Effects of alternative promoters of growth on the performance and cost of production of broilers

Directory of Open Access Journals (Sweden)

Patrícia Tomazini Medeiros

2009-09-01

Full Text Available Probiotics and prebiotics were compared to antimicrobials as alternative growth promoters in male broilers grown from 1 to 42 days of age. Eight treatments were evaluated: a control feed without antimicrobials or alternative growth promoters, a control feed with antimicrobials, a control feed with the antimicrobials colistine and avilamicine, three rations with probiotic Bacillus subtilis in different concentrations and/or under recommended usage, one ration with probiotic Saccharomyces cerevisiae in addition to a mixture of probiotic Bacillus subtilis, Saccharomyces cerevisiae and Aspergillus oryzae, and one ration with mananoligossacarids (MOS plus betaglutanes. Antimicrobials and alternative growth promoters were added to an initial feed and to a growth feed common to all birds. Thirteen to 17 replicates of 50 birds of a Cobb line were utilized per treatment in a completely randomized design. Feed consumption, feed conversion and production costs did not significantly differ among treatments. The weights of 42-day-old birds fed on Bacillus subtilis (1,6 x 109CFU/g or the mixture of probiotics were higher or similar to the weights of birds fed on ration with antimicrobials. It was concluded that probiotics can replace antimicrobials as growth promoters for broilers up to 42 days of age without negative effects on growth performance and production cost.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

International Nuclear Information System (INIS)

Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

CRE promoter sites modulate alternative splicing via p300-mediated histone acetylation

Czech Academy of Sciences Publication Activity Database

Dušková, Eva; Hnilicová, Jarmila; Staněk, David

2014-01-01

Roč. 11, č. 7 (2014), s. 865-874 ISSN 1547-6286 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68378050 Keywords : alternative splicing * fibronectin * p300 * histone acetylation * promoter Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.974, year: 2014

A novel CDX2 isoform regulates alternative splicing.

Directory of Open Access Journals (Sweden)

Matthew E Witek

Full Text Available Gene expression is a dynamic and coordinated process coupling transcription with pre-mRNA processing. This regulation enables tissue-specific transcription factors to induce expression of specific transcripts that are subsequently amplified by alternative splicing allowing for increased proteome complexity and functional diversity. The intestine-specific transcription factor CDX2 regulates development and maintenance of the intestinal epithelium by inducing expression of genes characteristic of the mature enterocyte phenotype. Here, sequence analysis of CDX2 mRNA from colonic mucosa-derived tissues revealed an alternatively spliced transcript (CDX2/AS that encodes a protein with a truncated homeodomain and a novel carboxy-terminal domain enriched in serine and arginine residues (RS domain. CDX2 and CDX2/AS exhibited distinct nuclear expression patterns with minimal areas of co-localization. CDX2/AS did not activate the CDX2-dependent promoter of guanylyl cyclase C nor inhibit transcriptional activity of CDX2. Unlike CDX2, CDX2/AS co-localized with the putative splicing factors ASF/SF2 and SC35. CDX2/AS altered splicing patterns of CD44v5 and Tra2-β1 minigenes in Lovo colon cancer cells independent of CDX2 expression. These data demonstrate unique dual functions of the CDX2 gene enabling it to regulate gene expression through both transcription (CDX2 and pre-mRNA processing (CDX2/AS.

BIOGAS AS AN ALTERNATIVE ENERGY SOURCE TO PROMOTE INDIGENOUS COMMUNITIES DEVELOPMENT

Directory of Open Access Journals (Sweden)

Carlos SABORÍO VÍQUEZ

2013-01-01

Full Text Available The key areas that determine the food and nutrition security are: availability, access, consumption and biological utilization. For this reason it is necessary to promote the health of vulnerable groups, in this case, indigenous communities, protecting and establishing conditions to ensure the human right to food. The initial plan focuses ondeveloping facilities for small swine and poultry farms, familiar, non-commercial. The main objective of the pigs raised at the site will be the production of animal waste in order to implement digesters for the production of biogas as an alternative energy source, the production of meat stays in the background, thinking only about the community consumption and helping to ensure their food source, from this perspective, the technologies applied to rural and indigenous progress are environmentally friendly, socially just, economically viable and culturally acceptable. The theme of rural and indigenous Development is focused on their food security and the use of alternative energies, considering that energy is a key element in achieving sustainable development in all sectors, therefore sought from a broad perspective solidarity and actively promote greater and more rational use of energy and the environment in remote communities, through diversification of supply sources and efficient use, thereby contributing toenvironmental conservation and reduction of health problems through the use of appropriate technologies.

CO2 methanation on the catalyst of Ni/MCM-41 promoted with CeO2.

Science.gov (United States)

Wang, Xiaoliu; Zhu, Lingjun; Liu, Yincong; Wang, Shurong

2018-06-01

CO 2 as a raw feed combined with renewable hydrogen for the production of useful chemicals and alternative energy products is one of the solutions to environmental and energy problems. In this study, a series of Ni-xCeO 2 /MCM-41 catalysts with a nickel content of 20wt% were prepared through deposition precipitation method for CO 2 methanation. Different characterization methods, including BET, XRD, TEM, SEM, H 2 -TPR and H 2 -TPD were applied to help explore the influence mechanism of CeO 2 on Ni/MCM-41 in CO 2 methanation. It was found that all CeO 2 -promoted catalysts exhibited enhanced catalytic activity when compared to Ni/MCM-41. The catalyst modified with 20wt% CeO 2 showed the best catalytic performance, with CO 2 conversion and CH 4 selectivity of 85.6% and 99.8%, respectively, at the temperature of 380°C under atmospheric pressure. The synergetic effects among Ni 0 active sites, the promoter and the support, including nickel dispersion improvement and increased CO 2 adsorption sites due to the addition of CeO 2 , were considered as important factors for high reactivity of the promoted catalysts. The stability test showed that the promoted catalyst maintained its high reactivity after 30h. Copyright © 2017 Elsevier B.V. All rights reserved.

Heteropoly acid promoted V2O5/TiO2 catalysts for NO abatement with ammonia in alkali containing flue gases

DEFF Research Database (Denmark)

Putluru, Siva Sankar Reddy; Jensen, Anker Degn; Riisager, Anders

2011-01-01

V2O5/TiO2 and heteropoly acid promoted V2O5/TiO2 catalysts were prepared and characterized by N2 physisorption, XRPD and NH3-TPD. The influence of the calcination temperature from 400 to 700 1C on crystallinity and acidic properties was studied and compared with the activity for the selective...... catalytic reduction (SCR) of NO with ammonia. The SCR activity of heteropoly acid promoted catalysts was found to be much higher than for unpromoted catalysts. The stability of heteropoly acid promoted catalysts is dependent on calcination temperature and there is a gradual decrease in SCR activity...... and acidity with increase in calcination temperatures. Furthermore, the heteropoly acid promoted V2O5/TiO2 catalysts showed excellent alkali deactivation resistance and might therefore be alternative deNOx catalysts in biomass fired power plants....

Multi-criteria evaluation of cooking energy alternatives for promoting parabolic solar cooker in India

Energy Technology Data Exchange (ETDEWEB)

Pohekar, S.D. [Birla Institute of Technology and Science, Pilani (India). CREED; Ramachandran, M. [Birla Institute of Technology and Science, Dubai (United Arab Emirates)

2004-07-01

The policy formulation for cooking energy substitution by renewables is addressed in multi-criteria context. A survey is conducted to know the perceptions of different decision making groups on present dissemination of various cooking energy alternatives in India. Nine cooking energy alternatives are evaluated on 30 different criteria comprising of technical, economic, environmental/social, behavioural and commercial issues. Preference Ranking Organization METHod for Enrichment Evaluation (PROMETHEE), a multi-criteria decision making method of outranking nature is used to rank the alternatives. It is found that liquefied petroleum gas (LPG) stove is the most preferred device, followed by kerosene stove, solar box cooker and parabolic solar cooker (PSC) in that order. A sensitivity analysis is also carried out for identifying potential areas for improvement for PSC. On the basis of results, strategies for promoting wide spread use of PSC are formulated. (author)

Loss of Endocan tumorigenic properties after alternative splicing of exon 2

International Nuclear Information System (INIS)

Depontieu, Florence; Grigoriu, Bogdan-Dragos; Scherpereel, Arnaud; Adam, Estelle; Delehedde, Maryse; Gosset, Philippe; Lassalle, Philippe

2008-01-01

Endocan was originally described as a dermatan sulfate proteoglycan found freely circulating in the blood. Endocan expression confers tumorigenic properties to epithelial cell lines or accelerate the growth of already tumorigenic cells. This molecule is the product of a single gene composed of 3 exons. Previous data showed that endocan mRNA is subject to alternative splicing with possible generation of two protein products. In the present study we identified, and functionally characterized, the alternative spliced product of the endocan gene: the exon 2-deleted endocan, called endocanΔ2. Stable, endocanΔ2-overexpressing cell lines were generated to investigate the biological activities of this new alternatively spliced product of endocan gene. Tumorigenesis was studied by inoculating endocan and endocanΔ2 expressing cell lines subcutaneously in SCID mice. Biochemical properties of endocan and endocanΔ2 were studied after production of recombinant proteins in various cell lines of human and murine origin. Our results showed that the exon 2 deletion impairs synthesis of the glycan chain, known to be involved in the pro-tumoral effect of endocan. EndocanΔ2 did not promote tumor formation by 293 cells implanted in the skin of severe combined immunodeficient (SCID) mice. Our results emphasize the key role of the polypeptide sequence encoded by the exon 2 of endocan gene in tumorigenesis, and suggest that this sequence could be a target for future therapies against cancer

Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene

International Nuclear Information System (INIS)

Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

2010-01-01

Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.

CR2-mediated activation of the complement alternative pathway results in formation of membrane attack complexes on human B lymphocytes

DEFF Research Database (Denmark)

Nielsen, C H; Marquart, H V; Prodinger, W M

2001-01-01

the alternative pathway. Blockade of the CR2 ligand-binding site with the monoclonal antibody FE8 resulted in 56 +/- 13% and 71 +/- 9% inhibition of the C3-fragment and MAC deposition, respectively, whereas the monoclonal antibody HB135, directed against an irrelevant CR2 epitope, had no effect. Blockade......Normal human B lymphocytes activate the alternative pathway of complement via complement receptor type 2 (CR2, CD21), that binds hydrolysed C3 (iC3) and thereby promotes the formation of a membrane-bound C3 convertase. We have investigated whether this might lead to the generation of a C5...... processes on CR2, indicate that MAC formation is a consequence of alternative pathway activation....

Promoter2.0: for the recognition of PolII promoter sequences

DEFF Research Database (Denmark)

Knudsen, Steen; Knudsen, Steen

1999-01-01

transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

Opioid inhibition of N-type Ca2+ channels and spinal analgesia couple to alternative splicing.

Science.gov (United States)

Andrade, Arturo; Denome, Sylvia; Jiang, Yu-Qiu; Marangoudakis, Spiro; Lipscombe, Diane

2010-10-01

Alternative pre-mRNA splicing occurs extensively in the nervous systems of complex organisms, including humans, considerably expanding the potential size of the proteome. Cell-specific alternative pre-mRNA splicing is thought to optimize protein function for specialized cellular tasks, but direct evidence for this is limited. Transmission of noxious thermal stimuli relies on the activity of N-type Ca(V)2.2 calcium channels in nociceptors. Using an exon-replacement strategy in mice, we show that mutually exclusive splicing patterns in the Ca(V)2.2 gene modulate N-type channel function in nociceptors, leading to a change in morphine analgesia. Exon 37a (e37a) enhances μ-opioid receptor-mediated inhibition of N-type calcium channels by promoting activity-independent inhibition. In the absence of e37a, spinal morphine analgesia is weakened in vivo but the basal response to noxious thermal stimuli is not altered. Our data suggest that highly specialized, discrete cellular responsiveness in vivo can be attributed to alternative splicing events regulated at the level of individual neurons.

Alternative Splicing of MBD2 Supports Self-Renewal in Human Pluripotent Stem Cells

Science.gov (United States)

Lu, Yu; Loh, Yuin-Han; Li, Hu; Cesana, Marcella; Ficarro, Scott B.; Parikh, Jignesh R.; Salomonis, Nathan; Toh, Cheng-Xu Delon; Andreadis, Stelios T.; Luckey, C. John; Collins, James J.; Daley, George Q.; Marto, Jarrod A.

2014-01-01

Summary Alternative RNA splicing (AS) regulates proteome diversity, including isoform-specific expression of several pluripotency genes. Here, we integrated global gene expression and proteomic analyses and identified a molecular signature suggesting a central role for AS in maintaining human pluripotent stem cell (hPSC) self-renewal. We demonstrate the splicing factor SFRS2 is an OCT4 target gene required for pluripotency. SFRS2 regulates AS of the methyl-CpG-binding protein MBD2, whose isoforms play opposing roles in maintenance of, and reprogramming to, pluripotency. While both MDB2a and MBD2c are enriched at the OCT4 and NANOG promoters, MBD2a preferentially interacts with repressive NuRD chromatin remodeling factors and promotes hPSC differentiation, whereas overexpression of MBD2c enhances reprogramming of fibroblasts to pluripotency. The miR-301 and miR-302 families provide additional regulation by targeting SFRS2 and MDB2a. These data suggest that OCT4, SFRS2, and MBD2 participate in a positive feedback loop, regulating proteome diversity complexity in support of hPSC self-renewal and reprogramming. PMID:24813856

Simulation-Based Analysis of the Potential of Alternative Fuels towards Reducing CO2 Emissions from Aviation

Directory of Open Access Journals (Sweden)

Karsten Kieckhäfer

2018-01-01

Full Text Available The mid-term framework of global aviation is shaped by air travel demand growth rates of 2–5% p.a. and ambitious targets to reduce aviation-related CO2 emissions by up to 50% until 2050. Alternative jet fuels such as bio- or electrofuels can be considered as a potential means towards low-emission aviation. While these fuels offer significant emission reduction potential, their market success depends on manifold influencing factors like the maturity of the production technology or the development of the price of conventional jet fuel. To study the potential for adoption of alternative jet fuels in aviation and the extent to which alternative fuels can contribute to the reduction targets, we deploy a System Dynamics approach. The results indicate that the adoption of alternative fuels and therefore their potential towards low-emissions aviation is rather limited in most scenarios considered since current production processes do not allow for competitive prices compared to conventional jet fuel. This calls for the development of new production processes that allow for economic feasibility of converting biomass or hydrogen into drop-in fuels as well as political measures to promote the adoption of alternative fuels.

Global restriction of using antibiotic growth promoters and alternative strategies in poultry production.

Science.gov (United States)

Salim, Hossan Md; Huque, Khan Shahidul; Kamaruddin, Kazi M; Beg, M D Anwarul Haque

2018-03-01

A growing global concern of antibiotic use in poultry diets due to its potential adverse effects on birds and human health, food safety and the environment has led to a complete ban or restricted use in some countries, and, at the same time, expanding options for the use of alternative feed additives. Multiple, rather than a single additive may replace antibiotic growth promoters (AGPs) in poultry. Blending of feeding additives and hygienic farm management, vaccination and biosecurity may help achieve good intestinal health, stabilise enteric ecosystems and result in sustainable and cost effective production performance of birds. Moreover, controlling unsolicited ingredients at the production level must have the support of different markets responsible for the supply of safe and quality poultry products for consumers. This requires the further increase and diversification of value added poultry products and the expansion of their markets through strategic planning and gradual limitation of live bird markets. More research is warranted in order to explore suitable, reliable and cost effective alternatives to AGPs for commercial use, and strategic poultry value chain development.

Potential of three microbial bio-effectors to promote maize growth and nutrient acquisition from alternative phosphorous fertilizers in contrasting soils

DEFF Research Database (Denmark)

Thonar, Cécile; Lekfeldt, Jonas Duus Stevens; Cozzolino, Vincenza

2017-01-01

results were mostly obtained with BEs in combination with organic fertilizers such as composted animal manures, fresh digestate of organic wastes, and sewage sludge. In only one experiment, the nutrient use efficiency of mineral recycling fertilizers was improved by BE inoculation. Conclusions......Background: Agricultural production is challenged by the limitation of non-renewable resources. Alternative fertilizers are promoted but they often have a lower availability of key macronutrients, especially phosphorus (P). Biological inoculants, the so-called bio-effectors (BEs), may be combined...... with these fertilizers to improve the nutrient use efficiency. Methods: The goal of this study was to assess the potential of three BEs in combination with alternative fertilizers (e.g., composted manure, biogas digestate, green compost) to promote plant growth and nutrient uptake in soils typical for various European...

Promotion of atomic hydrogen recombination as an alternative to electron trapping for the role of metals in the photocatalytic production of H2.

Science.gov (United States)

Joo, Ji Bong; Dillon, Robert; Lee, Ilkeun; Yin, Yadong; Bardeen, Christopher J; Zaera, Francisco

2014-06-03

The production of hydrogen from water with semiconductor photocatalysts can be promoted by adding small amounts of metals to their surfaces. The resulting enhancement in photocatalytic activity is commonly attributed to a fast transfer of the excited electrons generated by photon absorption from the semiconductor to the metal, a step that prevents deexcitation back to the ground electronic state. Here we provide experimental evidence that suggests an alternative pathway that does not involve electron transfer to the metal but requires it to act as a catalyst for the recombination of the hydrogen atoms made via the reduction of protons on the surface of the semiconductor instead.

Prevention of adenosine A2A receptor activation diminishes beat-to-beat alternation in human atrial myocytes.

Science.gov (United States)

Molina, Cristina E; Llach, Anna; Herraiz-Martínez, Adela; Tarifa, Carmen; Barriga, Montserrat; Wiegerinck, Rob F; Fernandes, Jacqueline; Cabello, Nuria; Vallmitjana, Alex; Benitéz, Raúl; Montiel, José; Cinca, Juan; Hove-Madsen, Leif

2016-01-01

Atrial fibrillation (AF) has been associated with increased spontaneous calcium release from the sarcoplasmic reticulum and linked to increased adenosine A2A receptor (A2AR) expression and activation. Here we tested whether this may favor atrial arrhythmogenesis by promoting beat-to-beat alternation and irregularity. Patch-clamp and confocal calcium imaging was used to measure the beat-to-beat response of the calcium current and transient in human atrial myocytes. Responses were classified as uniform, alternating or irregular and stimulation of Gs-protein coupled receptors decreased the frequency where a uniform response could be maintained from 1.0 ± 0.1 to 0.6 ± 0.1 Hz; p < 0.01 for beta-adrenergic receptors and from 1.4 ± 0.1 to 0.5 ± 0.1 Hz; p < 0.05 for A2ARs. The latter was linked to increased spontaneous calcium release and after-depolarizations. Moreover, A2AR activation increased the fraction of non-uniformly responding cells in HL-1 myocyte cultures from 19 ± 3 to 51 ± 9 %; p < 0.02, and electrical mapping in perfused porcine atria revealed that adenosine induced electrical alternans at longer cycle lengths, doubled the fraction of electrodes showing alternation, and increased the amplitude of alternations. Importantly, protein kinase A inhibition increased the highest frequency where uniform responses could be maintained from 0.84 ± 0.12 to 1.86 ± 0.11 Hz; p < 0.001 and prevention of A2AR-activation with exogenous adenosine deaminase selectively increased the threshold from 0.8 ± 0.1 to 1.2 ± 0.1 Hz; p = 0.001 in myocytes from patients with AF. In conclusion, A2AR-activation promotes beat-to-beat irregularities in the calcium transient in human atrial myocytes, and prevention of A2AR activation may be a novel means to maintain uniform beat-to-beat responses at higher beating frequencies in patients with atrial fibrillation.

FMDP Reactor Alternative Summary Report: Volume 2 - CANDU heavy water reactor alternative

International Nuclear Information System (INIS)

Greene, S.R.; Spellman, D.J.; Bevard, B.B.

1996-09-01

The Department of Energy Office of Fissile Materials Disposition (DOE/MD) initiated a detailed analysis activity to evaluate each of ten plutonium disposition alternatives that survived an initial screening process. This document, Volume 2 of a four volume report, summarizes the results of these analyses for the CANDU reactor based plutonium disposition alternative

FMDP Reactor Alternative Summary Report: Volume 2 - CANDU heavy water reactor alternative

Energy Technology Data Exchange (ETDEWEB)

Greene, S.R.; Spellman, D.J.; Bevard, B.B. [and others

1996-09-01

The Department of Energy Office of Fissile Materials Disposition (DOE/MD) initiated a detailed analysis activity to evaluate each of ten plutonium disposition alternatives that survived an initial screening process. This document, Volume 2 of a four volume report, summarizes the results of these analyses for the CANDU reactor based plutonium disposition alternative.

Novel P2 promoter-derived HNF4α isoforms with different N-terminus generated by alternate exon insertion

International Nuclear Information System (INIS)

Huang, Jianmin; Levitsky, Lynne L.; Rhoads, David B.

2009-01-01

Hepatocyte nuclear factor 4α (HNF4α) is a critical transcription factor for pancreas and liver development and functions in islet β cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4α variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4α variants designated HNF4α10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4α10-α12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding α7-α9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4α10-α12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4α than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4α mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

Novel P2 promoter-derived HNF4{alpha} isoforms with different N-terminus generated by alternate exon insertion

Energy Technology Data Exchange (ETDEWEB)

Huang, Jianmin, E-mail: jmhuang@partners.org [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Levitsky, Lynne L. [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Rhoads, David B., E-mail: rhoads@helix.mgh.harvard.edu [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States)

2009-04-15

Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

Promoting functional foods as acceptable alternatives to doping: potential for information-based social marketing approach.

Science.gov (United States)

James, Ricky; Naughton, Declan P; Petróczi, Andrea

2010-11-10

Substances with performance enhancing properties appear on a continuum, ranging from prohibited performance enhancing drugs (PED) through dietary supplements to functional foods (FF). Anti-doping messages designed to dissuade athletes from using PEDs have been typically based on moralising sport competition and/or employing scare campaigns with focus on the negative consequences. Campaigns offering comparable and acceptable alternatives are nonexistent, nor are athletes helped in finding these for themselves. It is timely that social marketing strategies for anti-doping prevention and intervention incorporate media messages that complement the existing approaches by promoting comparable and acceptable alternatives to doping. To facilitate this process, the aim of this study was to ascertain whether a single exposure knowledge-based information intervention led to increased knowledge and subsequently result in changes in beliefs and automatic associations regarding performance enhancements. In a repeated measure design, 115 male recreational gym users were recruited and provided with a brief information pamphlet on nitrite/nitrate and erythropoietin as a comparison. Measures of knowledge, beliefs and automatic associations were taken before and after the intervention with at least 24 hours between the two assessments. The psychological tests included explicit measures of beliefs and cognitive attitudes toward FF and PED using a self-reported questionnaire and computerised assessments of automatic associations using the modified and shortened version of the Implicit Association Test. The information based intervention significantly increased knowledge (p social marketing campaigns for drug free sport should follow appropriate market segmentation and use targeted messages via promoting the natural form as opposed to the purified form of the main active ingredient.

Amino-termini isoforms of the Slack K+ channel, regulated by alternative promoters, differentially modulate rhythmic firing and adaptation.

Science.gov (United States)

Brown, Maile R; Kronengold, Jack; Gazula, Valeswara-Rao; Spilianakis, Charalampos G; Flavell, Richard A; von Hehn, Christian A A; Bhattacharjee, Arin; Kaczmarek, Leonard K

2008-11-01

The rates of activation and unitary properties of Na+-activated K+ (K(Na)) currents have been found to vary substantially in different types of neurones. One class of K(Na) channels is encoded by the Slack gene. We have now determined that alternative RNA splicing gives rise to at least five different transcripts for Slack, which produce Slack channels that differ in their predicted cytoplasmic amino-termini and in their kinetic properties. Two of these, termed Slack-A channels, contain an amino-terminus domain closely resembling that of another class of K(Na) channels encoded by the Slick gene. Neuronal expression of Slack-A channels and of the previously described Slack isoform, now called Slack-B, are driven by independent promoters. Slack-A mRNAs were enriched in the brainstem and olfactory bulb and detected at significant levels in four different brain regions. When expressed in CHO cells, Slack-A channels activate rapidly upon depolarization and, in single channel recordings in Xenopus oocytes, are characterized by multiple subconductance states with only brief transient openings to the fully open state. In contrast, Slack-B channels activate slowly over hundreds of milliseconds, with openings to the fully open state that are approximately 6-fold longer than those for Slack-A channels. In numerical simulations, neurones in which outward currents are dominated by a Slack-A-like conductance adapt very rapidly to repeated or maintained stimulation over a wide range of stimulus strengths. In contrast, Slack-B currents promote rhythmic firing during maintained stimulation, and allow adaptation rate to vary with stimulus strength. Using an antibody that recognizes all amino-termini isoforms of Slack, Slack immunoreactivity is present at locations that have no Slack-B-specific staining, including olfactory bulb glomeruli and the dendrites of hippocampal neurones, suggesting that Slack channels with alternate amino-termini such as Slack-A channels are present at

22 CFR 101.2 - Promotion of American interests.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Promotion of American interests. 101.2 Section... FUNCTIONS § 101.2 Promotion of American interests. Officers of the Foreign Service shall further the.... (g) By taking appropriate steps to facilitate the promotion of such import trade into the United...

Intrasplicing coordinates alternative first exons with alternative splicing in the protein 4.1R gene

Energy Technology Data Exchange (ETDEWEB)

Conboy, John G.; Parra, Marilyn K.; Tan, Jeff S.; Mohandas, Narla; Conboy, John G.

2008-11-07

In the protein 4.1R gene, alternative first exons splice differentially to alternative 3' splice sites far downstream in exon 2'/2 (E2'/2). We describe a novel intrasplicing mechanism by which exon 1A (E1A) splices exclusively to the distal E2'/2 acceptor via two nested splicing reactions regulated by novel properties of exon 1B (E1B). E1B behaves as an exon in the first step, using its consensus 5' donor to splice to the proximal E2'/2 acceptor. A long region of downstream intron is excised, juxtaposing E1B with E2'/2 to generate a new composite acceptor containing the E1B branchpoint/pyrimidine tract and E2 distal 3' AG-dinucleotide. Next, the upstream E1A splices over E1B to this distal acceptor, excising the remaining intron plus E1B and E2' to form mature E1A/E2 product. We mapped branch points for both intrasplicing reactions and demonstrated that mutation of the E1B 5' splice site or branchpoint abrogates intrasplicing. In the 4.1R gene, intrasplicing ultimately determines N-terminal protein structure and function. More generally, intrasplicing represents a new mechanism whereby alternative promoters can be coordinated with downstream alternative splicing.

5 CFR 2423.2 - Alternative Dispute Resolution (ADR) services.

Science.gov (United States)

2010-01-01

... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Alternative Dispute Resolution (ADR) services. 2423.2 Section 2423.2 Administrative Personnel FEDERAL LABOR RELATIONS AUTHORITY, GENERAL COUNSEL... Filing, Investigating, Resolving, and Acting on Charges § 2423.2 Alternative Dispute Resolution (ADR...

Treatment, promotion, commotion: Antibiotic alternatives in food-producing animals

Science.gov (United States)

Alternatives to antibiotics in animal agriculture are urgently needed but present a complex problem because of their various uses: disease treatment, disease prevention, and feed efficiency improvement. Numerous antibiotic alternatives, such as feed amended with pre- and probiotics, have been propos...

Influenza Polymerase Can Adopt an Alternative Configuration Involving a Radical Repacking of PB2 Domains.

Science.gov (United States)

Thierry, Eric; Guilligay, Delphine; Kosinski, Jan; Bock, Thomas; Gaudon, Stephanie; Round, Adam; Pflug, Alexander; Hengrung, Narin; El Omari, Kamel; Baudin, Florence; Hart, Darren J; Beck, Martin; Cusack, Stephen

2016-01-07

Influenza virus polymerase transcribes or replicates the segmented RNA genome (vRNA) into respectively viral mRNA or full-length copies and initiates RNA synthesis by binding the conserved 3' and 5' vRNA ends (the promoter). In recent structures of promoter-bound polymerase, the cap-binding and endonuclease domains are configured for cap snatching, which generates capped transcription primers. Here, we present a FluB polymerase structure with a bound complementary cRNA 5' end that exhibits a major rearrangement of the subdomains within the C-terminal two-thirds of PB2 (PB2-C). Notably, the PB2 nuclear localization signal (NLS)-containing domain translocates ∼90 Å to bind to the endonuclease domain. FluA PB2-C alone and RNA-free FluC polymerase are similarly arranged. Biophysical and cap-dependent endonuclease assays show that in solution the polymerase explores different conformational distributions depending on which RNA is bound. The inherent flexibility of the polymerase allows it to adopt alternative conformations that are likely important during polymerase maturation into active progeny RNPs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Alternative detox.

Science.gov (United States)

Ernst, E

2012-01-01

The concept that alternative therapies can eliminate toxins and toxicants from the body, i.e. 'alternative detox' (AD) is popular. Selected textbooks and articles on the subject of AD. The principles of AD make no sense from a scientific perspective and there is no clinical evidence to support them. The promotion of AD treatments provides income for some entrepreneurs but has the potential to cause harm to patients and consumers. In alternative medicine, simplistic but incorrect concepts such as AD abound. AREAS TIMELY FOR RESEARCH: All therapeutic claims should be scientifically tested before being advertised-and AD cannot be an exception.

Expression of scavenger receptor‐AI promotes alternative activation of murine macrophages to limit hepatic inflammation and fibrosis

Science.gov (United States)

Labonte, Adam C.; Sung, Sun‐Sang J.; Jennelle, Lucas T.; Dandekar, Aditya P.

2016-01-01

The liver maintains an immunologically tolerant environment as a result of continuous exposure to food and bacterial constituents from the digestive tract. Hepatotropic pathogens can take advantage of this niche and establish lifelong chronic infections causing hepatic fibrosis and hepatocellular carcinoma. Macrophages (Mϕ) play a critical role in regulation of immune responses to hepatic infection and regeneration of tissue. However, the factors crucial for Mϕ in limiting hepatic inflammation or resolving liver damage have not been fully understood. In this report, we demonstrate that expression of C‐type lectin receptor scavenger receptor‐AI (SR‐AI) is crucial for promoting M2‐like Mϕ activation and polarization during hepatic inflammation. Liver Mϕ uniquely up‐regulated SR‐AI during hepatotropic viral infection and displayed increased expression of alternative Mϕ activation markers, such as YM‐1, arginase‐1, and interleukin‐10 by activation of mer receptor tyrosine kinase associated with inhibition of mammalian target of rapamycin. Expression of these molecules was reduced on Mϕ obtained from livers of infected mice deficient for the gene encoding SR‐AI (msr1). Furthermore, in vitro studies using an SR‐AI‐deficient Mϕ cell line revealed impeded M2 polarization and decreased phagocytic capacity. Direct stimulation with virus was sufficient to activate M2 gene expression in the wild‐type (WT) cell line, but not in the knockdown cell line. Importantly, tissue damage and fibrosis were exacerbated in SR‐AI–/– mice following hepatic infection and adoptive transfer of WT bone‐marrow–derived Mϕ conferred protection against fibrosis in these mice. Conclusion: SR‐AI expression on liver Mϕ promotes recovery from infection‐induced tissue damage by mediating a switch to a proresolving Mϕ polarization state. (Hepatology 2017;65:32‐43). PMID:27770558

What Next? Promoting Alternatives to Ability Grouping.

Science.gov (United States)

Wheelock, Anne; Hawley, Willis D.

1993-01-01

Suggests ways to eliminate ability grouping in the schools, and explores new alternatives to improve schooling for all students. Specific guidelines are given for the development of academically and racially heterogeneous schooling. The elimination of grouping practices that deny equal access to education is a goal worth pursuing. (SLD)

Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain

Science.gov (United States)

Salaheen, Serajus; Kim, Seon-Woo; Haley, Bradd J.; Van Kessel, Jo Ann S.; Biswas, Debabrata

2017-01-01

Antibiotic growth promoters (AGPs) are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE) from blueberry (Vaccinium corymbosum) and blackberry (Rubus fruticosus) pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial) in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline), or supplemented with 0.1 g Gallic acid equivalent (GAE)/L or 1.0 g GAE/L (during the last 72 h before euthanasia) of BPE for 6 weeks. When compared with the control group (water only), the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production. PMID:29123512

Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain

Directory of Open Access Journals (Sweden)

Serajus Salaheen

2017-10-01

Full Text Available Antibiotic growth promoters (AGPs are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE from blueberry (Vaccinium corymbosum and blackberry (Rubus fruticosus pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline, or supplemented with 0.1 g Gallic acid equivalent (GAE/L or 1.0 g GAE/L (during the last 72 h before euthanasia of BPE for 6 weeks. When compared with the control group (water only, the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production.

African American and Latino low income families' food shopping behaviors: promoting fruit and vegetable consumption and use of alternative healthy food options.

Science.gov (United States)

Fish, Caitlin A; Brown, Jonisha R; Quandt, Sara A

2015-04-01

Minority families often reside in neighborhoods with few supermarkets or alternative healthy food options (e.g., farmers markets, community gardens), making fresh produce difficult to obtain. This qualitative study identified factors influencing fruit and vegetable shopping and use of alternative healthy food options. Forty-eight minority women with children completed interviews regarding food shopping habits and use of and attitudes toward alternative healthy food options. Interviews were subjected to thematic analysis. Produce shopping was motivated by costs and family preferences. For African American women, poor cooking skills restricted the variety of fruits and vegetables purchased. Latinas were receptive to alternative healthy food options, but did not use them because these sources were inconvenient. African American women were not receptive to them. Improving cooking skills and perceptions of acceptable foods may be as important as increased access to promote greater consumption of fruits and vegetables.

Incentive policies for promoting wind power production in Brazil: Scenarios for the Alternative Energy Sources Incentive Program (PROINFA) under the New Brazilian electric power sector regulation

International Nuclear Information System (INIS)

Dutra, Ricardo Marques; Szklo, Alexandre Salem

2008-01-01

The Alternative Energy Sources Incentive Program (PROINFA) was designed in 2002 to stimulate the electricity generation from three energy sources (wind, biomass and small-scale hydro) in Brazil. The Program was divided into two phases. The first one uses feed-in tariffs for promoting the development of 3300 MW. The second one that was originally based on feed-in tariffs was modified in 2003, in order to be based on biddings for renewables. These biddings are capped to limit their impact on the final electricity tariff. Due to this bound, the highest-cost power option promoted by PROINFA (wind power generation) might have development problems. Simulating different scenarios for the biddings, it was verified that the only way to reach the original goal set by PROINFA (10% of the annual electricity consumption provided by alternative sources up to 2020) and, simultaneously, not overcome the bidding bound is to promote biomass-fired power generation alone, during the Program's second phase. However, this action contradicts one of the targets of the Program, which is to diversify the energy matrix. An alternative option could be biddings for renewables according to specific criteria (complementarities, industrial and technological development and cost), based not only on their cost-effectiveness. (author)

10 CFR 2.338 - Settlement of issues; alternative dispute resolution.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Settlement of issues; alternative dispute resolution. 2... alternative dispute resolution under paragraph (b) of this section. (b) Settlement judge; alternative dispute... alternative dispute resolution as the Commission may provide or to which the parties may agree. The order...

A charged residue at the subunit interface of PCNA promotes trimer formation by destabilizing alternate subunit interactions

International Nuclear Information System (INIS)

Freudenthal, Bret D.; Gakhar, Lokesh; Ramaswamy, S.; Washington, M. Todd

2009-01-01

Eukaryotic proliferating cell nuclear antigen (PCNA), an essential accessory factor in DNA replication and repair, is a ring-shaped homotrimer. A novel nontrimeric structure of E113G-mutant PCNA protein is reported, which shows that this protein forms alternate subunit interactions. It is concluded that the charged side chain of Glu113 promotes normal trimer formation by destabilizing these alternate subunit interactions. Eukaryotic proliferating cell nuclear antigen (PCNA) is an essential replication accessory factor that interacts with a variety of proteins involved in DNA replication and repair. Each monomer of PCNA has an N-terminal domain A and a C-terminal domain B. In the structure of the wild-type PCNA protein, domain A of one monomer interacts with domain B of a neighboring monomer to form a ring-shaped trimer. Glu113 is a conserved residue at the subunit interface in domain A. Two distinct X-ray crystal structures have been determined of a mutant form of PCNA with a substitution at this position (E113G) that has previously been studied because of its effect on translesion synthesis. The first structure was the expected ring-shaped trimer. The second structure was an unanticipated nontrimeric form of the protein. In this nontrimeric form, domain A of one PCNA monomer interacts with domain A of a neighboring monomer, while domain B of this monomer interacts with domain B of a different neighboring monomer. The B–B interface is stabilized by an antiparallel β-sheet and appears to be structurally similar to the A–B interface observed in the trimeric form of PCNA. The A–A interface, in contrast, is primarily stabilized by hydrophobic interactions. Because the E113G substitution is located on this hydrophobic surface, the A–A interface should be less favorable in the case of the wild-type protein. This suggests that the side chain of Glu113 promotes trimer formation by destabilizing these possible alternate subunit interactions

Influence of direct and alternating current electric fields on efficiency promotion and leaching risk alleviation of chelator assisted phytoremediation.

Science.gov (United States)

Luo, Jie; Cai, Limei; Qi, Shihua; Wu, Jian; Sophie Gu, Xiaowen

2018-03-01

Direct and alternating current electric fields with various voltages were used to improve the decontamination efficiency of chelator assisted phytoremediation for multi-metal polluted soil. The alleviation effect of electric field on leaching risk caused by chelator application during phytoremediation process was also evaluated. Biomass yield, pollutant uptake and metal leaching retardation under alternating current (AC) and direct current (DC) electric fields were compared. The biomass yield of Eucalyptus globulus under AC fields with various voltages (2, 4 and 10 V) were 3.91, 4.16 and 3.67kg, respectively, significantly higher than the chelator treatment without electric field (2.71kg). Besides growth stimulation, AC fields increased the metal concentrations of plant tissues especially in aerial parts manifested by the raised translocation factor of different metals. Direct current electric fields with low and moderate voltages increased the biomass production of the species to 3.45 and 3.12kg, respectively, while high voltage on the contrary suppressed the growth of the plants (2.66kg). Under DC fields, metal concentrations elevated obviously with increasing voltages and the metal translocation factors were similar under all voltages. Metal extraction per plant achieved the maximum value under moderate voltage due to the greatest biomass production. DC field with high voltage (10V) decreased the volume of leachate from the chelator treatment without electric field from 1224 to 56mL, while the leachate gathered from AC field treatments raised from 512 to 670mL. DC field can retard the downward movement of metals caused by chelator application more effectively relative to AC field due to the constant water flow and electroosmosis direction. Alternating current field had more promotive effect on chelator assisted phytoremediation efficiency than DC field illustrated by more metal accumulation in the species. However, with the consideration of leaching risk, DC

Cultural adaptation of preschool PATHS (Promoting Alternative Thinking Strategies) curriculum for Pakistani children.

Science.gov (United States)

Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira

2015-06-01

Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.

Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter

International Nuclear Information System (INIS)

Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.

2004-01-01

The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder

A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation

International Nuclear Information System (INIS)

Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A.; Delgado, F.; Alcaraz, Y.; FRobles, J.; Martinez A, M.

2014-01-01

An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, 1 H NMR and 13 C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)

Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter

Science.gov (United States)

Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.

2011-01-01

Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are

AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs

Science.gov (United States)

Exceptional Parent, 2011

2011-01-01

This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…

Promoting functional foods as acceptable alternatives to doping: potential for information-based social marketing approach

Directory of Open Access Journals (Sweden)

Petróczi Andrea

2010-11-01

Full Text Available Abstract Background Substances with performance enhancing properties appear on a continuum, ranging from prohibited performance enhancing drugs (PED through dietary supplements to functional foods (FF. Anti-doping messages designed to dissuade athletes from using PEDs have been typically based on moralising sport competition and/or employing scare campaigns with focus on the negative consequences. Campaigns offering comparable and acceptable alternatives are nonexistent, nor are athletes helped in finding these for themselves. It is timely that social marketing strategies for anti-doping prevention and intervention incorporate media messages that complement the existing approaches by promoting comparable and acceptable alternatives to doping. To facilitate this process, the aim of this study was to ascertain whether a single exposure knowledge-based information intervention led to increased knowledge and subsequently result in changes in beliefs and automatic associations regarding performance enhancements. Methods In a repeated measure design, 115 male recreational gym users were recruited and provided with a brief information pamphlet on nitrite/nitrate and erythropoietin as a comparison. Measures of knowledge, beliefs and automatic associations were taken before and after the intervention with at least 24 hours between the two assessments. The psychological tests included explicit measures of beliefs and cognitive attitudes toward FF and PED using a self-reported questionnaire and computerised assessments of automatic associations using the modified and shortened version of the Implicit Association Test. Results The information based intervention significantly increased knowledge (p p p Conclusion Evidence was found that even a single exposure to a persuasive positive message can lead to belief change and can create new or alter existing associations - but only in the specific domain. Interventions to change outcome expectations in a positive

Activity of platinum/carbon and palladium/carbon catalysts promoted by Ni2 P in direct ethanol fuel cells.

Science.gov (United States)

Li, Guoqiang; Feng, Ligang; Chang, Jinfa; Wickman, Björn; Grönbeck, Henrik; Liu, Changpeng; Xing, Wei

2014-12-01

Ethanol is an alternative fuel for direct alcohol fuel cells, in which the electrode materials are commonly based on Pt or Pd. Owing to the excellent promotion effect of Ni2 P that was found in methanol oxidation, we extended the catalyst system of Pt or Pd modified by Ni2 P in direct ethanol fuel cells. The Ni2 P-promoted catalysts were compared to commercial catalysts as well as to reference catalysts promoted with only Ni or only P. Among the studied catalysts, Pt/C and Pd/C modified by Ni2 P (30 wt %) showed both the highest activity and stability. Upon integration into the anode of a homemade direct ethanol fuel cell, the Pt-Ni2 P/C-30 % catalyst showed a maximum power density of 21 mW cm(-2) , which is approximately two times higher than that of a commercial Pt/C catalyst. The Pd-Ni2 P/C-30 % catalyst exhibited a maximum power density of 90 mW cm(-2) . This is approximately 1.5 times higher than that of a commercial Pd/C catalyst. The discharge stability on both two catalysts was also greatly improved over a 12 h discharge operation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Promoting physical activity among children and youth in disadvantaged South Australian CALD communities through alternative community sport opportunities.

Science.gov (United States)

Rosso, Edoardo; McGrath, Richard

2016-02-29

Issue addressed: Recently arrived migrants and refugees from a culturally and linguistically diverse background (CALD) may be particularly vulnerable to social exclusion. Participation in sport is endorsed as a vehicle to ease the resettlement process; however, in Australia, this is often thought as a simple matter of integration into existing sport structures (e.g. clubs). This approach fails to place actual community needs at the centre of sport engagement efforts. Methods: A consultation framework was established with South Australian CALD community leaders and organisations to scope needs for community-based alternatives to participation in traditional sport (e.g. clubs), co-design a suitable community sport program and pilot it in five communities. Interviews and questionnaire surveys were conducted with participants, community representatives, stakeholders and volunteers. Results: Regular, free soccer activities engaged 263 young people from a great variety of nationalities, including over 50% refugees, in secondary state school and community-based sites. Conclusion: Alternative community sport programs can provide a basic but valuable forum to promote physical activity and associated well being in CALD and refugee communities. So what?: Alternative approaches can extend the health benefits of sport participation to disadvantaged children and youth who are excluded from traditional sport participation opportunities.

Principles for RNA metabolism and alternative transcription initiation within closely spaced promoters

DEFF Research Database (Denmark)

Chen, Yun; Pai, Athma A; Herudek, Jan

2016-01-01

Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation s...... suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provide a framework with which evolution shapes transcriptomes.......Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation...

A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation

Energy Technology Data Exchange (ETDEWEB)

Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A. [Universidad de Guanajuato, Dapartamento de Quimica, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico); Delgado, F. [IPN, Escuela Nacional de Ciencias Biologicas, Departamento de Quimica Organica, Prol. Carpio y Plan de Ayala s/n, 11340 Mexico D. F. (Mexico); Alcaraz, Y.; FRobles, J.; Martinez A, M., E-mail: mvazquez@ugto.mx [Universidad de Guanajuato, Departamento de Farmacia, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico)

2014-10-01

An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, {sup 1}H NMR and {sup 13}C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)

Fip1 regulates mRNA alternative polyadenylation to promote stem cell self-renewal

Science.gov (United States)

Lackford, Brad; Yao, Chengguo; Charles, Georgette M; Weng, Lingjie; Zheng, Xiaofeng; Choi, Eun-A; Xie, Xiaohui; Wan, Ji; Xing, Yi; Freudenberg, Johannes M; Yang, Pengyi; Jothi, Raja; Hu, Guang; Shi, Yongsheng

2014-01-01

mRNA alternative polyadenylation (APA) plays a critical role in post-transcriptional gene control and is highly regulated during development and disease. However, the regulatory mechanisms and functional consequences of APA remain poorly understood. Here, we show that an mRNA 3′ processing factor, Fip1, is essential for embryonic stem cell (ESC) self-renewal and somatic cell reprogramming. Fip1 promotes stem cell maintenance, in part, by activating the ESC-specific APA profiles to ensure the optimal expression of a specific set of genes, including critical self-renewal factors. Fip1 expression and the Fip1-dependent APA program change during ESC differentiation and are restored to an ESC-like state during somatic reprogramming. Mechanistically, we provide evidence that the specificity of Fip1-mediated APA regulation depends on multiple factors, including Fip1-RNA interactions and the distance between APA sites. Together, our data highlight the role for post-transcriptional control in stem cell self-renewal, provide mechanistic insight on APA regulation in development, and establish an important function for APA in cell fate specification. PMID:24596251

Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress

Directory of Open Access Journals (Sweden)

Ou Shulin

2017-01-01

Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.

mTORC2 Promotes Tumorigenesis via Lipid Synthesis.

Science.gov (United States)

Guri, Yakir; Colombi, Marco; Dazert, Eva; Hindupur, Sravanth K; Roszik, Jason; Moes, Suzette; Jenoe, Paul; Heim, Markus H; Riezman, Isabelle; Riezman, Howard; Hall, Michael N

2017-12-11

Dysregulated mammalian target of rapamycin (mTOR) promotes cancer, but underlying mechanisms are poorly understood. We describe an mTOR-driven mouse model that displays hepatosteatosis progressing to hepatocellular carcinoma (HCC). Longitudinal proteomic, lipidomics, and metabolomic analyses revealed that hepatic mTORC2 promotes de novo fatty acid and lipid synthesis, leading to steatosis and tumor development. In particular, mTORC2 stimulated sphingolipid (glucosylceramide) and glycerophospholipid (cardiolipin) synthesis. Inhibition of fatty acid or sphingolipid synthesis prevented tumor development, indicating a causal effect in tumorigenesis. Increased levels of cardiolipin were associated with tubular mitochondria and enhanced oxidative phosphorylation. Furthermore, increased lipogenesis correlated with elevated mTORC2 activity and HCC in human patients. Thus, mTORC2 promotes cancer via formation of lipids essential for growth and energy production. Copyright © 2017 Elsevier Inc. All rights reserved.

Fox-2 Splicing Factor Binds to a Conserved Intron Motif to PromoteInclusion of Protein 4.1R Alternative Exon 16

Energy Technology Data Exchange (ETDEWEB)

Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo; Lersch,Robert A.; Gee, Sherry L.; Hou, Victor C.; Lo, Annie J.; Short, Sarah A.; Chasis, Joel A.; Winkelmann, John C.; Conboy, John G.

2006-03-01

Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding to the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.

GSTT2 promoter polymorphisms and colorectal cancer risk

Directory of Open Access Journals (Sweden)

Ahn Sun-A

2007-01-01

Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.

Regional alternative transportation evaluation report - region 2

Science.gov (United States)

2012-03-01

The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe : Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 2, : which is comprised of Arizona, Oklahoma, New Mexic...

Alternatives to Nuclear Power in Romania

International Nuclear Information System (INIS)

Andrei, L.; Manea, Gh.

1996-01-01

The paper proposes alternatives to nuclear power generation in Romania. The priorities are: improvement of efficiency in producing, transmission, and energy use; promoting the renewable resources of energy, especially of hydroelectric power; restructuring industry under criteria of power consumption efficiency; commercial purposes from horizontal nuclear sector activity in Romania. There are described the causes behind the energy crisis in Romania and present energy policy solutions to it. (author). 2 tabs., 10 refs

Ameloginins promote an alternatively activated macrophage phenotype in vitro

DEFF Research Database (Denmark)

Almqvist, S; Werthen, M; Lyngstadas, SP

2011-01-01

aggregates were visualised by transmission electron microscopy. The amelogenin treatment of macrophages increased several pro- and anti-inflammatory cytokines, including alternative macrophage activation marker AMAC-1 (p

Histone demethylase JMJD1A promotes alternative splicing of AR variant 7 (AR-V7) in prostate cancer cells.

Science.gov (United States)

Fan, Lingling; Zhang, Fengbo; Xu, Songhui; Cui, Xiaolu; Hussain, Arif; Fazli, Ladan; Gleave, Martin; Dong, Xuesen; Qi, Jianfei

2018-05-15

Formation of the androgen receptor splicing variant 7 (AR-V7) is one of the major mechanisms by which resistance of prostate cancer to androgen deprivation therapy occurs. The histone demethylase JMJD1A (Jumonji domain containing 1A) functions as a key coactivator for AR by epigenetic regulation of H3K9 methylation marks. Here, we describe a role for JMJD1A in AR-V7 expression. While JMJD1A knockdown had no effect on full-length AR (AR-FL), it reduced AR-V7 levels in prostate cancer cells. Reexpression of AR-V7 in the JMJD1A-knockdown cells elevated expression of select AR targets and partially rescued prostate cancer cell growth in vitro and in vivo. The AR-V7 protein level correlated positively with JMJD1A in a subset of human prostate cancer specimens. Mechanistically, we found that JMJD1A promoted alternative splicing of AR-V7 through heterogeneous nuclear ribonucleoprotein F (HNRNPF), a splicing factor known to regulate exon inclusion. Knockdown of JMJD1A or HNRNPF inhibited splicing of AR-V7, but not AR-FL, in a minigene reporter assay. JMJD1A was found to interact with and promote the recruitment of HNRNPF to a cryptic exon 3b on AR pre-mRNA for the generation of AR-V7. Taken together, the role of JMJD1A in AR-FL coactivation and AR-V7 alternative splicing highlights JMJD1A as a potentially promising target for prostate cancer therapy.

Genome-wide identification of hypoxia-inducible factor-1 and -2 binding sites in hypoxic human macrophages alternatively activated by IL-10.

Science.gov (United States)

Tausendschön, Michaela; Rehli, Michael; Dehne, Nathalie; Schmidl, Christian; Döring, Claudia; Hansmann, Martin-Leo; Brüne, Bernhard

2015-01-01

Macrophages (MΦ) often accumulate in hypoxic areas, where they significantly influence disease progression. Anti-inflammatory cytokines, such as IL-10, generate alternatively activated macrophages that support tumor growth. To understand how alternative activation affects the transcriptional profile of hypoxic macrophages, we globally mapped binding sites of hypoxia-inducible factor (HIF)-1α and HIF-2α in primary human monocyte-derived macrophages prestimulated with IL-10. 713 HIF-1 and 795 HIF-2 binding sites were identified under hypoxia. Pretreatment with IL-10 altered the binding pattern, with 120 new HIF-1 and 188 new HIF-2 binding sites emerging. HIF-1 binding was most prominent in promoters, while HIF-2 binding was more abundant in enhancer regions. Comparison of ChIP-seq data obtained in other cells revealed a highly cell type specific binding of HIF. In MΦ HIF binding occurred preferentially in already active enhancers or promoters. To assess the roles of HIF on gene expression, primary human macrophages were treated with siRNA against HIF-1α or HIF-2α, followed by genome-wide gene expression analysis. Comparing mRNA expression to the HIF binding profile revealed a significant enrichment of hypoxia-inducible genes previously identified by ChIP-seq. Analysis of gene expression under hypoxia alone and hypoxia/IL-10 showed the enhanced induction of a set of genes including PLOD2 and SLC2A3, while another group including KDM3A and ADM remained unaffected or was reduced by IL-10. Taken together IL-10 influences the DNA binding pattern of HIF and the level of gene induction. Copyright © 2014 Elsevier B.V. All rights reserved.

Immunohistochemistry and alternative FISH testing in breast cancer with HER2 equivocal amplification.

Science.gov (United States)

Agersborg, Sally; Mixon, Christopher; Nguyen, Thanh; Aithal, Sramila; Sudarsanam, Sucha; Blocker, Forrest; Weiss, Lawrence; Gasparini, Robert; Jiang, Shiping; Chen, Wayne; Hess, Gregory; Albitar, Maher

2018-03-22

While HER2 testing is well established in directing appropriate treatment for breast cancer, a small percentage of cases show equivocal results by immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). Alternative probes may be used in equivocal cases. We present a single community-based institution's experience in further evaluating these cases. Between 2014 and 2016, 4255 samples were submitted for HER2 amplification testing by alternative probes, TP53, RAI1, and RARA. Of the patients tested by FISH, 505/3908 (12.9%) also had IHC data. Most (73.9%) FISH equivocal cases remained equivocal after IHC testing. However, 50.5% of equivocal cases were classified as HER2 amplified by alternative probes. Most cases were positive by more than one probe: 78% of positive cases by RAI1 and 73.9% by TP53. There was a significant difference between IHC and FISH alternative testing (p alternative FISH testing. Available data showed that 41% of patients were treated with palbociclib and were positive by alternative FISH. The prevalence of double HER2 equivocal cases and the discrepancy between IHC and alternative FISH testing suggest that FISH alternative testing using both RAI1 and TP53 probes is necessary for conclusive classification. Because almost half of FISH equivocal cases converted to HER2 amplified upon alternative testing, clinical studies to determine the benefit of anti-HER2 therapy in these patients are urgently needed.

Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

DEFF Research Database (Denmark)

Møller, A M; Jensen, N M; Pildal, J

2001-01-01

This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...

Promoting Scientific Thinking and Conceptual Change about Alternative Explanations of Climate Change and Other Controversial Socio-scientific Topics

Science.gov (United States)

Lombardi, D.; Sinatra, G. M.

2013-12-01

Critical evaluation and plausibility reappraisal of scientific explanations have been underemphasized in many science classrooms (NRC, 2012). Deep science learning demands that students increase their ability to critically evaluate the quality of scientific knowledge, weigh alternative explanations, and explicitly reappraise their plausibility judgments. Therefore, this lack of instruction about critical evaluation and plausibility reappraisal has, in part, contributed to diminished understanding about complex and controversial topics, such as global climate change. The Model-Evidence Link (MEL) diagram (originally developed by researchers at Rutgers University under an NSF-supported project; Chinn & Buckland, 2012) is an instructional scaffold that promotes students to critically evaluate alternative explanations. We recently developed a climate change MEL and found that the students who used the MEL experienced a significant shift in their plausibility judgments toward the scientifically accepted model of human-induced climate change. Using the MEL for instruction also resulted in conceptual change about the causes of global warming that reflected greater understanding of fundamental scientific principles. Furthermore, students sustained this conceptual change six months after MEL instruction (Lombardi, Sinatra, & Nussbaum, 2013). This presentation will discuss recent educational research that supports use of the MEL to promote critical evaluation, plausibility reappraisal, and conceptual change, and also, how the MEL may be particularly effective for learning about global climate change and other socio-scientific topics. Such instruction to develop these fundamental thinking skills (e.g., critical evaluation and plausibility reappraisal) is demanded by both the Next Generation Science Standards (Achieve, 2013) and the Common Core State Standards for English Language Arts and Mathematics (CCSS Initiative-ELA, 2010; CCSS Initiative-Math, 2010), as well as a

Jamming Attack in Wireless Sensor Network: From Time to Space

Science.gov (United States)

Sun, Yanqiang; Wang, Xiaodong; Zhou, Xingming

Classical jamming attack models in the time domain have been proposed, such as constant jammer, random jammer, and reactive jammer. In this letter, we consider a new problem: given k jammers, how does the attacker minimize the pair-wise connectivity among the nodes in a Wireless Sensor Network (WSN)? We call this problem k-Jammer Deployment Problem (k-JDP). To the best of our knowledge, this is the first attempt at considering the position-critical jamming attack against wireless sensor network. We mainly make three contributions. First, we prove that the decision version of k-JDP is NP-complete even in the ideal situation where the attacker has full knowledge of the topology information of sensor network. Second, we propose a mathematical formulation based on Integer Programming (IP) model which yields an optimal solution. Third, we present a heuristic algorithm HAJDP, and compare it with the IP model. Numerical results show that our heuristic algorithm is computationally efficient.

Cyclooxygenase 2 Promotes Parathyroid Hyperplasia in ESRD

Science.gov (United States)

Zhang, Qian; Qiu, Junsi; Li, Haiming; Lu, Yanwen; Wang, Xiaoyun; Yang, Junwei; Wang, Shaoqing; Zhang, Liyin; Gu, Yong; Hao, Chuan-Ming

2011-01-01

Hyperplasia of the PTG underlies the secondary hyperparathyroidism (SHPT) observed in CKD, but the mechanism underlying this hyperplasia is incompletely understood. Because aberrant cyclooxygenase 2 (COX2) expression promotes epithelial cell proliferation, we examined the effects of COX2 on the parathyroid gland in uremia. In patients with ESRD who underwent parathyroidectomy, clusters of cells within the parathyroid glands had increased COX2 expression. Some COX2-positive cells exhibited two nuclei, consistent with proliferation. Furthermore, nearly 78% of COX2-positive cells expressed proliferating cell nuclear antigen (PCNA). In the 5/6-nephrectomy rat model, rats fed a high-phosphate diet had significantly higher serum PTH levels and larger parathyroid glands than sham-operated rats. Compared with controls, the parathyroid glands of uremic rats exhibited more PCNA-positive cells and greater COX2 expression in the chief cells. Treatment with COX2 inhibitor celecoxib significantly reduced PCNA expression, attenuated serum PTH levels, and reduced the size of the glands. In conclusion, COX2 promotes the pathogenesis of hyperparathyroidism in ESRD, suggesting that inhibiting the COX2 pathway could be a potential therapeutic target. PMID:21335517

Integrating Complementary and Alternative Medicine Into Conventional Health Care System in Developing Countries

DEFF Research Database (Denmark)

Mishra, Shiva Raj; Neupane, Dinesh; Kallestrup, Per

2015-01-01

Complementary and alternative medicine has been a part of human life and practices since the beginning of time. The role of complementary and alternative medicine for the health of humans is undisputed particularly in light of its role in health promotion and well-being. This article discusses wa...... through which complementary and alternative medicine can be promoted and sustained as an integrated element of health care in developing countries. We specifically present the exemplary of Amchi traditional doctors of Northern Himalayas......Complementary and alternative medicine has been a part of human life and practices since the beginning of time. The role of complementary and alternative medicine for the health of humans is undisputed particularly in light of its role in health promotion and well-being. This article discusses ways...

Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

Energy Technology Data Exchange (ETDEWEB)

Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

1994-09-01

The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

Identification of functional DNA variants in the constitutive promoter region of MDM2

Directory of Open Access Journals (Sweden)

Lalonde Marie-Eve

2012-09-01

Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

Long-term-consequence analysis of no action alternative 2

International Nuclear Information System (INIS)

Buck, J.W.; Bagaasen, L.M.; Staven, L.H.; Serne, R.J.

1996-07-01

This report is a supplement to the Waste Isolation Pilot Plant (WIPP) Disposal-Phase Supplemental Environmental Impact Statement. Data and information is described which pertains to estimated impacts from postulated long-term release of radionuclides and hazardous constituents from alpha-bearing wastes stored at major generator/storage sites after loss of institutional control (no action alternative 2). Under this alternative, wastes would remain at the generator sites and not be emplaced at WIPP

The "I" in us, or the eye on us? Regulatory focus, commitment and derogation of an attractive alternative person.

Directory of Open Access Journals (Sweden)

David Rodrigues

Full Text Available When individuals are highly committed to their romantic relationship, they are more likely to engage in pro-relationship maintenance mechanisms. The present research expanded on the notion that commitment redirects self-oriented goals to consider broader relational goals and examined whether commitment interacts with a promotion and prevention focus to activate derogation of attractive alternatives. Three studies used cross-sectional and experimental approaches. Study 1 showed that romantically involved individuals predominantly focused on promotion, but not prevention, reported less initial attraction to an attractive target than single individuals, especially when highly committed to their relationship. Study 2 showed that romantically involved individuals induced in a promotion focus, compared to those in prevention focus, reported less initial attraction, but only when more committed to their relationship. Regardless of regulatory focus manipulation, more committed individuals were also less likely to perceive quality among alternative scenarios and to be attentive to alternative others in general. Finally, Study 3 showed that romantically involved individuals induced in promotion focus and primed with high commitment reported less initial attraction, than those primed with low commitment, or than those induced in prevention focus. Once again, for these latter no differences occurred according to commitment prime. Together, the findings suggest that highly committed promotion focused individuals consider broader relationship goals and activate relationship maintenance behaviors such as derogation of attractive alternatives to promote their relationship.

The "I" in us, or the eye on us? Regulatory focus, commitment and derogation of an attractive alternative person.

Science.gov (United States)

Rodrigues, David; Lopes, Diniz; Kumashiro, Madoka

2017-01-01

When individuals are highly committed to their romantic relationship, they are more likely to engage in pro-relationship maintenance mechanisms. The present research expanded on the notion that commitment redirects self-oriented goals to consider broader relational goals and examined whether commitment interacts with a promotion and prevention focus to activate derogation of attractive alternatives. Three studies used cross-sectional and experimental approaches. Study 1 showed that romantically involved individuals predominantly focused on promotion, but not prevention, reported less initial attraction to an attractive target than single individuals, especially when highly committed to their relationship. Study 2 showed that romantically involved individuals induced in a promotion focus, compared to those in prevention focus, reported less initial attraction, but only when more committed to their relationship. Regardless of regulatory focus manipulation, more committed individuals were also less likely to perceive quality among alternative scenarios and to be attentive to alternative others in general. Finally, Study 3 showed that romantically involved individuals induced in promotion focus and primed with high commitment reported less initial attraction, than those primed with low commitment, or than those induced in prevention focus. Once again, for these latter no differences occurred according to commitment prime. Together, the findings suggest that highly committed promotion focused individuals consider broader relationship goals and activate relationship maintenance behaviors such as derogation of attractive alternatives to promote their relationship.

Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor

Energy Technology Data Exchange (ETDEWEB)

Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)

2007-11-30

Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.

H2A/K pseudogene mutation may promote cell proliferation

Energy Technology Data Exchange (ETDEWEB)

Guo, Jisheng; Jing, Ruirui; Lv, Xin; Wang, Xiaoyue; Li, Junqiang; Li, Lin; Li, Cuiling; Wang, Daoguang; Bi, Baibing; Chen, Xinjun [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Yang, Jing-Hua, E-mail: sdu_crc_group1@126.com [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Department of Surgery, VA Boston Healthcare System, Boston University School of Medicine, Boston 510660, MA (United States)

2016-05-15

Highlights: • The mutant H2A/K pseudogene is active. • The mutant H2A/K pseudogene can promote cell proliferation. - Abstract: Little attention has been paid to the histone H2A/K pseudogene. Results from our laboratory showed that 7 of 10 kidney cancer patients carried a mutant H2A/K pseudogene; therefore, we were interested in determining the relationship between mutant H2A/K and cell proliferation. We used shotgun and label-free proteomics methods to study whether mutant H2A/K lncRNAs affected cell proliferation. Quantitative proteomic analysis indicated that the expression of mutant H2A/K lncRNAs resulted in the upregulation of many oncogenes, which promoted cell proliferation. Further interaction analyses revealed that a proliferating cell nuclear antigen (PCNA)-protein interaction network, with PCNA in the center, contributes to cell proliferation in cells expressing the mutant H2A/K lncRNAs. Western blotting confirmed the critical upregulation of PCNA by mutant H2A/K lncRNA expression. Finally, the promotion of cell proliferation by mutant H2A/K lncRNAs (C290T, C228A and A45G) was confirmed using cell proliferation assays. Although we did not determine the exact mechanism by which the oncogenes were upregulated by the mutant H2A/K lncRNAs, we confirmed that the mutant H2A/K lncRNAs promoted cell proliferation by upregulating PCNA and other oncogenes. The hypothesis that cell proliferation is promoted by the mutant H2A/K lncRNAs was supported by the protein expression and cell proliferation assay results. Therefore, mutant H2A/K lncRNAs may be a new factor in renal carcinogenesis.

Multiple promoters and alternative splicing: Hoxa5 transcriptional complexity in the mouse embryo.

Directory of Open Access Journals (Sweden)

Yan Coulombe

2010-05-01

Full Text Available The genomic organization of Hox clusters is fundamental for the precise spatio-temporal regulation and the function of each Hox gene, and hence for correct embryo patterning. Multiple overlapping transcriptional units exist at the Hoxa5 locus reflecting the complexity of Hox clustering: a major form of 1.8 kb corresponding to the two characterized exons of the gene and polyadenylated RNA species of 5.0, 9.5 and 11.0 kb. This transcriptional intricacy raises the question of the involvement of the larger transcripts in Hox function and regulation.We have undertaken the molecular characterization of the Hoxa5 larger transcripts. They initiate from two highly conserved distal promoters, one corresponding to the putative Hoxa6 promoter, and a second located nearby Hoxa7. Alternative splicing is also involved in the generation of the different transcripts. No functional polyadenylation sequence was found at the Hoxa6 locus and all larger transcripts use the polyadenylation site of the Hoxa5 gene. Some larger transcripts are potential Hoxa6/Hoxa5 bicistronic units. However, even though all transcripts could produce the genuine 270 a.a. HOXA5 protein, only the 1.8 kb form is translated into the protein, indicative of its essential role in Hoxa5 gene function. The Hoxa6 mutation disrupts the larger transcripts without major phenotypic impact on axial specification in their expression domain. However, Hoxa5-like skeletal anomalies are observed in Hoxa6 mutants and these defects can be explained by the loss of expression of the 1.8 kb transcript. Our data raise the possibility that the larger transcripts may be involved in Hoxa5 gene regulation.Our observation that the Hoxa5 larger transcripts possess a developmentally-regulated expression combined to the increasing sum of data on the role of long noncoding RNAs in transcriptional regulation suggest that the Hoxa5 larger transcripts may participate in the control of Hox gene expression.

Characterization and sequence analysis of the F2 promoter from corynephage BFK20

International Nuclear Information System (INIS)

Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

1994-01-01

F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

Interplay between estrogen receptor and AKT in estradiol-induced alternative splicing.

Science.gov (United States)

Bhat-Nakshatri, Poornima; Song, Eun-Kyung; Collins, Nikail R; Uversky, Vladimir N; Dunker, A Keith; O'Malley, Bert W; Geistlinger, Tim R; Carroll, Jason S; Brown, Myles; Nakshatri, Harikrishna

2013-06-11

Alternative splicing is critical for generating complex proteomes in response to extracellular signals. Nuclear receptors including estrogen receptor alpha (ERα) and their ligands promote alternative splicing. The endogenous targets of ERα:estradiol (E2)-mediated alternative splicing and the influence of extracellular kinases that phosphorylate ERα on E2-induced splicing are unknown. MCF-7 and its anti-estrogen derivatives were used for the majority of the assays. CD44 mini gene was used to measure the effect of E2 and AKT on alternative splicing. ExonHit array analysis was performed to identify E2 and AKT-regulated endogenous alternatively spliced apoptosis-related genes. Quantitative reverse transcription polymerase chain reaction was performed to verify alternative splicing. ERα binding to alternatively spliced genes was verified by chromatin immunoprecipitation assay. Bromodeoxyuridine incorporation-ELISA and Annexin V labeling assays were done to measure cell proliferation and apoptosis, respectively. We identified the targets of E2-induced alternative splicing and deconstructed some of the mechanisms surrounding E2-induced splicing by combining splice array with ERα cistrome and gene expression array. E2-induced alternatively spliced genes fall into at least two subgroups: coupled to E2-regulated transcription and ERα binding to the gene without an effect on rate of transcription. Further, AKT, which phosphorylates both ERα and splicing factors, influenced ERα:E2 dependent splicing in a gene-specific manner. Genes that are alternatively spliced include FAS/CD95, FGFR2, and AXIN-1. E2 increased the expression of FGFR2 C1 isoform but reduced C3 isoform at mRNA level. E2-induced alternative splicing of FAS and FGFR2 in MCF-7 cells correlated with resistance to FAS activation-induced apoptosis and response to keratinocyte growth factor (KGF), respectively. Resistance of MCF-7 breast cancer cells to the anti-estrogen tamoxifen was associated with ER�

Naturally occurring BRCA2 alternative mRNA splicing events in clinically relevant samples

DEFF Research Database (Denmark)

Fackenthal, James D; Yoshimatsu, Toshio; Zhang, Bifeng

2016-01-01

patterns and thereby disrupt gene function. mRNA analyses are therefore among the tests used to interpret the clinical significance of some genetic variants. However, these could be confounded by the appearance of naturally occurring alternative transcripts unrelated to germline sequence variation...... to characterise the spectrum of naturally occurring BRCA2 mRNA alternate-splicing events. METHODS: mRNA was prepared from several blood and breast tissue-derived cells and cell lines by contributing ENIGMA laboratories. cDNA representing BRCA2 alternate splice sites was amplified and visualised using capillary...... or agarose gel electrophoresis, followed by sequencing. RESULTS: We demonstrate the existence of 24 different BRCA2 mRNA alternate-splicing events in lymphoblastoid cell lines and both breast cancer and non-cancerous breast cell lines. CONCLUSIONS: These naturally occurring alternate-splicing events...

The “I” in us, or the eye on us? Regulatory focus, commitment and derogation of an attractive alternative person

Science.gov (United States)

2017-01-01

When individuals are highly committed to their romantic relationship, they are more likely to engage in pro-relationship maintenance mechanisms. The present research expanded on the notion that commitment redirects self-oriented goals to consider broader relational goals and examined whether commitment interacts with a promotion and prevention focus to activate derogation of attractive alternatives. Three studies used cross-sectional and experimental approaches. Study 1 showed that romantically involved individuals predominantly focused on promotion, but not prevention, reported less initial attraction to an attractive target than single individuals, especially when highly committed to their relationship. Study 2 showed that romantically involved individuals induced in a promotion focus, compared to those in prevention focus, reported less initial attraction, but only when more committed to their relationship. Regardless of regulatory focus manipulation, more committed individuals were also less likely to perceive quality among alternative scenarios and to be attentive to alternative others in general. Finally, Study 3 showed that romantically involved individuals induced in promotion focus and primed with high commitment reported less initial attraction, than those primed with low commitment, or than those induced in prevention focus. Once again, for these latter no differences occurred according to commitment prime. Together, the findings suggest that highly committed promotion focused individuals consider broader relationship goals and activate relationship maintenance behaviors such as derogation of attractive alternatives to promote their relationship. PMID:28319147

SAGE 2.0 SOLVENT ALTERNATIVES GUIDE - USER'S GUIDE

Science.gov (United States)

The guide provides instruction for using the SAGE (Solvent Alternatives Guide) software system, version 2.O. It assumes that the user is familiar with the fundamentals of operating a personal computer under the Microsoft disk operating system (MS-DOS). AGE recommends solvent repl...

SAGE 2.1: SOLVENT ALTERNATIVES GUIDE: USER'S GUIDE

Science.gov (United States)

The guide provides instruction for using the SAGE (Solvent Alternatives GuidE) software system, version 2.1. SAGE recommends solvent replacements in cleaning and degreasing operations. It leads the user through a question-and-answer session. The user's responses allow the system ...

Perspectives in the use of tannins as alternative to antimicrobial growth promoter factors in poultry

Directory of Open Access Journals (Sweden)

Leandro M Redondo

2014-03-01

Full Text Available Antibiotics have been included in the formulation of feed for livestock production for more than 40 years as a strategy to improve feed conversion rates and to reduce costs. The use of antimicrobials as growth-promoting factors (AGP in sub-therapeutic doses for long periods is particularly favorable to select antimicrobial-resistant microorganisms. In the last years, global concern about development of antimicrobial resistance and transference of resistance genes from animal to human strains has been arising. Removal of AGP from animal diets involves a tremendous pressure on the livestock and poultry farmers, one of the main consequences being a substantial increase in the incidence of infectious diseases with the related increase in the use of antibiotics for therapy and, concomitantly, economic cost. Therefore, alternatives to AGP are urgently needed. The challenge is to implement new alternatives without affecting the production performances of livestock and also avoiding the increase of antimicrobial resistant microorganisms. Plant extracts and purified derived substances are showing promising results for food animal production, either from their efficacy as well as from an economical point of view. Tannins are plant derived compounds that are being successfully used as additives in feed poultry to control diseases and to improve animal performance. Successful use of any of these extracts as feed additive must ensure a product of consistent quality in enough quantities to fulfill the actual requirements of the poultry industry. Chestnut (hydrolizable and Quebracho (condennsed tannins are probably the most readily available commercial products that are covering those needs. The present report intends to analyze the available data supporting their use.

Alternative motor fuels today and tomorrow

International Nuclear Information System (INIS)

Bensaid, B.

2004-01-01

Today, petroleum products account for 97% of the energy consumed in road transport. The purpose of replacing these products with alternative energies is to reduce oil dependence as well as greenhouse gas emissions. The high price of oil has promoted the use of 'conventional' alternative motor fuels (biofuels, LPG, NGV) and also renewed interest in syn-fuels (GTL, CTL, BTL) that have already given rise to industrial and pilot projects. (author)

Promoter2.0: for the recognition of PolII promoter sequences

DEFF Research Database (Denmark)

Knudsen, Steen; Knudsen, Steen

1999-01-01

Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...

Alternative Fuel News, Vol. 2, No. 7

Energy Technology Data Exchange (ETDEWEB)

NREL

1999-05-20

What's in store for alternative Fuels and advanced technology vehicles in the new millennium? The Clean Cities Coalitions now operate more than 240,000 alternative fuel vehicles in both public and private sectors and have access to more than 4,000 alternative refueling stations. DOE recently announced the selection of 15 proposals that will receive just under $1.7 million in financial assistance to help expand DOE's information dissemination and public outreach efforts for alternative fuels and advanced transportation technologies.

Super gene alternation of magnetite and pyrite and the role of their alternation products in the fixation of uranium from the circulating media. Vol. 3

Energy Technology Data Exchange (ETDEWEB)

El-Gemmizi, M A [Nuclear Materials Authority, Cairo, (Egypt)

1996-03-01

In most of the Egyptian altered radioactive granites, highly magnetic heavy particles were found to be radioactive. They are a mixture of several iron oxide minerals which are products of super gene alternation of the preexisting hypo gene iron-bearing minerals especially magnetite and pyrite. The end products of this super gene alternation are mainly hydrated iron oxide minerals limonite and/or goethite. During the alternation, deformation and defects in the mineral structure took place, thereby promoting diffusion of the substitutional and interstitial ions (uranium) towards these sites. The mechanism of the alternation of the hypo gene iron-bearing minerals, magnetite and pyrite to form the secondary mineral hematite, limonite and goethite; and the role of these secondary minerals in fixing uranium from the circulating media, and as indicators to the radioactivity of the host rocks are discussed. 2 figs.

Super gene alternation of magnetite and pyrite and the role of their alternation products in the fixation of uranium from the circulating media. Vol. 3

International Nuclear Information System (INIS)

El-Gemmizi, M.A.

1996-01-01

In most of the Egyptian altered radioactive granites, highly magnetic heavy particles were found to be radioactive. They are a mixture of several iron oxide minerals which are products of super gene alternation of the preexisting hypo gene iron-bearing minerals especially magnetite and pyrite. The end products of this super gene alternation are mainly hydrated iron oxide minerals limonite and/or goethite. During the alternation, deformation and defects in the mineral structure took place, thereby promoting diffusion of the substitutional and interstitial ions (uranium) towards these sites. The mechanism of the alternation of the hypo gene iron-bearing minerals, magnetite and pyrite to form the secondary mineral hematite, limonite and goethite; and the role of these secondary minerals in fixing uranium from the circulating media, and as indicators to the radioactivity of the host rocks are discussed. 2 figs

TiO2 promoted by two different non-noble metal cocatalysts for enhanced photocatalytic H2 evolution

International Nuclear Information System (INIS)

Lin, Jing-Dong; Yan, Shi; Huang, Qin-Dong; Fan, Mei-Ting; Yuan, You-Zhu; Tan, Timothy Thatt-Yang; Liao, Dai-Wei

2014-01-01

TiO 2 photocatalysts modified by cobalt and nickel cocatalysts were prepared via polymerized complex method (PCM) and evaluated by photocatalytic hydrogen evolution. Hydrogen generation in 6 h for the TiO 2 promoted by cobalt and nickel (0.1%Co + 0.2%Ni/TiO 2 ) is about two times (2456 μmol H 2 ) compared to that of TiO 2 promoted only by cobalt (1180 μmol H 2 for 0.1%Co/TiO 2 ) or nickel (1127 μmol H 2 for 0.2%Ni/TiO 2 ), and mechanically mixed TiO 2 promoted by cobalt and TiO 2 promoted by nickel (0.1%Co/TiO 2 :0.2%Ni/TiO 2 = 1:1 (m/m), 1282 μmol H 2 ). The high photocatalytic H 2 evolution activity over TiO 2 promoted by cobalt and nickel is ascribed to enhanced photo response due to the presence of cobalt and nickel impurity level, and effective separation of photogenerated electrons and holes due to the synergistic effect of cobalt and nickel, which serve as active sites for H 2 evolution reaction (HER) and oxidation reaction (OR) respectively. This study demonstrates a viable strategy to design more active photocatalysts for photocatalytic H 2 evolution by substituting noble metals with more abundant elements using as HER and OR cocatalysts, respectively.

Induction of NFATc2 expression by interleukin 6 promotes T helper type 2 differentiation.

Science.gov (United States)

Diehl, Sean; Chow, Chi-Wing; Weiss, Linda; Palmetshofer, Alois; Twardzik, Thomas; Rounds, Laura; Serfling, Edgar; Davis, Roger J; Anguita, Juan; Rincón, Mercedes

2002-07-01

Interleukin (IL)-6 is produced by professional antigen-presenting cells (APCs) such as B cells, macrophages, and dendritic cells. It has been previously shown that APC-derived IL-6 promotes the differentiation of naive CD4+ T cells into effector T helper type 2 (Th2) cells. Here, we have studied the molecular mechanism for IL-6-mediated Th2 differentiation. During the activation of CD4+ T cells, IL-6 induces the production of IL-4, which promotes the differentiation of these cells into effector Th2 cells. Regulation of IL-4 gene expression by IL-6 is mediated by nuclear factor of activated T cells (NFAT), as inhibition of NFAT prevents IL-6-driven IL-4 production and Th2 differentiation. IL-6 upregulates NFAT transcriptional activity by increasing the levels of NFATc2. The ability of IL-6 to promote Th2 differentiation is impaired in CD4+ T cells that lack NFATc2, demonstrating that NFATc2 is required for regulation of IL-4 gene expression by IL-6. Regulation of NFATc2 expression and NFAT transcriptional activity represents a novel pathway by which IL-6 can modulate gene expression.

Aquaporin 2 promotes cell migration and epithelial morphogenesis.

Science.gov (United States)

Chen, Ying; Rice, William; Gu, Zhizhan; Li, Jian; Huang, Jianmin; Brenner, Michael B; Van Hoek, Alfred; Xiong, Jianping; Gundersen, Gregg G; Norman, Jim C; Hsu, Victor W; Fenton, Robert A; Brown, Dennis; Lu, Hua A Jenny

2012-09-01

The aquaporin 2 (AQP2) water channel, expressed in kidney collecting ducts, contributes critically to water homeostasis in mammals. Animals lacking or having significantly reduced levels of AQP2, however, have not only urinary concentrating abnormalities but also renal tubular defects that lead to neonatal mortality from renal failure. Here, we show that AQP2 is not only a water channel but also an integrin-binding membrane protein that promotes cell migration and epithelial morphogenesis. AQP2 expression modulates the trafficking and internalization of integrin β1, facilitating its turnover at focal adhesions. In vitro, disturbing the interaction between AQP2 and integrin β1 by mutating the RGD motif led to reduced endocytosis, retention of integrin β1 at the cell surface, and defective cell migration and tubulogenesis. Similarly, in vivo, AQP2-null mice exhibited significant retention of integrin β1 at the basolateral membrane and had tubular abnormalities. In summary, these data suggest that the water channel AQP2 interacts with integrins to promote renal epithelial cell migration, contributing to the structural and functional integrity of the mammalian kidney.

HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ

Energy Technology Data Exchange (ETDEWEB)

Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)

2016-04-15

Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.

HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ

International Nuclear Information System (INIS)

Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi

2016-01-01

Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.

Effect of probiotic supplementation on organic feed to alternative antibiotic growth promoter on production performance and economics analysis of quail.

Science.gov (United States)

Lokapirnasari, W P; Dewi, A R; Fathinah, A; Hidanah, S; Harijani, N; Soeharsono; Karimah, B; Andriani, A D

2017-12-01

The purpose of this study was to know the production performance and economic analysis in quail which use probiotic supplementation to alternate antibiotic growth promoter (AGP) to feed consumption, water consumption, egg production, egg mass, feed conversion, and feed efficiency. About 240 quails ( Coturnix coturnix japonica) at 14 weeks of age were completely randomized into four treatments, each treatment consisted of six replications and each replication consisted by 10 heads. The treatment was T0 (organic feed without AGP and without probiotic), T1 (organic feed + 0.001% AGP), T2 (organic feed + 0.005% probiotic in feed), and T3 (organic feed + 0.005% probiotic in drinking water). The probiotic consist of 1.2×10 5 CFU/g of Lactobacillus casei and Lactobacillus rhamnosus . The results showed that the probiotic supplementation both in feed and water give a significant impact to feed consumption, water intake, feed conversion, feed efficiency, and quail day production, but no statistical difference of egg mass. The T3 also show the most profitable business analysis, which has the best result in income, profit, break-even point, return cost ratio, benefit-cost ratio, and return on investment. It can be concluded that giving 0.005% probiotic in drinking water to get the best egg production and profit.

Utilization of Alternative Medical Services In An Urban Centre Of ...

African Journals Online (AJOL)

Alasia Datonye

pattern, behaviour and determinants of Alternative. Therapy (AT) use. ... promoted the use of alternative and traditional therapies and has .... The media jingle/advert. The public .... consumers, may give a false confidence to the users of AT that.

Bone marrow concentrate promotes bone regeneration with a suboptimal-dose of rhBMP-2.

Science.gov (United States)

Egashira, Kazuhiro; Sumita, Yoshinori; Zhong, Weijian; I, Takashi; Ohba, Seigo; Nagai, Kazuhiro; Asahina, Izumi

2018-01-01

Bone marrow concentrate (BMC), which is enriched in mononuclear cells (MNCs) and platelets, has recently attracted the attention of clinicians as a new optional means for bone engineering. We previously reported that the osteoinductive effect of bone morphogenetic protein-2 (BMP-2) could be enhanced synergistically by co-transplantation of peripheral blood (PB)-derived platelet-rich plasma (PRP). This study aims to investigate whether BMC can effectively promote bone formation induced by low-dose BMP-2, thereby reducing the undesirable side-effects of BMP-2, compared to PRP. Human BMC was obtained from bone marrow aspirates using an automated blood separator. The BMC was then seeded onto β-TCP granules pre-adsorbed with a suboptimal-dose (minimum concentration to induce bone formation at 2 weeks in mice) of recombinant human (rh) BMP-2. These specimens were transplanted subcutaneously to the dorsal skin of immunodeficient-mice and the induction of ectopic bone formation was assessed 2 and 4 weeks post-transplantation. Transplantations of five other groups [PB, PRP, platelet-poor plasma (PPP), bone marrow aspirate (BM), and BM-PPP] were employed as experimental controls. Then, to clarify the effects on vertical bone augmentation, specimens from the six groups were transplanted for on-lay placement on the craniums of mice. The results indicated that BMC, which contained an approximately 2.5-fold increase in the number of MNCs compared to PRP, could accelerate ectopic bone formation until 2 weeks post-transplantation. On the cranium, the BMC group promoted bone augmentation with a suboptimal-dose of rhBMP-2 compared to other groups. Particularly in the BMC specimens harvested at 4 weeks, we observed newly formed bone surrounding the TCP granules at sites far from the calvarial bone. In conclusion, the addition of BMC could reduce the amount of rhBMP-2 by one-half via its synergistic effect on early-phase osteoinduction. We propose here that BMC transplantation

Identification and characterization of an alternative promoter of the human PGC-1{alpha} gene

Energy Technology Data Exchange (ETDEWEB)

Yoshioka, Toyo; Inagaki, Kenjiro [Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan); Noguchi, Tetsuya, E-mail: noguchi@med.kobe-u.ac.jp [Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan); Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya [Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan); Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji [Genomic Science Laboratories, DainipponSumitomo Pharma Co. Ltd., 4-2-1 Takatsukasa, Takarazuka 665-8555 (Japan); Kasuga, Masato [Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan); Research Institute, International Medical Center of Japan, 1-21-1 Toyama, Shinjuku-ku, Tokyo 162-8655 (Japan)

2009-04-17

The transcriptional regulator peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1{alpha} expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1{alpha} transcript (designated PGC-1{alpha}-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1{alpha}-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca{sup 2+}- and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1{alpha}-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1{alpha} expression in contracting muscle.

Identification and characterization of an alternative promoter of the human PGC-1α gene

International Nuclear Information System (INIS)

Yoshioka, Toyo; Inagaki, Kenjiro; Noguchi, Tetsuya; Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya; Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji; Kasuga, Masato

2009-01-01

The transcriptional regulator peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1α expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1α transcript (designated PGC-1α-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1α-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca 2+ - and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1α-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1α expression in contracting muscle.

The potential of complementary and alternative medicine in promoting well-being and critical health literacy: a prospective, observational study of shiatsu.

Science.gov (United States)

Long, Andrew F

2009-06-18

The potential contribution of complementary and alternative medicine (CAM) modalities to promote and support critical health literacy has not received substantial attention within either the health promotion or the CAM literature. This paper explores the potential of one CAM modality, shiatsu, in promoting well-being and critical health literacy. Data are drawn from a longitudinal, 6 months observational, pragmatic study of the effects and experience of shiatsu within three European countries (Austria, Spain and the UK). Client postal questionnaires included: advice received, changes made 6 months later, clients 'hopes' from having shiatsu and features of the client-practitioner relationship. At baseline, three-quarters of clients (n = 633) received advice, on exercise, diet, posture, points to work on at home or other ways of self-care. At 6 months follow-up, about four-fifths reported making changes to their lifestyle 'as a result of having shiatsu treatment', including taking more rest and relaxation or exercise, changing their diet, reducing time at work and other changes such as increased body/mind awareness and levels of confidence and resolve. Building on the findings, an explanatory model of possible ways that a CAM therapy could contribute to health promotion is presented to guide future research, both within and beyond CAM. Supporting individuals to take control of their self-care requires advice-giving within a supportive treatment context and practitioner relationship, with clients who are open to change and committed to maintaining their health. CAM modalities may have an important role to play in this endeavour.

The potential of complementary and alternative medicine in promoting well-being and critical health literacy: a prospective, observational study of shiatsu

Directory of Open Access Journals (Sweden)

Long Andrew F

2009-06-01

Full Text Available Abstract Background The potential contribution of complementary and alternative medicine (CAM modalities to promote and support critical health literacy has not received substantial attention within either the health promotion or the CAM literature. This paper explores the potential of one CAM modality, shiatsu, in promoting well-being and critical health literacy. Methods Data are drawn from a longitudinal, 6 months observational, pragmatic study of the effects and experience of shiatsu within three European countries (Austria, Spain and the UK. Client postal questionnaires included: advice received, changes made 6 months later, clients 'hopes' from having shiatsu and features of the client-practitioner relationship. Result At baseline, three-quarters of clients (n = 633 received advice, on exercise, diet, posture, points to work on at home or other ways of self-care. At 6 months follow-up, about four-fifths reported making changes to their lifestyle 'as a result of having shiatsu treatment', including taking more rest and relaxation or exercise, changing their diet, reducing time at work and other changes such as increased body/mind awareness and levels of confidence and resolve. Building on the findings, an explanatory model of possible ways that a CAM therapy could contribute to health promotion is presented to guide future research, both within and beyond CAM. Conclusion Supporting individuals to take control of their self-care requires advice-giving within a supportive treatment context and practitioner relationship, with clients who are open to change and committed to maintaining their health. CAM modalities may have an important role to play in this endeavour.

The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries

Directory of Open Access Journals (Sweden)

Nove E. Variant Anna

2015-04-01

Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university libraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flicker to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.

The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries

Directory of Open Access Journals (Sweden)

Nove E. Variant Anna

2018-01-01

Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university librraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flikr to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.

Alternative energy and environmental concerns

International Nuclear Information System (INIS)

2002-01-01

The New Brunswick Market Design Committee will address environmental concerns within the context of the new energy policy and market rules for the newly restructured electric power industry. The new rules that come with power restructuring will in some ways facilitate environmental protection but they can also complicate it. With open access markets, it will be possible to coordinate evolving energy frameworks with current environmental objectives. Restructuring provides an opportunity to create incentives and guidelines to operate in an environmentally sustainable manner, as suggested in the New Brunswick Energy Policy, White Paper which outlines green pricing, the development of a provincial Climate Change Action Plan, and promotion of alternative energy. The Market Design Committee examined the environmental concerns listed within the White Paper that pertain to the generation and transmission of electricity. These include the integration of energy and environmental policy. Other issues addressed in this report were trans-boundary and global air emissions, the development of a provincial climate change action plan, and a federal-provincial climate change framework agreement. New Brunswick will encourage the development of pilot studies that demonstrate the benefits of renewable and alternative technologies and that help promote the market to manufacture, sell and maintain renewable and alternative technologies in small-scale on-site power generation. This report also discussed the 4 key air pollutants for which specific treatment has been defined, including sulphur dioxide, nitrogen oxides, mercury and carbon dioxide. Recommendations for reducing these emissions include the use of renewable energy sources, the use of lower carbon fuels, increased efficiency of power transmission/generation/distribution systems, reducing power demand by the industrial sector, and promoting energy efficient building codes. 34 refs., 1 tab

Alternative fuels for vehicles fleet demonstration program. Final report, volume 2: Appendices

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-06-01

The Alternative Fuels for Vehicles Fleet Demonstration Program (AFV-FDP) was a multiyear effort to collect technical data for use in determining the costs and benefits of alternative-fuel vehicles (AFVs) in typical applications in New York State. This report, Volume 2, includes 13 appendices to Volume 1 that expand upon issues raised therein. Volume 1 provides: (1) Information about the purpose and scope of the AFV-FDP; (2) A summary of AFV-FDP findings organized on the basis of vehicle type and fuel type; (3) A short review of the status of AFV technology development, including examples of companies in the State that are active in developing AFVs and AFV components; and (4) A brief overview of the status of AFV deployment in the State. Volume 3 provides expanded reporting of AFV-FDP technical details, including the complete texts of the brochure Garage Guidelines for Alternative Fuels and the technical report Fleet Experience Survey Report, plus an extensive glossary of AFV terminology. The appendices cover a wide range of issues including: emissions regulations in New York State; production and health effects of ozone; vehicle emissions and control systems; emissions from heavy-duty engines; reformulated gasoline; greenhouse gases; production and characteristics of alternative fuels; the Energy Policy Act of 1992; the Clean Fuel Fleet Program; garage design guidelines for alternative fuels; surveys of fleet managers using alternative fuels; taxes on conventional and alternative fuels; and zero-emission vehicle technology.

Anaesthetic gases: environmental impact and alternatives ...

African Journals Online (AJOL)

Anaesthetic gases: environmental impact and alternatives. ... PROMOTING ACCESS TO AFRICAN RESEARCH ... to be small when compared to gaseous emissions from industrial and agricultural sources, the actual percentage contribution to climate change is small. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

CCR2 deficiency leads to increased eosinophils, alternative macrophage activation, and type 2 cytokine expression in adipose tissue.

Science.gov (United States)

Bolus, W Reid; Gutierrez, Dario A; Kennedy, Arion J; Anderson-Baucum, Emily K; Hasty, Alyssa H

2015-10-01

Adipose tissue (AT) inflammation during obesity is mediated by immune cells and closely correlates with systemic insulin resistance. In lean AT, eosinophils are present in low but significant numbers and capable of promoting alternative macrophage activation in an IL-4/IL-13-dependent manner. In WT mice, obesity causes the proportion of AT eosinophils to decline, concomitant with inflammation and classical activation of AT macrophages. In this study, we show that CCR2 deficiency leads to increased eosinophil accumulation in AT. Furthermore, in contrast to WT mice, the increase in eosinophils in CCR2(-/-) AT is sustained and even amplified during obesity. Interestingly, a significant portion of eosinophils is found in CLSs in AT of obese CCR2(-/-) mice, which is the first time eosinophils have been shown to localize to these inflammatory hot spots. CCR2(-/-) bone marrow precursors displayed increased expression of various key eosinophil genes during in vitro differentiation to eosinophils, suggesting a potentially altered eosinophil phenotype in the absence of CCR2. In addition, the proportion of eosinophils in AT positively correlated with local expression of Il5, a potent eosinophil stimulator. The increase in eosinophils in CCR2(-/-) mice was detected in all white fat pads analyzed and in the peritoneal cavity but not in bone marrow, blood, spleen, or liver. In AT of CCR2(-/-) mice, an increased eosinophil number positively correlated with M2-like macrophages, expression of the Treg marker Foxp3, and type 2 cytokines, Il4, Il5, and Il13. This is the first study to link CCR2 function with regulation of AT eosinophil accumulation. © Society for Leukocyte Biology.

Alternative Splicing of G9a Regulates Neuronal Differentiation

Directory of Open Access Journals (Sweden)

Ana Fiszbein

2016-03-01

Full Text Available Chromatin modifications are critical for the establishment and maintenance of differentiation programs. G9a, the enzyme responsible for histone H3 lysine 9 dimethylation in mammalian euchromatin, exists as two isoforms with differential inclusion of exon 10 (E10 through alternative splicing. We find that the G9a methyltransferase is required for differentiation of the mouse neuronal cell line N2a and that E10 inclusion increases during neuronal differentiation of cultured cells, as well as in the developing mouse brain. Although E10 inclusion greatly stimulates overall H3K9me2 levels, it does not affect G9a catalytic activity. Instead, E10 increases G9a nuclear localization. We show that the G9a E10+ isoform is necessary for neuron differentiation and regulates the alternative splicing pattern of its own pre-mRNA, enhancing E10 inclusion. Overall, our findings indicate that by regulating its own alternative splicing, G9a promotes neuron differentiation and creates a positive feedback loop that reinforces cellular commitment to differentiation.

Test person operated 2-Alternative Forced Choice Audiometry compared to traditional audiometry

DEFF Research Database (Denmark)

Schmidt, Jesper Hvass; Brandt, Christian; Christensen-Dalsgaard, Jakob

  Background: With a newly developed technique, hearing thresholds can be estimated with a system operated by the test persons themselves. This technique is based on the 2 Alternative Forced Choice paradigm known from the psychoacoustic research theory. Test persons can operate the system very......-likelihood and up-down methods has proven effective and reliable even under suboptimal test settings. In non-optimal testing conditions i.e. as a part of a hearing conservation programme the headphone Sennheiser HDA-200 has been used as it contains hearing protection. This test-method has been validated......-retest studies of 2AFC audiometry are comparable to test-retest results known from traditional audiometry under standard clinical settings.   Conclusions 2 Alternative Forced Choice audiometry can be a reliable alternative to traditional audiometry especially under certain circumstances, where it can...

Alternative food promotes broad mite control on chilli pepper plants

NARCIS (Netherlands)

Duarte, M.V.A.; Venzon, M.; de S. Bittencourt, M.C.; Rodríguez-Cruz, F.A.; Pallini, A.; Janssen, A.

2015-01-01

Many omnivorous arthropods are important natural enemies because they can feed on plant-provided pollen and several prey species, and thus persist in crops even in the absence of the target pest. Hence, populations of these predators can be established in a crop by providing alternative food, thus

MECP2 promoter methylation and X chromosome inactivation in autism.

Science.gov (United States)

Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M

2008-06-01

Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.

Alternative Fuel News, Vol. 3 No. 2

Energy Technology Data Exchange (ETDEWEB)

NONE

1999-09-23

This special issue of Alternative Fuel News highlights the Fifth National Clean Cities Conference held in Louisville, Kentucky. The momentum for the program is stronger than ever and the coalitions are working to propel the alternative fuel industry forward.

Update on HER-2 as a target for cancer therapy: The ERBB2 promoter and its exploitation for cancer treatment

International Nuclear Information System (INIS)

Hurst, Helen C

2001-01-01

Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed

76 FR 68067 - United States-Peru Trade Promotion Agreement

Science.gov (United States)

2011-11-03

... between the Parties and promoting regional economic integration; promoting broad-based economic development in order to reduce poverty and generate opportunities for sustainable economic alternatives to... rule. CBP also invites comments that relate to the economic, environmental, or federalism effects that...

Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...

Indian Academy of Sciences (India)

First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...

IGF2BP2 alternative variants associated with glutamic acid decarboxylase antibodies negative diabetes in Malaysian subjects.

Directory of Open Access Journals (Sweden)

Sameer D Salem

Full Text Available BACKGROUND: The association of Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2 common variants (rs4402960 and rs1470579 with type 2 diabetes (T2D has been performed in different populations. The aim of this study was to evaluate the association of alternative variants of IGF2BP2; rs6777038, rs16860234 and rs7651090 with glutamic acid decarboxylase antibodies (GADA negative diabetes in Malaysian Subjects. METHODS/PRINCIPAL FINDINGS: IGF2BP2; rs6777038, rs16860234 and rs7651090 single nucleotide polymorphisms (SNPs were genotyped in 1107 GADA negative diabetic patients and 620 control subjects of Asian from Malaysia. The additive genetic model adjusted for age, race, gender and BMI showed that alternative variants; rs6777038, rs16860234 and rs7651090 of IGF2BP2 associated with GADA negative diabetes (OR = 1.21; 1.36; 1.35, P = 0.03; 0.0004; 0.0002, respectively. In addition, the CCG haplotype and diplotype CCG-TCG increased the risk of diabetes (OR = 1.51, P = 0.01; OR = 2.36, P = 0.009, respectively. CONCLUSIONS/SIGNIFICANCE: IGF2BP2 alternative variants were associated with GADA negative diabetes. The IGF2BP2 haplotypes and diplotypes increased the risk of diabetes in Malaysian subject.

Comparison of alternative beef production systems based on forage finishing or grain-forage diets with or without growth promotants: 2. Meat quality, fatty acid composition, and overall palatability.

Science.gov (United States)

Faucitano, L; Chouinard, P Y; Fortin, J; Mandell, I B; Lafrenière, C; Girard, C L; Berthiaume, R

2008-07-01

Five beef cattle management regimens were evaluated for their effect on meat quality, fatty acid composition, and overall palatability of the longis-simus dorsi (LD) muscle in Angus cross steers. A 98-d growing phase was conducted using grass silage with or without supplementation of growth promotants (Revalor G and Rumensin) or soybean meal. Dietary treatments in the finishing phase were developed with or without supplementation of growth promotants based on exclusive feeding of forages with no grain supplementation, or the feeding of grain:forage (70:30) diets. Growth promotants increased (P forages increased the proportion of cis-9, cis-12, cis-15 C18:3 as well as several other isomers of the n-3 family and decreased in the ratio of n-6 to n-3 fatty acids in the LD muscle as compared with supplementing grain (P forage-based diet increased (P Forage feeding also increased the proportion of cis-9, trans-11 C18:2 (P forage-finishing and growth promotants-free beef production system.

Structure of 2,4-Diaminopyrimidine-Theobromine Alternate Base Pairs

NARCIS (Netherlands)

Gengeliczki, Z.; Callahan, M. P.; Kabelac, M.; Rijs, A. M.; de Vries, M. S.

2011-01-01

We report the structure of dusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

Energy Technology Data Exchange (ETDEWEB)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo; Miller Jenkins, Lisa M.; Wlodawer, Alexander; Chattoraj, Dhruba; Dunny, Gary M.

2017-04-18

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in a dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that

["Habitual" left branch block alternating with 2 "disguised" bracnch block].

Science.gov (United States)

Lévy, S; Jullien, G; Mathieu, P; Mostefa, S; Gérard, R

1976-10-01

Two cases of alternating left bundle branch block and "masquerading block" (with left bundle branch morphology in the stnadard leads and right bundle branch block morphology in the precordial leads) were studied by serial tracings and his bundle electrocardiography. In case 1 "the masquerading" block was associated with a first degree AV block related to a prolongation of HV interval. This case is to our knowledge the first cas of alternating bundle branch block in which his bundle activity was recorded in man. In case 2, the patient had atrial fibrilation and His bundle recordings were performed while differents degrees of left bundle branch block were present: The mechanism of the alternation and the concept of "masquerading" block are discussed. It is suggested that this type of block represents a right bundle branch block associated with severe lesions of the "left system".

Plant growth promoting bacteria as an alternative strategy for salt tolerance in plants: A review.

Science.gov (United States)

Numan, Muhammad; Bashir, Samina; Khan, Yasmin; Mumtaz, Roqayya; Shinwari, Zabta Khan; Khan, Abdul Latif; Khan, Ajmal; Al-Harrasi, Ahmed

2018-04-01

Approximately 5.2 billion hectare agriculture land are affected by erosion, salinity and soil degradation. Salinity stress has significantly affecting the fertile lands, and therefore possesses a huge impact on the agriculture and economy of a country. Salt stress has severe effects on the growth and development of plants as well as reducing its yield. Plants are inherently equipped with stress tolerance ability to responds the specific type of stress. Plants retained specific mechanisms for salt stress mitigation, such as hormonal stimulation, ion exchange, antioxidant enzymes and activation of signaling cascades on their metabolic and genetic frontiers that sooth the stressed condition. Additional to the plant inherent mechanisms, certain plant growth promoting bacteria (PGPB) also have specialized mechanism that play key role for salt stress tolerance and plant growth promotion. These bacteria triggers plants to produce different plant growth hormones like auxin, cytokinine and gibberellin as well as volatile organic compounds. These bacteria also produces growth regulators like siderophore, which fix nitrogen, solubilize organic and inorganic phosphate. Considering the importance of PGPB in compensation of salt tolerance in plants, the present study has reviewed the different aspect and mechanism of bacteria that play key role in promoting plants growth and yield. It can be concluded that PGPB can be used as a cost effective and economical tool for salinity tolerance and growth promotion in plants. Copyright © 2018 Elsevier GmbH. All rights reserved.

Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

DEFF Research Database (Denmark)

Møller, A M; Jensen, N M; Pildal, J

2001-01-01

This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...

Alternative Fuel News, Vol. 2, No. 4

Energy Technology Data Exchange (ETDEWEB)

O' Connor, K.; Riley, C.; Raye, M.

1998-11-30

This issue of Alternative Fuel News highlights the accomplishments of the Clean Cities coalitions during the past 5 years. Now Clean Cities advocates in city after city across the US are building stations and driving alternative fuel vehicles, in addition to enhancing public awareness.

Simulation and modeling CO2 absorption in biogas with DEA promoted K2CO3 solution in packed column

Science.gov (United States)

Nurkhamidah, Siti; Altway, Ali; Airlangga, Bramantyo; Emilia, Dwi Putri

2017-05-01

Absorption of carbon dioxide (CO2) using potassium carbonate (K2CO3) is one of biogas purification method. However, K2CO3 have slow mass transfer in liquid phase. So it is necessary to eliminate the disadvantage of CO2 absorption using K2CO3 by adding promotor (activator). Diethanol amine (DEA) is one of promotor which can increase its reaction rate. Simulation and modeling research of the CO2 absorption from biogas with DEA promoted K2CO3 solution has not been conducted. Thus, the main goal of this research is create model and simulation for the CO2 absorption from biogas with DEA promoted K2CO3 solution, then observe the influence of promoter concentration. DEA concentration varies between 1-5 %wt. From the simulation, we concluded that the CO2 removal rise with the increasing of promoter concentration. The highest CO2 removal is 54.5318 % at 5 % wt DEA concentration.

Monte Carlo study of alternate mixed spin-5/2 and spin-2 Ising ferrimagnetic system on the Bethe lattice

Energy Technology Data Exchange (ETDEWEB)

Jabar, A. [Laboratoire de Magnétisme et Physique des Hautes Energies L.M.P.H.E.URAC 12, Université Mohammed V, Faculté des Sciences, B.P. 1014 Rabat (Morocco); Masrour, R., E-mail: rachidmasrour@hotmail.com [Laboratoire de Magnétisme et Physique des Hautes Energies L.M.P.H.E.URAC 12, Université Mohammed V, Faculté des Sciences, B.P. 1014 Rabat (Morocco); Laboratory of Materials, Processes, Environment and Quality, Cady Ayyed University, National School of Applied Sciences, PB 63 46000 Safi (Morocco); Benyoussef, A. [Laboratoire de Magnétisme et Physique des Hautes Energies L.M.P.H.E.URAC 12, Université Mohammed V, Faculté des Sciences, B.P. 1014 Rabat (Morocco); Institute of Nanomaterials and Nanotechnologies, MAScIR, Rabat (Morocco); Hassan II Academy of Science and Technology, Rabat (Morocco); Hamedoun, M. [Institute of Nanomaterials and Nanotechnologies, MAScIR, Rabat (Morocco)

2016-01-01

The magnetic properties of alternate mixed spin-5/2 and spin-2 Ising model on the Bethe lattice have been studied by using the Monte Carlo simulations. The ground state phase diagrams of alternate mixed spin-5/2 and spin-2 Ising model on the Bethe lattice has been obtained. The thermal total magnetization and magnetization of spins-5/2 and spin-2 with the different exchange interactions, external magnetic field and temperatures have been studied. The critical temperature have been deduced. The magnetic hysteresis cycle on the Bethe lattice has been deduced for different values of exchange interactions, for different values of crystal field and for different sizes. The magnetic coercive field has been deduced. - Highlights: • The alternate mixed spin-5/2 and -2 on the Bethe lattice is studied. • The critical temperature has been deduced. • The magnetic coercive filed has been deduced.

Alternatives to antibiotics as growth promoters for use in swine production: a review

Science.gov (United States)

2013-01-01

In the past two decades, an intensive amount of research has been focused on the development of alternatives to antibiotics to maintain swine health and performance. The most widely researched alternatives include probiotics, prebiotics, acidifiers, plant extracts and neutraceuticals such as copper and zinc. Since these additives have been more than adequately covered in previous reviews, the focus of this review will be on less traditional alternatives. The potential of antimicrobial peptides, clay minerals, egg yolk antibodies, essential oils, eucalyptus oil-medium chain fatty acids, rare earth elements and recombinant enzymes are discussed. Based on a thorough review of the literature, it is evident that a long and growing list of compounds exist which have been tested for their ability to replace antibiotics as feed additives in diets fed to swine. Unfortunately, the vast majority of these compounds produce inconsistent results and rarely equal antibiotics in their effectiveness. Therefore, it would appear that research is still needed in this area and that the perfect alternative to antibiotics does not yet exist. PMID:24034214

Academic Departments: Problems, Variations, and Alternatives.

Science.gov (United States)

McHenry, Dean E.; And Others

Do academic departments promote scholarship, protect higher learning from stagnation and interference, and provide a sound basis for hiring and advancing faculty? Or do they stifle teaching and research, foster parochialism, and limit the development of professors and students? There exist operating alternatives to conventional departments. Those…

Alternative splicing and extensive RNA editing of human TPH2 transcripts.

Directory of Open Access Journals (Sweden)

Maik Grohmann

Full Text Available Brain serotonin (5-HT neurotransmission plays a key role in the regulation of mood and has been implicated in a variety of neuropsychiatric conditions. Tryptophan hydroxylase (TPH is the rate-limiting enzyme in the biosynthesis of 5-HT. Recently, we discovered a second TPH isoform (TPH2 in vertebrates, including man, which is predominantly expressed in brain, while the previously known TPH isoform (TPH1 is primarly a non-neuronal enzyme. Overwhelming evidence now points to TPH2 as a candidate gene for 5-HT-related psychiatric disorders. To assess the role of TPH2 gene variability in the etiology of psychiatric diseases we performed cDNA sequence analysis of TPH2 transcripts from human post mortem amygdala samples obtained from individuals with psychiatric disorders (drug abuse, schizophrenia, suicide and controls. Here we show that TPH2 exists in two alternatively spliced variants in the coding region, denoted TPH2a and TPH2b. Moreover, we found evidence that the pre-mRNAs of both splice variants are dynamically RNA-edited in a mutually exclusive manner. Kinetic studies with cell lines expressing recombinant TPH2 variants revealed a higher activity of the novel TPH2B protein compared with the previously known TPH2A, whereas RNA editing was shown to inhibit the enzymatic activity of both TPH2 splice variants. Therefore, our results strongly suggest a complex fine-tuning of central nervous system 5-HT biosynthesis by TPH2 alternative splicing and RNA editing. Finally, we present molecular and large-scale linkage data evidencing that deregulated alternative splicing and RNA editing is involved in the etiology of psychiatric diseases, such as suicidal behaviour.

Common variants in the TPH2 promoter confer susceptibility to paranoid schizophrenia.

Science.gov (United States)

Yi, Zhenghui; Zhang, Chen; Lu, Weihong; Song, Lisheng; Liu, Dentang; Xu, Yifeng; Fang, Yiru

2012-07-01

Serotonergic system-related genes may be good candidates in investigating the genetic basis of schizophrenia. Our previous study suggested that promoter region of tryptophan hydroxylase 2 gene (TPH2) may confer the susceptibility to paranoid schizophrenia. In this study, we investigated whether common variants within TPH2 promoter may predispose to paranoid schizophrenia in Han Chinese. A total of 509 patients who met DSM-IV criteria for paranoid schizophrenia and 510 matched healthy controls were recruited for this study. Five polymorphisms within TPH2 promoter region were tested. No statistically significant differences were found in allele or genotype frequencies between schizophrenic patients and healthy controls. The frequency of the rs4448731T-rs6582071A-rs7963803A-rs4570625T-rs11178997A haplotype was significantly higher in cases compared to the controls (P = 0.003; OR = 1.49; 95% CI, 1.15-1.95). Our results suggest that the common variants within TPH2 promoter are associated with paranoid schizophrenia in Han Chinese. Further studies in larger samples are warranted to elucidate the role of TPH2 in the etiology of paranoid schizophrenia.

29 CFR 2703.2 - Designated agency ethics official and alternate designated agency ethics official.

Science.gov (United States)

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Designated agency ethics official and alternate designated agency ethics official. 2703.2 Section 2703.2 Labor Regulations Relating to Labor (Continued) FEDERAL... agency ethics official and alternate designated agency ethics official. The Chairman shall appoint an...

Alternative energy sources or integrated alternative energy systems? Oil as a modern lance of Peleus for the energy transition

International Nuclear Information System (INIS)

Szklo, Alexandre; Schaeffer, Roberto

2006-01-01

In this viewpoint, we discuss the importance of consorting alternative energy sources with oil, and not of opposing them. That is why we introduce the concept of alternative energy systems, which we feel is broader-ranging and more effective than alternative energy sources, as this deals with the actual transformation process of the global energy system. Alternative energy systems integrate oil with other energy sources and pave the way for new systems, which will benefit from what we call the 'virtues of oil'. They produce energy carriers for multi-fuel and multi-product strategies, where flexibility is a key target, allied to other co-benefits, especially those related to the increased use of renewable energy sources. The concept of alternative energy systems can bring a new light to the oil transition era discussion and might also influence energy policies for promoting renewables

Emission Control Cost-Effectiveness of Alternative-Fuel Vehicles

OpenAIRE

Wang, Quanlu; Sperling, Daniel; Olmstead, Janis

1993-01-01

Although various legislation and regulations have been adopted to promote the use of alternative-fuel vehicles for curbing urban air pollution problems, there is a lack of systematic comparisons of emission control cost-effectiveness among various alternative-fuel vehicle types. In this paper, life-cycle emission reductions and life-cycle costs were estimated for passenger cars fueled with methanol, ethanol, liquified petroleum gas, compressed natural gas, and electricity. Vehicle emission es...

MRG15 activates the cdc2 promoter via histone acetylation in human cells

International Nuclear Information System (INIS)

Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.

2011-01-01

Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.

MRG15 activates the cdc2 promoter via histone acetylation in human cells

Energy Technology Data Exchange (ETDEWEB)

Pena, AndreAna N., E-mail: andreana.pena@gmail.com [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Tominaga, Kaoru; Pereira-Smith, Olivia M. [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States)

2011-07-01

Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

Directory of Open Access Journals (Sweden)

Jyoti K. Jha

2017-04-01

Full Text Available Replication of Vibrio cholerae chromosome 2 (Chr2 depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations in rctB that reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in a dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding.

Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

Science.gov (United States)

Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

2015-04-01

The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

Pokemon and MEF2D co-operationally promote invasion of hepatocellular carcinoma.

Science.gov (United States)

Hong, Xin; Hong, Xing-Yu; Li, Tao; He, Cheng-Yan

2015-12-01

Hepatocellular carcinoma (HCC) is one of the most deadly human malignancy, and frequent invasion and metastasis is closely associated with its poor prognosis. However, the molecular mechanism underlying HCC invasion is still not completely elucidated. Pokemon is a well-established oncogene for HCC growth, but its contribution to HCC invasion has not been studied yet. In this paper, Pokemon was found to be overexpressed in MHCC-97H HCC cell line, which possesses higher invasiveness. Downregulation of Pokemon abolished the invasion of MHCC-97H HCC cell lines. Pokemon overexpression was able to enhance the invasion of MHCC-97L cells with lower invasiveness. MEF2D, an oncogene promoting the invasion of HCC cells, was further detected to be upregulated and downregulated when Pokemon was overexpressed and silenced, respectively. Online database analysis indicated that one Pokemon recognition site was located within the promoter of MEF2D. Chromatin co-precipitation, luciferase, and qPCR assays all proved that Pokemon can promote the expression of MEF2D in HCC cells. Restoration of MEF2D expression can prevent the impaired invasion of HCC cells with Pokemon silencing, while suppression of MEF2D abolished the effect of Pokemon overexpression on HCC invasion. More interestingly, MEF2D was also found to increase the transcription of Pokemon by binding myocyte enhancer factor 2 (MEF2) sites within its promoter region, implying an auto-regulatory circuit consisting of these two oncogenes that can promote HCC invasion. Our findings can contribute to the understanding of molecular mechanism underlying HCC invasion, and provided evidence that targeting this molecular loop may be a promising strategy for anti-invasion therapy.

Mechanism of Na2SO4 Promoting Nickel Extraction from Sulfide Concentrates by Sulfation Roasting-Water Leaching

Science.gov (United States)

Li, Guangshi; Cheng, Hongwei; Chen, Sha; Lu, Xionggang; Xu, Qian; Lu, Changyuan

2018-06-01

As a more environmentally friendly and energy-efficient route, the sulfation roasting-water leaching technique has been developed for highly effective extraction of non-ferrous metals from nickel sulfide concentrate in the presence of a Na2SO4 additive. The effects of several important roasting parameters—the roasting temperature, the addition of Na2SO4, the holding time, and the heating rate in particular—have been investigated. The results suggest that about 90 pct Ni, 92 pct Co, 95 pct Cu, and leached from the calcine roasted under the optimum conditions. Furthermore, the behavior and mechanism of the Na2SO4 additive in the roasting process have been well addressed by detailed characterization of the roasted product and leaching residue using quantitative phase analysis (QPA) and energy dispersive spectroscopy (EDS) mapping. The Na2SO4 additive was observed to play a noticeable role in promoting the sulfation degree of valuable metals by forming liquid phases [Na2Me(SO4)2] at the outermost layer, which can create a suitable dynamic environment for sulfation. Thus, addition of Na2SO4 might be conducive to an alternative metallurgical process involving complex sulfide ores.

Alternative sanitization methods for minimally processed lettuce in comparison to sodium hypochlorite.

Science.gov (United States)

Bachelli, Mara Lígia Biazotto; Amaral, Rívia Darla Álvares; Benedetti, Benedito Carlos

2013-01-01

Lettuce is a leafy vegetable widely used in industry for minimally processed products, in which the step of sanitization is the crucial moment for ensuring a safe food for consumption. Chlorinated compounds, mainly sodium hypochlorite, are the most used in Brazil, but the formation of trihalomethanes from this sanitizer is a drawback. Then, the search for alternative methods to sodium hypochlorite has been emerging as a matter of great interest. The suitability of chlorine dioxide (60 mg L(-1)/10 min), peracetic acid (100 mg L(-1)/15 min) and ozonated water (1.2 mg L(-1)/1 min) as alternative sanitizers to sodium hypochlorite (150 mg L(-1) free chlorine/15 min) were evaluated. Minimally processed lettuce washed with tap water for 1 min was used as a control. Microbiological analyses were performed in triplicate, before and after sanitization, and at 3, 6, 9 and 12 days of storage at 2 ± 1 °C with the product packaged on LDPE bags of 60 μm. It was evaluated total coliforms, Escherichia coli, Salmonella spp., psicrotrophic and mesophilic bacteria, yeasts and molds. All samples of minimally processed lettuce showed absence of E. coli and Salmonella spp. The treatments of chlorine dioxide, peracetic acid and ozonated water promoted reduction of 2.5, 1.1 and 0.7 log cycle, respectively, on count of microbial load of minimally processed product and can be used as substitutes for sodium hypochlorite. These alternative compounds promoted a shelf-life of six days to minimally processed lettuce, while the shelf-life with sodium hypochlorite was 12 days.

RLIM interacts with Smurf2 and promotes TGF-β induced U2OS cell migration

International Nuclear Information System (INIS)

Huang, Yongsheng; Yang, Yang; Gao, Rui; Yang, Xianmei; Yan, Xiaohua; Wang, Chenji; Jiang, Sirui; Yu, Long

2011-01-01

Highlights: → RLIM directly binds to Smurf2. → RLIM enhances TGF-β responsiveness in U2OS cells. → RLIM promotes TGF-β driven migration of osteosarcoma U2OS cells. -- Abstract: TGF-β (transforming growth factor-β), a pleiotropic cytokine that regulates diverse cellular processes, has been suggested to play critical roles in cell proliferation, migration, and carcinogenesis. Here we found a novel E3 ubiquitin ligase RLIM which can directly bind to Smurf2, enhancing TGF-β responsiveness in osteosarcoma U2OS cells. We constructed a U2OS cell line stably over-expressing RLIM and demonstrated that RLIM promoted TGF-β-driven migration of U2OS cells as tested by wound healing assay. Our results indicated that RLIM is an important positive regulator in TGF-β signaling pathway and cell migration.

[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].

Science.gov (United States)

Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W

2016-11-23

Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.

Fox-2 protein regulates the alternative splicing of scleroderma-associated lysyl hydroxylase 2 messenger RNA.

Science.gov (United States)

Seth, Puneet; Yeowell, Heather N

2010-04-01

Scleroderma (systemic sclerosis [SSc]) is a complex connective tissue disorder characterized by hardening and thickening of the skin. One hallmark of scleroderma is excessive accumulation of collagen accompanied by increased levels of pyridinoline collagen crosslinks derived from hydroxylysine residues in the collagen telopeptide domains. Lysyl hydroxylase 2 (LH2), an important alternatively spliced enzyme in collagen biosynthesis, acts as a collagen telopeptide hydroxylase. Changes in the pattern of LH2 alternative splicing, favoring increased inclusion of the alternatively spliced LH2 exon 13A, thereby increasing the levels of the long transcript of LH2 (LH2[long]), are linked to scleroderma disease. This study was undertaken to examine the role played by RNA binding protein Fox-2 in regulating exon 13A inclusion, which leads to the generation of scleroderma-associated LH2(long) messenger RNA (mRNA). Phylogenetic sequence analysis of introns flanking exon 13A was performed. A tetracycline-inducible system in T-Rex 293 cells was used to induce Fox-2 protein, and endogenous LH2(long) mRNA was determined by reverse transcriptase-polymerase chain reaction. An LH2 minigene was designed, validated, and used in Fox-2 overexpression and mutagenesis experiments. Knockdown of Fox-2 was performed in mouse embryonic fibroblasts and in fibroblasts from SSc patients. Overexpression of Fox-2 enhanced the inclusion of exon 13A and increased the generation of LH2(long) mRNA, whereas knockdown of Fox-2 decreased LH2(long) transcripts. Mutational analysis of an LH2 minigene demonstrated that 2 of the 4 Fox binding motifs flanking LH2 exon 13A are required for inclusion of exon 13A. In early passage fibroblasts derived from patients with scleroderma, the knockdown of Fox-2 protein significantly decreased the endogenous levels of LH2(long) mRNA. Our findings indicate that Fox-2 plays an integral role in the regulation of LH2 splicing. Knockdown of Fox-2 and other methods to decrease

Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells

Directory of Open Access Journals (Sweden)

Hsu Anna

2011-10-01

Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.

Examining the role of implementation quality in school-based prevention using the PATHS curriculum. Promoting Alternative THinking Skills Curriculum.

Science.gov (United States)

Kam, Chi-Ming; Greenberg, Mark T; Walls, Carla T

2003-03-01

In order for empirically validated school-based prevention programs to "go to scale," it is important to understand the processes underlying program dissemination. Data collected in effectiveness trials, especially those measuring the quality of program implementation and administrative support, are valuable in explicating important factors influencing implementation. This study describes findings regarding quality of implementation in a recent effectiveness trial conducted in a high-risk, American urban community. This delinquency prevention trial is a locally owned intervention, which used the Promoting Alternative THinking Skills Curriculum as its major program component. The intervention involved 350 first graders in 6 inner-city public schools. Three schools implemented the intervention and the other 3 were comparison schools from the same school district. Although intervention effects were not found for all the intervention schools, the intervention was effective in improving children's emotional competence and reducing their aggression in schools which effectively supported the intervention. This study, utilizing data from the 3 intervention schools (13 classrooms and 164 students), suggested that 2 factors contributed to the success of the intervention: (a) adequate support from school principals and (b) high degree of classroom implementation by teachers. These findings are discussed in light of the theory-driven models in program evaluation that emphasized the importance of the multiple factors influencing the implementation of school-based interventions.

Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene

International Nuclear Information System (INIS)

Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo

2006-01-01

In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains

Collaborative interplay between FGF-2 and VEGF-C promotes lymphangiogenesis and metastasis

DEFF Research Database (Denmark)

Cao, Renhai; Ji, Hong; Feng, Ninghan

2012-01-01

Interplay between various lymphangiogenic factors in promoting lymphangiogenesis and lymphatic metastasis remains poorly understood. Here we show that FGF-2 and VEGF-C, two lymphangiogenic factors, collaboratively promote angiogenesis and lymphangiogenesis in the tumor microenvironment, leading...... endothelial cell tip cell formation is a prerequisite for FGF-2-stimulated lymphangiogenesis. In the tumor microenvironment, the reciprocal interplay between FGF-2 and VEGF-C collaboratively stimulated tumor growth, angiogenesis, intratumoral lymphangiogenesis, and metastasis. Thus, intervention and targeting...

Methylobacterium populi VP2: Plant Growth-Promoting Bacterium Isolated from a Highly Polluted Environment for Polycyclic Aromatic Hydrocarbon (PAH Biodegradation

Directory of Open Access Journals (Sweden)

Valeria Ventorino

2014-01-01

Full Text Available The use of microorganisms to accelerate the natural detoxification processes of toxic substances in the soil represents an alternative ecofriendly and low-cost method of environmental remediation compared to harmful incineration and chemical treatments. Fourteen strains able to grow on minimal selective medium with a complex mixture of different classes of xenobiotic compounds as the sole carbon source were isolated from the soil of the ex-industrial site ACNA (Aziende Chimiche Nazionali Associate in Cengio (Savona, Italy. The best putative degrading isolate, Methylobacterium populi VP2, was identified using a polyphasic approach on the basis of its phenotypic, biochemical, and molecular characterisation. Moreover, this strain also showed multiple plant growth promotion activities: it was able to produce indole-3-acetic acid (IAA and siderophores, solubilise phosphate, and produce a biofilm in the presence of phenanthrene and alleviate phenanthrene stress in tomato seeds. This is the first report on the simultaneous occurrence of the PAH-degrading ability by Methylobacterium populi and its multiple plant growth-promoting activities. Therefore, the selected indigenous strain, which is naturally present in highly contaminated soils, is good candidate for plant growth promotion and is capable of biodegrading xenobiotic organic compounds to remediate contaminated soil alone and/or soil associated with plants.

Alternative Fuel News, Vol. 2, No. 5

Energy Technology Data Exchange (ETDEWEB)

NREL

1999-01-06

In this issue of the Alternative Fuel News, the authors remember what happened just 25 years ago (the energy crisis of 1973) and reiterate that foreign oil dependence is still a national issue. Highlighted are some the successes in the Clean Cities Program and the alternative fuels industry. Also featured is the Natural Gas Vehicle Coalition (NGVC) and the United States Postal Service (USPS) delivers with AFVs.

Providing training enhances the biomechanical improvements of an alternative computer mouse design

NARCIS (Netherlands)

Houwink, A.; Oude Hengel, K.M.; Odell, D.; Dennerlein, J.T.

2009-01-01

To determine if an alternative mouse promotes more neutral postures and decreases forearm muscle activity and if training enhances these biomechanical benefits is the purpose of the study. Computer mouse use is a risk factor for developing musculoskeletal disorders; alternative mouse designs can

A New Challenge for Alternative Energy

Institute of Scientific and Technical Information of China (English)

Editorial Department of China Power Enterprise Management

2009-01-01

@@ The year 2008 sees a turning point in China's strategy of promoting energy saving and emissions reduction,as well as development of renewable energy.Oil price breaking US$140 and large area in China suffering from ice and snow disaster,a result of global warming,have both stressed the importance of developing alternative energy.Today,alterative energy accounts for a very small portion in China's power industry.Therefore,it is imminently required to speed up energy restructuring,to vigorously develop power generation with alternative energy such as nuclear energy,hydroenergy,wind energy,solar energy,biomass energy,geothermic energy,thus to realize sustainable development.

CR2-mediated activation of the complement alternative pathway results in formation of membrane attack complexes on human B lymphocytes

DEFF Research Database (Denmark)

Nielsen, C H; Marquart, H V; Prodinger, W M

2001-01-01

of the CR1 binding site with the monoclonal antibody 3D9 also resulted in a minor reduction in MAC deposition, while FE8 and 3D9, in combination, markedly reduced deposition of both C3 fragments (91 +/- 5%) and C9 (95 +/- 3%). The kinetics of C3-fragment and MAC deposition, as well as the dependence of both......Normal human B lymphocytes activate the alternative pathway of complement via complement receptor type 2 (CR2, CD21), that binds hydrolysed C3 (iC3) and thereby promotes the formation of a membrane-bound C3 convertase. We have investigated whether this might lead to the generation of a C5...... convertase and consequent formation of membrane attack complexes (MAC). Deposition of C3 fragments and MAC was assessed on human peripheral B lymphocytes in the presence of 30% autologous serum containing 4.4 mM MgCl2/20 mM EGTA, which abrogates the classical pathway of complement without affecting...

Catalysts Promoted with Niobium Oxide for Air Pollution Abatement

Directory of Open Access Journals (Sweden)

Wendi Xiang

2017-05-01

Full Text Available Pt-containing catalysts are currently used commercially to catalyze the conversion of carbon monoxide (CO and hydrocarbon (HC pollutants from stationary chemical and petroleum plants. It is well known that Pt-containing catalysts are expensive and have limited availability. The goal of this research is to find alternative and less expensive catalysts to replace Pt for these applications. This study found that niobium oxide (Nb2O5, as a carrier or support for certain transition metal oxides, promotes oxidation activity while maintaining stability, making them candidates as alternatives to Pt. The present work reports that the orthorhombic structure of niobium oxide (formed at 800 °C in air promotes Co3O4 toward the oxidation of both CO and propane, which are common pollutants in volatile organic compound (VOC applications. This was a surprising result since this structure of Nb2O5 has a very low surface area (about 2 m2/g relative to the more traditional Al2O3 support, with a surface area of 150 m2/g. The results reported demonstrate that 1% Co3O4/Nb2O5 has comparable fresh and aged catalytic activity to 1% Pt/γ-Al2O3 and 1% Pt/Nb2O5. Furthermore, 6% Co3O4/Nb2O5 outperforms 1% Pt/Al2O3 in both catalytic activity and thermal stability. These results suggest a strong interaction between niobium oxide and the active component—cobalt oxide—likely by inducing an oxygen defect structure with oxygen vacancies leading to enhanced activity toward the oxidation of CO and propane.

Promoter characterization and genomic organization of the human X11β gene APBA2.

LENUS (Irish Health Repository)

Hao, Yan

2012-02-15

Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

Mutational analysis of the UCP2 core promoter and relationships of variants with obesity

DEFF Research Database (Denmark)

Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H

2003-01-01

To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....

Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

Science.gov (United States)

Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

2017-01-01

Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

Characterization of the promoter region of the human c-erbB-2 protooncogene

International Nuclear Information System (INIS)

Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

1987-01-01

Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

The Socio-economics and Alternative Livelihood Options of Fishers ...

African Journals Online (AJOL)

The Socio-economics and Alternative Livelihood Options of Fishers of Lake Victoria, ... PROMOTING ACCESS TO AFRICAN RESEARCH ... Most fishers were males aged 29-38yrs while women were involved in processing and marketing.

Identification of an ovine atadenovirus gene whose product activates the viral E2 promoter: possible involvement of E2F-1

International Nuclear Information System (INIS)

Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter

2004-01-01

Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth

Identification and characterization of a bile salt hydrolase from Lactobacillus salivarius for development of novel alternatives to antibiotic growth promoters.

Science.gov (United States)

Wang, Zhong; Zeng, Ximin; Mo, Yiming; Smith, Katie; Guo, Yuming; Lin, Jun

2012-12-01

Antibiotic growth promoters (AGPs) have been used as feed additives to improve average body weight gain and feed efficiency in food animals for more than 5 decades. However, there is a worldwide trend to limit AGP use to protect food safety and public health, which raises an urgent need to discover effective alternatives to AGPs. The growth-promoting effect of AGPs has been shown to be highly correlated with the decreased activity of intestinal bile salt hydrolase (BSH), an enzyme that is produced by various gut microflora and involved in host lipid metabolism. Thus, BSH inhibitors are likely promising feed additives to AGPs to improve animal growth performance. In this study, the genome of Lactobacillus salivarius NRRL B-30514, a BSH-producing strain isolated from chicken, was sequenced by a 454 GS FLX sequencer. A BSH gene identified by genome analysis was cloned and expressed in an Escherichia coli expression system for enzymatic analyses. The BSH displayed efficient hydrolysis activity for both glycoconjugated and tauroconjugated bile salts, with slightly higher catalytic efficiencies (k(cat)/K(m)) on glycoconjugated bile salts. The optimal pH and temperature for the BSH activity were 5.5 and 41°C, respectively. Examination of a panel of dietary compounds using the purified BSH identified some potent BSH inhibitors, in which copper and zinc have been recently demonstrated to promote feed digestion and body weight gain in different food animals. In sum, this study identified and characterized a BSH with broad substrate specificity from a chicken L. salivarius strain and established a solid platform for us to discover novel BSH inhibitors, the promising feed additives to replace AGPs for enhancing the productivity and sustainability of food animals.

Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

Directory of Open Access Journals (Sweden)

Rachel M. Woodfint

2017-01-01

Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

Reduced MeCP2 expression is frequent in autism frontal cortex and correlates with aberrant MECP2 promoter methylation.

Science.gov (United States)

Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M

2006-01-01

Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.

A STUDY ON LIMITATION OF GOVERNMENT INITIATIVE MODEL FOR ALTERNATIVE FUEL VEHICLE (AFV PROMOTION IN CHINA

Directory of Open Access Journals (Sweden)

Byunghun Choi

2016-04-01

Full Text Available Chinese responsibility for reducing Greenhouse Gas or carbon dioxide emission increases continuously. Chinese government suggested two targets; Alternative Fuel Vehicle output volume 500 thousand and AFV market share 5% by the end of 2011. However any of two targets did not come true. Therefore this study accessed the question, ‘why Chinese government initiative model for AFV promotion has been so poor?’ This study reviewed the transition process for AFV policies in China and made a structural analysis for three key policies since 2009. As a result the number of articles for related industries or factor endowments was relatively more than firm strategy or demand conditions. Also this study accessed the AFV strategy of Six SOEs from the perspective of social responsibility. Six SOEs have more concentrated on electric vehicle rather than hybrid vehicle with following the government leadership. However major EV or HEV models of them mostly were made by Joint Ventures being under control of foreign makers and the JVs have actually controlled over AFV business. So the limitation of Chinese government initiative model resulted from supplier-centric approach with targeting for public transportation and institution consumer, and it caused a failure to create the demand conditions of general customers.

Literacy, Numeracy and Alternative Dispute Resolution

Science.gov (United States)

Cumming, J. Joy; Wilson, Janice M.

2005-01-01

The formal court system in Australia has long been criticised for its adversarial nature. As a result, there has been an increase in the use of alternative dispute resolution processes such as mediation. These are promoted as a means of increasing access to justice by disadvantaged groups and as an inexpensive way of solving legal or quasi-legal…

CO_2 capture from flue gas using clathrate formation in the presence of thermodynamic promoters

International Nuclear Information System (INIS)

Kim, Soyoung; Choi, Sung-Deuk; Seo, Yongwon

2017-01-01

Tetrahydrofuran (THF) as a water-soluble sII clathrate former, cyclopentane (CP) as a water-insoluble sII clathrate former, and tetra n-butyl ammonium chloride (TBAC) as a water-soluble semiclathrate former were used to investigate their thermodynamic promotion effects on clathrate-based CO_2 capture from simulated flue gas. The phase equilibria of CO_2 (20%) + N_2 (80%) + promoter clathrates at different promoter concentrations revealed that the presence of THF, CP, and TBAC could significantly reduce the clathrate formation pressure. THF solutions provided the highest gas uptake and steepest CO_2 concentration changes in the vapor phase, whereas TBAC solutions showed the highest CO_2 selectivity (∼61%) in the clathrate phase. CP solutions exhibited a slower formation rate, but their final gas uptake and CO_2 selectivity in the clathrate phase were comparable to the THF solutions. Raman spectroscopy confirmed the enclathration of both CO_2 and N_2 in the clathrate cages and a structural transition due to the inclusion of promoters in the clathrate phase. The overall experimental results indicate that TBAC is a viable thermodynamic promoter for clathrate-based CO_2 capture from simulated flue gas, considering the lower pressure requirement for clathrate formation, higher CO_2 enrichment in the clathrate phase, non-toxicity, and non-volatility. - Highlights: • Clathrate-based CO_2 capture was investigated in the presence of thermodynamic promoters. • THF, CP, and TBAC demonstrated a significant thermodynamic promotion for CO_2 (20%) + N_2 (80%) clathrates. • The highest gas uptake was observed for the THF (5.6 mol%) solution. • TBAC solutions showed the highest CO_2 selectivity in the clathrate phase (∼61%). • Raman spectroscopy confirmed the guest gas enclathration and clathrate structure.

28 CFR 600.2 - Alternatives available to the Attorney General.

Science.gov (United States)

2010-07-01

... GENERAL POWERS OF SPECIAL COUNSEL § 600.2 Alternatives available to the Attorney General. When matters are brought to the attention of the Attorney General that might warrant consideration of appointment of a Special Counsel, the Attorney General may: (a) Appoint a Special Counsel; (b) Direct that an initial...

Alternative sanitization methods for minimally processed lettuce in comparison to sodium hypochlorite

Directory of Open Access Journals (Sweden)

Mara Lígia Biazotto Bachelli

2013-09-01

Full Text Available Lettuce is a leafy vegetable widely used in industry for minimally processed products, in which the step of sanitization is the crucial moment for ensuring a safe food for consumption. Chlorinated compounds, mainly sodium hypochlorite, are the most used in Brazil, but the formation of trihalomethanes from this sanitizer is a drawback. Then, the search for alternative methods to sodium hypochlorite has been emerging as a matter of great interest. The suitability of chlorine dioxide (60 mg L-1/10 min, peracetic acid (100 mg L-1/15 min and ozonated water (1.2 mg L-1 /1 min as alternative sanitizers to sodium hypochlorite (150 mg L-1 free chlorine/15 min were evaluated. Minimally processed lettuce washed with tap water for 1 min was used as a control. Microbiological analyses were performed in triplicate, before and after sanitization, and at 3, 6, 9 and 12 days of storage at 2 ± 1 ºC with the product packaged on LDPE bags of 60 µm. It was evaluated total coliforms, Escherichia coli, Salmonella spp., psicrotrophic and mesophilic bacteria, yeasts and molds. All samples of minimally processed lettuce showed absence of E. coli and Salmonella spp. The treatments of chlorine dioxide, peracetic acid and ozonated water promoted reduction of 2.5, 1.1 and 0.7 log cycle, respectively, on count of microbial load of minimally processed product and can be used as substitutes for sodium hypochlorite. These alternative compounds promoted a shelf-life of six days to minimally processed lettuce, while the shelf-life with sodium hypochlorite was 12 days.

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

Science.gov (United States)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Genome-wide function of H2B ubiquitylation in promoter and genic regions.

Science.gov (United States)

Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

2011-11-01

Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

on some properties of the alternating sylvester series and alternating

African Journals Online (AJOL)

DJFLEX

. (iii) above is known in literature as the alternating Sylvester series while (iv) is known as the alternating Engel expansion (Kalpazidou and Ganatsiou (1991)). We are interested in studying the properties of these alternating series. Theorem 2: ...

77 FR 17457 - Work Group on Alternative Test Methods for Commercial Measuring Devices

Science.gov (United States)

2012-03-26

... DEPARTMENT OF COMMERCE National Institute of Standards and Technology Work Group on Alternative... Work Group (WG) to examine alternative methods for testing the accuracy of commercial measuring devices... participates to promote uniformity among the states in laws, regulations, methods, and testing equipment that...

Promoting environmental sustainability via an expert elicitation process

International Nuclear Information System (INIS)

Swor, Tom; Canter, Larry

2011-01-01

Environmental sustainability (ES) planning was applied to the 981-mile, commercially navigable Ohio River. Navigation improvement needs were identified within the broad study along with actions to restore aquatic and riparian ecological resources to a higher state of sustainability. The actions were identified via an Expert Elicitation Process (EEP) involving aquatic and riparian/terrestrial experts knowledgeable of Ohio River resources. The received information was synthesized into goals for the selected resources (Valued Ecosystem Components - or VECs), actions or measures to attain the goals, and monitoring to evaluate conditions. Finally, 26 types of ES actions were identified and classified into three ES alternatives. These alternatives were then evaluated relative to key decision criteria, and such evaluations, based on pertinent decision criteria, were also conducted for four navigation improvement alternatives. Finally, the best combination of ES and navigation alternatives was identified. The key lessons derived from this use of EEP were that: (1) EEP can support the preliminary identification of ES measures; however, more detailed study of specific designs and cost evaluations will be necessary; (2) the method promotes collaboration between key scientists and policymakers from governmental agencies and private sectors, and such collaboration will ultimately provide the foundation for implementation of sustainability actions; and (3) an effective EEP does not occur by accident, it requires careful planning, implementation, and documentation. - Research Highlights: → Use of an Expert Elicitation Process (EEP) is demonstrated in this study. → EEP was used to identify Environmental Sustainability (ES) needs for the Ohio River. → EEP helped develop consensus among resource experts on ES needs. → EEP promotes collaboration to identify and contribute to common resource goals. → EEP may be used in assessing cumulative effects and formulating restoration

Complementary and alternative medicine usage and its determinant factors among Iranian infertile couples.

Science.gov (United States)

Dehghan, Mahlagha; Mokhtarabadi, Sima; Heidari, Fatemeh Ghaedi

2018-04-04

Background The aim of this study was to determine the status of utilizing some complementary and alternative medicine techniques in infertile couples. Methods This was a cross-sectional study conducted on 250 infertile couples referred to a hospital in Kerman using convenience sampling. A researcher-made questionnaire was used to study the prevalence and user satisfaction of complementary and alternative medicines. Results Results indicated that 49.6% of the infertile couples used at least one of the complementary and alternative medicines during the past year. Most individuals used spiritual techniques (71.8% used praying and 70.2% used Nazr) and medicinal plants (54.8%). Safety is the most important factor affecting the satisfaction of infertile couples with complementary treatments (couples think that such treatments are safe (54.8%)). Discussion Concerning high prevalence of complementary and alternative treatments in infertile couples, incorporating such treatments into the healthcare education and promoting the awareness of infertile individuals seem crucial.

Alternative Educational Futures for a Knowledge Society

Science.gov (United States)

Young, Michael

2010-01-01

This article offers a critical analysis of recent trends in educational policy with particular reference to their assumptions about the knowledge society. It examines the implications of the analysis for the issue of elitism and the promotion of greater educational equality. The article concludes by offering an alternative approach to educational…

Simulation of remediation alternatives for a 137Cs contaminated soil

International Nuclear Information System (INIS)

Bea, S.A.; Carrera, J.; Saaltink, M.; Soler, J.M.; Ayora, C.

2004-01-01

We analyze remediation alternatives for a soil contaminated with 137 Cs, which sorbs strongly to clay aggregates where water flux is negligible. The mobile portion of the soil (macropores) retains little water and cesium. Some of the remediation alternatives involve infiltration of seawater enriched with KCl, to promote mobilization of Cs through exchange with K. Therefore, a fully coupled reactive transport model is used to test these alternatives. We conclude that flushing is a viable alternative, provided that some recommendations, derived from the modelling exercise are followed. These include high rate periodic infiltration and draining, as well as performing infiltration from independent cells to limit the effect of preferential flowpaths. (orig.)

RBP2 Promotes Adult Acute Lymphoblastic Leukemia by Upregulating BCL2.

Directory of Open Access Journals (Sweden)

Xiaoming Wang

Full Text Available Despite recent increases in the cure rate of acute lymphoblastic leukemia (ALL, adult ALL remains a high-risk disease that exhibits a high relapse rate. In this study, we found that the histone demethylase retinoblastoma binding protein-2 (RBP2 was overexpressed in both on-going and relapse cases of adult ALL, which revealed that RBP2 overexpression was not only involved in the pathogenesis of ALL but that its overexpression might also be related to relapse of the disease. RBP2 knockdown induced apoptosis and attenuated leukemic cell viability. Our results demonstrated that BCL2 is a novel target of RBP2 and supported the notion of RBP2 being a regulator of BCL2 expression via directly binding to its promoter. As the role of RBP2 in regulating apoptosis was confirmed, RBP2 overexpression and activation of BCL2 might play important roles in ALL development and progression.

The promotive effect of N 2 fixers, Bacillus circulans and ...

African Journals Online (AJOL)

The promotive effect of N 2 fixers, Bacillus circulans and Saccharomyces cerevisiae on the viability of native arbuscular mycorrhizal fungi and the impact on the productivity of alfalfa ( Medicago sativa l.)

miR-181a Induces Macrophage Polarized to M2 Phenotype and Promotes M2 Macrophage-mediated Tumor Cell Metastasis by Targeting KLF6 and C/EBPα

Directory of Open Access Journals (Sweden)

Jia Bi

2016-01-01

Full Text Available Macrophages can acquire a variety of polarization status and functions: classically activated macrophages (M1 macrophages; alternatively activated macrophages (M2 macrophages. However, the molecular basis of the process is still unclear. Here, this study addresses that microRNA-181a (miR-181a is a key molecule controlling macrophage polarization. We found that miR-181a is overexpressed in M2 macrophages than in M1 macrophages. miR-181a expression was decreased when M2 phenotype converted to M1, whereas it increased when M1 phenotype converted to M2. Overexpression of miR-181a in M1 macrophages diminished M1 phenotype expression while promoting polarization to the M2 phenotype. In contrast, knockdown of miR-181a in M2 macrophages promoted M1 polarization and diminished M2 phenotype expression. Mechanistically, Bioinformatic analysis revealed that Kruppel-like factor 6 (KLF6 and CCAAT/enhancer binding protein-α (C/EBPα is a potential target of miR-181a and luciferase assay confirmed that KLF6 and C/EBPα translation is suppressed by miR-181a through interaction with the 3′UTR of KLF6 and C/EBPα mRNA. Further analysis showed that induction of miR-181a suppressed KLF6 and C/EBPα protein expression. Importantly, miR-181a also diminishes M2 macrophages-mediated migration and invasion capacity of tumor cells. Collectively, our results suggest that miR-181a plays a significant role in regulating macrophage polarization through directly target KLF6 and C/EBPα.

There is No Alternative: The Critical Potential of Alternative Media in the Face of Neoliberalism.

OpenAIRE

Linus Andersson

2012-01-01

The article discusses the concept of “the alternative” and the media through four sections. The first section discusses neoliberalism and the connection between neoliberal doctrine and mainstream media. This connection is described as promoting “public amnesia”, financialization and economization of news journalism, and social divide. The second section discusses alternative media from the perspective of new social movements and symbolic resistance, claiming that the symbolic resistance frame...

77 FR 40358 - Meeting of the Scientific Advisory Committee on Alternative Toxicological Methods (SACATM)

Science.gov (United States)

2012-07-09

..., revised, and alternative safety testing methods with regulatory applicability and promotes the scientific... DEPARTMENT OF HEALTH AND HUMAN SERVICES Meeting of the Scientific Advisory Committee on Alternative Toxicological Methods (SACATM) AGENCY: Division of the National Toxicology Program (DNTP...

A methodology for assessing the market benefits of alternative motor fuels: The Alternative Fuels Trade Model

Energy Technology Data Exchange (ETDEWEB)

Leiby, P.N.

1993-09-01

This report describes a modeling methodology for examining the prospective economic benefits of displacing motor gasoline use by alternative fuels. The approach is based on the Alternative Fuels Trade Model (AFTM). AFTM development was undertaken by the US Department of Energy (DOE) as part of a longer term study of alternative fuels issues. The AFTM is intended to assist with evaluating how alternative fuels may be promoted effectively, and what the consequences of substantial alternative fuels use might be. Such an evaluation of policies and consequences of an alternative fuels program is being undertaken by DOE as required by Section 502(b) of the Energy Policy Act of 1992. Interest in alternative fuels is based on the prospective economic, environmental and energy security benefits from the substitution of these fuels for conventional transportation fuels. The transportation sector is heavily dependent on oil. Increased oil use implies increased petroleum imports, with much of the increase coming from OPEC countries. Conversely, displacement of gasoline has the potential to reduce US petroleum imports, thereby reducing reliance on OPEC oil and possibly weakening OPEC`s ability to extract monopoly profits. The magnitude of US petroleum import reduction, the attendant fuel price changes, and the resulting US benefits, depend upon the nature of oil-gas substitution and the supply and demand behavior of other world regions. The methodology applies an integrated model of fuel market interactions to characterize these effects.

Understanding promotion of photocatalytic activity of TiO2 by Au nanoparticles

NARCIS (Netherlands)

Amrollahi Buky, Rezvaneh; Hamdy, Mohamed S.; Mul, Guido

2014-01-01

Au nanoparticles prepared by deposition–precipitation were evaluated in promoting photocatalytic activity of TiO2 (P25) in the oxidation of methylcyclohexane. At 375 nm and in particular at 425 nm, Au was found to significantly enhance the rate induced by P25. Illumination of Au-promoted P25 at 525

Economic impact of ethanol promotion in Mexico: A general equilibrium analysis

International Nuclear Information System (INIS)

Elizondo, Alejandra; Boyd, Roy

2017-01-01

In this paper we analyze the economic impact of a decision to produce ethanol in Mexico, comparing the effect of a subsidy to initiate ethanol production with that of alternative public policies. Public support of biofuels has been a public policy goal since 2008, and the promotion of ethanol remains an active part of the government agenda. The evidence used to encourage or alter the policy is (by necessity) chiefly based on international experience. In this study we use a computable general equilibrium model (CGE) to estimate the impact of ethanol production on the Mexican economy. Using cost data from Brazil we introduce ethanol into a Mexican social accounting matrix, and insert a latent sector into the model to analyze ethanol promotion. Our results show that subsidies to ethanol would increase agriculture production but at the expense of aggregate welfare. By contrast, alternative 'clean energy' policies appear to advance economic growth to a greater extent. - Highlights: • A CGE model is used to estimate the impact of ethanol promotion in Mexico. • The benefits of a policy designed to promote the use of ethanol are rather small. • The rural sector benefits modestly, but production in other sectors decrease. • Alternative policies advance economic growth and welfare to a greater extent.

Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.

Science.gov (United States)

Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela

2014-01-01

Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.

Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.

Directory of Open Access Journals (Sweden)

Inga Hinrichsen

Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.

The flavonoid fisetin promotes osteoblasts differentiation through Runx2 transcriptional activity.

Science.gov (United States)

Léotoing, Laurent; Davicco, Marie-Jeanne; Lebecque, Patrice; Wittrant, Yohann; Coxam, Véronique

2014-06-01

Flavonoids represent a group of polyphenolic compounds commonly found in daily nutrition with proven health benefits. Among this group, the flavonol fisetin has been previously shown to protect bone by repressing osteoclast differentiation. In the present study, we investigated the role of fisetin in regulating osteoblasts physiology. In vivo mice treated with LPSs exhibited osteoporosis features associated with a dramatic repression of osteoblast marker expression. In this model, inhibition of osteocalcin and type I collagen alpha 1 transcription was partially countered by a daily consumption of fisetin. Interestingly, in vitro, fisetin promoted both osteoblast alkaline phosphatase activity and mineralization process. To decipher how fisetin may exert its positive effect on osteoblastogenesis, we analyzed its ability to control the runt-related transcription factor 2 (Runx2), a key organizer in developing and maturing osteoblasts. While fisetin did not impact Runx2 mRNA and protein levels, it upregulated its transcriptional activity. Actually, fisetin stimulated the luciferase activity of a reporter plasmid driven by the osteocalcin gene promoter that contains Runx2 binding sites and promoted the mRNA expression of osteocalcin and type I collagen alpha 1 targets. Bone sparing properties of fisetin also rely on its positive influence on osteoblast differentiation and activity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria.

Science.gov (United States)

Zhou, Jie; Zhang, Haifeng; Meng, Hengkai; Zhu, Yan; Bao, Guanhui; Zhang, Yanping; Li, Yin; Ma, Yanhe

2014-03-28

Cyanobacteria are oxygenic photosynthetic prokaryotes that play important roles in the global carbon cycle. Recently, engineered cyanobacteria capable of producing various small molecules from CO2 have been developed. However, cyanobacteria are seldom considered as factories for producing proteins, mainly because of the lack of efficient strong promoters. Here, we report the discovery and verification of a super-strong promoter P(cpc560), which contains two predicted promoters and 14 predicted transcription factor binding sites (TFBSs). Using P(cpc560), functional proteins were produced at a level of up to 15% of total soluble protein in the cyanobacterium Synechocystis sp. 6803, a level comparable to that produced in Escherichia coli. We demonstrated that the presence of multiple TFBSs in P(cpc560) is crucial for its promoter strength. Genetically transformable cyanobacteria neither have endotoxins nor form inclusion bodies; therefore, P(cpc560) opens the possibility to use cyanobacteria as alternative hosts for producing heterogeneous proteins from CO2 and inorganic nutrients.

Second interim report of the Interagency Commission on Alternative Motor Fuels

International Nuclear Information System (INIS)

1991-09-01

This report describes progress the commission and government agencies have made in implementing the provisions of the Alternative Motor Fuels Act of 1988, assessing the role of alternative motor fuels in the US transportation sector, and developing policies to promote the use of alternative fuels. The alternative motor-fuels policies proposed in the National Energy Strategy (NES) are described and shows how they compose an effective long-term plan to encourage the widespread use of alternative motor fuels. The progress to date of the Department of Energy (DOE) and other agencies in implementing the programs required by the AMFA is reported. A detailed scenario of future alternative-fuel use that displaces 2.5 million barrels per day (MMBD) of petroleum and a feasible path of vehicle production and fuel supply leading to that goal is described. An analytical tool for exploring and quantifying the energy market impacts of alternative fuels, the Alternative Fuels Trade Model (AFTM), is described. The AFTM provides a means of investigating the impacts of alternative fuels in interrelated world energy markets for petroleum and natural gas. Several major initiatives have recently been enacted that have important ramifications for alternative-fuels policy. The Clean Air Act Amendments of 1990 contain provisions mandating the use of nonpetroleum oxygenates in reformulated gasoline. Other provisions for much more stringent emissions standards may affect the ability of manufacturers to make and sell conventional-fuel vehicles or, at the very least, affect their cost-effectiveness in comparison to cleaner alternative-fuel vehicles (AFV's). Finally, the key areas in which technological advances could substantially improve the competitiveness of AFV technologies in the marketplace are reviewed

Antibiotics in Canadian poultry productions and anticipated alternatives

Directory of Open Access Journals (Sweden)

Moussa Sory Diarra

2014-06-01

Full Text Available The use of antibiotics in food-producing animals has significantly increased animal health by lowering mortality and the incidence of diseases. Antibiotics also have largely contributed to increase productivity of farms. However, antibiotic usage in general and relevance of non-therapeutic antibiotics in feed (growth promoters need to be reevaluated especially because bacterial pathogens of humans and animals have developed and shared a variety of antibiotic resistance mechanisms that can easily spread within microbial communities. In Canada, poultry production involves more than 2,600 regulated chicken producers. There are several antibiotics approved as feed additives available for poultry farmers. Feed recipes and mixtures greatly vary geographically and from one farm to another, making links between use of a specific antibiotic feed additive and production yields or selection of specific antibiotic-resistant bacteria difficult to establish. Many on-farm studies have revealed the widespread presence of antibiotic-resistant bacteria in broiler chickens. While sporadic reports linked the presence of antibiotic-resistant organisms to the use of feed supplemented with antibiotics, no recent studies could clearly demonstrate the benefit of antimicrobial growth promoters on performance and production yields. With modern biosecurity and hygienic practices, there is a genuine concern that intensive utilization of antibiotics or use of antimicrobial growth promoters in feed might no longer be useful. Public pressure and concerns about food and environmental safety (antibiotic residues, antibiotic-resistant pathogens have driven researchers to actively look for alternatives to antibiotics. Some of the alternatives include pre- and probiotics, organic acids and essential oils. We will describe here the properties of some bioactive molecules, like those found in cranberry, which have shown interesting polyvalent antibacterial and immuno

Promoted V2O5/TiO2 catalysts for selective catalytic reduction of NO with NH3 at low temperatures

DEFF Research Database (Denmark)

Putluru, Siva Sankar Reddy; Schill, Leonhard; Godiksen, Anita

2016-01-01

characterized by N2 physisorption, XRPD, NH3-TPD, H2-TPR, Raman, FTIR and EPR spectroscopy to investigate the properties of the catalysts. XRPD, Raman and FTIR showed that promotion with 15 wt.% HPA does not cause V2O5 to be present in crystalline form, also at a loading of 5 wt.% V2O5. Hence, use of HPAs does......The influence of varying the V2O5 content (3–6 wt.%) was studied for the selective catalytic reduction (SCR) of nitrogen oxides by ammonia on heteropoly acid (HPA)- and tungsten oxide (WO3)-promoted V2O5/TiO2 catalysts. The SCR activity and alkali deactivation resistance of HPA-promoted V2O5/TiO2...... catalysts was found to be much higher than for WO3-promoted catalysts. By increasing the vanadium content from 3 to 5 wt.% the catalysts displayed a two fold increase in activity at 225 °C and retained their initial activity after alkali doping at a molar K/V ratio of 0.181. Furthermore, the catalysts were...

Smad4-dependent suppressor pituitary homeobox 2 promotes PPP2R2A-mediated inhibition of Akt pathway in pancreatic cancer.

Science.gov (United States)

Wang, Qi; Li, Juanjuan; Wu, Wei; Shen, Ruizhe; Jiang, He; Qian, Yuting; Tang, Yanping; Bai, Tingting; Wu, Sheng; Wei, Lumin; Zang, Yi; Zhang, Ji; Wang, Lifu

2016-03-08

The importance of Pituitary homeobox 2 (Pitx2) in malignancy remains enigmatic, and Pitx2 has not been previously implicated in pancreatic ductal adenocarcinoma (PDAC). In this study, we performed gene expression profiling of human PDAC tissues and identified Pitx2 as a promising candidate. Pitx2 expression was decreased from 2.6- to 19-fold in human PDAC tissues from microarray units. Immunochemistry staining showed that Pitx2 expression was moderate to intense in normal pancreatic and pancreatic intraepithelial neoplastic lesions, whereas low in human PDAC tissues. The Pitx2 levels correlated with overall patient survival post-operatively in PDAC. Induction of Pitx2 expression partly inhibited the malignant phenotype of PDAC cells. Interestingly, low Pitx2 expression was correlated with Smad4 mutant inactivation, but not with Pitx2 DNA-methylation. Furthermore, Smad4 protein bound to Pitx2 promoter and stimulated Pitx2 expression in PDAC. In addition, Pitx2 protein bound to the promoter of the protein phosphatase 2A regulatory subunit B55α (PPP2R2A) and upregulated PPP2R2A expression, which may activate dephosphorylation of Akt in PDAC. These findings provide new mechanistic insights into Pitx2 as a tumor suppressor in the downstream of Smad4. And Pitx2 protein promotes PPP2R2A expression which may inhibit Akt pathway. Therefore, we propose that the Smad4-Pitx2-PPP2R2A axis, a new signaling pathway, suppresses the pancreatic carcinogenesis.

CD147 reinforces [Ca2+]i oscillations and promotes oncogenic progression in hepatocellular carcinoma.

Science.gov (United States)

Tang, Juan; Guo, Yun-Shan; Yu, Xiao-Ling; Huang, Wan; Zheng, Ming; Zhou, Ying-Hui; Nan, Gang; Wang, Jian-Chao; Yang, Hai-Jiao; Yu, Jing-Min; Jiang, Jian-Li; Chen, Zhi-Nan

2015-10-27

Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC) metastasis and proliferation by enhancing the amplitude and frequency of [Ca2+]i oscillations in HCC cells. CD147 activates two distinct signaling pathways to regulate [Ca2+]i oscillations. By activating FAK-Src-IP3R1 signaling pathway, CD147 promotes Ca2+ release from endoplasmic reticulum (ER) and enhances the amplitude of [Ca2+]i oscillations. Furthermore, CD147 accelerates ER Ca2+refilling and enhances the frequency of [Ca2+]i oscillations through activating CaMKP-PAK1-PP2A-PLB-SERCA signaling pathway. Besides, CD147-promoted ER Ca2+ release and refilling are tightly regulated by changing [Ca2+]i. CD147 may activate IP3R1 channel under low [Ca2+]i conditions and CD147 may activate SERCA pump under high [Ca2+]i conditions. CD147 deletion suppresses HCC tumorigenesis and increases the survival rate of liver-specific CD147 knockout mice by regulating [Ca2+]i oscillations in vivo. Together, these results reveal that CD147 functions as a critical regulator of ER-dependent [Ca2+]i oscillations to promote oncogenic progression in HCC.

Analysis of the tumor-promoting potency of 2,4,4'-trichlorobiphenyl and 2,2',4,5,5'-pentachlorobiphenyl in rat liver

Energy Technology Data Exchange (ETDEWEB)

Kunz, S.; Schmitz, H.J.; Schrenk, D. [Kaiserslautern Univ. (Germany). Dept. of Food Chemistry and Environmental Toxicology; Buchmann, A.; Schwarz, M. [Tuebingen Univ. (Germany). Inst. of Toxicology; Schilling, B.; Paepke, O. [ERGO Research, Hamburg (Germany); Robertson, L.W.; Lehmler, H.J. [Iowa Univ, Iowa City, IA (United States). Dept. of Occupational and Environmental Health

2004-09-15

Polychlorinated biphenyls (PCBs) are potent persistent environmental pollutants exhibiting neurotoxic, teratogenic and tumor-promoting effects in experimental animal models. PCB congeners can be divided into 'dioxin-like' and 'non-dioxin-like' congeners on the basis of their ability to act as aryl hydrocarbon receptor (AhR) agonists. Like the most toxic dioxin congener 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 'dioxin-like' PCBs bind to the AhR and show characteristic effects on the expression of AhR-regulated genes including the induction of cytochrome P450 (CYP) 1A1. On the other hand, 'non-dioxin-like' PCB congeners have a lower or no binding affinity to the AhR, but exhibit a 'phenobarbital-type' induction of CYP 2B1/2 activity. The tumor-promoting potency of several PCBs has been demonstrated in two-stage initiation-promotion experiments in rat liver. Preneoplastic cell clones, targets for tumor promotion, can be identified as phenotypically altered foci showing characteristic enzyme patterns including the decreased activity of adenosine triphosphatase (ATPase) or the increased expression of the placental form of gluthatione S-transferase (GSTP). In the present study, the effect of the 'non-dioxin-like' 2,4,4'-trichlorobiphenyl (PCB 28) and 2,2',4,5,5'-pentachlorobiphenyl (PCB 101) on the promotion of enzyme-altered hepatic foci was investigated in female Wistar rats after initiation with diethylnitrosamine (DEN).

CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53

International Nuclear Information System (INIS)

Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu

2017-01-01

Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.

Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

Directory of Open Access Journals (Sweden)

Jianqing Pan

Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.

Carcinoma associated fibroblasts (CAFs) promote breast cancer motility by suppressing mammalian Diaphanous-related formin-2 (mDia2).

Science.gov (United States)

Dvorak, Kaitlyn M; Pettee, Krista M; Rubinic-Minotti, Kaitlin; Su, Robin; Nestor-Kalinoski, Andrea; Eisenmann, Kathryn M

2018-01-01

The tumor microenvironment (TME) promotes tumor cell invasion and metastasis. An important step in the shift to a pro-cancerous microenvironment is the transformation of normal stromal fibroblasts to carcinoma-associated fibroblasts (CAFs). CAFs are present in a majority of solid tumors and can directly promote tumor cell motility via cytokine, chemokine and growth factor secretion into the TME. The exact effects that the TME has upon cytoskeletal regulation in motile tumor cells remain enigmatic. The conserved formin family of cytoskeleton regulating proteins plays an essential role in the assembly and/or bundling of unbranched actin filaments. Mammalian Diaphanous-related formin 2 (mDia2/DIAPH3/Drf3/Dia) assembles a dynamic F-actin cytoskeleton that underlies tumor cell migration and invasion. We therefore sought to understand whether CAF-derived chemokines impact breast tumor cell motility through modification of the formin-assembled F-actin cytoskeleton. In MDA-MB-231 cells, conditioned media (CM) from WS19T CAFs, a human breast tumor-adjacent CAF line, significantly and robustly increased wound closure and invasion relative to normal human mammary fibroblast (HMF)-CM. WS19T-CM also promoted proteasome-mediated mDia2 degradation in MDA-MB-231 cells relative to control HMF-CM and WS21T CAF-CM, a breast CAF cell line that failed to promote robust MDA-MB-231 migration. Cytokine array analysis of CM identified up-regulated secreted factors in WS19T relative to control WS21T CM. We identified CXCL12 as a CM factor influencing loss of mDia2 protein while increasing MDA-MB-231 cell migration. Our data suggest a mechanism whereby CAFs promote tumor cell migration and invasion through CXCL12 secretion to regulate the mDia2-directed cytoskeleton in breast tumor cells.

The miR-599 promotes non-small cell lung cancer cell invasion via SATB2

International Nuclear Information System (INIS)

Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran

2017-01-01

MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.

Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

Energy Technology Data Exchange (ETDEWEB)

Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)

2012-01-13

Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

International Nuclear Information System (INIS)

Yang, Zhihong; Zhang, Yuxia; Wang, Li

2012-01-01

Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

MODEL2TALK : An Intervention to Promote Productive Classroom Talk

NARCIS (Netherlands)

van der Veen, Chiel; van der Wilt, Femke; van Kruistum, Claudia; van Oers, Bert; Michaels, Sarah

2017-01-01

This article describes the MODEL2TALK intervention, which aims to promote young children's oral communicative competence through productive classroom talk. Productive classroom talk provides children in early childhood education with many opportunities to talk and think together. Results from a

Exploiting nucleotide composition to engineer promoters.

Directory of Open Access Journals (Sweden)

Manfred G Grabherr

Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

E2F1 promote the aggressiveness of human colorectal cancer by activating the ribonucleotide reductase small subunit M2

Energy Technology Data Exchange (ETDEWEB)

Fang, Zejun [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Gong, Chaoju [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 (China); Liu, Hong [Zhejiang Normal University – Jinhua People' s Hospital Joint Center for Biomedical Research, Jinhua, Zhejiang, 321004 (China); Zhang, Xiaomin; Mei, Lingming [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Song, Mintao [Department of Pathophysiology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS), School of Basic Medicine, Peking Union Medical College (PUMC), Beijing, 100005 (China); Qiu, Lanlan; Luo, Shuchai; Zhu, Zhihua; Zhang, Ronghui; Gu, Hongqian [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Chen, Xiang, E-mail: sychenxiang@126.com [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China)

2015-08-21

As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2 were closely related to the transcription factor E2F1. Mechanistic studies were conducted to determine the molecular basis. Ectopic overexpression of E2F1 promoted RRM2 transactivation while knockdown of E2F1 reduced the levels of RRM2 mRNA and protein. To further investigate the roles of RRM2 which was activated by E2F1 in CRC, CCK-8 assay and EdU incorporation assay were performed. Overexpression of E2F1 promoted cell proliferation in CRC cells, which was blocked by RRM2 knockdown attenuation. In the migration and invasion tests, overexpression of E2F1 enhanced the migration and invasion of CRC cells which was abrogated by silencing RRM2. Besides, overexpression of RRM2 reversed the effects of E2F1 knockdown partially in CRC cells. Examination of clinical CRC specimens demonstrated that both RRM2 and E2F1 were elevated in most cancer tissues compared to the paired normal tissues. Further analysis showed that the protein expression levels of E2F1 and RRM2 were parallel with each other and positively correlated with lymph node metastasis (LNM), TNM stage and distant metastasis. Consistently, the patients with low E2F1 and RRM2 levels have a better prognosis than those with high levels. Therefore, we suggest that E2F1 can promote CRC proliferation, migration, invasion and metastasis by regulating RRM2 transactivation. Understanding the role of E2F1 in activating RRM2 transcription will help to explain the relationship between E2F1 and RRM2 in CRC and provide a novel predictive marker for diagnosis and prognosis of the disease. - Highlights: • E2F1 promotes RRM2 transactivation in CRC cells. • E2F1 promotes the proliferation of CRC cells by activating RRM2. • E2F1 promotes the migration and

EFFECT OF ALTERNATIVE MULTINUTRIENT SOURCES ON SOIL CHEMICAL PROPERTIES

Directory of Open Access Journals (Sweden)

Vanessa Martins

2015-02-01

Full Text Available The current high price of potassium chloride and the dependence of Brazil on imported materials to supply the domestic demand call for studies evaluating the efficiency of alternative sources of nutrients. The aim of this work was to evaluate the effect of silicate rock powder and a manganese mining by-product, and secondary materials originated from these two materials, on soil chemical properties and on brachiaria production. This greenhouse experiment was conducted in pots with 5 kg of soil (Latossolo Vermelho-Amarelo distrófico - Oxisol. The alternative nutrient sources were: verdete, verdete treated with NH4OH, phonolite, ultramafic rock, mining waste and the proportion of 75 % of these K fertilizers and 25 % lime. Mixtures containing 25 % of lime were heated at 800 ºC for 1 h. These sources were applied at rates of 0, 150, 300, 450 and 600 kg ha-1 K2O, and incubated for 45 days. The mixtures of heated silicate rocks with lime promoted higher increases in soil pH in decreasing order: ultramafic rock>verdete>phonolite>mining waste. Applying the mining waste-lime mixture increased soil exchangeable K, and available P when ultramafic rock was incorporated. When ultramafic rock was applied, the release of Ca2+ increased significantly. Mining subproduct released the highest amount of Zn2+ and Mn2+ to the soil. The application of alternative sources of K, with variable chemical composition, altered the nutrient availability and soil chemical properties, improving mainly plant development and K plant uptake, and are important nutrient sources.

HNF1 alpha activates the aminopeptidase N promoter in intestinal (Caco-2) cells

DEFF Research Database (Denmark)

Olsen, Jørgen; Laustsen, Lotte; Troelsen, J

1994-01-01

The importance of HNF1 binding proteins for intestinal aminopeptidase N expression was investigated using the Caco-2 cell-line. Aminopeptidase N promoter activity in Caco-2 cells depends on the HNF1 element (positions -85 to -58) and co-transfection with an HNF1 alpha expression vector demonstrates...... a direct activation of the promoter by HNF1 alpha through this element. Electrophoretic mobility shift assays using nuclear extracts from Caco-2 cells show the presence of high amounts of HNF1 binding proteins irrespective of their state of differentiation....

Alternative drives for motor cars. Hybrid systems, fuel cells, alternative energy sources. 2. enl. ed.; Alternative Antriebe fuer Automobile. Hybridsysteme, Brennstoffzellen, alternative Energietraeger

Energy Technology Data Exchange (ETDEWEB)

Stan, Cornel [Berkeley Univ., CA (United States)]|[Paris Univ. (France)]|[Pisa Univ. (Italy)]|[Perugia Univ. (Italy)]|[Westsaechsischen Hochschule Zwickau (Germany)

2008-07-01

The implementation possibilities of future drive concepts - from hybrid systems comprising an electric motor and an internal combustion engine to fuel cells to alternative fuels like hydrogen or alcohol - will depend largely on quality criteria, e.g. power density, rotary momentum, acceleration characteristics, specific energy consumption, emissions of chemical substances, and noise. The boundary criteria for the introduction of realizeable concepts of alternative drives for motor cars will be defined by the availability and storability of the envisaged fuels, technical complexity, cost, safety, infrastructure and service. The book presents and analyzes the processes, drives and energy sources that can be combined in complex energy management systems for motor cars in accordance with the aforementioned criteria. Knowledge about these facts is indispensable for the development of new concepts. The 2nd edition describes many new developments in car propulsion systems as well as their combinations, new energy sources, energy converters and energy stores. All contents and literature reflect the latest state of science and technology. (orig.) [German] Ueber die Realisierungsmoeglichkeiten zukuenftiger Antriebskonzepte - von Hybridsystemen Elektro-/Verbrennungsmotor ueber Brennstoffzellen bis zu alternativen Energietraegern wie Wasserstoff oder Alkohol - werden fundierte Kriterien der Qualitaet eines Antriebs entscheiden. Leistungsdichte, Drehmomentverlauf, Beschleunigungscharakteristik, spezifischer Energieverbrauch sowie Emission chemischer Stoffe und Geraeusche sind dafuer wichtige Merkmale zur Qualitaetsbeurteilung. Die Verfuegbarkeit und die Speicherfaehigkeit vorgesehener Energietraeger, die technische Komplexitaet, Kosten, Sicherheit, Infrastruktur und Service werden die Randbedingungen fuer die Einfuehrung realisierbarer Konzepte alternativer Antriebe fuer Automobile stellen. Die Uebersicht und die Analyse der Prozesse, Antriebsmaschinen und Energietraeger, die

Anterior gradient 2 is induced in cutaneous wound and promotes wound healing through its adhesion domain.

Science.gov (United States)

Zhu, Qi; Mangukiya, Hitesh Bhagavanbhai; Mashausi, Dhahiri Saidi; Guo, Hao; Negi, Hema; Merugu, Siva Bharath; Wu, Zhenghua; Li, Dawei

2017-09-01

Anterior gradient 2 (AGR2), a member of protein disulfide isomerase (PDI) family, is both located in cytoplasm and secreted into extracellular matrix. The orthologs of AGR2 have been linked to limb regeneration in newt and wound healing in zebrafish. In mammals, AGR2 influences multiple cell signaling pathways in tumor formation and in normal cell functions related to new tissue formation like angiogenesis. However, the function of AGR2 in mammalian wound healing remains unknown. This study aimed to investigate AGR2 expression and its function during skin wound healing and the possible application of external AGR2 in cutaneous wound to accelerate the healing process. Our results showed that AGR2 expression was induced in the migrating epidermal tongue and hyperplastic epidermis after skin excision. Topical application of recombinant AGR2 significantly accelerated wound-healing process by increasing the migration of keratinocytes (Kera.) and the recruitment of fibroblasts (Fibro.) near the wounded area. External AGR2 also promoted the migration of Kera. and Fibro. in vitro in a dose-dependent manner. The adhesion domain of AGR2 was required for the formation of focal adhesions in migrating Fibro., leading to the directional migration along AGR2 gradient. These results indicate that recombinant AGR2 accelerates skin wound healing through regulation of Kera. and Fibro. migration, thus demonstrating its potential utility as an alternative strategy of the therapeutics to accelerate the healing of acute or chronic skin wounds. © 2017 Federation of European Biochemical Societies.

Alternatives to the use of antibiotics as growth promoters for monogastric animals

NARCIS (Netherlands)

Verstegen, M.W.A.; Williams, B.A.

2002-01-01

Recently, more and more is becoming known about the mode of action of antibiotics as growth promoters (AMGP), particularly in relation to the development of microbial resistance. Consequently, the use of these AMGP is already restricted or forbidden in many countries. Therefore, to compensate for

Alternative growth promoters alter broiler gut microbiome and enhance body weight gain

Science.gov (United States)

Antibiotic growth promoters (AGPs) have commonly been used to enhance growth in poultry production. However, there has been increasing concern over the impact of AGPs use in food production on acquisition of antibiotic resistance in zoonotic bacterial pathogens through inter-bacterial transfer of an...

SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK

Energy Technology Data Exchange (ETDEWEB)

Bae, Sung Jun [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Ni, Lisheng [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Osinski, Adam [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Tomchick, Diana R. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Brautigam, Chad A. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, United States; Luo, Xuelian [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States

2017-10-24

The Hippo pathway controls tissue growth and homeostasis through a central MST-LATS kinase cascade. The scaffold protein SAV1 promotes the activation of this kinase cascade, but the molecular mechanisms remain unknown. Here, we discover SAV1-mediated inhibition of the PP2A complex STRIPAKSLMAP as a key mechanism of MST1/2 activation. SLMAP binding to autophosphorylated MST2 linker recruits STRIPAK and promotes PP2A-mediated dephosphorylation of MST2 at the activation loop. Our structural and biochemical studies reveal that SAV1 and MST2 heterodimerize through their SARAH domains. Two SAV1–MST2 heterodimers further dimerize through SAV1 WW domains to form a heterotetramer, in which MST2 undergoes trans-autophosphorylation. SAV1 directly binds to STRIPAK and inhibits its phosphatase activity, protecting MST2 activation-loop phosphorylation. Genetic ablation of SLMAP in human cells leads to spontaneous activation of the Hippo pathway and alleviates the need for SAV1 in Hippo signaling. Thus, SAV1 promotes Hippo activation through counteracting the STRIPAKSLMAP PP2A phosphatase complex.

Promoting de-escalation of commitment: a regulatory-focus perspective on sunk costs.

Science.gov (United States)

Molden, Daniel C; Hui, Chin Ming

2011-01-01

People frequently escalate their commitment to failing endeavors. Explanations for such behavior typically involve loss aversion, failure to recognize other alternatives, and concerns with justifying prior actions; all of these factors produce recommitment to previous decisions with the goal of erasing losses and vindicating these decisions. Solutions to escalation of commitment have therefore focused on external oversight and divided responsibility during decision making to attenuate loss aversion, blindness to alternatives, and justification biases. However, these solutions require substantial resources and have additional adverse effects. The present studies tested an alternative method for de-escalating commitment: activating broad motivations for growth and advancement (promotion). This approach should reduce concerns with loss and increase perceptions of alternatives, thereby attenuating justification motives. In two studies featuring hypothetical financial decisions, activating promotion motivations reduced recommitment to poorly performing investments as compared with both not activating any additional motivations and activating motivations for safety and security (prevention).

Alternative Tobacco Product Use and Smoking Cessation: A National Study

Science.gov (United States)

Popova, Lucy

2013-01-01

Objectives. We investigated the frequency of alternative tobacco product use (loose leaf, moist snuff, snus, dissolvables, electronic cigarettes [e-cigarettes]) among smokers and the association with quit attempts and intentions. Methods. A nationally representative probability-based cross-sectional survey of 1836 current or recently former adult smokers was completed in November 2011. Multivariate logistic regressions evaluated associations between alternative tobacco product use and smoking cessation behaviors. Results. Of the smokers, 38% had tried an alternative tobacco product, most frequently e-cigarettes. Alternative tobacco product use was associated with having made a quit attempt, and those intending to quit were significantly more likely to have tried and to currently use the products than were smokers with no intentions to quit. Use was not associated with successful quit attempts. Interest in future use of alternative tobacco products was low, except for e-cigarettes. Conclusions. Alternative tobacco products are attractive to smokers who want to quit smoking, but these data did not indicate that alternative tobacco products promote cessation. Unsubstantiated overt and implied claims that alternative tobacco products aid smoking cessation should be prohibited. PMID:23488521

Alkali promotion of N-2 dissociation over Ru(0001)

DEFF Research Database (Denmark)

Mortensen, Jens Jørgen; Hammer, Bjørk; Nørskov, Jens Kehlet

1998-01-01

Using self-consistent density functional calculations, we show that adsorbed Na and Cs lower the barrier for dissociation of N2 on Ru(0001). Since N2 dissociation is a crucial step in the ammonia synthesis reaction, we explain in this way the experimental observation that alkali metals promote th...... the ammonia synthesis reaction over Ru catalysts. We also show that the origin of this effect is predominantly a direct electrostatic attraction between the adsorbed alkali atoms and the dissociating molecule....

Shifting Cultivation : Promoting Innovative Policy and Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Shifting Cultivation : Promoting Innovative Policy and Development Options in the Eastern Himalayas. Shifting ... pressure and market forces. The idea is to share good policies and practices related to shifting cultivation and alternative options through regional exchange. ... Les chaînes de valeur comme leviers stratégiques.

A growth hormone receptor SNP promotes lung cancer by impairment of SOCS2-mediated degradation

DEFF Research Database (Denmark)

Chhabra, Y.; Wong, H. Y.; Nikolajsen, Louise Fletcher

2018-01-01

Both humans and mice lacking functional growth hormone (GH) receptors are known to be resistant to cancer. Further, autocrine GH has been reported to act as a cancer promoter. Here we present the first example of a variant of the GH receptor (GHR) associated with cancer promotion, in this case lu......-mesenchymal transition and metastases (TWIST1, SNAI2, EGFR, MYC and CCND1) at 2 h after a GH pulse. This is consistent with prolonged GH signalling acting to promote cancer progression in lung cancer.Oncogene advance online publication, 2 October 2017; doi:10.1038/onc.2017.352....

Host-race formation: promoted by phenology, constrained by heritability.

Science.gov (United States)

Whipple, A V; Abrahamson, W G; Khamiss, M A; Heinrich, P L; Urian, A G; Northridge, E M

2009-04-01

Host-race formation is promoted by genetic trade-offs in the ability of herbivores to use alternate hosts, including trade-offs due to differential timing of host-plant availability. We examined the role of phenology in limiting host-plant use in the goldenrod gall fly (Eurosta solidaginis) by determining: (1) whether phenology limits alternate host use, leading to a trade-off that could cause divergent selection on Eurosta emergence time and (2) whether Eurosta has the genetic capacity to respond to such selection in the face of existing environmental variation. Experiments demonstrated that oviposition and gall induction on the alternate host, Solidago canadensis, were the highest on young plants, whereas the highest levels of gall induction on the normal host, Solidago gigantea, occurred on intermediate-age plants. These findings indicate a phenological trade-off for host-plant use that sets up the possibility of divergent selection on emergence time. Heritability, estimated by parent-offspring regression, indicated that host-race formation is impeded by the amount of genetic variation, relative to environmental, for emergence time.

Enhancing promotional strategies within social marketing programs: use of Web 2.0 social media.

Science.gov (United States)

Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L; McKenzie, James F

2008-10-01

The second generation of Internet-based applications (i.e., Web 2.0), in which users control communication, holds promise to significantly enhance promotional efforts within social marketing campaigns. Web 2.0 applications can directly engage consumers in the creative process by both producing and distributing information through collaborative writing, content sharing, social networking, social bookmarking, and syndication. Web 2.0 can also enhance the power of viral marketing by increasing the speed at which consumers share experiences and opinions with progressively larger audiences. Because of the novelty and potential effectiveness of Web 2.0, social marketers may be enticed to prematurely incorporate related applications into promotional plans. However, as strategic issues such as priority audience preferences, selection of appropriate applications, tracking and evaluation, and related costs are carefully considered, Web 2.0 will expand to allow health promotion practitioners more direct access to consumers with less dependency on traditional communication channels.

The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

Science.gov (United States)

Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

2009-08-01

Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

CRE promoter sites modulate alternative splicing via p300-mediated histone acetylation

Czech Academy of Sciences Publication Activity Database

Dušková, E.; Hnilicová, Jarmila; Staněk, D.

2014-01-01

Roč. 11, č. 7 (2014), s. 1-10 ISSN 1547-6286 R&D Projects: GA ČR(CZ) GBP305/12/G034 Grant - others:Charles University Prague(CZ) 274111 Institutional support: RVO:61388971 Keywords : alternative splicing * fibronectin * p300 Subject RIV: EE - Microbiology, Virology Impact factor: 4.974, year: 2014

Designing a Culturally Appropriate Visually Enhanced Low-Text Mobile Health App Promoting Physical Activity for Latinos: A Qualitative Study.

Science.gov (United States)

Bender, Melinda S; Martinez, Suzanna; Kennedy, Christine

2016-07-01

Rapid proliferation of smartphone ownership and use among Latinos offers a unique opportunity to employ innovative visually enhanced low-text (VELT) mobile health applications (mHealth app) to promote health behavior change for Latinos at risk for lifestyle-related diseases. Using focus groups and in-depth interviews with 16 promotores and 5 health care providers recruited from California clinics, this qualitative study explored perceptions of visuals for a VELT mHealth app promoting physical activity (PA) and limiting sedentary behavior (SB) for Latinos. In this Phase 1 study, participants endorsed visuals portraying PA guidelines and recommended visuals depicting family and socially oriented PA. Overall, participants supported a VELT mHealth app as an alternative to text-based education. Findings will inform the future Phase 2 study development of a culturally appropriate VELT mHealth app to promote PA for Latinos, improve health literacy, and provide an alternative to traditional clinic text-based health education materials. © The Author(s) 2015.

Intrinsically bent DNA in replication origins and gene promoters.

Science.gov (United States)

Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

2008-06-24

Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

Dynamic usage of transcription start sites within core promoters

DEFF Research Database (Denmark)

Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro

2006-01-01

BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites...... is associated with CpG islands, broad and multimodal promoter structures, and imprinting. CONCLUSION: Our results reveal a new level of biologic complexity within promoters--fine-scale regulation of transcription starting events at the base pair level. These events are likely to be related to epigenetic...

The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

Directory of Open Access Journals (Sweden)

Rafael Estrada-Avilés

Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

Alternative Fuels Data Center: Workplace Charging Success: MetLife

Science.gov (United States)

future." Several others noted that their decision to purchase or lease a PEV was based on MetLife's : MetLife " By making PEV charging stations more readily available to employees, we can encourage more promote alternative transportation. By making PEV charging stations more readily available to employees

Role of CeO2 promoter in NiO/α-Al2O3 catalyst for dry reforming of methane

Science.gov (United States)

Loc, Luu Cam; Phuong, Phan Hong; Tri, Nguyen

2017-09-01

A series of Ni/α-Al2O3 (NiAl) catalysts promoted by CeO2 was prepared by co-impregnation methods with content of (NiO+CeO2) being in the range of 10-30 wt%. The NiO:CeO2 weight ratio was fluctuated at 1:1, 1:2 and 1:3. Several techniques, including X-ray powder diffraction (XRD), Hydrogen temperature-programmed reduction (H2-TPR), and transmission electron microscopy (TEM) were used to investigate catalysts' physico-chemical properties. The activity of these catalysts in dry reforming of CH4 was investigated at temperature range of 550-800 °C. The results revealed that the most suitable CeO2 promoted Ni catalyst contained 20 wt% of (NiO+CeO2) and NiO:CeO2 weight ratio of 1:2. The best catalytic performance of catalyst [20(1Ni2Ce)Al] due to a better reducibility resulted in a higher amount of free small particle NiO. At 700 °C and CH4:CO2 molar ratio of 1:1, the conversion of CH4 and CO2 on the most suitable CeO2 promoted Ni catalyst reached 86% and 67%, respectively; H2 and CO selectivity of 90% and H2:CO molar ratio of 1.15 were obtained. Being similar to MgO [1], promoter CeO2 could improve catalytic activity of Ni/α-Al2O3 catalyst at a lower range of temperature. Besides, both MgO and CeO2 had a great impact on improving coke resistance of Ni catalysts. At higher temperature, the role of CeO2 as well as MgO in preventing coke formation on catalyst was clarified by temperature-programmed oxidation (TPO) technique. Coke amount formed after 30-h TOS on 20(1Ni2Ce) catalyst was found to be 22.18 mgC/gcat, being less than on non-promoted catalyst (36.75 mgC/gcat), but more than on 20(1Ni2Mg)Al one (5.25 mgC/gcat).

Predictability of Joint Promotion Examinations in SS2 on Academic ...

African Journals Online (AJOL)

This research studied the predictability of joint SS2 promotion examinations of all the command secondary schools in Nigeria on academic performance of students in Senior School Certificate Examinations. The sample consists of 120 students selected at the Command Secondary School, Abakaliki and Command Day ...

Synthetic Promoter Library for Modulation of Actinorhodin Production in Streptomyces coelicolor A3(2)

DEFF Research Database (Denmark)

Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher

2014-01-01

The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...

Ground state properties of the bond alternating spin-1/2 anisotropic Heisenberg chain

Directory of Open Access Journals (Sweden)

S. Paul

2017-06-01

Full Text Available Ground state properties, dispersion relations and scaling behaviour of spin gap of a bond alternating spin-1/2 anisotropic Heisenberg chain have been studied where the exchange interactions on alternate bonds are ferromagnetic (FM and antiferromagnetic (AFM in two separate cases. The resulting models separately represent nearest neighbour (NN AFM-AFM and AFM-FM bond alternating chains. Ground state energy has been estimated analytically by using both bond operator and Jordan-Wigner representations and numerically by using exact diagonalization. Dispersion relations, spin gap and several ground state orders have been obtained. Dimer order and string orders are found to coexist in the ground state. Spin gap is found to develop as soon as the non-uniformity in alternating bond strength is introduced in the AFM-AFM chain which further remains non-zero for the AFM-FM chain. This spin gap along with the string orders attribute to the Haldane phase. The Haldane phase is found to exist in most of the anisotropic region similar to the isotropic point.

An alternative for antibiotic se in poultry: probiotics

Directory of Open Access Journals (Sweden)

FW Edens

2003-05-01

Full Text Available Over the past 50 years, there has been increasing amounts of antibiotics used prophylactically and as growth promoters. Today, there is a consumer and governmental outcry to eliminate that practice from poultry and livestock production. Evidence has been accumulated to show that there is a link between risk of zoonotic disease and growth promoting antibiotic usage in livestock and poultry. Therefore, alternatives to the use of growth promoting antibiotics must be found to promote growth or production at or near the genetic potential of the modern day broiler, turkey, and egg producer. The use of probiotics has many potential benefits and include modified host metabolism, immuno-stimulation, anti-inflammatory reactions, exclusion and killing of pathogens in the intestinal tract, reduced bacterial contamination on processed broiler carcasses, enhanced nutrient absorption and performance, and ultimately decreased human health risk. The development of these factors generally can be ascribed to the ability of most probiotic products to balance and maintain the intestinal microflora in poultry species.

Promotion of Nb2O5 on the wustite-based iron catalyst for ammonia synthesis

International Nuclear Information System (INIS)

Han, Wenfeng; Huang, Shiliang; Cheng, Tianhong; Tang, Haodong; Li, Ying; Liu, Huazhang

2015-01-01

Highlights: • Niobium enhances the reduction of wustite-based ammonia synthesis catalyst significantly. • Nb 2 O 5 inhibits the segregation or formation of solid solutions on the catalyst surface. • Nb 2 O 5 doping enhances the growth rates of [2 1 1] and [2 0 0] planes rather than their amounts. - Abstract: Niobium was selected and investigated as a potential promoter for wustite-based catalyst (WBC) for ammonia synthesis. Experiments on reduction performance, activity test and H 2 -TGA, in situ XRD as well as XPS were carried out to obtain the promotion effect and mechanism involved. Niobium as a promoter was confirmed to enhance the reduction of WBC significantly. This behavior is highly desired for industry in terms of catalyst regeneration and lesser pretreatment time for fabrication regardless the unimproved catalytic performance for Nb 2 O 5 -doped wustite-based catalyst (Nb-WBC). Possible reasons for these phenomena are discussed. It is suggested that Nb 2 O 5 is not favorable for the segregation or formation of solid solutions on the catalyst surface, which are difficult to be reduced. However, it seems that niobium does not promote the growth of [2 1 1] plane, which is active for ammonia synthesis.

Gremlin promotes retinal pigmentation epithelial (RPE) cell proliferation, migration and VEGF production via activating VEGFR2-Akt-mTORC2 signaling.

Science.gov (United States)

Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing

2017-01-03

Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.

Finding theory- and evidence-based alternatives to fear appeals: Intervention Mapping

OpenAIRE

Kok, Gerjo; Bartholomew, L Kay; Parcel, Guy S; Gottlieb, Nell H; Fernández, María E

2013-01-01

Fear arousal—vividly showing people the negative health consequences of life-endangering behaviors—is popular as a method to raise awareness of risk behaviors and to change them into health-promoting behaviors. However, most data suggest that, under conditions of low efficacy, the resulting reaction will be defensive. Instead of applying fear appeals, health promoters should identify effective alternatives to fear arousal by carefully developing theory- and evidence-based programs. The Interv...

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Acid-Sensing Ion Channel 2a (ASIC2a) Promotes Surface Trafficking of ASIC2b via Heteromeric Assembly

OpenAIRE

Kweon, Hae-Jin; Kim, Dong-Il; Bae, Yeonju; Park, Jae-Yong; Suh, Byung-Chang

2016-01-01

Acid-sensing ion channels (ASICs) are proton-activated cation channels that play important roles as typical proton sensors during pathophysiological conditions and normal synaptic activities. Among the ASIC subunits, ASIC2a and ASIC2b are alternative splicing products from the same gene, ACCN1. It has been shown that ASIC2 isoforms have differential subcellular distribution: ASIC2a targets the cell surface by itself, while ASIC2b resides in the ER. However, the underlying mechanism for this d...

Multi-protein delivery by nanodiamonds promotes bone formation.

Science.gov (United States)

Moore, L; Gatica, M; Kim, H; Osawa, E; Ho, D

2013-11-01

Bone morphogenetic proteins (BMPs) are well-studied regulators of cartilage and bone development that have been Food and Drug Administration (FDA)-approved for the promotion of bone formation in certain procedures. BMPs are seeing more use in oral and maxillofacial surgeries because of recent FDA approval of InFUSE(®) for sinus augmentation and localized alveolar ridge augmentation. However, the utility of BMPs in medical and dental applications is limited by the delivery method. Currently, BMPs are delivered to the surgical site by the implantation of bulky collagen sponges. Here we evaluate the potential of detonation nanodiamonds (NDs) as a delivery vehicle for BMP-2 and basic fibroblast growth factor (bFGF). Nanodiamonds are biocompatible, 4- to 5-nm carbon nanoparticles that have previously been used to deliver a wide variety of molecules, including proteins and peptides. We find that both BMP-2 and bFGF are readily loaded onto NDs by physisorption, forming a stable colloidal solution, and are triggered to release in slightly acidic conditions. Simultaneous delivery of BMP-2 and bFGF by ND induces differentiation and proliferation in osteoblast progenitor cells. Overall, we find that NDs provide an effective injectable alternative for the delivery of BMP-2 and bFGF to promote bone formation.

Promoting Social and Emotional Competencies among Young Children in Croatia with Preschool PATHS

Science.gov (United States)

Mihic, Josipa; Novak, Miranda; Basic, Josipa; Nix, Robert L.

2016-01-01

Preschool PATHS (Promoting Alternative Thinking Strategies) is an evidence-based universal prevention program focused on promoting children's social and emotional competencies and reducing the likelihood of behaviour problems and negative relationships with peers and teachers. This paper examines changes in the social and emotional competencies of…

Promoting Reflective Thinking Skills by Using Web 2.0 Application

Science.gov (United States)

Abdullah, Mohamed

2015-01-01

The study aims to investigate are using Web 2.0 applications promoting reflective thinking skills for higher education student in faculty for education. Although the literature reveals that technology integration is a trend in higher education and researchers and educators have increasingly shared their ideas and examples of implementations of Web…

Cap-proximal nucleotides via differential eIF4E binding and alternative promoter usage mediate translational response to energy stress.

Science.gov (United States)

Tamarkin-Ben-Harush, Ana; Vasseur, Jean-Jacques; Debart, Françoise; Ulitsky, Igor; Dikstein, Rivka

2017-02-08

Transcription start-site (TSS) selection and alternative promoter (AP) usage contribute to gene expression complexity but little is known about their impact on translation. Here we performed TSS mapping of the translatome following energy stress. Assessing the contribution of cap-proximal TSS nucleotides, we found dramatic effect on translation only upon stress. As eIF4E levels were reduced, we determined its binding to capped-RNAs with different initiating nucleotides and found the lowest affinity to 5'cytidine in correlation with the translational stress-response. In addition, the number of differentially translated APs was elevated following stress. These include novel glucose starvation-induced downstream transcripts for the translation regulators eIF4A and Pabp, which are also translationally-induced despite general translational inhibition. The resultant eIF4A protein is N-terminally truncated and acts as eIF4A inhibitor. The induced Pabp isoform has shorter 5'UTR removing an auto-inhibitory element. Our findings uncovered several levels of coordination of transcription and translation responses to energy stress.

[Regulation of alternative CO[sub 2] fixation pathways in procaryotic and eucaryotic photosynthetic organisms

Energy Technology Data Exchange (ETDEWEB)

1992-01-01

The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.

Multicomponent Biginelli's synthesis of 3,4-dihydropyrimidin-2(1H-ones promoted by SnCl2.2H2O

Directory of Open Access Journals (Sweden)

Russowsky Dennis

2004-01-01

Full Text Available The ability of SnCl2.2H2O as catalyst to promote the Biginelli three-component condensation reaction from a diversity of aromatic aldehydes, ethyl acetoacetate and urea or thiourea is described. The reaction was carried out in acetonitrile or ethanol as solvents in neutral media and represents an improvement of the classical Biginelli protocol and an advantage in comparison with FeCl3.6H2O, NiCl2.6H2O and CoCl2.6H2O which were used with HCl as co-catalyst. The synthesis of 3,4-dihydropyrimidinones was achieved in good to excelent yields.

Alternative Conceptions: Turning Adversity into Advantage

Science.gov (United States)

Ferreira, Annalize; Lemmer, Miriam; Gunstone, Richard

2017-08-01

While a vast body of research has identified difficulties in students' understanding about forces and acceleration and their related alternative conceptions, far less research suggests ways to use students' alternative conceptions to enhance conceptual understanding of a specific fundamental concept. This study focused on distinguishing between students' conceptual understanding of the Newtonian concept of gravitational acceleration being the same for all objects and students' alternative conception that heavy objects fall faster. A multiple choice questionnaire was distributed to first year physics students for three consecutive years at a university in South Africa. The results indicate that changing the direction of motion and the physics quantity asked in paired questions revealed practically significant inconsistencies in students' reasoning and conceptions. This research contributes to the body of knowledge in proposing how the alternative conception of mass-related gravitational acceleration can be used in instruction to enhance conceptual understanding of the force-mass-acceleration relationship. Understanding of this relationship not only promotes conceptual understanding of the basic Newtonian concepts of the laws of motion which forms the critical foundation on which more advanced physics courses are built, but also contributes towards students' perception of physics as a set of coherent ideas applicable in all contexts.

26 CFR 1.904(b)-2 - Special rules for application of section 904(b) to alternative minimum tax foreign tax credit.

Science.gov (United States)

2010-04-01

...) to alternative minimum tax foreign tax credit. 1.904(b)-2 Section 1.904(b)-2 Internal Revenue... alternative minimum tax foreign tax credit. (a) Application of section 904(b)(2)(B) adjustments. Section 904(b)(2)(B) shall apply for purposes of determining the alternative minimum tax foreign tax credit under...

Critical illness induces alternative activation of M2 macrophages in adipose tissue.

Science.gov (United States)

Langouche, Lies; Marques, Mirna B; Ingels, Catherine; Gunst, Jan; Derde, Sarah; Vander Perre, Sarah; D'Hoore, André; Van den Berghe, Greet

2011-01-01

We recently reported macrophage accumulation in adipose tissue of critically ill patients. Classically activated macrophage accumulation in adipose tissue is a known feature of obesity, where it is linked with increasing insulin resistance. However, the characteristics of adipose tissue macrophage accumulation in critical illness remain unknown. We studied macrophage markers with immunostaining and gene expression in visceral and subcutaneous adipose tissue from healthy control subjects (n = 20) and non-surviving prolonged critically ill patients (n = 61). For comparison, also subcutaneous in vivo adipose tissue biopsies were studied from 15 prolonged critically ill patients. Subcutaneous and visceral adipose tissue biopsies from non-surviving prolonged critically ill patients displayed a large increase in macrophage staining. This staining corresponded with elevated gene expression of "alternatively activated" M2 macrophage markers arginase-1, IL-10 and CD163 and low levels of the "classically activated" M1 macrophage markers tumor necrosis factor (TNF)-α and inducible nitric-oxide synthase (iNOS). Immunostaining for CD163 confirmed positive M2 macrophage staining in both visceral and subcutaneous adipose tissue biopsies from critically ill patients. Surprisingly, circulating levels and tissue gene expression of the alternative M2 activators IL-4 and IL-13 were low and not different from controls. In contrast, adipose tissue protein levels of peroxisome proliferator-activated receptor-γ (PPARγ), a nuclear receptor required for M2 differentiation and acting downstream of IL-4, was markedly elevated in illness. In subcutaneous abdominal adipose tissue biopsies from surviving critically ill patients, we could confirm positive macrophage staining with CD68 and CD163. We also could confirm elevated arginase-1 gene expression and elevated PPARγ protein levels. Unlike obesity, critical illness evokes adipose tissue accumulation of alternatively activated M2

FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression

Science.gov (United States)

Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin

2018-01-01

E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722

Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.

Directory of Open Access Journals (Sweden)

Nobuko Matsushita

Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.

saRNA-guided Ago2 targets the RITA complex to promoters to stimulate transcription.

Science.gov (United States)

Portnoy, Victoria; Lin, Szu Hua Sharon; Li, Kathy H; Burlingame, Alma; Hu, Zheng-Hui; Li, Hao; Li, Long-Cheng

2016-03-01

Small activating RNAs (saRNAs) targeting specific promoter regions are able to stimulate gene expression at the transcriptional level, a phenomenon known as RNA activation (RNAa). It is known that RNAa depends on Ago2 and is associated with epigenetic changes at the target promoters. However, the precise molecular mechanism of RNAa remains elusive. Using human CDKN1A (p21) as a model gene, we characterized the molecular nature of RNAa. We show that saRNAs guide Ago2 to and associate with target promoters. saRNA-loaded Ago2 facilitates the assembly of an RNA-induced transcriptional activation (RITA) complex, which, in addition to saRNA-Ago2 complex, includes RHA and CTR9, the latter being a component of the PAF1 complex. RITA interacts with RNA polymerase II to stimulate transcription initiation and productive elongation, accompanied by monoubiquitination of histone 2B. Our results establish the existence of a cellular RNA-guided genome-targeting and transcriptional activation mechanism and provide important new mechanistic insights into the RNAa process.

Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

Directory of Open Access Journals (Sweden)

Deepti Jain

Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

Species-Specific Expression of Full-Length and Alternatively Spliced Variant Forms of CDK5RAP2.

Directory of Open Access Journals (Sweden)

John S Y Park

Full Text Available CDK5RAP2 is one of the primary microcephaly genes that are associated with reduced brain size and mental retardation. We have previously shown that human CDK5RAP2 exists as a full-length form (hCDK5RAP2 or an alternatively spliced variant form (hCDK5RAP2-V1 that is lacking exon 32. The equivalent of hCDK5RAP2-V1 has been reported in rat and mouse but the presence of full-length equivalent hCDK5RAP2 in rat and mouse has not been examined. Here, we demonstrate that rat expresses both a full length and an alternatively spliced variant form of CDK5RAP2 that are equivalent to our previously reported hCDK5RAP2 and hCDK5RAP2-V1, repectively. However, mouse expresses only one form of CDK5RAP2 that is equivalent to the human and rat alternatively spliced variant forms. Knowledge of this expression of different forms of CDK5RAP2 in human, rat and mouse is essential in selecting the appropriate model for studies of CDK5RAP2 and primary microcephaly but our findings further indicate the evolutionary divergence of mouse from the human and rat species.

Epithelial-derived IL-33 promotes intestinal tumorigenesis in Apc Min/+ mice.

Science.gov (United States)

He, Zhengxiang; Chen, Lili; Souto, Fabricio O; Canasto-Chibuque, Claudia; Bongers, Gerold; Deshpande, Madhura; Harpaz, Noam; Ko, Huaibin M; Kelley, Kevin; Furtado, Glaucia C; Lira, Sergio A

2017-07-14

Increased expression of Interleukin (IL)-33 has been detected in intestinal samples of patients with ulcerative colitis, a condition associated with increased risk for colon cancer, but its role in the development of colorectal cancer has yet to be fully examined. Here, we investigated the role of epithelial expressed IL-33 during development of intestinal tumors. IL-33 expression was detected in epithelial cells in colorectal cancer specimens and in the Apc Min/+ mice. To better understand the role of epithelial-derived IL-33 in the intestinal tumorigenesis, we generated transgenic mice expressing IL-33 in intestinal epithelial cells (V33 mice). V33 Apc Min/+ mice, resulting from the cross of V33 with Apc Min/+ mice, had increased intestinal tumor burden compared with littermate Apc Min/+ mice. Consistently, Apc Min/+ mice deficient for IL-33 receptor (ST2), had reduced polyp burden. Mechanistically, overexpression of IL-33 promoted expansion of ST2 + regulatory T cells, increased Th2 cytokine milieu, and induced alternatively activated macrophages in the gut. IL-33 promoted marked changes in the expression of antimicrobial peptides, and antibiotic treatment of V33 Apc Min/+ mice abrogated the tumor promoting-effects of IL-33 in the colon. In conclusion, elevated IL-33 signaling increases tumor development in the Apc Min/+ mice.

The European Resource Centre for Alternatives in Higher Education.

Science.gov (United States)

de Boo, Jasmijn; Dewhurst, David; van der Valk, Jan

2004-06-01

The European Resource Centre for Alternatives in Higher Education (EURCA: http://www.eurca.org) is an exciting new project, which aims to enable teachers using animals in teaching to be more creative and innovative in their approach to teaching and learning, to foster high-quality training for science students, and to significantly reduce the number of animals used, often unnecessarily, in teaching. This will be achieved by: a) establishing a resource centre--a collection of mainly electronic alternatives, and taking this to relevant scientific meetings in Europe, where it would function as a drop-in advice centre for teachers; b) creating a network of academic teachers who actively use alternatives, to take responsibility for disseminating information about alternatives to other teachers in the European Union, to participate in the activity outlined above, and to share experiences and good practice; c) setting up an Internet website with an expansive, information-rich database (peer-reviews, demos, peer-evaluations, peer-recommendations, links to users, etc.) on selected "tried and tested" alternatives; and d) encouraging and promoting the findings of evaluative studies on the effectiveness of alternatives in higher education teaching and learning.

Impact of Ni promotion on the hydrogenation pathways of phenanthrene on MoS 2 /γ-Al 2 O 3

Energy Technology Data Exchange (ETDEWEB)

Schachtl, Eva; Yoo, Jong Suk; Gutiérrez, Oliver Y.; Studt, Felix; Lercher, Johannes A.

2017-08-01

The reaction network and elementary steps of the hydrogenation of phenanthrene are explored on parent and Ni-promoted MoS2/c-Al2O3. Two pathways were identified, i.e., Path 1: Phenanthrene _ 9,10-dihydrophenanthrene (DiHPhe)?1,2,3,4,4a,9,10,10a-octahydro-phenanthrene (asymOHPhe), and Path 2: Phenanthrene ?1,2,3,4-tetrahydrophenanthrene (TetHPhe)?1,2,3,4,5,6,7,8-octahydrophenan threne. The steps TetHPhe?asymOHPhe (hydrogenation), and DiHPhe?TetHPhe (hydrogenationisomerization) become notable at phenanthrene conversions above 20%. The reaction preferentially proceeds via Path 1 (90% selectivity) on MoS2/Al2O3. Ni promotion (Ni/(Ni + Mo) molar ratio of 0.3 at the edges on MoS2) increases the hydrogenation activity per active edge twofold and leads to 50% selectivity to both pathways. The reaction orders in H2 vary from _0.8 on MoS2/Al2O3 to _1.2 on Ni-MoS2/Al2O3, whereas the reaction orders in phenanthrene (_0.6) hardly depend on Ni promotion. The reaction orders in H2S are zero on MoS2/Al2O3 and slightly negative on Ni-MoS2/Al2O3. DFT calculations indicate that phenanthrene is preferentially adsorbed parallel to the basal planes, while H is located at the edges perpendicular to the basal planes. Theory also suggests that Ni atoms, incorporated preferentially on the S-edges, increase the stability of hydrogenated intermediates. Hydrogenation of phenanthrene proceeds through quasi-equilibrated adsorption of the reactants followed by consecutive addition of hydrogen pairs to the adsorbed hydrocarbon. The rate determining steps for the formation of DiHPhe and TetHPhe are the addition of the first and second hydrogen pair, respectively. The concentration of SH groups (activated H at the edges) increases with Ni promotion linearly correlating the rates of Path 1 and Path 2, albeit with different functions. The enhancing effect of Ni on Path 2 is attributed to accelerated hydrogen addition to adsorbed hydrocarbons without important changes in their coverages.

Analytic evidence of the equivalence of the alternating Heisenberg spin chain to the mixed spin (1, 1/2) Heisenberg chain

International Nuclear Information System (INIS)

Jiang Jianjun; Liu Yongjun; Tang Fei; Yang Cuihong

2011-01-01

We investigated the properties of the spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain using the spin-wave theory. The spin-wave excitation spectra, the sublattice magnetizations and the local bond energies of the model are calculated to be compared with the corresponding properties of the mixed spin (1, 1/2) chain for a range of α. The results demonstrate that all the properties show similar behaviours in the small α limit, so the properties of the mixed spin (1, 1/2) chain can be described using the spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain. -- Research Highlights: →The spin-wave excitation spectra, the sublattice magnetizations and the local bond energies of the spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain are calculated. →In the small α limit, the properties of the mixed spin (1,1/2) chain can be described using the spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain. →The spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain may be of interest for some real quasi-one-dimensional molecular magnetic materials.

Synthetic promoter libraries for Corynebacterium glutamicum

DEFF Research Database (Denmark)

Rytter, Jakob Vang; Helmark, Søren; Chen, Jun

2014-01-01

The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

P2Y2 Receptor and EGFR Cooperate to Promote Prostate Cancer Cell Invasion via ERK1/2 Pathway.

Science.gov (United States)

Li, Wei-Hua; Qiu, Ying; Zhang, Hong-Quan; Tian, Xin-Xia; Fang, Wei-Gang

2015-01-01

As one member of G protein-coupled P2Y receptors, P2Y2 receptor can be equally activated by extracellular ATP and UTP. Our previous studies have proved that activation of P2Y2 receptor by extracellular ATP could promote prostate cancer cell invasion and metastasis in vitro and in vivo via regulating the expressions of some epithelial-mesenchymal transition/invasion-related genes (including IL-8, E-cadherin, Snail and Claudin-1), and the most significant change in expression of IL-8 was observed after P2Y2 receptor activation. However, the signaling pathway downstream of P2Y2 receptor and the role of IL-8 in P2Y2-mediated prostate cancer cell invasion remain unclear. Here, we found that extracellular ATP/UTP induced activation of EGFR and ERK1/2. After knockdown of P2Y2 receptor, the ATP -stimulated phosphorylation of EGFR and ERK1/2 was significantly suppressed. Further experiments showed that inactivation of EGFR and ERK1/2 attenuated ATP-induced invasion and migration, and suppressed ATP-mediated IL-8 production. In addition, knockdown of IL-8 inhibited ATP-mediated invasion and migration of prostate cancer cells. These findings suggest that P2Y2 receptor and EGFR cooperate to upregulate IL-8 production via ERK1/2 pathway, thereby promoting prostate cancer cell invasion and migration. Thus blocking of the P2Y2-EGFR-ERK1/2 pathway may provide effective therapeutic interventions for prostate cancer.

Securing funds for health promotion: lessons from health promotion foundations based on experiences from Austria, Australia, Germany, Hungary and Switzerland.

Science.gov (United States)

Schang, Laura K; Czabanowska, Katarzyna M; Lin, Vivian

2012-06-01

Worldwide, countries face the challenge of securing funds for health promotion. To address this issue, some governments have established health promotion foundations, which are statutory bodies with long-term and recurrent public resources. This article draws on experiences from Austria, Australia, Germany, Hungary and Switzerland to illustrate four lessons learned from the foundation model to secure funding for health promotion. These lessons are concerned with: (i) the broad spectrum of potential revenue sources for health promotion foundations within national contexts; (ii) legislative anchoring of foundation revenues as a base for financial sustainability; (iii) co-financing as a means to increase funds and shared commitment for health promotion; (iv) complementarity of foundations to existing funding. Synthesizing the lessons, we discuss health promotion foundations in relation to wider concerns for investment in health based on the values of sustainability, solidarity and stewardship. We recommend policy-makers and researchers take notice of health promotion foundations as an alternative model for securing funds for health promotion, and appreciate their potential for integrating inter-sectoral revenue collection and inter-sectoral funding strategies. However, health promotion foundations are not a magic bullet. They also pose challenges to coordination and public sector stewardship. Therefore, health promotion foundations will need to act in concert with other governance instruments as part of a wider societal agenda for investment in health.

Finding theory- and evidence-based alternatives to fear appeals: Intervention Mapping

Science.gov (United States)

Kok, Gerjo; Bartholomew, L Kay; Parcel, Guy S; Gottlieb, Nell H; Fernández, María E

2014-01-01

Fear arousal—vividly showing people the negative health consequences of life-endangering behaviors—is popular as a method to raise awareness of risk behaviors and to change them into health-promoting behaviors. However, most data suggest that, under conditions of low efficacy, the resulting reaction will be defensive. Instead of applying fear appeals, health promoters should identify effective alternatives to fear arousal by carefully developing theory- and evidence-based programs. The Intervention Mapping (IM) protocol helps program planners to optimize chances for effectiveness. IM describes the intervention development process in six steps: (1) assessing the problem and community capacities, (2) specifying program objectives, (3) selecting theory-based intervention methods and practical applications, (4) designing and organizing the program, (5) planning, adoption, and implementation, and (6) developing an evaluation plan. Authors who used IM indicated that it helped in bringing the development of interventions to a higher level. PMID:24811880

Solubility and viscosity for CO_2 capture process using MEA promoted DEAE aqueous solution

International Nuclear Information System (INIS)

Fu, Dong; Wang, LeMeng; Zhang, Pan; Mi, ChenLu

2016-01-01

Highlights: • Solubility of CO_2 in MEA promoted DEAE aqueous solution was measured. • Mass fraction and temperature dependences of solubility were illustrated. • Viscosities of carbonated MEA–DEAE solutions were measured and calculated. • Temperature, mass fraction and CO_2 loading dependences of viscosity were illustrated. - Abstract: The saturated solubility of CO_2 in monoethanolamine (MEA) promoted 2-diethylaminoethanol (DEAE) aqueous solution was investigated at temperatures ranging from (303.2 to 323.2) K. The mass fraction and temperature dependences of the saturated solubility and CO_2 loading are illustrated. The viscosities of both CO_2-unloaded and CO_2-loaded DEAE–MEA aqueous solutions were measured and then calculated by using the Weiland equation. The effects of temperature, mass fraction and CO_2 loading on viscosities are demonstrated.

Antitumorigenic potential of STAT3 alternative splicing modulation.

Science.gov (United States)

Zammarchi, Francesca; de Stanchina, Elisa; Bournazou, Eirini; Supakorndej, Teerawit; Martires, Kathryn; Riedel, Elyn; Corben, Adriana D; Bromberg, Jacqueline F; Cartegni, Luca

2011-10-25

Signal transducer and activator of transcription 3 (STAT3) plays a central role in the activation of multiple oncogenic pathways. Splicing variant STAT3β uses an alternative acceptor site within exon 23 that leads to a truncated isoform lacking the C-terminal transactivation domain. Depending on the context, STAT3β can act as a dominant-negative regulator of transcription and promote apoptosis. We show that modified antisense oligonucleotides targeted to a splicing enhancer that regulates STAT3 exon 23 alternative splicing specifically promote a shift of expression from STAT3α to STAT3β. Induction of endogenous STAT3β leads to apoptosis and cell-cycle arrest in cell lines with persistent STAT3 tyrosine phosphorylation compared with total STAT3 knockdown obtained by forced splicing-dependent nonsense-mediated decay (FSD-NMD). Comparison of the molecular effects of splicing redirection to STAT3 knockdown reveals a unique STAT3β signature, with a down-regulation of specific targets (including lens epithelium-derived growth factor, p300/CBP-associated factor, CyclinC, peroxisomal biogenesis factor 1, and STAT1β) distinct from canonical STAT3 targets typically associated with total STAT3 knockdown. Furthermore, similar in vivo redirection of STAT3 alternative splicing leads to tumor regression in a xenograft cancer model, demonstrating how pharmacological manipulation of a single key splicing event can manifest powerful antitumorigenic properties and validating endogenous splicing reprogramming as an effective cancer therapeutic approach.

Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

Directory of Open Access Journals (Sweden)

Wang Xiaoqin

2005-10-01

Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

Ets2 in tumor fibroblasts promotes angiogenesis in breast cancer.

Directory of Open Access Journals (Sweden)

Julie A Wallace

Full Text Available Tumor fibroblasts are active partners in tumor progression, but the genes and pathways that mediate this collaboration are ill-defined. Previous work demonstrates that Ets2 function in stromal cells significantly contributes to breast tumor progression. Conditional mouse models were used to study the function of Ets2 in both mammary stromal fibroblasts and epithelial cells. Conditional inactivation of Ets2 in stromal fibroblasts in PyMT and ErbB2 driven tumors significantly reduced tumor growth, however deletion of Ets2 in epithelial cells in the PyMT model had no significant effect. Analysis of gene expression in fibroblasts revealed a tumor- and Ets2-dependent gene signature that was enriched in genes important for ECM remodeling, cell migration, and angiogenesis in both PyMT and ErbB2 driven-tumors. Consistent with these results, PyMT and ErbB2 tumors lacking Ets2 in fibroblasts had fewer functional blood vessels, and Ets2 in fibroblasts elicited changes in gene expression in tumor endothelial cells consistent with this phenotype. An in vivo angiogenesis assay revealed the ability of Ets2 in fibroblasts to promote blood vessel formation in the absence of tumor cells. Importantly, the Ets2-dependent gene expression signatures from both mouse models were able to distinguish human breast tumor stroma from normal stroma, and correlated with patient outcomes in two whole tumor breast cancer data sets. The data reveals a key function for Ets2 in tumor fibroblasts in signaling to endothelial cells to promote tumor angiogenesis. The results highlight the collaborative networks that orchestrate communication between stromal cells and tumor cells, and suggest that targeting tumor fibroblasts may be an effective strategy for developing novel anti-angiogenic therapies.

Hawaii alternative fuels utilization program. Phase 3, final report

Energy Technology Data Exchange (ETDEWEB)

Kinoshita, C.M.; Staackmann, M.

1996-08-01

The Hawaii Alternative Fuels Utilization Program originated as a five-year grant awarded by the US Department of Energy (USDOE) to the Hawaii Natural Energy Institute (HNEI) of the University of Hawaii at Manoa. The overall program included research and demonstration efforts aimed at encouraging and sustaining the use of alternative (i.e., substitutes for gasoline and diesel) ground transportation fuels in Hawaii. Originally, research aimed at overcoming technical impediments to the widespread adoption of alternative fuels was an important facet of this program. Demonstration activities centered on the use of methanol-based fuels in alternative fuel vehicles (AFVs). In the present phase, operations were expanded to include flexible fuel vehicles (FFVs) which can operate on M85 or regular unleaded gasoline or any combination of these two fuels. Additional demonstration work was accomplished in attempting to involve other elements of Hawaii in the promotion and use of alcohol fuels for ground transportation in Hawaii.

Electrochemical study on the cationic promotion of the catalytic SO2 oxidation in pyrosulfate melts

DEFF Research Database (Denmark)

Petrushina, Irina; Bjerrum, Niels; Cappeln, Frederik Vilhelm

1998-01-01

The electrochemical behavior of the molten V2O5-M2S2O7 (M = K, Cs, or Na) system was studied using a gold working electrode at 440 degrees C in argon and air atmosphere. The aim of the present investigation was to find a possible correlation between the promoting effect of Cs+ and Na+ ions...... on the catalytic oxidation of SO2 in the V2O5-M2S2O7 system and the effect of these alkali cations on the electrochemical behavior of V2O5 in the alkali pyrosulfate melts It has been shown that Na+ ions had a promoting effect on the V(V) reversible arrow V(IV) electrochemical reaction. Sodium ions accelerate both...... in the catalytic SO, oxidation most likely is the oxidation of V(IV) to V(V) and the Na+ and Cs+ promoting effect is based on the acceleration of this stage. It has also been proposed that voltammetric measurements can be used for fast optimization of the composition of the vanadium catalyst (which...

Botanical alternatives to antibiotics for use in organic poultry production.

Science.gov (United States)

Diaz-Sanchez, Sandra; D'Souza, Doris; Biswas, Debrabrata; Hanning, Irene

2015-06-01

The development of antibiotic resistant pathogens has resulted from the use of sub-therapeutic concentrations of antibiotics delivered in poultry feed. Furthermore, there are a number of consumer concerns regarding the use of antibiotics in food animals including residue contamination of poultry products and antibiotic resistant bacterial pathogens. These issues have resulted in recommendations to reduce the use of antibiotics as growth promoters in livestock in the United States. Unlike conventional production, organic systems are not permitted to use antibiotics. Thus, both conventional and organic poultry production need alternative methods to improve growth and performance of poultry. Herbs, spices, and various other plant extracts are being evaluated as alternatives to antibiotics and some do have growth promoting effects, antimicrobial properties, and other health-related benefits. This review aims to provide an overview of herbs, spices, and plant extracts, currently defined as phytobiotics as potential feed additives. © 2015 Poultry Science Association Inc.

Alternative Energy Development and China's Energy Future

Energy Technology Data Exchange (ETDEWEB)

Zheng, Nina; Fridley, David

2011-06-15

In addition to promoting energy efficiency, China has actively pursued alternative energy development as a strategy to reduce its energy demand and carbon emissions. One area of particular focus has been to raise the share of alternative energy in China’s rapidly growing electricity generation with a 2020 target of 15% share of total primary energy. Over the last ten years, China has established several major renewable energy regulations along with programs and subsidies to encourage the growth of non-fossil alternative energy including solar, wind, nuclear, hydro, geothermal and biomass power as well as biofuels and coal alternatives. This study thus seeks to examine China’s alternative energy in terms of what has and will continue to drive alternative energy development in China as well as analyze in depth the growth potential and challenges facing each specific technology. This study found that despite recent policies enabling extraordinary capacity and investment growth, alternative energy technologies face constraints and barriers to growth. For relatively new technologies that have not achieved commercialization such as concentrated solar thermal, geothermal and biomass power, China faces technological limitations to expanding the scale of installed capacity. While some alternative technologies such as hydropower and coal alternatives have been slowed by uneven and often changing market and policy support, others such as wind and solar PV have encountered physical and institutional barriers to grid integration. Lastly, all alternative energy technologies face constraints in human resources and raw material resources including land and water, with some facing supply limitations in critical elements such as uranium for nuclear, neodymium for wind and rare earth metals for advanced solar PV. In light of China’s potential for and barriers to growth, the resource and energy requirement for alternative energy technologies were modeled and scenario analysis

Epigenetic silencing of BTB and CNC homology 2 and concerted promoter CpG methylation in gastric cancer.

Science.gov (United States)

Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung

2014-09-01

BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Turkey in Search of Relevant Foreign Policy Strategy (2002-2016

Directory of Open Access Journals (Sweden)

Urmanov Dayan R.

2016-06-01

Full Text Available The main idea of this article is to describe the process of Turkish foreign policy evolvement during the rule of Justice and Development party (JDP. From weak economy and unstable political situation in 2001, JDP quickly formulated a new strategy of foreign policy and stabilized economy. In the article the Turkish foreign policy in the 21st century is divided into several stages which respond to different international threats and circumstances. The first stage was a peacekeeping stage when Turkey tried to stabilize the situation near its borders and implement peace initiatives for the purpose to find new markets and allies. As a result, Turkey formulated a new strategy of foreign policy, called “Zero Problems Policy” which aimed to create a ring of friendly countries on the borders. On the second stage, Turkish foreign policy was more active – Turkey tried to balance among regional power centers and confront with one of the most powerful actors – Israel. Confrontation with Tel Aviv was a preface to the third stage, and today under the influence of “Arab Spring” and desire to change its role in international relations, Turkey refused “Zero Problems Policy” strategy and turned to a new aggressive and revanchist idea – neo- Ottomanism. Ankara tries to build a new regional set of rules where Turkey will play a leading role.

Diverse alternative back-splicing and alternative splicing landscape of circular RNAs

Science.gov (United States)

Zhang, Xiao-Ou; Dong, Rui; Zhang, Yang; Zhang, Jia-Lin; Luo, Zheng; Zhang, Jun; Chen, Ling-Ling; Yang, Li

2016-01-01

Circular RNAs (circRNAs) derived from back-spliced exons have been widely identified as being co-expressed with their linear counterparts. A single gene locus can produce multiple circRNAs through alternative back-splice site selection and/or alternative splice site selection; however, a detailed map of alternative back-splicing/splicing in circRNAs is lacking. Here, with the upgraded CIRCexplorer2 pipeline, we systematically annotated different types of alternative back-splicing and alternative splicing events in circRNAs from various cell lines. Compared with their linear cognate RNAs, circRNAs exhibited distinct patterns of alternative back-splicing and alternative splicing. Alternative back-splice site selection was correlated with the competition of putative RNA pairs across introns that bracket alternative back-splice sites. In addition, all four basic types of alternative splicing that have been identified in the (linear) mRNA process were found within circRNAs, and many exons were predominantly spliced in circRNAs. Unexpectedly, thousands of previously unannotated exons were detected in circRNAs from the examined cell lines. Although these novel exons had similar splice site strength, they were much less conserved than known exons in sequences. Finally, both alternative back-splicing and circRNA-predominant alternative splicing were highly diverse among the examined cell lines. All of the identified alternative back-splicing and alternative splicing in circRNAs are available in the CIRCpedia database (http://www.picb.ac.cn/rnomics/circpedia). Collectively, the annotation of alternative back-splicing and alternative splicing in circRNAs provides a valuable resource for depicting the complexity of circRNA biogenesis and for studying the potential functions of circRNAs in different cells. PMID:27365365

Excitations and possible bound states in the S = 1/2 alternating chain compound (VO)2P2O7

International Nuclear Information System (INIS)

Tennant, D.A.; Nagler, S.E.; Sales, B.C.

1997-01-01

Magnetic excitations in an array of (VO) 2 P 2 O 7 single crystals have been measured using inelastic neutron scattering. Until now, (VO) 2 P 2 O 7 has been thought of as a two-leg antiferromagnetic Heisenberg spin ladder with chains running in the a-direction. The present results show unequivocally that (VO) 2 P 2 O 7 is best described as an alternating spin-chain directed along the crystallographic b-direction. In addition to the expected magnon with magnetic zone-center energy gap Δ = 3.1 meV, a second excitation is observed at an energy just below 2Δ. The higher mode may be a triplet two-magnon bound state. Numerical results in support of bound modes are presented

Sox2 promotes survival of satellite glial cells in vitro

International Nuclear Information System (INIS)

Koike, Taro; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao

2015-01-01

Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling

Sox2 promotes survival of satellite glial cells in vitro

Energy Technology Data Exchange (ETDEWEB)

Koike, Taro, E-mail: koiket@hirakata.kmu.ac.jp; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao

2015-08-14

Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling.

FGF-2 promotes osteocyte differentiation through increased E11/podoplanin expression.

Science.gov (United States)

Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N; Fleming, Robert; Vincent, Tonia L; Buttle, David J; Pitsillides, Andrew A; Staines, Katherine A; Farquharson, Colin

2018-07-01

E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast-like cells and murine primary osteoblasts to FGF-2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF-2-related changes in E11 expression and dendrite formation. FGF-2 strongly activated the ERK signaling pathway in osteoblast-like cells but inhibition of this pathway did not block the ability of FGF-2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF-2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF-2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. © 2017 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.

Copper nanoparticles as an alternative feed additives in poultry diet

DEFF Research Database (Denmark)

Scott, A.; Vadalasetty, K. P.; Chwalibog, A.

2018-01-01

of the crucial health and environmental concerns. In recent years, many studies have reported copper nanoparticles (Cu-NP) as a promising alternative to antibacterial reagents and a growth promoter. Depending on the size, shape, dose and animal species, Cu-NP exhibit a variety of effects on animal performance...

Characterizing AISI 1045 steel surface duplex-treated by alternating current field enhanced pack aluminizing and nitriding

Science.gov (United States)

Xie, Fei; Zhang, Ge; Pan, Jianwei

2018-02-01

Thin cases and long treating time are shortcomings of conventional duplex treatment of aluminizing followed by nitriding (DTAN). Alternating current field (ACF) enhanced DTAN was carried out on AISI 1045 steel by applying an ACF to treated samples and treating agents with a pair of electrodes for overcoming those shortcomings. By investigating cases' structures, phases, composition and hardness distributions of differently treated samples, preliminary studies were made on characterizations of the ACF enhanced duplex treatment to AISI 1045 steel. The results show that, with the help of the ACF, the surface Al-rich phase Al5Fe2 formed in conventional pack aluminizing can be easily avoided and the aluminizing process is dramatically promoted. The aluminizing case can be nitrided either with conventional pack nitriding or ACF enhanced pack nitriding. By applying ACF to pack nitriding, the diffusion of nitrogen into the aluminizing case is promoted. AlN, Fe2∼3N and solid solution of N in iron are efficiently formed as a result of reactions of N with the aluminizing case. A duplex treated case with an effective thickness of more than 170 μm can be obtained by the alternating current field enhanced 4 h pack aluminizing plus 4 h pack nitriding.

Alternative Fuel News: Official Publication of the Clean Cities Network and the Alternative Fuels Data Center, Vol. 4, No. 2

Energy Technology Data Exchange (ETDEWEB)

Ficker, C.

2000-09-08

This issue of Alternative Fuel News discusses Executive Order 13149 which is designed to not only increase the use of alternative fuel by federal agencies but also to increase the use of fuel efficient vehicles in the federal fleet. Also highlighted is the 6th National Clean Cities Conference and Expo held in San Diego, May 7-10, 2000, which attracted nearly 1,000 people for three action-packed days of alternative fuel activities. The work to develop a market for alternative fuels is more important than ever.

Environmental cost-effectiveness of bio diesel production in Greece: Current policies and alternative scenarios

International Nuclear Information System (INIS)

Iliopoulos, Constantine; Rozakis, Stelios

2010-01-01

Following European Directive 2003/30/EC, the Greek Government adapted legislation that introduces and regulates the bio diesel market. The implemented quota scheme allocates the country's annual, predetermined, tax exempt production of bio diesel to industries based on their ability to meet several criteria. A number of bio diesel supply chain stakeholders have criticized this policy for being efficiency-robbing and vague. This paper uses 2007 data from energy crop farms and three bio diesel-producing companies in order to assess these criticisms. We study the economic and environmental aspects of the currently adopted policy and compare them to three alternative scenarios. We conclude that such criticisms have a merit and that policy makers need to reconsider their alternative options regarding the promotion of bio diesel in transport. Permission of sales directly to local consumers and promotion of forward integration by farmers are efficiency enhancing and environment-friendly means of promoting the use of bio diesel in transport.

Mesoporous TiO2 : an alternative material for PEM fuel cells catalyst support

Energy Technology Data Exchange (ETDEWEB)

Do, T.B. [Michigan Univ., Ann Arbor, MI (United States). Dept. of Materials Science; Ruthkosky, M.; Cai, M. [General Motors, Warren, MI (United States). Research and Development Center

2008-07-01

This paper discussed the feasibility of using an alternative catalyst support material to replace carbon in proton exchange membrane (PEM) fuel cells. The alternative catalyst support material requires a high surface area with a large porosity but must have comparable conductivity with carbon. A mesoporous titanium oxide (TiO2) material produced by coprecipitation was introduced. The conductivity of the material is about one order of that of carbon. The 8 mole per cent Nb-doped TiO2 was formed and deposited on the surface of a nano polystyrene (PS) template via the hydrolysis of a co-solution of Ti(OC4H9)4 and Nb(OC2H5)5. The removal of PS by heat treatment produced porous structure of TiO2 with the appearance of 3 different pore types, notably open pore, ink-pot pores and closed pores. TiO2 formed from the rutile phase, allowing a lower activation temperature at 850 degrees C in a hydrogen atmosphere. The pore structures were retained after this heat treatment. The BET surface area was 116 m{sup 2}/g, porosity was 22 per cent and the average pore size was 159 angstrom. The conductivity improved considerably from almost non-conductive to one order of that of carbon.

Alternative Pathways to Legitimacy: Promotional Practices in the Ontario For-Profit College Sector

Science.gov (United States)

Pizarro Milian, Roger; Quirke, Linda

2017-01-01

This study empirically examines how for-profit career colleges in Ontario, Canada market themselves to prospective students. It uses a mixed-methods approach to review the content of 489 online promotional profiles representing 375 unique for-profit colleges. It finds that for-profit colleges adopt several distinct marketing strategies, including…

FCGR2A Promoter Methylation and Risks for Intravenous Immunoglobulin Treatment Responses in Kawasaki Disease

Directory of Open Access Journals (Sweden)

Ho-Chang Kuo

2015-01-01

Full Text Available Kawasaki disease (KD is characterized by pediatric systemic vasculitis of an unknown cause. The low affinity immunoglobulin gamma Fc region receptor II-a (FCGR2A gene was reported to be involved in the susceptibility of KD. DNA methylation is one of the epigenetic mechanisms that control gene expression; thus, we hypothesized that methylation status of CpG islands in FCGR2A promoter associates with the susceptibility and therapeutic outcomes of Kawasaki disease. In this study, 36 KD patients and 24 healthy subjects from out-patient clinic were recruited. Eleven potential methylation sites within the targeted promoter region of FCGR2A were selected for investigation. We marked the eleven methylation sites from A to K. Our results indicated that methylation at the CpG sites G, H, and J associated with the risk of KD. CpG sites B, C, E, F, H, J, and K were found to associate with the outcomes of IVIG treatment. In addition, CpG sites G, J, and K were predicted as transcription factors binding sites for NF-kB, Myc-Max, and SP2, respectively. Our study reported a significant association among the promoter methylation of FCGR2A, susceptibility of KD, and the therapeutic outcomes of IVIG treatment. The methylation levels of CpG sites of FCGR2A gene promoter should be an important marker for optimizing IVIG therapy.

E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor

International Nuclear Information System (INIS)

Hiebert, S.W.; Lipp, M.; Nevins, J.R.

1989-01-01

E2F is a cellular transcription factor that binds to two sites in the adenovirus E2 promoter. Previous experiments have implicated E2F in the E1A-dependent transactivation of the E2 gene since levels of active E2F increase markedly during adenovirus infection in parallel with the increase in E2 transcription, and an E2F binding site can confer E1A inducibility to a heterologous promoter. Here the authors show that E2F binds to two sequence elements within the P2 promoter of the human MYC gene which are within a region that is critical for promoter activity. The MYC promoter can be trans-activated in an E1A-dependent manner and site-directed mutagenesis demonstrates that these E2F elements are essential for trans-activation. Finally, they also find that adenovirus infection of quiescent cells results in a stimulation of the endogenous MYC gene. They conclude that the activation of the E2F factor, which is likely responsible for the activation of viral E2 transcription, is also responsible for the E1A-dependent induction of MYC transcription

Phase-alternated composite π/2 pulses for solid state quadrupole echo NMR spectroscopy

International Nuclear Information System (INIS)

Ramamoorthy, A.; Narasimhan, P.T.

1991-01-01

Phase-alternated composite π/2 pulses have been constructed for spin I=1 to overcome quadrupole interaction effects in solid state nuclear magnetic resonance(NMR) spectroscopy. Magnus expansion approach is used to design these sequences in a manner similar to the NMR coherent averaging theory. It is inferred that the symmetric phase-alternated composite π/2 pulses reported here are quite successful in producing quadrupole echo free phase distortions. This effectiveness of the present composite pulses is due to the fact that most of them are of shorter durations as compared to the ones reported in literature. In this theoretical procedure, irreducible spherical tensor operator formalism is employed to simplify the complexity involved in the evaluation of Magnus expansion terms. It has been argued in this paper that composite π/2 pulse sequences for this purpose can also be derived from the broadband inversion π pulses which are designed to compensate electric field gradient(efg) inhomogeniety in spin I=1 nuclear quadrupole resonance(NQR) spectroscopy. (author). 28 refs

Promoting lifestyle changes for Chinese Australians with Type 2 diabetes

OpenAIRE

SUET TING CHOI

2017-01-01

Providing translated diabetes education from English to Chinese is not enough to promote healthy lifestyle changes among Chinese Australians with type 2 diabetes. This thesis explored the behaviour patterns of Chinese patients during diabetes education and identified the most successful education approaches. The research involved a review of literature and an exploratory qualitative study across three countries. The findings suggest health professionals working with Chinese Australian patient...

Global warming impacts of CFC alternative technologies: Combining fluorocarbon and CO2 effects

International Nuclear Information System (INIS)

Fairchild, P.D.; Fischer, S.K.; Hughes, P.J.

1992-01-01

Chlorofluorocarbons (CFCs) are on their way out, due to their role in stratospheric ozone depletion and the related international Montreal Protocol agreement and various national phaseout timetables. As the research, engineering development, and manufacturing investment decisions have ensued to prepare for this transition away from CFCs, the climate change issue has emerged and there has recently been increased attention on the direct global warming potential (GWP) of the fluorocarbon alternatives as greenhouse gases. However, there has been less focus on the indirect global warming effect arising from end-use energy changes and associated CO 2 emissions. A study was undertaken to address these combined global warming effects. A concept of Total Equivalent Warming Impact (TEWI) was developed for combining the direct and indirect effects and was used for evaluating CFC-replacement options available in the required CFC transition time frame. Analyses of industry technology surveys indicate that CFC-user industries have made substantial progress toward near-equal energy efficiency with many HCFC/HFC alternatives. The findings also bring into question the relative importance of the direct effect in many applications and stress energy efficiency when searching for suitable CFC alternatives. For chillers, household refrigerators, and unitary air-conditioning or heat pump equipment, changes in efficiency of only 2--5% would have a greater effect on future TEWI than completely eliminating the direct effect

Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

Science.gov (United States)

Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

2017-09-12

Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription

Directory of Open Access Journals (Sweden)

Chen-Chun Pai

2017-09-01

Full Text Available Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB binding factor (MBF-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR expression, reduced deoxyribonucleoside triphosphate (dNTP synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast.

Epigenetic repression of regulator of G-protein signaling 2 promotes androgen-independent prostate cancer cell growth.

Science.gov (United States)

Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping

2012-04-01

G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.

41 CFR 102-79.110 - What Integrated Workplace policy must Federal agencies strive to promote?

Science.gov (United States)

2010-07-01

... capital costs over a substantial time period; and (i) Support alternative workplace arrangements... Workplace policy must Federal agencies strive to promote? 102-79.110 Section 102-79.110 Public Contracts and... Integrated Workplace § 102-79.110 What Integrated Workplace policy must Federal agencies strive to promote...

PTP1B inhibitor promotes endothelial cell motility by activating the DOCK180/Rac1 pathway.

Science.gov (United States)

Wang, Yuan; Yan, Feng; Ye, Qing; Wu, Xiao; Jiang, Fan

2016-04-07

Promoting endothelial cell (EC) migration is important not only for therapeutic angiogenesis, but also for accelerating re-endothelialization after vessel injury. Several recent studies have shown that inhibition of protein tyrosine phosphatase 1B (PTP1B) may promote EC migration and angiogenesis by enhancing the vascular endothelial growth factor receptor-2 (VEGFR2) signalling. In the present study, we demonstrated that PTP1B inhibitor could promote EC adhesion, spreading and migration, which were abolished by the inhibitor of Rac1 but not RhoA GTPase. PTP1B inhibitor significantly increased phosphorylation of p130Cas, and the interactions among p130Cas, Crk and DOCK180; whereas the phosphorylation levels of focal adhesion kinase, Src, paxillin, or Vav2 were unchanged. Gene silencing of DOCK180, but not Vav2, abrogated the effects of PTP1B inhibitor on EC motility. The effects of PTP1B inhibitor on EC motility and p130Cas/DOCK180 activation persisted in the presence of the VEGFR2 antagonist. In conclusion, we suggest that stimulation of the DOCK180 pathway represents an alternative mechanism of PTP1B inhibitor-stimulated EC motility, which does not require concomitant VEGFR2 activation as a prerequisite. Therefore, PTP1B inhibitor may be a useful therapeutic strategy for promoting EC migration in cardiovascular patients in which the VEGF/VEGFR functions are compromised.

Providing Training Enhances the Biomechanical Improvements of an Alternative Computer Mouse Design

NARCIS (Netherlands)

Houwink, A.; Oude Hengel, K.M.; Odell, D.; Dennerlein, J.T.

2009-01-01

Objective: The purpose of this study is to determine if an alternative mouse promotes more neutral postures and decreases forearm muscle activity and if training enhances these biomechanical benefits. Background: Computer mouse use is a risk factor for developing musculoskeletal disorders;

Promoting Exit from Violent Extremism

DEFF Research Database (Denmark)

Dalgaard-Nielsen, Anja

2013-01-01

A number of Western countries are currently adding exit programs targeting militant Islamists to their counterterrorism efforts. Drawing on research into voluntary exit from violent extremism, this article identifies themes and issues that seem to cause doubt, leading to exit. It then provides a ...... the influence attempt as subtle as possible, use narratives and self-affirmatory strategies to reduce resistance to persuasion, and consider the possibility to promote attitudinal change via behavioral change as an alternative to seek to influence beliefs directly....

How Bureaucracy Promotes Inclusive Organizing

DEFF Research Database (Denmark)

Holck, Lotte

Diversity literature in general and Feminist in particular have long promoted alternatives to bureaucracy on the premise that this form of governance is far from gender- and race-neutral, and that inclusive organizing necessitate a flatter, decentralized and more ‘organic’ set-up (Ferguson 1984...... and opportunities conducive to their inclusion. Guided by Ashcraft (2001) concept of organized dissonance, this paper explores how the combination of apparent incongruent elements of stability/flexibility and formality/informality might offer a passage for inclusive organizing....

Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

Science.gov (United States)

Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

2017-03-01

Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

SEASTAR: systematic evaluation of alternative transcription start sites in RNA.

Science.gov (United States)

Qin, Zhiyi; Stoilov, Peter; Zhang, Xuegong; Xing, Yi

2018-05-04

Alternative first exons diversify the transcriptomes of eukaryotes by producing variants of the 5' Untranslated Regions (5'UTRs) and N-terminal coding sequences. Accurate transcriptome-wide detection of alternative first exons typically requires specialized experimental approaches that are designed to identify the 5' ends of transcripts. We developed a computational pipeline SEASTAR that identifies first exons from RNA-seq data alone then quantifies and compares alternative first exon usage across multiple biological conditions. The exons inferred by SEASTAR coincide with transcription start sites identified directly by CAGE experiments and bear epigenetic hallmarks of active promoters. To determine if differential usage of alternative first exons can yield insights into the mechanism controlling gene expression, we applied SEASTAR to an RNA-seq dataset that tracked the reprogramming of mouse fibroblasts into induced pluripotent stem cells. We observed dynamic temporal changes in the usage of alternative first exons, along with correlated changes in transcription factor expression. Using a combined sequence motif and gene set enrichment analysis we identified N-Myc as a regulator of alternative first exon usage in the pluripotent state. Our results demonstrate that SEASTAR can leverage the available RNA-seq data to gain insights into the control of gene expression and alternative transcript variation in eukaryotic transcriptomes.

Identification of TNF-α-responsive promoters and enhancers in the intestinal epithelial cell model Caco-2

DEFF Research Database (Denmark)

Boyd, Mette; Coskun, Mehmet; Lilje, Berit

2014-01-01

The Caco-2 cell line is one of the most important in vitro models for enterocytes, and is used to study drug absorption and disease, including inflammatory bowel disease and cancer. In order to use the model optimally, it is necessary to map its functional entities. In this study, we have generated...... genome-wide maps of active transcription start sites (TSSs), and active enhancers in Caco-2 cells with or without tumour necrosis factor (TNF)-α stimulation to mimic an inflammatory state. We found 520 promoters that significantly changed their usage level upon TNF-α stimulation; of these, 52...... promoters. As a case example, we characterize an enhancer regulating the laminin-5 γ2-chain (LAMC2) gene by nuclear factor (NF)-κB binding. This report is the first to present comprehensive TSS and enhancer maps over Caco-2 cells, and highlights many novel inflammation-specific promoters and enhancers....

Androgen signaling promotes translation of TMEFF2 in prostate cancer cells via phosphorylation of the α subunit of the translation initiation factor 2.

Directory of Open Access Journals (Sweden)

Ryan F Overcash

Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.

TGF-β promotes glioma cell growth via activating Nodal expression through Smad and ERK1/2 pathways

International Nuclear Information System (INIS)

Sun, Jing; Liu, Su-zhi; Lin, Yan; Cao, Xiao-pan; Liu, Jia-ming

2014-01-01

Highlights: •TGF-β promoted Nodal expression in glioma cells. •TGF-β promoted Nodal expression via activating Smad and ERK1/2 pathways. •TGF-β promotes glioma cell growth via activating Nodal expression. -- Abstract: While there were certain studies focusing on the mechanism of TGF-β promoting the growth of glioma cells, the present work revealed another novel mechanism that TGF-β may promote glioma cell growth via enhancing Nodal expression. Our results showed that Nodal expression was significantly upregulated in glioma cells when TGF-β was added, whereas the TGF-β-induced Nodal expression was evidently inhibited by transfection Smad2 or Smad3 siRNAs, and the suppression was especially significant when the Smad3 was downregulated. Another, the attenuation of TGF-β-induced Nodal expression was observed with blockade of the ERK1/2 pathway also. Further detection of the proliferation, apoptosis, and invasion of glioma cells indicated that Nodal overexpression promoted the proliferation and invasion of tumor cells and inhibited their apoptosis, resembling the effect of TGF-β addition. Downregulation of Nodal expression via transfection Nodal-specific siRNA in the presence of TGF-β weakened the promoting effect of the latter on glioma cells growth, and transfecting Nodal siRNA alone in the absence of exogenous TGF-β more profoundly inhibited the growth of glioma cells. These results demonstrated that while both TGF-β and Nodal promoted glioma cells growth, the former might exert such effect by enhancing Nodal expression, which may form a new target for glioma therapy

Chemotherapy induces alternative transcription and splicing: Facts and hopes for cancer treatment.

Science.gov (United States)

Lambert, Charles A; Garbacki, Nancy; Colige, Alain C

2017-10-01

Alternative promoter usage, alternative splicing and alternative cleavage/polyadenylation (referred here as to alternative transcription and splicing) are main instruments to diversify the transcriptome from a limited set of genes. There is a good deal of evidence that chemotherapeutic drugs affect these processes, but the therapeutic incidence of these effects is poorly documented. The scope of this study is to review the impact of chemotherapy on alternative transcription and splicing and to discuss potential implications in cancer therapy. A literature survey identified >2200 events induced by chemotherapeutic drugs. The molecular pathways involved in these regulations are briefly discussed. The GO terms associated with the alternative transcripts are mainly related to cell cycle/division, mRNA processing, DNA repair, macromolecules catabolism and chromatin. A large fraction (43%) of transcripts are also related to the new hallmarks of cancer, mostly genetic instability and replicative immortality. Finally, we ask the question of the impact of alternative transcription and splicing on drug efficacy and of the possible curative benefit of combining chemotherapy and pharmaceutical regulation of this process. Copyright © 2017 Elsevier Ltd. All rights reserved.

Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease

International Nuclear Information System (INIS)

Alvarez, Enrique; Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M.

2011-01-01

Highlights: → Novel role for poliovirus 2A protease as splicing modulator. → Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. → Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A pro modulating the alternative splicing of pre-mRNAs. Expression of 2A pro potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A pro abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A pro , leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A pro on splicing is to selectively block the second catalytic step.

Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease

Energy Technology Data Exchange (ETDEWEB)

Alvarez, Enrique, E-mail: ealvarez@cbm.uam.es [Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), Nicolas Cabrera, 1 Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M. [Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), Nicolas Cabrera, 1 Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain)

2011-10-14

Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.

Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury

Directory of Open Access Journals (Sweden)

Kosuke Fujita

2017-06-01

Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.

Development of a gene therapy strategy to target hepatocellular carcinoma based inhibition of protein phosphatase 2A using the α-fetoprotein promoter enhancer and pgk promoter: an in vitro and in vivo study

International Nuclear Information System (INIS)

Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran

2012-01-01

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC

Benefit Analysis of Implementation of Alternative SO2 Quality Standards on Acute Respiratory Syndrome (ARI Incidence Reduction in Indonesia

Directory of Open Access Journals (Sweden)

Muhamad Nizar

2014-12-01

Full Text Available Indonesia Quality Standard (QS for ambient SO2 for 1 hour time average i.e. 900 μg/m3(equivalent to 360μg/m3in24 hour time average regulated in the Government Regulation No. 41 of 1999 is the most loose compared to the ambient SO2 standards of other countries in the world including WHO QS guideline. This QS is not expected to guarantee the protection of public health in Indonesia. Therefore more stringent QS alternative for ambient SO2 is required. This research examines benefit values in public health aspect if Indonesia tightens its ambient SO2 QS. Two alternative QS for SO2 are used i.e196 μg/m3(equivalent to 78μg/m3in24 hour time average referring to U.S. EPA and 750μg/m3(equivalent to 360μg/m3in24 hour time average referring to PUSARPEDAL. First step is to map distribution of SO2 ambient concentrations in Indonesia. The result indicates that Provinces of Jakarta and Banten have exceeded both alternative QS while Provinces of Yogyakarta, West Java, Central Java, East Java, Bali, and North Sumatra only exceed the alternative QS of 196μg/m3. From the public health aspect, by attaining to the alternative QS of 750μg/m3, Jakarta and Banten will reduce incidence of ARI by 95% and 98%. By attaining to the alternative QS of 196μg/m3, East Java, Bali and North Sumatra will reduce the incidence of ARI by 59%, 51%, and 5%.

Observation of the spin gap in a S=1/2 alternating chain compound, high pressure phase of (VO)2P2O7

International Nuclear Information System (INIS)

Saito, Takashi; Azuma, Masaki; Fujita, Masaki; Takano, Mikio

2001-01-01

Inelastic neutron scattering data were collected on the high pressure phase of (VO) 2 P 2 O 7 , a S=1/2 Heisenberg antiferromagnetic alternating chain compound. The existence of a spin gap was confirmed, and the size was determined to be Δ=2.15(6) meV (=25.0(7) K). The theoretically predicted second gap (Δ'=2Δ) owing to a 2-magnon bound state was not observed. This is consistent with the high field magnetization measurement reported previously. (author)

Experimental research on microscopic displacement mechanism of CO2-water alternative flooding in low permeability reservoir

Science.gov (United States)

Han, Hongyan; Zhu, Weiyao; Long, Yunqian; Song, Hongqing; Huang, Kun

2018-02-01

This paper provides an experimental method to deal with the problems of low oil recovery ratio faced with water flooding utilizing the CO2/water alternate displacement technology. A series of CO2/water alternate flooding experiments were carried out under 60°C and 18.4MPa using high temperature / pressure microscopic visualization simulation system. Then, we used the image processing technique and software to analyze the proportion of remaining oil in the displacement process. The results show that CO2 can extract the lighter chemical components in the crude oil and make it easier to form miscible phase, which can reduce the viscosity and favorable mobility ratio of oil. What’s more, the displacement reduces the impact of gas channeling, which can achieve an enlarged sweeping efficiency to improve filtration ability. In addition, the CO2 dissolved in oil and water can greatly reduce the interfacial tension, which can increase the oil displacement efficiency in a large extent. Generally speaking, the recovery rate of residual oil in the micro - model can be elevated up to 15.89% ∼ 16.48% under formation condition by alternate displacement.

Mesenchymal Stem Cells Promote Pancreatic Tumor Growth by Inducing Alternative Polarization of Macrophages

Directory of Open Access Journals (Sweden)

Esha Mathew

2016-03-01

Significance: Targeting the stroma is emerging as a new paradigm in pancreatic cancer; however, efforts to that effect are hampered by our limited understanding of the nature and function of stromal components. Here, we uncover previously unappreciated heterogeneity within the stroma and identify interactions among stromal components that promote tumor growth and could be targeted therapeutically.

Using Checklists to Assess Your Transition to Alternative Fuels: A Technical Reference

Energy Technology Data Exchange (ETDEWEB)

Risch, C. E. [Argonne National Lab. (ANL), Argonne, IL (United States); Santini, D. J. [Argonne National Lab. (ANL), Argonne, IL (United States); Johnson, L. R. [Argonne National Lab. (ANL), Argonne, IL (United States)

2016-12-01

The Checklist for Transition to New Alternative Fuel(s) was published in September 2011 by Chuck Risch and Dan Santini. Many improvements, described below, have been incorporated into this current document, Checklists for Assessing the Transitions to New Highway Fuels.2 Further, the original authors and Larry Johnson, co-author of the current report, identified a need for a succinct version of the full report and prepared a brochure based on it to aid busy decisionmakers: Check It Out: Using Checklists to Assess Your Transition to Alternative Fuels.2 These checklists are tools for those stakeholders charged with determining a feasible alternative fuel or fuels for highway transportation systems of the future. The original had four major players whose needs had to be satisfied for a successful transition. The term “activist,” intended to encompass environmental and other special interests, was included in the “customers” category. Activists are customers of the government in the sense that they organize citizens to exert political pressure to regulate the design of vehicles, fuel infrastructure, and roadway networks. Many who evaluate alternative fuels view activists, particularly environmental activists, as a separate category. Further, “activist” has become a pejorative term to many people. Therefore, we have used the word “advocate” or “activist/advocate” instead. Thus, in this update we recognize that environmental and other activists/advocates have been--and will continue to be--a powerful force promoting change in the nature of the fuels that are used in transportation.

IL6 gene promoter polymorphisms and type 2 diabetes

DEFF Research Database (Denmark)

Huth, Cornelia; Heid, Iris M; Vollmert, Caren

2006-01-01

Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

Quantification of mutation-derived bias for alternate mating functionalities of the Saccharomyces cerevisiae Ste2p pheromone receptor.

Science.gov (United States)

Choudhary, Pooja; Loewen, Michele C

2016-01-01

Although well documented for mammalian G-protein-coupled receptors, alternate functionalities and associated alternate signalling remain to be unequivocally established for the Saccharomyces cerevisiae pheromone Ste2p receptor. Here, evidence supporting alternate functionalities for Ste2p is re-evaluated, extended and quantified. In particular, strong mating and constitutive signalling mutations, focusing on residues S254, P258 and S259 in TM6 of Ste2p, are stacked and investigated in terms of their effects on classical G-protein-mediated signal transduction associated with cell cycle arrest, and alternatively, their impact on downstream mating projection and zygote formation events. In relative dose response experiments, accounting for systemic and observational bias, mutational-derived functional differences were observed, validating the S254L-derived bias for downstream mating responses and highlighting complex relationships between TM6-mutation derived constitutive signalling and ligand-induced functionalities. Mechanistically, localization studies suggest that alterations to receptor trafficking may contribute to mutational bias, in addition to expected receptor conformational stabilization effects. Overall, these results extend previous observations and quantify the contributions of Ste2p variants to mediating cell cycle arrest versus downstream mating functionalities. © Crown copyright 2015.

Alternative Fuels Data Center: Vermont Transportation Data for Alternative

Science.gov (United States)

alternative fuels Fuel Public Private Biodiesel (B20 and above) 3 0 Compressed Natural Gas (CNG) 1 2 Electric Recycled Cooking Oil Powers Biodiesel Vehicles in Vermont Recycled Cooking Oil Powers Biodiesel Vehicles in sold per GGE Biodiesel (B20) $2.79/gallon $2.54/GGE $2.84/gallon $2.58/GGE Biodiesel (B99-B100) $2.47

Comparison of the Kinetic Promoters Piperazine and Carbonic Anhydrase for CO₂ Absorption

DEFF Research Database (Denmark)

Gladis, Arne; Gundersen, Maria T.; Thomsen, Kaj

2017-01-01

Kinetic promoter that enhance the reaction kinetics with CO2 are enabling the use of the low heat of reaction of slow absorbing solvents like MDEA. Mass transfer experiments with 30 wt% MDEA promoted by either by 1.7 and 8.5g/L enzyme carbonic anhydrase (CA) or 5 wt% piperazine (PZ) where conduct...

Genome wide identification of aberrant alternative splicing events in myotonic dystrophy type 2.

Science.gov (United States)

Perfetti, Alessandra; Greco, Simona; Fasanaro, Pasquale; Bugiardini, Enrico; Cardani, Rosanna; Garcia-Manteiga, Jose M; Manteiga, Jose M Garcia; Riba, Michela; Cittaro, Davide; Stupka, Elia; Meola, Giovanni; Martelli, Fabio

2014-01-01

Myotonic dystrophy type 2 (DM2) is a genetic, autosomal dominant disease due to expansion of tetraplet (CCTG) repetitions in the first intron of the ZNF9/CNBP gene. DM2 is a multisystemic disorder affecting the skeletal muscle, the heart, the eye and the endocrine system. According to the proposed pathological mechanism, the expanded tetraplets have an RNA toxic effect, disrupting the splicing of many mRNAs. Thus, the identification of aberrantly spliced transcripts is instrumental for our understanding of the molecular mechanisms underpinning the disease. The aim of this study was the identification of new aberrant alternative splicing events in DM2 patients. By genome wide analysis of 10 DM2 patients and 10 controls (CTR), we identified 273 alternative spliced exons in 218 genes. While many aberrant splicing events were already identified in the past, most were new. A subset of these events was validated by qPCR assays in 19 DM2 and 15 CTR subjects. To gain insight into the molecular pathways involving the identified aberrantly spliced genes, we performed a bioinformatics analysis with Ingenuity system. This analysis indicated a deregulation of development, cell survival, metabolism, calcium signaling and contractility. In conclusion, our genome wide analysis provided a database of aberrant splicing events in the skeletal muscle of DM2 patients. The affected genes are involved in numerous pathways and networks important for muscle physio-pathology, suggesting that the identified variants may contribute to DM2 pathogenesis.

The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

Directory of Open Access Journals (Sweden)

Ling Yang

2013-01-01

Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

Putative tumour-suppressor gene DAB2 is frequently down regulated by promoter hypermethylation in nasopharyngeal carcinoma

International Nuclear Information System (INIS)

Tong, Joanna H; Lo, Kwok W; To, Ka F; Ng, David C; Chau, Shuk L; So, Ken K; Leung, Patrick P; Lee, Tin L; Lung, Raymond W; Chan, Michael W; Chan, Anthony W

2010-01-01

Human Disabled-2 (DAB2), is a multi-function signalling molecule that it is frequently down-regulated in human cancers. We aimed to investigate the possible tumour suppressor effect of DAB2 in nasopharyngeal carcinoma (NPC). We studied the expression of DAB2 in NPC cell lines, xenografts and primary tumour samples. The status of promoter methylation was assessed by methylation specific PCR and bisulfite sequencing. The functional role of DAB2 in NPC was investigated by re-introducing DAB2 expression into NPC cell line C666-1. Decrease or absent of DAB2 transcript was observed in NPC cell lines and xenografts. Loss of DAB2 protein expression was seen in 72% (33/46) of primary NPC as demonstrated by immunohistochemistry. Aberrant DAB2 promoter methylation was detected in 65.2% (30/46) of primary NPC samples by methylation specific PCR. Treatment of the DAB2 negative NPC cell line C666-1 with 5-aza-2'-deoxycytidine resulted in restoration of DAB2 expression in a dose-dependent manner. Overexpression of DAB2 in NPC cell line C666-1 resulted in reduced growth rate and 35% reduction in anchorage-dependent colony formation, and inhibition of serum-induced c-Fos expression compared to vector-transfected controls. Over expression of DAB2 resulted in alterations of multiple pathways as demonstrated by expression profiling and functional network analysis, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways. We report the frequent down regulation of DAB2 in NPC and the promoter hypermethylation contributes to the loss of expression of DAB2. This is the first study demonstrating frequent DAB2 promoter hypermethylation in human cancer. Our functional studies support the putative tumour suppressor effect of DAB2 in NPC cells

Transient HIF2A inhibition promotes satellite cell proliferation and muscle regeneration.

Science.gov (United States)

Xie, Liwei; Yin, Amelia; Nichenko, Anna S; Beedle, Aaron M; Call, Jarrod A; Yin, Hang

2018-03-13

The remarkable regeneration capability of skeletal muscle depends on coordinated proliferation and differentiation of satellite cells. The self-renewal of satellite cells is critical for long-term maintenance of muscle regeneration potential. Hypoxia profoundly affects the proliferation, differentiation, and self-renewal of cultured myoblasts. However, the physiological relevance of hypoxia and hypoxia signaling in satellite cells in vivo remains largely unknown. Here, we report that satellite cells are in an intrinsic hypoxic state in vivo and express hypoxia-inducible factor 2A (HIF2A). HIF2A promotes the stemness and long-term homeostatic maintenance of satellite cells by maintaining the quiescence, increasing the self-renewal and blocking the myogenic differentiation of satellite cells. HIF2A stabilization in satellite cells cultured under normoxia augmented their engraftment potential in regenerative muscle. Reversely, HIF2A ablation led to the depletion of satellite cells and the consequent regenerative failure in the long-term. In contrast, transient pharmacological inhibition of HIF2A accelerated muscle regeneration by increasing satellite cell proliferation and differentiation. Mechanistically, HIF2A induces the quiescence/self-renewal of satellite cells by binding the promoter of Spry1 gene and activating Spry1 expression. These findings suggest that HIF2A is a pivotal mediator of hypoxia signaling in satellite cells and may be therapeutically targeted to improve muscle regeneration.

2d-LCA - an alternative to x-wires

Science.gov (United States)

Puczylowski, Jaroslaw; Hölling, Michael; Peinke, Joachim

2014-11-01

The 2d-Laser Cantilever Anemometer (2d-LCA) is an innovative sensor for two-dimensional velocity measurements in fluids. It uses a micostructured cantilever made of silicon and SU-8 as a sensing element and is capable of performing mesurements with extremly high temporal resolutions up to 150 kHz. The size of the cantilever defines its spatial resolution, which is in the order of 150 μm only. Another big feature is a large angular range of 180° in total. The 2d-LCA has been developed as an alternative measurement method to x-wires with the motivation to create a sensor that can operate in areas where the use of hot-wire anemometry is difficult. These areas include measurements in liquids and in near-wall or particle-laden flows. Unlike hot-wires, the resolution power of the 2d-LCA does not decrease with increasing flow velocity, making it particularly suitable for measurements in high speed flows. Comparative measurements with the 2d-LCA and hot-wires have been carried out in order to assess the performance of the new anemometer. The data of both measurement techniques were analyzed using the same stochastic methods including a spectral analysis as well as an inspection of increment statistics and structure functions. Furthermore, key parameters, such as mean values of both velocity components, angles of attack and the characteristic length scales were determined from both data sets. The analysis reveals a great agreement between both anemometers and thus confirms the new approach.

Prebiotic synthesis of 2-deoxy-d-ribose from interstellar building blocks promoted by amino esters or amino nitriles.

Science.gov (United States)

Steer, Andrew M; Bia, Nicolas; Smith, David K; Clarke, Paul A

2017-09-25

Understanding the prebiotic genesis of 2-deoxy-d-ribose, which forms the backbone of DNA, is of crucial importance to unravelling the origins of life, yet remains open to debate. Here we demonstrate that 20 mol% of proteinogenic amino esters promote the selective formation of 2-deoxy-d-ribose over 2-deoxy-d-threopentose in combined yields of ≥4%. We also demonstrate the first aldol reaction promoted by prebiotically-relevant proteinogenic amino nitriles (20 mol%) for the enantioselective synthesis of d-glyceraldehyde with 6% ee, and its subsequent conversion into 2-deoxy-d-ribose in yields of ≥ 5%. Finally, we explore the combination of these two steps in a one-pot process using 20 mol% of an amino ester or amino nitrile promoter. It is hence demonstrated that three interstellar starting materials, when mixed together with an appropriate promoter, can directly lead to the formation of a mixture of higher carbohydrates, including 2-deoxy-d-ribose.

Vasohibin 2 promotes human luminal breast cancer angiogenesis in a non-paracrine manner via transcriptional activation of fibroblast growth factor 2.

Science.gov (United States)

Tu, Min; Lu, Cheng; Lv, Nan; Wei, Jishu; Lu, Zipeng; Xi, Chunhua; Chen, Jianmin; Guo, Feng; Jiang, Kuirong; Li, Qiang; Wu, Junli; Song, Guoxin; Wang, Shui; Gao, Wentao; Miao, Yi

2016-12-28

Vasohibin 2 (VASH2) is an angiogenic factor and cancer-related protein that acts via paracrine mechanisms. Here, we investigated the angiogenic function and mechanism of action of VASH2 in 200 human breast cancer tissues by performing immunohistochemical staining, western blot, indirect sandwich enzyme-linked immunosorbent assay (ELISA), and a semi-quantitative sandwich-based antibody array. Breast cancer cells stably overexpressing VASH2 or with knocked-down VASH2 were established and used for in vivo and in vitro models. In human luminal tissue, but not in HER2-positive or basal-like breast cancer tissues, VASH2 was positively correlated with CD31-positive microvascular density, induced angiogenesis in xenograft tumors, and promoted human umbilical vein endothelial cell tube formation in vitro. VASH2 expression was absent in the concentrated conditioned medium collected from knocked-down VASH2 and VASH2-overexpressing luminal breast cancer cells. Further, VASH2 regulated the expression of fibroblast growth factor 2 (FGF2) in human luminal breast cancer cells, and the pro-angiogenic effect induced by VASH2 overexpression was blocked by FGF2 neutralization in vitro. Additionally, dual luciferase reporter assay and Chromatin immunoprecipitation analysis results showed that FGF2 promoter was transcriptionally activated by VASH2 via histone modifications. In conclusion, VASH2 expression is positively correlated with FGF2 expression and promotes angiogenesis in human luminal breast cancer by transcriptional activation of fibroblast growth factor 2 through non-paracrine mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Yadav et al., Afr J Tradit Complement Altern Med. (2014) 11(2):249 ...

African Journals Online (AJOL)

cadewumi

Yadav et al., Afr J Tradit Complement Altern Med. (2014) 11(2):249-256 ..... In recent years the popularity of complementary medicine has increased. Much interest has been focused on exploring ... delayed the induction of glucose intolerance and euglycemia in high fructose diet fed rats. Diabegon treatment inhibits the ...

Alternate switching between MFC and MEC for H2O2 synthesis and residual removal in Bioelectro-Fenton system

DEFF Research Database (Denmark)

Zhang, Yifeng; Angelidaki, Irini

2016-01-01

Sustainable H2O2 supply and elimination of residual H2O2 are two key challenges to the Fenton processes treating recalcitrant contaminants. In this study, an innovative Bioelectro-Fenton system capable of alternate switching between microbial electrolysis cell (MEC) and microbial fuel cell (MFC......) mode of operation was developed to meet the challenges. In the MEC mode, H2O2 was electrochemically produced which reacts with Fenton’s reagent (Fe II) to form hydroxyradical. The residual H2O2 (unused H2O2) is removed as electron acceptor by switching the system to MFC mode. Complete decolorization...

Alternative developmental toxicity models for assessing the in vivo embryotoxicity of azoles

NARCIS (Netherlands)

Dimopoulou, Myrto

2018-01-01

The implementation of regulations for protecting both humans and the environment from potential chemical health hazards, as well as the increase of global pressure for reducing, refining and replacing animal experiments promote the development and application of alternatives to in vivo

Syndecans promote integrin-mediated adhesion of mesenchymal cells in two distinct pathways

DEFF Research Database (Denmark)

Whiteford, James; Behrends, Volker; Kirby, Hishani

2007-01-01

and signaling through the cytoplasmic domain of syndecan-4. Here an alternate pathway mediated by the extracellular domains of syndecans-2 and -4 is characterized that is independent of both heparan sulphate and syndecan signaling. This pathway is restricted to mesenchymal cells and was not seen in any...... epithelial cell line tested, apart from vascular endothelia. The syndecan ectodomains coated as substrates promoted integrin-dependent attachment, spreading and focal adhesion formation. Syndecan-4 null cells were competent, as were fibroblasts compromised in heparan sulphate synthesis that were unable...

Conserved alternative and antisense transcripts at the programmed cell death 2 locus

Czech Academy of Sciences Publication Activity Database

Mihola, Ondřej; Forejt, Jiří; Trachtulec, Zdeněk

2007-01-01

Roč. 8, - (2007), s. 20 ISSN 1471-2164 R&D Projects: GA ČR(CZ) GA204/01/0997; GA ČR GA301/05/0738; GA AV ČR IAA5052406; GA MŠk(CZ) 1M0520 Institutional research plan: CEZ:AV0Z50520514 Keywords : Pdcd2 * antisense * alternative transcript * imprinting Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.180, year: 2007

[The "health promotion" approach, a strategic alternative to teenagers' health in the Democratic Republic of Congo?].

Science.gov (United States)

Nsakala, Gabriel Vodiena; Coppieters, Yves

2014-01-01

This paper describes a review of the possibilities of improving HIV/AIDS prevention and reproductive health of teenagers and adolescents in the Democratic Republic of Congo (DRC). This approach was based on compilation of institutional, political, legislative and national strategy data. The document review was completed by information collected from 15 key informants and by direct observation of the work of peer educators and community workers, allowing evaluation of the possibilities of development of the priority domains of the Ottawa Charter for Health Promotion in young adolescents. Health promotion interventions for adolescents are globally ensured institutionally by three specialized programmes of the Ministry of Health, in collaboration with numerous national and international partners. Organized operationally outside of the primary health care circuit, strategic actions are more specifically directed towards acquisition of knowledge than individual skills by means of IEC (information, education and communication) and (BCC) (behaviour change communication) approaches, but with disappointing results. Although traces of these five priority domains of the Ottawa Charter are perceptible in the national response to the health problems of adolescents, the work of the various actors is not coordinated and organized in compliance with health promotion guidelines. The training of health workers appears to be a major determinant to structure this response around a dynamic federating the actions of all stakeholders to orient them towards the options of the health promotion approach.

Alternative loop rings

CERN Document Server

Goodaire, EG; Polcino Milies, C

1996-01-01

For the past ten years, alternative loop rings have intrigued mathematicians from a wide cross-section of modern algebra. As a consequence, the theory of alternative loop rings has grown tremendously. One of the main developments is the complete characterization of loops which have an alternative but not associative, loop ring. Furthermore, there is a very close relationship between the algebraic structures of loop rings and of group rings over 2-groups. Another major topic of research is the study of the unit loop of the integral loop ring. Here the interaction between loop rings and group ri

Standardization of Alternative Fuels. Phase 1

Energy Technology Data Exchange (ETDEWEB)

NONE

2003-08-15

There are different interpretations of the term 'alternative fuels', depending on the part of the world in which the definition is used. In this report, alternative fuels mainly stand for fuels that can replace gasoline and diesel oil and at the same time contribute to lowered emissions with impact on health, environment and climate. The use of alternative vehicle fuels has increased during the last 30 years. However, the increase has developed slowly and today the use is very limited, compared to the use of conventional fuels. Although, the use in some special applications, often in rather small geographical areas, can be somewhat larger. The main interest for alternative fuels has for a long time been driven by supply security issues and the possibility to reduce emissions with a negative impact on health and environment. However, the development of reformulated gasoline and low sulphur diesel oil has contributed to substantially decreased emissions from these fuels without using any alternative fuel. This has reduced the environmental impact driving force for the introduction of alternative fuels. In line with the increased interest for climate effects and the connections between these effects and the emission of greenhouse gases, and then primarily carbon dioxide, the interest for biomass based alternative fuels has increased during the 1990s. Even though one of the driving forces for alternative fuels is small today, alternative fuels are more commonly accepted than ever before. The European Commission has for example in May 2003 agreed on a directive for the promotion of the use of bio fuels. In the directive there are goals for the coming 7 years that will increase the use of alternative fuels in Europe rather dramatically, from below 1 percent now up to almost 6 percent of the total vehicle fuel consumption in 2010. The increased use of alternative fuels in Europe and the rest of the world will create a need for a common interpretation of what we

An Experimental Study of Surfactant Alternating CO2 Injection for Enhanced Oil Recovery of Carbonated Reservoir

Directory of Open Access Journals (Sweden)

Asghar Gandomkar

2016-10-01

Full Text Available Core flooding experiments were conducted with the objective of evaluating near miscible surfactant alternating CO2 injection and the effect of surfactant concentrations on gas-oil and water displacements in porous media. The core samples were provided from a low permeability mixed wet oil reservoir at 156 °F and 1900 psia. In addition, very few studies of surfactant adsorption on carbonate minerals have been conducted. Hence, the surfactant adsorption on carbonate rock was determined by core flooding and crushed tests. It was found that for the crushed rock, the required equilibrium time is approximately five hours, while it is more than four days for the flow-through tests. Hysteresis effects demonstrated that the irreducible water saturations were 5 to 10% higher than the initial connate water saturation after drainage cycles during 5000 ppm surfactant solution. Furthermore, near-miscible surfactant alternating CO2 injection process led to a 4-17% increase in the recovery factor in comparison to water alternating gas process.

GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders.

Directory of Open Access Journals (Sweden)

Kasey N Davis

Full Text Available Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA, the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC. No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517 in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders.

Regional differences in gene expression and promoter usage in aged human brains

KAUST Repository

Pardo, Luba M.

2013-02-19

To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

E1A FUNCTIONS AS A COACTIVATOR OF RETINOIC ACID-DEPENDENT RETINOIC ACID RECEPTOR-BETA-2 PROMOTER ACTIVATION

NARCIS (Netherlands)

KRUYT, FAE; FOLKERS, GE; WALHOUT, AJM; VANDERLEEDE, BM; VANDERSAAG, PT; Kruyt, Frank

The retinoic acid (RA) receptor (RAR) beta2 promoter is strongly activated by RA in embryonal carcinoma (EC) cells. We examined this activation in the P19 EC-derived END-2 cell line and in E1A-expressing counterparts and found strong RA-dependent RARbeta2 promoter activation in the E1A-expressing

LHCSR Expression under HSP70/RBCS2 Promoter as a Strategy to Increase Productivity in Microalgae

Directory of Open Access Journals (Sweden)

Federico Perozeni

2018-01-01

Full Text Available Microalgae are unicellular photosynthetic organisms considered as potential alternative sources for biomass, biofuels or high value products. However, limited biomass productivity is commonly experienced in their cultivating system despite their high potential. One of the reasons for this limitation is the high thermal dissipation of the light absorbed by the outer layers of the cultures exposed to high light caused by the activation of a photoprotective mechanism called non-photochemical quenching (NPQ. In the model organism for green algae Chlamydomonas reinhardtii, NPQ is triggered by pigment binding proteins called light-harvesting-complexes-stress-related (LHCSRs, which are over-accumulated in high light. It was recently reported that biomass productivity can be increased both in microalgae and higher plants by properly tuning NPQ induction. In this work increased light use efficiency is reported by introducing in C. reinhardtii a LHCSR3 gene under the control of Heat Shock Protein 70/RUBISCO small chain 2 promoter in a npq4 lhcsr1 background, a mutant strain knockout for all LHCSR genes. This complementation strategy leads to a low expression of LHCSR3, causing a strong reduction of NPQ induction but is still capable of protecting from photodamage at high irradiance, resulting in an improved photosynthetic efficiency and higher biomass accumulation.

LHCSR Expression under HSP70/RBCS2 Promoter as a Strategy to Increase Productivity in Microalgae.

Science.gov (United States)

Perozeni, Federico; Stella, Giulio Rocco; Ballottari, Matteo

2018-01-05

Microalgae are unicellular photosynthetic organisms considered as potential alternative sources for biomass, biofuels or high value products. However, limited biomass productivity is commonly experienced in their cultivating system despite their high potential. One of the reasons for this limitation is the high thermal dissipation of the light absorbed by the outer layers of the cultures exposed to high light caused by the activation of a photoprotective mechanism called non-photochemical quenching (NPQ). In the model organism for green algae Chlamydomonas reinhardtii , NPQ is triggered by pigment binding proteins called light-harvesting-complexes-stress-related (LHCSRs), which are over-accumulated in high light. It was recently reported that biomass productivity can be increased both in microalgae and higher plants by properly tuning NPQ induction. In this work increased light use efficiency is reported by introducing in C. reinhardtii a LHCSR3 gene under the control of Heat Shock Protein 70 / RUBISCO small chain 2 promoter in a npq4 lhcsr1 background, a mutant strain knockout for all LHCSR genes. This complementation strategy leads to a low expression of LHCSR3 , causing a strong reduction of NPQ induction but is still capable of protecting from photodamage at high irradiance, resulting in an improved photosynthetic efficiency and higher biomass accumulation.

Interleukin-33/ST2 axis promotes breast cancer growth and metastases by facilitating intratumoral accumulation of immunosuppressive and innate lymphoid cells.

Science.gov (United States)

Jovanovic, Ivan P; Pejnovic, Nada N; Radosavljevic, Gordana D; Pantic, Jelena M; Milovanovic, Marija Z; Arsenijevic, Nebojsa N; Lukic, Miodrag L

2014-04-01

The role of IL-33/ST2 pathway in antitumor immunity is unclear. Using 4T1 breast cancer model we demonstrate time-dependent increase of endogenous IL-33 at both the mRNA and protein levels in primary tumors and metastatic lungs during cancer progression. Administration of IL-33 accelerated tumor growth and development of lung and liver metastases, which was associated with increased intratumoral accumulation of CD11b(+) Gr-1(+) TGF-β1(+) myeloid-derived suppressor cells (MDSCs) that expressed IL-13α1R, IL-13-producing Lin(-) Sca-1(+) ST2(+) innate lymphoid cells (ILCs) and CD4(+) Foxp3(+) ST2(+) IL-10(+) Tregs compared to untreated mice. Higher incidence of monocytic vs. granulocytic MDSCs and plasmocytoid vs. conventional dendritic cells (DCs) was present in mammary tumors of IL-33-treated mice. Intratumoral NKp46(+) NKG2D(+) and NKp46(+) FasL(+) cells were markedly reduced after IL-33 treatment, while phosphate-buffered saline-treated ST2-deficient mice had increased frequencies of these tumoricidal natural killer (NK) cells compared to untreated wild-type mice. IL-33 promoted intratumoral cell proliferation and neovascularization, which was attenuated in the absence of ST2. Tumor-bearing mice given IL-33 had increased percentages of splenic MDSCs, Lin(-) Sca-1(+) ILCs, IL-10-expressing CD11c(+) DCs and alternatively activated M2 macrophages and higher circulating levels of IL-10 and IL-13. A significantly reduced NK cell, but not CD8(+) T-cell cytotoxicity in IL-33-treated mice was observed and the mammary tumor progression was not affected when CD8(+) T cells were in vivo depleted. We show a previously unrecognized role for IL-33 in promoting breast cancer progression through increased intratumoral accumulation of immunosuppressive cells and by diminishing innate antitumor immunity. Therefore, IL-33 may be considered as an important mediator in the regulation of breast cancer progression. © 2013 UICC.

Development and Study of Electrochemical Promotion Systems for CO2 Capture and Valorization in Combustion Gases. PROMOCAP Project Final Report

International Nuclear Information System (INIS)

Ruiz, E.; Cillero, D.; Martinez, P. J.; Morales, A.; San Vicente, G.; Diego, G. de; Sanchez, J. M.

2014-01-01

The ultimate goal of the project PROMOCAP was the development and study of electrochemical promotion systems for the capture and valorization of CO 2 in combustion flue gases. To achieve this objective, electrocatalysts consisting of tubes or monoliths of solid electrolyte (K-βAl 2 O 3 or YSZ), coated by the corresponding active metal (Pt, Pd, Ni, Cu, Fe-TiO 2 , Pt-Ru - C, Pt-C, etc.), were prepared using both conventional (painting) and improved (dip-coating, electroless or spray-coating) procedures. Both physico-chemical and volt amperometric characterization of the electrocatalysts was carried out both as prepared and after use in electro promoted CO 2 capture and valorization processes (study of chemisorption, reaction, inhibition, deactivation phenomena, etc.). Pilot plant studies were carried out under realistic conditions for identifying the best electro catalyst and the operating conditions more suitable for CO 2 electro promoted capture and valorization. Finally, the electrocatalysts identified as the most promising for electro promoted CO 2 capture (Pt/K-βAl 2 O 3 ) and valorization (Cu/K-βAl 2 O 3 ) were prepared using the developed optimized procedures and their behavior over multiple cycles of electro promoted CO 2 capture and in long term operation against electro promoted CO 2 hydrogenation, respectively, was studied under real or realistic conditions. (Author)

Alternative Fuels Data Center: Virginia Transportation Data for Alternative

Science.gov (United States)

/2018 Biodiesel and Green Diesel Definitions updated 4/9/2018 Data Download Fueling Stations 706 stations in Virginia with alternative fuels Fuel Public Private Biodiesel (B20 and above) 1 9 Compressed unit sold per GGE per unit sold per GGE Biodiesel (B20) $2.47/gallon $2.25/GGE $2.84/gallon $2.58/GGE

Identification of SH2B2β as an Inhibitor for SH2B1- and SH2B2α-Promoted Janus Kinase-2 Activation and Insulin Signaling

OpenAIRE

Li, Minghua; Li, Zhiqin; Morris, David L.; Rui, Liangyou

2007-01-01

The SH2B family has three members (SH2B1, SH2B2, and SH2B3) that contain conserved dimerization (DD), pleckstrin homology, and SH2 domains. The DD domain mediates the formation of homo- and heterodimers between members of the SH2B family. The SH2 domain of SH2B1 (previously named SH2-B) or SH2B2 (previously named APS) binds to phosphorylated tyrosines in a variety of tyrosine kinases, including Janus kinase-2 (JAK2) and the insulin receptor, thereby promoting the activation of JAK2 or the ins...

Promoter methylation and expression of MGMT and the DNA mismatch repair genes MLH1, MSH2, MSH6 and PMS2 in paired primary and recurrent glioblastomas.

Science.gov (United States)

Felsberg, Jörg; Thon, Niklas; Eigenbrod, Sabina; Hentschel, Bettina; Sabel, Michael C; Westphal, Manfred; Schackert, Gabriele; Kreth, Friedrich Wilhelm; Pietsch, Torsten; Löffler, Markus; Weller, Michael; Reifenberger, Guido; Tonn, Jörg C

2011-08-01

Epigenetic silencing of the O(6) -methylguanine-DNA methyltransferase (MGMT) gene promoter is associated with prolonged survival in glioblastoma patients treated with temozolomide (TMZ). We investigated whether glioblastoma recurrence is associated with changes in the promoter methylation status and the expression of MGMT and the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 in pairs of primary and recurrent glioblastomas of 80 patients, including 64 patients treated with radiotherapy and TMZ after the first operation. Among the primary tumors, the MGMT promoter was methylated in 31 patients and unmethylated in 49 patients. In 71 patients (89%), the MGMT promoter methylation status of the primary tumor was retained at recurrence. MGMT promoter methylation, but not MGMT protein expression, was associated with longer progression-free survival, overall survival and postrecurrence survival (PRS). Moreover, PRS was increased under salvage chemotherapy. Investigation of primary and recurrent glioblastomas of 43 patients did not identify promoter methylation in any of the four MMR genes. However, recurrent glioblastomas demonstrated significantly lower MSH2, MSH6 and PMS2 protein expression as detected by immunohistochemistry. In conclusion, reduced expression of MMR proteins, but not changes in MGMT promoter methylation, is characteristic of glioblastomas recurring after the current standards of care. Copyright © 2011 UICC.

[Regulation of alternative CO{sub 2} fixation pathways in procaryotic and eucaryotic photosynthetic organisms]. Progress report

Energy Technology Data Exchange (ETDEWEB)

1992-12-31

The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.

ATM-Dependent Phosphorylation of MEF2D Promotes Neuronal Survival after DNA Damage

Science.gov (United States)

Chan, Shing Fai; Sances, Sam; Brill, Laurence M.; Okamoto, Shu-ichi; Zaidi, Rameez; McKercher, Scott R.; Akhtar, Mohd W.; Nakanishi, Nobuki

2014-01-01

Mutations in the ataxia telangiectasia mutated (ATM) gene, which encodes a kinase critical for the normal DNA damage response, cause the neurodegenerative disorder ataxia-telangiectasia (AT). The substrates of ATM in the brain are poorly understood. Here we demonstrate that ATM phosphorylates and activates the transcription factor myocyte enhancer factor 2D (MEF2D), which plays a critical role in promoting survival of cerebellar granule cells. ATM associates with MEF2D after DNA damage and phosphorylates the transcription factor at four ATM consensus sites. Knockdown of endogenous MEF2D with a short-hairpin RNA (shRNA) increases sensitivity to etoposide-induced DNA damage and neuronal cell death. Interestingly, substitution of endogenous MEF2D with an shRNA-resistant phosphomimetic MEF2D mutant protects cerebellar granule cells from cell death after DNA damage, whereas an shRNA-resistant nonphosphorylatable MEF2D mutant does not. In vivo, cerebella in Mef2d knock-out mice manifest increased susceptibility to DNA damage. Together, our results show that MEF2D is a substrate for phosphorylation by ATM, thus promoting survival in response to DNA damage. Moreover, dysregulation of the ATM–MEF2D pathway may contribute to neurodegeneration in AT. PMID:24672010

LRRK2 mediated Rab8a phosphorylation promotes lipid storage.

Science.gov (United States)

Yu, Miao; Arshad, Muhammad; Wang, Wenmin; Zhao, Dongyu; Xu, Li; Zhou, Linkang

2018-02-27

Several mutations in leucine rich repeat kinase 2 (LRRK2) gene have been associated with pathogenesis of Parkinson's disease (PD), a neurodegenerative disorder marked by resting tremors, and rigidity, leading to Postural instability. It has been revealed that mutations that lead to an increase of kinase activity of LRRK2 protein are significantly associated with PD pathogenesis. Recent studies have shown that some Rab GTPases, especially Rab8, serve as substrates of LRRK2 and undergo phosphorylation in its switch II domain upon interaction. Current study was performed in order to find out the effects of the phosphorylation of Rab8 and its mutants on lipid metabolism and lipid droplets growth. The phosphorylation status of Rab8a was checked by phos-tag gel. Point mutant construct were generated to investigate the function of Rab8a. 3T3L1 cells were transfected with indicated plasmids and the lipid droplets were stained with Bodipy. Fluorescent microscopy experiments were performed to examine the sizes of lipid droplets. The interactions between Rab8a and Optineurin were determined by immunoprecipitation and western blot. Our assays demonstrated that Rab8a was phosphorylated by mutated LRRK2 that exhibits high kinase activity. Phosphorylation of Rab8a on amino acid residue T72 promoted the formation of large lipid droplets. T72D mutant of Rab8a had higher activity to promote the formation of large lipid droplets compared with wild type Rab8a, with increase in average diameter of lipid droplets from 2.10 μm to 2.46 μm. Moreover, phosphorylation of Rab8a weakened the interaction with its effector Optineurin. Y1699C mutated LRRK2 was able to phosphorylate Rab8a and phosphorylation of Rab8a on site 72 plays important role in the fusion and enlargement of lipid droplets. Taken together, our study suggests an indirect relationship between enhanced lipid storage capacity and PD pathogenesis.

TiO2-V2O5 nanocomposites as alternative energy storage substances for photocatalysts.

Science.gov (United States)

Ngaotrakanwiwat, Pailin; Meeyoo, Vissanu

2012-01-01

TiO2-V2O5 was prepared and evaluated as an energy storage material for photocatalysts with high capacity and initial charging rate. The compound was successfully obtained by sol-gel technique and effects of compound composition and calcination temperature on the energy storage ability were investigated. The synthesized compounds were characterized by means of X-ray powder diffraction (XRD), scanning electron microscopy equipped with energy-dispersive X-ray analysis (SEM-EDX) and transmission electron microscopy (TEM). The results reveals that the compound of Ti:V molar ratio equal to 1:0.11 calcined at 550 degrees C exhibited superior energy storage ability than parent substances and 1.7-times higher capacity and 2.3-times higher initial charging rate compared to WO3, indicating that the compound is a remarkable alternative to conventional energy storage substances.

Promotional programmes for energy conservation and CO2 avoidance. Efficiency and costs

International Nuclear Information System (INIS)

Lechtenboehmer, S.; Bach, W.

1994-01-01

Least-cost planning and demand-side management are attempts to bring into accord company policies of the energy utility with the targets of environmental and climate protection and resource savings. Since 1982 also the Stadtwerke Muenster have promotional programmes for heating system modernization. With the example of three current promotional programmes the article analysis the costs of such programmes, their impact with regard to energy conservation and CO 2 avoidance and their status within the scope of local climate protection. Moreover the volume of investment is assessed which is necessary in Muenster to reduce the heating energy consumption of existing residential buildings till 2005 by more than one third. (orig./UA) [de

Reproductive organ and vascular specific promoter of the rice plasma membrane Ca2+ATPase mediates environmental stress responses in plants.

Science.gov (United States)

Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra

2013-01-01

Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this

Reproductive organ and vascular specific promoter of the rice plasma membrane Ca2+ATPase mediates environmental stress responses in plants.

Directory of Open Access Journals (Sweden)

Kazi Md Kamrul Huda

Full Text Available Plasma membrane Ca(2+ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+ from the cell, hence regulating Ca(2+ level within cells. Though plant Ca(2+ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied.The 1478 bp promoter sequence of rice plasma membrane Ca(2+ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs.The rice plasma membrane Ca(2+ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible

The sunless study: a beach randomized trial of a skin cancer prevention intervention promoting sunless tanning.

Science.gov (United States)

Pagoto, Sherry L; Schneider, Kristin L; Oleski, Jessica; Bodenlos, Jamie S; Ma, Yunsheng

2010-09-01

To examine the impact of a skin cancer prevention intervention that promoted sunless tanning as a substitute for sunbathing. Randomized controlled trial. Public beaches in Massachusetts. Women (N = 250) were recruited to participate in the study during their visit to a public beach. Intervention The intervention included motivational messages to use sunless tanning as an alternative to UV tanning, instructions for proper use of sunless tanning products, attractive images of women with sunless tans, a free trial of a sunless tanning product, skin cancer education, and UV imaging. The control participants completed surveys. The primary outcome was sunbathing 2 months and 1 year after the intervention. Secondary outcomes included sunburns, sun protection use, and sunless tanning. At 2 months, intervention participants reduced their sunbathing significantly more than did controls and reported significantly fewer sunburns and greater use of protective clothing. At 1 year, intervention participants reported significant decreases in sunbathing and increases in sunless tanning relative to control participants but no differences in the other outcomes. This intervention, which promoted sunless tanning as an alternative to UV tanning, had a short-term effect on sunbathing, sunburns, and use of protective clothing and a longer-term effect on sunbathing and sunless tanning. clinicaltrials.gov Identifier: NCT00403377.

Radioactive Decontamination by Strippable Paint

International Nuclear Information System (INIS)

Chantaraparprachoom, N.; Mishima, K.

1998-01-01

The strippable paint, one of the adhesion method, is to decontaminate solid surface of materials or/and a large area. Two kinds of specimen planchet, SUS 304 stainless steel and polycarbonate plastic, contaminated with radioactive 137 Cs were studied under various conditions. It included surface bottom types, the flat and convex concentric circle type, normal condition at room temperature and overheat condition (∼80 degree celsius). This method used coating paints which contains some elements to have a reaction with radioactive materials selectively. ALARA-Decon clear, Rempack-X200 clear, JD-P5-Mrs.Coat and Pro-Blue-color guard were selected to use as the coating paints. The contaminated surface was coated by the strippable paint under the optimum time, followed by peeling the paint seal. The Rempack-X200 showed the best result, the highest decontamination efficiency which are about 99-100% for all conditions of specimens. The JD-P5 and ALARA-Decon showed good results, which are 98-99% decontamination efficiency for the normal condition set of specimens and about 94-97% for the overheat set of specimens. They can decontaminate polycarbonate specimens better than stainless steel specimens. The Pro-Blue-color guard showed the lowest decontamination efficiency of which 60% for polycarbonate specimens at normal condition and 40%, 30% for stainless steel specimens at normal and overheat conditions respectively. There was no effects of surface bottom types significantly

Alternative fuel buses currently in use in China: Life-cycle fossil energy use, GHG emissions and policy recommendations

International Nuclear Information System (INIS)

Ou Xunmin; Zhang Xiliang; Chang Shiyan

2010-01-01

The Chinese government has enacted policies to promote alternative vehicle fuels (AVFs) and alternative fuel vehicles (AFVs), including city bus fleets. The life cycle (LC), energy savings (ES) and GHG reduction (GR) profiles of AVFs/AFVs are critical to those policy decisions. The well-to-wheels module of the Tsinghua-CA3EM model is employed to investigate actual performance data. Compared with conventional buses, AFVs offer differences in performance in terms of both ES and GR. Only half of the AFVs analyzed demonstrate dual benefits. However, all non-oil/gas pathways can substitute oil/gas with coal. Current policies seek to promote technology improvements and market creation initiatives within the guiding framework of national-level diversification and district-level uniformity. Combined with their actual LC behavior and in keeping with near- and long-term strategies, integrated policies should seek to (1) apply hybrid electric technology to diesel buses; (2) encourage NG/LPG buses in gas-abundant cities; (3) promote commercialize electric buses or plug-in capable vehicles through battery technology innovation; (4) support fuel cell buses and hydrogen technology R and D for future potential applications; and (5) conduct further research on boosting vehicle fuel efficiency, applying low-carbon transportation technologies, and addressing all resultant implications of coal-based transportation solutions to human health and natural resources.

Alternative fuel buses currently in use in China: Life-cycle fossil energy use, GHG emissions and policy recommendations

Energy Technology Data Exchange (ETDEWEB)

Ou Xunmin, E-mail: oxm07@mails.tsinghua.edu.c [School of Public Policy and Management (SPPM), Tsinghua University, Beijing 100084 (China); China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China); Zhang Xiliang, E-mail: zhang_xl@tsinghua.edu.c [China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China); Chang Shiyan [China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China)

2010-01-15

The Chinese government has enacted policies to promote alternative vehicle fuels (AVFs) and alternative fuel vehicles (AFVs), including city bus fleets. The life cycle (LC), energy savings (ES) and GHG reduction (GR) profiles of AVFs/AFVs are critical to those policy decisions. The well-to-wheels module of the Tsinghua-CA3EM model is employed to investigate actual performance data. Compared with conventional buses, AFVs offer differences in performance in terms of both ES and GR. Only half of the AFVs analyzed demonstrate dual benefits. However, all non-oil/gas pathways can substitute oil/gas with coal. Current policies seek to promote technology improvements and market creation initiatives within the guiding framework of national-level diversification and district-level uniformity. Combined with their actual LC behavior and in keeping with near- and long-term strategies, integrated policies should seek to (1) apply hybrid electric technology to diesel buses; (2) encourage NG/LPG buses in gas-abundant cities; (3) promote commercialize electric buses or plug-in capable vehicles through battery technology innovation; (4) support fuel cell buses and hydrogen technology R and D for future potential applications; and (5) conduct further research on boosting vehicle fuel efficiency, applying low-carbon transportation technologies, and addressing all resultant implications of coal-based transportation solutions to human health and natural resources.

Alternative fuel buses currently in use in China. Life-cycle fossil energy use, GHG emissions and policy recommendations

Energy Technology Data Exchange (ETDEWEB)

Ou, Xunmin [School of Public Policy and Management (SPPM), Tsinghua University, Beijing 100084 (China); China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China); Zhang, Xiliang; Chang, Shiyan [China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China)

2010-01-15

The Chinese government has enacted policies to promote alternative vehicle fuels (AVFs) and alternative fuel vehicles (AFVs), including city bus fleets. The life cycle (LC), energy savings (ES) and GHG reduction (GR) profiles of AVFs/AFVs are critical to those policy decisions. The well-to-wheels module of the Tsinghua-CA3EM model is employed to investigate actual performance data. Compared with conventional buses, AFVs offer differences in performance in terms of both ES and GR. Only half of the AFVs analyzed demonstrate dual benefits. However, all non-oil/gas pathways can substitute oil/gas with coal. Current policies seek to promote technology improvements and market creation initiatives within the guiding framework of national-level diversification and district-level uniformity. Combined with their actual LC behavior and in keeping with near- and long-term strategies, integrated policies should seek to (1) apply hybrid electric technology to diesel buses; (2) encourage NG/LPG buses in gas-abundant cities; (3) promote commercialize electric buses or plug-in capable vehicles through battery technology innovation; (4) support fuel cell buses and hydrogen technology R and D for future potential applications; and (5) conduct further research on boosting vehicle fuel efficiency, applying low-carbon transportation technologies, and addressing all resultant implications of coal-based transportation solutions to human health and natural resources. (author)

DNA of HeLa cells during caffeine-promoted recovery from X-ray induced G2 arrest

International Nuclear Information System (INIS)

Bases, R.; Mendez, F.; Liebeskind, D.; Elequin, F.; Neubort, S.

1980-01-01

Progression of X-irradiated HeLa cells from G2 arrest through mitosis was promoted by 1mM caffeine. Caffeine promoted the return from abnormally high levels of radiation-induced immunoreactivity to antinucleoside antibodies, which indicates persistent DNA strand separation, to the low levels normally found in G2. With caffeine, the irradiated cells progressed through mitosis, producing daughter cells with the normal G1 content of DNA. Without caffeine, the DNA content of individual radiation-arrested cells retained G2 values and the abnormally high levels of immunoreactivity to antinucleoside antibodies. (author)

Data in support of FSH induction of IRS-2 in human granulosa cells: Mapping the transcription factor binding sites in human IRS-2 promoter

Directory of Open Access Journals (Sweden)

Surleen Kaur

2016-03-01

Full Text Available Insulin receptor substrate-2 (IRS-2 plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS, insulin resistance and cancer. To predict the transcription factors (TFs responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]. The ibid data is part of author׳s publication (Anjali et al., 2015 [2] that explains Follicle stimulating hormone (FSH mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. Keywords: IRS-2, TFBS, FSH, SP1, ChIP

[HER2 gene amplification assay: is CISH an alternative to FISH?].

Science.gov (United States)

Denoux, Yves; Arnould, Laurent; Fiche, Maryse; Lannes, B; Couturier, Jérôme; Vincent-Salomon, Anne; Penault-Llorca, Frédérique; Antoine, M; Balaton, A; Baranzelli, M C; Becette, V; Bellocq, J P; Bibeau, F; Ettore, F; Fridman, V; Gnassia, J P; Jacquemier, J; MacGrogan, G; Mathieu, M C; Migeon, C; Rigaud, C; Roger, P; Sigal-Zafrani, B; Simony-Lafontaine, J; Trassard, M; Treilleux, I; Verriele, V; Voigt, J J

2003-12-01

The HER2 proto-oncogene encodes a transmembrane protein, which is considered to function as a growth factor receptor. Overexpression of this protein found by immunohistochemistry in about 20% of infiltrating breast carcinomas, has a predictive value of response to treatment by trastuzumab, an anti-HER2 humanized monoclonal antibody. Search for HER2 gene amplification is necessary to adapt the immunohistochemical technique quality and also in the cases of delicate analysis or weak overexpression. It is usually carried out by Fluorescence In Situ Hybridization (FISH). A more recent hybridization technique, named CISH because of its chromogenic revelation is an alternative method, which gives highly correlated results with FISH. We present details of this technique, which may be more familiar for the pathologists than FISH, because reading analysis is similar to that of immunohistochemical staining.

Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

Directory of Open Access Journals (Sweden)

Yun-Fang Jia

2017-07-01

Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

Exploring the potential of the glycerol-3-phosphate dehydrogenase 2 (GPD2) promoter for recombinant gene expression in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna

2015-01-01

A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...

BAG3 directly stabilizes Hexokinase 2 mRNA and promotes aerobic glycolysis in pancreatic cancer cells.

Science.gov (United States)