillus) EPSPS genes. Using the Agrobacterium strain CP4 EPSPS as a model we identified translational control sequences that direct a 10,000-fold range of protein accumulation (to >10% total soluble protein in leaves). Plastid-expressed EPSPS could provide very high levels of glyphosate resistance, although levels of resistance in vegetative and reproductive tissues differed depending on EPSPS accumulation levels, and correlated to the plastid abundance in these tissues. Paradoxically, higher levels of plastid-expressed EPSPS protein accumulation were apparently required for efficacy than from a similar nuclear-encoded gene. Nevertheless, the demonstration of high-level glyphosate tolerance in vegetative and reproductive organs using transplastomic technology provides a necessary step for transfer of this technology to other crop species.

  7. Mechanisms of Salt Tolerance in Transgenic Arabidopsis thaliana Carrying a Peroxisomal Ascorbate Peroxidase Gene from Barley

    Institute of Scientific and Technical Information of China (English)

    XU Wei-Feng; SHI Wei-Ming; A. UEDA; T. TAKABE

    2008-01-01

    Ascorbate peroxidases (APX), localized in the cytosol, peroxisome, mitochondria, and chloroplasts of plant cells,catalyze the reduction of H2O2 to water by using ascorbic acid as the specific electron donor. To determine the role of peroxisomal type ascorbate peroxidasc (pAPX), an antioxidant enzyme, in protection against salt-induced oxidative stress, transgenic Arabidopsis thaliana plant carrying a pAPX gene (HvAPX1) from barley (Hordeum vulgare L.) was analyzed. The transgenic line pAPX3 was found to be more tolerant to salt stress than the wild type. Irrespective of salt stress, there were no significant differences in Na+, K+, Ca2+, and Mg2+ contents and the ratio of K+ to Na+ between pAPX3 and the wild type. Clearly, the salt tolerance in pAPX3 was not due to the maintenance and reestablishment of cellular ion homeostasis. However, the degree of H2O2 and lipid peroxidation (measured as the levels of malondialdehyde)accumulation under salt stress was higher in the wild type than in pAPX3. The mechanism of salt tolerance in transgenic pAPX3 can thus be explained by reduction of oxidative stress injury. Under all conditions tested, activities of superoxide,glutathionc reductase, and catalase were not significantly different between pAPX3 and the wild type. In contrast, the activity of APX was significantly higher in the transgcnic plant than in wild type under salt stress. These results suggested that in higher plants, HvAPX1 played an important role in salt tolerance and was a candidate gene for developing salt-tolerant crop plants.

  8. Gene expression programs during Brassica oleracea seed maturation, osmopriming and germination process and the stress tolerance level

    NARCIS (Netherlands)

    Soeda, Y.; Konings, M.C.J.M.; Vorst, O.F.J.; Houwelingen, van A.M.M.L.; Stoopen, G.M.; Maliepaard, C.A.; Kodde, J.; Bino, R.J.; Groot, S.P.C.; Geest, van der A.H.M.

    2005-01-01

    During seed maturation and germination, major changes in physiological status, gene expression, and metabolic events take place. Using chlorophyll sorting, osmopriming, and different drying regimes, Brassica oleracea seed lots of different maturity, stress tolerance, and germination behavior were cr

  9. Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

    Energy Technology Data Exchange (ETDEWEB)

    Monette, Michelle Y., E-mail: michelle.monette@yale.edu [Organismic and Evolutionary Biology Program, University of Massachusetts, Amherst, MA 01003 (United States); USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376 (United States); Yada, Takashi [Freshwater Fisheries Research Department, National Research Institute of Fisheries Science, Nikko (Japan); Matey, Victoria [Department of Biology, San Diego State University, San Diego, CA 92182 (United States); McCormick, Stephen D. [Organismic and Evolutionary Biology Program, University of Massachusetts, Amherst, MA 01003 (United States); USGS, Conte Anadromous Fish Research Center, Turners Falls, MA 01376 (United States)

    2010-08-01

    We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4 {mu}g l{sup -1} Al), acid and low Al (LAl: pH 5.4, 11 {mu}g l{sup -1} Al), acid and moderate Al (MAl: pH 5.3, 42 {mu}g l{sup -1} Al), and acid and high Al (HAl: pH 5.4, 56 {mu}g l{sup -1} Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24 h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na{sup +}/K{sup +}-ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl{sup -} channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time

  10. SELEÇÃO PARA TOLERÂNCIA AO ALUMÍNIO EM SOJA TROPICAL SELECTION FOR ALUMINUM TOLERANCE IN TROPICAL SOYBEANS

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Spehar

    2007-09-01

    Full Text Available

    A acidez do solo é fator limitante para a maioria das plantas cultivadas no Cerrado Brasileiro. A toxidez causada por alumínio (Al é especialmente séria na subsuperfície, que permanece ácida após o uso de corretivos, por impedir o crescimento radicular e causar suscetibilidade à seca e desbalanceamento nutricional. Aqui objetivou-se a seleção de genótipos de soja com maior tolerância ao Al, pela associação de experimentos em hidroponia e no campo. Cruzamentos incluindo genótipos selecionados no Cerrado foram realizados. Sementes de indivíduos contrastantes, selecionados em hidroponia na geração F2 pelo crescimento radicular, foram obtidas para avaliação de progênies em F3, no campo, e em F4, novamente em hidroponia. Rendimento de grãos e de biomassa das progênies selecionadas foram superiores aos genitores, no experimento em solo ácido. Esses resultados foram confirmados pelo desempenho em hidroponia, indicando que o método de seleção pode ser empregado com êxito em programas de melhoramento para adaptação de cultivos a condições de acidez subsuperficial do solo.

    PALAVRAS-CHAVE: Acidez sub-superficial; Glycine max; estresse; genótipo; melhoramento de plantas.

    Soil acidity is a limiting factor for most of the cultivated plants in the Brazilian Savannah. Toxicity caused by aluminum (Al is especially serious in the acid subsurface, which remains acidic after soil has been amended, by hindering root growth and causing drought susceptibility and nutritional unbalance. This research aimed at selecting soybean with increased tolerance to Al through association of hydroponics and field experiments. Crosses including savannah adapted genotypes were obtained. Seeds of contrasting individuals, selected in hydroponics at F2 generation for root

  11. Identification of a novel drought tolerance gene in Gossypium hirsutum L. cv KC3

    Directory of Open Access Journals (Sweden)

    Jagadeesh N. Selvam

    2009-02-01

    Full Text Available Development of drought resistant cotton cultivars has long been a major breeding objective, since water stress limits fiber production and productivity. Recent advances in functional genomics can increase the efficiency of conventional breeding for genetic improvement of crop plants for improved abiotic stress resistance. To this end, a novel drought resistance gene was identified by comparing the gene expression profile of Gossypium hirsutum cv KC3 and MCU12 by employing a cDNA-RAPD approach. Physiological and biochemical studies showed that KC3 has relatively better drought tolerance than MCU12. Among 25 random primers, OPA15 has identified differentially expressed cDNA in KC3. Results of BLASTP algorithm have shown that this cDNA has significant homology with P-Glycoprotein, ACC oxidase2 and ABC transporter which are involved either directly, or indirectly, in stress tolerance in animals and plants. Hence, the cDNA sequence identified in this study may be a novel gene that confers drought resistance in cotton as KC3 is well adapted and is widely cultivated in rain-fed tracts of Tamil Nadu, India. Further characterization of this gene may show it has potential application for development of cotton with improved drought resistance, through genetic engineering and/or marker aided selection (MAS

  12. Sugar beet M14 glyoxalase I gene can enhance plant tolerance to abiotic stresses.

    Science.gov (United States)

    Wu, Chuan; Ma, Chunquan; Pan, Yu; Gong, Shilong; Zhao, Chenxi; Chen, Sixue; Li, Haiying

    2013-05-01

    Glyoxalase I is the first enzyme of the glyoxalase system that can detoxify methylglyoxal, a cytotoxic compound increased rapidly under stress conditions. Here we report cloning and characterization of a glyoxalase I from sugar beet M14 line (an interspecific hybrid between a wild species Beta corolliflora Zoss and a cultivated species B. vulgaris L). The full-length gene BvM14-glyoxalase I has 1,449 bp in length with an open reading frame of 1,065 bp encoding 354 amino acids. Sequence analysis shows the conserved glyoxalase I domains, metal and glutathione binding sites and secondary structure (α-helixes and β-sheets). The BvM14-glyoxalase I gene was ubiquitously expressed in different tissues of sugar beet M14 line and up-regulated in response to salt, mannitol and oxidative stresses. Heterologous expression of BvM14-glyoxalase I could increase E. coli tolerance to methylglyoxal. Transgenic tobacco plants constitutively expressing BvM14-glyoxalase I were generated. Both leaf discs and seedlings showed significant tolerance to methylglyoxal, salt, mannitol and H2O2. These results suggest an important role of BvM14-glyoxalase I in cellular detoxification and tolerance to abiotic stresses.

  13. Overexpression of Bacterial mtlD Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol

    Science.gov (United States)

    Bhauso, Tengale Dipak; Radhakrishnan, Thankappan; Kumar, Abhay; Mishra, Gyan Prakash; Dobaria, Jentilal Ramjibhai; Patel, Kirankumar; Rajam, Manchikatla Venkat

    2014-01-01

    In the changing global environmental scenarios, water scarcity and recurrent drought impose huge reductions to the peanut (Arachis hypogaea L.) crop yield. In plants, osmotic adjustments associated with efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms. Mannitol, a compatible solute, is known to scavenge hydroxyl radicals generated during various abiotic stresses, thereby conferring tolerance to water-deficit stress in many plant species. However, peanut plant is not known to synthesize mannitol. Therefore, bacterial mtlD gene coding for mannitol 1-phosphate dehydrogenase under the control of constitutive promoter CaMV35S was introduced and overexpressed in the peanut cv. GG 20 using Agrobacterium tumefaciens-mediated transformation. A total of eight independent transgenic events were confirmed at molecular level by PCR, Southern blotting, and RT-PCR. Transgenic lines had increased amount of mannitol and exhibited enhanced tolerance in response to water-deficit stress. Improved performance of the mtlD transgenics was indicated by excised-leaf water loss assay and relative water content under water-deficit stress. Better performance of transgenics was due to the ability of the plants to synthesize mannitol. However, regulation of mtlD gene expression in transgenic plants remains to be elucidated. PMID:25436223

  14. Overexpression of Bacterial mtlD Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol

    Directory of Open Access Journals (Sweden)

    Tengale Dipak Bhauso

    2014-01-01

    Full Text Available In the changing global environmental scenarios, water scarcity and recurrent drought impose huge reductions to the peanut (Arachis hypogaea L. crop yield. In plants, osmotic adjustments associated with efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms. Mannitol, a compatible solute, is known to scavenge hydroxyl radicals generated during various abiotic stresses, thereby conferring tolerance to water-deficit stress in many plant species. However, peanut plant is not known to synthesize mannitol. Therefore, bacterial mtlD gene coding for mannitol 1-phosphate dehydrogenase under the control of constitutive promoter CaMV35S was introduced and overexpressed in the peanut cv. GG 20 using Agrobacterium tumefaciens-mediated transformation. A total of eight independent transgenic events were confirmed at molecular level by PCR, Southern blotting, and RT-PCR. Transgenic lines had increased amount of mannitol and exhibited enhanced tolerance in response to water-deficit stress. Improved performance of the mtlD transgenics was indicated by excised-leaf water loss assay and relative water content under water-deficit stress. Better performance of transgenics was due to the ability of the plants to synthesize mannitol. However, regulation of mtlD gene expression in transgenic plants remains to be elucidated.

  15. Efeito de diferentes concentrações de sais em solução nutritiva na tolerância de cultivares de trigo à toxicidade de alumínio Influence of salt concentrations in nutrient solution on tolerance to aluminum toxicity in wheat cultivars

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1981-01-01

    Full Text Available Foram estudados dez cultivares de trigo em soluções nutritivas contendo três diferentes níveis de alumínio tóxico combinados com quatro diferentes concentrações salinas. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após permanência de 46 horas em solução contendo determinadas concentrações de sais e de alumínio. Os cultivares Siete Cerros, Tobari-66 e INIA-66 foram os mais sensíveis, IAC-15 moderadamente sensível, Alondra S-46 e IAC-17 moderadamente tolerantes, BH-1146, IAC-13, IAC-5 e C-3 tolerantes à presença de quantidades crescentes de Al³+ na solução nutritiva tratamento, o sintoma de toxicidade de alumínio ficou acentuado ou por aumento da concentração de alumínio ou por diminuição da concentração de sais para todos os cultivares estudados. Aparentemente, tolerância à toxicidade de determinada concentração de alumínio é uma característica antes relativa do que absoluta, por depender da concentração de sais presentes.The aluminum tolerance of ten wheat cultivars was studied in nutrient solutions using three different levels of this element combined with four different salt concentrations. The tolerance was evaluated by measuring, the root growth in an aluminum-free complete nutrient solution after a previous treatment in Al added solutions of equal, one half, one fifth and one tenth the salt concentration of the aluminum-free solution. The wheat cultivars Siete Cerros, Tobari-66 and INIA-66 were sensitive; IAC-15 was moderately sensitive; Alondra-S-46 and IAC-17 showed moderate tolerance; BH-1146, IAC-13, IAC-5, and C-3 were tolerant to the presence of increasing concentrations of Al³+ in the treatment nutrient solution. The aluminum toxicity symptom (inhibition of root growth was dependent on the salt concentration and the amount of aluminum in the treatment solution. For the same level of Al3+ toxicity increased when the

  16. Chilling Tolerance of Cucumber During Germination is Related to Expression of Lysine Decarboxylase Gene

    Institute of Scientific and Technical Information of China (English)

    LU Ming-hui; LI Xiao-ming; CHEN Jin-feng; CHEN Long-zheng; QIAN Chun-tao

    2005-01-01

    Using cDNA-AFLP technique, a specific fragment was isolated from cucumber cultivar Changchun mici possessing chilling tolerance induced at low temperature (15℃). This fragment, named cctr 132, could not be induced in the chilling sensitive cucumber cultivar Beijing jietou. After recovering the fragment, sequencing and translating, the results of blastx and blastp in GenBank of NCBI indicated that CCTR132 had 88.37% identities and 100% positives with Oryza sativa putative lysine decarboxylase-like protein respectively, and PGGXGTXXE, the putative conserved domain of lysine decarboxylase family, was detected from CCTR132, suggesting the cucumber chilling tolerance during germination is related to the expression of the lysine decarboxylase gene.

  17. Down-Regulated Expression of RACK1 Gene by RNA Interference Enhances Drought Tolerance in Rice

    Institute of Scientific and Technical Information of China (English)

    LI Da-hong; LIU Hui; YANG Yan-li; ZHEN Ping-ping; LIANG Jian-sheng

    2009-01-01

    The receptor for activated C-kinase 1 (RACK1) is a highly conserved scaffold protein with versatile functions, and plays important roles in the regulation of plant growth and development. Transgenic rice plants, in which the expression of RACK1 gene was inhibited by RNA interference (RNAi), were studied to elucidate the possible functions of RACK1 in responses to drought stress in rice. Real-time PCR analysis showed that the expression of RACK1 in transgenic rice plants was inhibited by more than 50%. The tolerance to drought stress of the transgenic rice plants was higher as compared with the non-transgenic rice plants. The peroxidation of membrane and the production of malondialdehyde were significantly lower, and the superoxide dismutase activity in transgenic rice plants was significantly higher than those in non-trangenic rice plants. It is suggested that RACK1 negatively regulated the redox system-related tolerance to drought stress of rice plants.

  18. Improvement of acetic acid tolerance of Saccharomyces cerevisiae using a zinc-finger-based artificial transcription factor and identification of novel genes involved in acetic acid tolerance.

    Science.gov (United States)

    Ma, Cui; Wei, Xiaowen; Sun, Cuihuan; Zhang, Fei; Xu, Jianren; Zhao, Xinqing; Bai, Fengwu

    2015-03-01

    Acetic acid is present in cellulosic hydrolysate as a potent inhibitor, and the superior acetic acid tolerance of Saccharomyces cerevisiae ensures good cell viability and efficient ethanol production when cellulosic raw materials are used as substrates. In this study, a mutant strain of S. cerevisiae ATCC4126 (Sc4126-M01) with improved acetic acid tolerance was obtained through screening strains transformed with an artificial zinc finger protein transcription factor (ZFP-TF) library. Further analysis indicated that improved acetic acid tolerance was associated with improved catalase (CAT) activity. The ZFP coding sequence associated with the improved phenotype was identified, and real-time RT-PCR analysis revealed that three of the possible genes involved in the enhanced acetic acid tolerance regulated by this ZFP-TF, namely YFL040W, QDR3, and IKS1, showed decreased transcription levels in Sc4126-M01 in the presence of acetic acid, compared to those in the control strain. Sc4126-M01 mutants having QDR3 and IKS1 deletion (ΔQDR3 and ΔIKS1) exhibited higher acetic acid tolerance than the wild-type strain under acetic acid treatment. Glucose consumption rate and ethanol productivity in the presence of 5 g/L acetic acid were improved in the ΔQDR3 mutant compared to the wild-type strain. Our studies demonstrated that the synthetic ZFP-TF library can be used to improve acetic acid tolerance of S. cerevisiae and that the employment of an artificial transcription factor can facilitate the exploration of novel functional genes involved in stress tolerance of S. cerevisiae.

  19. Ectopic expression of Arabidopsis RCI2A gene contributes to cold tolerance in tomato.

    Science.gov (United States)

    Sivankalyani, Velu; Geetha, Mahalingam; Subramanyam, Kondeti; Girija, Shanmugam

    2015-04-01

    Cold is a major stress that limits the quality and productivity of economically important crops such as tomato (Solanum lycopersicum L.). Generating a cold-stress-tolerant tomato by expressing cold-inducible genes would increase agricultural strategies. Rare cold-inducible 2a (RCI2A) is expressed in Arabidopsis, but its molecular function during cold stress is not fully understood. Here we ectopically expressed Arabidopsis RCI2A in transgenic tomato to evaluate tolerance to cold stress without altering agronomic traits. Biochemical and physiological study demonstrated that expression of RCI2A in transgenic tomato enhanced the activity of peroxidase and ascorbate peroxidase (APX) and reduced the accumulation of H2O2, alleviated lipid peroxidation, increased the accumulation of chlorophyll, reduced chilling-induced membrane damage, retained relative water content and enhanced cold tolerance. A motif search revealed that the motifs of photosystem II (PSII) phosphoproteins PsbJ and PsbH and reaction-center proteins PsbL and PsbK were common to cold-inducible RCI2A and peroxidase proteins RCI3A, tomato peroxidase (TPX1), TPX2, tomato ascorbate peroxidase (APX1), and horseradish peroxidase (HRP-c). In addition to membrane protection, RCI2A may cross talk with PSII-associated proteins or peroxidase family enzymes in response to cold stress. Our findings may strengthen the understanding of the molecular function of RCI2A in cold-stress tolerance. RCI2A could be used to improve abiotic stress tolerance in agronomic crops.

  20. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    Energy Technology Data Exchange (ETDEWEB)

    Dixit, Prachy; Mukherjee, Prasun K.; Sherkhane, Pramod D.; Kale, Sharad P. [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Eapen, Susan, E-mail: eapenhome@yahoo.com [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2011-08-15

    Highlights: {yields} Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. {yields} Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. {yields} Using in vitro T{sub 1} seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. {yields} This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of {sup 14}C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T{sub 0} and T{sub 1}) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  1. Overexpression of AmRosea1 Gene Confers Drought and Salt Tolerance in Rice

    Science.gov (United States)

    Dou, Mingzhu; Fan, Sanhong; Yang, Suxin; Huang, Rongfeng; Yu, Huiyun; Feng, Xianzhong

    2016-01-01

    Ectopic expression of the MYB transcription factor of AmROSEA1 from Antirrhinum majus has been reported to change anthocyanin and other metabolites in several species. In this study, we found that overexpression of AmRosea1 significantly improved the tolerance of transgenic rice to drought and salinity stresses. Transcriptome analysis revealed that a considerable number of stress-related genes were affected by exogenous AmRosea1 during both drought and salinity stress treatments. These affected genes are involved in stress signal transduction, the hormone signal pathway, ion homeostasis and the enzymes that remove peroxides. This work suggests that the AmRosea1 gene is a potential candidate for genetic engineering of crops. PMID:28025485

  2. Overexpression of AmRosea1 Gene Confers Drought and Salt Tolerance in Rice

    Directory of Open Access Journals (Sweden)

    Mingzhu Dou

    2016-12-01

    Full Text Available Ectopic expression of the MYB transcription factor of AmROSEA1 from Antirrhinum majus has been reported to change anthocyanin and other metabolites in several species. In this study, we found that overexpression of AmRosea1 significantly improved the tolerance of transgenic rice to drought and salinity stresses. Transcriptome analysis revealed that a considerable number of stress-related genes were affected by exogenous AmRosea1 during both drought and salinity stress treatments. These affected genes are involved in stress signal transduction, the hormone signal pathway, ion homeostasis and the enzymes that remove peroxides. This work suggests that the AmRosea1 gene is a potential candidate for genetic engineering of crops.

  3. Physiological performance, secondary metabolite and expression profiling of genes associated with drought tolerance in Withania somnifera.

    Science.gov (United States)

    Sanchita; Singh, Ruchi; Mishra, Anand; Dhawan, Sunita S; Shirke, Pramod A; Gupta, Madan M; Sharma, Ashok

    2015-11-01

    Physiological, biochemical, and gene expression responses under drought stress were studied in Withania somnifera. Photosynthesis rate, stomatal conductance, transpiration rate, relative water content, chlorophyll content, and quantum yield of photosystems I and II (PSI and PSII) decreased in response to drought stress. Comparative expression of genes involved in osmoregulation, detoxification, signal transduction, metabolism, and transcription factor was analyzed through quantitative RT-PCR. The genes encoding 1-pyrroline-5-carboxylate synthetase (P5CS), glutathione S-transferase (GST), superoxide dismutase (SOD), serine threonine-protein kinase (STK), serine threonine protein phosphatase (PSP), aldehyde dehydrogenase (AD), leucoanthocyanidin dioxygenase/anthocyanin synthase (LD/AS), HSP, MYB, and WRKY have shown upregulation in response to drought stress condition in leaf tissues. Enhanced detoxification and osmoregulation along with increased withanolides production were also observed under drought stress. The results of this study will be helpful in developing stress-tolerant and high secondary metabolite yielding genotypes.

  4. Differential activation of genes related to aluminium tolerance in two contrasting rice cultivars.

    Science.gov (United States)

    Roselló, Maite; Poschenrieder, Charlotte; Gunsé, Benet; Barceló, Juan; Llugany, Mercè

    2015-11-01

    Rice (Oryza sativa) is a highly Al-tolerant crop. Among other mechanisms, a higher expression of STAR1/STAR2 (sensitive to Al rhizotoxicity1/2) genes and of Nrat1 (NRAMP Aluminium Transporter 1), and ALS1 (Aluminium sensitive 1) can at least in part be responsible for the inducible Al tolerance in this species. Here we analysed the responses to Al in two contrasting rice varieties. All analysed toxicity/tolerance markers (root elongation, Evans blue, morin and haematoxylin staining) indicated higher Al-tolerance in variety Nipponbare, than in variety Modan. Nipponbare accumulated much less Al in the roots than Modan. Aluminium supply caused stronger expression of STAR1 in Nipponbare than in Modan. A distinctively higher increase of Al-induced abscisic acid (ABA) accumulation was found in the roots of Nipponbare than in Modan. Highest ABA levels were observed in Nipponbare after 48 h exposure to Al. This ABA peak was coincident in time with the highest expression level of STAR1. It is proposed that ABA may be required for cell wall remodulation facilitated by the enhanced UDP-glucose transport to the walls through STAR1/STAR2. Contrastingly, in the roots of Modan the expression of both Nrat1 coding for a plasma membrane Al-transporter and of ALS1 coding for a tonoplast-localized Al transporter was considerably enhanced. Moreover, Modan had a higher Al-induced expression of ASR1 a gene that has been proposed to code for a reactive oxygen scavenging protein. In conclusion, the Al-exclusion strategy of Nipponbare, at least in part mediated by STAR1 and probably regulated by ABA, provided better protection against Al toxicity than the accumulation and internal detoxification strategy of Modan mediated by Nrat1, ALS1 and ARS1.

  5. Transcriptome Profiling of Wild Arachis from Water-Limited Environments Uncovers Drought Tolerance Candidate Genes.

    Science.gov (United States)

    Brasileiro, Ana C M; Morgante, Carolina V; Araujo, Ana C G; Leal-Bertioli, Soraya C M; Silva, Amanda K; Martins, Andressa C Q; Vinson, Christina C; Santos, Candice M R; Bonfim, Orzenil; Togawa, Roberto C; Saraiva, Mario A P; Bertioli, David J; Guimaraes, Patricia M

    Peanut (Arachis hypogaea L.) is an important legume cultivated mostly in drought-prone areas where its productivity can be limited by water scarcity. The development of more drought-tolerant varieties is, therefore, a priority for peanut breeding programs worldwide. In contrast to cultivated peanut, wild relatives have a broader genetic diversity and constitute a rich source of resistance/tolerance alleles to biotic and abiotic stresses. The present study takes advantage of this diversity to identify drought-responsive genes by analyzing the expression profile of two wild species, Arachis duranensis and Arachis magna (AA and BB genomes, respectively), in response to progressive water deficit in soil. Data analysis from leaves and roots of A. duranensis (454 sequencing) and A. magna (suppression subtractive hybridization (SSH)) stressed and control complementary DNA (cDNA) libraries revealed several differentially expressed genes in silico, and 44 of them were selected for further validation by quantitative RT-PCR (qRT-PCR). This allowed the identification of drought-responsive candidate genes, such as Expansin, Nitrilase, NAC, and bZIP transcription factors, displaying significant levels of differential expression during stress imposition in both species. This is the first report on identification of differentially expressed genes under drought stress and recovery in wild Arachis species. The generated transcriptome data, besides being a valuable resource for gene discovery, will allow the characterization of new alleles and development of molecular markers associated with drought responses in peanut. These together constitute important tools for the peanut breeding program and also contribute to a better comprehension of gene modulation in response to water deficit and rehydration.

  6. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  7. Improvement of Drought Tolerance in Transgenic Tobacco Plants by aDehydrin-Like Gene Transfer

    Institute of Scientific and Technical Information of China (English)

    SHENYe; JIAWei-long; ZHANGYan-qin; HUYuan-lei; WUQi; LINZhongping

    2004-01-01

    A full-length cDNA of dehydrin BcDh2 from Boea crassifolia and its antisense nucleotide sequence have been transferred into tobacco (Nicotiana tabacum) NC89 under the control of a caulifower mosaic virus 35S promoter. Under a progressive water stress, photosynthetic rate, transpiration rate and stomatal conductance of the sense and antisense plants reduced, and those of the control reduced much more. Photosynthetic rate, transpiration rate and stomatal conductance of all plants tested increased significantly 24 hours later after recoveried water supply, and those of the sense and antisense plants were higher than control. These indicated that overexpression of a dehydrin gene in tobacco may improve tolerance to water stress for plants, however, antisense BcDh2 gene in transgenic plant did not influence physiological conditions. The results of germination experiment of the transgenic seeds showed that on MS medium with different concentration PEG (8000), sense seed could more endure drought than control, while antisense seed was sensitive to drought. The results suggested that the overexpression of a dehydrin gene in tobacco might improve the tolerance to water stress for plants.

  8. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene confers drought tolerance in maize (Zea mays L.).

    Science.gov (United States)

    Lu, Yao; Li, Yajun; Zhang, Jiachang; Xiao, Yitao; Yue, Yuesen; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu

    2013-01-01

    Abscisic acid (ABA) is a key component of the signaling system that integrates plant adaptive responses to abiotic stress. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene (LOS5) in maize markedly enhanced the expression of ZmAO and aldehyde oxidase (AO) activity, leading to ABA accumulation and increased drought tolerance. Transgenic maize (Zea mays L.) exhibited the expected reductions in stomatal aperture, which led to decreased water loss and maintenance of higher relative water content (RWC) and leaf water potential. Also, transgenic maize subjected to drought treatment exhibited lower leaf wilting, electrolyte leakage, malondialdehyde (MDA) and H(2)O(2) content, and higher activities of antioxidative enzymes and proline content compared to wild-type (WT) maize. Moreover, overexpression of LOS5 enhanced the expression of stress-regulated genes such as Rad 17, NCED1, CAT1, and ZmP5CS1 under drought stress conditions, and increased root system development and biomass yield after re-watering. The increased drought tolerance in transgenic plants was associated with ABA accumulation via activated AO and expression of stress-related gene via ABA induction, which sequentially induced a set of favorable stress-related physiological and biochemical responses.

  9. Improvement of Drought Tolerance in Transgenic Tobacco Plants by a Dehydrin-Like Gene Transfer

    Institute of Scientific and Technical Information of China (English)

    SHEN Ye; JIA Wei-long; ZHANG Yan-qin; HU Yuan-lei; WU Qi; LIN Zhong-ping

    2004-01-01

    A full-length cDNA of dehydrin BcDh2 from Boea crassifolia and its antisense nucleotide sequence have been transferred into tobacco (Nicotiana tabacum) NC89 under the control of a caulifower mosaic virus 35S promoter. Under a progressive water stress, photosynthetic rate, transpiration rate and stomatal conductance of the sense and antisense plants reduced, and those of the control reduced much more. Photosynthetic rate, transpiration rate and stomatal conductance of all plants tested increased significantly 24 hours later after recoveried water supply, and those of the sense and antisense plants were higher than control. These indicated that overexpression of a dehydrin gene in tobacco may improve tolerance to water stress for plants, however, antisense BcDh2 gene in transgenic plant did not influence physiological conditions. The results of germination experiment of the transgenic seeds showed that on MS medium with different concentration PEG (8000), sense seed could more endure drought than control, while antisense seed was sensitive to drought. The results suggested that the overexpression of a dehydrin gene in tobacco might improve the tolerance to water stress for plants.

  10. Silencing of TaBTF3 gene impairs tolerance to freezing and drought stresses in wheat.

    Science.gov (United States)

    Kang, Guozhang; Ma, Hongzhen; Liu, Guoqin; Han, Qiaoxia; Li, Chengwei; Guo, Tiancai

    2013-11-01

    Basic transcription factor 3 (BTF3), the β-subunit of the nascent polypeptide-associated complex, is responsible for the transcriptional initiation of RNA polymerase II and is also involved in cell apoptosis, translation initiation regulation, growth, development, and other functions. Here, we report the impact of BTF3 on abiotic tolerance in higher plants. The transcription levels of the TaBTF3 gene, first isolated from wheat seedlings in our lab, were differentially regulated by diverse abiotic stresses and hormone treatments, including PEG-induced stress (20 % polyethylene glycol 6000), cold (4 °C), salt (100 mM NaCl), abscisic acid (100 μM), methyl jasmonate (50 μM), and salicylic acid (50 μM). Southern blot analysis indicated that, in the wheat genome, TaBTF3 is a multi-copy gene. Compared to BSMV-GFP-infected wheat plants (control), under freezing (-8 °C for 48 h) or drought stress (withholding water for 15 days) conditions, TaBTF3-silenced wheat plants showed lower survival rates, free proline content, and relative water content and higher relative electrical conductivity and water loss rate. These results suggest that silencing of the TaBTF3 gene may impair tolerance to freezing and drought stresses in wheat and that it may be involved in the response to abiotic stresses in higher plants.

  11. [Cloning and expression of organic solvent tolerant lipase gene from Staphylococcus saprophyticus M36].

    Science.gov (United States)

    Tang, Yanchong; Lu, Yaping; Lü, Fengxia; Bie, Xiaomei; Guo, Yao; Lu, Zhaoxin

    2009-12-01

    Lipases are important biocatalysts that are widely used in food processing and bio-diesel production. However, organic solvents could inactivate some lipases during applications. Therefore, the efficient cloning and expression of the organic solvent-tolerant lipase is important to its application. In this work, we first found out an organic solvent-tolerant lipase from Staphylococcus saprophyticus M36 and amplified the 741 bp Lipase gene lip3 (GenBank Accession No. FJ979867), by PCR, which encoded a 31.6 kD polypeptide of 247 amino acid residues. But the lipase shared 83% identity with tentative lip3 gene of Staphylococcus saprophyticus (GenBank Accession No. AP008934). We connected the gene with expression vector pET-DsbA, transformed it into Escherichia coli BL21 (DE3), and obtained the recombinant pET-DsbA-lip3. With the induction by 0.4 mmol/L of isopropyl beta-D-thiogalactopyranoside at pH 8.0, OD600 1.0, 25 degrees C for 12 h, the lipase activity reached up to 25.8 U/mL. The lipase expressed was stable in the presence of methanol, n-hexane, and isooctane, n-heptane.

  12. Mapping and validation of a dominant salt tolerance gene in the cultivated soybean(Glycine max) variety Tiefeng 8

    Institute of Scientific and Technical Information of China (English)

    Rongxia; Guan; Jiangang; Chen; Jinghan; Jiang; Guangyu; Liu; Ying; Liu; Lei; Tian; Lili; Yu; Ruzhen; Chang; Li-juan; Qiu

    2014-01-01

    Salt is an abiotic stress factor that strongly affects soybean growth and production. A single dominant gene has been shown to confer salt tolerance in the soybean cultivar Tiefeng 8.The objective of the present study was to genetically map the salt-tolerance gene in an F2:3population and a recombinant inbred line(RIL) population derived from a cross between two cultivated soybeans, Tiefeng 8(tolerant) and 85-140(sensitive). The F2:3families and RILs were treated with 200 mmol L-1Na Cl to evaluate salt tolerance. The F2:3population showed 1(42 tolerant): 2(132 segregating): 1(65 sensitive) segregation, indicating a single dominant gene for salt tolerance in Tiefeng 8. A sequence-characterized amplified region(SCAR) marker from a previously identified random amplified polymorphic DNA(RAPD)marker and four insertion/deletion polymorphism(In Del) markers were developed within the mapping region. Using these markers along with SSR markers, the salt-tolerance gene was mapped within 209 kb flanked by SCAR marker QS08064 and SSR marker Barcsoyssr31301 on chromosome 3. Three markers that cosegregated with the salt tolerance gene and SCAR marker QS08064 were used to genotype 35 tolerant and 23 sensitive soybean accessions. These markers showed selection efficiencies of 76.2% to94.2%. The results indicate that these markers will be useful for marker-assisted breeding and facilitating map-based cloning of the salt tolerance gene in soybean.

  13. Stable expression of mtlD gene imparts multiple stress tolerance in finger millet.

    Directory of Open Access Journals (Sweden)

    Ramanna Hema

    Full Text Available Finger millet is susceptible to abiotic stresses, especially drought and salinity stress, in the field during seed germination and early stages of seedling development. Therefore developing stress tolerant finger millet plants combating drought, salinity and associated oxidative stress in these two growth stages is important. Cellular protection through osmotic adjustment and efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms in plants. Mannitol, an osmolyte, is known to scavenge hydroxyl radicals generated during various abiotic stresses and thereby minimize stress damage in several plant species. In this study transgenic finger millet plants expressing the mannitol biosynthetic pathway gene from bacteria, mannitol-1-phosphate dehydrogenase (mtlD, were developed through Agrobacterium tumefaciens-mediated genetic transformation. mtlD gene integration in the putative transgenic plants was confirmed by Southern blot. Further, performance of transgenic finger millet under drought, salinity and oxidative stress was studied at plant level in T1 generation and in T1 and T2 generation seedlings. Results from these experiments showed that transgenic finger millet had better growth under drought and salinity stress compared to wild-type. At plant level, transgenic plants showed better osmotic adjustment and chlorophyll retention under drought stress compared to the wild-type. However, the overall increase in stress tolerance of transgenics for the three stresses, especially for oxidative stress, was only marginal compared to other mtlD gene expressing plant species reported in the literature. Moreover, the Agrobacterium-mediated genetic transformation protocol developed for finger millet in this study can be used to introduce diverse traits of agronomic importance in finger millet.

  14. 76 FR 23490 - Aluminum tris (O

    Science.gov (United States)

    2011-04-27

    ... AGENCY 40 CFR Part 180 Aluminum tris (O-ethylphosphonate), Butylate, Chlorethoxyfos, Clethodim, et al..., fosthiazate, propetamphos, and tebufenozide; the fungicide aluminum tris (O-ethylphosphonate); the herbicides.... Also, EPA is revoking the tolerances for aluminum tris (O-ethylphosphonate) on pineapple fodder...

  15. PL1 fusion gene: a novel visual selectable marker gene that confers tolerance to multiple abiotic stresses in transgenic tomato.

    Science.gov (United States)

    Jin, Feng; Li, Shu; Dang, Lijie; Chai, Wenting; Li, Pengli; Wang, Ning Ning

    2012-10-01

    Visual selectable markers, including the purple color caused by the accumulation of anthocyanins, have been proposed for use as antibiotic-free alternatives. However, the excessive accumulation of anthocyanins seriously inhibits the growth and development of transgenic plants. In our study, the AtDWF4 promoter from Arabidopsis and the tomato LeANT1 gene, encoding a MYB transcription factor, were used to construct the PL1 fusion gene to test whether it could be used as a visual selectable marker gene for tomato transformation. All the PL1 transgenic shoots exhibited intense purple color on shoot induction medium. In the transgenic tomato plants, PL1 was highly expressed in the cotyledons, but expressed only slightly in the true leaves and other organs. The expression of PL1 had no significantly adverse effects on the growth or development of the transgenic tomato plants, and conferred tolerance to multiple abiotic stresses in them. With the “cut off green shoots” method, multiple independent 35S::GFP transgenic tomato lines were successfully obtained using PL1 as the selectable marker gene. These results suggest that PL1 has potential application of visual selectable marker gene for tomato transformation.

  16. Dynamic QTL analysis and candidate gene mapping for waterlogging tolerance at maize seedling stage.

    Directory of Open Access Journals (Sweden)

    Khalid A Osman

    Full Text Available Soil waterlogging is one of the major abiotic stresses adversely affecting maize growth and yield. To identify dynamic expression of genes or quantitative trait loci (QTL, QTL associated with plant height, root length, root dry weight, shoot dry weight and total dry weight were identified via conditional analysis in a mixed linear model and inclusive composite interval mapping method at three respective periods under waterlogging and control conditions. A total of 13, 19 and 23 QTL were detected at stages 3D|0D (the period during 0-3 d of waterlogging, 6D|3D and 9D|6D, respectively. The effects of each QTL were moderate and distributed over nine chromosomes, singly explaining 4.14-18.88% of the phenotypic variation. Six QTL (ph6-1, rl1-2, sdw4-1, sdw7-1, tdw4-1 and tdw7-1 were identified at two consistent stages of seedling development, which could reflect a continuous expression of genes; the remaining QTL were detected at only one stage. Thus, expression of most QTL was influenced by the developmental status. In order to provide additional evidence regarding the role of corresponding genes in waterlogging tolerance, mapping of Expressed Sequence Tags markers and microRNAs were conducted. Seven candidate genes were observed to co-localize with the identified QTL on chromosomes 1, 4, 6, 7 and 9, and may be important candidate genes for waterlogging tolerance. These results are a good starting point for understanding the genetic basis for selectively expressing of QTL in different stress periods and the common genetic control mechanism of the co-localized traits.

  17. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Wang, Xiaojuan; Song, Yu; Ma, Yanhua; Zhuo, Renying; Jin, Liang

    2011-12-01

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible.

  18. Cloning of Lactate dehydrogenase Gene and Effect on the Waterlogging Tolerance of Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Ben-bo Xu

    2012-10-01

    Full Text Available To investigate the mechanism on waterlogging tolerance in Brassica napus, 12 B. napus cultivars with different waterlogging tolerance were used in the research and Waterlogging Tolerance Index (WTI was calculated by multiplying relative percentage germination and the relative seedling height. The results indicated that Lactate Dehydrogenase (LDH enzyme activity rapidly increased at 24 h after waterlogging treatment and reached peak between 48-72 h. WTI was correlated with LDH enzyme activity at 24 h after water logging treatment and the correlation coefficient between them was 0.84. Transcription level of the BnLDH had significant difference in the 12 lines after waterlogging treatment. BnLDH expression level was very low before waterlogging treatment and induced by waterlogging treatment and arrived at peak at 48 h. Correlation analysis indicated correlation coefficient between WTI and BnLDH expression at 24 and 48 h after waterlogging treatment was 0.56 and 0.72, respectively. An LDH gene, denoted BnLDH-1, was cloned from oilseeds by the Rapid Amplification of CDNA Ends (RACE from 12 materials and the results indicated all of them had same protein sequence.

  19. An omp gene enhances cell tolerance of Cu(II) in Sinorhizobium meliloti CCNWSX0020.

    Science.gov (United States)

    Li, Zhefei; Lu, Mingmei; Wei, Gehong

    2013-09-01

    The main aim of this work was to study molecular characterization of a DNA fragment conferring resistance to Cu(II) in Sinorhizobium meliloti CCNWSX0020. The strain CCNWSX0020, resistant to 1.4 mmol l(-1) Cu(II) in tryptone-yeast extract medium was isolated from Medicago lupulina growing in mine tailings of Fengxian County, China. The availability of the complete genome sequence of S. meliloti CCNWSX0020 provides an opportunity for investigating genes that play significant roles in Cu(II) resistance. A copper resistance gene, with a length of 1,445 bp, encoding 481 amino acids, designated omp, was identified by cDNA-amplified fragment length polymorphism from S. meliloti CCNWSX0020. The expression of omp gene strongly increased in the presence of Cu(II). The omp-defective mutants display sensitivities to Cu(II) compared with their wild types. The Cu(II)-sensitive phenotype of the mutant was complemented by a 1.5-kb DNA fragment containing omp gene. BLAST analysis revealed that this gene encoded a hypothetical outer membrane protein with 75 % similarity to outer membrane efflux protein in Rhizobium leguminosarum bv. viciae 3841. These studies suggested that the omp product was involved in the Cu(II) tolerance of S. meliloti CCNWSX0020.

  20. Molecular approaches unravel the mechanism of acid soil tolerance in plants

    Institute of Scientific and Technical Information of China (English)

    Miao; Bian; Meixue; Zhou; Dongfa; Sun; Chengdao; Li

    2013-01-01

    Acid soil is a worldwide problem to plant production. Acid toxicity is mainly caused by a lack of essential nutrients in the soil and excessive toxic metals in the plant root zone. Of the toxic metals, aluminum(Al) is the most prevalent and most toxic. Plant species have evolved to variable levels of tolerance to aluminum enabling breeding of high Al-tolerant cultivars.Physiological and molecular approaches have revealed some mechanisms of Al toxicity in higher plants. Mechanisms of plant tolerance to Al stress include: 1) exclusion of Al from the root tips, and 2) absorbance, but tolerance of Al in root cells. Organic acid exudation to chelate Al is a feature shared by many higher plants. The future challenge for Al tolerance studies is the identification of novel tolerance mechanisms and the combination of different mechanisms to achieve higher tolerance. Molecular approaches have led to significant progress in explaining mechanisms and detection of genes responsible for Al tolerance.Gene-specific molecular markers offer better options for marker-assisted selection in breeding programs than linked marker strategies. This paper mainly focuses on recent progress in the use of molecular approaches in Al tolerance research.

  1. Expression of betaine aldehyde dehydrogenase gene and salinity tolerance in rice transgenic plants

    Institute of Scientific and Technical Information of China (English)

    郭岩; 张莉; 肖岗; 曹守云; 谷冬梅; 田文忠; 陈受宜

    1997-01-01

    Betaine as one of osmolytes plays an important role in osmoregulation of most high plants. Betaine aldehyde dehydrogenase C BADH) is the second enzyme involved in betaine biosynthesis. The BADH gene from a halophite, Atriplex hortensis, was transformed into rice cultivars by bombarment method. Totally 192 transgenic rice plants were obtained and most of them had higher salt tolerance than controls. Among transgenic plants transplanted in the saline pool containing 0.5% NaCl in a greenhouse, 22 survived, 13 of which set seeds, and the frequency of seed setting was very low, only 10% . But the controls could not grow under the same condition. The results of BADH ac-tivity assay and Northern blot showed that the BADH gene was integrated into chromosomes of transgenic plants and expressed.

  2. An Na+/H+ antiporter gene from wheat plays an important role in stress tolerance

    Indian Academy of Sciences (India)

    Jia Ning Yu; Jian Huang; Zi Ning Wang; Jin Song Zhang; Shou Yi Chen

    2007-09-01

    A vacuole Na+/H+ antiporter gene TaNHX2 was obtained by screening the wheat cDNA library and by the 5′-RACE method. The expression of TaNHX2 was induced in roots and leaves by treatment with NaCl, polyethylene glycol (PEG), cold and abscisic acid (ABA). When expressed in a yeast mutant (nhx1), TaNHX2 suppressed the salt sensitivity of the mutant, which was deficient in vacuolar Na+/H+ antiporter, and caused partial recovery of growth of nhx1 in NaCl and LiCl media. The survival rate of yeast cells was improved by overexpressing the TaNHX2 gene under NaCl, KCl, sorbitol and freezing stresses when compared with the control. The results imply that TaNHX2 might play an important role in salt and osmotic stress tolerance in plant cells.

  3. Determination of drought tolerance using root activities in Robinia pseudoacacia 'Idaho' transformed with mtl-D gene

    Institute of Scientific and Technical Information of China (English)

    Wang Hua-fang; Zhu Yi-hong; Sun Hai-jun

    2006-01-01

    Idaho locust (Robinia pseudoacacia 'Idaho') is an exotic multi-purpose tree used in landscaping, soil and water conservation, fodder sources and others. To improve its drought tolerance for reclaiming arid land, five lines of transformed mtl-D gene, as osmotic regulator in plant cells, have been selected and managed to determine their drought tolerance under experimental conditions.Qualitative and quantitative variables of transformed plants were studied. The critical value of drought tolerance was determined by detecting the 2,3,5-triphenyl tetrazolium chloride (TTC) reductants in roots and soil water content (SWC). The critical value for drought tolerance was SWC 6% while for the control plants the critical SWC was 8%; a moderate level of SWC is 13% and the highest SWC for plant endurance was 18%. The method proved to be reliable and sensitive in the evaluation of drought tolerance for forest trees.

  4. Proteomic analysis of Pseudomonas putida reveals an organic solvent tolerance-related gene mmsB.

    Directory of Open Access Journals (Sweden)

    Ye Ni

    Full Text Available Organic solvents are toxic to most microorganisms. However, some organic-solvent-tolerant (OST bacteria tolerate the destructive effects of organic solvent through various accommodative mechanisms. In this work, we developed an OST adapted strain Pseudomonas putida JUCT1 that could grow in the presence of 60% (v/v cyclohexane. Two-dimensional gel electrophoresis was used to compare and analyze the total cellular protein of P. putida JUCT1 growing with or without 60% (v/v cyclohexane. Under different solvent conditions, five high-abundance protein spots whose intensity values show over 60% discrepancies were identified by MALDI-TOF/TOF spectra. Specifically, they are arginine deiminase, carbon-nitrogen hydrolase family putative hydrolase, 3-hydroxyisobutyrate dehydrogenase, protein chain elongation factor EF-Ts, and isochorismatase superfamily hydrolase. The corresponding genes of the latter three proteins, mmsB, tsf, and PSEEN0851, were separately expressed in Escherichia coli to evaluate their effect on OST properties of the host strain. In the presence of 4% (v/v cyclohexane, E. coli harboring mmsB could grow to 1.70 OD(660, whereas cell growth of E. coli JM109 (the control was completely inhibited by 2% (v/v cyclohexane. Transformants carrying tsf or PSEEN0851 also showed an increased resistance to cyclohexane and other organic solvents compared with the control. Of these three genes, mmsB exhibited the most prominent effect on increasing OST of E. coli. Less oxidation product of cyclohexane was detected because mmsB transformants might help keep a lower intracellular cyclohexane level. This study demonstrates a feasible approach for elucidating OST mechanisms of microorganisms, and provides molecular basis to construct organic-solvent-tolerant strains for industrial applications.

  5. Differential regulation of mitochondrial pyruvate carrier genes modulates respiratory capacity and stress tolerance in yeast.

    Directory of Open Access Journals (Sweden)

    Alba Timón-Gómez

    Full Text Available Mpc proteins are highly conserved from yeast to humans and are necessary for the uptake of pyruvate at the inner mitochondrial membrane, which is used for leucine and valine biosynthesis and as a fuel for respiration. Our analysis of the yeast MPC gene family suggests that amino acid biosynthesis, respiration rate and oxidative stress tolerance are regulated by changes in the Mpc protein composition of the mitochondria. Mpc2 and Mpc3 are highly similar but functionally different: Mpc2 is most abundant under fermentative non stress conditions and important for amino acid biosynthesis, while Mpc3 is the most abundant family member upon salt stress or when high respiration rates are required. Accordingly, expression of the MPC3 gene is highly activated upon NaCl stress or during the transition from fermentation to respiration, both types of regulation depend on the Hog1 MAP kinase. Overexpression experiments show that gain of Mpc2 function leads to a severe respiration defect and ROS accumulation, while Mpc3 stimulates respiration and enhances tolerance to oxidative stress. Our results identify the regulated mitochondrial pyruvate uptake as an important determinant of respiration rate and stress resistance.

  6. Identification of quantitative trait loci and candidate genes for cadmium tolerance in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Goncho T. [West Virginia University; Yin, Tongming [ORNL; Zhang, Xinye [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Steven P [West Virginia University

    2012-01-01

    Understanding genetic variation for the response of Populus to heavy metals like cadmium (Cd) is an important step in elucidating the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa Torr. & Gray and Populus deltoides Bart. was characterized for growth and performance traits after Cd exposure. A total of 16 quantitative trait loci (QTL) at logarithm of odds (LOD) ratio 2.5 were detected for total dry weight, its components and root volume. Major QTL for Cd responses were mapped to two different linkage groups and the relative allelic effects were in opposing directions on the two chromosomes, suggesting differential mechanisms at these two loci. The phenotypic variance explained by Cd QTL ranged from 5.9 to 11.6% and averaged 8.2% across all QTL. A whole-genome microarray study led to the identification of nine Cd-responsive genes from these QTL. Promising candidates for Cd tolerance include an NHL repeat membrane-spanning protein, a metal transporter and a putative transcription factor. Additional candidates in the QTL intervals include a putative homolog of a glutamate cysteine ligase, and a glutathione-S-transferase. Functional characterization of these candidate genes should enhance our understanding of Cd metabolism and transport and phytoremediation capabilities of Populus.

  7. Overexpression of a Cytosolic Ascorbate Peroxidase Gene, OsAPX2, Increases Salt Tolerance in Transgenic Alfalfa

    Institute of Scientific and Technical Information of China (English)

    ZHANG Qian; MA Cui; XUE Xin; XU Ming; LI Jing; WU Jin-xia

    2014-01-01

    Alfalfa (Medicago sativa L.) is an important forage crop in the world and it is of great signiifcance for the improvement of its salt tolerance. To improve salt tolerance in alfalfa, a rice ascorbate peroxidase gene (OsAPX2) was introduced into alfalfa using Agrobacterium tumefaciens-mediated transformation with marker gene bar. The different T-DNA insertions in T1 transgenic alfalfa were identiifed by Southern hybridization. Three independent T2 transgenic lines were selected for stress analysis and the results showed that all of them were salt tolerant compared with wild-type plants. The transgenic plants had low levels of H2O2, malondialdehyde and relative electrical conductivity under salt and drought stresses. Moreover, the contents of chlorophyll and proline, and APX activity were high in transgenic plants under salt and drought stresses. Taken together, the overexpression of OsAPX2 enhances salt tolerance in alfalfa through scavenging reactive oxygen species.

  8. Overexpression of osmotin gene confers tolerance to salt and drought stresses in transgenic tomato (Solanum lycopersicum L.).

    Science.gov (United States)

    Goel, D; Singh, A K; Yadav, V; Babbar, S B; Bansal, K C

    2010-09-01

    Abiotic stresses, especially salinity and drought, are major limiting factors for plant growth and crop productivity. In an attempt to develop salt and drought tolerant tomato, a DNA cassette containing tobacco osmotin gene driven by a cauliflower mosaic virus 35S promoter was transferred to tomato (Solanum lycopersicum) via Agrobacterium-mediated transformation. Putative T0 transgenic plants were screened by PCR analysis. The selected transformants were evaluated for salt and drought stress tolerance by physiological analysis at T1 and T2 generations. Integration of the osmotin gene in transgenic T1 plants was verified by Southern blot hybridization. Transgenic expression of the osmotin gene was verified by RT-PCR and northern blotting in T1 plants. T1 progenies from both transformed and untransformed plants were tested for salt and drought tolerance by subjecting them to different levels of NaCl stress and by withholding water supply, respectively. Results from different physiological tests demonstrated enhanced tolerance to salt and drought stresses in transgenic plants harboring the osmotin gene as compared to the wild-type plants. The transgenic lines showed significantly higher relative water content, chlorophyll content, proline content, and leaf expansion than the wild-type plants under stress conditions. The present investigation clearly shows that overexpression of osmotin gene enhances salt and drought stress tolerance in transgenic tomato plants.

  9. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage

    OpenAIRE

    Guo, P; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R; Von Korff, M.; Varshney, R.,; Graner, A.; Valkoun, V.

    2007-01-01

    Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas worldwide. Identification of the genes responsible for drought tolerance in barley (Hordeum vulgare L.) will facilitate understanding of the molecular mechanisms of drought tolerance, and also facilitate the genetic improvement of barley through marker-assisted selection or gene transformation. To monitor the changes in gene expression at the transcriptional level in barley leaves during the repro...

  10. Differential gene expression in salt-tolerant rice mutant and its parental variety

    Institute of Scientific and Technical Information of China (English)

    张劲松; 周骏马; 张驰; 陈受宜

    1996-01-01

    The differential expressions of three genes rbcL, salT and rab!6 in response to ABA, NaCl, PEG and heat shock were investigated in seedlings of a salt-tolerant rice mutant 20 (mutant 20) and its parental variety Oryza sativa var. japonica 77-170(170). By Northern blot analysis it was found that ABA induced the expression of all three genes of rbcL, salT and rab16 in shoots and roots of both 170 and mutant 20 with the exceptions of rab16 in shoots of mutant 20 and rbcL in roots of 170. Lower concentrations of NaCl induced rbcL expression in shoots of mutant 20 but not 170. Higher concentrations of NaCl decreased rbcL expression but induced expressions of salT and rab16 in shoots of both 170 and mutant 20. PEG(15%) and 37℃ heat shock showed almost no effects on the expression of the three genes in mutant 20. However, they caused a decrease in rbcL expression and slight induction of the rab16 gene in 170, with salT expression unaffected. These results indicated that mutant 20 was relatively less responsiv

  11. The essential role of the Deinococcus radiodurans ssb gene in cell survival and radiation tolerance.

    Directory of Open Access Journals (Sweden)

    J Scott Lockhart

    Full Text Available Recent evidence has implicated single-stranded DNA-binding protein (SSB expression level as an important factor in microbial radiation resistance. The genome of the extremely radiation resistant bacterium Deinococcus radiodurans contains genes for two SSB homologs: the homodimeric, canonical Ssb, encoded by the gene ssb, and a novel pentameric protein encoded by the gene ddrB. ddrB is highly induced upon exposure to radiation, and deletions result in decreased radiation-resistance, suggesting an integral role of the protein in the extreme resistance exhibited by this organism. Although expression of ssb is also induced after irradiation, Ssb is thought to be involved primarily in replication. In this study, we demonstrate that Ssb in D. radiodurans is essential for cell survival. The lethality of an ssb deletion cannot be complemented by providing ddrB in trans. In addition, the radiation-sensitive phenotype conferred by a ddrB deletion is not alleviated by providing ssb in trans. By altering expression of the ssb gene, we also show that lower levels of transcription are required for optimal growth than are necessary for high radiation resistance. When expression is reduced to that of E. coli, ionizing radiation resistance is similarly reduced. UV resistance is also decreased under low ssb transcript levels where growth is unimpaired. These results indicate that the expression of ssb is a key component of both normal cellular metabolism as well as pathways responsible for the high radiation tolerance of D. radiodurans.

  12. Aluminum oxide nanoparticles alter cell cycle progression through CCND1 and EGR1 gene expression in human mesenchymal stem cells.

    Science.gov (United States)

    Periasamy, Vaiyapuri Subbarayan; Athinarayanan, Jegan; Alshatwi, Ali A

    2016-05-01

    Aluminum oxide nanoparticles (Al2 O3 -NPs) are important ceramic materials that have been used in a variety of commercial and industrial applications. However, the impact of acute and chronic exposure to Al2 O3 -NPs on the environment and on human health has not been well studied. In this investigation, we evaluated the cytotoxic effects of Al2 O3 -NPs on human mesenchymal stem cells (hMSCs) by using a cell viability assay and observing cellular morphological changes, analyzing cell cycle progression, and monitoring the expression of cell cycle response genes (PCNA, EGR1, E2F1, CCND1, CCNC, CCNG1, and CYCD3). The Al2 O3 -NPs reduced hMSC viability in a dose- and time-dependent manner. Nuclear condensation and fragmentation, chromosomal DNA fragmentation, and cytoplasmic vacuolization were observed in Al2 O3 -NP-exposed cells. The nuclear morphological changes indicated that Al2 O3 -NPs alter cell cycle progression and gene expression. The cell cycle distribution revealed that Al2 O3 -NPs cause cell cycle arrest in the sub-G0-G1 phase, and this is associated with a reduction in the cell population in the G2/M and G0/G1 phases. Moreover, Al2 O3 -NPs induced the upregulation of cell cycle response genes, including EGR1, E2F1, and CCND1. Our results suggested that exposure to Al2 O3 -NPs could cause acute cytotoxic effects in hMSCs through cell cycle regulatory genes.

  13. Systems biology analysis of gene expression during in vivo Mycobacterium avium paratuberculosis enteric colonization reveals role for immune tolerance.

    Directory of Open Access Journals (Sweden)

    Sangeeta Khare

    Full Text Available Survival and persistence of Mycobacterium avium subsp. paratuberculosis (MAP in the intestinal mucosa is associated with host immune tolerance. However, the initial events during MAP interaction with its host that lead to pathogen survival, granulomatous inflammation, and clinical disease progression are poorly defined. We hypothesize that immune tolerance is initiated upon initial contact of MAP with the intestinal Peyer's patch. To test our hypothesis, ligated ileal loops in neonatal calves were infected with MAP. Intestinal tissue RNAs were collected (0.5, 1, 2, 4, 8 and 12 hrs post-infection, processed, and hybridized to bovine gene expression microarrays. By comparing the gene transcription responses of calves infected with the MAP, informative complex patterns of expression were clearly visible. To interpret these complex data, changes in the gene expression were further analyzed by dynamic Bayesian analysis, and genes were grouped into the specific pathways and gene ontology categories to create a holistic model. This model revealed three different phases of responses: i early (30 min and 1 hr post-infection, ii intermediate (2, 4 and 8 hrs post-infection, and iii late (12 hrs post-infection. We describe here the data that include expression profiles for perturbed pathways, as well as, mechanistic genes (genes predicted to have regulatory influence that are associated with immune tolerance. In the Early Phase of MAP infection, multiple pathways were initiated in response to MAP invasion via receptor mediated endocytosis and changes in intestinal permeability. During the Intermediate Phase, perturbed pathways involved the inflammatory responses, cytokine-cytokine receptor interaction, and cell-cell signaling. During the Late Phase of infection, gene responses associated with immune tolerance were initiated at the level of T-cell signaling. Our study provides evidence that MAP infection resulted in differentially regulated genes, perturbed

  14. Tolerância de genótipos de trigo comum, trigo duro e triticale à toxicidade de alumínio em soluções nutritivas Tolerance of bread wheat, durum wheat and triticale genotypes to aluminum toxicity in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    2006-01-01

    Full Text Available Foi estudado o comportamento diferencial de 12 genótipos de trigo comum (Triticum aestivum L., um genótipo de trigo duro (Triticum durum L., e um de triticale (Triticosecale sp em soluções nutritivas de tratamento contendo duas concentrações salinas (1/5 e 1/10 da completa e seis concentrações de alumínio ( 0, 2, 4, 6, 8 e 10 mg L-1, à temperatura de 25 ± 1ºC e pH 4,0. Foram utilizadas dez plântulas por parcela e quatro repetições. A tolerância foi medida pela capacidade de as raízes primárias continuarem a crescer em solução sem alumínio, após permanecer 48 horas em solução nutritiva completa, contendo uma concentração conhecida de alumínio combinada com cada uma das concentrações salinas. Os genótipos de trigo comum IAC-289, IAC-350 e IAC-370 e a cultivar controle Anahuac, e os genótipos de trigo duro IAC-1003 e de triticale IAC-5 foram os mais sensíveis a níveis crescentes de Al3+nas soluções nutritivas de tratamento e, portanto, somente seriam indicados para cultivo em solos corrigidos. Os genótipos de trigo comum IAC-24 e IAC-378 e a cultivar controle BH-1146 destacaram-se pela tolerância à toxicidade de Al3+, com potencial para uso em solos ácidos e como fontes genéticas de tolerância nos futuros cruzamentos. Os sintomas de toxicidade de alumínio foram maiores com a elevação da concentração de alumínio e da diminuição das concentrações de sais da solução nutritiva para todos os genótipos estudados.Twelve bread wheat (Triticum aestivum L., one durum wheat (Triticum durum L. and one triticale (Triticosecale sp genotypes were studied in nutrient solutions with a high salt concentration in experiment 1 and a weak salt concentration in experiment 2, for aluminum tolerance at six levels: 0, 2, 4, 6, 8 and 10 mg L-1, under temperature 25 ± 1ºC and pH 4,0. Four replications were used per experiment. Aluminum tolerance was evaluated by measuring root growth in an aluminum-free complete

  15. Arabidopsis LOS5 Gene Enhances Chilling and Salt Stress Tolerance in Cucumber

    Institute of Scientific and Technical Information of China (English)

    LIU Li-ying; DUAN Liu-sheng; ZHANG Jia-chang; MI Guo-quan; ZHANG Xiao-lan; ZHANG Zhen-xian; REN Hua-zhong

    2013-01-01

    Low temperature and high salinity are the major abiotic stresses that restrict cucumber growth and production, breeding materials with multiple abiotic resistance are in greatly need. Here we investigated the effect of introducing the LOS5 gene, a key regulator of ABA biosynthesis in Arabidopsis thaliana, under the stress-responsive RD29A promoter into cucumber (Cucumis sativus L. cv. S516). We found that T1 RD29A-LOS5 transgenic lines have enhanced tolerance to cold and salt stresses. Specifically, transgenic lines exhibited dwarf phenotypes with reduced leaf number, shorter internode, decreased length of the biggest leaf, fewer female flowers, shorter fruit neck and lower vitamin C (Vc). The increased cold tolerance can be reflected from the significantly decreased cold index, the reduced electrolyte leakage index and the MDA content upon cold treatment as compared to those in the control. This may result from the accumulation of internal ABA, soluble sugars and proline, and the enhanced activities of protective enzymes superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) in the transgenic lines. Under salt treatment, the transgenic lines exhibited increased germination index, vigor index, more lateral roots and increased root fresh weight. Moreover, RD29A-LOS5 transgenic plants displayed quicker responses in salt stress than that in low-temperature stress.

  16. Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Shiyi Zhou

    Full Text Available Aquaporin (AQP proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high water channel activity in Xenopus laevis oocytes and TaAQP7 transcript was induced by dehydration, and treatments with polyethylene glycol (PEG, abscisic acid (ABA and H(2O(2. Further, TaAQP7 was upregulated after PEG treatment and was blocked by inhibitors of ABA biosynthesis, implying that ABA signaling was involved in the upregulation of TaAQP7 after PEG treatment. Overexpression of TaAQP7 increased drought tolerance in tobacco. The transgenic tobacco lines had lower levels of malondialdehyde (MDA and H(2O(2, and less ion leakage (IL, but higher relative water content (RWC and superoxide dismutase (SOD and catalase (CAT activities when compared with the wild type (WT under drought stress. Taken together, our results show that TaAQP7 confers drought stress tolerance in transgenic tobacco by increasing the ability to retain water, reduce ROS accumulation and membrane damage, and enhance the activities of antioxidants.

  17. Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene.

    Science.gov (United States)

    Zhao, Qi-chao; Liu, Ming-hong; Zhang, Xian-wen; Lin, Chao-yang; Zhang, Qing; Shen, Zhi-cheng

    2015-10-01

    Insect resistance and glyphosate tolerance have been two of the most important traits in the genetic improvement of various crops. In this study, two Bacillus thuringiensis (Bt) insecticidal genes, Cry1Ac and Cry1Ig, and a modified glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene (G10) were combined into a single transferred DNA (T-DNA) fragment and introduced into rice by Agrobacterium-mediated transformation. A transgenic line with single-copy T-DNA insertion named GAI-14 was found to be highly resistant to striped stem borer and rice leaf roller, and tolerant to glyphosate. Analysis of T-DNA border sequence suggested that the transgenes were inserted at the chromosome 3 and appeared to have not interrupted any known or putative genes. A field trial observed no significant difference in the basic agronomic traits between GAI-14 and the recipient rice.

  18. Genome-wide functional profiling reveals genes required for tolerance to benzene metabolites in yeast.

    Directory of Open Access Journals (Sweden)

    Matthew North

    Full Text Available Benzene is a ubiquitous environmental contaminant and is widely used in industry. Exposure to benzene causes a number of serious health problems, including blood disorders and leukemia. Benzene undergoes complex metabolism in humans, making mechanistic determination of benzene toxicity difficult. We used a functional genomics approach to identify the genes that modulate the cellular toxicity of three of the phenolic metabolites of benzene, hydroquinone (HQ, catechol (CAT and 1,2,4-benzenetriol (BT, in the model eukaryote Saccharomyces cerevisiae. Benzene metabolites generate oxidative and cytoskeletal stress, and tolerance requires correct regulation of iron homeostasis and the vacuolar ATPase. We have identified a conserved bZIP transcription factor, Yap3p, as important for a HQ-specific response pathway, as well as two genes that encode putative NAD(PH:quinone oxidoreductases, PST2 and YCP4. Many of the yeast genes identified have human orthologs that may modulate human benzene toxicity in a similar manner and could play a role in benzene exposure-related disease.

  19. Use of Heat Stress Responsive Gene Expression Levels for Early Selection of Heat Tolerant Cabbage (Brassica oleracea L.

    Directory of Open Access Journals (Sweden)

    Jun Cheul Ahn

    2013-06-01

    Full Text Available Cabbage is a relatively robust vegetable at low temperatures. However, at high temperatures, cabbage has disadvantages, such as reduced disease tolerance and lower yields. Thus, selection of heat-tolerant cabbage is an important goal in cabbage breeding. Easier or faster selection of superior varieties of cabbage, which are tolerant to heat and disease and have improved taste and quality, can be achieved with molecular and biological methods. We compared heat-responsive gene expression between a heat-tolerant cabbage line (HTCL, “HO”, and a heat-sensitive cabbage line (HSCL, “JK”, by Genechip assay. Expression levels of specific heat stress-related genes were increased in response to high-temperature stress, according to Genechip assays. We performed quantitative RT-PCR (qRT-PCR to compare expression levels of these heat stress-related genes in four HTCLs and four HSCLs. Transcript levels for heat shock protein BoHsp70 and transcription factor BoGRAS (SCL13 were more strongly expressed only in all HTCLs compared to all HSCLs, showing much lower level expressions at the young plant stage under heat stress (HS. Thus, we suggest that expression levels of these genes may be early selection markers for HTCLs in cabbage breeding. In addition, several genes that are involved in the secondary metabolite pathway were differentially regulated in HTCL and HSCL exposed to heat stress.

  20. Over-Expression of ICE1 Gene in Transgenic Rice Improves Cold Tolerance

    Institute of Scientific and Technical Information of China (English)

    XIANG Dian-jun; HU Xiang-yang; ZHANG Yu; YIN Kui-de

    2008-01-01

    ICE1, an Arabidopsis thaliana transcription factor gene, was cloned by RT-PCR and successfully transformed into rice variety Kenjiandao 10 by the Agrobacterium-mediated transformation method. PCR amplification and Southern blot analysis indicated that ICE1 had been integrated into rice genome. Compared with the non-transgenic plants, the transgenic plants exhibited high resistance to hygromycin B and were consistent with the Mendelian inheritance of a single copy of the transgenic ICE1. Under the low temperature stress, the transgenic plants showed the lower mortality rate and the increased proline content. These results suggest that the Arabidopsis ICE1 is functional in rice and the over-expression of ICE1 improves the tolerance to cold stress in rice.

  1. An Ipomoea batatas iron-sulfur cluster scaffold protein gene, IbNFU1, is involved in salt tolerance.

    Directory of Open Access Journals (Sweden)

    Degao Liu

    Full Text Available Iron-sulfur cluster biosynthesis involving the nitrogen fixation (Nif proteins has been proposed as a general mechanism acting in various organisms. NifU-like protein may play an important role in protecting plants against abiotic and biotic stresses. An iron-sulfur cluster scaffold protein gene, IbNFU1, was isolated from a salt-tolerant sweetpotato (Ipomoea batatas (L. Lam. line LM79 in our previous study, but its role in sweetpotato stress tolerance was not investigated. In the present study, the IbNFU1 gene was introduced into a salt-sensitive sweetpotato cv. Lizixiang to characterize its function in salt tolerance. The IbNFU1-overexpressing sweetpotato plants exhibited significantly higher salt tolerance compared with the wild-type. Proline and reduced ascorbate content were significantly increased, whereas malonaldehyde (MDA content was significantly decreased in the transgenic plants. The activities of superoxide dismutase (SOD and photosynthesis were significantly enhanced in the transgenic plants. H2O2 was also found to be significantly less accumulated in the transgenic plants than in the wild-type. Overexpression of IbNFU1 up-regulated pyrroline-5-carboxylate synthase (P5CS and pyrroline-5-carboxylate reductase (P5CR genes under salt stress. The systemic up-regulation of reactive oxygen species (ROS scavenging genes was found in the transgenic plants under salt stress. These findings suggest that IbNFU1gene is involved in sweetpotato salt tolerance and enhances salt tolerance of the transgenic sweetpotato plants by regulating osmotic balance, protecting membrane integrity and photosynthesis and activating ROS scavenging system.

  2. Allele summation of diabetes risk genes predicts impaired glucose tolerance in female and obese individuals.

    Directory of Open Access Journals (Sweden)

    Katarzyna Linder

    Full Text Available INTRODUCTION: Single nucleotide polymorphisms (SNPs in approximately 40 genes have been associated with an increased risk for type 2 diabetes (T2D in genome-wide association studies. It is not known whether a similar genetic impact on the risk of prediabetes (impaired glucose tolerance [IGT] or impaired fasting glycemia [IFG] exists. METHODS: In our cohort of 1442 non-diabetic subjects of European origin (normal glucose tolerance [NGT] n = 1046, isolated IFG n = 142, isolated IGT n = 140, IFG+IGT n = 114, an impact on glucose homeostasis has been shown for 9 SNPs in previous studies in this specific cohort. We analyzed these SNPs (within or in the vicinity of the genes TCF7L2, KCNJ11, HHEX, SLC30A8, WFS1, KCNQ1, MTNR1B, FTO, PPARG for association with prediabetes. RESULTS: The genetic risk load was significantly associated with the risk for IGT (p = 0.0006 in a model including gender, age, BMI and insulin sensitivity. To further evaluate potential confounding effects, we stratified the population on gender, BMI and insulin sensitivity. The association of the risk score with IGT was present in female participants (p = 0.008, but not in male participants. The risk score was significantly associated with IGT (p = 0.008 in subjects with a body mass index higher than 30 kg/m(2 but not in non-obese individuals. Furthermore, only in insulin resistant subjects a significant association between the genetic load and the risk for IGT (p = 0.01 was found. DISCUSSION: We found that T2D genetic risk alleles cause an increased risk for IGT. This effect was not present in male, lean and insulin sensitive subjects, suggesting a protective role of beneficial environmental factors on the genetic risk.

  3. The functions of an apple cytosolic malate dehydrogenase gene in growth and tolerance to cold and salt stresses.

    Science.gov (United States)

    Yao, Yu-Xin; Dong, Qing-Long; Zhai, Heng; You, Chun-Xiang; Hao, Yu-Jin

    2011-03-01

    It is well-known that cytosolic NAD-dependent malate dehydrogenase (cyMDH; l-malate:NAD-oxidoreductase; EC 1.1.1.37) is an enzyme crucial for malic acid synthesis in the cytosol. Nothing is known about cyMDH in growth and stress tolerance. Here we characterised the role of the apple cyMDH gene (MdcyMDH, GenBank ID: DQ221207) in growth and tolerance to cold and salt stresses. MdcyMDH transcripts were highly accumulated in vigorously growing apple tissues, organs and suspension cells. In addition, MdcyMDH was sensitive to cold and salt stresses. MdcyMDH overexpression favourably contributed to cell and plant growth and conferred stress tolerance both in the apple callus and tomato. Taken together, our results indicated that MdcyMDH is involved in plant and cell growth as well as the tolerance to cold and salt stresses.

  4. Integrating QTL mapping and transcriptomics identifies candidate genes underlying QTLs associated with soybean tolerance to low-phosphorus stress.

    Science.gov (United States)

    Zhang, Dan; Zhang, Hengyou; Chu, Shanshan; Li, Hongyan; Chi, Yingjun; Triebwasser-Freese, Daniella; Lv, Haiyan; Yu, Deyue

    2017-01-01

    Soybean is a high phosphorus (P) demand species that is sensitive to low-P stress. Although many quantitative trait loci (QTL) for P efficiency have been identified in soybean, but few of these have been cloned and agriculturally applied mainly due to various limitations on identifying suitable P efficiency candidate genes. Here, we combined QTL mapping, transcriptome profiling, and plant transformation to identify candidate genes underlying QTLs associated with low-P tolerance and response mechanisms to low-P stress in soybean. By performing QTL linkage mapping using 152 recombinant inbred lines (RILs) that were derived from a cross between a P-efficient variety, Nannong 94-156, and P-sensitive Bogao, we identified four major QTLs underlying P efficiency. Within these four QTL regions, 34/81 candidate genes in roots/leaves were identified using comparative transcriptome analysis between two transgressive RILs, low-P tolerant genotype B20 and sensitive B18. A total of 22 phosphatase family genes were up-regulated significantly under low-P condition in B20. Overexpression of an acid phosphatase candidate gene, GmACP2, in soybean hairy roots increased P efficiency by 15.43-24.54 % compared with that in controls. Our results suggest that integrating QTL mapping and transcriptome profiling could be useful for rapidly identifying candidate genes underlying complex traits, and phosphatase-encoding genes, such as GmACP2, play important roles involving in low-P stress tolerance in soybean.

  5. Simultaneous Expression of PDH45 with EPSPS Gene Improves Salinity and Herbicide Tolerance in Transgenic Tobacco Plants

    Science.gov (United States)

    Garg, Bharti; Gill, Sarvajeet S.; Biswas, Dipul K.; Sahoo, Ranjan K.; Kunchge, Nandkumar S.; Tuteja, Renu; Tuteja, Narendra

    2017-01-01

    To cope with the problem of salinity- and weed-induced crop losses, a multi-stress tolerant trait is need of the hour but a combinatorial view of such traits is not yet explored. The overexpression of PDH45 (pea DNA helicase 45) and EPSPS (5-enoylpruvyl shikimate-3-phosphate synthase) genes have been reported to impart salinity and herbicide tolerance. Further, the understanding of mechanism and pathways utilized by PDH45 and EPSPS for salinity and herbicide tolerance will help to improve the crops of economical importance. In the present study, we have performed a comparative analysis of salinity and herbicide tolerance to check the biochemical parameters and antioxidant status of tobacco transgenic plants. Collectively, the results showed that PDH45 overexpressing transgenic lines display efficient tolerance to salinity stress, while PDH45+EPSPS transgenics showed tolerance to both the salinity and herbicide as compared to the control [wild type (WT) and vector control (VC)] plants. The activities of the components of enzymatic antioxidant machinery were observed to be higher in the transgenic plants indicating the presence of an efficient antioxidant defense system which helps to cope with the stress-induced oxidative-damages. Photosynthetic parameters also showed significant increase in PDH45 and PDH45+EPSPS overexpressing transgenic plants in comparison to WT, VC and EPSPS transgenic plants under salinity stress. Furthermore, PDH45 and PDH45+EPSPS synergistically modulate the jasmonic acid and salicylic acid mediated signaling pathways for combating salinity stress. The findings of our study suggest that pyramiding of the PDH45 gene with EPSPS gene renders host plants tolerant to salinity and herbicide by enhancing the antioxidant machinery thus photosynthesis.

  6. Transient B cell depletion or improved transgene expression by codon optimization promote tolerance to factor VIII in gene therapy.

    Directory of Open Access Journals (Sweden)

    Brandon K Sack

    Full Text Available The major complication in the treatment of hemophilia A is the development of neutralizing antibodies (inhibitors against factor VIII (FVIII. The current method for eradicating inhibitors, termed immune tolerance induction (ITI, is costly and protracted. Clinical protocols that prevent rather than treat inhibitors are not yet established. Liver-directed gene therapy hopes to achieve long-term correction of the disease while also inducing immune tolerance. We sought to investigate the use of adeno-associated viral (serotype 8 gene transfer to induce tolerance to human B domain deleted FVIII in hemophilia A mice. We administered an AAV8 vector with either human B domain deleted FVIII or a codon-optimized transgene, both under a liver-specific promoter to two strains of hemophilia A mice. Protein therapy or gene therapy was given either alone or in conjunction with anti-CD20 antibody-mediated B cell depletion. Gene therapy with a low-expressing vector resulted in sustained near-therapeutic expression. However, supplementary protein therapy revealed that gene transfer had sensitized mice to hFVIII in a high-responder strain but not in mice of a low-responding strain. This heightened response was ameliorated when gene therapy was delivered with anti-murine CD20 treatment. Transient B cell depletion prevented inhibitor formation in protein therapy, but failed to achieve a sustained hypo-responsiveness. Importantly, use of a codon-optimized hFVIII transgene resulted in sustained therapeutic expression and tolerance without a need for B cell depletion. Therefore, anti-CD20 may be beneficial in preventing vector-induced immune priming to FVIII, but higher levels of liver-restricted expression are preferred for tolerance.

  7. De novo assembly and discovery of genes that are involved in drought tolerance in Tibetan Sophora moorcroftiana.

    Directory of Open Access Journals (Sweden)

    Huie Li

    Full Text Available Sophora moorcroftiana, a Leguminosae shrub species that is restricted to the arid and semi-arid regions of the Qinghai-Tibet Plateau, is an ecologically important foundation species and exhibits substantial drought tolerance in the Plateau. There are no functional genomics resources in public databases for understanding the molecular mechanism underlying the drought tolerance of S. moorcroftiana. Therefore, we performed a large-scale transcriptome sequencing of this species under drought stress using the Illumina sequencing technology. A total of 62,348,602 clean reads were obtained. The assembly of the clean reads resulted in 146,943 transcripts, including 66,026 unigenes. In the assembled sequences, 1534 transcription factors were identified and classified into 23 different common families, and 9040 SSR loci, from di- to hexa-nucleotides, whose repeat number is greater than five, were presented. In addition, we performed a gene expression profiling analysis upon dehydration treatment. The results indicated significant differences in the gene expression profiles among the control, mild stress and severe stress. In total, 4687, 5648 and 5735 genes were identified from the comparison of mild versus control, severe versus control and severe versus mild stress, respectively. Based on the differentially expressed genes, a Gene Ontology annotation analysis indicated many dehydration-relevant categories, including 'response to water 'stimulus' and 'response to water deprivation'. Meanwhile, the Kyoto Encyclopedia of Genes and Genomes pathway analysis uncovered some important pathways, such as 'metabolic pathways' and 'plant hormone signal transduction'. In addition, the expression patterns of 25 putative genes that are involved in drought tolerance resulting from quantitative real-time PCR were consistent with their transcript abundance changes as identified by RNA-seq. The globally sequenced genes covered a considerable proportion of the S

  8. De novo assembly and discovery of genes that are involved in drought tolerance in Tibetan Sophora moorcroftiana.

    Science.gov (United States)

    Li, Huie; Yao, Weijie; Fu, Yaru; Li, Shaoke; Guo, Qiqiang

    2015-01-01

    Sophora moorcroftiana, a Leguminosae shrub species that is restricted to the arid and semi-arid regions of the Qinghai-Tibet Plateau, is an ecologically important foundation species and exhibits substantial drought tolerance in the Plateau. There are no functional genomics resources in public databases for understanding the molecular mechanism underlying the drought tolerance of S. moorcroftiana. Therefore, we performed a large-scale transcriptome sequencing of this species under drought stress using the Illumina sequencing technology. A total of 62,348,602 clean reads were obtained. The assembly of the clean reads resulted in 146,943 transcripts, including 66,026 unigenes. In the assembled sequences, 1534 transcription factors were identified and classified into 23 different common families, and 9040 SSR loci, from di- to hexa-nucleotides, whose repeat number is greater than five, were presented. In addition, we performed a gene expression profiling analysis upon dehydration treatment. The results indicated significant differences in the gene expression profiles among the control, mild stress and severe stress. In total, 4687, 5648 and 5735 genes were identified from the comparison of mild versus control, severe versus control and severe versus mild stress, respectively. Based on the differentially expressed genes, a Gene Ontology annotation analysis indicated many dehydration-relevant categories, including 'response to water 'stimulus' and 'response to water deprivation'. Meanwhile, the Kyoto Encyclopedia of Genes and Genomes pathway analysis uncovered some important pathways, such as 'metabolic pathways' and 'plant hormone signal transduction'. In addition, the expression patterns of 25 putative genes that are involved in drought tolerance resulting from quantitative real-time PCR were consistent with their transcript abundance changes as identified by RNA-seq. The globally sequenced genes covered a considerable proportion of the S. moorcroftiana transcriptome

  9. bHLH106 Integrates Functions of Multiple Genes through Their G-Box to Confer Salt Tolerance on Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Aftab Ahmad

    Full Text Available An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8 as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'. The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.

  10. The Metallothionein Gene, TaMT3, from Tamarix androssowii Confers Cd2+ Tolerance in Tobacco

    Directory of Open Access Journals (Sweden)

    Boru Zhou

    2014-06-01

    Full Text Available Cadmium (Cd is a nonessential microelement and low concentration Cd2+ has strong toxicity to plant growth. Plant metallothioneins, a class of low molecular, cystein(Cys-rich and heavy-metal binding proteins, play an important role in both metal chaperoning and scavenging of reactive oxygen species (ROS with their large number of cysteine residues and therefore, protect plants from oxidative damage. In this study, a metallothionein gene, TaMT3, isolated from Tamarix androssowii was transformed into tobacco (Nicotiana tobacum through Agrobacterium-mediated leaf disc method, and correctly expressed under the control of 35S promoter. Under Cd2+ stress, the transgenic tobacco showed significant increases of superoxide dismutase (SOD activity and chlorophyll concentration, but decreases of peroxidase (POD activity and malondialdehyde (MDA accumulation when compared to the non-transgenic tobacco. Vigorous growth of transgenic tobacco was observed at the early development stages, resulting in plant height and fresh weight were significantly larger than those of the non-transgenic tobacco under Cd2+ stress. These results demonstrated that the expression of the exogenous TaMT3 gene increased the ability of ROS cleaning-up, indicating a stronger tolerance to Cd2+ stress.

  11. The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms

    DEFF Research Database (Denmark)

    Nilsson, Carl Martin Peter; Rybtke, Morten; Givskov, Michael;

    2016-01-01

    Microbial biofilms are tolerant to antibiotic treatment and therefore cause problematic infections. Knowledge about the molecular mechanisms underlying biofilm-associated antimicrobial tolerance will aid the development of antibiofilm drugs. Screening of a Streptococcus mutans transposon mutant...

  12. Overexpression of WsSGTL1 gene of Withania somnifera enhances salt tolerance, heat tolerance and cold acclimation ability in transgenic Arabidopsis plants.

    Directory of Open Access Journals (Sweden)

    Manoj K Mishra

    Full Text Available BACKGROUND: Sterol glycosyltrnasferases (SGT are enzymes that glycosylate sterols which play important role in plant adaptation to stress and are medicinally important in plants like Withania somnifera. The present study aims to find the role of WsSGTL1 which is a sterol glycosyltransferase from W. somnifera, in plant's adaptation to abiotic stress. METHODOLOGY: The WsSGTL1 gene was transformed in Arabidopsis thaliana through Agrobacterium mediated transformation, using the binary vector pBI121, by floral dip method. The phenotypic and physiological parameters like germination, root length, shoot weight, relative electrolyte conductivity, MDA content, SOD levels, relative electrolyte leakage and chlorophyll measurements were compared between transgenic and wild type Arabidopsis plants under different abiotic stresses--salt, heat and cold. Biochemical analysis was done by HPLC-TLC and radiolabelled enzyme assay. The promoter of the WsSGTL1 gene was cloned by using Genome Walker kit (Clontech, USA and the 3D structures were predicted by using Discovery Studio Ver. 2.5. RESULTS: The WsSGTL1 transgenic plants were confirmed to be single copy by Southern and homozygous by segregation analysis. As compared to WT, the transgenic plants showed better germination, salt tolerance, heat and cold tolerance. The level of the transgene WsSGTL1 was elevated in heat, cold and salt stress along with other marker genes such as HSP70, HSP90, RD29, SOS3 and LEA4-5. Biochemical analysis showed the formation of sterol glycosides and increase in enzyme activity. When the promoter of WsSGTL1 gene was cloned from W. somnifera and sequenced, it contained stress responsive elements. Bioinformatics analysis of the 3D structure of the WsSGTL1 protein showed functional similarity with sterol glycosyltransferase AtSGT of A. thaliana. CONCLUSIONS: Transformation of WsSGTL1 gene in A. thaliana conferred abiotic stress tolerance. The promoter of the gene in W.somnifera was found

  13. Screening of genes involved in isooctane tolerance in Saccharomyces cerevisiae by using mRNA differential display.

    Science.gov (United States)

    Miura, S; Zou, W; Ueda, M; Tanaka, A

    2000-11-01

    A Saccharomyces cerevisiae strain, KK-211, isolated by the long-term bioprocess of stereoselective reduction in isooctane, showed extremely high tolerance to the solvent, which is toxic to yeast cells, but, in comparison with its wild-type parent, DY-1, showed low tolerance to hydrophilic organic solvents, such as dimethyl sulfoxide and ethanol. In order to detect the isooctane tolerance-associated genes, mRNA differential display (DD) was employed using mRNAs isolated from strains DY-1 and KK-211 cultivated without isooctane, and from strain KK-211 cultivated with isooctane. Thirty genes were identified as being differentially expressed in these three types of cells and were classified into three groups according to their expression patterns. These patterns were further confirmed and quantified by Northern blot analysis. On the DD fingerprints, the expression of 14 genes, including MUQ1, PRY2, HAC1, AGT1, GAC1, and ICT1 (YLR099c) was induced, while the expression of the remaining 16 genes, including JEN1, PRY1, PRY3, and KRE1, was decreased, in strain KK-211 cultivated with isooctane. The genes represented by HAC1, PRY1, and ICT1 have been reported to be associated with cell stress, and AGT1 and GAC1 have been reported to be involved in the uptake of trehalose and the production of glycogen, respectively. MUQ1 and KRE1, encoding proteins associated with cell surface maintenance, were also detected. Based on these results, we concluded that alteration of expression levels of multiple genes, not of a single gene, might be the critical determinant for isooctane tolerance in strain KK-211.

  14. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    Directory of Open Access Journals (Sweden)

    Yu Agnes

    2008-12-01

    Full Text Available Abstract Background Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying potential targets for plant breeding. Drought tolerance in the field was successfully conferred to crops by transferring genes from this model species. While involved in a plant genomics programme, which aims to identify new genes responsible for plant response to abiotic stress, we identified ESKIMO1 as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE, which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis of one mutant line and its wild-type background was carried out. Under control watering conditions a number of genes were differentially expressed between the mutant and the wild type whereas under mild drought stress this list of genes was reduced. Among the genes that were differentially expressed between the wild type and mutant, two functional categories related to the response to stress or biotic and abiotic stimulus were over-represented. Under salt stress conditions, all gene functional categories were represented equally in both the mutant and wild type. Based on this transcriptome analysis we hypothesise that in control conditions the esk1 mutant behaves as if it was exposed to drought stress. Conclusion Overall our findings suggest that the

  15. Gene expression and functional analyses in brassinosteroid-mediated stress tolerance.

    Science.gov (United States)

    Divi, Uday K; Rahman, Tawhidur; Krishna, Priti

    2016-01-01

    The plant hormone brassinosteroid (BR) plays essential roles in plant growth and development, while also controlling plant stress responses. This dual ability of BR is intriguing from a mechanistic point of view and as a viable solution for stabilizing crop yields under the changing climatic conditions. Here we report a time course analysis of BR responses under both stress and no-stress conditions, the results of which establish that BR incorporates many stress-related features even under no-stress conditions, which are then accompanied by a dynamic stress response under unfavourable conditions. Found within the BR transcriptome were distinct molecular signatures of two stress hormones, abscisic acid and jasmonic acid, which were correlated with enhanced endogenous levels of the two hormones in BR-treated seedlings. The marked presence of genes related to protein metabolism and modification, defence responses and calcium signalling highlights the significance of their associated mechanisms and roles in BR processes. Functional analysis of loss-of-function mutants of a subset of genes selected from the BR transcriptome identified abiotic stress-related roles for ACID PHOSPHATASE5 (ACP5), WRKY33, JACALIN-RELATED LECTIN1-3 (JAC-LEC1-3) and a BR-RESPONSIVE-RECEPTOR-LIKE KINASE (BRRLK). Overall, the results of this study provide a clear link between the molecular changes impacted by BR and its ability to confer broad-range stress tolerance, emphasize the importance of post-translational modification and protein turnover as BR regulatory mechanisms and demonstrate the BR transcriptome as a repertoire of new stress-related regulatory and structural genes.

  16. A single gene all3940 (Dps) overexpression in Anabaena sp. PCC 7120 confers multiple abiotic stress tolerance via proteomic alterations.

    Science.gov (United States)

    Narayan, Om Prakash; Kumari, Nidhi; Bhargava, Poonam; Rajaram, Hema; Rai, Lal Chand

    2016-01-01

    DNA-binding proteins (Dps) induced during starvation play an important role in gene regulation and maintaining homeostasis in bacteria. The nitrogen-fixing cyanobacterium, Anabaena PCC7120, has four genes annotated as coding for Dps; however, the information on their physiological roles is limiting. One of the genes coding for Dps, 'all3940' was found to be induced under different abiotic stresses in Anabaena and upon overexpression enhanced the tolerance of Anabaena to a multitude of stresses, which included salinity, heat, heavy metals, pesticide, and nutrient starvation. On the other hand, mutation in the gene resulted in decreased growth of Anabaena. The modulation in the levels of All3940 in Anabaena, achieved either by overexpression of the protein or mutation of the gene, resulted in changes in the proteome, which correlated well with the physiological changes observed. Proteins required for varied physiological activities, such as photosynthesis, carbon-metabolism, oxidative stress alleviation, exhibited change in protein profile upon modulation of All3940 levels in Anabaena. This suggested a direct or an indirect effect of All3940 on the expression of the above stress-responsive proteins, thereby enhancing tolerance in Anabaena PCC7120. Thus, All3940, though categorized as a Dps, is possibly a general stress protein having a global role in regulating tolerance to multitude of stresses in Anabaena.

  17. De Novo Transcriptome Sequencing of Desert Herbaceous Achnatherum splendens (Achnatherum Seedlings and Identification of Salt Tolerance Genes

    Directory of Open Access Journals (Sweden)

    Jiangtao Liu

    2016-03-01

    Full Text Available Achnatherum splendens is an important forage herb in Northwestern China. It has a high tolerance to salinity and is, thus, considered one of the most important constructive plants in saline and alkaline areas of land in Northwest China. However, the mechanisms of salt stress tolerance in A. splendens remain unknown. Next-generation sequencing (NGS technologies can be used for global gene expression profiling. In this study, we examined sequence and transcript abundance data for the root/leaf transcriptome of A. splendens obtained using an Illumina HiSeq 2500. Over 35 million clean reads were obtained from the leaf and root libraries. All of the RNA sequencing (RNA-seq reads were assembled de novo into a total of 126,235 unigenes and 36,511 coding DNA sequences (CDS. We further identified 1663 differentially-expressed genes (DEGs between the salt stress treatment and control. Functional annotation of the DEGs by gene ontology (GO, using Arabidopsis and rice as references, revealed enrichment of salt stress-related GO categories, including “oxidation reduction”, “transcription factor activity”, and “ion channel transporter”. Thus, this global transcriptome analysis of A. splendens has provided an important genetic resource for the study of salt tolerance in this halophyte. The identified sequences and their putative functional data will facilitate future investigations of the tolerance of Achnatherum species to various types of abiotic stress.

  18. Phosphate-induced-1 gene from Eucalyptus (EgPHI-1) enhances osmotic stress tolerance in transgenic tobacco.

    Science.gov (United States)

    Sousa, A O; Assis, E T C M; Pirovani, C P; Alvim, F C; Costa, M G C

    2014-03-12

    Environmental stresses such as drought, freezing, and high salinity induce osmotic stress in plant cells. The plant response to osmotic stress involves a number of physiological and developmental changes, which are made possible, in part, by the modulation of the expression of specific genes. Phosphate-induced-1 gene (PHI-1) was first isolated from phosphate-treated phosphate-starved tobacco cell cultures as a stress-inducible gene, which is presumably related to intracellular pH maintenance; however, the role of the PHI-1 gene product has not yet been clarified. A gene encoding a predicted protein with high similarity to tobacco PHI-1, named EgPHI-1, was previously identified in Eucalyptus by comparative transcriptome analysis of xylem cells from species of contrasting phenotypes for wood quality and growth traits. Here, we show that the overexpression of EgPHI-1 in transgenic tobacco enhances tolerance to osmotic stress. In comparison with wild-type plants, EgPHI-1 transgenic plants showed a significant increase in root length and biomass dry weight under NaCl-, polyethylene glycol, and mannitol-induced osmotic stresses. The enhanced stress tolerance of transgenic plants was correlated with increased endogenous protein levels of the molecular chaperone binding protein BiP, which in turn was correlated with the EgPHI-1 expression level in the different transgenic lines. These results provide evidence about the involvement of EgPHI-1 in osmotic stress tolerance via modulation of BiP expression, and pave the way for its future use as a candidate gene for engineering tolerance to environmental stresses in crop plants.

  19. Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi [Plant Bioengineering Laboratory, Northeast Agricultural University, Harbin 150030 (China); Deyholos, Michael K. [Department of Biological Sciences, University of Alberta, Edmonton, Canada T6G 2E9 (Canada); Chen, Qin [Lethbridge Research Centre, Agriculture and Agri-Food Canada, 5403-1 Ave., South P.O. Box 3000, Lethbridge, AB, Canada T1J 4B1 (Canada); Chen, Chao; Ji, Wei [Plant Bioengineering Laboratory, Northeast Agricultural University, Harbin 150030 (China); Zhu, Yanming, E-mail: ymzhu@neau.edu.cn [Plant Bioengineering Laboratory, Northeast Agricultural University, Harbin 150030 (China)

    2012-09-21

    Highlights: Black-Right-Pointing-Pointer We isolated and characterized a novel JAZ family gene, GsJAZ2, from Glycine soja. Black-Right-Pointing-Pointer Overexpression of GsJAZ2 enhanced plant tolerance to salt and alkali stress. Black-Right-Pointing-Pointer The transcriptions of stress marker genes were higher in GsJAZ2 overexpression lines. Black-Right-Pointing-Pointer GsJAZ2 was localized to nucleus. -- Abstract: Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.

  20. [Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

    Science.gov (United States)

    Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

    2014-04-01

    Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

  1. Cloning and expression pattern of a dehydrin-like BDN1 gene from drought-tolerant Boea crassifolia Hemsl.

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A 500-bp cDNA fragment was amplified via RT-PCR from drought-induced total RNA of the drought-tolerant B. crassifolia Hemsl. using primers based on the sequence of published dehydrin conserved region. By using 5′RACE, full-length coding region (1 148 bp) of BDN1 gene was produced. It is a new member of the dehydrin gene family. Southern analysis indicated that BDN1 is present in the B. crassifolia genome as a single-copy gene. Northern analysis revealed that its expression is inducible by drought and cold stresses as well as ABA application.

  2. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    Science.gov (United States)

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast.

  3. Over-expression of histone H3K4 demethylase gene JMJ15 enhances salt tolerance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Yuan eShen

    2014-06-01

    Full Text Available Histone H3 lysine 4 trimethylation (H3K4me3 has been shown to be involved in stress-responsive gene expression and gene priming in plants. However, the role of H3K4me3 resetting in the processes is not clear. In this work we studied the expression and function of Arabidopsis H3K4 demethylase gene JMJ15. We show that the expression of JMJ15 was relatively low and was limited to a number of tissues during vegetative growth but was higher in young floral organs. Over-expression of the gene in gain-of-function mutants reduced the plant height with accumulation of lignin in stems, while the loss-of-function mutation did not produce any visible phenotype. The gain-of-function mutants showed enhanced salt tolerance, whereas the loss-of-function mutant was more sensitive to salt compared to the wild type. Transcriptomic analysis revealed that over-expression of JMJ15 down-regulated many genes which are preferentially marked by H3K4me3 and H3K4me2. Many of the down-regulated genes encode transcription regulators involved in stress responses. The data suggest that increased JMJ15 levels may regulate the gene expression program that enhances stress tolerance.

  4. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    DEFF Research Database (Denmark)

    Bouchabke-Coussa, O.; Quashie, M.L.; Seoane, Jose Miguel;

    2008-01-01

    Background: Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying p...... to elucidate the function of the ESKIMO1 protein and the way it modulates plant water uptake.......Background: Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying...... as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results: All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant...

  5. Novel SNPs in HSPB8 gene and their association with heat tolerance traits in Sahiwal indigenous cattle.

    Science.gov (United States)

    Verma, Nishant; Gupta, Ishwar Dayal; Verma, Archana; Kumar, Rakesh; Das, Ramendra; Vineeth, M R

    2016-01-01

    Heat shock proteins (HSPs) are expressed in response to heat stress, and the polymorphism in HSP genes at single-nucleotide level has been reported to be associated with heat tolerance and production performance traits in cattle. HSPB8 gene has been mapped on Bos taurus autosome 17 (BTA-17) spanning nearly 13,252 bp and comprising three exons and two introns. The present study was conducted in Sahiwal cows (n = 108) reared in subtropical climate with the objectives to identify SNPs in all three exons and part of intron 1 of HSPB8 gene and to analyze their association with heat tolerance traits in Sahiwal cows. Respiration rate (RR) and rectal temperature (RT) were recorded once during probable extreme hours in different seasons or Temperature-Humidity Index (THI), i.e., winter, spring, and summer. Heat tolerance coefficient (HTC) was also calculated to check the adaptability of the animals during the period of heat stress. The comparative sequence analysis revealed a total two single-nucleotide polymorphisms (SNPs), i.e., g.507G>A in exon 1 and g.881T>C in intron 1 of HSPB8 gene. Out of these two identified SNPs, only one SNP, i.e., g.507G>A, was found to be significantly associated with heat tolerance indicator traits (RR, RT, and HTC) in Sahiwal cows. The perusal of results across different seasons showed the significant (P A SNP of HSPB8 gene. However, in case of another SNP, i.e., g.881T>C, located on intron 1, the RR, RT, and HTC were having non-significant association with the different genotypes, i.e., TT and TC. These findings may partly suggest that GA genotype of SNP g.507G>A of HSPB8 gene has a probable role in heat tolerance in Sahiwal cattle and can therefore be utilized as a marker in propagation of thermo-tolerance cattle in hot tropical and subtropical climate. Nevertheless, the involvement of other regulatory mechanisms cannot be overruled.

  6. Overexpression of the Maize psbA Gene Enhances Drought Tolerance Through Regulating Antioxidant System, Photosynthetic Capability, and Stress Defense Gene Expression in Tobacco

    OpenAIRE

    2016-01-01

    The psbA (encoding D1 protein) plays an important role in protecting photosystem II (PSII) from oxidative damage in higher plants. In our previous study, the role of the psbA from maize (Zea mays. L) in response to SO2 stress was characterized. To date, information about the involvement of the psbA gene in drought response is scarce. Here we found that overexpression (OE) of ZmpsbA showed increased D1 protein abundance and enhanced drought stress tolerance in tobacco. The drought-tolerant phe...

  7. Novel Type Ⅱ Peroxiredoxin Gene Homologue from Chinese Wildrye Enhancing Salt Stress Tolerance of Transgenic Yeast

    Institute of Scientific and Technical Information of China (English)

    YU Ying; LIU Xiang-guo; LU Yang; DOU Yao; WANG Hu-yi; HAN Si-ping; FENG Shu-dan; HAO Dong-yun

    2011-01-01

    Peroxiredoxins(Prxs)are a large family of antioxidant enzymes of various types that take part in signal transduction via decomposing reactive oxygen species(ROS).Although extensive efforts have been made over the last decades in understanding the structures and functions of Prxs,type Ⅱ Prxs in monocots are hardly studied.In this work,a monocot type Ⅱ Prx gene homologue from Chinese wildrye(Leymus Chinensis),designated as LcTpxⅡ,was isolated and characterized.LcTpxⅡ encoding a 162-amino acid protein contains a thioredoxin domain and a cysteine residue at position 51,suggesting that it is a member of the Prxs family.The LcTpxⅡ is capable of decomposing H2O2 and protecting plasmid DNA from damage caused by ROS.The expression of LcTpxⅡ in Chinese wildrye was induced by 400 mmol/L NaCl and 100 mmol/L Na2CO3 in the experiment.The overexpression of LcTpxⅡ enhances the tolerance of transgenic yeast to 1.6 mol/L NaCl and 10 mmol/L Na2CO3.

  8. Purine biosynthetic genes are required for cadmium tolerance in Schizosaccharomyces pombe

    Energy Technology Data Exchange (ETDEWEB)

    Speiser, D.M.; Ortiz, D.F.; Kreppel, L.; Scheel, G.; McDonald, G.; Ow, D.W. (Dept. of Agriculture, Albany, CA (United States) Univ. of California, Berkeley (United States))

    1992-12-01

    Phytochelatins (PCs) are metal-chelating peptides produced in plants and some fungi in response to heavy metal exposure. A Cd-sensitive mutant of the fission yeast Schizosaccharomyces pombe, defective in production of a PC-Cd-sulfide complex essential for metal tolerance, was found to harbor mutations in specific genes of the purine biosynthetic pathway. Genetic analysis of the link between metal complex accumulation and purine biosynthesis enzymes revealed that genetic lesions blocking two segments of the pathway, before and after the IMP branchpoint, are required to produce the Cd-sensitive phenotype. The biochemical functions of these two segments of the pathway are similar, and a model based on the alternate use of a sulfur analog substrate is presented. The novel participation of purine biosynthesis enzymes in the conversion of the PC-Cd complex to the PC-Cd-sulfide complex in the fission yeast raises an intriguing possibility that these same enzymes might have a role in sulfur metabolism in the fission yeast S. pombe, and perhaps in other biological systems. 41 refs., 8 figs., 2 tabs.

  9. Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance.

    Science.gov (United States)

    Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming

    2012-09-21

    Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.

  10. Transformation of tomato with a bacterial codA gene enhances tolerance to salt and water stresses.

    Science.gov (United States)

    Goel, Deepa; Singh, Ajay K; Yadav, Vichita; Babbar, Shashi B; Murata, Norio; Bansal, Kailash C

    2011-07-15

    Genetically engineered tomato (Lycopersicon esculentum) with the ability to synthesize glycinebetaine was generated by introducing the codA gene encoding choline oxidase from Arthrobacter globiformis. Integration of the codA gene in transgenic tomato plants was verified by PCR analysis and DNA blot hybridization. Transgenic expression of gene was verified by RT-PCR analysis and RNA blot hybridization. The codA-transgenic plants showed higher tolerance to salt stress during seed germination, and subsequent growth of young seedlings than wild-type plants. The codA transgene enhanced the salt tolerance of whole plants and leaves. Mature leaves of codA-transgenic plants revealed higher levels of relative water content, chlorophyll content, and proline content than those of wild-type plants under salt and water stresses. Results from the current study suggest that the expression of the codA gene in transgenic tomato plants induces the synthesis of glycinebetaine and improves the tolerance of plants to salt and water stresses.

  11. ATHB17 enhances stress tolerance by coordinating photosynthesis associated nuclear gene and ATSIG5 expression in response to abiotic stress

    Science.gov (United States)

    Zhao, Ping; Cui, Rong; Xu, Ping; Wu, Jie; Mao, Jie-Li; Chen, Yu; Zhou, Cong-Zhao; Yu, Lin-Hui; Xiang, Cheng-Bin

    2017-01-01

    Photosynthesis is sensitive to environmental stress and must be efficiently modulated in response to abiotic stress. However, the underlying mechanisms are not well understood. Here we report that ARABIDOPSIS THALIANA HOMEOBOX 17 (ATHB17), an Arabidopsis HD-Zip transcription factor, regulated the expression of a number of photosynthesis associated nuclear genes (PhANGs) involved in the light reaction and ATSIG5 in response to abiotic stress. ATHB17 was responsive to ABA and multiple stress treatments. ATHB17-overexpressing plants displayed enhanced stress tolerance, whereas its knockout mutant was more sensitive compared to the wild type. Through RNA-seq and quantitative real-time reverse transcription PCR (qRT-PCR) analysis, we found that ATHB17 did not affect the expression of many known stress-responsive marker genes. Interestingly, we found that ATHB17 down-regulated many PhANGs and could directly modulate the expression of several PhANGs by binding to their promoters. Moreover, we identified ATSIG5, encoding a plastid sigma factor, as one of the target genes of ATHB17. Loss of ATSIG5 reduced salt tolerance while overexpression of ATSIG5 enhanced salt tolerance, similar to that of ATHB17. ATHB17 can positively modulate the expression of many plastid encoded genes (PEGs) through regulation of ATSIG5. Taken together, our results suggest that ATHB17 may play an important role in protecting plants by adjusting expression of PhANGs and PEGs in response to abiotic stresses. PMID:28358040

  12. Transgenic tobacco plants overexpressing a grass PpEXP1 gene exhibit enhanced tolerance to heat stress.

    Directory of Open Access Journals (Sweden)

    Qian Xu

    Full Text Available Heat stress is a detrimental abiotic stress limiting the growth of many plant species and is associated with various cellular and physiological damages. Expansins are a family of proteins which are known to play roles in regulating cell wall elongation and expansion, as well as other growth and developmental processes. The in vitro roles of expansins regulating plant heat tolerance are not well understood. The objectives of this study were to isolate and clone an expansin gene in a perennial grass species (Poa pratensis and to determine whether over-expression of expansin may improve plant heat tolerance. Tobacco (Nicotiana tabacum was used as the model plant for gene transformation and an expansin gene PpEXP1 from Poa pratensis was cloned. Sequence analysis showed PpEXP1 belonged to α-expansins and was closely related to two expansin genes in other perennial grass species (Festuca pratensis and Agrostis stolonifera as well as Triticum aestivum, Oryza sativa, and Brachypodium distachyon. Transgenic tobacco plants over-expressing PpEXP1 were generated through Agrobacterium-mediated transformation. Under heat stress (42°C in growth chambers, transgenic tobacco plants over-expressing the PpEXP1 gene exhibited a less structural damage to cells, lower electrolyte leakage, lower levels of membrane lipid peroxidation, and lower content of hydrogen peroxide, as well as higher chlorophyll content, net photosynthetic rate, relative water content, activity of antioxidant enzyme, and seed germination rates, compared to the wild-type plants. These results demonstrated the positive roles of PpEXP1 in enhancing plant tolerance to heat stress and the possibility of using expansins for genetic modification of cool-season perennial grasses in the development of heat-tolerant germplasm and cultivars.

  13. Comparative study of SOS2 and a novel PMP3-1 gene expression in two sunflower (Helianthus annuus L.) lines differing in salt tolerance.

    Science.gov (United States)

    Saadia, Mubshara; Jamil, Amer; Ashraf, Muhammad; Akram, Nudrat Aisha

    2013-06-01

    Gene expression pattern of two important regulatory proteins, salt overly sensitive 2 (SOS2) and plasma membrane protein 3-1 (PMP3-1), involved in ion homeostasis, was analyzed in two salinity-contrasting sunflower (Helianthus annuus L.) lines, Hysun-38 (salt tolerant) and S-278 (moderately salt tolerant). The pattern was studied at selected time intervals (24 h) under 150 mM NaCl treatment. Using reverse transcription PCR, SOS2 gene fragment was obtained from young leaf and root tissues of opposing lines while that for PMP3-1 was obtained only from young root tissues. Both tolerant and moderately tolerant lines showed a gradual increase in SOS2 expression in sunflower root tissues. Leaf tissues showed the gradually increasing pattern of SOS2 expression in tolerant plants as compared to that for moderately tolerant ones that showed a relatively lower level of expression for this gene. We found the highest level of PMP 3-1 expression in the roots of tolerant sunflower line at 6 and 12 h postsalinity treatment. The moderately tolerant line showed higher expression of PMP3-1 at 12 and 24 h after salt treatment. Overall, the expression of genes for both the regulator proteins varied significantly in the two sunflower lines differing in salinity tolerance.

  14. Evaluation of potential candidate genes involved in salinity tolerance in striped catfish (Pangasianodon hypophthalmus) using an RNA-Seq approach.

    Science.gov (United States)

    Nguyen, Tuan Viet; Jung, Hyungtaek; Nguyen, Thanh Minh; Hurwood, David; Mather, Peter

    2016-02-01

    Increasing salinity levels in freshwater and coastal environments caused by sea level rise linked to climate change is now recognized to be a major factor that can impact fish growth negatively, especially for freshwater teleost species. Striped catfish (Pangasianodon hypophthalmus) is an important freshwater teleost that is now widely farmed across the Mekong River Delta in Vietnam. Understanding the basis for tolerance and adaptation to raised environmental salinity conditions can assist the regional culture industry to mitigate predicted impacts of climate change across this region. Attempt of next generation sequencing using the ion proton platform results in more than 174 million raw reads from three tissue libraries (gill, kidney and intestine). Reads were filtered and de novo assembled using a variety of assemblers and then clustered together to generate a combined reference transcriptome. Downstream analysis resulted in a final reference transcriptome that contained 60,585 transcripts with an N50 of 683 bp. This resource was further annotated using a variety of bioinformatics databases, followed by differential gene expression analysis that resulted in 3062 transcripts that were differentially expressed in catfish samples raised under two experimental conditions (0 and 15 ppt). A number of transcripts with a potential role in salinity tolerance were then classified into six different functional gene categories based on their gene ontology assignments. These included; energy metabolism, ion transportation, detoxification, signal transduction, structural organization and detoxification. Finally, we combined the data on functional salinity tolerance genes into a hypothetical schematic model that attempted to describe potential relationships and interactions among target genes to explain the molecular pathways that control adaptive salinity responses in P. hypophthalmus. Our results indicate that P. hypophthalmus exhibit predictable plastic regulatory responses

  15. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  16. Expression responses of five cold tolerant related genes to two temperature dropping treatments in sea cucumber Apostichopus japonicus

    Science.gov (United States)

    Li, Chengze; Chang, Yaqing; Pang, Zhenguo; Ding, Jun; Ji, Nanjing

    2015-03-01

    Environmental conditions, including ambient temperature, play important roles in survival, growth development, and reproduction of the Japanese sea cucumber, Apostichopus japonicus. Low temperatures result in slowed growth and skin ulceration disease. In a previous study, we investigated the effect of low temperature on gene expression profiles in A. japonicus by suppression subtractive hybridization (SSH). Genes encoding Ferritin, Lysozyme, Hsp70, gp96, and AjToll were selected from a subtracted cDNA library of A. japonicus under acute cold stress. The transcriptional expression profiles of these genes were investigated in different tissues (coelomocyte, respiratory tree, intestine, longitudinal muscle) after exposure to acute and mild temperature dropping treatments. The results show that (1) the five cold-tolerance-related genes were found in all four tissues and the highest mRNA levels were observed in coelomocyte and respiratory tree; (2) under the temperature dropping treatments, three types of transcriptional regulation patterns were observed: primary suppression followed by up-regulation at -2°C, suppressed expression throughout the two treatments, and more rarely an initial stimulation followed by suppression; and (3) gene expression suppression was more severe under acute temperature dropping than under mild temperature dropping treatment. The five cold-tolerance-related genes that were distributed mainly in coelomocyte and respiratory tissues were generally down-regulated by low temperature stress but an inverse up-regulation event was found at the extreme temperature (-2°C).

  17. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions.

  18. Crescimento radicular e produção de ácidos orgânicos em cultivares de soja com diferentes tolerâncias ao alumínio Root growth and production of organic acids by soybean cultivars with different tolerance to aluminum

    Directory of Open Access Journals (Sweden)

    Orival Gastão Menosso

    2001-11-01

    Full Text Available A elucidação dos mecanismos que definem o comportamento diferencial entre genótipos de soja quanto à toxidez de Al facilita a utilização da variabilidade genética existente ou produzida. O objetivo deste trabalho foi avaliar a influência do Al no crescimento radicular, na modificação do pH da solução e no conteúdo de ácidos orgânicos em extratos de raízes de cultivares de soja tolerantes ao Al, FT-1 e FT-6 (Veneza e sensíveis, IAC-13 e Paraná. As plantas cresceram por nove dias em solução contendo 50 mg L-1 de Ca e 0,0 e 0,2 mg L-1 de Al, com pH inicial de 4,76. Houve maior crescimento de raízes nas cultivares tolerantes e não houve alterações do pH da solução relacionadas à tolerância das cultivares ao alumínio. A presença do Al reduziu o conteúdo dos ácidos cítrico, lático, succínico, oxálico e málico, em ambos os grupos de cultivares avaliados, porém com maior redução no grupo das cultivares sensíveis. O ácido cítrico foi encontrado em maior quantidade nas cultivares tolerantes. A capacidade das cultivares de soja FT-1 e FT-6 (Veneza de alterar o conteúdo de ácidos orgânicos não-voláteis, principalmente o ácido cítrico, que pode complexar o Al, indica que este mecanismo pode ser muito importante para a tolerância a esse elemento.The understanding of the mechanisms for the differential performance of soybean genotypes in relation to Al toxicity is important to explore the existing or produced genetic variability. The objective of this study was to determine the Al influence on root growth, solution pH modifications and organic acid content in root extracts of Al tolerant, FT-1 and FT-6 (Veneza and sensitive, IAC-13 and Paraná, soybean cultivars. Plants were grown during nine days in a solution containing 50 mg L-1 of calcium and 0.0 and 0.2 mg L-1 of aluminum. The solution pH at the beginning was 4.76. Root growth in Al solutions of the tolerant soybean cultivars was higher than that of the

  19. Trigo, triticale e centeio: avaliação da eficiência ao fósforo e tolerância à toxicidade ao alumínio Evaluation of wheat, triticale and rye cultivars for phosphorus efficiency and tolerance to aluminum toxicity in nutrient solution

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1987-01-01

    Full Text Available Com o objetivo de estudar a eficiência da utilização de fósforo e a tolerância à toxicidade ao alumínio, instalou-se um experimento empregando os cultivares de trigo BH-1146, Anahuac, IAC-5, IAC-24 e IAC-21; o de triticale TCEP 77138 e o de centeio Branco, em soluções nutritivas contendo cinco níveis de fósforo (0; 3,1; 6,2; 12,4 e 31 mg/litro combinados com cinco níveis de alumínio (0, 1, 3, 6 e 10 mg/litro. A eficiência ao fósforo foi avaliada levando-se em consideração a produção de matéria seca e a quantidade de P nela presente, e a tolerância ao alumínio, com base no comprimento máximo das raízes após doze dias de crescimento em soluções nutritivas. O cultivar de centeio e o de triticale mostraram maior tolerância ao alumínio. Os cultivares de trigo BH-1146, IAC-21, IAC-5 e IAC-24 apresentaram-se como tolerantes e Anahuac, como sensível. O sintoma da toxicidade de alumínio ficou acentuado pelo aumento das concentrações de alumínio e fósforo para todos esses cultivares. 'IAC-5' foi considerado eficiente na utilização de fósforo; 'IAC-21' e 'IAC-24', moderadamente eficientes, e 'Anahuac', Ineficiente, em soluções contendo baixos níveis de fósforo na presença de Al3+.Five wheat cultivars, one triticale and one rye cultivar were studied in aerated nutrient solution with one tenth of the salt concentration of a complete nutrient solution, pH = 4.0 with five levels of aluminum (0, 1, 3, 6 and 10 mg/l combined with five levels of phosphorus (0; 3.1; 6.2; 12.4 and 31 mg/l. As controls, it was used a complete nutrient solution and distilled water. The aluminum tolerance was evaluated by measuring the primary root lenght of the seedlings after a 12-days growth period in the different treatment solutions. The rye cultivar (Branco and the triticale cultivar (TCEP 77138 were the most tolerant as far as aluminum toxicity is concerned, independently of the phosphorus concentrations into the solutions. The wheat

  20. Expression of the yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: pleiotropic phenotypes include drought tolerance.

    Science.gov (United States)

    Romero, C; Bellés, J M; Vayá, J L; Serrano, R; Culiáñez-Macià, F A

    1997-03-01

    The yeast trehalose-6-phosphate synthase gene (TPS1) was engineered under the control of the cauliflower mosaic virus regulatory sequences (CaMV35S) for expression in plants. Using Agrobacterium-mediated transfer, the gene was incorporated into the genomic DNA and constitutively expressed in Nicotiana tabacum L. plants. Trehalose was determined in the transformants, by anion-exchange chromatography coupled to pulsed amperometric detection. The non-reducing disaccharide accumulated up to 0.17 mg per g fresh weight in leaf extracts of transgenic plants. Trehaloseaccumulating plants exhibited multiple phenotypic alterations, including stunted growth, lancet-shaped leaves, reduced sucrose content and improved drought tolerance. These pleiotropic effects, and the fact that water loss from detached leaves was not significantly affected by trehalose accumulation, suggest that synthesis of this sugar, rather than leading to an osmoprotectant effect, had altered sugar metabolism and regulatory pathways affecting plant development and stress tolerance.

  1. Differences in salinity tolerance and gene expression between two populations of Atlantic cod (Gadus morhua) in response to salinity stress

    DEFF Research Database (Denmark)

    Larsen, Peter Foged; Eg Nielsen, Einar; Meier, Kristian

    2012-01-01

    in salinity tolerance and gene expression among Atlantic cod (Gadus morhua) from two populations distributed across a steep salinity gradient, we observed high mortality (45% North Sea cod and 80% Baltic Sea cod) in a reciprocal common garden setup. Quantitative RT-PCR assays for expression of hsp70 and Na....... The findings strongly suggest that Atlantic cod are adapted to local saline conditions, despite relatively low levels of neutral genetic divergence between populations...

  2. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  3. Addressing immune tolerance issues in inflammatory bowel disease and adeno-associated virus based gene transfer

    NARCIS (Netherlands)

    Majowicz, Anna

    2014-01-01

    This thesis is focusing on cell-mediated induction of immune tolerance and consists of two parts. The studies described in Part I report the development of strategies for possible treatment of Inflammatory Bowel Diseases (IBD). Induction of immune tolerance, in IBD mouse model, with the use of regul

  4. Molecular Cloning and Functional Characterization of a Salt Tolerance-Associated Gene IbNFU1 from Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    WANG Lian-jun; HE Shao-zhen; ZHAI Hong; LIU De-gao; WANG Yan-nan; LIU Qing-chang

    2013-01-01

    Iron-sulfur cluster biosynthesis involving the nitrogen fixation (Nif) proteins has been proposed as a general mechanism acting in various organisms. NifU-like protein may play an important role in protecting plants against abiotic and biotic stresses. Based on the EST sequence selected from salt-stressed suppression subtractive hybridization (SSH) cDNA library constructed with a salt-tolerant mutant LM79, a NFU gene, termed IbNFU1, was cloned from sweetpotato (Ipomoea batatas (L.) Lam.) via rapid amplification of cDNA ends (RACE). The cDNA sequence of 1 117 bp contained an 846 bp open reading frame encoding a 281 amino acids polypeptide with a molecular weight of 30.5 kDa and an isoelectric point (pI) of 5.12. IbNFU1 gene contained a conserved Cys-X-X-Cys motif in C-terminal of the iron-sulfur cluster domain. The deduced amino acid sequence had 66.08 to 71.99%sequence identity to NFU genes reported in Arabidopsis thaliana, Eucalyptus grandis and Vitis vinifera. Real-time quantitative PCR analysis revealed that the expression level of IbNFU1 gene was significantly higher in the roots of the mutant LM79 compared to the wild-type Lizixiang. Transgenic tobacco (cv. Wisconsin 38) plants expressing IbNFU1 gene exhibited significantly higher salt tolerance compared to the untransformed control plants. It is proposed that IbNFU1 gene has an important function for salt tolerance of plants.

  5. Genetic transformation and expression of transgenic lines of Populus x euramericana with insect-resistance and salt-tolerance genes.

    Science.gov (United States)

    Yang, R L; Wang, A X; Zhang, J; Dong, Y; Yang, M S; Wang, J M

    2016-04-29

    We characterized new transgenic varieties of poplar with multiple insect-resistant and salt stress tolerant genes. Two insect-resistant Bacillus thuringiensis (Bt) genes, Cry1Ac and Cry3A, and a salt-tolerant gene, Betaine aldehyde dehydrogenase (BADH) were inserted into a vector, p209-Cry1Ac-Cry3A-BADH. The clone of Populus x euramericana was transformed by the vector using the Agrobacterium-mediated method. Three transgenic lines were assessed using genetic detection and resistance expression analysis. PCR revealed that exogenous genes Cry1Ac, Cry3A, BADH and selective marker gene NPTII were present in three transgenic lines. Quantitative real-time PCR (qPCR) showed significant differences in the transcriptional abundance of three exogenous genes in different lines. Results of assays for Bt toxic proteins showed that the Cry1Ac and Cry3A toxic protein content of each line was 12.83-26.32 and 2108.91-2724.79 ng/g, respectively. The Cry1Ac toxic protein content of different lines was significantly different; the Cry3A toxic protein content was about 100 times higher than that of the Cry1Ac toxic protein. The insect-resistance test revealed the mortality rate of transgenic lines to Hyphantria cunea L1 larvae varied by 42.2-66.7%, which was significantly higher than non-transgenic lines. The mortality rate of L1 and L2 Plagiodera versicolora larvae was 100%. The insecticidal effect of transgenic lines to P. versicolora larvae was higher than that to H. cunea larvae. NaCl stress tolerance of three transgenic lines under 3-6% NaCl concentration was significantly higher than that of non-transgenic lines.

  6. The Opuntia streptacantha OpsHSP18 Gene Confers Salt and Osmotic Stress Tolerance in Arabidopsis thaliana

    Science.gov (United States)

    Salas-Muñoz, Silvia; Gómez-Anduro, Gracia; Delgado-Sánchez, Pablo; Rodríguez-Kessler, Margarita; Jiménez-Bremont, Juan Francisco

    2012-01-01

    Abiotic stress limits seed germination, plant growth, flowering and fruit quality, causing economic decrease. Small Heat Shock Proteins (sHSPs) are chaperons with roles in stress tolerance. Herein, we report the functional characterization of a cytosolic class CI sHSP (OpsHSP18) from Opuntia streptacantha during seed germination in Arabidopsis thaliana transgenic lines subjected to different stress and hormone treatments. The over-expression of the OpsHSP18 gene in A. thaliana increased the seed germination rate under salt (NaCl) and osmotic (glucose and mannitol) stress, and in ABA treatments, compared with WT. On the other hand, the over-expression of the OpsHSP18 gene enhanced tolerance to salt (150 mM NaCl) and osmotic (274 mM mannitol) stress in Arabidopsis seedlings treated during 14 and 21 days, respectively. These plants showed increased survival rates (52.00 and 73.33%, respectively) with respect to the WT (18.75 and 53.75%, respectively). Thus, our results show that OpsHSP18 gene might have an important role in abiotic stress tolerance, in particular in seed germination and survival rate of Arabidopsis plants under unfavorable conditions. PMID:22949853

  7. Over-Expression of SlSHN1 Gene Improves Drought Tolerance by Increasing Cuticular Wax Accumulation in Tomato

    Directory of Open Access Journals (Sweden)

    Ayed M. Al-Abdallat

    2014-10-01

    Full Text Available Increasing cuticular wax accumulation in plants has been associated with improving drought tolerance in plants. In this study, a cDNA clone encoding the SlSHN1 transcription factor, the closest ortholog to WIN/SHN1 gene in Arabidopsis, was isolated from tomato plant. Expression analysis of SlSHN1 indicated that it is induced in response to drought conditions. The over-expression of SlSHN1 in tomato under the control of the constitutive CaMV 35S promoter produced plants that showed mild growth retardation phenotype with shiny and dark green leaves. Scanning electron microscopy showed that the over-expression of SlSHN1 in tomato resulted in higher cuticular wax deposition on leaf epidermial tissue when compared to non-transformed plants. Expression analysis in transgenic lines over-expressing SlSHN1 indicated that several wax-related synthesis genes were induced. Transgenic tomato plants over-expressing SlSHN1 showed higher drought tolerance when compared with wild type plants; this was reflected in delayed wilting of transgenic lines, improved water status and reduced water loss rate when compared with wild type plants. In conclusion, the SlSHN1 gene can modulate wax accumulation and could be utilized to enhance drought tolerance in tomato plant.

  8. Structure, allelic diversity and selection of Asr genes, candidate for drought tolerance, in Oryza sativa L. and wild relatives.

    Science.gov (United States)

    Philippe, Romain; Courtois, Brigitte; McNally, Kenneth L; Mournet, Pierre; El-Malki, Redouane; Le Paslier, Marie Christine; Fabre, Denis; Billot, Claire; Brunel, Dominique; Glaszmann, Jean-Christophe; This, Dominique

    2010-08-01

    Asr (ABA, stress, ripening) genes represent a small gene family potentially involved in drought tolerance in several plant species. To analyze their interest for rice breeding for water-limited environments, this gene family was characterized further. Genomic organization of the gene family reveals six members located on four different chromosomes and with the same exon-intron structure. The maintenance of six members of the Asr gene family, which are the result of combination between tandem duplication and whole genome duplication, and their differential regulation under water stress, involves probably some sub-functionalization. The polymorphism of four members was studied in a worldwide collection of 204 accessions of Oryza sativa L. and 14 accessions of wild relatives (O. rufipogon and O. nivara). The nucleotide diversity of the Asr genes was globally low, but contrasted for the different genes, leading to different shapes of haplotype networks. Statistical tests for neutrality were used and compared to their distribution in a set of 111 reference genes spread across the genome, derived from another published study. Asr3 diversity exhibited a pattern concordant with a balancing selection at the species level and with a directional selection in the tropical japonica sub-group. This study provides a thorough description of the organization of the Asr family, and the nucleotide and haplotype diversity of four Asr in Oryza sativa species. Asr3 stood out as the best potential candidate. The polymorphism detected here represents a first step towards an association study between genetic polymorphisms of this gene family and variation in drought tolerance traits.

  9. Overexpression of the Maize psbA Gene Enhances Drought Tolerance Through Regulating Antioxidant System, Photosynthetic Capability, and Stress Defense Gene Expression in Tobacco.

    Science.gov (United States)

    Huo, Yongjin; Wang, Meiping; Wei, Yangyang; Xia, Zongliang

    2015-01-01

    The psbA (encoding D1 protein) plays an important role in protecting photosystem II (PSII) from oxidative damage in higher plants. In our previous study, the role of the psbA from maize (Zea mays. L) in response to SO2 stress was characterized. To date, information about the involvement of the psbA gene in drought response is scarce. Here we found that overexpression (OE) of ZmpsbA showed increased D1 protein abundance and enhanced drought stress tolerance in tobacco. The drought-tolerant phenotypes of the OE lines were accompanied by increases of key antioxidant enzymes SOD, CAT, and POD activities, but decreases of hydrogen peroxide, malondialdehyde, and ion leakage. Further investigation showed that the OE plants had much less reductions than the wild-type in the net photosynthesis rate (Pn), stomatal conductance (Gs), and the maximal photochemical efficiency of PSII (Fv/Fm) during drought stress; indicating that OE of ZmpsbA may alleviate photosynthesis inhibition during drought. qRT-PCR analysis revealed that there was significantly increased expression of NtLEA5, NtERD10C, NtAREB, and NtCDPK2 in ZmpsbA-OE lines. Together, our results indicate that ZmpsbA improves drought tolerance in tobacco possibly by alleviating photosynthesis reduction, reducing reactive oxygen species accumulation and membrane damage, and modulating stress defense gene expression. ZmpsbA could be exploited for engineering drought-tolerant plants in molecular breeding of crops.

  10. Overexpression of the Maize psbA Gene Enhances Drought Tolerance Through Regulating Antioxidant System, Photosynthetic Capability, and Stress Defense Gene Expression in Tobacco

    Directory of Open Access Journals (Sweden)

    Yongjin eHuo

    2016-01-01

    Full Text Available The psbA (encoding D1 protein plays an important role in protecting photosystem II (PSII from oxidative damage in higher plants. In our previous study, the role of the psbA from maize (Zea mays. L in response to SO2 stress was characterized. To date, information about the involvement of the psbA gene in drought response is scarce. Here we found that overexpression (OE of ZmpsbA showed increased D1 protein abundance and enhanced drought stress tolerance in tobacco. The drought-tolerant phenotypes of the OE lines were accompanied by increases of key antioxidant enzymes SOD, CAT, and POD activities, but decreases of hydrogen peroxide, malondialdehyde and ion leakage. Further investigation showed that the OE plants had much less reductions than the wild-type in the net photosynthesis rate (Pn, stomatal conductance (Gs, and the maximal photochemical efficiency of PSII (Fv/Fm during drought stress; indicating that overexpression of ZmpsbA may alleviate photosynthesis inhibition during drought. qRT-PCR analysis revealed that there was significantly increased expression of NtLEA5, NtERD10C, NtAREB, and NtCDPK2 in ZmpsbA-OE lines. Together, our results indicate that ZmpsbA improves drought tolerance in tobacco possibly by alleviating photosynthesis reduction, reducing ROS accumulation and membrane damage, and modulating stress defense gene expression. ZmpsbA could be exploited for engineering drought-tolerant plants in molecular breeding of crops.

  11. Seleção de genótipos de Brachiaria Ruziziensis quanto ao alumínio em solução nutritiva: II: Avaliação da tolerância ao alumínio Brachiaria Ruziziensis genotypes selection: II: Evaluation of the aluminum tolerance

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Balbino Miguel

    2011-01-01

    Full Text Available O alumínio, em solos ácidos, é um dos principais responsáveis pela baixa produtividade de culturas. O objetivo deste trabalho foi avaliar a variabilidade genética da Brachiaria ruziziensis para a tolerância ao alumínio. Foram utilizados 10 genótipos da espécie referida, crescidas em vasos com 0, 30 e 60 mg/L de alumínio em solução nutritiva. Foi utilizado o delineamento inteiramente casualizado em esquema fatorial, com seis repetições e parcelas de uma planta por vaso. Foram avaliados: a produção de massa verde da parte aérea e raízes (MVPA e MVR, a produção de matéria seca da parte aérea e raízes (MSPA e MSR, o incremento no crescimento da parte aérea e das raízes (IPA e IR, expresso pela diferença entre o crescimento final e o inicial, e o incremento no número de perfilhos (INP. O aumento nas concentrações de alumínio provocou decréscimos para as médias de todas as características avaliadas, excetuando o IR. A ausência de diferenças do genótipo 8 para seis das sete características analisadas, com exceção da MVPA, demonstra ser ela a mais promissora para estudos posteriores em melhoramento, visando maior produtividade em solos ácidos. Os resultados evidenciaram a existência de variabilidade genética entre os genótipos avaliados para a tolerância ao alumínio tóxico, sendo possível identificar materiais mais produtivos na presença desse metal.In acid soils, the aluminum is responsible for the low cultures productivity. The objective of this work was to evaluate the Brachiaria ruziziensis genetic variability for the aluminum tolerance.10 genotypes of that species were used, grown in vases with 0, 30 and 60 mg/L of aluminum in nutritious solution. A completely randomized design under 10 x 3 factorial, with six replicates. The following variables were evaluated: the green mass production of the aerial part and roots (MVPA and MVR, the dry matter production of the aerial part and roots (MSPA and MSR

  12. Transfer of E. coli gutD gene into maize and regeneration of salt-tolerant transgenic plants

    Institute of Scientific and Technical Information of China (English)

    刘岩; 王国英; 刘俊君; 彭学贤; 谢友菊; 戴景瑞; 郭世伟; 张福锁

    1999-01-01

    GutD gene, encoding a key enzyme (glucitol-6-phosphate dehydrogenase) of sugar alcohol metabolic pathway in E. coli, was transferred into maize. Results of Southern and Western blotting analysis certified that this gene had integrated and been expressed in transgenic maize plants and their progeny. The synthesis and accumulation of sorbitol were detected in transgenic maize plants and a preliminary nutrient solution culture experiment showed that gutD transgenic maize plants had an increased tolerance to salt stress compared with nontransgenic ones.

  13. High prevalence of multidrug-tolerant bacteria and associated antimicrobial resistance genes isolated from ornamental fish and their carriage water.

    Directory of Open Access Journals (Sweden)

    David W Verner-Jeffreys

    Full Text Available BACKGROUND: Antimicrobials are used to directly control bacterial infections in pet (ornamental fish and are routinely added to the water these fish are shipped in to suppress the growth of potential pathogens during transport. METHODOLOGY/PRINCIPAL FINDINGS: To assess the potential effects of this sustained selection pressure, 127 Aeromonas spp. isolated from warm and cold water ornamental fish species were screened for tolerance to 34 antimicrobials. Representative isolates were also examined for the presence of 54 resistance genes by a combination of miniaturized microarray and conventional PCR. Forty-seven of 94 Aeromonas spp. isolates recovered from tropical ornamental fish and their carriage water were tolerant to > or =15 antibiotics, representing seven or more different classes of antimicrobial. The quinolone and fluoroquinolone resistance gene, qnrS2, was detected at high frequency (37% tested recent isolates were positive by PCR. Class 1 integrons, IncA/C broad host range plasmids and a range of other antibiotic resistance genes, including floR, bla(TEM-1, tet(A, tet(D, tet(E, qacE2, sul1, and a number of different dihydrofolate reductase and aminoglycoside transferase coding genes were also detected in carriage water samples and bacterial isolates. CONCLUSIONS: These data suggest that ornamental fish and their carriage water act as a reservoir for both multi-resistant bacteria and resistance genes.

  14. The involvement of wheat F-box protein gene TaFBA1 in the oxidative stress tolerance of plants.

    Directory of Open Access Journals (Sweden)

    Shu-Mei Zhou

    Full Text Available As one of the largest gene families, F-box domain proteins have been found to play important roles in abiotic stress responses via the ubiquitin pathway. TaFBA1 encodes a homologous F-box protein contained in E3 ubiquitin ligases. In our previous study, we found that the overexpression of TaFBA1 enhanced drought tolerance in transgenic plants. To investigate the mechanisms involved, in this study, we investigated the tolerance of the transgenic plants to oxidative stress. Methyl viologen was used to induce oxidative stress conditions. Real-time PCR and western blot analysis revealed that TaFBA1 expression was up-regulated by oxidative stress treatments. Under oxidative stress conditions, the transgenic tobacco plants showed a higher germination rate, higher root length and less growth inhibition than wild type (WT. The enhanced oxidative stress tolerance of the transgenic plants was also indicated by lower reactive oxygen species (ROS accumulation, malondialdehyde (MDA content and cell membrane damage under oxidative stress compared with WT. Higher activities of antioxidant enzymes, including superoxide dismutase (SOD, catalase (CAT, ascorbate peroxidase (APX and peroxidase (POD, were observed in the transgenic plants than those in WT, which may be related to the upregulated expression of some antioxidant genes via the overexpression of TaFBA1. In others, some stress responsive elements were found in the promoter region of TaFBA1, and TaFBA1 was located in the nucleus, cytoplasm and plasma membrane. These results suggest that TaFBA1 plays an important role in the oxidative stress tolerance of plants. This is important for understanding the functions of F-box proteins in plants' tolerance to multiple stress conditions.

  15. The involvement of wheat F-box protein gene TaFBA1 in the oxidative stress tolerance of plants.

    Science.gov (United States)

    Zhou, Shu-Mei; Kong, Xiang-Zhu; Kang, Han-Han; Sun, Xiu-Dong; Wang, Wei

    2015-01-01

    As one of the largest gene families, F-box domain proteins have been found to play important roles in abiotic stress responses via the ubiquitin pathway. TaFBA1 encodes a homologous F-box protein contained in E3 ubiquitin ligases. In our previous study, we found that the overexpression of TaFBA1 enhanced drought tolerance in transgenic plants. To investigate the mechanisms involved, in this study, we investigated the tolerance of the transgenic plants to oxidative stress. Methyl viologen was used to induce oxidative stress conditions. Real-time PCR and western blot analysis revealed that TaFBA1 expression was up-regulated by oxidative stress treatments. Under oxidative stress conditions, the transgenic tobacco plants showed a higher germination rate, higher root length and less growth inhibition than wild type (WT). The enhanced oxidative stress tolerance of the transgenic plants was also indicated by lower reactive oxygen species (ROS) accumulation, malondialdehyde (MDA) content and cell membrane damage under oxidative stress compared with WT. Higher activities of antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and peroxidase (POD), were observed in the transgenic plants than those in WT, which may be related to the upregulated expression of some antioxidant genes via the overexpression of TaFBA1. In others, some stress responsive elements were found in the promoter region of TaFBA1, and TaFBA1 was located in the nucleus, cytoplasm and plasma membrane. These results suggest that TaFBA1 plays an important role in the oxidative stress tolerance of plants. This is important for understanding the functions of F-box proteins in plants' tolerance to multiple stress conditions.

  16. Abscisic acid enhances tolerance of wheat seedlings to drought and regulates transcript levels of genes encoding ascorbate-glutathione biosynthesis

    Directory of Open Access Journals (Sweden)

    Wei eLiting

    2015-06-01

    Full Text Available Glutathione (GSH and ascorbate (ASA are associated with the abscisic acid (ABA-induced abiotic tolerance in higher plant, however, its molecular mechanism remains obscure. In this study, exogenous application (10 μM of ABA significantly increased the tolerance of seedlings of common wheat (Triticum aestivum L. suffering from 5 days of 15% polyethylene glycol (PEG-stimulated drought stress, as demonstrated by increased shoot lengths and shoot and root dry weights, while showing decreased contents of hydrogen peroxide (H2O2 and malondialdehyde (MDA. Under drought stress conditions, ABA markedly increased contents of GSH and ASA in both leaves and roots of ABA-treated plants. Temporal and spatial expression patterns of eight genes encoding ASA and GSH synthesis-related enzymes were measured using quantitative real-time reverse transcription polymerase chain reaction (qPCR. The results showed that ABA temporally regulated the transcript levels of genes encoding ASA-GSH cycle enzymes. Moreover, these genes exhibited differential expression patterns between the root and leaf organs of ABA-treated wheat seedlings during drought stress. These results implied that exogenous ABA increased the levels of GSH and ASA in drought-stressed wheat seedlings in time- and organ-specific manners. Moreover, the transcriptional profiles of ASA-GSH synthesis-related enzyme genes in the leaf tissue were compared between ABA- and salicylic acid (SA-treated wheat seedlings under PEG-stimulated drought stress, suggesting that they increased the contents of ASA and GSH by differentially regulating expression levels of ASA-GSH synthesis enzyme genes. Our results increase our understanding of the molecular mechanism of ABA-induced drought tolerance in higher plants

  17. Proteomic Analyses Reveal the Mechanism of Dunaliella salina Ds-26-16 Gene Enhancing Salt Tolerance in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Yanlong Wang

    Full Text Available We previously screened the novel gene Ds-26-16 from a 4 M salt-stressed Dunaliella salina cDNA library and discovered that this gene conferred salt tolerance to broad-spectrum organisms, including E. coli (Escherichia coli, Haematococcus pluvialis and tobacco. To determine the mechanism of this gene conferring salt tolerance, we studied the proteome of E. coli overexpressing the full-length cDNA of Ds-26-16 using the iTRAQ (isobaric tags for relative and absolute quantification approach. A total of 1,610 proteins were identified, which comprised 39.4% of the whole proteome. Of the 559 differential proteins, 259 were up-regulated and 300 were down-regulated. GO (gene ontology and KEGG (Kyoto encyclopedia of genes and genomes enrichment analyses identified 202 major proteins, including those involved in amino acid and organic acid metabolism, energy metabolism, carbon metabolism, ROS (reactive oxygen species scavenging, membrane proteins and ABC (ATP binding cassette transporters, and peptidoglycan synthesis, as well as 5 up-regulated transcription factors. Our iTRAQ data suggest that Ds-26-16 up-regulates the transcription factors in E. coli to enhance salt resistance through osmotic balance, energy metabolism, and oxidative stress protection. Changes in the proteome were also observed in E. coli overexpressing the ORF (open reading frame of Ds-26-16. Furthermore, pH, nitric oxide and glycerol content analyses indicated that Ds-26-16 overexpression increases nitric oxide content but has no effect on glycerol content, thus confirming that enhanced nitric oxide synthesis via lower intercellular pH was one of the mechanisms by which Ds-26-16 confers salt tolerance to E. coli.

  18. Over-expression of the apple spermidine synthase gene in pear confers multiple abiotic stress tolerance by altering polyamine titers.

    Science.gov (United States)

    Wen, Xiao-Peng; Pang, Xiao-Ming; Matsuda, Narumi; Kita, Masayuki; Inoue, Hiromichi; Hao, Yu-Jin; Honda, Chikako; Moriguchi, Takaya

    2008-04-01

    An apple spermidine synthase (SPDS) gene (MdSPDS1) was verified to encode a functional protein by the complementation of the spe3 yeast mutant, which lacks the SPDS gene. To justify our hypothesis that apple SPDS is involved in abiotic stress responses and to obtain transgenic fruit trees tolerant to abiotic stresses as well, MdSPDS1-over-expressing transgenic European pear (Pyrus communis L. 'Ballad') plants were created by Agrobacterium-mediated transformation. A total of 21 transgenic lines showing various spermidine (Spd) titers and MdSPDS1 expression levels were obtained. Selected lines were exposed to salt (150 mM NaCl), osmosis (300 mM mannitol), and heavy metal (500 microM CuSO4) stresses for evaluating their stress tolerances. Transgenic line no. 32, which was revealed to have the highest Spd accumulation and expression level of MdSPDS1, showed the strongest tolerance to these stresses. When growth increments, electrolyte leakage (EL), and values of thiobarbituric acid reactive substances (TBARS) were monitored, line no. 32 showed the lowest growth inhibition and the least increase in EL or TBARS under stress conditions. Spd titers in wild-type and transgenic lines showed diverse changes upon stresses, and these changes were not consistent with the changes in MdSPDS1 expressions. Moreover, there were no differences in the sodium concentration in the shoots between the wild type and line no. 32, whereas the copper concentration was higher in the wild type than in line no. 32. Although the mechanism(s) underlying the involvement of polyamines in stress responses is not known, these results suggest that the over-expression of the SPDS gene substantially increased the tolerance to multiple stresses by altering the polyamine titers in pear. Thus, MdSPDS1-over-expressing transgenic pear plants could be used to improve desert land and/or to repair polluted environments.

  19. Heterologous expression of the AtDREB1A gene in chrysanthemum increases drought and salt stress tolerance

    Institute of Scientific and Technical Information of China (English)

    HONG; Bo; TONG; Zheng; MA; Nan; LI; Jianke; KASUGA; Mie; YAMAGUCHI-SHINOZAKI; Kazuko; GAO; Junping

    2006-01-01

    DNA cassette containing an AtDREB1A cDNA and a nos terminator, driven by a cauliflower mosaic 35S promoter, or a stress-inducible rd29A promoter, was transformed into the ground cover chrysanthemum (Dendranthema grandiflorum) 'Fall Color' genome. Compared with wild type plants, severe growth retardation was observed in 35S:DREB1A plants, but not in rd29A:DREB1A plants. RT-PCR analysis revealed that, under stress conditions, the DREB1A gene was over-expressed constitutively in 35S:DREB1A plants, but was over-expressed inductively in rd29A:DREB1A plants. The transgenic plants exhibited tolerance to drought and salt stress, and the tolerance was significantly stronger in rd29A:DREB1A plants than tn 35S:DREB1A plants. Proline content and SOD activity were increased inductively in rd29A:DREB1A plants than in 35S:DREB1A plants under stress conditions. These results indicate that heterologous AtDREB1A can confer drought and salt tolerance in transgenic chrysanthemum, and improvement of the stress tolerance may be related to enhancement of proline content and SOD activity.

  20. Overexpression of soybean ubiquitin-conjugating enzyme gene GmUBC2 confers enhanced drought and salt tolerance through modulating abiotic stress-responsive gene expression in Arabidopsis.

    Science.gov (United States)

    Zhou, Guo-An; Chang, Ru-Zhen; Qiu, Li-Juan

    2010-03-01

    Previous studies have shown that ubiquitination plays important roles in plant abiotic stress responses. In the present study, the ubiquitin-conjugating enzyme gene GmUBC2, a homologue of yeast RAD6, was cloned from soybean and functionally characterized. GmUBC2 was expressed in all tissues in soybean and was up-regulated by drought and salt stress. Arabidopsis plants overexpressing GmUBC2 were more tolerant to salinity and drought stresses compared with the control plants. Through expression analyses of putative downstream genes in the transgenic plants, we found that the expression levels of two ion antiporter genes AtNHX1 and AtCLCa, a key gene involved in the biosynthesis of proline, AtP5CS, and the copper chaperone for superoxide dismutase gene AtCCS, were all increased significantly in the transgenic plants. These results suggest that GmUBC2 is involved in the regulation of ion homeostasis, osmolyte synthesis, and oxidative stress responses. Our results also suggest that modulation of the ubiquitination pathway could be an effective means of improving salt and drought tolerance in plants through genetic engineering.

  1. Genome-Wide Mapping of Furfural Tolerance Genes in Escherichia coli

    OpenAIRE

    Glebes, Tirzah Y.; Sandoval, Nicholas R.; Philippa J Reeder; Schilling, Katherine D.; Min ZHANG; Ryan T Gill

    2014-01-01

    Advances in genomics have improved the ability to map complex genotype-to-phenotype relationships, like those required for engineering chemical tolerance. Here, we have applied the multiSCale Analysis of Library Enrichments (SCALEs; Lynch et al. (2007) Nat. Method.) approach to map, in parallel, the effect of increased dosage for >105 different fragments of the Escherichia coli genome onto furfural tolerance (furfural is a key toxin of lignocellulosic hydrolysate). Only 268 of >4,000 E. coli ...

  2. Comparative study of Saccharomyces cerevisiae wine strains to identify potential marker genes correlated to desiccation stress tolerance.

    Science.gov (United States)

    Capece, Angela; Votta, Sonia; Guaragnella, Nicoletta; Zambuto, Marianna; Romaniello, Rossana; Romano, Patrizia

    2016-05-01

    The most diffused formulation of starter for winemaking is active dry yeast (ADY). ADYs production process is essentially characterized by air-drying stress, a combination of several stresses, including thermal, hyperosmotic and oxidative and cell capacity to counteract such multiple stresses will determine its survival. The molecular mechanisms underlying cell stress response to desiccation have been mostly studied in laboratory and commercial yeast strains, but a growing interest is currently developing for indigenous yeast strains which represent a valuable and alternative source of genetic and molecular biodiversity to be exploited. In this work, a comparative study of different Saccharomyces cerevisiae indigenous wine strains, previously selected for their technological traits, has been carried out to identify potentially relevant genes involved in desiccation stress tolerance. Cell viability was evaluated along desiccation treatment and gene expression was analyzed by real-time PCR before and during the stress. Our data show that the observed differences in individual strain sensitivity to desiccation stress could be associated to specific gene expression over time. In particular, either the basal or the stress-induced mRNA levels of certain genes, such as HSP12, SSA3, TPS1, TPS2, CTT1 and SOD1, result tightly correlated to the strain survival advantage. This study provides a reliable and sensitive method to predict desiccation stress tolerance of indigenous wine yeast strains which could be preliminary to biotechnological applications.

  3. Salicornia europaea L. Na⁺/H⁺ antiporter gene improves salt tolerance in transgenic alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Zhang, L Q; Niu, Y D; Huridu, H; Hao, J F; Qi, Z; Hasi, A

    2014-07-24

    In order to obtain a salt-tolerant perennial alfalfa (Medicago sativa L.), we transferred the halophyte Salicornia europaea L. Na(+)/H(+) antiporter gene, SeNHX1, to alfalfa by using the Agrobacterium-mediated transformation method. The transformants were confirmed by both PCR and RT-PCR analyses. Of 197 plants that were obtained after transformation, 36 were positive by PCR analysis using 2 primer pairs for the CaMV35S-SeNHX1 and SeNHX1-Nos fragments; 6 plants survived in a greenhouse. RT-PCR analysis revealed that SeNHX1 was expressed in 5 plants. The resultant transgenic alfalfa had better salt tolerance. After stress treatment for 21 days with 0.6% NaCl, the chlorophyll and MDA contents in transgenic plants were lower, but proline content and SOD, POD, and CAT activities were higher than those in wild-type plants. These results suggest that the salt tolerance of transgenic alfalfa was improved by the overexpression of the SeNHX1 gene.

  4. Development of new gene-specific markers associated with salt tolerance for mungbean (Vigna radiata L. Wilczek

    Directory of Open Access Journals (Sweden)

    Nirmala Sehrawat

    2014-07-01

    Full Text Available Thirty eight novel microsatellite markers (SSRs specific to candidate genes involved in salt tolerance were developed for detection of genetic variations in 12 mungbean genotypes variably adapted to salt stress. A 100 out of 124 putative alleles were found polymorphic between wild and cultivated genotypes (inter-specific, 80.65%, 65 were within cultivars of mungbean (intra-specific, 52.42% and 52 were within wild genotypes (inter-specific, 41.94%. The polymorphism varied from 86.84% to 100%, while the number of polymorphic alleles ranged from 1 to 4 with an average value of 2.63 per locus. The polymorphism information content (PIC values ranged from 0.326 to 0.875 with an average value of 0.671, which shows their effectiveness in genetic analysis. Cluster analysis resulted in the distribution of salt tolerant and susceptible genotypes in separate groups which revealed the presence of inherent variations among mungbean cultivars. These variations were explored effectively for SSR markers studies. The developed SSR markers may help along with already available markers to execute further research on mungbean. The markers may be coupled with specific loci linked with salt tolerance. The developed markers will help to identify the QTLs (quantitative trait loci or other important genes. These markers can also be utilized for testing the purity of hybrids or diversity assessment of Vigna species for important agronomic traits.

  5. Transgenic tobacco plants expressing BoRS1 gene from Brassica oleracea var. acephala show enhanced tolerance to water stress

    Indian Academy of Sciences (India)

    Dongqin Tang; Hongmei Qian; Lingxia Zhao; Danfeng Huang; Kexuan Tang

    2005-12-01

    Water stress is by far the leading environmental stress limiting crop yields worldwide. Genetic engineering techniques hold great promise for developing crop cultivars with high tolerance to water stress. In this study, the Brassica oleracea var. acephala BoRS1 gene was transferred into tobacco through Agrobacterium-mediated leaf disc transformation. The transgenic status and transgene expression of the transgenic plants was confirmed by polymerase chain reaction (PCR) analysis, Southern hybridization and semi-quantitative one step RT-PCR analysis respectively. Subsequently, the growth status under water stress, and physiological responses to water stress of transgenic tobacco were studied. The results showed that the transgenic plants exhibited better growth status under water stress condition compared to the untransformed control plants. In physiological assessment of water tolerance, transgenic plants showed more dry matter accumulation and maintained significantly higher levels of leaf chlorophyll content along with increasing levels of water stress than the untransformed control plants. This study shows that BoRS1 is a candidate gene in the engineering of crops for enhanced water stress tolerance.

  6. Early induction of Fe-SOD gene expression is involved in tolerance to Mn toxicity in perennial ryegrass.

    Science.gov (United States)

    Ribera-Fonseca, Alejandra; Inostroza-Blancheteau, Claudio; Cartes, Paula; Rengel, Zed; Mora, M L

    2013-12-01

    Manganese (Mn) toxicity limits plant growth in acid soils. Although Mn toxicity induces oxidative stress, the role of superoxide dismutase (SOD, EC.1.15.1.1) isoforms in conferring Mn tolerance remains unclear. Seedlings of ryegrass cultivars Nui (Mn-sensitive) and Kingston (Mn-tolerant) were hydroponically grown at 2.4 (optimal) or 750 μM Mn (toxic) concentration, and harvested from 2 to 48 h. Kingston showed higher shoot Mn than Nui at 2.4 μM Mn. At toxic supply, shoot Mn concentration steadily increased in both cultivars, with Kingston having the highest accumulation at 48 h. An early (2 h) increase in lipid peroxidation under Mn excess occurred, but it returned (after 6 h) to the basal level in Kingston only. Kingston exhibited higher SOD activity than Nui, and that difference increased due to toxic Mn. In general, Mn-induced gene expression of Mn- and Cu/Zn-SOD isoforms was higher in Nui than Kingston. Nevertheless, under Mn excess, we found a greater Fe-SOD up-regulation (up to 5-fold) in Kingston compared to Nui. Thus, Fe-SOD induction in Kingston might explain, at least partly, its high tolerance to Mn toxicity. This is the first evidence that Mn toxicity causes differential gene expression of SOD isoforms in ryegrass cultivars in the short-term.

  7. Overexpression of ARGOS Genes Modifies Plant Sensitivity to Ethylene, Leading to Improved Drought Tolerance in Both Arabidopsis and Maize.

    Science.gov (United States)

    Shi, Jinrui; Habben, Jeffrey E; Archibald, Rayeann L; Drummond, Bruce J; Chamberlin, Mark A; Williams, Robert W; Lafitte, H Renee; Weers, Ben P

    2015-09-01

    Lack of sufficient water is a major limiting factor to crop production worldwide, and the development of drought-tolerant germplasm is needed to improve crop productivity. The phytohormone ethylene modulates plant growth and development as well as plant response to abiotic stress. Recent research has shown that modifying ethylene biosynthesis and signaling can enhance plant drought tolerance. Here, we report novel negative regulators of ethylene signal transduction in Arabidopsis (Arabidopsis thaliana) and maize (Zea mays). These regulators are encoded by the ARGOS gene family. In Arabidopsis, overexpression of maize ARGOS1 (ZmARGOS1), ZmARGOS8, Arabidopsis ARGOS homolog ORGAN SIZE RELATED1 (AtOSR1), and AtOSR2 reduced plant sensitivity to ethylene, leading to enhanced drought tolerance. RNA profiling and genetic analysis suggested that the ZmARGOS1 transgene acts between an ethylene receptor and CONSTITUTIVE TRIPLE RESPONSE1 in the ethylene signaling pathway, affecting ethylene perception or the early stages of ethylene signaling. Overexpressed ZmARGOS1 is localized to the endoplasmic reticulum and Golgi membrane, where the ethylene receptors and the ethylene signaling protein ETHYLENE-INSENSITIVE2 and REVERSION-TO-ETHYLENE SENSITIVITY1 reside. In transgenic maize plants, overexpression of ARGOS genes also reduces ethylene sensitivity. Moreover, field testing showed that UBIQUITIN1:ZmARGOS8 maize events had a greater grain yield than nontransgenic controls under both drought stress and well-watered conditions.

  8. Differences of aluminum tolerance on wheat genotypes and its screening techniques%不同小麦基因型耐铝性的差异及筛选方法的研究

    Institute of Scientific and Technical Information of China (English)

    林咸永; 章永松; 罗安程

    2001-01-01

    Large-volume solution culture, rapid screening with soil in petridishes and small-pot soil test were used to screen for aluminum tolerance on wheat. Of the tested 24 wheat genotypes, there were significant differences of aluminum tolerance. Significant correlation was observed among screening criteria in wheat genotypes by three screening methods employed. In the tested parameters, relative root length (RRL) had the greatest variation, relative root weight (RRW) the second, and relative shoot length (RSL) and relative shoot weight (RSW) the last within wheat genotypes indicated by standard deviation (SD), coefficient of variation (CV) and distribution of data. These results implied that RRL and RRW could be sensitive and reliable screening criteria for differentiating aluminum tolerance in wheat genotypes, whereas RSL and RSW might be lower sensitive and reliable selection criteria. The three screening techniques developed in this study are superior to the conventional methods such as small- volume solution culture, pot experiment and field experiment which could be hardly used in the screening for a large number of genotypes because of their time and labor consumption. These three techniques are characterized by their convenience for operation, easy control of conditions, reliability and high screening effiency for a large number of genotypes in term of time and labor costs.%采用了大体积溶液培养法、培养皿快速鉴定法和小盆钵土培筛选法对小麦基因型进行了耐铝性筛选。供试的24个小麦基因型的耐铝性存在极显著的差异。所采用的各项筛选指标间呈极显著的正相关,且都能不同程度地区分基因型间的耐铝性差异。其中相对根长的SD、CV及分布范围最大,可以灵敏、可靠地反映不同基因型的耐铝性差异;其次是相对根系干重;相对株高和相对地上部干重的SD、CV及分布范围较小,反映基因型间耐铝性差异的灵敏度较低。3种

  9. 不同耐铝性的小麦基因型在酸性铝毒土壤的适应性及其与体内养分状况的关系%Adaptation of wheat genotypes with differential aluminum tolerance to acid, aluminum toxic soil in relation to their nutrient composition in shoots.

    Institute of Scientific and Technical Information of China (English)

    林咸永; 章永松; 陶勤南

    2000-01-01

    A soil culture test was conducted to evaluate adaptation of four wheat genotypes with differential aluminum tolerance to acid, aluminum toxic soil in relation to their nutrient composition in shoot. It was found that shoot growth of four wheat genotypes was greatly inhibited, while Al-tolerant genotypes exhibited higher shoot length, shoot dry weight and grain yield than those of Al- sensitive genotypes at lower soil pH and higher active Al condition. A significant decrease in the N, K, Ca, P, Zn contents, increase in Al content and no obvious change in Mg, Fe and Mn content in shoot were observed in all the tested wheat genotypes in the treatment of lower pH and higher Al. However, higher N, K, Ca, P contents, lower Al content, and higher ratios of Ca/Al, P/Al and K/Al were found in the shoot of the Al-tolerant genotype than in the shoot of Al-sensitive genotype in the presence of lower soil pH and higher Al. The resuits of the study indicate that adaptation of Al-tolerant genotype to acid, Aluminum toxic soil may be associated with their higher Ca, P contents and lower Al content, and higher Ca/Al , P/Al and K/Al ratiosin shoots.%采用土培试验研究了4个不同耐铝性的小麦基因型在酸性高铝土壤中的适应性及其与体内养分状况的关系.结果表明,酸性高铝条件明显抑制小麦的生长,但耐铝基因型的株高、地上部干重和籽粒产量均显著高于敏感基因型,表现出对酸性铝毒土壤较强的适应性.低pH高铝处理降低了小麦地上部氮、钾、钙、磷和锌的含量,提高了铝含量,对镁、铁和锰含量则无明显的影响,但耐铝基因型植株地上部比铝敏感基因型有较高的氮、钾、钙和磷含量及较低的铝含量.耐铝基因型对酸性铝毒土壤的适应性强可能与其在低pH高铝条件下维持较高的钙、磷含量,较低的铝含量以及较高的Ca/Al,P/Al和K/Al比值有关.

  10. Contribution of seedling vigour and anoxia/hypoxia-responsive genes to submergence tolerance in Vietnamese lowland rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Hien Thi Thu Vu

    2016-09-01

    Full Text Available A direct-seeded rice cultivation system has been widely adopted in Asian countries. Optimum germination and vigorous seedling growth under submergence are key traits for the practice of direct seeding. We studied the post-germination seedling vigour in Vietnamese lowland rice accessions based on three bio-parameters, shoot elongation growth under five-day submergence in water-filled test-tubes, seedling recovery rate five days after transferring submerged seedlings to pots with soil and seedling survival rate 21 days after sowing seeds in nursery beds and immediate incubation under submergence. A large diversity was found in seedling vigour thus estimated among the accessions. Significantly high correlations were observed among all three bio-parameters, verifying the contribution of seedling vigour to the manifestation of submergence tolerance at this critical stage of rice development. To examine the roles of anoxia/hypoxia-responsive genes, the expression of 17 candidate genes was studied by reverse transcription polymerase chain reaction (RT-PCR and compared between selected vigorous and non-vigorous groups of accessions. Transcripts of all but two genes showed marked accumulation in submerged seedlings. No differences, however, were found between the two contrasting groups. The observed common and coordinate expression of anoxia/hypoxia-induced genes suggests that they might assume roles in attaining baseline tolerance against submergence stress. It was also suggested that some unknown genetic factors are operating in determining cultivar/genotype-specific levels of submergence tolerance as assessed by post-germination seedling vigour.

  11. Seleção de populações de Lotus corniculatus L. com maior tolerância ao alumínio em solução nutritiva Selection of populations of Lotus corniculatus L. with increased tolerance to aluminum in nutrient solution

    Directory of Open Access Journals (Sweden)

    Aline Janke

    2010-11-01

    Full Text Available O experimento foi realizado com o objetivo de selecionar genótipos de Lotus corniculatus L. (Draco, São Gabriel e UFRGS mais tolerantes ao alumínio, utilizando-se a técnica de seleção em solução nutritiva. A solução continha 200 µmol/L de cálcio (CaCl2, 100 µmol/L de alumínio (AlCl3 e pH controlado na faixa de 4,1 a 4,3. Realizaram-se dois ciclos de seleção, nos quais as plântulas foram selecionadas pelo comprimento final das radículas. Posteriormente, avaliou-se o ganho genético alcançado nos ciclos de seleção, tanto nas populações originais como nas melhoradas, em um experimento com solução nutritiva com quatro concentrações de alumínio (0, 50, 100 e 150 µmol/L (AlCl3, por meio do crescimento radicular líquido. O uso de solução nutritiva foi eficiente na seleção de plântulas de cornichão tolerantes ao alumínio. Os materiais analisados apresentam diferenças em relação a esta característica, destacando-se o genótipo UFRGS F2, proveniente de dois ciclos de seleção, como o material com maior tolerância ao alumínio.The experiment was carried out to select genotypes of Lotus corniculatus L. (Draco, São Gabriel and UFRGS more tolerant to aluminum, using the technique of selection in nutrient solution. The solution contained 200 µmol/L calcium (CaCl2 and 100 µmol/L aluminum (AlCl3 and a pH controlled in the range from 4.1 to 4.3. It was performed two cycles of selection, in which the seedlings were selected by the root final length. Subsequently, the genetic gain achieved in the cycles of selection was tested, in original and improved populations in an experiment in nutrient solution with four concentrations of aluminum (0, 50, 100 and 150 µmol/L (AlCl3, by liquid root growth. Use of nutritional solution was efficient in the selection of seedlings of birdsfoot trefoil tolerant to aluminum. The materials analyzed differ for this characteristic, with the genotype UFRGS F2, being the most tolerant.

  12. Over-Expression of ScMnSOD, a SOD Gene Derived from Jojoba, Improve Drought Tolerance in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    LIU Xiao-fei; ZHANG Gen-fa; SUN Wei-min; LI Ze-qin; BAI Rui-xue; LI Jing-xiao; SHI Zi-han; GENG Hong-wei; ZHENG Ying; ZHANG Jun

    2013-01-01

    Jojoba (Simmondsia chinensis) is mainly distributed in desert, and the molecular mechanisms of jojoba in response to abiotic stress still remain elusive. In this paper, we cloned and characterized a SOD gene from jojoba named as ScMnSOD, and introduced into Arabidopsis to investigate its functions of responding to drought stress. The transgenic Arabidopsis showed an improvement in drought tolerance. Moreover, under a water deifcit condition, the accumulation of reactive oxygen species (ROS) was remarkably decreased in the transgenic lines compared to the WT. Furthermore, the ScMnSOD promoter was cloned to the 5´-upstream of GUS coding region in a binary vector, and introduced into Arabidopsis. And results showed that ScMnSOD expression can be induced by drought, salt, ABA, and low temperature. In conclusion, ScMnSOD plays an important role in drought tolerance which is, at least partially, attributed to its role in ROS detoxiifcation.

  13. Salt tolerance conferred by over-expression of OsNHX1 gene in Poplar 84K

    Institute of Scientific and Technical Information of China (English)

    WANG Shuyao; CHEN Qijun; WANG Wenlong; WANG Xuechen; LU Mengzhu

    2005-01-01

    OsNHX1 gene (Na+/H+ antiporter gene of Oryza sativa L.) was introduced into Poplar 84K with Agrobacterium tumefaciens-mediated transformation. PCR, Southern and Northern blot analysis showed that OsNHX1 gene was incorporated successfully into the genome of Poplar 84K and expressed in these transgenic plants. Salt tolerance test showed that three lines of transgenic plants grew normally in the presence of 200 mmol/L NaCl, while the Na+ content in the leaves of the transgenic plants grown at 200 mmol/L NaCl was significantly higher than that in plants grown at 0 mmol/L NaCl. The osmotic potential in the transgenic plants with high salinity treatment was lower than that of control plants. Our results demonstrate the potential use of these transgenic plants for agricultural use in saline soils.

  14. The adenylate cyclase gene MaAC is required for virulence and multi-stress tolerance of Metarhizium acridum

    Directory of Open Access Journals (Sweden)

    Liu Shuyang

    2012-08-01

    Full Text Available Abstract Background The efficacy of entomopathogenic fungi in pest control is mainly affected by various adverse environmental factors, such as heat shock and UV-B radiation, and by responses of the host insect, such as oxidative stress, osmotic stress and fever. In this study, an adenylate cyclase gene (MaAC was cloned from the locust-specific entomopathogenic fungus, Metarhizium acridum, which is homologous to various fungal adenylate cyclase genes. RNA silencing was adapted to analyze the role of MaAC in virulence and tolerance to adverse environmental and host insect factors. Results Compared with the wild type, the vegetative growth of the RNAi mutant was decreased in PD (potato dextrose medium, Czapek-dox and PDA plates, respectively, demonstrating that MaAC affected vegetative growth. The cAMP levels were also reduced in PD liquid culture, and exogenous cAMP restored the growth of RNAi mutants. These findings suggested that MaAC is involved in cAMP synthesis. The knockdown of MaAC by RNAi led to a reduction in virulence after injection or topical inoculation. Furthermore, the RNAi mutant grew much slower than the wild type in the haemolymph of locust in vitro and in vivo, thus demonstrating that MaAC affects the virulence of M. acridum via fungal growth inside the host locust. A plate assay indicated that the tolerances of the MaAC RNAi mutant under oxidative stress, osmotic stress, heat shock and UV-B radiation was decreased compared with the wild type. Conclusion MaAC is required for virulence and tolerance to oxidative stress, osmotic stress, heat shock and UV-B radiation. MaAC affects fungal virulence via vegetative growth inside the insect and tolerance against oxidative stress, osmotic stress and locust fever.

  15. Transcriptome analysis of acetic-acid-treated yeast cells identifies a large set of genes whose overexpression or deletion enhances acetic acid tolerance.

    Science.gov (United States)

    Lee, Yeji; Nasution, Olviyani; Choi, Eunyong; Choi, In-Geol; Kim, Wankee; Choi, Wonja

    2015-08-01

    Acetic acid inhibits the metabolic activities of Saccharomyces cerevisiae. Therefore, a better understanding of how S. cerevisiae cells acquire the tolerance to acetic acid is of importance to develop robust yeast strains to be used in industry. To do this, we examined the transcriptional changes that occur at 12 h post-exposure to acetic acid, revealing that 56 and 58 genes were upregulated and downregulated, respectively. Functional categorization of them revealed that 22 protein synthesis genes and 14 stress response genes constituted the largest portion of the upregulated and downregulated genes, respectively. To evaluate the association of the regulated genes with acetic acid tolerance, 3 upregulated genes (DBP2, ASC1, and GND1) were selected among 34 non-protein synthesis genes, and 54 viable mutants individually deleted for the downregulated genes were retrieved from the non-essential haploid deletion library. Strains overexpressing ASC1 and GND1 displayed enhanced tolerance to acetic acid, whereas a strain overexpressing DBP2 was sensitive. Fifty of 54 deletion mutants displayed enhanced acetic acid tolerance. Three chosen deletion mutants (hsps82Δ, ato2Δ, and ssa3Δ) were also tolerant to benzoic acid but not propionic and sorbic acids. Moreover, all those five (two overexpressing and three deleted) strains were more efficient in proton efflux and lower in membrane permeability and internal hydrogen peroxide content than controls. Individually or in combination, those physiological changes are likely to contribute at least in part to enhanced acetic acid tolerance. Overall, information of our transcriptional profile was very useful to identify molecular factors associated with acetic acid tolerance.

  16. The yajC gene from Lactobacillus buchneri and Escherichia coli and its role in ethanol tolerance.

    Science.gov (United States)

    Liu, Siqing; Skory, Chris; Qureshi, Nasib; Hughes, Stephen

    2016-04-01

    The yajC gene (Lbuc_0921) from Lactobacillus buchneri NRRL B-30929 was identified from previous proteomics analyses in response to ethanol treatment. The YajC protein expression was increased by 15-fold in response to 10 % ethanol vs 0 % ethanol. The yajC gene encodes the smaller subunit of the preprotein translocase complex, which interacts with membrane protein SecD and SecF to coordinate protein transport and secretion across cytoplasmic membrane in Escherichia coli. The YajC protein was linked to sensitivity to growth temperatures in E. coli, involved in translocation of virulence factors during Listeria infection, and stimulating a T cell-mediated response of Brucella abortus. In this study, the L. buchneri yajC gene was over-expressed in E. coli. The strain carrying pET28byajC that produces YajC after isopropyl β-D-1-thiogalactopyranoside induction showed tolerance to 4 % ethanol in growth media, compared to the control carrying pET28b. This is the first report linking YajC to ethanol stress and tolerance.

  17. HyPRP1 Gene Suppressed by Multiple Stresses Plays a Negative Role in Abiotic Stress Tolerance in Tomato

    Science.gov (United States)

    Li, Jinhua; Ouyang, Bo; Wang, Taotao; Luo, Zhidan; Yang, Changxian; Li, Hanxia; Sima, Wei; Zhang, Junhong; Ye, Zhibiao

    2016-01-01

    Many hybrid proline-rich protein (HyPRP) genes respond to biotic and abiotic stresses in plants, but little is known about their roles other than as putative cell-wall structural proteins. A HyPRP1 gene encodes a protein with proline-rich domain, and an eight-cysteine motif was identified from our previous microarray experiments on drought-tolerant tomato. In this study, the expression of the HyPRP1 gene in tomato was suppressed under various abiotic stresses, such as drought, high salinity, cold, heat, and oxidative stress. Transgenic functional analysis showed no obvious changes in phenotypes, but enhanced tolerance to various abiotic stresses (e.g., oxidative stress, dehydration, and salinity) was observed in RNAi transgenic plants. Interestingly, several SO2 detoxification-related enzymes, including sulfite oxidase, ferredoxins (Fds), and methionine sulfoxide reductase A (Msr A), were revealed in HyPRP1-interacting proteins identified by Yeast Two-Hybrid screening. More sulfates and transcripts of Msr A and Fds were accumulated in HyPRP1 knockdown lines when wild-type plants were exposed to SO2 gas. Our findings illustrate that the tomato HyPRP1 is a negative regulator of salt and oxidative stresses and is probably involved in sulfite metabolism. PMID:27446190

  18. Tolerance of Deregulated G1/S Transcription Depends on Critical G1/S Regulon Genes to Prevent Catastrophic Genome Instability

    Directory of Open Access Journals (Sweden)

    Catia Caetano

    2014-12-01

    Full Text Available Expression of a G1/S regulon of genes that are required for DNA replication is a ubiquitous mechanism for controlling cell proliferation; moreover, the pathological deregulated expression of E2F-regulated G1/S genes is found in every type of cancer. Cellular tolerance of deregulated G1/S transcription is surprising because this regulon includes many dosage-sensitive proteins. Here, we used the fission yeast Schizosaccharomyces pombe to investigate this issue. We report that deregulating the MBF G1/S regulon by eliminating the Nrm1 corepressor increases replication errors. Homology-directed repair proteins, including MBF-regulated Ctp1CtIP, are essential to prevent catastrophic genome instability. Surprisingly, the normally inconsequential MBF-regulated S-phase cyclin Cig2 also becomes essential in the absence of Nrm1. This requirement was traced to cyclin-dependent kinase inhibition of the MBF-regulated Cdc18Cdc6 replication origin-licensing factor. Collectively, these results establish that, although deregulation of G1/S transcription is well tolerated by cells, nonessential G1/S target genes become crucial for preventing catastrophic genome instability.

  19. Cloning of the Lycopene β-cyclase Gene in Nicotiana tabacum and Its Overexpression Confers Salt and Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yanmei Shi

    2015-12-01

    Full Text Available Carotenoids are important pigments in plants that play crucial roles in plant growth and in plant responses to environmental stress. Lycopene β cyclase (β-LCY functions at the branch point of the carotenoid biosynthesis pathway, catalyzing the cyclization of lycopene. Here, a β-LCY gene from Nicotiana tabacum, designated as Ntβ-LCY1, was cloned and functionally characterized. Robust expression of Ntβ-LCY1 was found in leaves, and Ntβ-LCY1 expression was obviously induced by salt, drought, and exogenous abscisic acid treatments. Strong accumulation of carotenoids and expression of carotenoid biosynthesis genes resulted from Ntβ-LCY1 overexpression. Additionally, compared to wild-type plants, transgenic plants with overexpression showed enhanced tolerance to salt and drought stress with higher abscisic acid levels and lower levels of malondialdehyde and reactive oxygen species. Conversely, transgenic RNA interference plants had a clear albino phenotype in leaves, and some plants did not survive beyond the early developmental stages. The suppression of Ntβ-LCY1 expression led to lower expression levels of genes in the carotenoid biosynthesis pathway and to reduced accumulation of carotenoids, chlorophyll, and abscisic acid. These results indicate that Ntβ-LCY1 is not only a likely cyclization enzyme involved in carotenoid accumulation but also confers salt and drought stress tolerance in Nicotiana tabacum.

  20. 外源水杨酸对铝胁迫下栝楼光合特性及耐铝性的影响%Effect of Exogenous SA on Photosynthesis and Al Tolerance of Trichosanthes kirilowii Maxim Under Aluminum Stress

    Institute of Scientific and Technical Information of China (English)

    高培培; 章艺; 吴玉环; 徐根娣; 郑人卫; 罗虹; 陈果果; 周桑桑; 刘鹏

    2012-01-01

    以耐铝品种安国栝楼和铝敏感品种浦江栝楼为试验材料,采用溶液培养法研究800μmol/L铝胁迫下,不同浓度水杨酸对2个栝楼品种的生长特性、光合特性及抗氧化酶活性、MDA和紫外吸收物含量的影响。结果表明,经过800μmol/L铝处理15d后,安国栝楼和浦江栝楼的相对根长、株高及地上部鲜重、叶绿素含量、最大光能转化效率(Fv/Fm)、最大荧光产量(Fm)及电子传递速率(ETR)明显下降,SOD、CAT活性却出现2种相反的变化趋势,显示出2个栝楼品种的耐铝性差异,POD活性和紫外吸收物含量降低,MDA含量及初始荧光(F0)升高。10,30,50μmol/L外源SA可不同程度地降低铝在根尖细胞壁中的积累、MDA含量及初始荧光(F0),提高栝楼的相对根长、株高、地上部鲜重、叶绿素含量及叶绿素荧光的相关指标和抗氧化酶活性。由此可知,外源SA通过提高栝楼抗氧化酶活性及光合作用能力增强栝楼抗铝毒能力。由隶属函数分析得出,SA具有缓解铝胁迫的效果,但并不能消除铝胁迫对栝楼生长的抑制作用。%A solution culture experiment was conducted to study the effects of different SA concentration on growth characteristics,photosynthesis,oxidation resistance,UV-B absorbing compounds and MDA content of two Trichosanthes kirilowii cultivars,Anguo(Al-tolerant genotype) and Pujiang(Al-sensitive genotype),under 800 μmol/L aluminum stress.The results showed that 800 μmol/L Al treated for 15 days,the relative root length,plant height and fresh shoot weight,chlorophyll content,the maximum energy conversion efficiency(Fv/Fm),maximum fluorescence yield(Fm) and electron transport rate(ETR) were significantly lower of the two T.kirilowii cultivars.SOD,CAT activity changed in the opposite trend,indicating the differences of the two T.kirilowii cultivars in aluminum tolerance,POD activity and UV-B absorbing compounds decreased,MDA content and initial

  1. SlDEAD31, a Putative DEAD-Box RNA Helicase Gene, Regulates Salt and Drought Tolerance and Stress-Related Genes in Tomato.

    Directory of Open Access Journals (Sweden)

    Mingku Zhu

    Full Text Available The DEAD-box RNA helicases are involved in almost every aspect of RNA metabolism, associated with diverse cellular functions including plant growth and development, and their importance in response to biotic and abiotic stresses is only beginning to emerge. However, none of DEAD-box genes was well characterized in tomato so far. In this study, we reported on the identification and characterization of two putative DEAD-box RNA helicase genes, SlDEAD30 and SlDEAD31 from tomato, which were classified into stress-related DEAD-box proteins by phylogenetic analysis. Expression analysis indicated that SlDEAD30 was highly expressed in roots and mature leaves, while SlDEAD31 was constantly expressed in various tissues. Furthermore, the expression of both genes was induced mainly in roots under NaCl stress, and SlDEAD31 mRNA was also increased by heat, cold, and dehydration. In stress assays, transgenic tomato plants overexpressing SlDEAD31 exhibited dramatically enhanced salt tolerance and slightly improved drought resistance, which were simultaneously demonstrated by significantly enhanced expression of multiple biotic and abiotic stress-related genes, higher survival rate, relative water content (RWC and chlorophyll content, and lower water loss rate and malondialdehyde (MDA production compared to wild-type plants. Collectively, these results provide a preliminary characterization of SlDEAD30 and SlDEAD31 genes in tomato, and suggest that stress-responsive SlDEAD31 is essential for salt and drought tolerance and stress-related gene regulation in plants.

  2. SlDEAD31, a Putative DEAD-Box RNA Helicase Gene, Regulates Salt and Drought Tolerance and Stress-Related Genes in Tomato.

    Science.gov (United States)

    Zhu, Mingku; Chen, Guoping; Dong, Tingting; Wang, Lingling; Zhang, Jianling; Zhao, Zhiping; Hu, Zongli

    2015-01-01

    The DEAD-box RNA helicases are involved in almost every aspect of RNA metabolism, associated with diverse cellular functions including plant growth and development, and their importance in response to biotic and abiotic stresses is only beginning to emerge. However, none of DEAD-box genes was well characterized in tomato so far. In this study, we reported on the identification and characterization of two putative DEAD-box RNA helicase genes, SlDEAD30 and SlDEAD31 from tomato, which were classified into stress-related DEAD-box proteins by phylogenetic analysis. Expression analysis indicated that SlDEAD30 was highly expressed in roots and mature leaves, while SlDEAD31 was constantly expressed in various tissues. Furthermore, the expression of both genes was induced mainly in roots under NaCl stress, and SlDEAD31 mRNA was also increased by heat, cold, and dehydration. In stress assays, transgenic tomato plants overexpressing SlDEAD31 exhibited dramatically enhanced salt tolerance and slightly improved drought resistance, which were simultaneously demonstrated by significantly enhanced expression of multiple biotic and abiotic stress-related genes, higher survival rate, relative water content (RWC) and chlorophyll content, and lower water loss rate and malondialdehyde (MDA) production compared to wild-type plants. Collectively, these results provide a preliminary characterization of SlDEAD30 and SlDEAD31 genes in tomato, and suggest that stress-responsive SlDEAD31 is essential for salt and drought tolerance and stress-related gene regulation in plants.

  3. Variation in Dehydration Tolerance, ABA Sensitivity and Related Gene Expression Patterns in D-Genome Progenitor and Synthetic Hexaploid Wheat Lines

    Directory of Open Access Journals (Sweden)

    Yumeto Kurahashi

    2009-06-01

    Full Text Available The wild wheat Aegilops tauschii Coss. has extensive natural variation available for breeding of common wheat. Drought stress tolerance is closely related to abscisic acid (ABA sensitivity. In this study, 17 synthetic hexaploid wheat lines, produced by crossing the tetraploid wheat cultivar Langdon with 17 accessions of Ae. tauschii, were used for comparative analysis of natural variation in drought tolerance and ABA sensitivity. Ae. tauschii showed wide natural variation, with weak association between the traits. Drought-sensitive accessions of Ae. tauschii exhibited significantly less ABA sensitivity. D-genome variations observed at the diploid genome level were not necessarily reflected in synthetic wheats. However, synthetic wheats derived from the parental Ae. tauschii accessions with high drought tolerance were significantly more tolerant to drought stress than those from drought-sensitive accessions. Moreover, synthetic wheats with high drought tolerance showed significantly higher ABA sensitivity than drought-sensitive synthetic lines. In the hexaploid genetic background, therefore, weak association of ABA sensitivity with drought tolerance wasobserved. To study differences in gene expression patterns between stress-tolerant and -sensitive lines, levels of two Cor/Lea and three transcription factor gene transcripts were compared. The more tolerant accession of Ae. tauschii tended to accumulate more abundant transcripts of the examined genes than the sensitive accession under stress conditions. The expression patterns in the synthetic wheats seemed to be additive for parental lines exposed to drought and ABA treatments. However, the transcript levels of transcription factor genes in the synthetic wheats did not necessarily correspond to the postulated levels based on expression in parental lines. Allopolyploidization altered the expression levels of the stress-responsive genes in synthetic wheats.

  4. Integration of gene-based markers in a pearl millet genetic map for identification of candidate genes underlying drought tolerance quantitative trait loci

    Directory of Open Access Journals (Sweden)

    Sehgal Deepmala

    2012-01-01

    Full Text Available Abstract Background Identification of genes underlying drought tolerance (DT quantitative trait loci (QTLs will facilitate understanding of molecular mechanisms of drought tolerance, and also will accelerate genetic improvement of pearl millet through marker-assisted selection. We report a map based on genes with assigned functional roles in plant adaptation to drought and other abiotic stresses and demonstrate its use in identifying candidate genes underlying a major DT-QTL. Results Seventy five single nucleotide polymorphism (SNP and conserved intron spanning primer (CISP markers were developed from available expressed sequence tags (ESTs using four genotypes, H 77/833-2, PRLT 2/89-33, ICMR 01029 and ICMR 01004, representing parents of two mapping populations. A total of 228 SNPs were obtained from 30.5 kb sequenced region resulting in a SNP frequency of 1/134 bp. The positions of major pearl millet linkage group (LG 2 DT-QTLs (reported from crosses H 77/833-2 × PRLT 2/89-33 and 841B × 863B were added to the present consensus function map which identified 18 genes, coding for PSI reaction center subunit III, PHYC, actin, alanine glyoxylate aminotransferase, uridylate kinase, acyl-CoA oxidase, dipeptidyl peptidase IV, MADS-box, serine/threonine protein kinase, ubiquitin conjugating enzyme, zinc finger C- × 8-C × 5-C × 3-H type, Hd3, acetyl CoA carboxylase, chlorophyll a/b binding protein, photolyase, protein phosphatase1 regulatory subunit SDS22 and two hypothetical proteins, co-mapping in this DT-QTL interval. Many of these candidate genes were found to have significant association with QTLs of grain yield, flowering time and leaf rolling under drought stress conditions. Conclusions We have exploited available pearl millet EST sequences to generate a mapped resource of seventy five new gene-based markers for pearl millet and demonstrated its use in identifying candidate genes underlying a major DT-QTL in this species. The reported gene

  5. Genetic mapping of a 7R Al tolerance QTL in triticale (x Triticosecale Wittmack).

    Science.gov (United States)

    Niedziela, A; Bednarek, P T; Labudda, M; Mańkowski, D R; Anioł, A

    2014-02-01

    Triticale (x Triticosecale Wittmack) is a relatively new cereal crop. In Poland, triticale is grown on 12 % of arable land ( http://www.stat.gov.pl ). There is an increasing interest in its cultivation due to lowered production costs and increased adaptation to adverse environmental conditions. However, it has an insufficient tolerance to the presence of aluminum ions (Al(3+)) in the soil. The number of genes controlling aluminum tolerance in triticale and their chromosomal location is not known. Two F2 mapping biparental populations (MP1 and MP15) segregating for aluminum (Al) tolerance were tested with AFLP, SSR, DArT, and specific PCR markers. Genetic mapping enabled the construction of linkage groups representing chromosomes 7R, 5R and 2B. Obtained linkage groups were common for both mapping populations and mostly included the same markers. Composite interval mapping (CIM) allowed identification of a single QTL that mapped to the 7R chromosome and explained 25 % (MP1) and 36 % (MP15) of phenotypic variation. The B1, B26 and Xscm150 markers were 0.04 cM and 0.02 cM from the maximum of the LOD function in the MP1 and MP15, respectively and were highly associated with aluminum tolerance as indicated by Kruskal-Wallis nonparametric test. Moreover, the molecular markers B1, B26, Xrems1162 and Xscm92, previously associated with the Alt4 locus that encoded an aluminum-activated malate transporter (ScALMT1) that was involved in Al tolerance in rye (Secale cereale) also mapped within QTL. Biochemical analysis of plants represented MP1 and MP15 mapping populations confirmed that the QTL located on 7R chromosome in both mapping populations is responsible for Al tolerance.

  6. A versatile and efficient markerless gene disruption system for Acidithiobacillus thiooxidans: application for characterizing a copper tolerance related multicopper oxidase gene.

    Science.gov (United States)

    Wen, Qing; Liu, Xiangmei; Wang, Huiyan; Lin, Jianqun

    2014-11-01

    The acidophilic bioleaching bacteria can usually survive in high concentrations of copper ions because of their special living environment. However, little is known about the copper homeostatic mechanisms of Acidithiobacillus thiooxidans, an important member of bioleaching bacteria. Here, a putative multicopper oxidase gene (cueO) was detected from the draft genome of A. thiooxidans ATCC 19377. The transcriptional level of cueO in response to 10 mM CuSO₄was upregulated 25.01 ± 2.59 folds. The response of P(cueO) to copper was also detected and might be stimulated by a putative CueR protein. Then, by using the counter-selectable marker lacZ and enhancing the expression of endonuclease I-SceI with tac promoter, a modified markerless gene disruption system was developed and the cueO gene disruption mutant (ΔcueO) of A. thiooxidans was successfully constructed with a markedly improved second homologous recombination frequency of 0.28 ± 0.048. The ΔcueO mutant was more sensitive to external copper and nearly completely lost the phenoloxidase activity; however, the activity could be restored after complementing the cueO gene. All results suggest the close relation of cueO gene to copper tolerance in A. thiooxidans. In addition, the developed efficient markerless gene knockout method can also be introduced into other Acidithiobacillus strains.

  7. Divergent regulation of CBF regulon on cold tolerance and plant phenotype in cassava overexpressing Arabidopsis CBF3 gene

    Directory of Open Access Journals (Sweden)

    Dong An

    2016-12-01

    Full Text Available Cassava is a tropical origin plant that is sensitive to chilling stress. In order to understand the CBF cold response pathway, a well-recognized regulatory mechanism in temperate plants, in cassava, overexpression of an Arabidopsis CBF3 gene is studied. This gene renders cassava increasingly tolerant to cold and drought stresses but is associated with retarded plant growth, leaf curling, reduced storage root yield, and reduced anthocyanin accumulation in a transcript abundance-dependent manner. Physiological analysis revealed that the transgenic cassava increased proline accumulation, reduced malondialdehyde production, and electrolyte leakage under cold stress. These transgenic lines also showed high relative water content when faced with drought. The expression of partial CBF-targeted genes in response to cold displayed temporal and spatial variations in the wild-type and transgenic plants: highly inducible in leaves and less altered in apical buds. In addition, anthocyanin accumulation was inhibited by downregulating the expression of genes involved in its biosynthesis and by interplaying between the CBF3 and the endogenous transcription factors. Thus, the heterologous CBF3 modulates the expression of stress-related genes and carries out a series of physiological adjustments under stressful conditions, showing a varied regulation pattern of CBF regulon from that of cassava CBFs.

  8. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage

    Science.gov (United States)

    Guo, Peiguo; Baum, Michael; Grando, Stefania; Ceccarelli, Salvatore; Bai, Guihua; Li, Ronghua; von Korff, Maria; Varshney, Rajeev K.; Graner, Andreas; Valkoun, Jan

    2009-01-01

    Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas worldwide. Identification of the genes responsible for drought tolerance in barley (Hordeum vulgare L.) will facilitate understanding of the molecular mechanisms of drought tolerance, and also facilitate the genetic improvement of barley through marker-assisted selection or gene transformation. To monitor the changes in gene expression at the transcriptional level in barley leaves during the reproductive stage under drought conditions, the 22K Affymetrix Barley 1 microarray was used to screen two drought-tolerant barley genotypes, Martin and Hordeum spontaneum 41-1 (HS41-1), and one drought-sensitive genotype Moroc9-75. Seventeen genes were expressed exclusively in the two drought-tolerant genotypes under drought stress, and their encoded proteins may play significant roles in enhancing drought tolerance through controlling stomatal closure via carbon metabolism (NADP malic enzyme, NADP-ME, and pyruvate dehydrogenase, PDH), synthesizing the osmoprotectant glycine-betaine (C-4 sterol methyl oxidase, CSMO), generating protectants against reactive-oxygen-species scavenging (aldehyde dehydrogenase,ALDH, ascorbate-dependent oxidoreductase, ADOR), and stabilizing membranes and proteins (heat-shock protein 17.8, HSP17.8, and dehydrin 3, DHN3). Moreover, 17 genes were abundantly expressed in Martin and HS41-1 compared with Moroc9-75 under both drought and control conditions. These genes were possibly constitutively expressed in drought-tolerant genotypes. Among them, seven known annotated genes might enhance drought tolerance through signalling [such as calcium-dependent protein kinase (CDPK) and membrane steroid binding protein (MSBP)], anti-senescence (G2 pea dark accumulated protein, GDA2), and detoxification (glutathione S-transferase, GST) pathways. In addition, 18 genes, including those encoding Δl-pyrroline-5-carboxylate synthetase (P5CS), protein phosphatase 2C

  9. Improved drought tolerance in wheat plants overexpressing a synthetic bacterial cold shock protein gene SeCspA

    Science.gov (United States)

    Yu, Tai-Fei; Xu, Zhao-Shi; Guo, Jin-Kao; Wang, Yan-Xia; Abernathy, Brian; Fu, Jin-Dong; Chen, Xiao; Zhou, Yong-Bin; Chen, Ming; Ye, Xing-Guo; Ma, You-Zhi

    2017-01-01

    Cold shock proteins (CSPs) enhance acclimatization of bacteria to adverse environmental circumstances. The Escherichia coli CSP genes CspA and CspB were modified to plant-preferred codon sequences and named as SeCspA and SeCspB. Overexpression of exogenous SeCspA and SeCspB in transgenic Arabidopsis lines increased germination rates, survival rates, and increased primary root length compared to control plants under drought and salt stress. Investigation of several stress-related parameters in SeCspA and SeCspB transgenic wheat lines indicated that these lines possessed stress tolerance characteristics, including lower malondialdehyde (MDA) content, lower water loss rates, lower relative Na+ content, and higher chlorophyll content and proline content than the control wheat plants under drought and salt stresses. RNA-seq and qRT-PCR expression analysis showed that overexpression of SeCsp could enhance the expression of stress-responsive genes. The field experiments showed that the SeCspA transgenic wheat lines had great increases in the 1000-grain weight and grain yield compared to the control genotype under drought stress conditions. Significant differences in the stress indices revealed that the SeCspA transgenic wheat lines possessed significant and stable improvements in drought tolerance over the control plants. No such improvement was observed for the SeCspB transgenic lines under field conditions. Our results indicated that SeCspA conferred drought tolerance and improved physiological traits in wheat plants. PMID:28281578

  10. IL-10 Gene Modified Dendritic Cells Inhibit T Helper Type 1-Mediated Alloimmune Responses and Promote Immunological Tolerance in Diabetes

    Institute of Scientific and Technical Information of China (English)

    Huifen Zhu; Feili Gong; Wenhong Qiu; Ping Lei; Wei Zhou; Xue Wen; Fengrong He; Li Li; Hong Dai; Guanxin Shen

    2008-01-01

    Dendritic cells (DCs)have the potency to regulate the outcome of autoimmunity through the modulation of immune responses. The induction of antigen specific tolerance is critical for prevention and treatment of allograft rejection. In the present Study, we transfected IL-10 gene into DCs and investigated their effect on inhibition of lymphocyte activity in vitro and induction of immune tolerance on islet allograft in mice. An IDDM c57BL, 6 mouse model was induced by streptozotocin. The islet cells isolated from the BALB/c mice were transplanted into the kidney capules of the model mice followed by injection of IL-10 modified DCs(mDCs).The results showed that mDCs could significantly inhibit T lymphocyte proliferation mediated by aliotype cells and induce its apoptosis, whereas, unmodified DCs(umDCs)could promote the murine lymphocyte proliferation markedly. The injection of mDCs could prolong the survival of allotype islet transplanted IDDM mice. The average plasma glucose(PG)level in mDCs treated mice returned to normal within 3 days and lasted for about 2 weeks. The rejection response in control mice occurred for 5 days after transplantation. The level of IFN-γ was lower while IL-4 Was higher in mDCs treated mice than that in umDCs treated mice. which indicated that Thl/Th2 deviation occurred.Our studies suggest that IL. 10 gene modified DCs can induce the immune tolerance to islet graft and prolong survival of the recipients by the inhibiting of T cell proliferation in allotype mice. Cellular & Molecular Immunology. 2008;5(1):41-46.

  11. Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum

    Indian Academy of Sciences (India)

    Xiuhong Yang; Chao Sun; Yuanlei Hun; Zhongping Lin

    2008-03-01

    A RING zinc finger ankyrin protein gene, designated AdZFP1, was isolated from drought-tolerant Artemisia desertorum Spreng by mRNA differential display and RACE. Its cDNA was 1723 bp and encoded a putative protein of 445 amino acids with a predicted molecular mass of 47.9 kDa and an isoelectric point (pI) of 7.49. A typical C3HC4-type RING finger domain was found at the C-terminal region of the AdZFP1 protein, and several groups of ankyrin repeats were found at the N-terminal region. Alignments of amino acid sequence showed that AdZFP1 was 66% identical to the Arabidopsis thaliana putative RING zinc finger ankyrin protein AAN31869. Transcriptional analysis showed that AdZFP1 was inducible under drought stress in root, stem and leaf of the plant. Semi-quantitative reverse-transcriptase-polymerase chain reaction (RT-PCR) analysis showed that the transcript of AdZFP1 was strongly induced by exogenous abscisic acid (ABA) and also by salinity, cold and heat to some extent. Overexpression of the AdZFP1 gene in transgenic tobacco enhanced their tolerance to drought stress.

  12. The Cotton WRKY Gene GhWRKY41 Positively Regulates Salt and Drought Stress Tolerance in Transgenic Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Xiaoqian Chu

    Full Text Available WRKY transcription factors constitute a very large family of proteins in plants and participate in modulating plant biological processes, such as growth, development and stress responses. However, the exact roles of WRKY proteins are unclear, particularly in non-model plants. In this study, Gossypium hirsutum WRKY41 (GhWRKY41 was isolated and transformed into Nicotiana benthamiana. Our results showed that overexpression of GhWRKY41 enhanced the drought and salt stress tolerance of transgenic Nicotiana benthamiana. The transgenic plants exhibited lower malondialdehyde content and higher antioxidant enzyme activity, and the expression of antioxidant genes was upregulated in transgenic plants exposed to osmotic stress. A β-glucuronidase (GUS staining assay showed that GhWRKY41 was highly expressed in the stomata when plants were exposed to osmotic stress, and plants overexpressing GhWRKY41 exhibited enhanced stomatal closure when they were exposed to osmotic stress. Taken together, our findings demonstrate that GhWRKY41 may enhance plant tolerance to stress by functioning as a positive regulator of stoma closure and by regulating reactive oxygen species (ROS scavenging and the expression of antioxidant genes.

  13. OsPOP5, A Prolyl Oligopeptidase Family Gene from Rice Confers Abiotic Stress Tolerance in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Ping-Rong Wang

    2013-10-01

    Full Text Available The prolyl oligopeptidase family, which is a group of serine peptidases, can hydrolyze peptides smaller than 30 residues. The prolyl oligopeptidase family in plants includes four members, which are prolyl oligopeptidase (POP, EC3.4.21.26, dipeptidyl peptidase IV (DPPIV, EC3.4.14.5, oligopeptidase B (OPB, EC3.4.21.83, and acylaminoacyl peptidase (ACPH, EC3.4.19.1. POP is found in human and rat, and plays important roles in multiple biological processes, such as protein secretion, maturation and degradation of peptide hormones, and neuropathies, signal transduction and memory and learning. However, the function of POP is unclear in plants. In order to study POP function in plants, we cloned the cDNA of the OsPOP5 gene from rice by nested-PCR. Sequence analysis showed that the cDNA encodes a protein of 596 amino acid residues with Mw ≈ 67.29 kD. In order to analyze the protein function under different abiotic stresses, OsPOP5 was expressed in Escherichia coli. OsPOP5 protein enhanced the tolerance of E. coli to high salinity, high temperature and simulated drought. The results indicate that OsPOP5 is a stress-related gene in rice and it may play an important role in plant tolerance to abiotic stress.

  14. Overexpression of the Lotus corniculatus Soloist Gene LcAP2/ERF107 Enhances Tolerance to Salt Stress.

    Science.gov (United States)

    Sun, Zhan-Min; Zhou, Mei-Liang; Dan-Wang; Tang, Yi-Xiong; Lin, Min; Wu, Yan-Min

    2016-01-01

    The AP2/ERF play a key role in multiple stress responses in plants. we here report a novel salt stress-related gene, LcAP2/ERF107 that encodes an AP2/ERF protein in Lotus corniculatus cultivar Leo. LcAP2/ERF107 was classified into the soloist subfamiliy based on phylogenetic relationship. The transcription of LcAP2/ERF107 were strongly induced by salt and other phytohormones (ABA, ACC, MeJA). A subcellular localization experiment indicated that LcAP2/ERF107 is a nuclear protein that activates transcription. LcAP2/ERF107 overexpression in Arabidopsis resulted in pleiotropic phenotypes, including higher seed germination rate and transgenic plants with enhanced tolerance to salt stress. Further, under salt tolerance the transgenic lines elevated the relative moisture content; however, the relative electrolyte leakage was lower than in control plants. The expression levels of indicative genes RD22, RD29A, LEA4-5, P5CS1 and P5CS2 were found to be increased in the transgenic plants compared with the WT plants. These results indicated that LcAP2/ERF107 play an important role in the responses of plant to salt stress.

  15. Aluminum alloy

    Science.gov (United States)

    Blackburn, Linda B. (Inventor); Starke, Edgar A., Jr. (Inventor)

    1989-01-01

    This invention relates to aluminum alloys, particularly to aluminum-copper-lithium alloys containing at least about 0.1 percent by weight of indium as an essential component, which are suitable for applications in aircraft and aerospace vehicles. At least about 0.1 percent by weight of indium is added as an essential component to an alloy which precipitates a T1 phase (Al2CuLi). This addition enhances the nucleation of the precipitate T1 phase, producing a microstructure which provides excellent strength as indicated by Rockwell hardness values and confirmed by standard tensile tests.

  16. Freezing tolerance revisited-effects of variable temperatures on gene regulation in temperate grasses and legumes.

    Science.gov (United States)

    Kovi, Mallikarjuna Rao; Ergon, Åshild; Rognli, Odd Arne

    2016-10-01

    Climate change creates new patterns of seasonal climate variation with higher temperatures, longer growth seasons and more variable winter climates. This is challenging the winter survival of perennial herbaceous plants. In this review, we focus on the effects of variable temperatures during autumn/winter/spring, and its interactions with light, on the development and maintenance of freezing tolerance. Cold temperatures induce changes at several organizational levels in the plant (cold acclimation), leading to the development of freezing tolerance, which can be reduced/lost during warm spells (deacclimation) in winters, and attained again during cold spells (reacclimation). We summarize how temperature interacts with components of the light regime (photoperiod, PSII excitation pressure, irradiance, and light quality) in determining changes in the transcriptome, proteome and metabolome.

  17. Comparison of four glyphosate tolerance genes%四个抗草甘膦基因的抗性比较

    Institute of Scientific and Technical Information of China (English)

    刘健; 肖雅文; 芦佳; 吴忠义; 张中保; 徐杰; 姚磊

    2015-01-01

    草甘膦抗性是当代农业重要的农艺性状。为了选择最佳的抗性基因用于植物筛选标记,通过选取 cp4-epsps 、GR79-epsps 、gat4621和 GAT 四个草甘膦抗性基因进行比较,在拟南芥中验证各基因对草甘膦的抗性。4个基因的转化苗经4个浓度的草甘膦喷施检测,结果显示,GAT 类基因的抗性明显高于epsps 类基因,基因间的差异达到了极显著水平。gat4621基因对草甘膦的抗性最好,在各浓度下存活率均表现为最高值,且抗性稳定。国内发掘的 GAT 基因对草甘膦也表现出良好的抗性。GAT 类基因的拟南芥转化苗在喷施高浓度草甘膦条件下出现严重抽苔抑制;但在停施草甘膦后抑制解除,且可以开花结实。转 epsps 类基因可以获得高抗草甘膦植株,但在花期喷施草甘膦将造成败育。从基因大小及抗性强弱考虑,GAT 类基因作为筛选标记基因应该更为适合。%Glyphosate tolerance is an important agronomic trait in modern agriculture.In order to determine the best glyphosate tolerance gene for plant selectable markers we compared four glyphosate tolerance genes,cp4-epsps ,GR79-epsps ,gat4621 and GAT,in Arabidopsis .Four transgenic plants harboring each gene were trea-ted with four different rates of glyphosate.The results showed that the resistance of plants with GAT gene was significantly higher than plants with the epsps gene.Plants with the gat4621 gene had the highest survival rate at all herbicide rates.The plants with the domestic GAT gene also had strong resistance.Reproductive devel-opment of Arabidopsis plants with the GAT gene was suppressed at higher glyphosate application rates.It was concluded that the GAT gene was more suitable as a selectable marker gene.

  18. Nylon Filter Arrays Reveal Differential Expression of Expressed Sequence Tags in Wheat Roots Under Aluminum Stress

    Institute of Scientific and Technical Information of China (English)

    Kai XIAO; Gui-Hua BAI; Brett F CARVER

    2005-01-01

    To enrich differentially expressed sequence tags (ESTs) for aluminum (Al) tolerance, cDNA subtraction libraries were generated from Al-stressed roots of two wheat (Triticum aestivum L.) nearisogenic lines (NILs) contrasting in Al-tolerance gene(s) from the Al-tolerant cultivar Atlas 66, using suppression subtractive hybridization (SSH). Expression patterns of the ESTs were investigated with nylon filter arrays containing 614 cDNA clones from the subtraction library. Gene expression profiles from macroarray analysis indicated that 25 ESTs were upregulated in the tolerant NIL in response to Al stress. The result from Northern analysis of selected upregulated ESTs was similar to that from macroarray analysis. These highly expressed ESTs showed high homology with genes involved in signal transduction, oxidative stress alleviation, membrane structure, Mg2+ transportation, and other functions. Under Al stress, the Al-tolerant NIL may possess altered structure or function of the cell wall, plasma membrane, and mitochondrion. The wheat response to Al stress may involve complicated defense-related signaling and metabolic pathways.The present experiment did not detect any induced or activated genes involved in the synthesis of malate and other organic acids in wheat under Al-stress.

  19. Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress.

    Science.gov (United States)

    Checker, Vibha G; Chhibbar, Anju K; Khurana, Paramjit

    2012-10-01

    Coping with different kinds of biotic and abiotic stresses is the foundation of sustainable agriculture. Although conventional breeding and marker-assisted selection are being employed in mulberry (Morus indica L.) to develop better varieties, nonetheless the longer time periods required for these approaches necessitates the use of precise biotechnological approaches for sustainable agriculture. In an attempt to improve stress tolerance of mulberry, an important plant of the sericulture industry, an encoding late embryogenesis abundant gene from barley (HVA1) was introduced into mulberry plants by Agrobacterium-mediated transformation. Transgenic mulberry with barley Hva1 under a constitutive promoter actin1 was shown to enhance drought and salinity tolerance. Here, we report that overexpression of barley Hva1 also confers cold tolerance in transgenic mulberry. Further, barley Hva1 gene under control of a stress-inducible promoter rd29A can effectively negate growth retardation under non-stress conditions and confer stress tolerance in transgenic mulberry. Transgenic lines display normal morphology to enhanced growth and an increased tolerance against drought, salt and cold conditions as measured by free proline, membrane stability index and PSII activity. Protein accumulation was detected under stress conditions confirming inductive expression of HVA1 in transgenics. Investigations to assess stress tolerance of these plants under field conditions revealed an overall better performance than the non-transgenic plants. Enhanced expression of stress responsive genes such as Mi dnaJ and Mi 2-cysperoxidin suggests that Hva1 can regulate downstream genes associated with providing abiotic stress tolerance. The investigation of transgenic lines presented here demonstrates the acquisition of tolerance against drought, salt and cold stress in plants overexpressing barley Hva1, indicating that Arabidopsis rd29A promoter can function in mulberry.

  20. Genome-wide RNAi screen reveals the E3 SUMO-protein ligase gene SIZ1 as a novel determinant of furfural tolerance in Saccharomyces cerevisiae

    OpenAIRE

    Xiao, Han; Zhao, Huimin

    2014-01-01

    Background Furfural is a major growth inhibitor in lignocellulosic hydrolysates and improving furfural tolerance of microorganisms is critical for rapid and efficient fermentation of lignocellulosic biomass. In this study, we used the RNAi-Assisted Genome Evolution (RAGE) method to select for furfural resistant mutants of Saccharomyces cerevisiae, and identified a new determinant of furfural tolerance. Results By using a genome-wide RNAi (RNA-interference) screen in S. cerevisiae for genes in...

  1. Development of highly glyphosate-tolerant tobacco by coexpression of glyphosate acetyltransferase gat and EPSPS G2-aroA genes

    Institute of Scientific and Technical Information of China (English)

    Baoqing; Dun; Xujing; Wang; Wei; Lu; Ming; Chen; Wei; Zhang; Shuzhen; Ping; Zhixing; Wang; Baoming; Zhang; Min; Lin

    2014-01-01

    The widely used herbicide glyphosate targets 5-enolpyruvylshikimate-3-phosphate synthase(EPSPS).Glyphosate acetyltransferase(GAT)effectively detoxifies glyphosate by N-acetylation.With the aim of identifying a new strategy for development of glyphosate-tolerant crops,the plant expression vector pG2-GAT harboring gat and G2-aroA(encoding EPSPS)has been transformed into tobacco(Nicotiana tabacum)to develop novel plants with higher tolerance to glyphosate.Results from Southern and Western blotting analyses indicated that the target genes were integrated into tobacco chromosomes and expressed effectively at the protein level.Glyphosate tolerance was compared among transgenic tobacco plants containing gat,G2-aroA,or both genes.Plants containing both gat and G2-aroA genes were the most glyphosate-tolerant.This study has shown that a combination of different strategies may result in higher tolerance in transgenic crops,providing a new approach for development of glyphosate-tolerant crops.

  2. Candidate genes for drought tolerance and improved productivity in rice (Oryza sativa L.)

    Indian Academy of Sciences (India)

    M S Vinod; Naveen Sharma; K Manjunatha; Adnan Kanbar; N B Prakash; H E Shashidhar

    2006-03-01

    Candidate genes are sequenced genes of known biological action involved in the development or physiology of a trait. Twenty-one putative candidate genes were designed after an exhaustive search in the public databases along with an elaborate literature survey for candidate gene products and/or regulatory sequences associated with enhanced drought resistance. The downloaded sequences were then used to design primers considering the flanking sequences as well. Polymerase chain reaction (PCR) performed on 10 diverse cultivars that involved Japonica, Indica and local accessions, revealed 12 polymorphic candidate genes. Seven polymorphic candidate genes were then utilized to genotype 148 individuals of CT9993 × IR62266 doubled haploid (DH) mapping population. The segregation data were tested for deviation from the expected Mendelian ratio (1:1) using a Chi-square test (<1%). Based on this, four candidate genes were assessed to be significant and the remaining three, as non-significant. All the significant candidate genes were biased towards CT9993, the female parent in the DH mapping population. Single-marker analysis strongly associated ( < 1%) them to different traits under both well-watered and low-moisture stress conditions. Two candidate genes, EXP15 and EXP13, were found to be associated with root number and silicon content in the stem respectively, under both well-watered and low-moisture stress conditions.

  3. Trigo duro: tolerância à toxicidade de alumínio, manganês e ferro em soluções nutritivas Durum wheat: tolerance to aluminum, manganese and iron toxicities in nutrient solutions

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1995-01-01

    Full Text Available Avaliou-se o comportamento diferencial de 23 linhagens de trigo duro (Triticum durum L. em compraração com os seguintes cultivares de trigo (T. aestivum L.: IAC-24, BH-1146, Siete Cerros e IAC-60, quanto aos níveis de Al3+ (0;0,2;0,4; 0,6; 0,8 e 1,0 mg/L, de Mn2+ (0,11; 300; 600 c 1.200 mg/L e de Fe2+ (0,56; 5; 10 e 20 mg/L em solução nutritiva. Os cultivares de trigo Siete Cerros (sensível à toxicidade de Al3+, BH-1146, IAC-60 e IAC-24 (tolerantes à toxicidade de Al3+, exibiram crescimento das raízes na presença de 1 mg/L de Al3+, e todas as linhagens de trigo duro avaliadas foram totalmente sensíveis a 0,4 mg/L de Al3+, com paralisação irreversível do crescimento das raízes. O aumento das concentrações de Mn2+(0,11 a 1.200 mg/L e de Fe2+ (0,56 a 20 mg/L nas soluções causou uma redução significativa no comprimento das raízes dos genótipos em estudo. As linhagens de trigo duro I (Avetoro "S" x Anhinga "S" - Purcell "S"/D.67.2, 2 (Cando - Yavaros "S", 6 (Chen "S" e 8 (Carcomum "S" apresentaram-se muito tolerantes à toxicidade de Mn2+ em relação ao controle 'Siete Cerros'. O 'Siete Cerros' e as linhagens de trigo duro 1, 6, 12 (CI 14955 x Yavaros "S"- Gediz "S"/Tropic Bird, 16 e 21 (Swan "S" c 20 (Boyeros "S"/Cocorit-71/5/Crane/Ganso//Marte "S"/3/Tildillo "S"/4/ Memo "S" exibiram tolerância à presença de elevadas quantidades de Fe2+ nas soluções nutritivas.Twenty three durum wheat inbred lines were evaluated with four bread wheat cultivars (IAC-24, BH-1146, Siete Cerros and IAC-60 in three experiments, using nutrient solutions. In the first experiment, the following levels of Al3+ were used: 0; 0.2; 0.4; 0.6; 0.8 and 1.0 mg/L; in the second experiment, the following levels of Mn2+ were used: 0.11; 300; 600 and 1.200 mg/L; and in the third experiment, Fe2+ was used at: 0.56; 5; 10 and 1.200 mg/L. The wheat cultivars Siete Cerros (sensitive to Al3+ toxicity and BH-1146, IAC-24 and IAC-60 (tolerant to Al3+ toxicity

  4. Field Supervisory Test of DREB-Transgenic Populus: Salt Tolerance, Long-Term Gene Stability and Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Nan Lu

    2014-05-01

    Full Text Available Improving saline resistance may be useful for reducing environmental susceptibility and improving yields in poplar plantations. However, the instability of genetically engineered traits and gene transfer reduce their usefulness and commercial value. To investigate whether the foreign gene is still present in the genome of receptor plants after seven years (i.e., long-term foreign gene stability and gene transfer, we randomly analyzed ten field-grown transgenic hybrid Populus ((Populus tomentosa × Populus bolleana × P. tomentosa carrying the DREB1 gene from Atriplex hortensis. The results of PCR and tissue culture experiments showed that AhDREB1 was present in the transgenic trees and was still expressed. However, the transcriptional expression level had decreased compared with that four years earlier. The PCR results also indicated no foreign gene in the genomic DNA of microorganisms in the soil near the transgenic poplars, indicating that no significant gene transfer had occurred from the transgenic poplars to the microorganisms at seven years after planting.

  5. Expression in Escherichia coli of Three Different Soybean Late Embryogenesis Abundant (LEA) Genes to Investigate Enhanced Stress Tolerance

    Institute of Scientific and Technical Information of China (English)

    Ying LAN; Dan CAI; Yi-Zhi ZHENG

    2005-01-01

    In order to identify the function of late embryogenesis abundant (LEA) genes, in vitro functional analyses were perfo rmed using an Escherichia coli heterologous expression system. Three soybean late embryogenesis abundant (LEA) genes, PM11 (GenBank accession No. AF004805; group 1), PM30 (AF1 17884; group 3), and ZLDE-2 (AY351918; group 2), were cloned and expressed in a pET-28a system.The gene products were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and identified by mass spectrometry. E. coli cells containing the recombinant plasmids or empty vector as controls were treated by salt and low temperature stress. Compared with control cells, the E. coli cells expressing either PM11 or PM30 showed a shorter lag period and improved growth when transferred to LB (Luria-Bertani) liquid media containing 800 mmol/L NaCl or 700 mmol/L KCl or after 4 ℃ treatment. E. coli cells expressing ZLDE-2 did not show obvious growth improvement both in either high KCl medium or after 4 ℃ treatment. The results indicate that the E. coli expression system is a simple, useful method to identify the functions of some stress-tolerant genes from plants.

  6. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression.

    Science.gov (United States)

    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

    2013-07-01

    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms.

  7. An efficient and reproducible protocol for the production of salt tolerant transgenic wheat plants expressing the Arabidopsis AtNHX1 gene.

    Science.gov (United States)

    Moghaieb, Reda E A; Sharaf, Ahmed N; Soliman, Mohamed H; El-Arabi, Nagwa I; Momtaz, Osama A

    2014-01-01

    We present an efficient method for the production of transgenic salt tolerant hexaploid wheat plants expressing the Arabidopsis AtNHX1 gene. Wheat mature zygotic embryos were isolated from two hexaploid bread wheat (Triticum aestivum) cultivars (namely: Gemmeiza 9 and Gemmeiza 10) and were transformed with the A. tumefaciens LBA4404 harboring the pBI-121 vector containing the AtNHX1 gene. Transgenic wheat lines that express the gus intron was obtained and used as control. The results confirmed that npt-II gene could be transmitted and expressed in the T2 following 3:1 Mendelian segregation while the control plant couldn't. The data indicate that, the AtNHX1 gene was integrated in a stable manner into the wheat genome and the corresponding transcripts were expressed. The transformation efficiency was 5.7 and 7.5% for cultivars Gemmeiza 10 and Gemmeiza 9, respectively. A greenhouse experiment was conducted to investigate the effect of AtNHX1 gene in wheat salt tolerance. The transgenic wheat lines could maintain high growth rate under salt stress condition (350 mM NaCl) while the control plant couldn't. The results confirmed that Na(+)/H(+) antiporter gene AtNHX1 increased salt tolerance by increasing Na(+) accumulation and keeping K+/Na(+) balance. Thus, transgenic plants showed high tolerance to salt stress and can be considered as a new genetic resource in breeding programs.

  8. Expression of acyl-lipid Delta12-desaturase gene in prokaryotic and eukaryotic cells and its effect on cold stress tolerance of potato.

    Science.gov (United States)

    Amiri, Reza Maali; Yur'eva, Natalia O; Shimshilashvili, Khristina R; Goldenkova-Pavlova, Irina V; Pchelkin, Vasiliy P; Kuznitsova, Elmira I; Tsydendambaev, Vladimir D; Trunova, Tamara I; Los, Dmitry A; Jouzani, Gholamreza Salehi; Nosov, Alexander M

    2010-03-01

    We report the expression profile of acyl-lipid Delta12-desaturase (desA) gene from Synechocystis sp. PCC6803 and its effect on cell membrane lipid composition and cold tolerance in prokaryotic (Escherichia coli) and eukaryotic (Solanum tuberosum) cells. For this purpose, a hybrid of desA and reporter gene encoding thermostable lichenase (licBM3) was constructed and used to transform these cells. The expression of this hybrid gene was measured using qualitative (Petri dish test, electrophoregram and zymogram) and quantitative methods (spectrometry and gas liquid chromatography assays). The maximum level of linoleic acid in the bacterial cells containing hybrid gene was 1.9% of total fatty acids. Cold stress tolerance assays using plant damage index and growth parameters showed that cold tolerance was enhanced in primary transgenic lines because of increased unsaturated fatty acid concentration in their lipids. The greatest content of 18:2 and 18:3 fatty acids in primary transgenic plants was observed for lines 2 (73%) and 3 (41%). Finally, our results showed that desaturase could enhance tolerance to cold stress in potato, and desaturase and lichenase retain their functionality in the structure of the hybrid protein where the enzymatic activity of target gene product was higher than in the case of reporter lichenase gene absence in the construction.

  9. Efficacy of methuselah gene mutation toward tolerance of dichlorvos exposure in Drosophila melanogaster.

    Science.gov (United States)

    Pandey, Ashutosh; Khatoon, Rehana; Saini, Sanjay; Vimal, Divya; Patel, Devendra Kumar; Narayan, Gopeshwar; Chowdhuri, Debapratim Kar

    2015-06-01

    Adverse reports on the exposure of organisms to dichlorvos (DDVP; an organophosphate insecticide) necessitate studies of organismal resistance/tolerance by way of pharmacological or genetic means. In the context of genetic modulation, a mutation in methuselah (mth; encodes a class II G-protein-coupled receptor (GPCR)) is reported to extend (~35%) the life span of Drosophila melanogaster and enhance their resistance to oxidative stress induced by paraquat exposure (short term, high level). A lack of studies on organismal tolerance of DDVP by genetic modulation prompted us to examine the protective efficacy of mth mutation in exposed Drosophila. Flies were exposed to 1.5 and 15.0 ng/ml DDVP for 12-48 h to examine oxidative stress endpoints and chemical resistance. After prolonged exposure of flies to DDVP, antioxidant enzyme activities, oxidative stress, glutathione content, and locomotor performance were assayed at various days (0, 10, 20, 30, 40, 50) of age. Flies with the mth mutation (mth(1)) showed improved chemical resistance and rescued redox impairment after acute DDVP exposure. Exposed mth(1) flies exhibited improved life span along with enhanced antioxidant enzyme activities and rescued oxidative perturbations and locomotor insufficiency up to middle age (~20 days) over similarly exposed w(1118) flies. However, at late (≥30 days) age, these benefits were undermined. Further, similarly exposed mth-knockdown flies showed effects similar to those observed in mth(1) flies. This study provides evidence of tolerance in organisms carrying a mth mutation against prolonged DDVP exposure and further warrants examination of similar class II GPCR signaling facets toward better organismal health.

  10. Gossypol-enhanced P450 gene pool contributes to cotton bollworm tolerance to a pyrethroid insecticide.

    Science.gov (United States)

    Tao, Xiao-Yuan; Xue, Xue-Yi; Huang, Yong-Ping; Chen, Xiao-Ya; Mao, Ying-Bo

    2012-09-01

    Cotton plants accumulate phytotoxins, including gossypol and related sesquiterpene aldehydes, to resist insect herbivores and pathogens. To counteract these defensive plant secondary metabolites, cotton bollworms (Helicoverpa armigera) elevate their production of detoxification enzymes, including cytochrome P450 monooxygenases (P450s). Besides their tolerance to phytotoxin, cotton bollworms have quickly developed resistance to deltamethrin, a widely used pyrethroid insecticide in cotton field. However, the relationship between host plant secondary metabolites and bollworm insecticide resistance is poorly understood. Here, we show that exogenously expressed CYP6AE14, a gossypol-inducible P450 of cotton bollworm, has epoxidation activity towards aldrin, an organochlorine insecticide, indicating that gossypol-induced P450s participate in insecticide metabolism. Gossypol-ingested cotton bollworm larvae showed higher midgut P450 enzyme activities and exhibited enhanced tolerance to deltamethrin. The midgut transcripts of bollworm larvae administrated with different phytochemicals and deltamethrin were then compared by microarray analysis, which showed that gossypol and deltamethrin induced the most similar P450 expression profiles. Gossypol-induced P450s exhibited high divergence and at least five of them (CYP321A1, CYP9A12, CYP9A14, CYP6AE11 and CYP6B7) contributed to cotton bollworm tolerance to deltamethrin. Knocking down one of them, CYP9A14, by plant-mediated RNA interference (RNAi) rendered the larvae more sensitive to the insecticide. These data demonstrate that generalist insects can take advantage of secondary metabolites from their major host plants to elaborate defence systems against other toxic chemicals, and impairing this defence pathway by RNAi holds a potential for reducing the required dosages of agrochemicals in pest control.

  11. Cloning of a cystatin gene from sugar beet M14 that can enhance plant salt tolerance.

    Science.gov (United States)

    Wang, Yuguang; Zhan, Yanan; Wu, Chuan; Gong, Shilong; Zhu, Ning; Chen, Sixue; Li, Haiying

    2012-08-01

    An open reading frame encoding a cysteine protease inhibitor, cystatin was isolated from the buds of sugar beet monosomic addition line M14 (BvM14) using 5'-/3'-RACE method. It encoded a polypeptide of 104 amino acids with conserved G and PW motifs, the consensus phytocystatin sequence LARFAV and the active site QVVAG. The protein showed significant homology to other plant cystatins. BvM14-cystatin was expressed ubiquitously in roots, stems, leaves and flower tissues with relatively high abundance in developing stems and roots. It was found to be localized in the nucleus, cytoplasm and plasma membrane. Recombinant BvM14-cystatin expressed in Escherichia coli was purified and it exhibited cysteine protease inhibitor activity. Salt-stress treatment induced BvM14-cystatin transcript levels in the M14 seedlings. Homozygous Arabidopsis plants over-expressing BvM14-cystatin showed enhanced salt tolerance. Taken together, these data improved understanding of the functions of BvM14-cystatin and highlighted the possibility of employing the cystatin in engineering plants for enhanced salt tolerance.

  12. Cloning and Characterisation of Two H+ Translocating Organic Pyrophos-phatase Genes in Salix and Their Expression Differences in Two Willow Varieties with Different Salt Tolerances.

    Science.gov (United States)

    Li, Min; Yu, Chunmei; Wang, Yaoyi; Li, Wentao; Wang, Ying; Yang, Yun; Liu, Huihui; Li, Yujuan; Tan, Feng; Zhang, Jian

    2014-10-01

    Willows are one of the most important tree species for landscaping, biofuel and raw timber. Screening salt-tolerant willow varieties is an effective approach to balance wood supply and demand. However, more salt-tolerant willow varieties are required and little is known regarding the mechanism of salt tolerance at the gene expression level. In this paper, two willow varieties were studies in terms of their differences in salt-tolerances and mechanism of salt tolerance at the level of VP1 gene expression. The results showed that Salix L0911 (L0911) had higher biomass than Salix matsudana (SM), and salt injuries were less severe in L0911 than in SM. The activities of peroxidase and superoxide dismutase, as well as the contents of soluble protein and proline, were higher in L0911 than in SM, whereas the contents of Na(+) and K(+), as well as the Na(+)/K(+) ratio, were lower in L0911 than in SM. Two VP1 genes (VP1.1 and VP1.2) cloned in L0911 and SM had similar sequences and structures. VP1.1 and VP1.2 belonged to different subgroups. Total expression levels of the VP1.1 gene in both roots and leaves of L0911 were higher than that in SM under normal conditions. Under salt stress, expression of VP1 in SM roots initially increased and then decreased, whereas the expression of VP1 in leaves of L0911 and SM, as well as in roots of L0911, decreased with increasing salt concentrations. This study increased our understanding of the salt-tolerance mechanism of willow and may facilitate the selection of salt-tolerant willow resources.

  13. Analysis of changes in hepatic gene expression in a murine model of tolerance to acetaminophen hepatotoxicity (autoprotection)

    Energy Technology Data Exchange (ETDEWEB)

    O' Connor, Meeghan A., E-mail: meeghan.oconnor@boehringer-ingelheim.com [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Boehringer Ingelheim Pharmaceuticals Inc., 900 Ridgebury Road, Ridgefield, CT 06877-0368 (United States); Koza-Taylor, Petra, E-mail: petra.h.koza-taylor@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Campion, Sarah N., E-mail: sarah.campion@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Aleksunes, Lauren M., E-mail: aleksunes@eohsi.rutgers.edu [Rutgers University, Department of Pharmacology and Toxicology, Environmental and Occupational Health Sciences Institute, Piscataway, NJ 08854 (United States); Gu, Xinsheng, E-mail: xinsheng.gu@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Enayetallah, Ahmed E., E-mail: ahmed.enayetallah@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Lawton, Michael P., E-mail: michael.lawton@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Manautou, José E., E-mail: jose.manautou@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States)

    2014-01-01

    Pretreatment of mice with a low hepatotoxic dose of acetaminophen (APAP) results in resistance to a subsequent, higher dose of APAP. This mouse model, termed APAP autoprotection was used here to identify differentially expressed genes and cellular pathways that could contribute to this development of resistance to hepatotoxicity. Male C57BL/6J mice were pretreated with APAP (400 mg/kg) and then challenged 48 h later with 600 mg APAP/kg. Livers were obtained 4 or 24 h later and total hepatic RNA was isolated and hybridized to Affymetrix Mouse Genome MU430{sub 2} GeneChip. Statistically significant genes were determined and gene expression changes were also interrogated using the Causal Reasoning Engine (CRE). Extensive literature review narrowed our focus to methionine adenosyl transferase-1 alpha (MAT1A), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), flavin-containing monooxygenase 3 (Fmo3) and galectin-3 (Lgals3). Down-regulation of MAT1A could lead to decreases in S-adenosylmethionine (SAMe), which is known to protect against APAP toxicity. Nrf2 activation is expected to play a role in protective adaptation. Up-regulation of Lgals3, one of the genes supporting the Nrf2 hypothesis, can lead to suppression of apoptosis and reduced mitochondrial dysfunction. Fmo3 induction suggests the involvement of an enzyme not known to metabolize APAP in the development of tolerance to APAP toxicity. Subsequent quantitative RT-PCR and immunochemical analysis confirmed the differential expression of some of these genes in the APAP autoprotection model. In conclusion, our genomics strategy identified cellular pathways that might further explain the molecular basis for APAP autoprotection. - Highlights: • Differential expression of genes in mice resistant to acetaminophen hepatotoxicity. • Increased gene expression of Flavin-containing monooxygenase 3 and Galectin-3. • Decrease in MAT1A expression and compensatory hepatocellular regeneration. • Two distinct gene

  14. In planta transformation of sorghum (Sorghum bicolor (L.) Moench) using TPS1 gene for enhancing tolerance to abiotic stresses

    Indian Academy of Sciences (India)

    Varalaxmi Yellisetty; L. A. Reddy; Maheswari Mandapaka

    2015-09-01

    An in planta transformation protocol for sorghum (Sorghum bicolor (L.) Moench) using shoot apical meristem of germinating seedlings is reported in this study. Agrobacterium tumefaciens strain, LBA4404 with pCAMBIA1303 vector and construct pCAMBIA1303TPS1 were individually used for transformation. Since, the transgene is integrated into the cells of already differentiated tissues, the T0 plants were chimeric and stable integration was observed in T1 generation. -Glucuronidase (GUS) expression in the seedlings and spikelets of emerging cob was the first indication of transformability in T0 generation which was further confirmed by PCR analysis using hpt and TPS1 gene-specific primers. Screening on 25 mg/L hygromycin combined with PCR analysis was used for selection of transformants in the T1 generation. Transformation efficiencies ranged between 34–38% and 26–34% using pCAMBIA1303 vector and construct pCAMBIA1303TPS1, respectively. Molecular characterization of the T2 transgenics using PCR, RT-PCR and Southern blot analyses further revealed the integration, expression and inheritance of the transgene. These results indicate the feasibility of the method to generate transgenics with pCAM-BIA1303 vector and construct pCAMBIA1303TPS1. The abiotic stress tolerance of TPS1 transgenics developed in the present study was evident by the ability of the transformants to tolerate 200 mM NaCl as well as higher root growth and biomass.

  15. Molecular cloning and functional analysis of the drought tolerance gene MsHSP70 from alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Li, Zhenyi; Long, Ruicai; Zhang, Tiejun; Wang, Zhen; Zhang, Fan; Yang, Qingchuan; Kang, Junmei; Sun, Yan

    2017-03-01

    Heat shock proteins (HSPs) are a ubiquitously expressed class of protective proteins that play a key role in plant response to stressful conditions. This study aimed to characterize and investigate the function of an HSP gene in alfalfa (Medicago sativa). MsHSP70, which contains a 2028-bp open reading frame, was identified through homology cloning. MsHSP70 shares high sequence identity (94.47%) with HSP70 from Medicago truncatula. Expression analysis of MsHSP70 in alfalfa organs revealed a relatively higher expression level in aerial organs such as flowers, stems and leaves than in roots. MsHSP70 was induced by heat shock, abscisic acid (ABA) and hydrogen peroxide. Transgenic Arabidopsis seedlings overexpressing MsHSP70 were hyposensitive to polyethylene glycol (PEG) and ABA treatments, suggesting that exogenous expression of MsHSP70 enhanced Arabidopsis tolerance to these stresses. Examination of physiological indexes related to drought and ABA stress demonstrated that in comparison with non-transgenic plants, T3 transgenic Arabidopsis plants had an increased proline content, higher superoxide dismutase (SOD) activity, and decreased malondialdehyde (MDA) content. Furthermore, higher relative water content (RWC) was detected in transgenic plants compared with non-transgenic plants under drought stress. These findings clearly indicate that molecular manipulation of MsHSP70 in plants can have substantial effects on stress tolerance.

  16. Long non-coding RNA-mediated transcriptional interference of a permease gene confers drug tolerance in fission yeast.

    Science.gov (United States)

    Ard, Ryan; Tong, Pin; Allshire, Robin C

    2014-11-27

    Most long non-coding RNAs (lncRNAs) encoded by eukaryotic genomes remain uncharacterized. Here we focus on a set of intergenic lncRNAs in fission yeast. Deleting one of these lncRNAs exhibited a clear phenotype: drug sensitivity. Detailed analyses of the affected locus revealed that transcription of the nc-tgp1 lncRNA regulates drug tolerance by repressing the adjacent phosphate-responsive permease gene transporter for glycerophosphodiester 1 (tgp1(+)). We demonstrate that the act of transcribing nc-tgp1 over the tgp1(+) promoter increases nucleosome density, prevents transcription factor access and thus represses tgp1(+) without the need for RNA interference or heterochromatin components. We therefore conclude that tgp1(+) is regulated by transcriptional interference. Accordingly, decreased nc-tgp1 transcription permits tgp1(+) expression upon phosphate starvation. Furthermore, nc-tgp1 loss induces tgp1(+) even in repressive conditions. Notably, drug sensitivity results directly from tgp1(+) expression in the absence of the nc-tgp1 RNA. Thus, transcription of an lncRNA governs drug tolerance in fission yeast.

  17. Zinc up-regulated the expression of the rice metallonthionein gene family and enhanced the zinc tolerance of yeast cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Northern blot and functional complementation assay were employed to analyze the effects of zinc on expression of ten rice metallothionein genes (OsMT-Is) in rice seedlings and the growth of yeast cells transformed with OsMT-Is. Northern blot revealed that in shoots of the rice seedlings treated with different Zn2+ concentrations, expression of most members of OsMT-I family was increased, except the type 4 OsMT-Is (OsMT-I-4a, 4b and 4c). In roots, Zn2+ significantly increased the transcription of OsMT-I-1b and OsMT-I-2c, but reduced the trascription of OsMT-I-1a and OsMT-I-3a. When these ten cDNAs were heterologously expressed in zinc sensitive yeast mutant, all transgenic yeasts showed increased tolerance to Zn2+, and zinc accumulation in these yeast cells also increased.These indicated that OsMT-I family members might respond to extra Zn2+, and they could enhance Zn2+ tolerance of cells by direct binding Zn2+.

  18. Disease-tolerance of transgenic tobacco plants expressing Ah-AMP gene of Amaranthus hypochondriacus

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    An antimicrobial peptide gene from Amaranthus hypochondriacus, Ah-AMP, was amplified by PCR and cloned. Sequence analysis results revealed that this gene is 261 bp in length encoding a precursor polypeptide of 87 amino acid residues. Ah-AMP gene was inserted in the binary vector pBin438 to construct a plant expression vector pBinAH916. Leave explants of Nicotiana tabacum var. SR1 were transformed with Agrobacterium tumefaciens LBA4404 harboring the above expression vector. Results from PCR, Southern and Northern blot analyses confirmed that the Ah-AMP gene had been integrated into the tobacco genome and was transcribed at mRNA level. Two bacterial-resistant transgenic plants were selected by inoculating the plants with Pseudomonas solanacearum and statistic analysis of two T1 lines showed that the resistance increased by 2.24 and 1.62 grade and the disease index decreased by 49.6% and 37.3% respectively when compared with the non-transformed control plants SR1. The results from challenging the plants with inoculums of Phytophthora parasitica showed that the symptom development was delayed and disease index was significantly reduced. These results suggest that Ah-AMP gene may be a potentially valuable gene for genetic engineering of plant for disease-resistance.

  19. ABI-like transcription factor gene TaABL1 from wheat improves multiple abiotic stress tolerances in transgenic plants.

    Science.gov (United States)

    Xu, Dong-Bei; Gao, Shi-Qing; Ma, You-Zhi; Xu, Zhao-Shi; Zhao, Chang-Ping; Tang, Yi-Miao; Li, Xue-Yin; Li, Lian-Cheng; Chen, Yao-Feng; Chen, Ming

    2014-12-01

    The phytohormone abscisic acid (ABA) plays crucial roles in adaptive responses of plants to abiotic stresses. ABA-responsive element binding proteins (AREBs) are basic leucine zipper transcription factors that regulate the expression of downstream genes containing ABA-responsive elements (ABREs) in promoter regions. A novel ABI-like (ABA-insensitive) transcription factor gene, named TaABL1, containing a conserved basic leucine zipper (bZIP) domain was cloned from wheat. Southern blotting showed that three copies were present in the wheat genome. Phylogenetic analyses indicated that TaABL1 belonged to the AREB subfamily of the bZIP transcription factor family and was most closely related to ZmABI5 in maize and OsAREB2 in rice. Expression of TaABL1 was highly induced in wheat roots, stems, and leaves by ABA, drought, high salt, and low temperature stresses. TaABL1 was localized inside the nuclei of transformed wheat mesophyll protoplast. Overexpression of TaABL1 enhanced responses of transgenic plants to ABA and hastened stomatal closure under stress, thereby improving tolerance to multiple abiotic stresses. Furthermore, overexpression of TaABL1 upregulated or downregulated the expression of some stress-related genes controlling stomatal closure in transgenic plants under ABA and drought stress conditions, suggesting that TaABL1 might be a valuable genetic resource for transgenic molecular breeding.

  20. Enhancing stress tolerance by overexpression of a methionine sulfoxide reductase A (MsrA) gene in Pleurotus ostreatus.

    Science.gov (United States)

    Yin, Chaomin; Zheng, Liesheng; Zhu, Jihong; Chen, Liguo; Ma, Aimin

    2015-04-01

    Proteins are subjected to modification by reactive oxygen species (ROS), and oxidation of specific amino acid residues can impair their biological functions. Methionine as a sulfur-containing amino acid is easily oxidized to methionine sulfoxide (MetSO). The modified methionine can be repaired by methionine sulfoxide reductase (Msr), an enzyme that reverses oxidation of methionine in proteins. In this study, a methionine sulfoxide reductase A (PoMsrA) gene from Pleurotus ostreatus was cloned and characterized. Furthermore, the function of PoMsrA gene was analyzed by overexpression in P. ostreatus via Agrobacterium-mediated transformation. Stable integration of the target gene into the genome of P. ostreatus was confirmed by PCR, fluorescence observation, and Southern blot hybridization. qRT-PCR analysis showed that PoMsrA was highly expressed in the stage of mature and young fruiting bodies as well as the osmotic stress condition of 0.3 M NaCl. Additionally, the transgenic strains with PoMsrA overexpression exhibited an enhanced tolerance to high temperature, high osmotic stress, and oxidative stress. This suggests that PoMsrA is an active player in the protection of the cellular proteins from oxidative stress damage.

  1. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × P. nigra.

    Directory of Open Access Journals (Sweden)

    Weidong Gao

    Full Text Available Late embryogenesis abundant (LEA genes were confirmed to confer resistance to drought and water deficiency. An LEA gene from Tamarixandrossowii (named TaLEA was transformed into Xiaohei poplar (Populussimonii × P. nigra via Agrobacterium. Twenty-five independent transgenic lines were obtained that were resistant to kanamycin, and 11 transgenic lines were randomly selected for further analysis. The polymerase chain reaction (PCR and ribonucleic acid (RNA gel blot indicated that the TaLEA gene had been integrated into the poplar genome. The height growth rate, malondialdehyde (MDA content, relative electrolyte leakage and damages due to salt or drought to transgenic and non-transgenic plants were compared under salt and drought stress conditions. The results showed that the constitutive expression of the TaLEA gene in transgenic poplars could induce an increase in height growth rate and a decrease in number and severity of wilted leaves under the salt and drought stresses. The MDA content and relative electrolyte leakage in transgenic lines under salt and drought stresses were significantly lower compared to those in non-transgenic plants, indicating that the TaLEA gene may enhance salt and drought tolerance by protecting cell membranes from damage. Moreover, amongst the lines analyzed for stress tolerance, the transgenic line 11 (T11 showed the highest tolerance levels under both salinity and drought stress conditions. These results indicated that the TaLEA gene could be a salt and drought tolerance candidate gene and could confer a broad spectrum of tolerance under abiotic stresses in poplars.

  2. Rice Yellow Mottle Virus stress responsive genes from susceptible and tolerant rice genotypes

    Directory of Open Access Journals (Sweden)

    Siré Christelle

    2008-03-01

    Full Text Available Abstract Background The effects of viral infection involve concomitant plant gene variations and cellular changes. A simple system is required to assess the complexity of host responses to viral infection. The genome of the Rice yellow mottle virus (RYMV is a single-stranded RNA with a simple organisation. It is the most well-known monocotyledon virus model. Several studies on its biology, structure and phylogeography have provided a suitable background for further genetic studies. 12 rice chromosome sequences are now available and provide strong support for genomic studies, particularly physical mapping and gene identification. Results The present data, obtained through the cDNA-AFLP technique, demonstrate differential responses to RYMV of two different rice cultivars, i.e. susceptible IR64 (Oryza sativa indica, and partially resistant Azucena (O. s. japonica. This RNA profiling provides a new original dataset that will enable us to gain greater insight into the RYMV/rice interaction and the specificity of the host response. Using the SIM4 subroutine, we took the intron/exon structure of the gene into account and mapped 281 RYMV stress responsive (RSR transcripts on 12 rice chromosomes corresponding to 234 RSR genes. We also mapped previously identified deregulated proteins and genes involved in partial resistance and thus constructed the first global physical map of the RYMV/rice interaction. RSR transcripts on rice chromosomes 4 and 10 were found to be not randomly distributed. Seven genes were identified in the susceptible and partially resistant cultivars, and transcripts were colocalized for these seven genes in both cultivars. During virus infection, many concomitant plant gene expression changes may be associated with host changes caused by the infection process, general stress or defence responses. We noted that some genes (e.g. ABC transporters were regulated throughout the kinetics of infection and differentiated susceptible and

  3. Integrating Small RNA Sequencing with QTL Mapping for Identification of miRNAs and Their Target Genes Associated with Heat Tolerance at the Flowering Stage in Rice

    Science.gov (United States)

    Liu, Qing; Yang, Tifeng; Yu, Ting; Zhang, Shaohong; Mao, Xingxue; Zhao, Junliang; Wang, Xiaofei; Dong, Jingfang; Liu, Bin

    2017-01-01

    Although, microRNAs (miRNAs) have been reported to be associated with heat tolerance at the seedling stage in rice, their involvement in heat tolerance at the flowering stage is still unknown. In this study, small RNA profiling was conducted in a heat-tolerant variety Gan-Xiang-Nuo (GXN) and a heat-sensitive variety Hua-Jing-Xian-74 (HJX), respectively. Totally, 102 miRNAs were differentially expressed (DE) under heat stress. Compared to HJX, GXN had more DE miRNAs and its DE miRNAs changed earlier under heat stress. Plant Ontology (PO) analysis of the target genes revealed that many DE miRNAs were involved in flower development. As a parallel experiment, QTL mapping was also conducted and four QTLs for heat tolerance at the flowering stage were identified using chromosome single-segment substitution lines derived from GXN and HJX. Further, through integrating analysis of DE miRNAs with QTLs, we identified 8 target genes corresponding to 26 miRNAs within the four QTL regions. Some meaningful target genes such as LOC_Os12g42400, SGT1, and pectinesterase were within the QTL regions. The negative correlation between miR169r-5p and its target gene LOC_Os12g42400 was confirmed under heat stress, and overexpression of miR169r-5p enhanced heat tolerance at flowering stage in rice. Our results demonstrate that the integrated analysis of genome-wide miRNA profiling with QTL mapping can facilitate identification of miRNAs and their target genes associated with the target traits and the limited candidates identified in this study offer an important source for further functional analysis and molecular breeding for heat tolerance in rice. PMID:28174587

  4. JcCBF2 gene from Jatropha curcas improves freezing tolerance of Arabidopsis thaliana during the early stage of stress.

    Science.gov (United States)

    Wang, Linghui; Gao, Jihai; Qin, Xiaobo; Shi, Xiaodong; Luo, Lin; Zhang, Guozhen; Yu, Hongwu; Li, Chenyang; Hu, Minchao; Liu, Qifan; Xu, Ying; Chen, Fang

    2015-05-01

    High chilling-susceptibility is becoming the bottleneck for cultivation and commercialization of Jatropha curcas L. For insights to chilling resistance ability of this plant species, a cold response transcription factor, JcCBF2, was cloned and studied. It codes a 26 kDa protein, which contains all conserved motifs unique to the C-repeat binding factor (CBF) family and has high similarity to CBFs of Ricinus communis and Populus. Its transcripts express specifically in leaves of Jatropha at cold temperature. After transmitting the report vector, 35S::JcCBF2-GFP, into Arabidopsis thaliana, JcCBF2 protein is main detected in cell nucleus, being consistent to the nuclear orientation signal in its N-terminal. Compared to the control Arabidopsis, the frozen leaves of JcCBF2-overexpressed seedlings grow stronger with less malondialdehyde, smaller leaf conductivity and activer superoxide dismutase, showing their higher freezing tolerance. RT-PCR tests revealed that JcCBF2 functioned mainly at the early stage (0-6 h) of resistance events in Arabidopsis, and its transcripts reduced after 6 h. In addition, JcCBF2 could quickly regulate transcripts of some cold-responsive (COR) genes such as RD29A, COR105A and COR6.6, also during the early stage of frozen treatment. This study not only proves the chilling resistance roles of JcCBF2, but also presents a candidate gene engineering for improvement of chilling tolerance in J. curcas.

  5. Characterization of pbt genes conferring increased Pb2+ and Cd2+ tolerance upon Achromobacter xylosoxidans A8.

    Science.gov (United States)

    Hložková, Kateřina; Suman, Jáchym; Strnad, Hynek; Ruml, Tomas; Paces, Vaclav; Kotrba, Pavel

    2013-12-01

    The cluster of pbtTFYRABC genes is carried by plasmid pA81. Its elimination from Achromobacter xylosoxidans A8 resulted in increased sensitivity towards Pb(2+) and Cd(2+). Predicted pbtTRABC products share strong similarities with Pb(2+) uptake transporter PbrT, transcriptional regulator PbrR, metal efflux P1-ATPases PbrA and CadA, undecaprenyl pyrophosphatase PbrB and its signal peptidase PbrC from Cupriavidus metallidurans CH34. Expression of pbtABC or pbtA in a metal-sensitive Escherichia coli GG48 rendered the strain Pb(2+)-, Cd(2+)- and Zn(2+)-tolerant and caused decreased accumulation of the metal ions. Accumulation of Pb(2+), but not of Cd(2+) or Zn(2+), was promoted in E. coli expressing pbtT. Additional genes of the pbt cluster are pbtF and pbtY, which encode the cation diffusion facilitator (CDF)-like transporter and a putative fatty acid hydroxylase of unknown function, respectively. Expression of pbtF did not confer increased metal tolerance upon E. coli GG48, although the protein showed measurable Pb(2+)-efflux activity. Unlike the pbtT promoter, promoters of pbtABC, pbtF and pbtY contain features characteristic of promoters controlled by metal-responsive transcriptional regulators of the MerR family. Upregulation of pbtABC, pbtF and pbtY upon Pb(2+), Cd(2+) and Zn(2+) exposure was confirmed in wild-type Achromobacter xylosoxidans A8. Gel shift assays proved binding of purified PbtR to the respective promoters.

  6. A concentração de fósforo na tolerância de cultivares de trigo à toxicidade de alumínio em soluções nutritivas Effect of phosphorus in nutrient solution on the tolerance to aluminum toxicity in wheat cultivars

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1985-01-01

    +. Houve aumento mais acentuado nos teores de P na matéria seca das raízes em relação ao das partes aéreas quando se elevaram as concentrações de P das soluções. Esse aumento foi mais intenso no 'Siete Cerros' e 'IAC-17' do que no 'BH-1146'. Os teores de Al aumentaram nas raízes para todos os cultivares, à medida que cresceram as concentrações de P das soluções. Os resultados evidenciaram que, com o aumento da concentração de P, acentuou-se o efeito da toxicidade do Al3+, indicando que o Al e o P ficaram acumulados interna ou externamente nas raízes.Two experiments were conducted with the objective of studying the tolerance of wheat cultivars to 5 mg/l of Al3+ in nutrient solutions. The tolerance was evaluated by measuring the root growth in an aluminum-free complete nutrient solution after a treatment of 48 hours, in aluminum solution with different levels of phosphorus, and with controlled pH and temperature (25 ± 1ºC. In the first experiment eight cultivars were studied in treatment solutions with four levels of phosphorus (0; 15.5; 31.0 and 62.0 mg/l combined with three levels of pH (4.0; 5.0 and 6.0. The cultivars CNT-8 and Siete Cerros were sensitive and 'BH-1146', 'IAC-18', 'IAC-13', 'C-3', 'IAC-17 and 'Alondra- 4546' were tolerant to 5 mg/l of Al3+ in the solutions with pH 4.0 and in absence of P. All cultivars were sensitive to Al3+ when it was applied 15.5 mg/l of P and they were tolerant when was used 62 mg/l of P in the solutions, considering constant the pH 4.0. In solutions with the level of 31 mg/l of P and pH 4.0, the cultivars IAC-18, BH-1146, IAC-13 and C-3 showed tolerance and IAC-17, Alondra-4546, CNT-8 and Siete Cerros showed sensitivity to Al3+ when it was used solution with pH 5.0 or 6.0 the cultivars presented tolerance being non dependent of P concentration, in consequence of the low activity of Al3+ ions under these pH levels. The data demonstrated that tolerance to 5 m/l of Al3+, besides the pH level was dependent on the P

  7. Characteristics of Three Thioredoxin Genes and Their Role in Chilling Tolerance of Harvested Banana Fruit

    Science.gov (United States)

    Wu, Fuwang; Li, Qing; Yan, Huiling; Zhang, Dandan; Jiang, Guoxiang; Jiang, Yueming; Duan, Xuewu

    2016-01-01

    Thioredoxins (Trxs) are small proteins with a conserved redox active site WCGPC and are involved in a wide range of cellular redox processes. However, little information on the role of Trx in regulating low-temperature stress of harvested fruit is available. In this study, three full-length Trx cDNAs, designated MaTrx6, MaTrx9 and MaTrx12, were cloned from banana (Musa acuminata) fruit. Phylogenetic analysis and protein sequence alignments showed that MaTrx6 was grouped to h2 type with a typical active site of WCGPC, whereas MaTrx9 and MaTrx12 were assigned to atypical cys his-rich Trxs (ACHT) and h3 type with atypical active sites of GCAGC and WCSPC, respectively. Subcellular localization indicated that MaTrx6 and MaTrx12 were located in the plasma membrane and cytoplasm, respectively, whereas MaTrx9 showed a dual cytoplasmic and chloroplast localization. Application of ethylene induced chilling tolerance of harvested banana fruit, whereas 1-MCP, an inhibitor of ethylene perception, aggravated the development of chilling injury. RT-qPCR analysis showed that expression of MaTrx12 was up-regulated and down-regulated in ethylene- and 1-MCP-treated banana fruit at low temperature, respectively. Furthermore, heterologous expression of MaTrx12 in cytoplasmic Trx-deficient Saccharomyces cerevisiae strain increased the viability of the strain under H2O2. These results suggest that MaTrx12 plays an important role in the chilling tolerance of harvested banana fruit, possibly by regulating redox homeostasis. PMID:27618038

  8. Characteristics of Three Thioredoxin Genes and Their Role in Chilling Tolerance of Harvested Banana Fruit

    Directory of Open Access Journals (Sweden)

    Fuwang Wu

    2016-09-01

    Full Text Available Thioredoxins (Trxs are small proteins with a conserved redox active site WCGPC and are involved in a wide range of cellular redox processes. However, little information on the role of Trx in regulating low-temperature stress of harvested fruit is available. In this study, three full-length Trx cDNAs, designated MaTrx6, MaTrx9 and MaTrx12, were cloned from banana (Musa acuminata fruit. Phylogenetic analysis and protein sequence alignments showed that MaTrx6 was grouped to h2 type with a typical active site of WCGPC, whereas MaTrx9 and MaTrx12 were assigned to atypical cys his-rich Trxs (ACHT and h3 type with atypical active sites of GCAGC and WCSPC, respectively. Subcellular localization indicated that MaTrx6 and MaTrx12 were located in the plasma membrane and cytoplasm, respectively, whereas MaTrx9 showed a dual cytoplasmic and chloroplast localization. Application of ethylene induced chilling tolerance of harvested banana fruit, whereas 1-MCP, an inhibitor of ethylene perception, aggravated the development of chilling injury. RT-qPCR analysis showed that expression of MaTrx12 was up-regulated and down-regulated in ethylene- and 1-MCP-treated banana fruit at low temperature, respectively. Furthermore, heterologous expression of MaTrx12 in cytoplasmic Trx-deficient Saccharomyces cerevisiae strain increased the viability of the strain under H2O2. These results suggest that MaTrx12 plays an important role in the chilling tolerance of harvested banana fruit, possibly by regulating redox homeostasis.

  9. Introduction of Pea DNA Helicase 45 Into Sugarcane (Saccharum spp. Hybrid) Enhances Cell Membrane Thermostability And Upregulation Of Stress-responsive Genes Leads To Abiotic Stress Tolerance.

    Science.gov (United States)

    Augustine, Sruthy Maria; Ashwin Narayan, J; Syamaladevi, Divya P; Appunu, C; Chakravarthi, M; Ravichandran, V; Tuteja, Narendra; Subramonian, N

    2015-05-01

    DNA helicases are motor proteins that play an essential role in nucleic acid metabolism, by providing a duplex-unwinding function. To improve the drought and salinity tolerance of sugarcane, a DEAD-box helicase gene isolated from pea with a constitutive promoter, Port Ubi 2.3 was transformed into the commercial sugarcane variety Co 86032 through Agrobacterium-mediated transformation, and the transgenics were screened for tolerance to soil moisture stress and salinity. The transgene integration was confirmed through polymerase chain reaction, and the V 0 transgenic events showed significantly higher cell membrane thermostability under normal irrigated conditions. The V 1 transgenic events were screened for tolerance to soil moisture stress and exhibited significantly higher cell membrane thermostability, transgene expression, relative water content, gas exchange parameters, chlorophyll content, and photosynthetic efficiency under soil moisture stress compared to wild-type (WT). The overexpression of PDH45 transgenic sugarcane also led to the upregulation of DREB2-induced downstream stress-related genes. The transgenic events demonstrated higher germination ability and better chlorophyll retention than WT under salinity stress. Our results suggest the possibility for development of increased abiotic stress tolerant sugarcane cultivars through overexpression of PDH45 gene. Perhaps this is the first report, which provides evidence for increased drought and salinity tolerance in sugarcane through overexpression of PDH45.

  10. Physiological performance and differential expression profiling of genes associated with drought tolerance in root tissue of four contrasting varieties of two Gossypium species.

    Science.gov (United States)

    Singh, Ruchi; Pandey, Neha; Kumar, Anil; Shirke, Pramod A

    2016-01-01

    Root growth in drying soil is generally limited by a combination of mechanical impedance and water stress. As the major function of root tissue is water and nutrient uptake, so it imparts an important role in plant growth and stress management. Previously, we have studied physiological performance and expression profiling of gene associated with drought tolerance in leaf tissue of four cotton varieties. Here, we have further continued our studies with the root tissue of these varieties. The Gossypium hirsutum species JKC-770 is drought-tolerant and KC-2 is drought-sensitive, while Gossypium herbaceum species JKC-717 is drought-tolerant and RAHS-187 is drought-sensitive. JKC-770 and JKC-717 the drought-tolerant varieties showed a comparatively high glutathione-S-transferase, superoxide dismutase, proline along with their gene expression, and low malondialdehyde content indicating low membrane damage and better antioxidative defense under drought condition. The expression levels of cellulose synthase, xyloglucan:xyloglucosyl transferase, and glycosyl hydrolases suggest modulation in cell wall structure and partitioning of sugars towards osmoprotectants instead of cell wall biosynthesis in tolerant varieties. Heat shock proteins and serine/threonine protein phosphotases show upregulation under drought condition, which are responsible for temperature tolerance and protein phosphorylation, respectively. These effects many metabolic processes and may be playing a key role in drought tolerance and adaptability of JKC-770 towards drought tolerance. The long-term water use efficiency (WUE) estimated in terms of carbon isotope discrimination (∆(13)C) in the root tissues showed maximum depletion in the ∆(13)C values in JKC-770 variety, while minimum in RAHS-187 under drought stress with reference to their respective control, suggesting a high WUE in JKC-770 variety.

  11. Evidence of a major gene influencing hair length and heat tolerance in Bos taurus cattle.

    Science.gov (United States)

    Olson, T A; Lucena, C; Chase, C C; Hammond, A C

    2003-01-01

    Evidence was found that supports the existence of a major gene (designated as the slick hair gene), dominant in mode of inheritance, that is responsible for producing a very short, sleek hair coat. Cattle with slick hair were observed to maintain lower rectal temperatures (RT). The gene is found in Senepol cattle and criollo (Spanish origin) breeds in Central and South America. This gene is also found in a Venezuelan composite breed, the Carora, formed from the Brown Swiss and a Venezuelan criollo breed. Two sets of backcross matings of normal-haired sire breeds to Senepol crossbred dams assumed to be heterozygous for the slick hair gene resulted in ratios of slick to normal-haired progeny that did not significantly differ from 1:1. Data from Carora x Holstein crossbred cows in Venezuela also support the concept of a major gene that is responsible for the slick hair coat of the Carora breed. Cows that were 75% Holstein: 25% Carora in breed composition segregated with a ratio that did not differ from 1:1, as would be expected from a backcross matinginvolving a dominant gene. The effect of the slick hair gene on RT depended on the degree of heat stress and appeared to be affected by age and/or lactation status. The decreased RT observed for slick-haired crossbred calves compared to normal-haired contemporaries ranged from 0.18 to 0.4 degrees C. An even larger decrease in RT (0.61 degrees C; P heat stress. The improved thermotolerance of crossbred calves due to their slick hair coats did not result in increased weaning weights, possibly because both the slick and normal-haired calves were being nursed by slick-haired dams. There were indications that the slick-haired calves grew faster immediately following weaning and that their growth during the cooler months of the year was not compromised significantly by their reduced quantity of hair. In the Carora x Holstein crossbred cows there was a positive effect of slick hair on milk yield under dry, tropical conditions.

  12. Identification of Differentially Expressed Genes Related to Dehydration Resistance in a Highly Drought-Tolerant Pear, Pyrus betulaefolia, as through RNA-Seq

    OpenAIRE

    Kong-Qing Li; Xiao-Yong Xu; Xiao-San Huang

    2016-01-01

    Drought is a major abiotic stress that affects plant growth, development and productivity. Pear is one of the most important deciduous fruit trees in the world, but the mechanisms of drought tolerance in this plant are still unclear. To better understand the molecular basis regarding drought stress response, RNA-seq was performed on samples collected before and after dehydration in Pyrus betulaefolia. In total, 19,532 differentially expressed genes (DEGs) were identified. These genes were ann...

  13. Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Tokuyasu Ken

    2008-04-01

    Full Text Available Abstract Background Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Results Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Conclusion Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

  14. TaSCL14, a novel wheat (Triticum aestivum L.) GRAS gene, regulates plant growth, photosynthesis, tolerance to photooxidative stress, and senescence.

    Science.gov (United States)

    Chen, Kunmei; Li, Hongwei; Chen, Yaofeng; Zheng, Qi; Li, Bin; Li, Zhensheng

    2015-01-20

    Rates of photosynthesis, tolerance to photooxidative stress, and senescence are all important physiological factors that affect plant development and thus agricultural productivity. GRAS proteins play essential roles in plant growth and development as well as in plant responses to biotic and abiotic stresses. So far few GRAS genes in wheat (Triticum aestivum L.) have been characterized. A previous transcriptome analysis indicated that the expression of a GRAS gene (TaSCL14) was induced by high-light stress in Xiaoyan 54 (XY54), a common wheat cultivar with strong tolerance to high-light stress. In this study, TaSCL14 gene was isolated from XY54 and mapped on chromosome 4A. TaSCL14 was expressed in various wheat organs, with high levels in stems and roots. Our results confirmed that TaSCL14 expression was indeed responsive to high-light stress. Barley stripe mosaic virus (BSMV)-based virus-induced gene silencing (VIGS) of TaSCL14 in wheat was performed to help characterize its potential functions. Silencing of TaSCL14 resulted in inhibited plant growth, decreased photosynthetic capacity, and reduced tolerance to photooxidative stress. In addition, silencing of TaSCL14 in wheat promoted leaf senescence induced by darkness. These results suggest that TaSCL14 may act as a multifunctional regulator involved in plant growth, photosynthesis, tolerance to photooxidative stress, and senescence.

  15. Over-expression of an Arabidopsis δ-OAT gene enhances salt and drought tolerance in transgenic rice

    Institute of Scientific and Technical Information of China (English)

    WU Liangqi; FAN Zhanmin; GUO Lei; LI Yongqing; ZHANG Wenjing; QU Li-Jia; CHEN Zhangliang

    2003-01-01

    δ-OAT, ornithine-δ-aminotransferase, is the key enzyme involved in proline biosynthesis. In this study the Arabidopsisδ-OAT gene was transferred into rice (Oryza sativa L. ssp japonica cv. Zhongzuo 321), whose successful integration was demonstrated by PCR and Southern blot analysis. The over-expression of the gene in transgenic rice was also confirmed. Biochemical analysis showed that, under salt or drought stress conditions, proline contents in the leaves and roots in transgenic rice plants were 5- to 15-fold of those in non-transgenic controls. Under stress conditions, germinating rate of transgenic lines is higher than that of controls. Although the growth of rice plants tested were more and more retarded with the increasing of NaCl concentration, the transgenic plants grow faster compared to the controls under the same stress condition. Meanwhile, the resistance to KCl and MgSO4 stresses was also found enhanced in transgenic rice. Furthermore, the over-expression ofδ-OAT also improved the yield of transgenic plants under stress conditions. The average yield per plant of transgenic lines increases about 12%-41% more than that of control lines under 0.1 mol/L NaCl stress. These data indicated that the over-expression of δ-OAT, with the accumulation of proline, resulted in the enhancement of salt and drought tolerance and an increase of rice yield, which is of significance in agriculture.

  16. CmWRKY1 Enhances the Dehydration Tolerance of Chrysanthemum through the Regulation of ABA-Associated Genes.

    Directory of Open Access Journals (Sweden)

    Qingqing Fan

    Full Text Available WRKY transcription factors serve as antagonistic or synergistic regulators in a variety of abiotic stress responses in plants. Here, we show that CmWRKY1, a member of the group IIb WRKY family isolated from Chrysanthemum morifolium, exhibits no transcriptional activation in yeast cells. The subcellular localization examination showed that CmWRKY1 localizes to the nucleus in vivo. Furthermore, CmWRKY1-overexpressing transgenic lines exhibit enhanced dehydration tolerance in response to polyethylene glycol (PEG treatment compared with wild-type plants. We further confirmed that the transgenic plants exhibit suppressed expression levels of genes negatively regulated by ABA, such as PP2C, ABI1 and ABI2, and activated expression levels of genes positively regulated by ABA, such as PYL2, SnRK2.2, ABF4, MYB2, RAB18, and DREB1A. Taken together, our results indicate that CmWRKY1 plays an important role in the response to drought in chrysanthemum through an ABA-mediated pathway.

  17. Thellungiella halophilaThPIP1 gene enhances the tolerance of the transgenic rice to salt stress

    Institute of Scientific and Technical Information of China (English)

    QIANG Xiao-jing; YU Guo-hong; JIANG Lin-lin; SUN Lin-lin; ZHANG Shu-hui; LI Wei; CHENG Xian-guo

    2015-01-01

    Aquaporin proteins were demonstrated to play an important regulatory role in transporting water and other smal mole-cules. To better understand physiological functions of aquaporins in extremophile plants, a novelThPIP1 gene from the Thelungiela halophila was isolated and functionaly characterized in the transgenic rice. Data showed that the ThPIP1 protein encoded 284 amino acids, and was identiifed to be located on the plasma membrane. The expression ofThPIP1 genein the shoots and roots ofT. halophilaseedlings were induced by high salinity. The transgenic rice overexpressing ThPIP1 gene signiifcantly increased plants tolerance to salt stress through the pathway regulating the osmotic potentials, accumulation of organic smal molecules substances and the ratio of K+/Na+ in the plant cels. Moreover, split-ubiquitin yeast two-hybrid assay showed that ThPIP1 protein speciifcaly interacted with ThPIP2 and a non-speciifc lipid-transfer protein 2, suggesting thatThPIP1 probably play a key role in responding to the reactions of multiple external stimulus and in participating in different physiological processes of plants exposed to salt stress.

  18. Down-regulation of BdBRI1, a putative brassinosteroid receptor gene produces a dwarf phenotype with enhanced drought tolerance in Brachypodium distachyon.

    Science.gov (United States)

    Feng, Ying; Yin, Yanhai; Fei, Shuizhang

    2015-05-01

    Brassinosteroids (BRs) play important roles in plant growth, development and responses to a range of environmental cues. Although the mechanism of how BRs regulate growth and development is well-understood in Arabidopsis, the effect of BRs on stress tolerance, particularly drought tolerance remains unknown. We isolated a BRI1 (BRASSINOSTEROID INSENSITIVE 1) homologous gene, BdBRI1 from Brachypodium distachyon, a model for temperate grasses and cereals, created and characterized RNA interference (RNAi) knockdown mutants for BdBRI1 in Brachypodium. The loss-of-function BdBRI1-RNAi mutants exhibited reduced plant height, shortened internodes, narrow and short leaf, and reduced expression of BR signaling genes, BdBES1, BdBZR1, BdBLE2, and enhanced expression of BR biosynthesis genes BdD2, BdCPD and BdDWF4. More importantly, BdBRI1 RNAi mutants exhibited enhanced drought tolerance, accompanied by highly elevated expression of drought-responsive genes, BdP5CS, BdCOR47/BdRD17, together with BdERD1 and BdRD26, two putative targets of the transcription factors BES1 and BZR1 that are key components of the BR signaling pathway. Our results suggest that BR signaling and biosynthesis are largely conserved among Arabidopsis, rice and Brachypodium, and that BR signaling plays an important role in drought tolerance by directly regulating expression of key drought-responsive genes. The effect of BR biosynthesis or crosstalks between BR and other hormones or components of stress signaling pathways on drought tolerance is discussed.

  19. Transgenic petunia with the iron(III-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments.

    Directory of Open Access Journals (Sweden)

    Yoshiko Murata

    Full Text Available Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III to iron(II and the uptake of iron(II by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III. Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems

  20. Combination of CTLA4-FasL gene transfer and allogeneic bone marrow transplantation led to durable macrochimerism and donor-specific tolerance in mouse model

    Institute of Scientific and Technical Information of China (English)

    FENG Yougang; WANG Guangming; HAO Jie; LI Ailing; YUAN Guohong; LI Chong; ZENG Fuqing; XIE Shusheng

    2005-01-01

    Mixed hemopoietic chimerism is capable of inducing donor specific tolerance, thus eliminating the chronic immunosuppressive therapy following organ transplantation. As yet no safe and effective tolerance protocol is available for clinical implementation. Here we describe an alternative nonmyeloablative based strategy of using a single injection of recombination adenovirus vector encoding CTLA4-FasL fusing gene and donor bone marrow cells to promote durable mixed macrochimerism (>20% on 140 d). Chimeras exhibited robust donor-specific tolerance, as evidenced by acceptance of fully allogeneic skin grafts (the mean survival time (MST)>200 d) and rejection of third- party skin grafts in a normal manner (MST<10 d). In this model, the frequencies of helper T lymphocyte precursor (HTLp) and cytotoxic T lymphocyte precursor (CTLp) were greatly reduced on day 14 after transplantation, suggesting that CTLA4-FasL led to rapid systemic peripheral tolerance to facilitate the bone marrow engraftment, while both HTLp and CTLp remained at low level only in recipient mice with mixed chimerism on day 140 after transplantation, demonstrating that long-term skin grafts tolerance was associated with stable mixed chimerism, and central deletion of donor specific T cell may be the main mechanism for tolerance maintenance.

  1. Identification and Molecular Characterization of Genes Coding Pharmaceutically Important Enzymes from Halo-Thermo Tolerant Bacillus

    Science.gov (United States)

    Safary, Azam; Moniri, Rezvan; Hamzeh-Mivehroud, Maryam; Dastmalchi, Siavoush

    2016-01-01

    Purpose: Robust pharmaceutical and industrial enzymes from extremophile microorganisms are main source of enzymes with tremendous stability under harsh conditions which make them potential tools for commercial and biotechnological applications. Methods: The genome of a Gram-positive halo-thermotolerant Bacillus sp. SL1, new isolate from Saline Lake, was investigated for the presence of genes coding for potentially pharmaceutical enzymes. We determined gene sequences for the enzymes laccase (CotA), l-asparaginase (ansA3, ansA1), glutamate-specific endopeptidase (blaSE), l-arabinose isomerase (araA2), endo-1,4-β mannosidase (gmuG), glutaminase (glsA), pectate lyase (pelA), cellulase (bglC1), aldehyde dehydrogenase (ycbD) and allantoinases (pucH) in the genome of Bacillus sp. SL1. Results: Based on the DNA sequence alignment results, six of the studied enzymes of Bacillus sp. SL-1 showed 100% similarity at the nucleotide level to the same genes of B. licheniformis 14580 demonstrating extensive organizational relationship between these two strains. Despite high similarities between the B. licheniformis and Bacillus sp. SL-1 genomes, there are minor differences in the sequences of some enzyme. Approximately 30% of the enzyme sequences revealed more than 99% identity with some variations in nucleotides leading to amino acid substitution in protein sequences. Conclusion: Molecular characterization of this new isolate provides useful information regarding evolutionary relationship between B. subtilis and B. licheniformis species. Since, the most industrial processes are often performed in harsh conditions, enzymes from such halo-thermotolerant bacteria may provide economically and industrially appealing biocatalysts to be used under specific physicochemical situations in medical, pharmaceutical, chemical and other industries. PMID:28101462

  2. Allergenicity assessment of genetically-modified tobacco expressing salt tolerance cbl gene.

    Science.gov (United States)

    Verma, Alok Kumar; Kumar, Sandeep; Chaudhari, Bhushan P; Tuteja, Narendra; Das, Mukul; Dwivedi, Premendra D

    2014-09-01

    It is mandatory to assess the allergenic potential of genetically modified (GM) crops before their commercialization. Recently, a transgene [Calcineurin B-like (CBL) protein] has been introduced into tobacco plant to make the crop salt resistance. Therefore, it was felt necessary to assess the allergenic potential of the cbl gene product, which was introduced and expressed in Nicotiana tabacum (tobacco) plant and compared the allergenic effects with the wild-type (WT) counterpart. Bioinformatic analysis revealed that there was no significant sequence homology with known allergens. Also, no difference between the protein digestibility profiles of GM and WT tobacco was found. Rapid digestion of CBL protein (Mol Wt 35 kDa) by simulated gastric fluid (SGF) indicated reduced chances of this protein to induce allergenicity. In addition, BALB/c mice sensitized by intraperitoneal administration of WT and GM tobacco protein showed comparable levels of clinical score, specific IgE, IgG1, histamine level, similar effect on different organs as well as IgE binding proteins. These findings indicate that insertion of cbl gene in tobacco did not cause any additional allergic risk to consumer and the GM and native tobacco proteins behave similarly in both in vitro and in vivo situations even after genetic modification.

  3. Improvement in salt tolerance of Populus tomentosa from transformation by a mtl-D gene

    Institute of Scientific and Technical Information of China (English)

    Li Min; Wang Hua-fang; Yin Wei-lun; He Si-jie; Chen Shou-yi

    2006-01-01

    Transgenic lines were achieved by transforming the E. coli 1-phosphate mannitol dehydrogenase gene (mtl-D) into the Populus tomentosa Carr. genome. An Agrobacterium tumefaciens strain (AGL1), constructed by cloning mtl-D into the disarmed plasmid pBin438, was used to infect leaves of the clone YW2. The infected leaf discs were cultured on a medium containing 30mg·L-1 kanamycin and 500 mg·L-1 cefotaxime. Transgenic plantlets regenerated from the infected leaves, rooted on the medium containing 30 mg·L-1 kanamycin. PCR and a Southern blotting test verified that the exogenous mtl-D gene had integrated into the transformation plants of the P. tomentosa genome. The mannitol content in control plant was 69 μg·g-1 FW, and the mannitol contents of the transgenic lines T1 to T5 ranged between 103.7 and 289.5 μg·g-1 FW. Of the shoots of the control plants 20% survived; on the medium containing 0.6% NaCl, 60% and 70% of two transgenic shoots survived on a medium containing 0.8% NaCl.

  4. Overexpression of pigeonpea stress-induced cold and drought regulatory gene (CcCDR) confers drought, salt, and cold tolerance in Arabidopsis.

    Science.gov (United States)

    Tamirisa, Srinath; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2014-09-01

    A potent cold and drought regulatory protein-encoding gene (CcCDR) was isolated from the subtractive cDNA library of pigeonpea plants subjected to drought stress. CcCDR was induced by different abiotic stress conditions in pigeonpea. Overexpression of CcCDR in Arabidopsis thaliana imparted enhanced tolerance against major abiotic stresses, namely drought, salinity, and low temperature, as evidenced by increased biomass, root length, and chlorophyll content. Transgenic plants also showed increased levels of antioxidant enzymes, proline, and reducing sugars under stress conditions. Furthermore, CcCDR-transgenic plants showed enhanced relative water content, osmotic potential, and cell membrane stability, as well as hypersensitivity to abscisic acid (ABA) as compared with control plants. Localization studies confirmed that CcCDR could enter the nucleus, as revealed by intense fluorescence, indicating its possible interaction with various nuclear proteins. Microarray analysis revealed that 1780 genes were up-regulated in CcCDR-transgenics compared with wild-type plants. Real-time PCR analysis on selected stress-responsive genes, involved in ABA-dependent and -independent signalling networks, revealed higher expression levels in transgenic plants, suggesting that CcCDR acts upstream of these genes. The overall results demonstrate the explicit role of CcCDR in conferring multiple abiotic stress tolerance at the whole-plant level. The multifunctional CcCDR seems promising as a prime candidate gene for enhancing abiotic stress tolerance in diverse plants.

  5. Characterization of AtSTOP1 orthologous genes in tobacco and other plant species.

    Science.gov (United States)

    Ohyama, Yoshinao; Ito, Hiroki; Kobayashi, Yuriko; Ikka, Takashi; Morita, Akio; Kobayashi, Masatomo; Imaizumi, Ryujiro; Aoki, Toshio; Komatsu, Kenji; Sakata, Yoichi; Iuchi, Satoshi; Koyama, Hiroyuki

    2013-08-01

    Aluminum (Al) and proton (H⁺) tolerances are essential traits for plants to adapt to acid soil environments. In Arabidopsis (Arabidopsis thaliana), these tolerances are mediated by a zinc-finger transcription factor, SENSITIVE TO PROTON RHIZOTOXICITY1 (AtSTOP1), which regulates the transcription of multiple genes critical for tolerance to both stressors. Here, the functions of orthologous proteins (STOP1-like proteins) in other plant species were characterized by reverse genetics analyses and in planta complementation assays. RNA interference of a gene for NtSTOP1 repressed Al and H⁺ tolerances of tobacco (Nicotiana tabacum) roots. Tobacco roots released citrate in response to Al, concomitant with the up-regulated transcription of an ortholog of an Al tolerance gene encoding a citrate-transporting multidrug and toxic compound extrusion protein. The RNA interference repression of NtSTOP1 blocked this process and also repressed the transcription of another orthologous gene for Al tolerance, ALUMINUM SENSITIVE3, which encodes a prokaryote-type transporter. These results demonstrated that NtSTOP1 regulates Al tolerance in tobacco through the transcriptional regulation of these genes. The in planta complementation assays revealed that other plant species, including woody plants, a legume, and a moss (Physcomitrella patens), possess functional STOP1-like proteins that can activate several H⁺ and Al-tolerance genes in Arabidopsis. Knocking out the gene encoding the STOP1-like protein decreased the Al tolerance of P. patens. Together, our results strongly suggest that transcriptional regulation by STOP1-like proteins is evolutionarily conserved among land plants and that it confers the ability to survive in acid soils through the transcriptional regulation of Al- and H⁺-tolerance genes.

  6. Expression Profiling of Abiotic Stress-Inducible Genes in response to Multiple Stresses in Rice (Oryza sativa L. Varieties with Contrasting Level of Stress Tolerance

    Directory of Open Access Journals (Sweden)

    Supratim Basu

    2014-01-01

    Full Text Available The present study considered transcriptional profiles and protein expression analyses from shoot and/or root tissues under three abiotic stress conditions, namely, salinity, dehydration, and cold, as well as following exogenous abscisic acid treatment, at different time points of stress exposure in three indica rice varieties, IR-29 (salt sensitive, Pokkali, and Nonabokra (both salt tolerant. The candidate genes chosen for expression studies were HKT-1, SOS-3, NHX-1, SAPK5, SAPK7, NAC-1, Rab16A, OSBZ8, DREBP2, CRT/DREBP, WRKY24, and WRKY71, along with the candidate proteins OSBZ8, SAMDC, and GST. Gene expression profile revealed considerable differences between the salt-sensitive and salt-tolerant rice varieties, as the expression in the latter was higher even at the constitutive level, whereas it was inducible only by corresponding stress signals in IR-29. Whether in roots or shoots, the transcriptional responses to different stressors peaked following 24 h of stress/ABA exposure, and the transcript levels enhanced gradually with the period of exposure. The generality of stress responses at the transcriptional level was therefore time dependent. Heat map data also showed differential transcript abundance in the three varieties, correlating the observation with transcript profiling. In silico analysis of the upstream regions of all the genes represented the existence of conserved sequence motifs in single or multiple copies that are indispensable to abiotic stress response. Overall, the transcriptome and proteome analysis undertaken in the present study indicated that genes/proteins conferring tolerance, belonging to different functional classes, were overrepresented, thus providing novel insight into the functional basis of multiple stress tolerance in indica rice varieties. The present work will pave the way in future to select gene(s for overexpression, so as to generate broad spectrum resistance to multiple stresses simultaneously.

  7. Transcriptome changes in foxtail millet genotypes at high salinity: identification and characterization of a PHGPX gene specifically upregulated by NaCl in a salt-tolerant line.

    Science.gov (United States)

    Sreenivasulu, Nese; Miranda, Manoela; Prakash, Harischandra Sripathy; Wobus, Ulrich; Weschke, Winfriede

    2004-04-01

    Using a macro array filter with 711 cDNA inserts representing 620 unigenes selected from a barley EST collection, we identified transcripts differentially expressed in salt (NaCl)-treated tolerant (cv. Prasad) and sensitive (cv. Lepakshi) seedlings of foxtail millet (Setaria italica L.). Transcripts of hydrogen peroxide scavenging enzymes such as phospholipid hydroperoxide glutathione peroxidase (PHGPX), ascorbate peroxidase (APX) and catalase 1 (CAT1) in addition to some genes of cellular metabolism were found to be especially up-regulated at high salinity in the tolerant line. To analyse this process at the protein level we examined protein expression patterns under various stress conditions. A 25 kD protein with a pI of 4.8 was found to be induced prominently under high salt concentrations (250 mmol/L). This salt-induced 25 kD protein has been purified and identified by peptide sequencing as PHGPX protein. The increase of the PHGPX protein level under salt stress in the tolerant line parallels the PHGPX mRNA results of array analysis but was more pronounced. We cloned and characterized the foxtail millet PHGPX cDNA, which shows 85% and 95% homology at the DNA and protein level, respectively, to one stress-induced member of the small barley PHGPX gene family encoding non-selenium glutathione peroxidases. As shown by Southern blot analysis, a small family of PHGPX genes exists in foxtail millet, too. The specific expression pattern of the PHGPX gene in salt-induced tolerant millet seedlings suggests that its product plays an important role in the defense reaction against salt-induced oxidative damage and that the characterized glutathione peroxidase is one of the components conferring resistance against salt to the tolerant foxtail millet cultivar.

  8. Overexpression of glycerol-3-phosphate acyltransferase gene improves chilling tolerance in tomato.

    Science.gov (United States)

    Sui, Na; Li, Meng; Zhao, Shi-Jie; Li, Feng; Liang, Hui; Meng, Qing-Wei

    2007-10-01

    A tomato (Lycopersicon esculentum Mill.) glycerol-3-phosphate acyltransferase gene (LeGPAT) was isolated. The deduced amino acid sequence revealed that LeGPAT contained four acyltransferase domains, showing high identities with GPAT in other plant species. A GFP fusion protein of LeGPAT was targeted to chloroplast in cowpea mesophyll protoplast. RNA gel blot showed that the mRNA accumulation of LeGPAT in the wild type (WT) was induced by chilling temperature. Higher expression levels were observed when tomato leaves were exposed to 4 degrees C for 4 h. RNA gel and western blot analysis confirmed that the sense gene LeGPAT was transferred into the tomato genome and overexpressed under the control of 35S-CaMV. Although tomato is classified as a chilling-sensitive plant, LeGPAT exhibited selectivity to 18:1 over 16:0. Overexpression of LeGPAT increased total activity of LeGPAT and cis-unsaturated fatty acids in PG in thylakoid membrane. Chilling treatment induced less ion leakage from the transgenic plants than from the WT. The photosynthetic rate and the maximal photochemical efficiency of PS II (Fv/Fm) in transgenic plants decreased more slowly during chilling stress and recovered faster than in WT under optimal conditions. The oxidizable P700 in both WT and transgenic plants decreased obviously at chilling temperature under low irradiance, but the oxidizable P700 recovered faster in transgenic plants than in the WT. These results indicate that overexpression of LeGPAT increased the levels of PG cis-unsaturated fatty acids in thylakoid membrane, which was beneficial for the recovery of chilling-induced PS I photoinhibition in tomato.

  9. The Relationship between Hydroxamates Cyclic Secretion from Maize and Its Tolerance to Aluminum%玉米异羟肟酸类物质的分泌与其耐铝性的关系

    Institute of Scientific and Technical Information of China (English)

    唐新莲; 郭添香; 高小凤; 黎晓峰; 顾明华

    2015-01-01

    Aluminum (Al) toxicity is a major limiting factor for plant growth on acid soils; plants have evolved different strategies to detoxify Al stress due to different growth environments. Elucidation of these strategies will help us generate crops with enhanced Al tolerance. Most land plants use secretion of organic acid anions, such as oxalate, citrate and malate in response to Al stress. However, little work has so far been reported on relationship between Al resistance and Al-induced exudation of hydroxamates cyclic from roots ofZea MaysL. varieties. In this study, fifty-six varieties of maize were used to study the relationship between hydroxamates cyclic and Al tolerance based on the root elongation, Al content, callose content and hydroxamates cyclic measured among these 56 varieties. Al could induce secretion of hydroxamates cyclic from roots of different maize varieties, and callose, Al content of root tips were also significantly increased after Al treatment. Furthermore, there was significantly positive correlation between the root elon-gation and Al-induced secretion of hydroxamates cyclic(rDIMBOA=0.4550**,rMBOA=0.6008**),whereas there was significantly negative correlation between the Al content and hydroxamates cyclic(rDIMBOA=-0.3542**,rMBOA=-0.4841**), and callose was also significantly positively related to hydroxamates cyclic (rDIMBOA=-0.3651**,rMBOA=-0.1351). Cluster analysis showed that Al-induced secretion of hydroxamates cyclic from 30 Al-tolerance varieties such as Taiyu No.11, Feiyu No.3 and so on were higher than those of 7 Al-sensitive varieties such as Zhengdan No.958, Beiyu No.2883 and so on. Our results suggested that the secretion of hydroxamates cyclic in roots could be a novel mechanism for some tolerance varieties to resist the toxicity of Al.%铝毒是植物在酸性土壤中生长的主要限制因子,由于生长环境的差异,植物进化出不同的策略来抵抗铝毒害。阐明这些机理,将有助于开发抗铝毒农作

  10. Tolerating Zero Tolerance?

    Science.gov (United States)

    Moore, Brian N.

    2010-01-01

    The concept of zero tolerance dates back to the mid-1990s when New Jersey was creating laws to address nuisance crimes in communities. The main goal of these neighborhood crime policies was to have zero tolerance for petty crime such as graffiti or littering so as to keep more serious crimes from occurring. Next came the war on drugs. In federal…

  11. Identification of stress-induced genes from the drought-tolerant plant Prosopis juliflora (Swartz) DC. through analysis of expressed sequence tags.

    Science.gov (United States)

    George, Suja; Venkataraman, Gayatri; Parida, Ajay

    2007-05-01

    Abiotic stresses such as cold, salinity, drought, wounding, and heavy metal contamination adversely affect crop productivity throughout the world. Prosopis juliflora is a phreatophyte that can tolerate severe adverse environmental conditions such as drought, salinity, and heavy metal contamination. As a first step towards the characterization of genes that contribute to combating abiotic stress, construction and analysis of a cDNA library of P. juliflora genes is reported here. Random expressed sequence tag (EST) sequencing of 1750 clones produced 1467 high-quality reads. These clones were classified into functional categories, and BLAST comparisons revealed that 114 clones were homologous to genes implicated in stress response(s) and included heat shock proteins, metallothioneins, lipid transfer proteins, and late embryogenesis abundant proteins. Of the ESTs analyzed, 26% showed homology to previously uncharacterized genes in the databases. Fifty-two clones from this category were selected for reverse Northern analysis: 21 were shown to be upregulated and 16 downregulated. The results obtained by reverse Northern analysis were confirmed by Northern analysis. Clustering of the 1467 ESTs produced a total of 295 contigs encompassing 790 ESTs, resulting in a 54.2% redundancy. Two of the abundant genes coding for a nonspecific lipid transfer protein and late embryogenesis abundant protein were sequenced completely. Northern analysis (after polyethylene glycol stress) of the 2 genes was carried out. The implications of the analyzed genes in abiotic stress tolerance are also discussed.

  12. Two P5CS genes from common bean exhibiting different tolerance to salt stress in transgenic Arabidopsis

    Indian Academy of Sciences (India)

    Ji Bao Chen; Jian Wei Yang; Zhao Yuan Zhang; Xiao Fan Feng; Shu Min Wang

    2013-12-01

    Many plants accumulate proline in response to salt stress. -pyrroline-5-carboxylate synthetase (P5CS) is the rate-limiting enzyme in proline biosynthesis in plants. Plasmid DNA (pCHF3-PvP5CS1 and pCHF3-PvP5CS2) containing the selectable neomycin phosphotransferase gene for kanamycin resistance and Phaseolus vulgaris P5CS (PvP5CS1 and PvP5CS2) cDNA was introduced into Arabidopsis plants using Agrobacterium-mediated gene transfer. Southern blot, northern blot and RT-PCR analyses demonstrated that the foreign genes were integrated into Arabidopsis chromosomal DNA and expressed. Single-gene transformants were analysed in this study. Transgenic plants expressed higher levels of PvP5CS1 and PvP5CS2 transcripts under salt stress conditions than under normal conditions. When treated with 0, 100 and 200 mM NaCl, the average proline content in leaves of transgenic plants was significantly higher $(P \\lt 0.01)$ than control plants. The average relative electrical conductivity (REC) of transgenic lines was significantly lower $(P \\lt 0.01)$ than control plants under salt stress condition. Biomass production of transgenic lines was significantly higher $(P \\lt 0.05)$ than control plants under 200 mM NaCl stress treatment. These results indicated that introducing PvP5CS1 and PvP5CS2 cDNA into transgenic Arabidopsis caused proline overproduction, increasing salt tolerance. Although the expression of PvP5CS1 in L4 lines and PvP5CS2 in S4 lines was the same under salt stress condition, the S4 lines accumulated 1.6 and 1.9 times more proline than the L4 lines under 100 and 200 mM NaCl treatments, respectively. The REC of S4 plants was 0.5 (100 mM NaCl) and 0.6 times (200 mM NaCl) that of L4 plants. The biomass production of S4 plants was 1.6 times (200 mM NaCl) more than in L4 plants. Total P5CS enzyme activity of S4 was significantly higher than that of L4. These results implied that the PvP5CS2 protein had stronger capacity to catalyze proline synthesis than PvP5CS1 under salt

  13. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

    Directory of Open Access Journals (Sweden)

    Bingying Han

    2016-07-01

    Full Text Available Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD. Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis. All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g−1 fresh weight (FW, and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3–5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS, 10 trehalose-6-phosphate phosphatases (TPP, and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1–4 that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1 in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose

  14. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava.

    Science.gov (United States)

    Han, Bingying; Fu, Lili; Zhang, Dan; He, Xiuquan; Chen, Qiang; Peng, Ming; Zhang, Jiaming

    2016-07-13

    Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz) is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD). Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis). All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g(-1) fresh weight (FW), and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3-5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS), 10 trehalose-6-phosphate phosphatases (TPP), and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1-4) that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1) in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose under normal

  15. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

    Science.gov (United States)

    Han, Bingying; Fu, Lili; Zhang, Dan; He, Xiuquan; Chen, Qiang; Peng, Ming; Zhang, Jiaming

    2016-01-01

    Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz) is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD). Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis). All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g−1 fresh weight (FW), and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3–5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS), 10 trehalose-6-phosphate phosphatases (TPP), and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1–4) that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1) in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose under

  16. Neonatal helper-dependent adenoviral vector gene therapy mediates correction of hemophilia A and tolerance to human factor VIII.

    Science.gov (United States)

    Hu, Chuhong; Cela, Racel G; Suzuki, Masataka; Lee, Brendan; Lipshutz, Gerald S

    2011-02-01

    Neonatal gene therapy is a promising strategy for treating a number of congenital diseases diagnosed shortly after birth as expression of therapeutic proteins during postnatal life may limit the pathologic consequences and result in a potential "cure." Hemophilia A is often complicated by the development of antibodies to recombinant protein resulting in treatment failure. Neonatal administration of vectors may avoid inhibitory antibody formation to factor VIII (FVIII) by taking advantage of immune immaturity. A helper-dependent adenoviral vector expressing human factor VIII was administered i.v. to neonatal hemophilia A knockout mice. Three days later, mice produced high levels of FVIII. Levels declined rapidly with animal growth to 5 wk of age with stable factor VIII expression thereafter to >1 y of age. Decline in factor VIII expression was not related to cell-mediated or humoral responses with lack of development of antibodies to capsid or human factor VIII proteins. Subsequent readministration and augmentation of expression was possible as operational tolerance was established to factor VIII without development of inhibitors; however, protective immunity to adenovirus remained.

  17. Heterology expression of the sweet pepper CBF3 gene confers elevated tolerance to chilling stress in transgenic tobacco.

    Science.gov (United States)

    Yang, Sha; Tang, Xian-Feng; Ma, Na-Na; Wang, Li-Yan; Meng, Qing-Wei

    2011-10-15

    Various studies have confirmed that the CBF (C-repeat binding factor) family of transcription factors has a key role in regulating many plants' responses to cold stress. Here we isolated CBF3 from sweet pepper (Capsicum frutescens). Green fluorescent protein (GFP) fusion protein of CfCBF3 was targeted to the nucleus of the onion epidermis cell. RNA gel blot analysis indicated that CfCBF3 was expressed in leaves of sweet pepper and the expression was induced by low temperature, drought and salinity stresses but not by ABA. Overexpression of CfCBF3 under the control of the CaMV35S promoter in tobacco induced expression of orthologs of CBF3-targeted genes and increased chilling tolerance without a dwarf phenotype. Indeed it also led to multiple biochemical and physiological changes associated with chilling stress. Higher levels of proline (Pro) and soluble sugars and lower content of reactive oxygen species (ROS) were observed in transgenic plants. Our results demonstrated that the increase in total unsaturated fatty acids, especially in phosphatidylglycerol (PG) was detected by overexpression of CfCBF3. During exposure to chilling stress, the transgenic lines were less susceptible to chilling-induced photoinhibition than wild-type (WT) plants. These results suggest that overexpression of CfCBF3 led to modification of the fatty acid unsaturation and alleviated the injuries under chilling stress.

  18. Overexpression of MpCYS4, A Phytocystatin Gene from Malus prunifolia (Willd.) Borkh., Enhances Stomatal Closure to Confer Drought Tolerance in Transgenic Arabidopsis and Apple.

    Science.gov (United States)

    Tan, Yanxiao; Li, Mingjun; Yang, Yingli; Sun, Xun; Wang, Na; Liang, Bowen; Ma, Fengwang

    2017-01-01

    Phytocystatins (PhyCys) comprise a group of inhibitors for cysteine proteinases in plants. They play a wide range of important roles in regulating endogenous processes and protecting plants against various environmental stresses, but the underlying mechanisms remain largely unknown. Here, we detailed the biological functions of MpCYS4, a member of cystatin genes isolated from Malus prunifolia. This gene was activated under water deficit, heat (40°C), exogenous abscisic acid (ABA), or methyl viologen (MV) (Tan et al., 2014a). At cellular level, MpCYS4 protein was found to be localized in the nucleus, cytoplasm, and plasma membrane of onion epidermal cells. Recombinant MpCYS4 cystatin expressed in Escherichia coli was purified and it exhibited cysteine protease inhibitor activity. Transgenic overexpression of MpCYS4 in Arabidopsis (Arabidopsis thaliana) and apple (Malus domestica) led to ABA hypersensitivity and series of ABA-associated phenotypes, such as enhanced ABA-induced stomatal closing, altered expression of many ABA/stress-responsive genes, and enhanced drought tolerance. Taken together, our results demonstrate that MpCYS4 is involved in ABA-mediated stress signal transduction and confers drought tolerance at least in part by enhancing stomatal closure and up-regulating the transcriptional levels of ABA- and drought-related genes. These findings provide new insights into the molecular mechanisms by which phytocystatins influence plant growth, development, and tolerance to stress.

  19. The association of SNPs in Hsp90β gene 5' flanking region with thermo tolerance traits and tissue mRNA expression in two chicken breeds.

    Science.gov (United States)

    Chen, Zhuo-Yu; Gan, Jian-Kang; Xiao, Xiong; Jiang, Li-Yan; Zhang, Xi-Quan; Luo, Qing-Bin

    2013-09-01

    Thermo stress induces heat shock proteins (HSPs) expression and HSP90 family is one of them that has been reported to involve in cellular protection against heat stress. But whether there is any association of genetic variation in the Hsp90β gene in chicken with thermo tolerance is still unknown. Direct sequencing was used to detect possible SNPs in Hsp90β gene 5' flanking region in 3 chicken breeds (n = 663). Six mutations, among which 2 SNPs were chosen and genotypes were analyzed with PCR-RFLP method, were found in Hsp90β gene in these 3 chicken breeds. Association analysis indicated that SNP of C.-141G>A in the 5' flanking region of the Hsp90β gene in chicken had some effect on thermo tolerance traits, which may be a potential molecular marker of thermo tolerance, and the genotype GG was the thermo tolerance genotype. Hsp90β gene mRNA expression in different tissues detected by quantitative real-time PCR assay were demonstrated to be tissue dependent, implying that different tissues have distinct sensibilities to thermo stress. Besides, it was shown time specific and varieties differences. The expression of Hsp90β mRNA in Lingshan chickens in some tissues including heart, liver, brain and spleen were significantly higher or lower than that of White Recessive Rock (WRR). In this study, we presume that these mutations could be used in marker assisted selection for anti-heat stress chickens in our breeding program, and WRR were vulnerable to tropical thermo stress whereas Lingshan chickens were well adapted.

  20. A Cyclin Dependent Kinase Regulatory Subunit (CKS) Gene of Pigeonpea Imparts Abiotic Stress Tolerance and Regulates Plant Growth and Development in Arabidopsis.

    Science.gov (United States)

    Tamirisa, Srinath; Vudem, Dashavantha R; Khareedu, Venkateswara R

    2017-01-01

    Frequent climatic changes in conjunction with other extreme environmental factors are known to affect growth, development and productivity of diverse crop plants. Pigeonpea, a major grain legume of the semiarid tropics, endowed with an excellent deep-root system, is known as one of the important drought tolerant crop plants. Cyclin dependent kinases (CDKs) are core cell cycle regulators and play important role in different aspects of plant growth and development. The cyclin-dependent kinase regulatory subunit gene (CKS) was isolated from the cDNA library of pigeonpea plants subjected to drought stress. Pigeonpea CKS (CcCKS) gene expression was detected in both the root and leaf tissues of pigeonpea and was upregulated by polyethylene glycol (PEG), mannitol, NaCl and abscisic acid (ABA) treatments. The overexpression of CcCKS gene in Arabidopsis significantly enhanced tolerance of transgenics to drought and salt stresses as evidenced by different physiological parameters. Under stress conditions, transgenics showed higher biomass, decreased rate of water loss, decreased MDA levels, higher free proline contents, and glutathione levels. Moreover, under stress conditions transgenics exhibited lower stomatal conductance, lower transpiration, and higher photosynthetic rates. However, under normal conditions, CcCKS-transgenics displayed decreased plant growth rate, increased cell size and decreased stomatal number compared to those of wild-type plants. Real-time polymerase chain reaction revealed that CcCKS could regulate the expression of both ABA-dependent and ABA-independent genes associated with abiotic stress tolerance as well as plant growth and development. As such, the CcCKS seems promising and might serve as a potential candidate gene for enhancing the abiotic stress tolerance of crop plants.

  1. HsfA1d, a Protein Identified via FOX Hunting Using Thellungiella salsuginea cDNAs Improves Heat Tolerance by Regulating Heat-Stress-Responsive Gene Expression

    Institute of Scientific and Technical Information of China (English)

    Yukari Higashi; Naohiko Ohama; Tomoko Ishikawa; Taku Katori; Ayaka Shimura; Kazuya Kusakabe; Kazuko Yamaguchi-Shinozaki

    2013-01-01

    Theilungiella salsuginea (formerly T.halophila),a species closely related to Arabidopsis (Arabidopsis thaliana),is tolerant not only to high salt levels,but also to chilling,freezing,and ozone.Here,we report that T.salsuginea also shows greater heat tolerance than Arabidopsis.We identified T.salsuginea HsfAld (TsHsfAld) as a gene that can confer marked heat tolerance on Arabidopsis.TsHsfAld was identified via Full-length cDNA Over-eXpressing gene (FOX) hunting from among a collection of heat-stress-related T.salsuginea cDNAs.Transgenic Arabidopsis overexpressing TsHsfAld showed constitutive up-regulation of many genes in the Arabidopsis AtHsfA1 regulon under normal growth temperature.In Arabidopsis mesophyll protoplasts,TsHsfAld was localized in both the nucleus and the cytoplasm.TsHsfAld also interacted with AtHSP90,which negatively regulates AtHsfAls by forming HsfA1-HSP90 complexes in the cytoplasm.It is likely that the partial nuclear localization of TsHsfAld induced the expression of the AtHsfAld regulon in the transgenic plants at normal temperature.We also discovered that transgenic Arabidopsis plants overexpressing AtHsfAld were more heat-tolerant than wild-type plants and up-regulated the expression of the HsfAld regulon,as was observed in TsHsfAld-overexpressing plants.We propose that the products of both TsHsfAld and AtHsfAld function as positive regulators of Arabidopsis heat-stress response and would be useful for the improvement of heat-stress tolerance in other plants.

  2. Enhancing Heat Tolerance of the Little Dogwood Cornus canadensis L. f. with Introduction of a Superoxide Reductase Gene from the Hyperthermophilic Archaeon Pyrococcus furiosus.

    Science.gov (United States)

    Geng, Xing-Min; Liu, Xiang; Ji, Mikyoung; Hoffmann, William A; Grunden, Amy; Xiang, Qiu-Yun J

    2016-01-01

    Production of reactive oxygen species (ROS) can be accelerated under various biotic and abiotic stresses causing lipid peroxidation, protein degradation, enzyme inactivation, and DNA damage. Superoxide reductase (SOR) is a novel antioxidant enzyme from Pyrococcus furiosus and is employed by this anaerobic hyperthermophilic archaeon for efficient detoxification of ROS. In this study, SOR was introduced into a flowering plant Cornus canadensis to enhance its heat tolerance and reduce heat induced damage. A fusion construct of the SOR gene and Green Fluorescent Protein gene (GFP) was introduced into C. canadensis using Agrobacterium-mediated transformation. Heat tolerance of the GFP-SOR expressing transgenic plants was investigated by observing morphological symptoms of heat injury and by examining changes in photosynthesis, malondialdehyde (MDA), and proline levels in the plants. Our results indicate that the expression of the P. furiosus SOR gene in the transgenic plants alleviated lipid peroxidation of cell membranes and photoinhibition of PS II, and decreased the accumulation of proline at 40°C. After a series of exposures to increasing temperatures, the SOR transgenic plants remained healthy and green whereas most of the non-transgenic plants dried up and were unable to recover. While it had previously been reported that expression of SOR in Arabidopsis enhanced heat tolerance, this is the first report of the successful demonstration of improved heat tolerance in a non-model plant resulting from the introduction of P. furiosus SOR. The study demonstrates the potential of SOR for crop improvement and that inherent limitations of plant heat tolerance can be ameliorated with P. furiosus SOR.

  3. Enhancing heat tolerance of the little dogwood Cornus canadensis L. f. with introduction of a superoxide reductase gene from the hyperthermophilic archaeon Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Xinmin eGeng

    2016-01-01

    Full Text Available Production of reactive oxygen species (ROS can be accelerated under various biotic and abiotic stresses causing lipid peroxidation, protein degradation, enzyme inactivation, and DNA damage. Superoxide reductase (SOR is a novel antioxidant enzyme from Pyrococcus furiosus and is employed by this anaerobic hyperthermophilic archaeon for efficient detoxification of ROS. In this study, SOR was introduced into a flowering plant Cornus canadensis to enhance its heat tolerance and reduce heat induced damage. A fusion construct of the SOR gene and Green Fluorescent Protein gene (GFP was introduced into C. canadensis using Agrobacterium-mediated transformation. Heat tolerance of the GFP-SOR expressing transgenic plants was investigated by observing morphological symptoms of heat injury and by examining changes in photosynthesis, malondialdehyde (MDA, and proline levels in the plants. Our results indicate that the expression of the P. furiosus SOR gene in the transgenic plants alleviated lipid peroxidation of cell membranes and photoinhibition of PS II, and decreased the accumulation of proline at 40°C. After a series of exposures to increasing temperatures, the SOR transgenic plants remained healthy and green whereas most of the non-transgenic plants dried up and were unable to recover. While it had previously been reported that expression of SOR in Arabidopsis enhanced heat tolerance, this is the first report of the successful demonstration of improved heat tolerance in a non-model plant resulting from the introduction of P. furiosus SOR. The study demonstrates the potential of SOR for crop improvement and that inherent limitations of plant heat tolerance can be ameliorated with P. furiosus SOR.

  4. Genetic dissection of drought and heat tolerance in chickpea through genome-wide and candidate gene-based association mapping approaches.

    Directory of Open Access Journals (Sweden)

    Mahendar Thudi

    Full Text Available To understand the genetic basis of tolerance to drought and heat stresses in chickpea, a comprehensive association mapping approach has been undertaken. Phenotypic data were generated on the reference set (300 accessions, including 211 mini-core collection accessions for drought tolerance related root traits, heat tolerance, yield and yield component traits from 1-7 seasons and 1-3 locations in India (Patancheru, Kanpur, Bangalore and three locations in Africa (Nairobi, Egerton in Kenya and Debre Zeit in Ethiopia. Diversity Array Technology (DArT markers equally distributed across chickpea genome were used to determine population structure and three sub-populations were identified using admixture model in STRUCTURE. The pairwise linkage disequilibrium (LD estimated using the squared-allele frequency correlations (r2; when r2<0.20 was found to decay rapidly with the genetic distance of 5 cM. For establishing marker-trait associations (MTAs, both genome-wide and candidate gene-sequencing based association mapping approaches were conducted using 1,872 markers (1,072 DArTs, 651 single nucleotide polymorphisms [SNPs], 113 gene-based SNPs and 36 simple sequence repeats [SSRs] and phenotyping data mentioned above employing mixed linear model (MLM analysis with optimum compression with P3D method and kinship matrix. As a result, 312 significant MTAs were identified and a maximum number of MTAs (70 was identified for 100-seed weight. A total of 18 SNPs from 5 genes (ERECTA, 11 SNPs; ASR, 4 SNPs; DREB, 1 SNP; CAP2 promoter, 1 SNP and AMDH, 1SNP were significantly associated with different traits. This study provides significant MTAs for drought and heat tolerance in chickpea that can be used, after validation, in molecular breeding for developing superior varieties with enhanced drought and heat tolerance.

  5. Transient blockade of the inducible costimulator pathway generates long-term tolerance to factor VIII after nonviral gene transfer into hemophilia A mice.

    Science.gov (United States)

    Peng, Baowei; Ye, Peiqing; Blazar, Bruce R; Freeman, Gordon J; Rawlings, David J; Ochs, Hans D; Miao, Carol H

    2008-09-01

    Formation of inhibitory antibodies is a common problem encountered in clinical treatment for hemophilia. Human factor VIII (hFVIII) plasmid gene therapy in hemophilia A mice also leads to strong humoral responses. We demonstrate that short-term therapy with an anti-ICOS monoclonal antibody to transiently block the inducible costimulator/inducible costimulator ligand (ICOS/ICOSL) signaling pathway led to sustained tolerance to hFVIII in hFVIII plasmid-treated hemophilia A mice and allowed persistent, high-level FVIII functional activity (100%-300% of normal). Anti-ICOS treatment resulted in depletion of ICOS(+)CD4(+) T cells and activation of CD25(+)Foxp3(+) Tregs in the peripheral blood, spleen, and lymph nodes. CD4(+) T cells from anti-ICOS-treated mice did not proliferate in response to hFVIII stimulation and produced high levels of regulatory cytokines, including interleukin-10 and transforming growth factor-beta. Moreover, CD4(+)CD25(+) Tregs from tolerized mice adoptively transferred dominant tolerance in syngeneic hFVIII plasmid-treated hemophilia A mice and reduced the production of antibodies against FVIII. Anti-ICOS-treated mice tolerized to hFVIII generated normal primary and secondary antibody responses after immunization with the T-dependent antigen, bacteriophage Phix 174, indicating maintenance of immune competency. Our data indicate that transient anti-ICOS monoclonal antibody treatment represents a novel single-agent immunomodulatory strategy to overcome the immune responses against transgene product after gene therapy.

  6. AtHsfA2 modulates expression of stress responsive genes and enhances tolerance to heat and oxidative stress in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    LI; Chunguang; CHEN; Qijun; GAO; Xinqi; QI; Bishu; CHEN; Na

    2005-01-01

    There is increasing evidence for considerable interlinking between the responses to heat stress and oxidative stress, and recent researches suggest heat shock transcription factors (Hsfs) play an important role in linking heat shock with oxidative stress signals. In this paper, we present evidence that AtHsfA2 modulated expression of stress responsive genes and enhanced tolerance to heat and oxidative stress in Arabidopsis. Using Northern blot and quantitative RT-PCR analysis, we demonstrated that the expression of AtHsfA2 was induced by not only HS but also oxidative stress. By functional analysis of AtHsfA2 knockout mutants and AtHsfA2 overexpressing transgenic plants, we also demonstrated that the mutants displayed reduced the basal and acquired thermotolerance as well as oxidative stress tolerance but the overexpression lines displayed increased tolerance to these stress. The phenotypes correlated with the expression of some Hsps and APX1, ion leakage, H2O2 level and degree of oxidative injuries. These results showed that, by modulated expression of stress responsive genes, AtHsfA2 enhanced tolerance to heat and oxidative stress in Arabidopsis. So we suggest that AtHsfA2 plays an important role in linking heat shock with oxidative stress signals.

  7. Expression of multiple resistance genes enhances tolerance to environmental stressors in transgenic poplar (Populus × euramericana 'Guariento'.

    Directory of Open Access Journals (Sweden)

    Xiaohua Su

    Full Text Available Commercial and non-commercial plants face a variety of environmental stressors that often cannot be controlled. In this study, transgenic hybrid poplar (Populus × euramericana 'Guariento' harboring five effector genes (vgb, SacB, JERF36, BtCry3A and OC-I were subjected to drought, salinity, waterlogging and insect stressors in greenhouse or laboratory conditions. Field trials were also conducted to investigate long-term effects of transgenic trees on insects and salt tolerance in the transformants. In greenhouse studies, two transgenic lines D5-20 and D5-21 showed improved growth, as evidenced by greater height and basal diameter increments and total biomass relative to the control plants after drought or salt stress treatments. The improved tolerance to drought and salt was primarily attributed to greater instantaneous water use efficiency (WUEi in the transgenic trees. The chlorophyll concentrations tended to be higher in the transgenic lines under drought or saline conditions. Transformed trees in drought conditions accumulated more fructan and proline and had increased Fv/Fm ratios (maximum quantum yield of photosystem II under waterlogging stress. Insect-feeding assays in the laboratory revealed a higher total mortality rate and lower exuviation index of leaf beetle [Plagiodera versicolora (Laicharting] larvae fed with D5-21 leaves, suggesting enhanced insect resistance in the transgenic poplar. In field trials, the dominance of targeted insects on 2-year-old D5-21 transgenic trees was substantially lower than that of the controls, indicating enhanced resistance to Coleoptera. The average height and DBH (diameter at breast height of 2.5-year-old transgenic trees growing in naturally saline soil were 3.80% and 4.12% greater than those of the control trees, but these increases were not significant. These results suggested that multiple stress-resistance properties in important crop tree species could be simultaneously improved, although

  8. Genome-wide analysis of AP2/ERF family genes from Lotus corniculatus shows LcERF054 enhances salt tolerance.

    Science.gov (United States)

    Sun, Zhan-Min; Zhou, Mei-Liang; Xiao, Xing-Guo; Tang, Yi-Xiong; Wu, Yan-Min

    2014-09-01

    Lotus corniculatus is used in agriculture as a main forage plant. Members of the Apetala2/ethylene response factor (AP2/ERF) family play important roles in regulating gene expression in response to many forms of stress, including drought and salt. Here, starting from database of the L. corniculatus var. japonicus genome, we identified 127 AP2/ERF genes by insilico cloning method. The phylogeny, gene structures, and putative conserved motifs in L. corniculatus var. japonicus ERF proteins were analyzed. Based on the number of AP2/ERF domains and the function of the genes, 127 AP2/ERF genes from L. corniculatus var. japonicus were classified into five subfamilies named the AP2, dehydration-responsive element binding factor (DREB), ERF, RAV, and a soloist. Outside the AP2/ERF domain, many L. corniculatus var. japonicus-specific conserved motifs were detected. Expression profile analysis of AP2/ERF genes by quantitative real-time PCR revealed that 19 LcERF genes, including LcERF054 (KJ004728), were significantly induced by salt stress. The results showed that the LcERF054 gene encodes a nuclear transcription activator. Overexpression of LcERF054 in Arabidopsis enhanced the tolerances to salt stress, showed higher germination ratio of seeds, and had elevated levels of relative moisture contents, soluble sugars, proline, and lower levels of malondialdehyde under stress conditions compared to wild-type plants. The expression of hyperosmotic salinity response genes COR15A, LEA4-5, P5CS1, and RD29A was found to be elevated in the LcERF054-overexpressing Arabidopsis plants compared to wild type. These results revealed that the LcERF genes play important roles in L. corniculatus cv Leo under salt stress and that LcERFs are attractive engineering targets in applied efforts to improve abiotic stress tolerances in L. corniculatus cv Leo or other crops.

  9. Over-expression of a glutathione S-transferase gene, GsGST, from wild soybean (Glycine soja) enhances drought and salt tolerance in transgenic tobacco.

    Science.gov (United States)

    Ji, Wei; Zhu, Yanming; Li, Yong; Yang, Liang; Zhao, Xiaowen; Cai, Hua; Bai, Xi

    2010-08-01

    Glycine soja is a species of soybean that survives in adverse environments including high salt and drought conditions. We constructed a cDNA library from G. soja seedlings treated with NaCl and isolated a glutathione S-transferase gene (GsGST: GQ265911) from the library. The cDNA encoding GsGST contains an open reading frame of 660 bp and the predicted protein belongs to the tau class of GST family proteins. Tobacco plants over-expressing the GsGST gene showed sixfold higher GST activity than wild-type plants. Transgenic tobacco plants exhibited enhanced dehydration tolerance. T(2) transgenic tobacco plants showed higher tolerance at the seedling stage than wild-type plants to salt and mannitol as demonstrated by longer root length and less growth retardation.

  10. Adenoviral-mediated localized CTLA-4Ig gene expression induces long-term allograft pancreas survival and donor-specific immune tolerance in rats

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    T cell activation following alloantigen recognition plays a critical role in the development of the rejection in all solid organ, tissue and cell transplantation. A recombinant molecule, cytotoxic T lymphocyte antigen 4 antibody (CTLA-4Ig), is known to induce to T-cell into "anergy" by blocking the costimulatory B7-CD28 interaction. Either systemic or localized administration of CTLA-Ig has been shown to prolong allograft survival and induce donor-specific tolerance in some transplant models. In this study, we characterized the expression and immunosuppressive effectiveness of adenoviral-mediated CTLA-4Ig gene transfer. We demonstrated transduction of the allografts with AdCTLA-41g resulted in localized expression, permanent graft survival and stable donor-specific tolerance. In addition, by performing simultaneous dual-organ transplantation, we targeted on immunosuppression through a local expression of CTLA-4Ig via adenoviral-mediated gene transfer into pancreatic allografts.

  11. ADH enzyme activity and Adh gene expression in Drosophila melanogaster lines differentially selected for increased alcohol tolerance

    NARCIS (Netherlands)

    Malherbe, Y.; Kamping, Albert; van Delden, W.; van de Zande, L.

    2005-01-01

    In Drosophila melanogaster, alcohol dehydrogenase (ADH) activity is essential for ethanol tolerance, but its role may not be restricted to alcohol metabolism alone. Here we describe ADH activity and Adh expression level upon selection for increased alcohol tolerance in different life-stages of D. me

  12. Over-expression of PsGPD, a mushroom glyceraldehyde-3-phosphate dehydrogenase gene, enhances salt tolerance in rice plants.

    Science.gov (United States)

    Cho, Jung-Il; Lim, Hye-Min; Siddiqui, Zamin Shaheed; Park, Sung-Han; Kim, A-Ram; Kwon, Taek-Ryoun; Lee, Seong-Kon; Park, Soo-Chul; Jeong, Mi-Jeong; Lee, Gang-Seob

    2014-08-01

    Transgenic potatoes expressing glyceraldehyde-3-phosphate dehydrogenase (GPD), isolated from the oyster mushroom, Pleurotus sajor-caju, had increased tolerance to salt stress (Jeong et al. Biochem Biophys Res Commun 278:192-196, 2000). To examine the physiological mechanisms enhancing salt tolerance in GPD-transgenic rice plants, the salt tolerance of five GPD transgenic rice lines (T1-T5) derived from Dongjin rice cultivar were evaluated in a fixed 150 mM saline environment in comparison to two known wild-type rice cultivars, Dongjin (salt sensitive) and Pokali (salt tolerant). Transgenic lines, T2, T3, and T5, had a substantial increase in biomass and relative water content compared to Dongjin. Stomatal conductance and osmotic potential were higher in the GPD transgenic lines and were similar to those in Pokali. The results are discussed based on the comparative physiological response of GPD transgenic lines with those of the salt-sensitive and salt-tolerant rice cultivars.

  13. A novel Glycine soja tonoplast intrinsic protein gene responds to abiotic stress and depresses salt and dehydration tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Wang, Xi; Li, Yong; Ji, Wei; Bai, Xi; Cai, Hua; Zhu, Dan; Sun, Xiao-Li; Chen, Lian-Jiang; Zhu, Yan-Ming

    2011-07-15

    Tonoplast intrinsic protein (TIP) is a subfamily of the aquaporin (AQP), also known as major intrinsic protein (MIP) family, and regulates water movement across vacuolar membranes. Some reports have implied that TIP genes are associated with plant tolerance to some abiotic stresses that cause water loss, such as drought and high salinity. In our previous work, we found that an expressed sequence tag (EST) representing a TIP gene in our Glycine soja EST library was inducible by abiotic stresses. This TIP was subsequently isolated from G. soja with cDNA library screening, EST assembly and PCR, and named as GsTIP2;1. The expression patterns of GsTIP2;1 in G. soja under low temperature, salt and dehydration stress were different in leaves and roots. Though GsTIP2;1 is a stress-induced gene, overexpression of GsTIP2;1 in Arabidopsis thaliana depressed tolerance to salt and dehydration stress, but did not affect seedling growth under cold or favorable conditions. Higher dehydration speed was detected in Arabidopsis plants overexpressing GsTIP2;1, implying GsTIP2;1 might mediate stress sensitivity by enhancing water loss in the plant. Such a result is not identical to previous reports, providing some new information about the relationship between TIP and plant abiotic stress tolerance.

  14. Cytosolic expression of synthetic phytochelatin and bacterial metallothionein genes in Deinococcus radiodurans R1 for enhanced tolerance and bioaccumulation of cadmium.

    Science.gov (United States)

    Chaturvedi, Ruchi; Archana, G

    2014-06-01

    Due to its exemplary resistance to ionising radiation, oxidative stress, desiccation and several DNA damaging agents, Deinococcus radiodurans R1 (DR1) is considered as one of the most appropriate candidates for the bioremediation of the nuclear waste sites. However, the high sensitivity of this bacterium to heavy metals, which are usually preponderant at nuclear waste dump sites, precludes its application for bioremediation. This study deals with the expression two metal binding peptides in DR1 as an attractive strategy for developing metal tolerance in this bacterium. A synthetic gene (EC20) encoding a phytochelatin analogue with twenty repeating units of glutamate and cysteine was constructed by overlap extension and expressed in DR1. The cyanobacterial metallothionein (MT) gene, smtA was cloned for intracellular expression in DR1. Both the genes were expressed under the native groESL promoter. DR1 strain carrying the recombinant EC20 demonstrated 2.5-fold higher tolerance to Cd(2+) and accumulated 1.21-fold greater Cd(2+) as opposed to the control while the heterologous expression of MT SmtA in DR1 imparted the transformant superior tolerance to Cd(2+) amassing 2.5-fold greater Cd(2+) than DR1 expressing EC20.

  15. Soybean GmMYB76,GmMYB92,and GmMYB177 genes confer stress tolerance in transgenic Arabidopsis plants

    Institute of Scientific and Technical Information of China (English)

    Yong Liao; Hong-Feng Zou; Hui-Wen Wang; Wan-Ke Zhang; Biao Ma; Jin-Song Zhang; Shou-Yi Chen

    2008-01-01

    MYB-type transcription factors contain the conserved MYB DNA-binding domain of approximately 50 amino acids and are involved in the regulation of many aspects of plant growth,development,metabolism and stress responses.From soybean plants,we identified 156 GmMYB genes using our previously obtained 206 MYB unigenes,and 48 were found to have full-length open-reading frames.Expressions of all these identified genes were examined,and we found that expressions of 43 genes were changed upon treatment with ABA,salt,drought and/or cold stress.Three GmMYB genes,GmMYB76,GmMYB92 and GmMYB177,were chosen for further analysis.Using the yeast assay system,GmMYB76 and GmMYB92 were found to have transactivation activity and can form homodimers.GmMYBI77 did not appear to have transactivation activity but can form heterodimers with GmMYB76.Yeast onehybrid assay revealed that all the three GmMYBs could bind to cis-elements TAT AAC GGT TTT TT and CCG GAA AAAAGG AT,but with different affinity,and GmMYB92 could also bind to TCT CAC CTA CC.The transgenic Arabidopsis plants overexpressing GmMYB76 or GmMYB177 showed better performance than the GmMYB92-transgenic plants in salt and freezing tolerance.However,these transgenic plants exhibited reduced sensitivity to ABA treatment at germination stage in comparison with the wild-type plants.The three GmMYB genes differentially affected a subset of stress-responsive genes in addition to their regulation of a common subset of stress-responsive genes.These results indicate that the three GmMYB genes may play differential roles in stress tolerance,possibly through regulation of stress-responsive genes.

  16. Transcriptional analysis of cell wall and cuticle related genes during fruit development of two sweet cherry cultivars with contrasting levels of cracking tolerance

    Directory of Open Access Journals (Sweden)

    Cristián Balbontín

    2014-04-01

    Full Text Available Rain-induced cracking before harvest is the major cause of crop loss in sweet cherry (Prunus avium [L.] L. In order to better understand the relationship between cherry fruit cracking and gene expression, the transcriptional patterns of six genes related to cell wall modification and cuticular wax biosynthesis were analyzed during fruit setting (FS, fruit color change (FC and fruit ripening (FR, employing two contrasting cultivars: the cracking resistant 'Kordia' and the cracking susceptible 'Bing'. The transcription levels of AP2/EREBP-type transcription factor (PaWINB, wax synthase (WS, ß-ketoacyl-CoA synthase (PaKCS6, and ß-galactosidase (ß-Gal showed higher levels in 'Kordia' than in 'Bing' during the FS stage, while similar values were observed in both cultivars at FR stage. In contrast to that pattern, transcription levels of expansin (PaEXPl were higher at FR stage in 'Kordia' than in 'Bing'. Transcript profile of lipid transport protein gene (PaLTPGl decreased during fruit development, with higher levels in 'Bing' than in 'Kordia' at FC and FR stages suggesting no relation with cracking tolerance. The expression profiles of PaWINB, WS, PaKCS6, and ß-Gal suggest that they are genes involved in conferring cracking tolerance, likely due to their function in cuticle deposition during early stages of fruit development. In addition, a greater expression level of expansin gene would allow for a faster growth rate in 'Kordia' at FR stage.

  17. Antioxidant response and Lea genes expression under salt stress and combined salt plus water stress in two wheat cultivars contrasting in drought tolerance.

    Science.gov (United States)

    Bhagi, Priyanka; Zhawar, Vikramjit Kaur; Gupta, Anil Kumar

    2013-09-01

    Two wheat cultivars, C306 and PBW343 contrasting in drought tolerance were compared for their antioxidant response and Lea genes' expression under salt stress (SS) and combined stress (CS) of salt stress plus water stress during seedlings growth. The drought susceptible cultivar (PBW343) behaved different towards SS/CS than towards WS. It accumulated more dry masses in shoots, more ascorbate, had higher ascorbate to dehydroascorbate ratio, lesser dehydroascorbate, lesser malondialdehyde (MDA), more proline and higher antioxidant enzymes under SS than under WS. CS increased dry masses, ascorbate, ascorbate to dehydroascorbate ratio, antioxidant enzymes and decreased dehydroascorbate and MDA contents from levels under WS. The drought tolerant cultivar (C306) though showed higher levels of ascorbate, ascorbate to dehydroascorbate ratio, lower levels of dehydroascorbate, showed lesser dry biomasses in shoots, higher MDA and lesser ascorbate peroxidase and catalase activities under SS than under WS and these features were improved on combining WS with SS. All lea genes were induced under all stresses in both cultivars except Wrab17 in C306 only, was not induced under any stress. Eight Lea genes out of ten were induced higher under WS than SS in C306 but induced same in PBW343. Wdhn13 gene was higher salt-responsive than other lea genes in both cultivars.

  18. Molecular cloning and functional characterization of a novel apple MdCIPK6L gene reveals its involvement in multiple abiotic stress tolerance in transgenic plants.

    Science.gov (United States)

    Wang, Rong-Kai; Li, Ling-Li; Cao, Zhong-Hui; Zhao, Qiang; Li, Ming; Zhang, Ling-Yun; Hao, Yu-Jin

    2012-05-01

    CBL-interacting protein kinases (CIPKs) are involved in many aspects of plant responses to abiotic stresses. However, their functions are poorly understood in fruit trees. In this study, a salt-induced MdCIPK6L gene was isolated from apple. Its expression was positively induced by abiotic stresses, stress-related hormones and exogenous Ca(2+). MdCIPK6L was not homologous to AtSOS2, however, its ectopic expression functionally complemented Arabidopsis sos2 mutant. Furthermore, yeast two-hybrid assay showed that MdCIPK6L protein interacted with AtSOS3, indicating that it functions in salt tolerance partially like AtSOS2 through SOS pathway. As a result, the overexpression of both MdCIPK6L and MdCIPK6LT175D remarkably enhanced the tolerance to salt, osmotic/drought and chilling stresses, but did not affect root growth, in transgenic Arabidopsis and apple. Also, T-to-D mutation to MdCIPK6L at Thr175 did not affect its function. These differences between MdCIPK6L and other CIPKs, especially CIPK6s, indicate that MdCIPK6L encodes a novel CIPK in apple. Finally, MdCIPK6L overexpression also conferred tolerance to salt, drought and chilling stresses in transgenic tomatoes. Therefore, MdCIPK6L functions in stress tolerance crossing the species barriers, and is supposed to be a potential candidate gene to improve stress tolerance by genetic manipulation in apple and other crops.

  19. Molecular cloning of a novel bioH gene from an environmental metagenome encoding a carboxylesterase with exceptional tolerance to organic solvents

    DEFF Research Database (Denmark)

    Shi, Yuping; Pan, Yingjie; Li, Bailin

    2013-01-01

    Hx with other known BioH proteins revealed interesting diversity in their sensitivity to ionic and nonionic detergents and organic solvents, and BioHx exhibited exceptional resistance to organic solvents, being the most tolerant one amongst all known BioH enzymes. This ascribed BioHx as a novel carboxylesterase...... with a strong potential in industrial applications. CONCLUSIONS: This study constituted the first investigation of a novel bioHx gene in a biotin biosynthetic gene cluster cloned from an environmental metagenome. The bioHx gene was successfully cloned, expressed and characterized. The results demonstrated...... that BioHx is a novel carboxylesterase, displaying distinct biochemical properties with strong application potential in industry. Our results also provided the evidence for the effectiveness of functional metagenomic approach for identifying novel bioH genes from complex ecosystem....

  20. A Member of the 14-3-3 Gene Family in Brachypodium distachyon, BdGF14d, Confers Salt Tolerance in Transgenic Tobacco Plants

    Science.gov (United States)

    He, Yuan; Zhang, Yang; Chen, Lihong; Wu, Chunlai; Luo, Qingchen; Zhang, Fan; Wei, Qiuhui; Li, Kexiu; Chang, Junli; Yang, Guangxiao; He, Guangyuan

    2017-01-01

    Plant 14-3-3 proteins are involved in diverse biological processes, but for the model monocotyledonous species, Brachypodium distachyon, their roles in abiotic stress tolerance are not well understood. In this study, a total of eight Bd14-3-3 genes were identified from B. distachyon and these were designated respectively as BdGF14a–BdGF14g. The qRT-PCR analyses of 3-month-old plants of B. distachyon showed that these genes were all expressed in the stems, leaves, and spikelets. By contrast, most of the plants had relatively lower transcriptional levels in their roots, except for the BdGF14g gene. The different expression profiles of the Bd14-3-3s under various stress treatments, and the diverse interaction patterns between Bd14-3-3s and BdAREB/ABFs, suggested that these gene products probably had a range of functions in the stress responses. The NaCl-induced Bd14-3-3 gene, BdGF14d, was selected for overexpression in tobacco. BdGF14d was found to be localized throughout the cell and it conferred enhanced tolerance to salt in the transgenic plants. Lowered contents of malondialdehyde, H2O2, and Na+, and lower relative electronic conductance (Rec%), yet greater activities of catalase and peroxidase, were observed in the overexpressing plants. Higher photosynthetic rate, transpiration rate, stomatal conductance, and water use efficiency were measured in the transgenic lines. Following abscisic acid (ABA) or NaCl treatment, stomatal aperture in leaves of the BdGF14d-overexpression plants was significantly lower than in leaves of the wild type (WT) controls. The stress-related marker genes involved in the ABA signaling pathway, the reactive oxygen species (ROS)-scavenging system, and the ion transporters were all up-regulated in the BdGF14d-overexpressing plants as compared with WT. Taken together, these results demonstrate that the Bd14-3-3 genes play important roles in abiotic stress tolerance. The ABA signaling pathway, the ROS-scavenging system, and ion

  1. Transgenic rice expressing a cassava (Manihot esculenta Crantz) plasma membrane gene MePMP3-2 exhibits enhanced tolerance to salt and drought stresses.

    Science.gov (United States)

    Yu, Y; Cui, Y C; Ren, C; Rocha, P S C F; Peng, M; Xu, G Y; Wang, M L; Xia, X J

    2016-01-01

    Plasma membrane proteolipid 3 (PMP3) is a class of small hydrophobic proteins found in many organisms including higher plants. Some plant PMP3 genes have been shown to respond to abiotic stresses and to participate in the processes of plant stress tolerance. In this study, we isolated the cassava (Manihot esculenta Crantz) MePMP3-2 gene and functionally characterized its role in tolerance to abiotic stress by expressing it in rice (Oryza sativa L.). MePMP3-2 encodes a 77-amino acid protein belonging to a subgroup of plant PMP3s that have long hydrophylic C-terminal tails of unknown function. In silico analysis and co-localization studies indicated that MePMP3-2 is a plasma membrane protein with two transmembrane domains, similar to other PMP3s. In cassava leaves, MePMP3-2 expression was up-regulated by salt and drought stresses. Heterologous constitutive expression of MePMP3-2 in rice did not alter plant growth and development but increased tolerance to salt and drought stresses. In addition, under stress conditions MePMP3-2 transgenic plants accumulated less malondialdehyde, had increased levels of proline, and exhibited greater up-regulation of the stress-related genes OsProT and OsP5CS, but led to only minor changes in OsDREB2A and OsLEA3 expression. These findings indicate that MePMP3-2 may play an important role in salt and drought stress tolerance in transgenic rice.

  2. Responses of antioxidant gene, protein and enzymes to salinity stress in two genotypes of perennial ryegrass (Lolium perenne) differing in salt tolerance.

    Science.gov (United States)

    Hu, Longxing; Li, Huiying; Pang, Huangcheng; Fu, Jinmin

    2012-01-15

    Salinity could damage cellular membranes through overproduction of reactive oxygen species (ROS), while antioxidant capacities play a vital role in protecting plants from salinity caused oxidative damages. The objective of this study was to investigate the toxic effect of salt on the antioxidant enzyme activities, isoforms and gene expressions in perennial ryegrass (Lolium perenne L.). Salt-tolerant 'Quickstart II' and salt-sensitive 'DP1' were subjected to 0 and 250 mM NaCl for 12 d. Salt stress increased the content of lipid peroxidation (MDA), electrolyte leakage (EL) and hydrogen peroxide (H₂O₂), to a greater extent in salt-sensitive genotype. Salt-stressed plant leaves exhibited a greater activity of superoxide dismutase (SOD, EC 1.15.1.1), peroxidase (POD, EC 1.11.1.7), ascorbate peroxidase (APX, EC 1.11.1.11) at 4d after treatment (DAT), but a lower level of enzyme activity at 8 and 12d, when compared to the control. Catalase (CAT, EC 1.11.1.6) activity was greater at 4 DAT and thereafter decreased in salt tolerant genotype relative to the control, whereas lower than the control during whole experiment period for salt-sensitive genotype. There were different patterns of five isoforms of SOD, POD and two isoforms of APX between two genotypes. Antioxidant gene expression was positively related to isoenzymatic and total enzymatic activities during 12-d salt-treated leaves of two genotypes, with a relatively higher level in salt-tolerant genotype. Thus, salt tolerance could be related to the constitutive/induced antioxidant gene, leading to more efficient enzyme stimulation and protection in perennial ryegrass.

  3. Tolerance to the antimicrobial peptide colistin in Pseudomonas aeruginosa biofilms is linked to metabolically active cells, and depends on the pmr and mexAB-oprM genes.

    Science.gov (United States)

    Pamp, Sünje Johanna; Gjermansen, Morten; Johansen, Helle Krogh; Tolker-Nielsen, Tim

    2008-04-01

    Bacteria living as biofilm are frequently reported to exhibit inherent tolerance to antimicrobial compounds, and might therefore contribute to the persistence of infections. Antimicrobial peptides are attracting increasing interest as new potential antimicrobial therapeutics; however, little is known about potential mechanisms, which might contribute to resistance or tolerance development towards these compounds in biofilms. Here we provide evidence that a spatially distinct subpopulation of metabolically active cells in Pseudomonas aeruginosa biofilms is able to develop tolerance to the antimicrobial peptide colistin. On the contrary, biofilm cells exhibiting low metabolic activity were killed by colistin. We demonstrate that the subpopulation of metabolically active cells is able to adapt to colistin by inducing a specific adaptation mechanism mediated by the pmr operon, as well as an unspecific adaptation mechanism mediated by the mexAB-oprM genes. Mutants defective in either pmr-mediated lipopolysaccharide modification or in mexAB-oprM-mediated antimicrobial efflux were not able to develop a tolerant subpopulation in biofilms. In contrast to the observed pattern of colistin-mediated killing in biofilms, conventional antimicrobial compounds such as ciprofloxacin and tetracycline were found to specifically kill the subpopulation of metabolically active biofilm cells, whereas the subpopulation exhibiting low metabolic activity survived the treatment. Consequently, targeting the two physiologically distinct subpopulations by combined antimicrobial treatment with either ciprofloxacin and colistin or tetracycline and colistin almost completely eradicated all biofilm cells.

  4. Effect of the C.-1 388 A>G polymorphism in chicken heat shock transcription factor 3 gene on heat tolerance

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-wu; KONG Li-na; ZHANG De-xiang; JI Cong-liang; ZHANG Xi-quan; LUO Qing-bin

    2015-01-01

    Heat stress is one of the main factors that inlfuence poultry production. Heat shock proteins (HSPs) are known to affect heat tolerance. The formation of HSPs is regulated by heat shock transcription factor 3 (HSF3) in chicken. A DNA pool was established for identifying single nucleotide polymorphisms (SNPs) of the chicken HSF3, and 13 SNPs were detected. The bioinformatic analysis showed that 8 SNPs had the capacity to alter the transcription activity of HSF3. The dual luciferase report gene assay showed that there was a signiifcant difference (PG (S1) and C.–1 388 A>G (S4) sites at the 5´-untranslated region (UTR) of chicken HSF3. The elec-trophoretic mobility shift assay showed that the S4 site was a transcription binding factor. The analysis of the association of the S1 and S4 sites with heat tolerance index revealed that the S4 site was signiifcantly correlated with the CD3+T cel , corticosterone, and T3 levels in Lingshan chickens and with the heterophil/lymphocyte value in White Recessive Rock. These results showed that the S4 site at the 5´ UTR of chicken HSF3 might have an impact on heat tolerance in summer and could be used as a potential marker for the selection of chicken with heat tolerance in the future.

  5. Functional screening of a cDNA library from the desiccation-tolerant plant Selaginella lepidophylla in yeast mutants identifies trehalose biosynthesis genes of plant and microbial origin.

    Science.gov (United States)

    Pampurova, Suzana; Verschooten, Katrien; Avonce, Nelson; Van Dijck, Patrick

    2014-11-01

    Trehalose is a non-reducing disaccharide that accumulates to large quantities in microbial cells, but in plants it is generally present in very low, barely-detectible levels. A notable exception is the desiccation-tolerant plant Selaginella lepidophylla, which accumulates very high levels of trehalose in both the hydrated and dehydrated state. As trehalose is known to protect membranes, proteins, and whole cells against dehydration stress, we have been interested in the characterization of the trehalose biosynthesis enzymes of S. lepidophylla; they could assist in engineering crop plants towards better stress tolerance. We previously isolated and characterized trehalose-6-phosphate synthases from Arabidopsis thaliana (desiccation sensitive) and S. lepidophylla (desiccation tolerant) and found that they had similar enzymatic characteristics. In this paper, we describe the isolation and characterization of trehalose-6-phosphate phosphatase from S. lepidophylla and show that its catalytic activities are also similar to those of its homolog in A. thaliana. Screening of an S. lepidophylla cDNA library using yeast trehalose biosynthesis mutants resulted in the isolation of a large number of trehalose biosynthesis genes that were of microbial rather than plant origin. Thus, we suggest that the high trehalose levels observed in S. lepidophylla are not the product of the plant but that of endophytes, which are known to be present in this plant. Additionally, the high trehalose levels in S. lepidophylla are unlikely to account for its desiccation tolerance, because its drought-stress-sensitive relative, S. moellendorffii, also accumulated high levels of trehalose.

  6. Enhancing the aluminium tolerance of barley by expressing the citrate transporter genes SbMATE and FRD3

    OpenAIRE

    Zhou, Gaofeng; Pereira, Jorge F.; Delhaize, Emmanuel; Zhou, Meixue; Magalhaes, Jurandir V.; Ryan, Peter R.

    2014-01-01

    Malate and citrate efflux from root apices is a mechanism of Al3+ tolerance in many plant species. Citrate efflux is facilitated by members of the MATE (multidrug and toxic compound exudation) family localized to the plasma membrane of root cells. Barley (Hordeum vulgare) is among the most Al3+-sensitive cereal species but the small genotypic variation in tolerance that is present is correlated with citrate efflux via a MATE transporter named HvAACT1. This study used a biotechnological approa...

  7. Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene

    Institute of Scientific and Technical Information of China (English)

    Qi-chao ZHAO; Ming-hong LIU; Xian-wen ZHANG; Chao-yang LIN; Qing ZHANG; Zhi-cheng SHEN‡

    2015-01-01

    题目:转Cry1Ac、Cry1Ig和EPSPS基因水稻及其抗虫、抗草甘膦活性鉴定  目的:获得具有高水平表达 Cry1Ac、Cry1Ig和 EPSPS基因并且具有抗虫、抗草甘膦活性的转基因水稻株。  创新点:Cry1Ig为新发现的苏云金杆菌(Bt)杀虫基因;Cry1Ig与 Cry1Ac共同使用有利于延缓害虫产生对Bt杀虫蛋白抗性。  方法:将Cry1Ac、Cry1Ig和EPSPS(G10)基因的表达框依次插入到同一转移 DNA(T-DNA)中,再将此 T-DNA 利用农杆菌介导法转化到水稻中。从转基因后代中,利用蛋白质印迹法(Western blot)、DNA印迹法(Southern blot)和热不对称交错聚合酶链式反应(TAIL-PCR)技术,筛选出能够高水平表达上述三个基因以及 T-DNA 单拷贝插入并且未发生明显插入突变的转化株。对于筛选到的转化株,利用 Western blot进一步分析 Cry1Ac、Cry1Ig和 G10基因的表达水平;使用酶联免疫吸附测定(ELISA)检测Cry1Ac的表达量;使用棉铃虫、二化螟和稻纵卷叶螟为对象,测定转基因水稻的抗虫活性;使用草甘膦喷施法,测定转基因水稻的抗草甘膦活性。最后,在大田试验中,考察转基因水稻与非转基因水稻的基本农艺性状,观察 T-DNA 的插入是否对转基因水稻的生长产生明显的影响。  结论:本实验最终获得具有高水平表达Cry1Ac、Cry1Ig和G10基因以及T-DNA单拷贝插入并且未引起明显变化的转化株 GAI-14。GAI-14对棉铃虫、二化螟、稻纵卷叶螟以及草甘膦均具有明显的抗性。田间试验表明 GAI-14在基本农艺性状上与非转基因水稻无明显差异。%Insect resistance and glyphosate tolerance have been two of the most important traits in the genetic improvement of various crops. In this study, two Bacil us thuringiensis (Bt) insecticidal genes, Cry1Ac and Cry1Ig, and a modified glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate

  8. PtrBAM1, a β-amylase-coding gene of Poncirus trifoliata, is a CBF regulon member with function in cold tolerance by modulating soluble sugar levels.

    Science.gov (United States)

    Peng, Ting; Zhu, Xiaofang; Duan, Nian; Liu, Ji-Hong

    2014-12-01

    β-Amylase (BAM) catalyses starch breakdown to generate maltose, which can be incorporated into sugar metabolism. However, the role of BAM genes in cold tolerance is less characterized. In this study, we report the isolation and functional characterization of a chloroplast-localizing BAM-encoding gene PtrBAM1 from Poncirus trifoliata. PtrBAM1 was induced by cold, dehydration and salt, but repressed by maltose. Overexpression of PtrBAM1 in tobacco (Nicotiana nudicaulis) increased BAM activity, promoted starch degradation and enhanced the contents of maltose and soluble sugars, whereas opposite changes were observed when PtrBAM1 homolog in lemon (Citrus lemon) was knocked down. The tobacco overexpressing lines exhibited enhanced tolerance to cold at chilling or freezing temperatures. Under cold stress, higher BAM activity and greater accumulation of maltose and soluble sugars were observed in the overexpressing lines when compared with the wild-type or empty vector transformants. Bioinformatics analysis demonstrated that PtrBAM1 promoter contained a CBF-recognizing element. Yeast one-hybrid assay demonstrated that PtrCBF could interact with the promoter fragment containing the element. Taken together, these results demonstrate that PtrBAM1 is a member of CBF regulon and plays an important role in cold tolerance by modulating the levels of soluble sugars acting as osmolytes or antioxidants.

  9. De Novo Transcriptome Assembly and Identification of Gene Candidates for Rapid Evolution of Soil Al Tolerance in Anthoxanthum odoratum at the Long-Term Park Grass Experiment.

    Directory of Open Access Journals (Sweden)

    Billie Gould

    Full Text Available Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE, cell wall modification (OsSTAR1, and internal Al detoxification (OsNRAT1 in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE.

  10. Influence of the interleukin-6 -174 G/C gene polymorphism on exercise training-induced changes in glucose tolerance indexes.

    Science.gov (United States)

    McKenzie, Jennifer A; Weiss, Edward P; Ghiu, Ioana A; Kulaputana, Onanong; Phares, Dana A; Ferrell, Robert E; Hagberg, James M

    2004-10-01

    A polymorphism in the IL-6 gene, a G-to-C substitution 176 bp upstream of the ATG translation initiation site, has been associated with diabetes prevalence and insulin resistance. Interventions including exercise training are frequently used to modify cardiovascular disease risk factors. Consequently, this project examined associations between the IL-6 -174 genotype and oral glucose tolerance test outcomes in 50- to 75-yr-old sedentary men and postmenopausal women before and after aerobic exercise training. Among the 87 individuals who started the study, 56 were retested after 6 mo of aerobic exercise training. Subject characteristics at baseline did not differ between the IL-6 genotype groups with the exception of fasting glucose, which was higher (P = 0.02, covariates age, gender, and ethnicity) in the CC genotype group. The training-induced change in glucose area under the curve during the oral glucose tolerance test varied between the IL-6 -174 genotype groups (P = 0.05, covariates age, gender, ethnicity, baseline glucose area under the curve, and percent body fat change) with a significant decrease occurring only in the GG genotype group. Insulin outcomes did not differ among the groups at baseline or after training. Training-induced changes in weight, percent body fat, maximal oxygen consumption, fasting glucose, and an insulin sensitivity index also changed similarly among the genotype groups. In conclusion, fasting glucose and the extent to which glucose tolerance changes with exercise training may be influenced by the IL-6 -174 gene polymorphism.

  11. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.

    Directory of Open Access Journals (Sweden)

    Zongliang Xia

    Full Text Available Sulfite oxidase (SO plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO was cloned, and its response to SO(2/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2O(2 accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized.

  12. Identification of Differentially Expressed Genes Related to Dehydration Resistance in a Highly Drought-Tolerant Pear, Pyrus betulaefolia, as through RNA-Seq.

    Science.gov (United States)

    Li, Kong-Qing; Xu, Xiao-Yong; Huang, Xiao-San

    2016-01-01

    Drought is a major abiotic stress that affects plant growth, development and productivity. Pear is one of the most important deciduous fruit trees in the world, but the mechanisms of drought tolerance in this plant are still unclear. To better understand the molecular basis regarding drought stress response, RNA-seq was performed on samples collected before and after dehydration in Pyrus betulaefolia. In total, 19,532 differentially expressed genes (DEGs) were identified. These genes were annotated into 144 Gene Ontology (GO) terms and 18 clusters of orthologous groups (COG) involved in 129 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. These DEGs comprised 49 (26 up-regulated, 23 down-regulated), 248 (166 up-regulated, 82 down-regulated), 3483 (1295 up-regulated, 2188 down-regulated), 1455 (1065 up-regulated, 390 down-regulated) genes from the 1 h, 3 h and 6 h dehydration-treated samples and a 24 h recovery samples, respectively. RNA-seq was validated by analyzing the expresson patterns of randomly selected 16 DEGs by quantitative real-time PCR. Photosynthesis, signal transduction, innate immune response, protein phosphorylation, response to water, response to biotic stimulus, and plant hormone signal transduction were the most significantly enriched GO categories amongst the DEGs. A total of 637 transcription factors were shown to be dehydration responsive. In addition, a number of genes involved in the metabolism and signaling of hormones were significantly affected by the dehydration stress. This dataset provides valuable information regarding the Pyrus betulaefolia transcriptome changes in response to dehydration and may promote identification and functional analysis of potential genes that could be used for improving drought tolerance via genetic engineering of non-model, but economically-important, perennial species.

  13. Identification of Differentially Expressed Genes Related to Dehydration Resistance in a Highly Drought-Tolerant Pear, Pyrus betulaefolia, as through RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Kong-Qing Li

    Full Text Available Drought is a major abiotic stress that affects plant growth, development and productivity. Pear is one of the most important deciduous fruit trees in the world, but the mechanisms of drought tolerance in this plant are still unclear. To better understand the molecular basis regarding drought stress response, RNA-seq was performed on samples collected before and after dehydration in Pyrus betulaefolia. In total, 19,532 differentially expressed genes (DEGs were identified. These genes were annotated into 144 Gene Ontology (GO terms and 18 clusters of orthologous groups (COG involved in 129 Kyoto Encyclopedia of Genes and Genomes (KEGG defined pathways. These DEGs comprised 49 (26 up-regulated, 23 down-regulated, 248 (166 up-regulated, 82 down-regulated, 3483 (1295 up-regulated, 2188 down-regulated, 1455 (1065 up-regulated, 390 down-regulated genes from the 1 h, 3 h and 6 h dehydration-treated samples and a 24 h recovery samples, respectively. RNA-seq was validated by analyzing the expresson patterns of randomly selected 16 DEGs by quantitative real-time PCR. Photosynthesis, signal transduction, innate immune response, protein phosphorylation, response to water, response to biotic stimulus, and plant hormone signal transduction were the most significantly enriched GO categories amongst the DEGs. A total of 637 transcription factors were shown to be dehydration responsive. In addition, a number of genes involved in the metabolism and signaling of hormones were significantly affected by the dehydration stress. This dataset provides valuable information regarding the Pyrus betulaefolia transcriptome changes in response to dehydration and may promote identification and functional analysis of potential genes that could be used for improving drought tolerance via genetic engineering of non-model, but economically-important, perennial species.

  14. Polyamine regulates tolerance to water stress in leaves of white clover associated with antioxidant defense and dehydrin genes via involvement in calcium messenger system and hydrogen peroxide signaling

    Directory of Open Access Journals (Sweden)

    Zhou eLi

    2015-10-01

    Full Text Available Endogenous polyamine (PA may play a critical role in tolerance to water stress in plants acting as a signaling molecule activator. Water stress caused increases in endogenous PA content in leaves, including putrescine (Put, spermidine (Spd, and spermine (Spm. Exogenous application of Spd could induce the instantaneous H2O2 burst and accumulation of cytosolic free Ca2+, and activate NADPH oxidase and CDPK gene expression in cells. To a great extent, PA biosynthetic inhibitor reduced the water stress-induced H2O2 accumulation, free cytosolic Ca2+ release, antioxidant enzyme activities and genes expression leading to aggravate water stress-induced oxidative damage, while these suppressing effects were alleviated by the addition of exogenous Spd, indicating PA was involved in water stress-induced H2O2 and cytosolic free Ca2+ production as well as stress tolerance. Dehydrin genes (Y2SK, Y2K, and SK2 were showed to be highly responsive to exogenous Spd. PA-induced antioxidant defense and dehydrin genes expression could be blocked by the scavenger of H2O2 and the inhibitors of H2O2 generation or Ca2+ channels blockers, a calmodulin antagonist, as well as the inhibitor of CDPK. These findings suggested that PA regulated tolerance to water stress in white clover associated with antioxidant defenses and dehydrins via involvement in the calcium messenger system and H2O2 signaling pathways. PA-induced H2O2 production required Ca2+ release, while PA-induced Ca2+ release was also essential for H2O2 production, suggesting an interaction between PA-induced H2O2 and Ca2+ signaling.

  15. Drought tolerance established by enhanced expression of the CC-NBS-LRR gene, ADR1, requires salicylic acid, EDS1 and ABI1.

    Science.gov (United States)

    Chini, Andrea; Grant, John J; Seki, Motoaki; Shinozaki, Kazuo; Loake, Gary J

    2004-06-01

    An activation-tagged allele of activated disease resistance 1 (ADR1) has previously been shown to convey broad spectrum disease resistance. ADR1 was found to encode a coiled-coil (CC)-nucleotide-binding site (NBS)-leucine-rich repeat (LRR) protein, which possessed domains of homology with serine/threonine protein kinases. Here, we show that either constitutive or conditional enhanced expression of ADR1 conferred significant drought tolerance. This was not a general feature of defence-related mutants because cir (constitutive induced resistance)1, cir2 and cpr (constitutive expressor of PR genes)1, which constitutively express systemic acquired resistance (SAR), failed to exhibit this phenotype. Cross-tolerance was not a characteristic of adr1 plants, rather they showed increased sensitivity to thermal and salinity stress. Hence, adr1-activated signalling may antagonise some stress responses. Northern analysis of abiotic marker genes revealed that dehydration-responsive element (DRE)B2A but not DREB1A, RD (response to dehydration)29A or RD22 was expressed in adr1 plant lines. Furthermore, DREB2A expression was salicylic acid (SA) dependent but NPR (non-expressor of PR genes)1 independent. In adr1/ADR1 nahG (naphthalene hydroxylase G), adr1/ADR1 eds (enhanced disease susceptibility)1 and adr1/ADR1 abi1 double mutants, drought tolerance was significantly reduced. Microarray analyses of plants containing a conditional adr1 allele demonstrated that a significant number of the upregulated genes had been previously implicated in responses to dehydration. Therefore, biotic and abiotic signalling pathways may share multiple nodes and their outputs may have significant functional overlap.

  16. ALUMINUM BOX BUNDLING PRESS

    Directory of Open Access Journals (Sweden)

    Iosif DUMITRESCU

    2015-05-01

    Full Text Available In municipal solid waste, aluminum is the main nonferrous metal, approximately 80- 85% of the total nonferrous metals. The income per ton gained from aluminum recuperation is 20 times higher than from glass, steel boxes or paper recuperation. The object of this paper is the design of a 300 kN press for aluminum box bundling.

  17. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions.

  18. Identification of candidate genes for drought stress tolerance in rice by the integration of a genetic (QTL) map with the rice genome physical map

    Institute of Scientific and Technical Information of China (English)

    WANG Xu-sheng; ZHU Jun; MANSUETO Locedie; BRUSKIEWICH Richard

    2005-01-01

    Genetic improvement for drought stress tolerance in rice involves the quantitative nature of the trait, which reflects the additive effects of several genetic loci throughout the genome. Yield components and related traits under stressed and well-water conditions were assayed in mapping populations derived from crosses of Azucena×IR64 and Azucena×Bala. To find the candidate rice genes underlying Quantitative Trait Loci (QTL) in these populations, we conducted in silico analysis of a candidate region flanked by the genetic markers RM212 and RM319on chromosome 1, proximal to the semi-dwarf (sd1) locus. A total of 175annotated genes were identified from this region. These included 48 genes annotated by functional homology to known genes, 23pseudogenes, 24 ab initio predicted genes supported by an alignment match to an EST (Expressed sequence tag) of unknown function, and 80 hypothetical genes predicted solely by ab initio means. Among these, 16 candidate genes could potentially be involved in drought stress response.

  19. Brassinosteroids-Induced Systemic Stress Tolerance was Associated with Increased Transcripts of Several Defence-Related Genes in the Phloem in Cucumis sativus.

    Directory of Open Access Journals (Sweden)

    Pingfang Li

    Full Text Available Brassinosteroids (BRs, a group of naturally occurring plant steroidal compounds, are essential for plant growth, development and stress tolerance. Recent studies showed that BRs could induce systemic tolerance to biotic and abiotic stresses; however, the molecular mechanisms by which BRs signals lead to responses in the whole plant are largely unknown. In this study, 24-epibrassinosteroid (EBR-induced systemic tolerance in Cucumis sativus L. cv. Jinyan No. 4 was analyzed through the assessment of symptoms of photooxidative stress by chlorophyll fluorescence imaging pulse amplitude modulation. Expression of defense/stress related genes were induced in both treated local leaves and untreated systemic leaves by local EBR application. With the suppressive subtractive hybridization (SSH library using cDNA from the phloem sap of EBR-treated plants as the tester and distilled water (DW-treated plants as the driver, 14 transcripts out of 260 clones were identified. Quantitative Real Time-Polymerase Chain Reaction (RT-qPCR validated the specific up-regulation of these transcripts. Of the differentially expressed transcripts with known functions, transcripts for the selected four cDNAs, which encode an auxin-responsive protein (IAA14, a putative ankyrin-repeat protein, an F-box protein (PP2, and a major latex, pathogenesis-related (MLP-like protein, were induced in local leaves, systemic leaves and roots after foliar application of EBR onto mature leaves. Our results demonstrated that EBR-induced systemic tolerance is accompanied with increased transcript of genes in the defense response in other organs. The potential role of phloem mRNAs as signaling components in mediating BR-regulated systemic resistance is discussed.

  20. The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco

    Directory of Open Access Journals (Sweden)

    Yadav Narendra

    2012-10-01

    Full Text Available Abstract Background Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1 gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. Results The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC, chlorophyll, K+/Na+ ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na+ content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na+ content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na+ loading to xylem from root and leaf tissues. Transgenic lines also showed increased K+ and Ca2+ content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Conclusions Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na+ efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na+ content in different organs and also affect the other

  1. [Process and mechanism of plants in overcoming acid soil aluminum stress].

    Science.gov (United States)

    Zhao, Tian-Long; Xie, Guang-Ning; Zhang, Xiao-Xia; Qiu, Lin-Quan; Wang, Na; Zhang, Su-Zhi

    2013-10-01

    Aluminum (Al) stress is one of the most important factors affecting the plant growth on acid soil. Currently, global soil acidification further intensifies the Al stress. Plants can detoxify Al via the chelation of ionic Al and organic acids to store the ionic Al in vacuoles and extrude it from roots. The Al extrusion is mainly performed by the membrane-localized anion channel proteins Al(3+)-activated malate transporter (ALMT) and multi-drug and toxin extrusion (MATE). The genes encoding ABC transporter and zinc-finger protein conferred plant Al tolerance have also been found. The identification of these Al-resistant genes makes it possible to increase the Al resistance of crop plants and enhance their production by the biological methods such as gene transformation and mark-associated breeding. The key problems needed to be solved and the possible directions in the researches of plant Al stress resistance were proposed.

  2. Correlation between differential drought tolerability of two contrasting drought-responsive chickpea cultivars and differential expression of a subset of CaNAC genes under normal and dehydration conditions.

    Science.gov (United States)

    Nguyen, Kien Huu; Ha, Chien Van; Watanabe, Yasuko; Tran, Uyen Thi; Nasr Esfahani, Maryam; Nguyen, Dong Van; Tran, Lam-Son Phan

    2015-01-01

    Drought causes detrimental effect to growth and productivity of many plants, including crops. NAC transcription factors have been reported to play important role in drought tolerance. In this study, we assessed the expression profiles of 19 dehydration-responsive CaNAC genes in roots and leaves of two contrasting drought-responsive chickpea varieties treated with water (control) and dehydration to examine the correlation between the differential expression levels of the CaNAC genes and the differential drought tolerability of these two cultivars. Results of real-time quantitative PCR indicated a positive relationship between the number of dehydration-inducible and -repressible CaNAC genes and drought tolerability. The higher drought-tolerant capacity of ILC482 cultivar vs. Hashem cultivar might be, at least partly, attributed to the higher number of dehydration-inducible and lower number of dehydration-repressible CaNAC genes identified in both root and leaf tissues of ILC482 than in those of Hashem. In addition, our comparative expression analysis of the selected CaNAC genes in roots and leaves of ILC482 and Hashem cultivars revealed different dehydration-responsive expression patterns, indicating that CaNAC gene expression is tissue- and genotype-specific. Furthermore, the analysis suggested that the enhanced drought tolerance of ILC482 vs. Hashem might be associated with five genes, namely CaNAC02, 04, 05, 16, and 24. CaNAC16 could be a potential candidate gene, contributing to the better drought tolerance of ILC482 vs. Hashem as a positive regulator. Conversely, CaNAC02 could be a potential negative regulator, contributing to the differential drought tolerability of these two cultivars. Thus, our results have also provided a solid foundation for selection of promising tissue-specific and/or dehydration-responsive CaNAC candidates for detailed in planta functional analyses, leading to development of transgenic chickpea varieties with improved productivity under

  3. 鸡源大肠杆菌四环素耐药基因检测%Detection of Tetracycline-tolerant Genes in Escherichia coli Isolated from Chickens

    Institute of Scientific and Technical Information of China (English)

    张扬; 陈丽鹏; 吴华; 赵金凤; 许瑞; 贺志沛; 胡功政

    2014-01-01

    The susceptibilities of 32 strains of Escherichia coli isolated from chickens to 8 antibacterial agents were determined with broth microdilution method, the presence of 5 tetracycline-tolerant genes (tet genes) was investigated by using PCR method, and the clonal relationship among the tested isolates was assessed by using ERIC -PCR method .The results revealed that the toler-ant rates of 32 isolates to tetracycline and doxycycline were 84%and 75%respectively, and the positive rates of genes tetA and tetB in these strains were 78%and 25%respectively.Total positive rate of gene tet in 32 strains was 90.6%, which was basically con-sistent with the above drug -tolerant rates .The isolates carrying one or two tet genes were tolerant not only to tetracycline , but also to cefotaxime, ciprofloxacin, florfenicol and neomycin, showing multidrug tolerance.A total of 15 ERIC patterns (A~O) were ob-served among the 32 strains of E.coli.The genes tetA and tetB were found to almost equally distribute on various ERIC -pattern i-solates, indicating their horizontal spread in E.coli isolates.%用肉汤稀释法测定32株鸡源大肠杆菌对四环素等8种抗菌药物的敏感性,用PCR方法检测5种四环素耐药基因( tet基因),并用ERIC-PCR方法分析试验菌株间的克隆关系。结果显示:32株大肠杆菌对四环素、多西环素的耐药率分别为84%、75%,tetA和tetB阳性率分别为78%和25%。总tet基因阳性率为90.6%,与对四环素、多西环素的耐药率基本一致。携带1种或2种tet基因的临床分离菌,不仅对四环素类药物耐药,还对头孢噻肟、环丙沙星、新霉素和氟苯尼考耐药,呈现多重耐药的特点。试验菌共分为A~O 15个ERIC型,tetA和tetB几乎均匀分布于不同ERIC型菌株中,表明其在试验菌株间水平扩散。

  4. Simultaneous Overexpression of the HhERF2 and PeDREB2a Genes Enhanced Tolerances to Salt and Drought in Transgenic Cotton.

    Science.gov (United States)

    Li, Jin Bo; Ni Dong, Xue; Lei, Zhi; Liang Li, Yong; Yang Yang, Pei; Tao, Fei; Zhao, Liang; Li, Shi-Gang; Du, Lin Feng; Shao, Ji Rong; Wu, Yan Min

    2016-01-01

    A desert-grown Halimodendron halodendron ethylene-responsive element binding factor gene (HhERF2), which encodes a 245 amino acids protein containing a conserved AP2/EREBP domain, was isolated through the rapid amplification cDNA end (RACE) method. Sequence and phylogenetic analysis indicated that HhERF2 was classified into the B-2 group of ERF subfamily. Semiquantitative RT-PCR showed that HhERF2 was greatly induced by treatments with high-salt, drought and low temperature in H. halodendron seedlings. The expression vector containing HhERF2 and Populus euphratica dehydration- responsive element binding protein (PeDREB2a) genes driven by rd29A promoter was constructed and transferred into cotton (Gossypium hirsutum L.) by non-tissue culture Agrobacterium-mediated genetic transformation system. The transformation and expression of HhERF2 and PeDREB2a were identified by PCR and RT-PCR. Analyses of physiological function indicated that transgenic cottons had improved seeds germination, tolerance to drought and highsalt stresses. Agronomic evaluation in the field exhibited that transgenic lines presented a dwarf phenotype and improved further in the yield and characters. These results demonstrated that overexpressed both HhERF2 and PeDREB2a transcription factor genes in cotton induced elevated tolerance to drought and high-salt stresses.

  5. Engineering drought tolerant tomato plants over-expressing BcZAT12 gene encoding a C₂H₂ zinc finger transcription factor.

    Science.gov (United States)

    Rai, Avinash Chandra; Singh, Major; Shah, Kavita

    2013-01-01

    Efficient genetic transformation of cotyledonary explants of tomato (Solanum lycopersicum, cv. H-86, Kashi vishesh) was obtained. Disarmed Agrobacterium tumifaciens strain GV 3101 was used in conjugation with binary vector pBinAR containing a construct consisting of the coding sequence of the BcZAT12 gene under the regulatory control of the stress inducible Bclea1a promoter. ZAT12 encodes a C₂H₂ zinc finger protein which confers multiple abiotic stress tolerance to plants. Integration of ZAT12 gene into nuclear genome of individual kanamycin resistant transformed T₀ tomato lines was confirmed by Southern blot hybridization with segregation analysis of T(1) plants showing Mendelian inheritance of the transgene. Expression of ZAT12 in drought-stressed transformed tomato lines was verified in T₂ generation plants using RT-PCR. Of the six transformed tomato lines (ZT1-ZT6) the transformants ZT1 and ZT5 showed maximum expression of BcZAT12 gene transcripts when exposed to 7 days drought stress. Analysis of relative water content (RWC), electrolyte leakage (EL), chlorophyll colour index (CCI), H₂O₂ level and catalase activity suggested that tomato BcZAT12 transformants ZT1 and ZT5 have significantly increased levels of drought tolerance. These results suggest that BcZAT12 transformed tomato cv. H-86 has real potential for molecular breeding programs aimed at augmenting yield of tomato in regions affected with drought stress.

  6. Overexpression of Rice Sphingosine-1-Phoshpate Lyase Gene OsSPL1 in Transgenic Tobacco Reduces Salt and Oxidative Stress Tolerance

    Institute of Scientific and Technical Information of China (English)

    Huijuan Zhang; Jing Zhai; Jibo Mo; Dayong Li; Fengming Song

    2012-01-01

    Sphingolipids,including sphingosine-1-phosphate (S1P),have been shown to function as signaling mediators to regulate diverse aspects of plant growth,development,and stress response.In this study,we performed functional analysis of a rice (Oryza sativa) S1P lyase gene OsSPL1 in transgenic tobacco plants and explored its possible involvement in abiotic stress response.Overexpression of OsSPL1 in transgenic tobacco resulted in enhanced sensitivity to exogenous abscisic acid (ABA),and decreased tolerance to salt and oxidative stress,when compared with the wild type.Furthermore,the expression levels of some selected stress-related genes in OsSPL1-overexpressing plants were reduced after application of salt or oxidative stress,indicating that the altered responsiveness of stress-related genes may be responsible for the reduced tolerance in OsSPL1-overexpressing tobacco plants under salt and oxidative stress.Our results suggest that rice OsSPL1 plays an important role in abiotic stress responses.

  7. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang

    2013-11-01

    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  8. Tolerance to the antimicrobial peptide colistin in Pseudomonas aeruginosa biofilms is linked to metabolically active cells, and depends on the pmr and mexAB-oprM genes

    DEFF Research Database (Denmark)

    Pamp, Sünje Johanna; Gjermansen, Morten; Johansen, Helle Krogh

    2008-01-01

    to the antimicrobial peptide colistin. On the contrary, biofilm cells exhibiting low metabolic activity were killed by colistin. We demonstrate that the subpopulation of metabolically active cells is able to adapt to colistin by inducing a specific adaptation mechanism mediated by the pmr operon, as well...... as an unspecific adaptation mechanism mediated by the mexAB-oprM genes. Mutants defective in either pmr-mediated lipopolysaccharide modification or in mexAB-oprM-mediated antimicrobial efflux were not able to develop a tolerant subpopulation in biofilms. In contrast to the observed pattern of colistin...

  9. Overexpression of a Chloroplast-located Peroxiredoxin Q Gene, SsPrxQ, Increases the Salt and Low-temperature Tolerance of Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Li-Wen Jing; Shi-Hua Chen; Xiao-Li Guo; Hui Zhang; Yan-Xiu Zhao

    2006-01-01

    Abiotic stress, such as salt, drought and extreme temperature,can result in enhanced production of reactive oxygen species (ROS). Plants have developed both enzymatic ROS-scavenging and non-enzymatic ROS-scavenging systems. The major ROS-scavenging enzymes of plants include superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), glutathione peroxidase (GPX) and peroxiredoxins (Prxs). In the present work, we identified a gene encoding chloroplast-located peroxiredoxin Q, SsPrxQ, from Suaeda salsa L. Located at chloroplast. Overexpression of SsPrxQ in Arabidopsis leads to an increase in salt and low-temperature tolerance.

  10. Association analysis of frost tolerance in rye using candidate genes and phenotypic data from controlled, semi-controlled, and field phenotyping platforms

    Directory of Open Access Journals (Sweden)

    Li Yongle

    2011-10-01

    Full Text Available Abstract Background Frost is an important abiotic stress that limits cereal production in the temperate zone. As the most frost tolerant small grain cereal, rye (Secale cereale L. is an ideal cereal model for investigating the genetic basis of frost tolerance (FT, a complex trait with polygenic inheritance. Using 201 genotypes from five Eastern and Middle European winter rye populations, this study reports a multi-platform candidate gene-based association analysis in rye using 161 single nucleotide polymorphisms (SNPs and nine insertion-deletion (Indel polymorphisms previously identified from twelve candidate genes with a putative role in the frost responsive network. Results Phenotypic data analyses of FT in three different phenotyping platforms, controlled, semi-controlled and field, revealed significant genetic variations in the plant material under study. Statistically significant (P ScCbf15 and one in ScCbf12, all leading to amino acid exchanges, were significantly associated with FT over all three phenotyping platforms. Distribution of SNP effect sizes expressed as percentage of the genetic variance explained by individual SNPs was highly skewed towards zero with a few SNPs obtaining large effects. Two-way epistasis was found between 14 pairs of candidate genes. Relatively low to medium empirical correlations of SNP-FT associations were observed across the three platforms underlining the need for multi-level experimentation for dissecting complex associations between genotypes and FT in rye. Conclusions Candidate gene based-association studies are a powerful tool for investigating the genetic basis of FT in rye. Results of this study support the findings of bi-parental linkage mapping and expression studies that the Cbf gene family plays an essential role in FT.

  11. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata”) and Their Interspecific Inbred Line “Maxchata”

    Science.gov (United States)

    Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2013-01-01

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2−) and malondialdehyde (MDA) contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration. PMID:24336062

  12. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata” and Their Interspecific Inbred Line “Maxchata”

    Directory of Open Access Journals (Sweden)

    Neelam Ara

    2013-12-01

    Full Text Available The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C and severe (42 °C heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2, superoxide (O2− and malondialdehyde (MDA contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD, ascorbate peroxidase (APX, catalase (CAT and peroxidase (POD were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  13. Antioxidant enzymatic activities and gene expression associated with heat tolerance in the stems and roots of two cucurbit species ("Cucurbita maxima" and "Cucurbita moschata") and their interspecific inbred line "Maxchata".

    Science.gov (United States)

    Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2013-12-10

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant "C. moschata", thermolabile "C. maxima" and moderately heat-tolerant interspecific inbred line "Maxchata" genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. "C. moschata" exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2(-)) and malondialdehyde (MDA) contents in the roots compared to stems, followed by "Maxchata". The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among "C. maxima" and "Maxchata", most of these genes were highly induced under heat stress in "Maxchata", which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  14. Regulated Expression of an Isopentenyltransferase Gene (IPT) in Peanut Significantly Improves Drought Tolerance and Increases Yield Under Field Conditions.

    Science.gov (United States)

    Isopentenyltransferase (IPT) is a critical enzyme in the cytokinin biosynthetic pathway. The expression of IPT under the control of a maturation- and stress-induced promoter was shown to delay stress-induced plant senescence that resulted in an enhanced drought tolerance in both monocot and dicot p...

  15. Overexpression of Arabidopsis and rice stress genes' inducible transcription factor confers drought and salinity tolerance to rice.

    Science.gov (United States)

    Datta, Karabi; Baisakh, Niranjan; Ganguly, Moumita; Krishnan, Sellapan; Yamaguchi Shinozaki, Kazuko; Datta, Swapan K

    2012-06-01

    Rice yield is greatly affected by environmental stresses such as drought and salinity. In response to the challenge of producing rice plants tolerant to these stresses, we introduced cDNA encoding the transcription factors DREB1A and DREB1B under the control of the stress inducible rd29 promoter. Two different indica rice cultivars were used, BR29, an improved commercially cultivated variety from Bangladesh and IR68899B, an IRRI bred maintainer line for hybrid rice. Agrobacterium mediated transformation of BR29 was done independently with DREB1A isolated from rice and Arabidopsis and DREB1B isolated from rice, whereas biolistic transformation was done with rice- DREB1B in the case of IR68899B. Initial genetic integration was confirmed by PCR and Southern blot analysis. Salinity tolerance was assayed in very young seedlings. Drought stress tests were found to be more reliable when they were carried out at the pre-flowering booting stage. RNA gel blot analysis as well as quantitative PCR analysis was performed to estimate the transcription level under stressed and unstressed conditions. Agronomic performance studies were done with stressed and unstressed plants to compare the yield losses due to dehydration and salt loading stresses. Noticeably enhanced tolerance to dehydration was observed in the plants transformed with DREB1A isolated from Arabidopsis while DREB1B was found to be more effective for salt tolerance.

  16. FcWRKY70, a WRKY protein of Fortunella crassifolia, functions in drought tolerance and modulates putrescine synthesis by regulating arginine decarboxylase gene.

    Science.gov (United States)

    Gong, Xiaoqing; Zhang, Jingyan; Hu, Jianbing; Wang, Wei; Wu, Hao; Zhang, Qinghua; Liu, Ji-Hong

    2015-11-01

    WRKY comprises a large family of transcription factors in plants, but most WRKY members are still poorly understood. In this study, we report functional characterization of a Group III WRKY gene (FcWRKY70) from Fortunella crassifolia. FcWRKY70 was greatly induced by drought and abscisic acid, but slightly or negligibly by salt and cold. Overexpression of FcWRKY70 in tobacco (Nicotiana nudicaulis) and lemon (Citrus lemon) conferred enhanced tolerance to dehydration and drought stresses. Transgenic tobacco and lemon exhibited higher expression levels of ADC (arginine decarboxylase), and accumulated larger amount of putrescine in comparison with wild type (WT). Treatment with D-arginine, an inhibitor of ADC, caused transgenic tobacco plants more sensitive to dehydration. Knock-down of FcWRKY70 in kumquat down-regulated ADC abundance and decreased putrescine level, accompanied by compromised dehydration tolerance. The promoter region of FcADC contained two W-box elements, which were shown to be interacted with FcWRKY70. Taken together, our data demonstrated that FcWRKY70 functions in drought tolerance by, at least partly, promoting production of putrescine via regulating ADC expression.

  17. Molecular and physiological strategies to increase aluminum resistance in plants.

    Science.gov (United States)

    Inostroza-Blancheteau, Claudio; Rengel, Zed; Alberdi, Miren; de la Luz Mora, María; Aquea, Felipe; Arce-Johnson, Patricio; Reyes-Díaz, Marjorie

    2012-03-01

    Aluminum (Al) toxicity is a primary limitation to plant growth on acid soils. Root meristems are the first site for toxic Al accumulation, and therefore inhibition of root elongation is the most evident physiological manifestation of Al toxicity. Plants may resist Al toxicity by avoidance (Al exclusion) and/or tolerance mechanisms (detoxification of Al inside the cells). The Al exclusion involves the exudation of organic acid anions from the root apices, whereas tolerance mechanisms comprise internal Al detoxification by organic acid anions and enhanced scavenging of free oxygen radicals. One of the most important advances in understanding the molecular events associated with the Al exclusion mechanism was the identification of the ALMT1 gene (Al-activated malate transporter) in Triticum aestivum root cells, which codes for a plasma membrane anion channel that allows efflux of organic acid anions, such as malate, citrate or oxalate. On the other hand, the scavenging of free radicals is dependent on the expression of genes involved in antioxidant defenses, such as peroxidases (e.g. in Arabidopsis thaliana and Nicotiana tabacum), catalases (e.g. in Capsicum annuum), and the gene WMnSOD1 from T. aestivum. However, other recent findings show that reactive oxygen species (ROS) induced stress may be due to acidic (low pH) conditions rather than to Al stress. In this review, we summarize recent findings regarding molecular and physiological mechanisms of Al toxicity and resistance in higher plants. Advances have been made in understanding some of the underlying strategies that plants use to cope with Al toxicity. Furthermore, we discuss the physiological and molecular responses to Al toxicity, including genes involved in Al resistance that have been identified and characterized in several plant species. The better understanding of these strategies and mechanisms is essential for improving plant performance in acidic, Al-toxic soils.

  18. Variation in salinity tolerance of four lowland genotypes of quinoa (Chenopodium quinoa Willd.) as assessed by growth, physiological traits, and sodium transporter gene expression.

    Science.gov (United States)

    Ruiz-Carrasco, Karina; Antognoni, Fabiana; Coulibaly, Amadou Konotie; Lizardi, Susana; Covarrubias, Adriana; Martínez, Enrique A; Molina-Montenegro, Marco A; Biondi, Stefania; Zurita-Silva, Andrés

    2011-11-01

    Chenopodium quinoa (Willd.) is an Andean plant showing a remarkable tolerance to abiotic stresses. In Chile, quinoa populations display a high degree of genetic distancing, and variable tolerance to salinity. To investigate which tolerance mechanisms might account for these differences, four genotypes from coastal central and southern regions were compared for their growth, physiological, and molecular responses to NaCl at seedling stage. Seeds were sown on agar plates supplemented with 0, 150 or 300mM NaCl. Germination was significantly reduced by NaCl only in accession BO78. Shoot length was reduced by 150mM NaCl in three out of four genotypes, and by over 60% at 300mM (except BO78 which remained more similar to controls). Root length was hardly affected or even enhanced at 150mM in all four genotypes, but inhibited, especially in BO78, by 300mM NaCl. Thus, the root/shoot ratio was differentially affected by salt, with the highest values in PRJ, and the lowest in BO78. Biomass was also less affected in PRJ than in the other accessions, the genotype with the highest increment in proline concentration upon salt treatment. Free putrescine declined dramatically in all genotypes under 300mM NaCl; however (spermidine+spermine)/putrescine ratios were higher in PRJ than BO78. Quantitative RT-PCR analyses of two sodium transporter genes, CqSOS1 and CqNHX, revealed that their expression was differentially induced at the shoot and root level, and between genotypes, by 300mM NaCl. Expression data are discussed in relation to the degree of salt tolerance in the different accessions.

  19. Effect of the C.-1 388 A〉G polymorphism in chicken heat shock transcription factor 3 gene on heat tolerance

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-wu[1,2,3; KONG Li-na[1,2,3; ZHANG De-xian[1,4; JI Cong-liang[4; ZHANG Xi-quan[1,2; LUO Qing-bin[1,2,3

    2015-01-01

    Heat stress is one of the main factors that influence poultry production. Heat shock proteins (HSPs) are known to affect heat tolerance. The formation of HSPs is regulated by heat shock transcription factor 3 (HSF3) in chicken. A DNA pool was established for identifying single nucleotide polymorphisms (SNPs) of the chicken HSF3, and 13 SNPs were detected. The bioinformatic analysis showed that 8 SNPs had the capacity to alter the transcdption activity of HSF3. The dual luciferase report gene assay showed that there was a significant difference (P〈0.01) in the Firefly luciferase/Renilla luciferase ratio (F/R) of C.-1 703 A〉G ($1) and C.-1 388 A〉G (S4) sites at the 5"-untranslated region (UTR) of chicken HSF3. The elec- trophoretic mobility shift assay showed that the S4 site was a transcription binding factor. The analysis of the association of the S1 and S4 sites with heat tolerance index revealed that the $4 site was significantly correlated with the CD3+ T cell, corticosterone, and T3 levels in Lingshan chickens and with the heterophil/lymphocyte value in White Recessive Rock. These results showed that the S4 site at the 5 UTR of chicken HSF3 might have an impact on heat tolerance in summer and could be used as a potential marker for the selection of chicken with heat tolerance in the future.

  20. LcMKK, a MAPK kinase from Lycium chinense, confers cadmium tolerance in transgenic tobacco by transcriptional upregulation of ethylene responsive transcription factor gene

    Indian Academy of Sciences (India)

    CHUNFENG GUAN; JING JI; XIAOZHOU LI; CHAO JIN; GANG WANG

    2016-12-01

    Cadmium (Cd) is a highly toxic element to plants. Ethylene is an important phytohormone in the regulation of plant growth, development and stress response. Mitogen-activated protein kinase (MAPK) activation has been observed in plants exposed to Cd stress and was suggested to be involved in ethylene biosynthesis. We hypothesized that there may be a link between MAPK cascades and ethylene signalling in Cd-stressed plants. To test this hypothesis, the expression of LcMKK, LchERF and LcGSH1 genes, endogenous ethylene accumulation, GSH content and Cd concentration in Lycium chinense with or without Cd stress treatment were studied. Our results showed that LcMKK gene expression can be induced by the treatment of Cd in L. chinense. The transgenic tobacco expressing 35S::LcMKK showed greater tolerance to Cd stress and enhanced expression of NtERF and NtGSH1 genes, indicating that LcMKK is associated with the enhanced expression level of ERF and GSH synthesis-related genes in tobacco. We also found that endogenous ethylene and GSH content can be induced by Cd stress inL. chinense, and inhibited by cotreatment with PD98059, an inhibitor of MAPK kinase. Evidences presented here suggest that under Cd stress, GSH accumulation occurred at least partially by enhanced LcMKK gene expression and the ethylene signal transduction pathways might be involved in this accumulation.

  1. Over-expression of VvWRKY1 in grapevines induces expression of jasmonic acid pathway-related genes and confers higher tolerance to the downy mildew.

    Directory of Open Access Journals (Sweden)

    Chloé Marchive

    Full Text Available Most WRKY transcription factors activate expression of defence genes in a salicylic acid- and/or jasmonic acid-dependent signalling pathway. We previously identified a WRKY gene, VvWRKY1, which is able to enhance tolerance to fungal pathogens when it is overexpressed in tobacco. The present work analyzes the effects of VvWRKY1 overexpression in grapevine. Microarray analysis showed that genes encoding defence-related proteins were up-regulated in the leaves of transgenic 35S::VvWRKY1 grapevines. Quantitative RT-PCR analysis confirmed that three genes putatively involved in jasmonic acid signalling pathway were overexpressed in the transgenic grapes. The ability of VvWRKY1 to trans-activate the promoters of these genes was demonstrated by transient expression in grape protoplasts. The resistance to the causal agent of downy mildew, Plasmopara viticola, was enhanced in the transgenic plants. These results show that VvWRKY1 can increase resistance of grapevine against the downy mildew through transcriptional reprogramming leading to activation of the jasmonic acid signalling pathway.

  2. The Myxococcus xanthus Two-Component System CorSR Regulates Expression of a Gene Cluster Involved in Maintaining Copper Tolerance during Growth and Development

    Science.gov (United States)

    Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

    2013-01-01

    Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560

  3. Construction and Verification of LuxS-negative Mutants of Streptococcus Mutans and the Effect of the Absence of LuxS Gene on the Acid Tolerance

    Institute of Scientific and Technical Information of China (English)

    YU Dan-ni; CHEN Jie; ZHANG Yao-chao; HAN Yu-zhi

    2009-01-01

    Objective: To knock out the entire Luxs gene of Streptococcus mutans(S.mutans) UA159 strain via homologous recombination and construct a Luxs-deleted mutant strain of S. Mutans. To study the difference between the acid resistance of S. Mutans Ingbritt C international standard strain and the acid resistance of LuxS mutant strain. Methods: Two DNA fragments locating in the upper and downstream of Luxs gene were amplified and a erythromycin resistance gene of PJT10 between them were engineered into PUC19 plasmid for constructing the recombination plasmid pUCluxKO. Electrotransformation of S.mutans cells with pUCluxKO-mutant resulted in isolation of erythromycin resistant S. Mutans transformants, which was identified by polymerase chain reaction, V.harveyi BB170 luminescence bioassay and sequencing analysis. Solutions of S. Mutans standard strain and LuxS mutant strain with same density were made and cultured at pH 3.5 to 7.0 BHI liquid for the same period.Terminal growth situation was compared.Firstly acidized in pH 5.5 BHI liquid,the two strains were cultured at pH 3.0 BHI liquid. The acid tolerance responses of the two strains were compared.Results:Restriction endonuclease analyses showed that pUCluxKO-mutant vector had been successfully recombined. The Luxs-deleted status of S.mutans mutants was confirmed by PCR with primers which were specific for the genes of Luxs and Erythromycin resistance. S.mutans mutant can not induce bioluminescence, indiating the mutant had been successfully recombined. After twenty generations of culture, the constructed Chinese S.mutans mutants were confirmed to be stable. Significant difference of aciduricity was observed between S.mutans standard strain and LuxS mutant strain.The acid resistance of standard strain was stronger than that of LuxS mutant strain.The two strains both displayed the capability of acid tolerance responses. Conclusion:The S.mutans gene allelic exchange plasmid is constructed correctively and a Luxs

  4. Plant Adaptation to Acid Soils: The Molecular Basis for Crop Aluminum Resistance.

    Science.gov (United States)

    Kochian, Leon V; Piñeros, Miguel A; Liu, Jiping; Magalhaes, Jurandir V

    2015-01-01

    Aluminum (Al) toxicity in acid soils is a significant limitation to crop production worldwide, as approximately 50% of the world's potentially arable soil is acidic. Because acid soils are such an important constraint to agriculture, understanding the mechanisms and genes conferring resistance to Al toxicity has been a focus of intense research interest in the decade since the last article on crop acid soil tolerance was published in this journal. An impressive amount of progress has been made during that time that has greatly increased our understanding of the diversity of Al resistance genes and mechanisms, how resistance gene expression is regulated and triggered by Al and Al-induced signals, and how the proteins encoded by these genes function and are regulated. This review examines the state of our understanding of the physiological, genetic, and molecular bases for crop Al tolerance, looking at the novel Al resistance genes and mechanisms that have been identified over the past ten years. Additionally, it examines how the integration of molecular and genetic analyses of crop Al resistance is starting to be exploited for the improvement of crop plants grown on acid soils via both molecular-assisted breeding and biotechnology approaches.

  5. The transcription factor SlAREB1 confers drought, salt stress tolerance and regulates biotic and abiotic stress-related genes in tomato.

    Science.gov (United States)

    Orellana, Sandra; Yañez, Mónica; Espinoza, Analía; Verdugo, Isabel; González, Enrique; Ruiz-Lara, Simón; Casaretto, José A

    2010-12-01

    Members of the abscisic acid-responsive element binding protein (AREB)/abscisic acid-responsive element binding factor (ABF) subfamily of basic leucine zipper (bZIP) transcription factors have been implicated in abscisic acid (ABA) and abiotic stress responses in plants. Here we describe two members identified in cultivated tomato (Solanum lycopersicum), named SlAREB1 and SlAREB2. Expression of SlAREB1 and SlAREB2 is induced by drought and salinity in both leaves and root tissues, although that of SlAREB1 was more affected. In stress assays, SlAREB1-overexpressing transgenic tomato plants showed increased tolerance to salt and water stress compared to wild-type and SlAREB1-down-regulating transgenic plants, as assessed by physiological parameters such as relative water content (RWC), chlorophyll fluorescence and damage by lipoperoxidation. In order to identify SlAREB1 target genes responsible for the enhanced tolerance, microarray and cDNA-amplified fragment length polymorphism (AFLP) analyses were performed. Genes encoding oxidative stress-related proteins, lipid transfer proteins (LTPs), transcription regulators and late embryogenesis abundant proteins were found among the up-regulated genes in SlAREB1-overexpressing lines, especially in aerial tissue. Notably, several genes encoding defence proteins associated with responses to biotic stress (e.g. pathogenesis-related proteins, protease inhibitors, and catabolic enzymes) were also up-regulated by SlAREB1 overexpression, suggesting that this bZIP transcription factor is involved in ABA signals that participate in abiotic stress and possibly in response to pathogens.

  6. Enhanced drought tolerance in transgenic rice over-expressing of maize C4 phosphoenolpyruvate carboxylase gene via NO and Ca(2+).

    Science.gov (United States)

    Qian, Baoyun; Li, Xia; Liu, Xiaolong; Chen, Pingbo; Ren, Chengang; Dai, Chuanchao

    2015-03-01

    We determined the effects of endogenous nitric oxide and Ca(2+) on photosynthesis and gene expression in transgenic rice plants (PC) over-expressing the maize C4pepc gene, which encodes phosphoenolpyruvate carboxylase (PEPC) under drought. In this study, seedlings were subjected to PEG 6000 treatments using PC and wild type (WT; Kitaake). The results showed that, compared with WT, PC had higher relative water content (RWC) and net photosynthetic rate (Pn) under drought. During a 2-day re-watering treatment, Pn recovered faster in PC than in WT. Further analyses showed that, under the drought treatment, the amount of endogenous hydrogen peroxide (H2O2) increased in WT mainly via NADPH oxidase. While in PC, the endogenous nitric oxide (NO) content increased via nitrate reductase and nitric oxide synthase on day 2 of the drought treatment and day 1 of the re-watering treatment. After 2 days of drought treatment, PC also showed higher PEPC activity, calcium content, phospholipase D (PLD) activity, C4-pepc and NAC6 transcript levels, and protein kinase activity as compared with PC without treatment. These changes did not occur in WT. Correlation analysis also proved NO associated with these indicators in PC. Based on these results, there was a particular molecular mechanism of drought tolerance in PC. The mechanism is related to the signaling processes via NO and Ca(2+) involving the protein kinase and the transcription factor, resulted in up-regulation of PEPC activity and its gene expression, such as C4pepc. Some genes encode antioxidant system, cu/zn-sod as well, which promote antioxidant system to clear MDA and superoxide anion radical, thereby conferring drought tolerance.

  7. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    Science.gov (United States)

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants.

  8. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Directory of Open Access Journals (Sweden)

    Bianca Lawson

    Full Text Available Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60% over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research

  9. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Science.gov (United States)

    Lawson, Bianca; Clulow, Simon; Mahony, Michael J; Clulow, John

    2013-01-01

    Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60%) over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+)-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research directions for

  10. Differential responses of CO2 assimilation, carbohydrate allocation and gene expression to NaCl stress in perennial ryegrass with different salt tolerance.

    Directory of Open Access Journals (Sweden)

    Tao Hu

    Full Text Available Little is known about the effects of NaCl stress on perennial ryegrass (Lolium perenne L. photosynthesis and carbohydrate flux. The objective of this study was to understand the carbohydrate metabolism and identify the gene expression affected by salinity stress. Seventy-four days old seedlings of two perennial ryegrass accessions (salt-sensitive 'PI 538976' and salt-tolerant 'Overdrive' were subjected to three levels of salinity stress for 5 days. Turf quality in all tissues (leaves, stems and roots of both grass accessions negatively and significantly correlated with GFS (Glu+Fru+Suc content, except for 'Overdrive' stems. Relative growth rate (RGR in leaves negatively and significantly correlated with GFS content in 'Overdrive' (P0.05 for turf quality. A greater up-regulation in the expression of SPS, SS, SI, 6-SFT gene was observed in 'Overdrive' than 'PI 538976'. A higher level of SPS and SS expression in leaves was found in 'PI 538976' relative to 'Overdrive'. Accumulation of hexoses in roots, stems and leaves can induce a feedback repression to photosynthesis in salt-stressed perennial ryegrass and the salt tolerance may be changed with the carbohydrate allocation in leaves and stems.

  11. MaJAZ1 Attenuates the MaLBD5-Mediated Transcriptional Activation of Jasmonate Biosynthesis Gene MaAOC2 in Regulating Cold Tolerance of Banana Fruit.

    Science.gov (United States)

    Ba, Liang-jie; Kuang, Jian-fei; Chen, Jian-ye; Lu, Wang-jin

    2016-02-01

    Previous studies indicated that methyl jasmonate (MeJA) treatment could effectively reduce the chilling injury of many fruits, including banana, but the underlying mechanism is poorly understood. In this study, one lateral organ boundaries (LOB) domain (LBD) gene, designated as MaLBD5, was isolated and characterized from banana fruit. Expression analysis revealed that accumulation of MaLBD5 was induced by cold temperature and MeJA treatment. Subcellular localization and transactivation assays showed that MaLBD5 was localized to the nucleus and possessed transcriptional activation activity. Protein-protein interaction analysis demonstrated that MaLBD5 physically interacted with MaJAZ1, a potential repressor of jasmonate signaling. Furthermore, transient expression assays indicated that MaLBD5 transactivated a jasmonate biosynthesis gene, termed MaAOC2, which was also induced by cold and MeJA. More interestingly, MaJAZ1 attenuated the MaLBD5-mediated transactivation of MaAOC2. These results suggest that MaLBD5 and MaJAZ1 might act antagonistically in relation to MeJA-induced cold tolerance of banana fruit, at least partially via affecting jasmonate biosynthesis. Collectively, our findings expand the knowledge of the transcriptional regulatory network of MeJA-mediated cold tolerance of banana fruit.

  12. Linking stomatal traits and expression of slow anion channel genes HvSLAH1 2 HvSLAC1 with grain yield for increasing salinity tolerance in barley

    Directory of Open Access Journals (Sweden)

    Xiaohui eLiu

    2014-11-01

    Full Text Available Soil salinity is an environmental and agricultural problem in many parts of the world. One of the keys to breeding barley for adaptation to salinity lies in a better understanding of the genetic control of stomatal regulation. We have employed a range of physiological and molecular techniques (stomata assay, gas exchange, phylogenetic analysis, QTL analysis, and gene expression to investigate stomatal behaviour and genotypic variation in barley cultivars and a genetic population in four experimental trials. A set of relatively efficient and reliable methods were developed for the characterisation of stomatal behaviour of large numbers of varieties and genetic lines. Furthermore, we have found a large genetic variation of gas exchange and stomatal traits in barley in response to salinity stress. Salt-tolerant CM72 showed significantly larger stomatal aperture in 200 mM NaCl treatment than that of salt-sensitive Gairdner. Stomatal traits such as aperture width/length were found to significantly correlate with grain yield in salt treatment. Phenotypic characterisation and QTL analysis of a segregating double haploid population of the CM72/Gairdner resulted in the identification of significant stomatal traits-related QTLs for salt tolerance. Moreover, expression analysis of the slow anion channel genes HvSLAH1 and HvSLAC1 demonstrated that their up-regulation is linked to high barley grain yield in the field.

  13. Aspects of aluminum toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Hewitt, C.D.; Savory, J.; Wills, M.R. (Univ. of Virginia Health Sciences Center, Charlottesville (USA))

    1990-06-01

    Aluminum is the most abundant metal in the earth's crust. The widespread occurrence of aluminum, both in the environment and in foodstuffs, makes it virtually impossible for man to avoid exposure to this metal ion. Attention was first drawn to the potential role of aluminum as a toxic metal over 50 years ago, but was dismissed as a toxic agent as recently as 15 years ago. The accumulation of aluminum, in some patients with chronic renal failure, is associated with the development of toxic phenomena; dialysis encephalopathy, osteomalacic dialysis osteodystrophy, and an anemia. Aluminum accumulation also occurs in patients who are not on dialysis, predominantly infants and children with immature or impaired renal function. Aluminum has also been implicated as a toxic agent in the etiology of Alzheimer's disease, Guamiam amyotrophic lateral sclerosis, and parkinsonism-dementia. 119 references.

  14. Regulated expression of an isopentenyltransferase gene (IPT) in peanut significantly improves drought tolerance and increases yield under field conditions.

    Science.gov (United States)

    Qin, Hua; Gu, Qiang; Zhang, Junling; Sun, Li; Kuppu, Sundaram; Zhang, Yizheng; Burow, Mark; Payton, Paxton; Blumwald, Eduardo; Zhang, Hong

    2011-11-01

    Isopentenyltransferase (IPT) is a critical enzyme in the cytokinin biosynthetic pathway. The expression of IPT under the control of a maturation- and stress-induced promoter was shown to delay stress-induced plant senescence that resulted in an enhanced drought tolerance in both monocot and dicot plants. This report extends the earlier findings in tobacco and rice to peanut (Arachis hypogaea L.), an important oil crop and protein source. Regulated expression of IPT in peanut significantly improved drought tolerance in both laboratory and field conditions. Transgenic peanut plants maintained higher photosynthetic rates, higher stomatal conductance and higher transpiration than wild-type control plants under reduced irrigation conditions. More importantly, transgenic peanut plants produced significantly higher yields than wild-type control plants in the field, indicating a great potential for the development of crops with improved performance and yield in water-limited areas of the world.

  15. Aluminum powder metallurgy processing

    Energy Technology Data Exchange (ETDEWEB)

    Flumerfelt, J.F.

    1999-02-12

    The objective of this dissertation is to explore the hypothesis that there is a strong linkage between gas atomization processing conditions, as-atomized aluminum powder characteristics, and the consolidation methodology required to make components from aluminum powder. The hypothesis was tested with pure aluminum powders produced by commercial air atomization, commercial inert gas atomization, and gas atomization reaction synthesis (GARS). A comparison of the GARS aluminum powders with the commercial aluminum powders showed the former to exhibit superior powder characteristics. The powders were compared in terms of size and shape, bulk chemistry, surface oxide chemistry and structure, and oxide film thickness. Minimum explosive concentration measurements assessed the dependence of explosibility hazard on surface area, oxide film thickness, and gas atomization processing conditions. The GARS aluminum powders were exposed to different relative humidity levels, demonstrating the effect of atmospheric conditions on post-atomization processing conditions. The GARS aluminum powders were exposed to different relative humidity levels, demonstrating the effect of atmospheric conditions on post-atomization oxidation of aluminum powder. An Al-Ti-Y GARS alloy exposed in ambient air at different temperatures revealed the effect of reactive alloy elements on post-atomization powder oxidation. The pure aluminum powders were consolidated by two different routes, a conventional consolidation process for fabricating aerospace components with aluminum powder and a proposed alternative. The consolidation procedures were compared by evaluating the consolidated microstructures and the corresponding mechanical properties. A low temperature solid state sintering experiment demonstrated that tap densified GARS aluminum powders can form sintering necks between contacting powder particles, unlike the total resistance to sintering of commercial air atomization aluminum powder.

  16. Disruption of the Arabidopsis Defense Regulator Genes SAG101, EDS1, and PAD4 Confers Enhanced Freezing Tolerance.

    Science.gov (United States)

    Chen, Qin-Fang; Xu, Le; Tan, Wei-Juan; Chen, Liang; Qi, Hua; Xie, Li-Juan; Chen, Mo-Xian; Liu, Bin-Yi; Yu, Lu-Jun; Yao, Nan; Zhang, Jian-Hua; Shu, Wensheng; Xiao, Shi

    2015-10-01

    In Arabidopsis, three lipase-like regulators, SAG101, EDS1, and PAD4, act downstream of resistance protein-associated defense signaling. Although the roles of SAG101, EDS1, and PAD4 in biotic stress have been extensively studied, little is known about their functions in plant responses to abiotic stresses. Here, we show that SAG101, EDS1, and PAD4 are involved in the regulation of freezing tolerance in Arabidopsis. With or without cold acclimation, the sag101, eds1, and pad4 single mutants, as well as their double mutants, exhibited similarly enhanced tolerance to freezing temperatures. Upon cold exposure, the sag101, eds1, and pad4 mutants showed increased transcript levels of C-REPEAT/DRE BINDING FACTORs and their regulons compared with the wild type. Moreover, freezing-induced cell death and accumulation of hydrogen peroxide were ameliorated in sag101, eds1, and pad4 mutants. The sag101, eds1, and pad4 mutants had much lower salicylic acid (SA) and diacylglycerol (DAG) contents than the wild type, and exogenous application of SA and DAG compromised the freezing tolerance of the mutants. Furthermore, SA suppressed the cold-induced expression of DGATs and DGKs in the wild-type leaves. These findings indicate that SAG101, EDS1, and PAD4 are involved in the freezing response in Arabidopsis, at least in part, by modulating the homeostasis of SA and DAG.

  17. Correlation between differential drought tolerability of two contrasting drought-responsive chickpea cultivars and differential expression of a subset of CaNAC genes under normal and dehydration conditions

    Directory of Open Access Journals (Sweden)

    Kien Huu Nguyen

    2015-06-01

    Full Text Available Drought causes detrimental effect to growth and productivity of many plants, including crops. NAC transcription factors (TFs have been reported to play important role in drought tolerance. In this study, we assessed the expression profiles of 19 dehydration-responsive CaNAC genes in roots and leaves of two contrasting drought-responsive chickpea varieties treated with water (control and dehydration to examine the correlation between the differential expression levels of the CaNACs and the differential drought tolerability of these two cultivars. Results of real-time quantitative PCR indicated a positive relationship between the number of dehydration-inducible and -repressible CaNAC genes and drought tolerability. The higher drought-tolerant capacity of ICL482 cultivar vs. Hashem cultivar might be, at least partly, attributed to the higher number of dehydration-inducible and lower number of dehydration-repressible CaNAC genes identified in both root and leaf tissues of ICL482 than in those of Hashem. In addition, our comparative expression analysis of the selected CaNACs in roots and leaves of ICL482 and Hashem cultivars revealed different dehydration-responsive expression patterns, indicating that CaNAC gene expression is tissue- and genotype-specific. Furthermore, the analysis suggested that the enhanced drought tolerance of ICL482 vs. Hashem might be associated with 5 genes, namely CaNAC02, 04, 05, 16 and 24. CaNAC16 could be a potential candidate contributing to the better drought tolerance of ICL482 vs. Hashem as a positive regulator. Conversely, CaNAC02 could be a potential negative regulator, contributing to the differential drought tolerability of these two cultivars. Thus, our results have also provided a solid foundation for selection of promising tissue-specific and/or dehydration-responsive CaNAC candidates for detailed in planta functional analyses, leading to development of transgenic chickpea varieties with improved productivity

  18. STOP2 Activates Transcription of Several Genesfor AI- and Low pH-Tolerance that Are Regulatedby STOP1 in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    2014-01-01

    The zinc-finger protein STOP1 (sensitive to proton rhizotoxicity 1) regulates transcription of multiple genescritical for tolerance to aluminum (AI) and low pH in Arabidopsis. We evaluated the contributions of genes that are sup-pressed in the stop1 mutant to AI- and low pH-tolerance using T-DNA-inserted disruptants, and transgenic stop1 mutantsexpressing each of the suppressed genes. STOP2, a STOP1 homolog, partially recovered AI- and low pH-tolerance byrecovering the expression of genes regulated by STOP1. Growth and root tip viability under proton stress were partiallyrescued in the STOP2-complemented line. STOP2 localized in the nucleus and regulated transcription of two genes (PGIP1and PGIP2) associated with cell wall stabilization at low pH. GUS assays revealed that STOP1 and STOP2 showed similarcellular expression in the root. However, the expression level of STOP2 was much lower than that of STOP1. In a STOP1promoter::STOP2-complemented line, AI tolerance was slightly recovered, concomitant with the recovery of expressionof ALS3 (aluminum sensitive 3) and AtMATE (Arabidopsis thaliana multidrug and toxic compound extrusion), while theexpression of AtALMT1 (aluminum-activated malate transporter 1) was not recovered. These analyses indicated thatSTOP2 is a physiologically minor isoform of STOP1, but it can activate expression of some genes regulated by STOP1.

  19. Impact of two common polymorphisms in the PPARgamma gene on glucose tolerance and plasma insulin profiles in monozygotic and dizygotic twins: thrifty genotype, thrifty phenotype, or both?

    DEFF Research Database (Denmark)

    Poulsen, Pernille; Andersen, Gitte; Fenger, Mogens;

    2003-01-01

    The Pro12Ala polymorphism in the PPARgamma2 gene has been associated with reduced risk of type 2 diabetes and insulin resistance. Recently, an association between dizygotic twinning and PPARgamma gene polymorphisms has been proposed. We investigated the phenotypic appearance of the two polymorphi......The Pro12Ala polymorphism in the PPARgamma2 gene has been associated with reduced risk of type 2 diabetes and insulin resistance. Recently, an association between dizygotic twinning and PPARgamma gene polymorphisms has been proposed. We investigated the phenotypic appearance of the two...... polymorphism on glucose tolerance, diabetic status, homeostasis model assessment for insulin resistance, and plasma insulin profiles in twins. No impact of the silent exon 6 polymorphism on glucose homeostasis or plasma insulin profiles was found. Independent of the polymorphisms, we observed a significant...... an association between the Ala allele and reduced risk of diabetes and insulin resistance in twins. However, the differences in metabolic profiles among MZ and DZ twins were not explained by differences in frequencies of the genetic variants and may be due to intrauterine environmental factors operating in twins...

  20. Impact of two common polymorphisms in the PPARgamma gene on glucose tolerance and plasma insulin profiles in monozygotic and dizygotic twins

    DEFF Research Database (Denmark)

    Poulsen, Pernille; Andersen, Gitte; Fenger, Mogens;

    2003-01-01

    The Pro12Ala polymorphism in the PPARgamma2 gene has been associated with reduced risk of type 2 diabetes and insulin resistance. Recently, an association between dizygotic twinning and PPARgamma gene polymorphisms has been proposed. We investigated the phenotypic appearance of the two polymorphi......The Pro12Ala polymorphism in the PPARgamma2 gene has been associated with reduced risk of type 2 diabetes and insulin resistance. Recently, an association between dizygotic twinning and PPARgamma gene polymorphisms has been proposed. We investigated the phenotypic appearance of the two...... polymorphism on glucose tolerance, diabetic status, homeostasis model assessment for insulin resistance, and plasma insulin profiles in twins. No impact of the silent exon 6 polymorphism on glucose homeostasis or plasma insulin profiles was found. Independent of the polymorphisms, we observed a significant...... an association between the Ala allele and reduced risk of diabetes and insulin resistance in twins. However, the differences in metabolic profiles among MZ and DZ twins were not explained by differences in frequencies of the genetic variants and may be due to intrauterine environmental factors operating in twins...

  1. The phenome analysis of mutant alleles in Leucine-Rich Repeat Receptor-Like Kinase genes in rice reveals new potential targets for stress tolerant cereals.

    Science.gov (United States)

    Dievart, Anne; Perin, Christophe; Hirsch, Judith; Bettembourg, Mathilde; Lanau, Nadège; Artus, Florence; Bureau, Charlotte; Noel, Nicolas; Droc, Gaétan; Peyramard, Matthieu; Pereira, Serge; Courtois, Brigitte; Morel, Jean-Benoit; Guiderdoni, Emmanuel

    2016-01-01

    Plants are constantly exposed to a variety of biotic and abiotic stresses that reduce their fitness and performance. At the molecular level, the perception of extracellular stimuli and the subsequent activation of defense responses require a complex interplay of signaling cascades, in which protein phosphorylation plays a central role. Several studies have shown that some members of the Leucine-Rich Repeat Receptor-Like Kinase (LRR-RLK) family are involved in stress and developmental pathways. We report here a systematic analysis of the role of the members of this gene family by mutant phenotyping in the monocotyledon model plant rice, Oryza sativa. We have then targeted 176 of the ∼320 LRR-RLK genes (55.7%) and genotyped 288 mutant lines. Position of the insertion was confirmed in 128 lines corresponding to 100 LRR-RLK genes (31.6% of the entire family). All mutant lines harboring homozygous insertions have been screened for phenotypes under normal conditions and under various abiotic stresses. Mutant plants have been observed at several stages of growth, from seedlings in Petri dishes to flowering and grain filling under greenhouse conditions. Our results show that 37 of the LRR-RLK rice genes are potential targets for improvement especially in the generation of abiotic stress tolerant cereals.

  2. Regulation of pepc gene expression in Anabaena sp. PCC 7120 and its effects on cyclic electron flow around photosystem I and tolerances to environmental stresses

    Institute of Scientific and Technical Information of China (English)

    Xiao-Hui Jia; Peng-Peng Zhang; Ding-Ji Shi; Hua-Ling Mi; Jia-Cheng Zhu; Xi-Wen Huang; Pei-Min He

    2015-01-01

    Since pepc gene encoding phosphoenolpyruvate carboxylase (PEPCase) has been cloned from Anabaena sp. PCC 7120 and other cyanobacteria, the effects of pepc gene expression on photosynthesis have not been reported yet. In this study, we constructed mutants containing either upregu-lated (forward) or downregulated (reverse) pepc gene in Anabaena sp. PCC 7120. Results from real‐time quantitative polymerase chain reaction (RT‐qPCR), Western blot and enzymatic analysis showed that PEPCase activity was signifi-cantly reduced in the reverse mutant compared with the wild type, and that of the forward mutant was obviously increased. Interestingly, the net photosynthesis in both the reverse mutant and the forward mutant were higher than that of the wild type, but dark respiration was decreased only in the reverse mutant. The absorbance changes of P700 upon saturation pulse showed the photosystem I (PSI) activity was inhibited, as reflected by Y(I), and Y(NA) was elevated, and dark reduction of P700þ was stimulated, indicating enhanced cyclic electron flow (CEF) around PSI in the reverse mutant. Additional y, the reverse mutant photosynthesis was higher than that of the wild type in low temperature, low and high pH, and high salinity, and this implies increased tolerance in the reverse mutant through downregulated pepc gene.

  3. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    Science.gov (United States)

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  4. Analysis of genes specifically expressed under salt stress in salt-tolerant mutant of rice by using DDRT-PCR technique

    Institute of Scientific and Technical Information of China (English)

    张弛; 陈受宜

    1996-01-01

    Differential display reverse transcription-PCR (DDRT-PCR) technique was used to identify those genes that are expressed differentially between wild type rice variety 77-170 (Oryza Sativa vas Japonica) and its salt-tolerant mutant (M-20) under salt stress. Totally 13 salt-inducible cDNA fragments of 200-600 bp were identified and doned, and were designated as SIGR1 - SIGR13 (salt-induced gene in rice). Northern blot analysis showed that expression of SIGR6 and SIGR8 was salt-inducible in both wild type and mutant, and expression of SIGR12 in M-20 was much higher than that in 77-170 under salt stress. It was also shown that expression of SIGR3, SIGR4, SIGR7, SIGRIO and SIGR13 was salt-inducible, and the genes were highly homologous with Rab1d which was an ABA-inducible gene of rice. The great potential application of DDRT-PCR technique in plant molecular biology research may promote the investigation of expression of salt-induced protein in rice.

  5. Cloning and Sequence Analysis of a Glucose-6-Phosphate Dehydrogenase Gene PsG6PDH from Freezing-tolerant Populus suaveolens

    Institute of Scientific and Technical Information of China (English)

    Lin Yuan-zhen; Lin Shan-zhi; Zhang Wei; Zhang Qian; Zhang Zhi-yi; Guo Huan

    2005-01-01

    A 1207 hp cDNA fragment (PsG6PDH) was amplified by PT-PCR from cold-induced total Pna of the freexing-tolerant P. Suaveolens, using primers based on the highly comserved region of published plant glucose-6-phosphate dehydrogenase (G6PDH)genes. The sepuence analysis showed that PsG6PDH coding region had 1 101 bp and encoded 367 predicted aminoacid residues. Moreover, the nucleotide sequence of psG6PDH showed 83%,82%,79%,79% and 78% identity, and the derived amino acid sequence shared 44.2%,44.7%,42.0%,40.5% and 43.9% identity with those of the Solanum tuberosum, Nicotiana tabacum, Triticum aestivum, Oryxa sativa and Arabidopsis thaliana, respectively. The results show that PsG6PDH is a new member of G6PDH gene family and belongs to cytosolic G6PDH gene. This is the first report on clonign of the G6PDH gene from woody plants.

  6. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.

    Science.gov (United States)

    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil

    2015-07-01

    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress.

  7. Regulation of pepc gene expression in Anabaena sp. PCC 7120 and its effects on cyclic electron flow around photosystem I and tolerances to environmental stresses.

    Science.gov (United States)

    Jia, Xiao-Hui; Zhang, Peng-Peng; Shi, Ding-Ji; Mi, Hua-Ling; Zhu, Jia-Cheng; Huang, Xi-Wen; He, Pei-Min

    2015-05-01

    Since pepc gene encoding phosphoenolpyruvate carboxylase (PEPCase) has been cloned from Anabaena sp. PCC 7120 and other cyanobacteria, the effects of pepc gene expression on photosynthesis have not been reported yet. In this study, we constructed mutants containing either upregulated (forward) or downregulated (reverse) pepc gene in Anabaena sp. PCC 7120. Results from real-time quantitative polymerase chain reaction (RT-qPCR), Western blot and enzymatic analysis showed that PEPCase activity was significantly reduced in the reverse mutant compared with the wild type, and that of the forward mutant was obviously increased. Interestingly, the net photosynthesis in both the reverse mutant and the forward mutant were higher than that of the wild type, but dark respiration was decreased only in the reverse mutant. The absorbance changes of P700 upon saturation pulse showed the photosystem I (PSI) activity was inhibited, as reflected by Y(I), and Y(NA) was elevated, and dark reduction of P700(+) was stimulated, indicating enhanced cyclic electron flow (CEF) around PSI in the reverse mutant. Additionally, the reverse mutant photosynthesis was higher than that of the wild type in low temperature, low and high pH, and high salinity, and this implies increased tolerance in the reverse mutant through downregulated pepc gene.

  8. A cotton (Gossypium hirsutum) DRE-binding transcription factor gene, GhDREB, confers enhanced tolerance to drought, high salt, and freezing stresses in transgenic wheat.

    Science.gov (United States)

    Gao, Shi-Qing; Chen, Ming; Xia, Lian-Qin; Xiu, Hui-Jun; Xu, Zhao-Shi; Li, Lian-Cheng; Zhao, Chang-Ping; Cheng, Xian-Guo; Ma, You-Zhi

    2009-02-01

    A cotton (G. hirsutum L.) dehydration responsive element binding protein gene, GhDREB, which encodes a 153 amino acid protein containing a conserved AP2/EREBP domain, was isolated from the cDNA library of cotton cv. Simian 3 by a yeast one-hybrid system. RNA blot analysis showed that the GhDREB gene was induced in cotton seedlings by drought, high salt and cold stresses. An electrophoretic mobility shift assay (EMSA) indicated that the GhDREB protein bound specifically to the DRE core element (A/GCCGAC) in vitro. Two expression vectors containing the GhDREB gene with either of the Ubiqutin or rd29A promoters were constructed and transferred into wheat (Triticum aestivum L.) by bombardment. Fifty-eight Ubi::GhDREB and 17 rd29A::GhDREB T(0) plants of Yangmai (36 plants) and Lumai (39 plants) were identified by PCR analysis, respectively. Southern blot and RT-PCR analyses showed that two or three copies of the GhDREB were integrated into the Yangmai 10 genome and were expressed at the transcriptional level, and three or four copies were integrated into the Lumai 23 genome. Functional analysis indicated that the transgenic plants had improved tolerance to drought, high salt, and freezing stresses through accumulating higher levels of soluble sugar and chlorophyll in leaves after stress treatments. No phenotype differences were observed between transgenic plants and their non-transgenic controls. These results indicated that GhDREB might be useful in improving wheat stress tolerance through genetic engineering.

  9. Transcriptomic profiling to identify genes involved in Fusarium mycotoxin Deoxynivalenol and Zearalenone tolerance in the mycoparasitic fungus Clonostachys rosea

    DEFF Research Database (Denmark)

    Kosawang, Chatchai; Karlsson, Magnus; Jensen, Dan Funck;

    2014-01-01

    approach to identify genes induced by DON and ZEA in order to investigate the molecular basis of mycotoxin resistance C. rosea.Results: We generated DON- and ZEA-induced cDNA libraries based on suppression subtractive hybridization. A total of 443 and 446 sequenced clones (corresponding to 58 and 65 genes...

  10. Is the Aluminum Hypothesis Dead?

    OpenAIRE

    Lidsky, Theodore I.

    2014-01-01

    The Aluminum Hypothesis, the idea that aluminum exposure is involved in the etiology of Alzheimer disease, dates back to a 1965 demonstration that aluminum causes neurofibrillary tangles in the brains of rabbits. Initially the focus of intensive research, the Aluminum Hypothesis has gradually been abandoned by most researchers. Yet, despite this current indifference, the Aluminum Hypothesis continues to attract the attention of a small group of scientists and aluminum continues to be viewed w...

  11. High energy density aluminum battery

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Gilbert M.; Paranthaman, Mariappan Parans; Dai, Sheng; Dudney, Nancy J.; Manthiram, Arumugan; McIntyre, Timothy J.; Sun, Xiao-Guang; Liu, Hansan

    2016-10-11

    Compositions and methods of making are provided for a high energy density aluminum battery. The battery comprises an anode comprising aluminum metal. The battery further comprises a cathode comprising a material capable of intercalating aluminum or lithium ions during a discharge cycle and deintercalating the aluminum or lithium ions during a charge cycle. The battery further comprises an electrolyte capable of supporting reversible deposition and stripping of aluminum at the anode, and reversible intercalation and deintercalation of aluminum or lithium at the cathode.

  12. A novel Zea mays ssp. mexicana L. MYC-type ICE-like transcription factor gene ZmmICE1, enhances freezing tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Lu, Xiang; Yang, Lei; Yu, Mengyuan; Lai, Jianbin; Wang, Chao; McNeil, David; Zhou, Meixue; Yang, Chengwei

    2017-04-01

    The annual Zea mays ssp. mexicana L., a member of the teosinte group, is a close wild relative of maize and thus can be effectively used in maize improvement. In this study, an ICE-like gene, ZmmICE1, was isolated from a cDNA library of RNA-Seq from cold-treated seedling tissues of Zea mays ssp. mexicana L. The deduced protein of ZmmICE1 contains a highly conser