Alpha Adrenergic Induction of Transport of Lysosomal Enzyme across the Blood-Brain Barrier.

Directory of Open Access Journals (Sweden)

Akihiko Urayama

Full Text Available The impermeability of the adult blood-brain barrier (BBB to lysosomal enzymes impedes the ability to treat the central nervous system manifestations of lysosomal storage diseases. Here, we found that simultaneous stimulation of the alpha1 and alpha2 adrenoreceptor restores in adult mice the high rate of transport for the lysosomal enzyme P-GUS that is seen in neonates but lost with development. Beta adrenergics, other monoamines, and acetylcholine did not restore this transport. A high dose (500 microg/mouse of clonidine, a strong alpha2 and weak alpha1 agonist, was able to act as monotherapy in the stimulation of P-GUS transport. Neither use of alpha1 plus alpha2 agonists nor the high dose clonidine disrupted the BBB to albumin. In situ brain perfusion and immunohistochemistry studies indicated that adrengerics act on transporters already at the luminal surface of brain endothelial cells. These results show that adrenergic stimulation, including monotherapy with clonidine, could be key for CNS enzyme replacement therapy.

Branching enzyme assay: selective quantitation of the alpha 1,6-linked glucosyl residues involved in the branching points.

Science.gov (United States)

Krisman, C R; Tolmasky, D S; Raffo, S

1985-06-01

Methods previously described for glycogen or amylopectin branching enzymatic activity are insufficiently sensitive and not quantitative. A new, more sensitive, specific, and quantitative one was developed. It is based upon the quantitation of the glucose residues joined by alpha 1,6 bonds introduced by varying amounts of branching enzyme. The procedure involved the synthesis of a polysaccharide from Glc-1-P and phosphorylase in the presence of the sample to be tested. The branched polysaccharide was then purified and the glucoses involved in the branching points were quantitated after degradation with phosphorylase and debranching enzymes. This method appeared to be useful, not only in enzymatic activity determinations but also in the study of the structure of alpha-D-glucans when combined with those of total polysaccharide quantitation, such as iodine and phenol-sulfuric acid.

Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

OpenAIRE

Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael

2001-01-01

(1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

Comparison of Chain-Length Preferences and Glucan Specificities of Isoamylase-Type α-Glucan Debranching Enzymes from Rice, Cyanobacteria, and Bacteria.

Directory of Open Access Journals (Sweden)

Taiki Kobayashi

Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.

Defining Starch Binding by Glucan Phosphatases

DEFF Research Database (Denmark)

Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

2015-01-01

Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...

Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

Science.gov (United States)

Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

2004-03-26

The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

β-1,3-glucan in developing cotton fibers

International Nuclear Information System (INIS)

Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.

1979-01-01

Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis

Mechanism of action of the endo-(1-->3)-alpha-glucanase MutAp from the mycoparasitic fungus Trichoderma harzianum

NARCIS (Netherlands)

Grün, Christian H.; Dekker, Nick; Nieuwland, Alexander A.; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.; Hochstenbach, Frans

2006-01-01

(1-->3)-alpha-glucanases catalyze the hydrolysis of fungal cell wall (1-->3)-alpha-glucan, and function during cell division of yeasts containing this cell wall component or act in mycoparasitic processes. Here, we characterize the mechanism of action of the (1-->3)-alpha-glucanase MutAp from the

Molecular size estimation of plasma membrane β-glucan synthase from red beet root

International Nuclear Information System (INIS)

Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

1986-01-01

Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.

Directory of Open Access Journals (Sweden)

Chad Steele

2005-12-01

Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.

(1,3;1,4)-β-Glucan Biosynthesis by the CSLF6 Enzyme: Position and Flexibility of Catalytic Residues Influence Product Fine Structure.

Science.gov (United States)

Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B

2016-04-05

Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.

Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis

DEFF Research Database (Denmark)

Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

2016-01-01

was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...

Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

Directory of Open Access Journals (Sweden)

Ira Widjiastuti

2017-03-01

Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

Tumor necrosis factor alpha converting enzyme: an encouraging target for various inflammatory disorders.

Science.gov (United States)

Bahia, Malkeet S; Silakari, Om

2010-05-01

Tumor necrosis factor alpha is one of the most common pro-inflammatory cytokines responsible for various inflammatory disorders. It plays an important role in the origin and progression of rheumatoid arthritis and also in other autoimmune disease conditions. Some anti-tumor necrosis factor alpha antibodies like Enbrel, Humira and Remicade have been successfully used in these disease conditions as antagonists of tumor necrosis factor alpha. Inhibition of generation of active form of tumor necrosis factor alpha is a promising therapy for various inflammatory disorders. Therefore, the inhibition of an enzyme (tumor necrosis factor alpha converting enzyme), which is responsible for processing inactive form of tumor necrosis factor alpha into its active soluble form, is an encouraging target. Many tumor necrosis factor alpha converting enzyme inhibitors have been the candidates of clinical trials but none of them have reached in to the market because of their broad spectrum inhibitory activity for other matrix metalloproteases. Selectivity of tumor necrosis factor alpha converting enzyme inhibition over matrix metalloproteases is of utmost importance. If selectivity is achieved successfully, side-effects can be over-ruled and this approach may become a novel therapy for treatment of rheumatoid arthritis and other inflammatory disorders. This cytokine not only plays a pivotal role in inflammatory conditions but also in some cancerous conditions. Thus, successful targeting of tumor necrosis factor alpha converting enzyme may result in multifunctional therapy.

Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

Science.gov (United States)

Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

2003-01-01

Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

Science.gov (United States)

Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

2017-06-15

Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

Starch and alpha-glucan acting enzymes, modulating their properties by directed evolution

NARCIS (Netherlands)

Kelly, Ronan M.; Dijkhuizen, Lubbert; Leemhuis, Hans

2009-01-01

Starch is the major food reserve in plants and forms a large part of the daily calorie intake in the human diet. Industrially, starch has become a major raw material in the production of various products including bio-ethanol, coating and anti-stating agents. The complexity and diversity of these

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

Directory of Open Access Journals (Sweden)

Akira Yoshimi

2017-11-01

Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

Two secondary carbohydrate binding sites on the surface of barley alpha-amylase 1 have distinct functions and display synergy in hydrolysis of starch granules.

Science.gov (United States)

Nielsen, Morten M; Bozonnet, Sophie; Seo, Eun-Seong; Mótyán, János A; Andersen, Joakim M; Dilokpimol, Adiphol; Abou Hachem, Maher; Gyémánt, Gyöngyi; Naested, Henrik; Kandra, Lili; Sigurskjold, Bent W; Svensson, Birte

2009-08-18

Some polysaccharide processing enzymes possess secondary carbohydrate binding sites situated on the surface far from the active site. In barley alpha-amylase 1 (AMY1), two such sites, SBS1 and SBS2, are found on the catalytic (beta/alpha)(8)-barrel and the noncatalytic C-terminal domain, respectively. Site-directed mutagenesis of Trp(278) and Trp(279), stacking onto adjacent ligand glucosyl residues at SBS1, and of Tyr(380) and His(395), making numerous ligand contacts at SBS2, suggested that SBS1 and SBS2 act synergistically in degradation of starch granules. While SBS1 makes the major contribution to binding and hydrolysis of starch granules, SBS2 exhibits a higher affinity for the starch mimic beta-cyclodextrin. Compared to that of wild-type AMY1, the K(d) of starch granule binding by the SBS1 W278A, W279A, and W278A/W279A mutants thus increased 15-35 times; furthermore, the k(cat)/K(m) of W278A/W279A was 2%, whereas both affinity and activity for Y380A at SBS2 were 10% of the wild-type values. Dual site double and triple SBS1/SBS2 substitutions eliminated binding to starch granules, and the k(cat)/K(m) of W278A/W279A/Y380A AMY1 was only 0.4% of the wild-type value. Surface plasmon resonance analysis of mutants showed that beta-cyclodextrin binds to SBS2 and SBS1 with K(d,1) and K(d,2) values of 0.07 and 1.40 mM, respectively. A model that accounts for the observed synergy in starch hydrolysis, where SBS1 and SBS2 bind ordered and free alpha-glucan chains, respectively, thus targeting the enzyme to single alpha-glucan chains accessible for hydrolysis, is proposed. SBS1 and SBS2 also influence the kinetics of hydrolysis for amylose and maltooligosaccharides, the degree of multiple attack on amylose, and subsite binding energies.

Structure-function relationships of family GH70 glucansucrase and 4,6-α-glucanotransferase enzymes, and their evolutionary relationships with family GH13 enzymes

NARCIS (Netherlands)

Meng, Xiangfeng; Gangoiti, Joana; Bai, Yuxiang; Pijning, Tjaard; Van Leeuwen, Sander S; Dijkhuizen, Lubbert

2016-01-01

Lactic acid bacteria (LAB) are known to produce large amounts of α-glucan exopolysaccharides. Family GH70 glucansucrase (GS) enzymes catalyze the synthesis of these α-glucans from sucrose. The elucidation of the crystal structures of representative GS enzymes has advanced our understanding of their

Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

Science.gov (United States)

Gomaa, K; Kraus, J; Franz, G; Röper, H

1991-09-18

Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

Beta-glucans in the treatment of diabetes and associated cardiovascular risks

Directory of Open Access Journals (Sweden)

Jiezhong Chen

2008-12-01

Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis

Binding Interactions Between α-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

DEFF Research Database (Denmark)

Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.

2012-01-01

Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...

Quantitative iTRAQ secretome analysis of Aspergillus niger reveals novel hydrolytic enzymes.

Science.gov (United States)

Adav, Sunil S; Li, An A; Manavalan, Arulmani; Punt, Peter; Sze, Siu Kwan

2010-08-06

The natural lifestyle of Aspergillus niger made them more effective secretors of hydrolytic proteins and becomes critical when this species were exploited as hosts for the commercial secretion of heterologous proteins. The protein secretion profile of A. niger and its mutant at different pH was explored using iTRAQ-based quantitative proteomics approach coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). This study characterized 102 highly confident unique proteins in the secretome with zero false discovery rate based on decoy strategy. The iTRAQ technique identified and relatively quantified many hydrolyzing enzymes such as cellulases, hemicellulases, glycoside hydrolases, proteases, peroxidases, and protein translocating transporter proteins during fermentation. The enzymes have potential application in lignocellulosic biomass hydrolysis for biofuel production, for example, the cellulolytic and hemicellulolytic enzymes glucan 1,4-alpha-glucosidase, alpha-glucosidase C, endoglucanase, alpha l-arabinofuranosidase, beta-mannosidase, glycosyl hydrolase; proteases such as tripeptidyl-peptidase, aspergillopepsin, and other enzymes including cytochrome c oxidase, cytochrome c oxidase, glucose oxidase were highly expressed in A. niger and its mutant secretion. In addition, specific enzyme production can be stimulated by controlling pH of the culture medium. Our results showed comprehensive unique secretory protein profile of A. niger, its regulation at different pH, and the potential application of iTRAQ-based quantitative proteomics for the microbial secretome analysis.

Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

DEFF Research Database (Denmark)

Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

2017-01-01

-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

Science.gov (United States)

Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

2007-01-01

Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

Science.gov (United States)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-20

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

Science.gov (United States)

Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

2014-03-01

The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

Characterization of the Paenibacillus beijingensis DSM 24997 GtfD and its glucan polymer products representing a new glycoside hydrolase 70 subfamily of 4,6-α-glucanotransferase enzymes.

Directory of Open Access Journals (Sweden)

Joana Gangoiti

Full Text Available Previously we have reported that the Gram-negative bacterium Azotobacter chroococcum NCIMB 8003 uses the 4,6-α-glucanotransferase GtfD to convert maltodextrins and starch into a reuteran-like polymer consisting of (α1→4 glucan chains connected by alternating (α1→4/(α1→6 linkages and (α1→4,6 branching points. This enzyme constituted the single evidence for this reaction and product specificity in the GH70 family, mostly containing glucansucrases encoded by lactic acid bacteria (http://www.CAZy.org. In this work, 4 additional GtfD-like proteins were identified in taxonomically diverse plant-associated bacteria forming a new GH70 subfamily with intermediate characteristics between the evolutionary related GH13 and GH70 families. The GtfD enzyme encoded by Paenibacillus beijingensis DSM 24997 was characterized providing the first example of a reuteran-like polymer synthesizing 4,6-α-glucanotransferase in a Gram-positive bacterium. Whereas the A. chroococcum GtfD activity on amylose resulted in the synthesis of a high molecular polymer, in addition to maltose and other small oligosaccharides, two reuteran-like polymer distributions are produced by P. beijingensis GtfD: a high-molecular mass polymer and a low-molecular mass polymer with an average Mw of 27 MDa and 19 kDa, respectively. Compared to the A. chroooccum GtfD product, both P. beijingensis GtfD polymers contain longer linear (α1→4 sequences in their structure reflecting a preference for transfer of even longer glucan chains by this enzyme. Overall, this study provides new insights into the evolutionary history of GH70 enzymes, and enlarges the diversity of natural enzymes that can be applied for modification of the starch present in food into less and/or more slowly digestible carbohydrate structures.

An extracellular cell-attached pullulanase confers branched α-glucan utilization in human gut Lactobacillus acidophilus

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig

2017-01-01

binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...

Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

Science.gov (United States)

Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

2017-09-05

Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

Science.gov (United States)

Kuzmanoff, K. M.

1984-01-01

In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

The Exiguobacterium sibiricum 255-15 GtfC Enzyme Represents a Novel Glycoside Hydrolase 70 Subfamily of 4,6-α-Glucanotransferase Enzymes.

Science.gov (United States)

Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

2016-01-15

The glycoside hydrolase 70 (GH70) family originally was established for glucansucrase enzymes found solely in lactic acid bacteria synthesizing α-glucan polysaccharides from sucrose (e.g., GtfA). In recent years, we have characterized GtfB and related Lactobacillus enzymes as 4,6-α-glucanotransferase enzymes. These GtfB-type enzymes constitute the first GH70 subfamily of enzymes that are unable to act on sucrose as a substrate but are active with maltodextrins and starch, cleave α1→4 linkages, and synthesize linear α1→6-glucan chains. The GtfB disproportionating type of activity results in the conversion of malto-oligosaccharides into isomalto/malto-polysaccharides with a relatively high percentage of α1→6 linkages. This paper reports the identification of the members of a second GH70 subfamily (designated GtfC enzymes) and the characterization of the Exiguobacterium sibiricum 255-15 GtfC enzyme, which is also inactive with sucrose and displays 4,6-α-glucanotransferase activity with malto-oligosaccharides. GtfC differs from GtfB in synthesizing isomalto/malto-oligosaccharides. Biochemically, the GtfB- and GtfC-type enzymes are related, but phylogenetically, they clearly constitute different GH70 subfamilies, displaying only 30% sequence identity. Whereas the GtfB-type enzyme largely has the same domain order as glucansucrases (with α-amylase domains A, B, and C plus domains IV and V), this GtfC-type enzyme differs in the order of these domains and completely lacks domain V. In GtfC, the sequence of conserved regions I to IV of clan GH-H is identical to that in GH13 (I-II-III-IV) but different from that in GH70 (II-III-IV-I because of a circular permutation of the (β/α)8 barrel. The GtfC 4,6-α-glucanotransferase enzymes thus represent structurally and functionally very interesting evolutionary intermediates between α-amylase and glucansucrase enzymes. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Methodologies for conformational studies of oligo- and poly-glucans: crystallography and molecular mechanics

International Nuclear Information System (INIS)

Tran, Huu Vinh

1983-01-01

After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans

Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

Directory of Open Access Journals (Sweden)

E. Y. Choi

2016-11-01

Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

The effect of alpha amylase enzyme on quality of sweet sorghum juice for chrystal sugar

Science.gov (United States)

Marwati, T.; Cahyaningrum, N.; Widodo, S.; Astiati, U. T.; Budiyanto, A.; Wahyudiono; Arif, A. B.; Richana, N.

2018-01-01

Sweet sorghum juice (Sorghum bicolor L. Moench) has characteristics similar to sugar cane juice and potentially used for sugar substitutes that can support food security. Nevertheless the sweet sorghum juicecontain starch which impede sorghum sugar crystallization. Therefore, research on the enzymatic process is needed to convert starch into reducing sugar. The experimental design used was the Factorial Randomized Design with the first factor was alpha amylase enzyme concentration (0, 20, 40, 60, 80, 100, 120 μL/100 mL) and second factor was incubation time (0, 30, 60, 90 minute) at temperature 100°C. The experiment was conducted on fresh sweet sorghum. The results showed that the addition of the alpha amylase enzyme increased the content of reducing sugar and decreased levels of starch. Elevating concentration of alpha amylase enzyme will increase the reducing sugar content in sweet sorghum juice. The optimum alpha amylase enzyme concentration to produce the highest total sugar was 80 μL/100 mL of sweet sorghum juice with the optimum incubation time was 90 minutes. The results of this study are expected to create a new sweetener for sugar substitution. From the economic prospective aspect, sorghum is a potential crop and can be relied upon to support the success of the food diversification program which further leads to the world food security

Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

Science.gov (United States)

Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

2014-01-01

Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

Science.gov (United States)

Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

Evaluation on prebiotic properties of β-glucan and oligo-β-glucan from mushrooms by human fecal microbiota in fecal batch culture

Directory of Open Access Journals (Sweden)

Chiraphon Chaikliang

2015-11-01

Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of

Effect of neohesperidin dihydrochalcone on the activity and stability of alpha-amylase: a comparative study on bacterial, fungal, and mammalian enzymes.

Science.gov (United States)

Kashani-Amin, Elaheh; Ebrahim-Habibi, Azadeh; Larijani, Bagher; Moosavi-Movahedi, Ali Akbar

2015-10-01

Neohesperidin dihydrochalcone (NHDC) was recently introduced as an activator of mammalian alpha-amylase. In the current study, the effect of NHDC has been investigated on bacterial and fungal alpha-amylases. Enzyme assays and kinetic analysis demonstrated the capability of NHDC to significantly activate both tested alpha-amylases. The ligand activation pattern was found to be more similar between the fungal and mammalian enzyme in comparison with the bacterial one. Further, thermostability experiments indicated a stability increase in the presence of NHDC for the bacterial enzyme. In silico (docking) test locates a putative binding site for NHDC on alpha-amylase surface in domain B. This domain shows differences in various alpha-amylase types, and the different behavior of the ligand toward the studied enzymes may be attributed to this fact. Copyright © 2015 John Wiley & Sons, Ltd.

Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

Science.gov (United States)

Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

2016-10-01

This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Transcriptome wide identification and characterization of starch branching enzyme in finger millet.

Science.gov (United States)

Tyagi, Rajhans; Tiwari, Apoorv; Garg, Vijay Kumar; Gupta, Sanjay

2017-01-01

Starch-branching enzymes (SBEs) are one of the four major enzyme classes involved in starch biosynthesis in plants and play an important role in determining the structure and physical properties of starch granules. Multiple SBEs are involved in starch biosynthesis in plants. Finger millet is calcium rich important serial crop belongs to grass family and the transcriptome data of developing spikes is available on NCBI. In this study it was try to find out the gene sequence of starch branching enzyme and annotate the sequence and submit the sequence for further use. Rice SBE sequence was taken as reference and for characterization of the sequence different in silico tools were used. Four domains were found in the finger millet Starch branching enzyme like alpha amylase catalytic domain from 925 to2172 with E value 0, N-terminal Early set domain from 634 to 915 with E value 1.62 e-42, Alpha amylase, C-terminal all-beta domain from 2224 to 2511 with E value 5.80e-24 and 1,4-alpha-glucan-branching enzyme from 421 to 2517 with E value 0. Major binding interactions with the GLC (alpha-d-glucose), CA (calcium ion), GOL (glycerol), TRS (2-amino-2-hydroxymethylpropane- 1, 3-diol), MG (magnesium ion) and FLC (citrate anion) are fond with different residues. It was found in the phylogenetic study of the finger millet SBE with the 6 species of grass family that two clusters were form A and B. In cluster A, finger millet showed closeness with Oryzasativa and Setariaitalica, Sorghum bicolour and Zea mays while cluster B was formed with Triticumaestivum and Brachypodium distachyon. The nucleotide sequence of Finger millet SBE was submitted to NCBI with the accession no KY648913 and protein structure of SBE of finger millet was also submitted in PMDB with the PMDB id - PM0080938. This research presents a comparative overview of Finger millet SBE and includes their properties, structural and functional characteristics, and recent developments on their post-translational regulation.

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

Science.gov (United States)

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

2017-04-01

Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

Enzymatic hydrolysis on protein and β-glucan content of Sang-yodrice bran hydrolysatesand their anti-inflammatory activityonRAW 264.7 cells

Directory of Open Access Journals (Sweden)

Natcha Phantuwong

2017-12-01

Full Text Available Background: Research focusing on the improvement of the utilization of rice bran is increasing due to its nutritional properties. Several biological activities of rice bran hydrolysates and its constituents have been reported. Sang-yod rice, a local rice variety in Southern of Thailand, is a pigmented rice. Furthermore, its bran has high nutritive value and health beneficial components. Accordingly, there is growing interest in transforming this by-product into a functional food ingredient. Objective: To investigate the effect of enzymatic hydrolysis processes on the digestion of protein and β-glucan and evaluate anti-proinflammatory properties of selected hydrolysates on RAW 264.7 macrophage cells. Method: Sang-yod rice bran hydrolysates were obtained using a single or co-enzymatic hydrolysis process and sequential hydrolysis process using amyloglucosidase and protease G6. Effects of enzyme concentration (3-5% v/w and hydrolysis duration (30, 60, and 120 min on soluble protein and β-glucan contents of obtained rice bran hydrolysates were evaluated. The selected rice bran hydrolysates were evaluated for their cell viability and inhibition against NO and pro-inflammatory cytokines generation on RAW 264.7 mouse macrophage cell lines. Results: Protein content (0.59-3.37 % of the rice bran hydrolysates (RBHs was increased by increasing of enzyme concentration (3-5% v/w and hydrolysis time (60-120 min. However, the β-glucan content (0.88-4.63% of RBHs decreased with the increase of those parameters. The RBHs derived by the sequential process using 5% v/w enzyme concentration and 60 min hydrolysis time gave high protein (3.23% and high β-glucan (4.02% contents. The hydrolysates with high amount of protein and/or β-glucan contents demonstrated no cytotoxicity against RAW 264.7 cells at concentration range of 100-2,000 μg/ml. Additionally, they demonstrated NO inhibition and pro-inflammatory inhibition ranges of 49.09-71.63% and 9

Roles of multiple surface sites, long substrate binding clefts, and carbohydrate binding modules in the action of amylolytic enzymes on polysaccharide substrates

DEFF Research Database (Denmark)

Nielsen, Morten Munch; Seo, E.S.; Dilokpimol, Adiphol

2008-01-01

Germinating barley seeds contain multiple forms of alpha-amylase, which are subject to both differential gene expression and differential degradation as part of the repertoire of starch-degrading enzymes. The alpha-amylases are endo-acting and possess a long substrate binding cleft with a charact......Germinating barley seeds contain multiple forms of alpha-amylase, which are subject to both differential gene expression and differential degradation as part of the repertoire of starch-degrading enzymes. The alpha-amylases are endo-acting and possess a long substrate binding cleft...... will address surface sites in both barley alpha-amylase 1 and in the related isozyme 2....

Structural Characterization of Bioengineered alpha-D-Glucans Produced by Mutant Glucansucrase GTF180 Enzymes of Lactobacillus reuteri Strain 180

NARCIS (Netherlands)

van Leeuwen, Sander S.; Kralj, Slavko; Eeuwema, Wieger; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

Mutagenesis of specific amino acid residues of the glucansucrase (GTF180) enzyme from Lactobacillus reuteri strain 180 yielded 12 mutant enzymes that produced modified exopolysaccharides (mEPSs) from sucrose. Ethanol-precipitated and purified mEPSs were subjected to linkage analysis, Smith

Reflection on design and testing of pancreatic alpha-amylase inhibitors: an in silico comparison between rat and rabbit enzyme models

Directory of Open Access Journals (Sweden)

Khalil-Moghaddam Shiva

2012-11-01

Full Text Available Abstract Background Inhibitors of pancreatic alpha-amylase are potential drugs to treat diabetes and obesity. In order to find compounds that would be effective amylase inhibitors, in vitro and in vivo models are usually used. The accuracy of models is limited, but these tools are nonetheless valuable. In vitro models could be used in large screenings involving thousands of chemicals that are tested to find potential lead compounds. In vivo models are still used as preliminary mean of testing compounds behavior in the whole organism. In the case of alpha-amylase inhibitors, both rats and rabbits could be chosen as in vivo models. The question was which animal could present more accuracy with regard to its pancreatic alpha-amylase. Results As there is no crystal structure of these enzymes, a molecular modeling study was done in order to compare the rabbit and rat enzymes with the human one. The overall result is that rabbit enzyme could probably be a better choice in this regard, but in the case of large ligands, which could make putative interactions with the −4 subsite of pancreatic alpha-amylase, interpretation of results should be made cautiously. Conclusion Molecular modeling tools could be used to choose the most suitable model enzyme that would help to identify new enzyme inhibitors. In the case of alpha-amylase, three-dimensional structures of animal enzymes show differences with the human one which should be taken into account when testing potential new drugs.

Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children

DEFF Research Database (Denmark)

Holst, Gitte Juel; Høst, Arne; Doekes, G

2015-01-01

Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...

beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

Energy Technology Data Exchange (ETDEWEB)

Satoh, S; Matsuda, K; Tamari, K

1976-12-01

A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

Plants with elevated levels of glucan

Energy Technology Data Exchange (ETDEWEB)

Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

2018-03-20

The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

Synthesis of New Hyper-Branched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants

NARCIS (Netherlands)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-01

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were

Glucan: mechanisms involved in its radioprotective effect

International Nuclear Information System (INIS)

Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.

1987-01-01

It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested

Effect of modification with 1,4-α-glucan branching enzyme on the rheological properties of cassava starch.

Science.gov (United States)

Li, Yadi; Li, Caiming; Gu, Zhengbiao; Hong, Yan; Cheng, Li; Li, Zhaofeng

2017-10-01

Steady and dynamic shear measurements were used to investigate the rheological properties of cassava starches modified using the 1,4-α-glucan branching enzyme (GBE) from Geobacillus thermoglucosidans STB02. GBE treatment lowered the hysteresis loop areas, the activation energy (E a ) values and the parameters in rheological models of cassava starch pastes. Moreover, GBE treatment increased its storage (G') and loss (G″) moduli, and decreased their tan δ (ratio of G″/G') values and frequency-dependencies. Scanning electron microscopic studies showed the selective and particular attack of GBE on starch granules, and X-ray diffraction analyses showed that GBE treatment produces significant structural changes in amylose and amylopectin. These changes demonstrate that GBE modification produces cassava starch with a more structured network and improved stability towards mechanical processing. Differential scanning calorimetric analysis and temperature sweeps indicated greater resistance to granule rupture, higher gel rigidity, and a large decrease in the rate of initial conformational ordering with increasing GBE treatment time. Pronounced changes in rheological parameters revealed that GBE modification enhances the stability of cassava starch and its applicability in the food processing industry. Copyright © 2017 Elsevier B.V. All rights reserved.

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

Science.gov (United States)

Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

2008-06-01

Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

Science.gov (United States)

Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

2018-04-03

Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.

Science.gov (United States)

Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza

2008-03-20

Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).

Multipoint attachment to a support protects enzyme from inactivation by organic solvents: alpha-Chymotrypsin in aqueous solutions of alcohols and diols.

Science.gov (United States)

Mozhaev, V V; Sergeeva, M V; Belova, A B; Khmelnitsky, Y L

1990-03-25

Inactivation of alpha-chymotrypsin in aqueous solutions of alcohols and diols proceeds both reversibly and irreversibly. Reversible loss of the specific enzyme activity results from conformational changes (unfolding) of the enzyme detected by fluorescence spectroscopy. Multipoint covalent attachment to the matrix of polyacryl-amide gel by copolymerization method stabilizes alpha-chymotrypsin from denaturation by alcohols, the stabilizing effect increasing with the number of bonds between the protein and the support. Immobilization protects the enzyme also from irreversible inactivation by organic solvents resulting from bimolecular aggregation and autolysis.

6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

Science.gov (United States)

Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

2016-02-12

With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

Structure and biosynthesis of fungal alpha-glucans

NARCIS (Netherlands)

Grün, Christian Hugo

2003-01-01

The fungal cell wall is unique among eukaryotes and therefore it forms an ideal target for the development of novel antifungal drugs. Fungal cell morphology and integrity depend on a cell-surrounding wall, which is composed of glycoproteins and polysaccharides. Disrupting enzymes that are involved

Oral beta-glucan adjuvant therapy converts nonprotective Th2 response to protective Th1 cell-mediated immune response in mammary tumor-bearing mice.

Directory of Open Access Journals (Sweden)

Gordon D Ross

2007-06-01

Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.

β-glucan extract from oat bran and its industrial importance

Science.gov (United States)

Ibrahim, M. N. G.; Selezneva, I. S.

2017-09-01

The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

Science.gov (United States)

Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

1989-05-01

A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

Progranulin acts as a shared chaperone and regulates multiple lysosomal enzymes

Directory of Open Access Journals (Sweden)

Jinlong Jian

2017-09-01

Full Text Available Multifunctional factor progranulin (PGRN plays an important role in lysosomes, and its mutations and insufficiency are associated with lysosomal storage diseases, including neuronal ceroid lipofuscinosis and Gaucher disease (GD. The first breakthrough in understanding the molecular mechanisms of PGRN as regulator of lysosomal storage diseases came unexpectedly while investigating the role of PGRN in inflammation. Challenged PGRN null mice displayed typical features of GD. In addition, GRN gene variants were identified in GD patients and the serum levels of PGRN were significantly lower in GD patients. PGRN directly binds to and functions as a chaperone of the lysosomal enzyme β-glucocerebrosidase (GCaase, whose mutations cause GD. In addition, its C-terminus containing granulin E domain, termed Pcgin (PGRN C-terminus for GCase Interaction, is required for the association between PGRN and GCase. The concept that PGRN acts as a chaperone of lysosomal enzymes was further supported and extended by a recent article showing that PGRN acts as a chaperone molecule of lysosomal enzyme cathepsin D (CSTD, and the association between PGRN and CSTD is also mediated by PGRN's C-terminal granulin E domain. Collectively, these reports suggest that PGRN may act as a shared chaperone and regulates multiple lysosomal enzymes.

Enzyme replacement therapy for alpha-mannosidosis

DEFF Research Database (Denmark)

Borgwardt, Line Gutte; Dali, Christine I.; Fogh, J

2013-01-01

Alpha-mannosidosis (OMIM 248500) is a rare lysosomal storage disease (LSD) caused by alpha-mannosidase deficiency. Manifestations include intellectual disabilities, facial characteristics and hearing impairment. A recombinant human alpha-mannosidase (rhLAMAN) has been developed for weekly...

Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

OpenAIRE

Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

2003-01-01

Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

Functional diversity of carbohydrate-active enzymes enabling a bacterium to ferment plant biomass.

Science.gov (United States)

Boutard, Magali; Cerisy, Tristan; Nogue, Pierre-Yves; Alberti, Adriana; Weissenbach, Jean; Salanoubat, Marcel; Tolonen, Andrew C

2014-11-01

Microbial metabolism of plant polysaccharides is an important part of environmental carbon cycling, human nutrition, and industrial processes based on cellulosic bioconversion. Here we demonstrate a broadly applicable method to analyze how microbes catabolize plant polysaccharides that integrates carbohydrate-active enzyme (CAZyme) assays, RNA sequencing (RNA-seq), and anaerobic growth screening. We apply this method to study how the bacterium Clostridium phytofermentans ferments plant biomass components including glucans, mannans, xylans, galactans, pectins, and arabinans. These polysaccharides are fermented with variable efficiencies, and diauxies prioritize metabolism of preferred substrates. Strand-specific RNA-seq reveals how this bacterium responds to polysaccharides by up-regulating specific groups of CAZymes, transporters, and enzymes to metabolize the constituent sugars. Fifty-six up-regulated CAZymes were purified, and their activities show most polysaccharides are degraded by multiple enzymes, often from the same family, but with divergent rates, specificities, and cellular localizations. CAZymes were then tested in combination to identify synergies between enzymes acting on the same substrate with different catalytic mechanisms. We discuss how these results advance our understanding of how microbes degrade and metabolize plant biomass.

The biological activities of (1,3)-(1,6)-{beta}-d-glucan and porous electrospun PLGA membranes containing {beta}-glucan in human dermal fibroblasts and adipose tissue-derived stem cells

Energy Technology Data Exchange (ETDEWEB)

Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)

2010-08-01

In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.

Progress of pancreatitis disease biomarker alpha amylase enzyme by new nano optical sensor.

Science.gov (United States)

Attia, M S; Al-Radadi, Najlaa S

2016-12-15

A new nano optical sensor binuclear Pd-(2-aminothiazole) (urea), Pd(atz,ur) complex was prepared and characterized for the assessment of the activity of alpha amylase enzyme in urine and serum samples for early diagnosis of Pancreatitis disease. The assessment of alpha amylase activity is carried out by the quenching of the luminescence intensity of the nano optical sensor binuclear Pd(atz,ur) complex at 457nm by the 2-chloro-4-nitrophenol (2-CNP) which produced from the reaction of the enzyme with 2-chloro-4-nitrophenyl-α-d-maltotrioside (CNPG3) substrate. The remarkable quenching of the luminescence intensity at 457nm of nano Pd(atz,ur) doped in sol-gel matrix by various concentrations of the 2-CNP was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 8.5×10(-6) to 1.9×10(-9)molL(-1) 2-CNP with a correlation coefficient of (0.999) and a detection limit of (7.4×10(-10)molL(-1)). The method was used satisfactorily for the assessment of the α-amylase activity over activity range (3-321U/L) in different urine and serum samples of pancreatitis patients. The assessment of the alpha amylase biomarker by the proposed method increases its sensitivity (96.88%) and specificity (94.41%) for early diagnosis of pancreatitis diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

Optimization and scale-up of fermentation of glucansucrase and branched glucan by Pediococcus pentosaceus CRAG3 using Taguchi methodology in bioreactor

Directory of Open Access Journals (Sweden)

RISHIKESH SHUKLA

2012-01-01

Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.

Reactions of saccharides catalyzed by molybdate ions. XXXIII. Use of. cap alpha. (U-/sup 14/C)glucan for preparation of /sup 14/C-labelled saccharides

Energy Technology Data Exchange (ETDEWEB)

Bilik, V; Biely, P [Institute of Chemistry, Centre for Chemical Research, Slovak Academy of Sciences, Bratislava (Czechoslovakia); Kolina, J [Ustav pro Vyzkum, Vyrobu a Vyuziti Radioisotopu, Prague (Czechoslovakia)

1984-01-01

D-(U-/sup 14/C)glucose obtained in acid hydrolysis of ..cap alpha..-(U-/sup 14/C)glucan (2 M-HCl) was epimerized under a catalytic action of molybdate ions to D-(U-/sup 14/C)mannose isolated with a 20% yield. Oxidative degradation of 4-nitrophenylhydrazones of D-(U-/sup 14/C)arabinose and D-(U-/sup 14/C)xylose resulted in D-(U-/sup 14/C)erythrose and D-(U-/sup 14/C)threose, respectively, with a 15% yield relative to the starting aldopentoses. Nitromethane synthesis with D-(U-/sup 14/C)lyxose followed by oxidative decomposition of the corresponding nitrohexitols yielded /sup 14/C-labelled D-galactose. Described is also the preparation of D-(U-/sup 14/C)arabinose from D-(U-/sup 14/C)glucose and the conversion of D-(U-/sup 14/C)arabinose to D-(U-/sup 14/C)xylose and D-(U-/sup 14/C)lyxose.

Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

Science.gov (United States)

Pierangeli, Silvia S.; Sonnenfeld, Gerald

1989-01-01

Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

Crystal Structure of α-1,4-Glucan Lyase, a Unique Glycoside Hydrolase Family Member with a Novel Catalytic Mechanism

NARCIS (Netherlands)

Rozeboom, Henriëtte J.; Yu, Shukun; Madrid, Susan; Kalk, Kor H.; Zhang, Ran; Dijkstra, Bauke W.

2013-01-01

α-1,4-Glucan lyase (EC 4.2.2.13) from the red seaweed Gracilariopsis lemaneiformis cleaves α-1,4-glucosidic linkages in glycogen, starch, and malto-oligosaccharides, yielding the keto-monosaccharide 1,5-anhydro-D-fructose. The enzyme belongs to glycoside hydrolase family 31 (GH31) but degrades

Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

NARCIS (Netherlands)

Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

Initiation of glycogen biosynthesis in rat heart. Studies with a purified preparation

International Nuclear Information System (INIS)

Blumenfeld, M.L.; Krisman, C.R.

1985-01-01

Two fractions of glycogen synthase were isolated from rat cardiac muscle on the basis of a different affinity for DEAE-cellulose and omega-aminobutyl-agarose. One of these fractions was able to transfer glucosyl residues from UDP-glucose not only to glycogen (GS-1 activity) but also to an endogenous acceptor. The latter reaction (GS-2 activity) occurred in the absence of added glycogen, and its reaction product was insoluble in trichloroacetic acid. This compound was degraded by amylolytic enzymes, thus showing that the product synthesized on the endogenous acceptor was an alpha 1,4-glucan. After incubation with alpha-amylase-free proteolytic enzyme, the compound was rendered trichloroacetic acid-soluble. Polyacrylamide gel electrophoresis, under both native and denaturing conditions, showed that GS-2 reaction products moved electrophoretically associated to protein. The results give further evidence for the association between an alpha 1,4-glucan and protein, which the authors postulate is related to the initiation of glycogen biosynthesis

Preparation, characterization, and biological properties of β-glucans

Directory of Open Access Journals (Sweden)

Sandeep Rahar

2011-01-01

Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

Directory of Open Access Journals (Sweden)

D. El Khoury

2012-01-01

Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.

Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Goyal, Arun

2014-03-15

Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

Science.gov (United States)

Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

2017-12-05

Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

PGC-1alpha is required for training-induced prevention of age-associated decline in mitochondrial enzymes in mouse skeletal muscle

DEFF Research Database (Denmark)

Leick, Lotte; Lyngby, Stine Secher; Wojtaszewski, Jørgen

2010-01-01

The aim of the present study was to test the hypothesis that exercise training prevents an age-associated decline in skeletal muscle mitochondrial enzymes through a PGC-1alpha dependent mechanism. Whole body PGC-1alpha knock-out (KO) and littermate wildtype (WT) mice were submitted to long term...

Comparative studies on the induction of Trichoderma harzianum mutanase by α-(1→3)-glucan-rich fruiting bodies and mycelia of Laetiporus sulphureus.

Science.gov (United States)

Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz

2012-01-01

Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

Science.gov (United States)

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

Science.gov (United States)

Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

2015-07-20

Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

Energy Technology Data Exchange (ETDEWEB)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2010-07-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

International Nuclear Information System (INIS)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

2010-01-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

Directory of Open Access Journals (Sweden)

JD Biller-Takahashi

Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

Suppressing effects of glucan on micronuclei induced by Co60 in mice

International Nuclear Information System (INIS)

Chorvatovicova, D.

1991-01-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

AlphaACT

Science.gov (United States)

2014-07-20

and other ADT data As part of Task 2, AlphaTRAC: • Collaborated with CERDEC and the U.S. Military Academy Network Sciences Center to develop...example) Meehl (1954) and Swets, Dawes, and Monahan (2000), which convincingly explain how actuarial judgments rendered by statistical models tend to...Reasoning (DARPA), Morgan Kaufmann Publishers, San Mateo, CA. Swcts, J.A., Dawes, R.M., and Monahan, J. (2000). Better decisions through science

Pressure effects on enzyme reactions in mainly organic media: alpha-chymotrypsin in reversed micelles of Aerosol OT in octane.

Science.gov (United States)

Mozhaev, V V; Bec, N; Balny, C

1994-08-01

Biocatalytic transformations in reversed micelles formed by anionic surfactant Aerosol OT in octane have been studied at high pressures by an example of alpha-chymotrypsin-catalyzed hydrolysis of N-carbobenzoxy-L-tyrosine p-nitrophenyl ester and N-succinyl-L-phenylalanine p-nitroanilide. For the first time it has been found that the enzyme retains high activity in these water-in-oil microemulsions up to a pressure of 2 kbar. The value of the activation volume (delta V*) for the enzyme reactions shows a dependence on the water content in the system. When the size of the micellar aqueous inner cavity (as evaluated at 1 atm) approaches the molecular size of alpha-chymotrypsin, delta V* becomes significantly different from the value in aqueous solution and in the micelles with a larger size. Possibilities of regulating the enzyme activity by pressure in systems with a low content of water are discussed.

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

Science.gov (United States)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-07-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

International Nuclear Information System (INIS)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-01-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Discovering an Accessible Enzyme: Salivary [alpha]-Amylase--"Prima Digestio Fit in Ore"--A Didactic Approach for High School Students

Science.gov (United States)

Marini, Isabella

2005-01-01

Human salivary [alpha]-amylase is used in this experimental approach to introduce biology high school students to the concept of enzyme activity in a dynamic way. Through a series of five easy, rapid, and inexpensive laboratory experiments students learn what the activity of an enzyme consists of: first in a qualitative then in a semi-quantitative…

Beta-glucans and cholesterol

Czech Academy of Sciences Publication Activity Database

Šíma, Petr; Vannucci, Luca; Větvička, V.

2017-01-01

Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

NARCIS (Netherlands)

Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

1999-01-01

β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

Energy Technology Data Exchange (ETDEWEB)

Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

1991-10-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

Science.gov (United States)

Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

2017-07-18

Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

NARCIS (Netherlands)

Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

2015-01-01

β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

Science.gov (United States)

Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

2009-10-14

To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

Effects of gamma irradiation on the physical and structural properties of β-glucan

International Nuclear Information System (INIS)

Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

2008-01-01

This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

[Regulation of thermal stability of enzymes by changing the composition of media. Native and modified alpha-chymotrypsin].

Science.gov (United States)

Levitskiĭ, V Iu; Melik-Nubarov, N S; Slepnev, V I; Shikshnis, V A; Mozhaev, V V

1990-01-01

Stabilizing effect of denaturing salts on irreversible thermoinactivation of native and modified alpha-chymotrypsin at elevated temperatures is observed. The effect is caused by a shift of conformational equilibrium, at the primary step of reversible unfolding in the course of thermoinactivation, to a more unfolded form which is not able to refold "incorrectly". The stability of alpha-chymotrypsin is regulated within a wide range by medium alteration: the stabilizing effects are similar to those achieved by multipoint attachment of the enzyme to a support or by hydrophilization of protein by covalent modification.

Inactivation of pecS restores the virulence of mutants devoid of osmoregulated periplasmic glucans in the phytopathogenic bacterium Dickeya dadantii.

Science.gov (United States)

Bontemps-Gallo, Sébastien; Madec, Edwige; Lacroix, Jean-Marie

2014-04-01

Dickeya dadantii is a phytopathogenic enterobacterium that causes soft rot disease in a wide range of plant species. Maceration, an apparent symptom of the disease, is the result of the synthesis and secretion of a set of plant cell wall-degrading enzymes (PCWDEs), but many additional factors are required for full virulence. Among these, osmoregulated periplasmic glucans (OPGs) and the PecS transcriptional regulator are essential virulence factors. Several cellular functions are controlled by both OPGs and PecS. Strains devoid of OPGs display a pleiotropic phenotype including total loss of virulence, loss of motility and severe reduction in the synthesis of PCWDEs. PecS is one of the major regulators of virulence in D. dadantii, acting mainly as a repressor of various cellular functions including virulence, motility and synthesis of PCWDEs. The present study shows that inactivation of the pecS gene restored virulence in a D. dadantii strain devoid of OPGs, indicating that PecS cannot be de-repressed in strains devoid of OPGs.

Recent insight in α-glucan metabolism in probiotic bacteria

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

2014-01-01

α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

β-Glucans: Relationships between Modification, Conformation and Functional Activities

Directory of Open Access Journals (Sweden)

Qiang Wang

2017-02-01

Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

International Nuclear Information System (INIS)

Nguyen Thanh Long; Le Quang Luan

2015-01-01

The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

2013-01-01

Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers

International Nuclear Information System (INIS)

Dugger, W.M.; Palmer, R.L.

1986-01-01

The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system

Effect of Enzyme Supplementation and Irradiation of Barley on Broiler Chicks Performance

International Nuclear Information System (INIS)

Farag, D.H.M.; Abd El-Hakeim, N.F.

1999-01-01

The experiments were conducted to study the influence of irradiation treatment at dose levels of 0.20 and 60 kGy on barley beta-glucan and the effect of enzyme supplementation and irradiation of barley on broiler chicks performance. The amount of total and water-soluble beta-glucan in raw barley was 36 kg -1 , respectively. The effect of irradiation treatment on total beta-glucan was insignificant while the level of soluble beta-glucan was increased with increasing the dose levels of irradiation. The effect of irradiation treatment and enzyme supplementation of barley diets on growth and conversion performance of broiler chicks indicated that birds fed raw barley diet had lower body weight, body weight gain and feed conversion than those fed control diet throughout the experimental period. Irradiation of barley at dose of 20 kGy did not affect the chick performance (feed consumption, weight gain feed-gain ratio) that received the B 20 diet from 7 to 21 days of age, but when bird maintained on B 20 diet from 7 28 days of age, only feed-gain ratio was improved by 14.4%. The results indicate that there was a significant effect of irradiation of barley at 60 kGy (B 60) on feed -gain ratio of chicks when were fed B 60 diet from 7 to 21 days of age. The corresponding improvement in feed-gain ratio was 16.4%. When birds were fed B 60 diet from 7-28 days of age, the improvement in body weight and feed-gain ratio was 25.5 and 19.6%, respectively

First principles insight into the α-glucan structures of starch

DEFF Research Database (Denmark)

Damager, Iben; Engelsen, Søren Balling; Blennow, Andreas

2010-01-01

A study was conducted to demonstrate the synthesis, conformation, and hydration of the α-glucan structures of starch. Starch and glycogen were synthesized by sets of specific enzyme activities that directly determined their molecular structures and physical properties. It was demonstrated...... that the extent of crystallinity, aggregation and hydration was of fundamental importance for starch and its human analogue glycogen. Starch was deposited in the plant as a stable form in highly organized and semicrystalline granules having specific crystalline polymorphs as determined by powder X......-ray crystallography. The investigations mainly focused on the bottom-up approach of synthesis, conformation, and hydration of starch. Starch and glycogen were found to be polymers that were built up from a single monomer, D-glucopyranose, or for short D-glucose....

Structural complex of sterol 14[alpha]-demethylase (CYP51) with 14[alpha]-methylenecyclopropyl-[delta]7-24, 25-dihydrolanosterol[S

Energy Technology Data Exchange (ETDEWEB)

Hargrove, Tatiana Y.; Wawrzak, Zdzislaw; Liu, Jialin; Waterman, Michael R.; Nes, W. David; Lepesheva, Galina I. (Vanderbilt); (TTU); (NWU)

2012-06-28

Sterol 14{alpha}-demethylase (CYP51) that catalyzes the removal of the 14{alpha}-methyl group from the sterol nucleus is an essential enzyme in sterol biosynthesis, a primary target for clinical and agricultural antifungal azoles and an emerging target for antitrypanosomal chemotherapy. Here, we present the crystal structure of Trypanosoma (T) brucei CYP51 in complex with the substrate analog 14{alpha}-methylenecyclopropyl-{Delta}7-24,25-dihydrolanosterol (MCP). This sterol binds tightly to all protozoan CYP51s and acts as a competitive inhibitor of F105-containing (plant-like) T. brucei and Leishmania (L) infantum orthologs, but it has a much stronger, mechanism-based inhibitory effect on I105-containing (animal/fungi-like) T. cruzi CYP51. Depicting substrate orientation in the conserved CYP51 binding cavity, the complex specifies the roles of the contact amino acid residues and sheds new light on CYP51 substrate specificity. It also provides an explanation for the effect of MCP on T. cruzi CYP51. Comparison with the ligand-free and azole-bound structures supports the notion of structural rigidity as the characteristic feature of the CYP51 substrate binding cavity, confirming the enzyme as an excellent candidate for structure-directed design of new drugs, including mechanism-based substrate analog inhibitors.

Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

Science.gov (United States)

Singh, Mukti; Kim, Sanghoon; Liu, Sean X

2012-08-01

Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

Diversity of microbial carbohydrate-active enzymes in Danish anaerobic digesters fed with wastewater treatment sludge

DEFF Research Database (Denmark)

Wilkens, Casper; Busk, Peter Kamp; Pilgaard, Bo

2017-01-01

treatment plants. Metagenomes from the ADs were mined for CAZymes with Homology to Peptide Patterns (HotPep). 19,335 CAZymes were identified of which 30% showed 50% or lower identity to known proteins demonstrating that ADs make up a promising pool for discovery of novel CAZymes. A function was assigned...... to 54% of all CAZymes identified by HotPep. Many different α-glucan-acting CAZymes were identified in the four metagenomes, and the most abundant family was glycoside hydrolase family 13, which contains α-glucan-acting CAZymes. Cellulytic and xylanolytic CAZymes were also abundant in the four...

Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

Science.gov (United States)

Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

2013-05-01

The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

Directory of Open Access Journals (Sweden)

KUSMIATI

2007-04-01

Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

Characterization of cereal β-glucan extracts from oat and barley and quantification of proteinaceous matter.

Directory of Open Access Journals (Sweden)

Claudia Zielke

Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.

Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

Directory of Open Access Journals (Sweden)

Vesna Zechner-Krpan

2010-01-01

Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

Science.gov (United States)

Zheng, Xueling; Li, Limin; Wang, Qi

2011-01-01

Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

Crystal structure of a 117 kDa glucansucrase fragment provides insight into evolution and product specificity of GH70 enzymes

NARCIS (Netherlands)

Vujičić-Žagar, Andreja; Pijning, Tjaard; Kralj, Slavko; López, Cesar A.; Eeuwema, Wieger; Dijkhuizen, Lubbert; Dijkstra, Bauke W.

2010-01-01

Glucansucrases are large enzymes belonging to glycoside hydrolase family 70, which catalyze the cleavage of sucrose into fructose and glucose, with the concomitant transfer of the glucose residue to a growing α-glucan polymer. Among others, plaque-forming oral bacteria secrete these enzymes to

Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

Science.gov (United States)

Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

2014-06-01

Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

Alpha-mannosidase activity in goats fed with Sida carpinifolia.

Science.gov (United States)

Bedin, Marisete; Moleta Colodel, Edson; Viapiana, Marli; Matte, Ursula; Driemeier, David; Giugliani, Roberto

2010-03-01

Human alpha-mannosidosis results from alpha-mannosidase deficiency and progressive accumulation of mannose-rich oligosaccharides in lysosomes. Two days before Saanen goats were fed with Sida carpinifolia, alpha-mannosidase activity in leukocytes was 128+/-28 nmoles4-MU/h/mgprotein (first trial) and 104+/-6 nmoles4-MU/h/mgprotein (second trial). At day 5, after the introduction of S. carpinifolia diet, the alpha-mannosidase activity in leukocytes was significantly increased, both in the first (288+/-13 nmoles4-MU/h/mgprotein) and in the second trial (303+/-45 nmoles4-MU/h/mgprotein), and it returned to normal levels 2 days after the withdrawal of the plant from the diet (114+/-7 nmoles4-MU/h/mgprotein in first trial, and 108+/-25 nmoles4-MU/h/mgprotein in the second one). Plasma alpha-mannosidase activity decreased significantly 4 days after animal exposure to the S. carpinifolia diet (769+/-167 nmoles4-MU/h/ml) and returned to normal values 10 days after the withdrawal of the plant from the diet (1289+/-163 nmoles4-MU/h/ml). Thin-layer chromatography showed an abnormal excretion of oligosaccharides in urine as of day 2 after diet exposure, which persisted until one day after the withdrawal of the plant. Animals presented neurological clinical signs beginning at day 37 (in the first trial) and at day 25 (in the second trial) after being fed with the plant. The results obtained herein suggest that oligosaccharides observed in urine are a result of a decrease in alpha-mannosidase activity in plasma. S. carpinifolia seems to have other compounds that act on alpha-mannosidase enzyme in leukocytes in a competitive manner with swainsonine. The increase in alpha-mannosidase enzyme in leukocytes could be attributed to one of these compounds present in S. carpinifolia. Copyright 2009 Elsevier GmbH. All rights reserved.

Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

Science.gov (United States)

Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

1992-01-01

The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

Science.gov (United States)

Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

2016-01-01

Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

Salivary alpha-amylase: More than an enzyme Investigating confounders of stress-induced and basal amylase activity

OpenAIRE

Strahler, Jana

2010-01-01

Summary: Salivary alpha-amylase: More than an enzyme - Investigating confounders of stress-induced and basal amylase activity (Dipl.-Psych. Jana Strahler) The hypothalamus-pituitary-adrenal (HPA) axis and the autonomic nervous system (ANS) are two of the major systems playing a role in the adaptation of organisms to developmental changes that threaten homeostasis. The HPA system involves the secretion of glucocorticoids, including cortisol, into the circulatory system. Numerous studies hav...

Visual effects of β-­glucans on wound healing in fish

DEFF Research Database (Denmark)

Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

2011-01-01

Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

The effect of lignin removal by alkaline peroxide pretreatment on the susceptibility of corn stover to purified cellulolytic and xylanolytic enzymes.

Science.gov (United States)

Selig, Michael J; Vinzant, Todd B; Himmel, Michael E; Decker, Stephen R

2009-05-01

Pretreatment of corn stover with alkaline peroxide (AP) at pH 11.5 resulted in reduction of lignin content in the residual solids as a function of increasing batch temperature. Scanning electron microscopy of these materials revealed notably more textured surfaces on the plant cell walls as a result of the delignifying pretreatment. As expected, digestion of the delignified samples with commercial cellulase preparations showed an inverse relationship between the content of lignin present in the residual solids after pretreatment and the extent of both glucan and xylan conversion achievable. Digestions with purified enzymes revealed that decreased lignin content in the pretreated solids did not significantly impact the extent of glucan conversion achievable by cellulases alone. Not until purified xylanolytic activities were included with the cellulases were significant improvements in glucan conversion realized. In addition, an inverse relationship was observed between lignin content after pretreatment and the extent of xylan conversion achievable in a 24-h period with the xylanolytic enzymes in the absence of the cellulases. This observation, coupled with the direct relationship between enzymatic xylan and glucan conversion observed in a number of cases, suggests that the presence of lignins may not directly occlude cellulose present in lignocelluloses but rather impact cellulase action indirectly by its association with xylan.

An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.

NARCIS (Netherlands)

Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.

2004-01-01

(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method

Dynamic, morphotype-specific Candida albicans beta-glucan exposure during infection and drug treatment.

Directory of Open Access Journals (Sweden)

Robert T Wheeler

2008-12-01

Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.

Optimization of enzyme complexes for efficient hydrolysis of corn stover to produce glucose.

Science.gov (United States)

Yu, Xiaoxiao; Liu, Yan; Meng, Jiatong; Cheng, Qiyue; Zhang, Zaixiao; Cui, Yuxiao; Liu, Jiajing; Teng, Lirong; Lu, Jiahui; Meng, Qingfan; Ren, Xiaodong

2015-05-01

Hydrolysis of cellulose to glucose is the critical step for transferring the lignocellulose to the industrial chemicals. For improving the conversion rate of cellulose of corn stover to glucose, the cocktail of celllulase with other auxiliary enzymes and chemicals was studied in this work. Single factor tests and Response Surface Methodology (RSM) were applied to optimize the enzyme mixture, targeting maximum glucose release from corn stover. The increasing rate of glucan-to-glucose conversion got the higher levels while the cellulase was added 1.7μl tween-80/g cellulose, 300μg β-glucosidase/g cellulose, 400μg pectinase/g cellulose and 0.75mg/ml sodium thiosulphate separately in single factor tests. To improve the glucan conversion, the β-glucosidase, pectinase and sodium thiosulphate were selected for next step optimization with RSM. It is showed that the maximum increasing yield was 45.8% at 377μg/g cellulose Novozyme 188, 171μg/g cellulose pectinase and 1mg/ml sodium thiosulphate.

Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

Science.gov (United States)

Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

2017-02-01

Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

Science.gov (United States)

Theuwissen, Elke; Mensink, Ronald P

2007-03-01

Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

Science.gov (United States)

Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

2017-07-28

The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

Recombinant human acid alpha-glucosidase: high level production in mouse milk, biochemical characteristics, correction of enzyme deficiency in GSDII KO mice

NARCIS (Netherlands)

A.G.A. Bijvoet (Agnes); M.A. Kroos (Marian); F.R. Pieper (Frank); M. Van der Vliet (Martin); H.A. de Boer (Herman); A.T. van der Ploeg (Ans); M.Ph. Verbeet (Martin); A.J.J. Reuser (Arnold)

1998-01-01

textabstractGlycogen storage disease type II (GSDII) is caused by lysosomal acid alpha-glucosidase deficiency. Patients have a rapidly fatal or slowly progressive impairment of muscle function. Enzyme replacement therapy is under investigation. For large-scale, cost-effective

Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2012-01-01

Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

Science.gov (United States)

Boulos, Samy; Nyström, Laura

2017-11-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO�

Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

Science.gov (United States)

Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

2017-11-01

Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

Rational and combinatorial engineering of the glucan synthesizing enzyme amylosucrase

DEFF Research Database (Denmark)

Albenne, C.; Van Der Veen, B.A.; Potocki-Véronèse, G.

2003-01-01

Rational engineering of amylosucrase required detailed investigations of the molecular basis of catalysis. Biochemical characterization of the enzyme coupled to structural analyses enabled the polymerization mechanism to be elucidated. This provided key information for successfully changing amylo...

Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B

2016-08-01

In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

Directory of Open Access Journals (Sweden)

Mattia P. Arena

2014-02-01

Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

Science.gov (United States)

Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

2013-03-01

β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.

Modulation of the immune response of porcine neutrophils by different β-glucan preparations

DEFF Research Database (Denmark)

Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

2010-01-01

β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

Alpha Blockers

Science.gov (United States)

... quickly, but their effects last only a few hours. Long-acting medications take longer to work, but their effects last longer. Which alpha blocker is best for you depends on your health and the condition being treated. Alpha blockers are ...

Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Cloning and expression of the Aspergillus oryzae glucan 1,3-beta-glucosidase A (exgA) in Pichia pastoris.

Science.gov (United States)

Boonvitthya, Nassapat; Tanapong, Phatrapan; Kanngan, Patcharaporn; Burapatana, Vorakan; Chulalaksananukul, Warawut

2012-10-01

The glucan 1,3-beta-glucosidase A gene (exgA) from Aspergillus oryzae and fused to the Saccharomyces cerevisiae signal peptide (α-factor) was expressed under the control of either a constitutive (GAP) or an inducible (AOX1) promoter in Pichia pastoris. A 1.4-fold higher extracellular enzyme activity (2 U/ml) was obtained using the AOX1 inducible expression system than with the GAP constitutive promoter (1.4 U/ml). The purified recombinant ExgA enzyme, with a yield of 10 mg protein/l culture supernatant, was about 40 kDa by SDS-PAGE analysis with a specific activity of 289 U/mg protein. The enzyme was optimally active at 35 °C and pH 5.0 and displayed a K(M) and V(max) of 0.56 mM and 10,042 μmol/(min mg protein), respectively, with p-nitrophenyl-β-D-glucopyranoside as the substrate. Moreover, it was tolerant to glucose inhibition with a K(i) of 365 mM.

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

International Nuclear Information System (INIS)

Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

2015-01-01

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

Energy Technology Data Exchange (ETDEWEB)

Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

2015-02-27

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in hepatocellular carcinoma.

Science.gov (United States)

Liu, Rui; Zhang, Haiyang; Zhang, Yan; Li, Shuang; Wang, Xinyi; Wang, Xia; Wang, Cheng; Liu, Bin; Zen, Ke; Zhang, Chen-Yu; Zhang, Chunni; Ba, Yi

2017-04-01

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha plays a crucial role in regulating the biosynthesis of mitochondria, which is closely linked to the energy metabolism in various tumors. This study investigated the regulatory role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha in the pathogenesis of hepatocellular carcinoma. In this study, the changes of peroxisome proliferator-activated receptor gamma coactivator-1 alpha messenger RNA levels between normal human liver and hepatocellular carcinoma tissue were examined by quantitative reverse transcription polymerase chain reaction. Knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by RNA interference in the human liver cell line L02, while overexpression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha complementary DNA in the human hepatocarcinoma cell line HepG2. Cellular morphological changes were observed via optical and electron microscopy. Cellular apoptosis was determined by Hoechst 33258 staining. In addition, the expression levels of 21,400 genes in tissues and cells were detected by microarray. It was shown that peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression was significantly downregulated in hepatocellular carcinoma compared with normal liver tissues. After knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression in L02 cells, cells reverted to immature and dedifferentiated morphology exhibiting cancerous tendency. Apoptosis occurred in the HepG2 cells after transfection by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Microarray analysis showed consistent results. The results suggest that peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor

β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

Directory of Open Access Journals (Sweden)

AHMAD THONTOWI

2007-10-01

Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

Directory of Open Access Journals (Sweden)

Matthew J. Elder

2017-07-01

Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

Various roles of beta-glucan in invertebrates

Czech Academy of Sciences Publication Activity Database

Větvička, V.; Šíma, Petr

2017-01-01

Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

Effects of 1 alpha,25-Dihydroxyvitamin D-3 on Transporters and Enzymes of the Rat Intestine and Kidney In Vivo

NARCIS (Netherlands)

Chow, Edwin C. Y.; Sun, Huadong; Khan, Ansar A.; Groothuis, Geny M. M.; Pang, K. Sandy

1 alpha,25-Dihydroxyvitamin D-3 (1,25(OH)(2)D-3), the natural ligand of the vitamin D receptor (VDR), was found to regulate bile acid related transporters and enzymes directly and indirectly in the rat intestine and liver in vivo. The kidney is another VDR-rich target organ in which VDR regulation

Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

Science.gov (United States)

Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

2014-02-07

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

Directory of Open Access Journals (Sweden)

Antonio Francioso

2017-05-01

Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

Science.gov (United States)

Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

2017-07-01

The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dietary β-glucan (MacroGard®) enhances survival of first feeding turbot (Scophthalmus maximus) larvae by altering immunity, metabolism and microbiota.

Science.gov (United States)

Miest, Joanna J; Arndt, Carmen; Adamek, Mikolaj; Steinhagen, Dieter; Reusch, Thorsten B H

2016-01-01

Reflecting the natural biology of mass spawning fish aquaculture production of fish larvae is often hampered by high and unpredictable mortality rates. The present study aimed to enhance larval performance and immunity via the oral administration of an immunomodulator, β-glucan (MacroGard(®)) in turbot (Scophthalmus maximus). Rotifers (Brachionus plicatilis) were incubated with or without yeast β-1,3/1,6-glucan in form of MacroGard(®) at a concentration of 0.5 g/L. Rotifers were fed to first feeding turbot larvae once a day. From day 13 dph onwards all tanks were additionally fed untreated Artemia sp. nauplii (1 nauplius ml/L). Daily mortality was monitored and larvae were sampled at 11 and 24 dph for expression of 30 genes, microbiota analysis, trypsin activity and size measurements. Along with the feeding of β-glucan daily mortality was significantly reduced by ca. 15% and an alteration of the larval microbiota was observed. At 11 dph gene expression of trypsin and chymotrypsin was elevated in the MacroGard(®) fed fish, which resulted in heightened tryptic enzyme activity. No effect on genes encoding antioxidative proteins was observed, whilst the immune response was clearly modulated by β-glucan. At 11 dph complement component c3 was elevated whilst cytokines, antimicrobial peptides, toll like receptor 3 and heat shock protein 70 were not affected. At the later time point (24 dph) an anti-inflammatory effect in form of a down-regulation of hsp 70, tnf-α and il-1β was observed. We conclude that the administration of MacroGard(®) induced an immunomodulatory response and could be used as an effective measure to increase survival in rearing of turbot. Copyright © 2015 Elsevier Ltd. All rights reserved.

Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

Science.gov (United States)

Chang, I.; Cho, G.

2012-12-01

Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

Directory of Open Access Journals (Sweden)

Jenneke Leentjens

Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

Directory of Open Access Journals (Sweden)

Tomoko Jippo

2015-02-01

Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

Directory of Open Access Journals (Sweden)

Fulcher R Gary

2007-03-01

Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

Specific binding of a fungal glucan phytoalexin elicitor to membrane fractions from soybean Glycine max

International Nuclear Information System (INIS)

Schmidt, W.E.; Ebel, J.

1987-01-01

Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay

Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats

International Nuclear Information System (INIS)

Salama, S.F.

2011-01-01

1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications

Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

Science.gov (United States)

Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

2004-10-01

Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

2014-08-01

An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

Determination of the starch-phosphorylating enzyme activity in plant extracts

DEFF Research Database (Denmark)

Ritte, G.; Steup, M.; Kossmann, J.

2003-01-01

For quantification of alpha-glucan, water dikinase(GWD) activity in crude extracts of plant tissues a radio-labeling assay was established that uses soluble starch and P-33-labeled ATP as phosphate acceptor and donor, respectively. A constant rate of starch labeling was observed only if the ATP...... incorporation of phosphate whereas extracts from potato (Solanum tuberosum L.) tuber expressing a GWD antisense construct exhibited less activity than the wild-type control. To our knowledge this is the first time that a quantification of the starch-phosphorylating activity has been achieved in plant crude...

Enzymic saccharification of some pretreated agricultural wastes

Energy Technology Data Exchange (ETDEWEB)

El-Gammal, S.M.A.; Sadek, M.A.

1988-01-01

Cellulosie wastes, artichoke leaves and stalks, sugar-cane bagasse and fennel seeds after extraction of essential oils were treated with various concentrations of peracetic acid at 100/sup 0/C, 60/sup 0/C and room temperature several times, washed with water and ethanol and air dried. The degree of enzymatic solubilization of each treated cellulosic waste was measured with Aspergillus niger cellulase (Endo-1,4-B-Glucanase; 1,4-(1,3; 1,4)-..beta..-D-glucan 4-glucanohydrolase; EC 3. 2.1.4). Artichoke waste and sugar-cane bagasse were solubilized more efectively by the enzymethan fennel waste. Data are presented describing the effect of time, enzyme and substrate concentration on the rate of enzymic hydrolysis. Infrared spectra of the treated and untreated cellulosic materials were recorded.

Interaction of Salivary alpha-Amylase and Amylase-Binding-Protein A (AbpA of Streptococcus gordonii with Glucosyltransferase of S. gordonii and Streptococcus mutans

Directory of Open Access Journals (Sweden)

Tanzer Jason M

2007-06-01

Full Text Available Abstract Background Glucosyltransferases (Gtfs, enzymes that produce extracellular glucans from dietary sucrose, contribute to dental plaque formation by Streptococcus gordonii and Streptococcus mutans. The alpha-amylase-binding protein A (AbpA of S. gordonii, an early colonizing bacterium in dental plaque, interacts with salivary amylase and may influence dental plaque formation by this organism. We examined the interaction of amylase and recombinant AbpA (rAbpA, together with Gtfs of S. gordonii and S. mutans. Results The addition of salivary alpha-amylase to culture supernatants of S. gordonii precipitated a protein complex containing amylase, AbpA, amylase-binding protein B (AbpB, and the glucosyltransferase produced by S. gordonii (Gtf-G. rAbpA was expressed from an inducible plasmid, purified from Escherichia coli and characterized. Purified rAbpA, along with purified amylase, interacted with and precipitated Gtfs from culture supernatants of both S. gordonii and S. mutans. The presence of amylase and/or rAbpA increased both the sucrase and transferase component activities of S. mutans Gtf-B. Enzyme-linked immunosorbent assay (ELISA using anti-Gtf-B antibody verified the interaction of rAbpA and amylase with Gtf-B. A S. gordonii abpA-deficient mutant showed greater biofilm growth under static conditions than wild-type in the presence of sucrose. Interestingly, biofilm formation by every strain was inhibited in the presence of saliva. Conclusion The results suggest that an extracellular protein network of AbpA-amylase-Gtf may influence the ecology of oral biofilms, likely during initial phases of colonization.

Rapid optimization of enzyme mixtures for deconstruction of diverse pretreatment/biomass feedstock combinations

Directory of Open Access Journals (Sweden)

Walton Jonathan D

2010-10-01

Full Text Available Abstract Background Enzymes for plant cell wall deconstruction are a major cost in the production of ethanol from lignocellulosic biomass. The goal of this research was to develop optimized synthetic mixtures of enzymes for multiple pretreatment/substrate combinations using our high-throughput biomass digestion platform, GENPLAT, which combines robotic liquid handling, statistical experimental design and automated Glc and Xyl assays. Proportions of six core fungal enzymes (CBH1, CBH2, EG1, β-glucosidase, a GH10 endo-β1,4-xylanase, and β-xylosidase were optimized at a fixed enzyme loading of 15 mg/g glucan for release of Glc and Xyl from all combinations of five biomass feedstocks (corn stover, switchgrass, Miscanthus, dried distillers' grains plus solubles [DDGS] and poplar subjected to three alkaline pretreatments (AFEX, dilute base [0.25% NaOH] and alkaline peroxide [AP]. A 16-component mixture comprising the core set plus 10 accessory enzymes was optimized for three pretreatment/substrate combinations. Results were compared to the performance of two commercial enzymes (Accellerase 1000 and Spezyme CP at the same protein loadings. Results When analyzed with GENPLAT, corn stover gave the highest yields of Glc with commercial enzymes and with the core set with all pretreatments, whereas corn stover, switchgrass and Miscanthus gave comparable Xyl yields. With commercial enzymes and with the core set, yields of Glc and Xyl were highest for grass stovers pretreated by AP compared to AFEX or dilute base. Corn stover, switchgrass and DDGS pretreated with AFEX and digested with the core set required a higher proportion of endo-β1,4-xylanase (EX3 and a lower proportion of endo-β1,4-glucanase (EG1 compared to the same materials pretreated with dilute base or AP. An optimized enzyme mixture containing 16 components (by addition of α-glucuronidase, a GH11 endoxylanase [EX2], Cel5A, Cel61A, Cip1, Cip2, β-mannanase, amyloglucosidase, �

Long-lived effects of administering β-glucans

NARCIS (Netherlands)

Petit, Jules; Wiegertjes, Geert F.

2016-01-01

Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

Science.gov (United States)

Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

Science.gov (United States)

Rosburg, Valerie; Boylston, Terri; White, Pamela

2010-06-01

Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

Effect of salivary gland adenocarcinoma cell-derived alpha-N-acetylgalactosaminidase on the bioactivity of macrophage activating factor.

Science.gov (United States)

Matsuura, Takashi; Uematsu, Takashi; Yamaoka, Minoru; Furusawa, Kiyofumi

2004-03-01

The aim of this study was to clarify the effects of alpha-N-acetylgalactosaminidase (alpha-NaGalase) produced by human salivary gland adenocarcinoma (SGA) cells on the bioactivity of macrophage-activating factor (GcMAF). High exo-alpha-NaGalase activity was detected in the SGA cell line HSG. HSG alpha-NaGalase had both exo- and endo-enzyme activities, cleaving the Gal-GalNAc and GalNAc residues linked to Thr/Ser but not releasing the [NeuAc2-6]GalNac residue. Furthermore, GcMAF enzymatically prepared from the Gc protein enhanced the superoxide-generation capacity and phagocytic activity of monocytes/macrophages. However, GcMAF treated with purified alpha-NaGalase did not exhibit these effects. Thus, HSG possesses the capacity to produce larger quantities of alpha-NaGalase, which inactivates GcMAF produced from Gc protein, resulting in reduced phagocytic activity and superoxide-generation capacity of monocytes/macrophages. The present data strongly suggest that HSG alpha-NaGalase acts as an immunodeficiency factor in cancer patients.

Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

Science.gov (United States)

Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

2016-12-01

β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Protective effect of poly ({alpha}-L-glutamate) against UV and {gamma}-irradiation

Energy Technology Data Exchange (ETDEWEB)

Furuta, Masakazu E-mail: mfuruta@riast.osakafu-u.ac.jp; Huy, Nguyen Quang; Tsuchiya, Akihito; Nakatsuka, Hiroshige; Hayashi, Toshio

2004-10-01

We occasionally found that poly ({alpha}-L-glutamate) showed a superior protective effect on enzymes against UV and {sup 60}Co-{gamma} irradiation. We selected papain and {alpha}-amylase as a model enzyme and irradiated the aqueous solution (10 mg/ml) of each enzyme with UV and {sup 60}Co-{gamma} rays in the presence of poly ({alpha}-L-glutamate) ({alpha}-PGA), poly (glucosyl oxyethyl methacrylate (GEMA)), and glucose (1.25% w/v each). The mixture of the three compounds has a significant protective effect on the activity of papain solution showing 40% of remaining activity twice as much as the control containing no additive at the dose of 15 kGy. Among them, {alpha}-PGA showed the highest protecting effect on the both papain and {alpha}-amylase even after 10-kGy irradiation at which 50% of the activity was retained. {alpha}-PGA also showed significant protective activity on {alpha}-amylase against UV both in solution and under dried state.

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

Science.gov (United States)

Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

2013-01-01

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

α-Amylase: an enzyme specificity found in various families of glycoside hydrolases

DEFF Research Database (Denmark)

Janeček, Štefan; Svensson, Birte; MacGregor, E. Ann

2014-01-01

of all carbohydrate-active enzymes, it is one of the most frequently occurring glycoside hydrolases (GH). α-Amylase is the main representative of family GH13, but it is probably also present in the families GH57 and GH119, and possibly even in GH126. Family GH13, known generally as the main α...... investigation because of an obvious, but unexpected, homology with inverting β-glucan-active hydrolases....

Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau

-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

Crosslinked Enzyme Aggregates in Hierarchically-Ordered Mesoporous Silica: A Simple and Effective Method for Enzyme Stabilization

Energy Technology Data Exchange (ETDEWEB)

Kim, Moon Il; Kim, Jungbae; Lee, Jinwoo; Jia, Hongfei; Na, Hyon Bin; Youn, Jongkyu; Kwak, Ja Hun; Dohnalkova, Alice; Grate, Jay W.; Wang, Ping; Hyeon, Taeghwan; Park, Hyun-Gyu; Chang, Ho Nam

2007-02-01

alpha-chymotrypsin (CT) and lipase (LP) were immobilized in hierarchically-ordered mesocellular mesoporous silica (HMMS) in a simple but effective way for the enzyme stabilization, which was achieved by the enzyme adsorption followed by glutaraldehyde (GA) crosslinking. This resulted in the formation of nanometer scale crosslinked enzyme aggregates (CLEAs) entrapped in the mesocellular pores of HMMS (37 nm), which did not leach out of HMMS through narrow mesoporous channels (13 nm). CLEA of alpha-chymotrypsin (CLEA-CT) in HMMS showed a high enzyme loading capacity and significantly increased enzyme stability. No activity decrease of CLEA-CT was observed for two weeks under even rigorously shaking condition, while adsorbed CT in HMMS and free CT showed a rapid inactivation due to the enzyme leaching and presumably autolysis, respectively. With the CLEA-CT in HMMS, however, there was no tryptic digestion observed suggesting that the CLEA-CT is not susceptible to autolysis. Moreover, CLEA of lipase (CLEA-LP) in HMMS retained 30% specific activity of free lipase with greatly enhanced stability. This work demonstrates that HMMS can be efficiently employed as host materials for enzyme immobilization leading to highly enhanced stability of the immobilized enzymes with high enzyme loading and activity.

Enzymes in biogenesis of plant cell wall polysaccharides. Enzyme characterization using tracer techniques

International Nuclear Information System (INIS)

Dickinson, D.B.

1975-01-01

Enzymes and metabolic pathways, by which starch and cell wall polysaccharides are formed, were investigated in order to learn how these processes are regulated and to identify the enzymatic regulatory mechanisms involved. Germinating lily pollen was used for studies of cell wall formation, and pollen and maize endosperm for studies of starch biosynthesis. Hexokinase being the first step in conversion of hexoses to starch, wall polysaccharides and respiratory substrates, maize endosperm enzyme was assayed by its conversion of 14 C-hexose to 14 C-hexose-6-P, and rapid separation of the two labelled compounds on anion-exchange paper. This enzyme did not appear to be under tight regulation by feed-back inhibition or activation, nor to be severely inhibited by glucose-6-P or activated by citrate. ADP-glucose pyrophosphorylase and other pyrophosphorylases were assayed radiochemically with 14 C-glucose-1-P (forward direction) or 32-PPsub(i) (reverse direction). They showed that the maize endosperm enzyme was activated by the glycolytic intermediates fructose-6-P and 3-phosphoglycerate, and that low levels of the enzyme were present in the high sucrose-low starch mutant named shrunken-2. Under optimal in-vitro assay conditions, the pollen enzyme reacted four times faster than the observed in-vivo rate of starch accumulation. Biogenesis of plant cell wall polysaccharides requires the conversion of hexose phosphates to various sugar nucleotides and utilization of the latter by the appropriate polysaccharide synthetases. Lily pollen possesses a β-1,3-glucan synthetase which is activated up to six-fold by β-linked oligosaccharides. Hence, the in-vivo activity of this enzyme may be modulated by such effector molecules

Crystal Structure of 4,6-α-Glucanotransferase Supports Diet-Driven Evolution of GH70 Enzymes from α-Amylases in Oral Bacteria

NARCIS (Netherlands)

Bai, Yuxiang; Gangoiti, Joana; Dijkstra, Bauke W; Dijkhuizen, Lubbert; Pijning, Tjaard

2017-01-01

Food processing and refining has dramatically changed the human diet, but little is known about whether this affected the evolution of enzymes in human microbiota. We present evidence that glycoside hydrolase family 70 (GH70) glucansucrases from lactobacilli, synthesizing α-glucan-type extracellular

Study of the role of epididymal alpha-glucosidase in the fertility of male rats by the administration of the enzyme inhibitor castanospermine.

Science.gov (United States)

Yeung, C H; Cooper, T G

1994-11-01

The activity of epididymal alpha-glucosidase in adult rats was rapidly suppressed to histochemically undetectable levels within 2 days by the continuous release of the enzyme inhibitor castanospermine via a peritoneal osmotic pump at a rate of 100-200 nmol h-1. It was established that mating activities overnight depleted 72% of the spermatozoa in the distal cauda, which was replenished in 2 days, and that fertility began to decline 3 weeks after efferent duct ligation. Male rats of proven mating proficiency and fertility were treated with castanospermine, or buffered saline as control, for up to 30 days and enzyme inhibition was confirmed at the end of treatment by histochemistry. Fertility was normal at the first mating test on day 7, significantly decreased at the second mating on day 9, but recovered in a stepwise manner at subsequent matings on days 12 and 14. Delaying the third mating until day 25 did not sustain the transient subfertility. However, prolonging sperm storage in the distal cauda epididymides and preventing replenishment with freshly matured spermatozoa, by efferent duct ligation for 14 days performed on day 15 during castanospermine administration, caused a decrease in fertility and a change in the kinematics of epididymal spermatozoa of the castanospermine-treated group. In control rats, binding of epididymal spermatozoa to Vicia faba, a lectin specific for glucose and glucosamine, and mannose and mannosamine residues, decreased from the proximal caput to the distal corpus coincident with the increase in alpha-glucosidase activity on the epithelial brush border. Lectin binding then increased in the cauda where enzyme activity was absent. However, castanospermine treatment did not significantly alter this binding profile. The findings suggest that epididymal alpha-glucosidase does not play a crucial role in the development of sperm fertilizing capacity, but may be involved in the preparation of spermatozoa for storage.

Comprehensive functional characterization of the Glycoside Hydrolase Family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification

International Nuclear Information System (INIS)

Nelson, Cassandra E.; Attia, Mohamed A.; Rogowski, Artur; Morland, Carl; Brumer, Harry; Gardner, Jeffrey G.

2017-01-01

Here, lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1!3)/β(1!4) mixed-linkage glucan (MLG), and β(1!3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active Enzymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach we have delineated the physiological roles of the four C. japonicus Glycoside Hydrolase Family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activity profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1!3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1!3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species.

Prevalence of sensitization to 'improver' enzymes in UK supermarket bakers.

Science.gov (United States)

Jones, M; Welch, J; Turvey, J; Cannon, J; Clark, P; Szram, J; Cullinan, P

2016-07-01

Supermarket bakers are exposed not only to flour and alpha-amylase but also to other 'improver' enzymes, the nature of which is usually shrouded by commercial sensitivity. We aimed to determine the prevalence of sensitization to 'improver' enzymes in UK supermarket bakers. We examined the prevalence of sensitization to enzymes in 300 bakers, employed by one of two large supermarket bakeries, who had declared work-related respiratory symptoms during routine health surveillance. Sensitization was determined using radioallergosorbent assay to eight individual enzymes contained in the specific 'improver' mix used by each supermarket. The prevalence of sensitization to 'improver' enzymes ranged from 5% to 15%. Sensitization was far more likely if the baker was sensitized also to either flour or alpha-amylase. The prevalence of sensitization to an 'improver' enzyme did not appear to be related to the concentration of that enzyme in the mix. We report substantial rates of sensitization to enzymes other than alpha-amylase in UK supermarket bakers; in only a small proportion of bakers was there evidence of sensitization to 'improver mix' enzymes without sensitization to either alpha-amylase or flour. The clinical significance of these findings needs further investigation, but our findings indicate that specific sensitization in symptomatic bakers may not be identified without consideration of a wide range of workplace antigens. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

Science.gov (United States)

Kumari, J; Sahoo, P K

2006-02-01

This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

Probiotic activity of lignocellulosic enzyme as bioactivator for rice husk degradation

Science.gov (United States)

Lamid, Mirni; Al-Arif, Anam; Warsito, Sunaryo Hadi

2017-02-01

The utilization of lignocellulosic enzyme will increase nutritional value of rice husk. Cellulase consists of C1 (β-1, 4-glucan cellobiohydrolase or exo-β-1,4glucanase), Cc (endo-β-1,4-glucanase) and component and cellobiose (β-glucocidase). Hemicellulase enzyme consists of endo-β-1,4-xilanase, β-xilosidase, α-L arabinofuranosidase, α-D-glukuronidaseand asetil xilan esterase. This research aimed to study the activity of lignocellulosic enzyme, produced by cows in their rumen, which can be used as a bioactivator in rice husk degradation. This research resulted G6 and G7 bacteria, producing xylanase and cellulase with the activity of 0.004 U mL-1 and 0.021 U mL-1; 0.003 ( U mL-1) and 0.026 (U mL-1) respectively.

Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

DEFF Research Database (Denmark)

Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

2010-01-01

To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

Interaction between chitosan and its related enzymes: A review.

Science.gov (United States)

Shinya, Shoko; Fukamizo, Tamo

2017-11-01

Chitosan-related enzymes including chitosanases, exo-β-glucosaminidases, and enzymes having chitosan-binding modules recognize ligands through electrostatic interactions between the acidic amino acids in proteins and amino groups of chitosan polysaccharides. However, in GH8 chitosanases, several aromatic residues are also involved in substrate recognition through stacking interactions, and these enzymes consequently hydrolyze β-1,4-glucan as well as chitosan. The binding grooves of these chitosanases are extended and opened at both ends of the grooves, so that the enzymes can clamp a long chitosan polysaccharide. The association/dissociation of positively charged glucosamine residues to/from the binding pocket of a GH2 exo-β-glucosaminidase controls the p K a of the catalytic acid, thereby maintaining the high catalytic potency of the enzyme. In contrast to chitosanases, chitosan-binding modules only accommodate a couple of glucosamine residues, predominantly recognizing the non-reducing end glucosamine residue of chitosan by electrostatic interactions and a hydrogen-bonding network. These structural findings on chitosan-related enzymes may contribute to future applications for the efficient conversion of the chitin/chitosan biomass. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

Directory of Open Access Journals (Sweden)

Jae Gil Lee

2016-06-01

Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

Science.gov (United States)

Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

2018-03-01

Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

Science.gov (United States)

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

Science.gov (United States)

Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

2012-01-01

ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

Directory of Open Access Journals (Sweden)

Đukić Nevena H.

2014-01-01

Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

Science.gov (United States)

Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

2017-02-01

(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

Immunostimulatory properties and antitumor activities of glucans (Review)

Czech Academy of Sciences Publication Activity Database

Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

2013-01-01

Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Proteinaceous alpha-araylase inhibitors

DEFF Research Database (Denmark)

Svensson, Birte; Fukuda, Kenji; Nielsen, P.K.

2004-01-01

-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha...

Alkaline peroxide pretreatment of corn stover: effects of biomass, peroxide, and enzyme loading and composition on yields of glucose and xylose

Science.gov (United States)

2011-01-01

Background Pretreatment is a critical step in the conversion of lignocellulose to fermentable sugars. Although many pretreatment processes are currently under investigation, none of them are entirely satisfactory in regard to effectiveness, cost, or environmental impact. The use of hydrogen peroxide at pH 11.5 (alkaline hydrogen peroxide (AHP)) was shown by Gould and coworkers to be an effective pretreatment of grass stovers and other plant materials in the context of animal nutrition and ethanol production. Our earlier experiments indicated that AHP performed well when compared against two other alkaline pretreatments. Here, we explored several key parameters to test the potential of AHP for further improvement relevant to lignocellulosic ethanol production. Results The effects of biomass loading, hydrogen peroxide loading, residence time, and pH control were tested in combination with subsequent digestion with a commercial enzyme preparation, optimized mixtures of four commercial enzymes, or optimized synthetic mixtures of pure enzymes. AHP pretreatment was performed at room temperature (23°C) and atmospheric pressure, and after AHP pretreatment the biomass was neutralized with HCl but not washed before enzyme digestion. Standard enzyme digestion conditions were 0.2% glucan loading, 15 mg protein/g glucan, and 48 h digestion at 50°C. Higher pretreatment biomass loadings (10% to 20%) gave higher monomeric glucose (Glc) and xylose (Xyl) yields than the 2% loading used in earlier studies. An H2O2 loading of 0.25 g/g biomass was almost as effective as 0.5 g/g, but 0.125 g/g was significantly less effective. Optimized mixtures of four commercial enzymes substantially increased post-AHP-pretreatment enzymatic hydrolysis yields at all H2O2 concentrations compared to any single commercial enzyme. At a pretreatment biomass loading of 10% and an H2O2 loading of 0.5 g/g biomass, an optimized commercial mixture at total protein loadings of 8 or 15 mg/g glucan gave

Where do the immunostimulatory effects of oral proteolytic enzymes ('systemic enzyme therapy') come from? Microbial proteolysis as a possible starting point.

Science.gov (United States)

Biziulevicius, Gediminas A

2006-01-01

Enteric-coated proteolytic enzyme preparations like Wobenzym and Phlogenzym are widely used for the so-called 'systemic enzyme therapy' both in humans and animals. Numerous publications reveal that oral proteolytic enzymes are able to stimulate directly the activity of immune competent cells as well as to increase efficiency of some of their products. But origins of the immunostimulatory effects of oral proteolytic enzymes are still unclear. The hypothesis described here suggests that it may be proteolysis of intestinal microorganisms that makes the immune competent cells to work in the immunostimulatory manner. The hypothesis was largely formed by several scientific observations: First, microbial lysis products (lipopolysaccharides, muropeptides and other peptidoglycan fragments, beta-glucans, etc.) are well known for their immunostimulatory action. Second, a normal human being hosts a mass of intestinal microorganisms equivalent to about 1 kg. The biomass (mainly due to naturally occurring autolysis) continuously supplies the host's organism with immunostimulatory microbial cell components. Third, the immunostimulatory effects resulting from the oral application of exogenously acting antimicrobial (lytic) enzyme preparations, such as lysozyme and lysosubtilin, are likely to be a result of the action of microbial lysis products. Fourth, cell walls of most microorganisms contain a considerable amount of proteins/peptides, a possible target for exogenous proteolytic enzymes. In fact, several authors have already shown that a number of proteases possess an ability to lyse the microbial cells in vitro. Fifth, the pretreatment of microbial cells (at least of some species) in vitro with proteolytic enzymes makes them more sensitive to the lytic action of lysozyme and, otherwise, pretreatment with lysozyme makes them more susceptible to proteolytic degradation. Sixth, exogenous proteases, when in the intestines, may participate in final steps of food-protein digestion

NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

Directory of Open Access Journals (Sweden)

Henky Manoppo

2010-06-01

Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

Directory of Open Access Journals (Sweden)

Ľubomír Mikuš

2013-02-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

DEFF Research Database (Denmark)

Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

2013-01-01

for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

Science.gov (United States)

Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

2003-01-01

Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

Science.gov (United States)

Kupetz, M; Sacher, B; Becker, T

2016-06-05

Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

Acute cadmium intoxication induces alpha-class glutathione S-transferase protein synthesis and enzyme activity in rat liver

International Nuclear Information System (INIS)

Casalino, Elisabetta; Sblano, Cesare; Calzaretti, Giovanna; Landriscina, Clemente

2006-01-01

Acute cadmium intoxication affects glutathione S-transferase (GST) in rat liver. It has been found that 24 h after i.p. cadmium administration to rats, at a dose of 2.5 mg CdCl 2 kg -1 body weight, the activity of this enzyme in liver cytosol increased by 40%. A less stimulatory effect persisted till 48 h and thereafter the enzyme activity normalized. Since, GST isoenzymes belong to different classes in mammalian tissues, we used quantitative immunoassays to verify which family of GST isoenzymes is influenced by this intoxication. Only alpha-class glutathione S-transferase (α-GST) proteins were detected in rat liver cytosol and their level increased by about 25%, 24 h after cadmium treatment. No pi-GST isoforms were found in liver cytosol from either normal or cadmium-treated rats. Co-administration of actinomycin D with cadmium normalized both the protein level and the activity of α-GST, suggesting that some effect occurs on enzyme transcription of these isoenzymes by this metal. On the other hand, it seems unlikely that the stimulatory effect is due to the high level of peroxides caused by lipid peroxidation, since Vitamin E administration strongly reduced the TBARS level, but did not cause any GST activity decrease

Extremely thermophilic microorganisms for biomass conversion: status and prospects.

Science.gov (United States)

Blumer-Schuette, Sara E; Kataeva, Irina; Westpheling, Janet; Adams, Michael Ww; Kelly, Robert M

2008-06-01

Many microorganisms that grow at elevated temperatures are able to utilize a variety of carbohydrates pertinent to the conversion of lignocellulosic biomass to bioenergy. The range of substrates utilized depends on growth temperature optimum and biotope. Hyperthermophilic marine archaea (T(opt)>or=80 degrees C) utilize alpha- and beta-linked glucans, such as starch, barley glucan, laminarin, and chitin, while hyperthermophilic marine bacteria (T(opt)>or=80 degrees C) utilize the same glucans as well as hemicellulose, such as xylans and mannans. However, none of these organisms are able to efficiently utilize crystalline cellulose. Among the thermophiles, this ability is limited to a few terrestrial bacteria with upper temperature limits for growth near 75 degrees C. Deconstruction of crystalline cellulose by these extreme thermophiles is achieved by 'free' primary cellulases, which are distinct from those typically associated with large multi-enzyme complexes known as cellulosomes. These primary cellulases also differ from the endoglucanases (referred to here as 'secondary cellulases') reported from marine hyperthermophiles that show only weak activity toward cellulose. Many extremely thermophilic enzymes implicated in the deconstruction of lignocellulose can be identified in genome sequences, and many more promising biocatalysts probably remain annotated as 'hypothetical proteins'. Characterization of these enzymes will require intensive effort but is likely to generate new opportunities for the use of renewable resources as biofuels.

Synthesis of bromo phenyl piperidine derivatives and the study of their effects on neurotransmitters and strong compatibility with alpha amylase enzyme

International Nuclear Information System (INIS)

Rafiq, K.; Zarreen, T.

2016-01-01

In the last few decades several novel derivatives of piperidine have been synthesized for their CNS potentials and proved to be effective in the treatment of psychiatric and other CNS disorders. The present study is the demonstration of same phenomenon through which a new series of 4-(4-Bromophenyl)-4-hydroxypiperidine derivatives were synthesized via substitution at nitrogen and tested for aectylcholinestrase and butyrylcholinestrase activity by TLC bioautographic method and showed that among these synthesized moieties two were found to produce effects on these neurotransmitters. The synthesized compounds were also assessed further for their interaction with digestive enzymes (alpha-amylase) in vitro by plate method and all the compounds showed good interaction with amylase enzyme. (author)

Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2016-01-01

Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.

GENPLAT: an automated platform for biomass enzyme discovery and cocktail optimization.

Science.gov (United States)

Walton, Jonathan; Banerjee, Goutami; Car, Suzana

2011-10-24

The high cost of enzymes for biomass deconstruction is a major impediment to the economic conversion of lignocellulosic feedstocks to liquid transportation fuels such as ethanol. We have developed an integrated high throughput platform, called GENPLAT, for the discovery and development of novel enzymes and enzyme cocktails for the release of sugars from diverse pretreatment/biomass combinations. GENPLAT comprises four elements: individual pure enzymes, statistical design of experiments, robotic pipeting of biomass slurries and enzymes, and automated colorimeteric determination of released Glc and Xyl. Individual enzymes are produced by expression in Pichia pastoris or Trichoderma reesei, or by chromatographic purification from commercial cocktails or from extracts of novel microorganisms. Simplex lattice (fractional factorial) mixture models are designed using commercial Design of Experiment statistical software. Enzyme mixtures of high complexity are constructed using robotic pipeting into a 96-well format. The measurement of released Glc and Xyl is automated using enzyme-linked colorimetric assays. Optimized enzyme mixtures containing as many as 16 components have been tested on a variety of feedstock and pretreatment combinations. GENPLAT is adaptable to mixtures of pure enzymes, mixtures of commercial products (e.g., Accellerase 1000 and Novozyme 188), extracts of novel microbes, or combinations thereof. To make and test mixtures of ˜10 pure enzymes requires less than 100 μg of each protein and fewer than 100 total reactions, when operated at a final total loading of 15 mg protein/g glucan. We use enzymes from several sources. Enzymes can be purified from natural sources such as fungal cultures (e.g., Aspergillus niger, Cochliobolus carbonum, and Galerina marginata), or they can be made by expression of the encoding genes (obtained from the increasing number of microbial genome sequences) in hosts such as E. coli, Pichia pastoris, or a filamentous fungus such

Thermophilic and unusually acidophilic amylase produced by a thermophilic acidophilic bacillus sp

Energy Technology Data Exchange (ETDEWEB)

Uchino, F

1982-01-01

Bacillus sp. 11-1S, a thermophilic acidophilic bacterial strain, produced an extracellular amylase with unusual characteristics. The enzyme was purified 40-fold by SE-Sephadex column chromatography. The pH optimum for activity was 2.0, and substantial activity was noted in the pH range of 1.5-3.5. The optimal temperature was 70 degrees C, but the activity decreased markedly in lower reaction temperatures. Arrhenius plots of the reaction showed two straight lines intersecting at about 50 degrees C. The activity or stability of the enzyme was not likely to depend on Ca2+. The molecular weight of the enzyme was 54,000 calculated from the electrophoretic mobility. The enzyme behaved like an alpha-amylase (1,4-alpha-D- glucan glucanohydrolase, E.C. 3.2.1.1). About 34% of glucosidic linkages of soluble starch was hydrolyzed at 65 degrees C and pH 2.0, in 24 hours, and the major products were maltotriose and maltose. (Refs. 14).

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

OpenAIRE

Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

2012-01-01

Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

Physiological covalent regulation of rat liver branched-chain alpha-ketoacid dehydrogenase

International Nuclear Information System (INIS)

Harris, R.A.; Powell, S.M.; Paxton, R.; Gillim, S.E.; Nagae, H.

1985-01-01

A radiochemical assay was developed for measuring branched-chain alpha-ketoacid dehydrogenase activity of Triton X-100 extracts of freeze-clamped rat liver. The proportion of active (dephosphorylated) enzyme was determined by measuring enzyme activities before and after activation of the complex with a broad-specificity phosphoprotein phosphatase. Hepatic branched-chain alpha-ketoacid dehydrogenase activity in normal male Wistar rats was 97% active but decreased to 33% active after 2 days on low-protein (8%) diet and to 13% active after 4 days on the same diet. Restricting protein intake of lean and obese female Zucker rats also caused inactivation of hepatic branched-chain alpha-ketoacid dehydrogenase complex. Essentially all of the enzyme was in the active state in rats maintained for 14 days on either 30 or 50% protein diets. This was also the case for rats maintained on a commercial chow diet (minimum 23% protein). However, maintaining rats on 20, 8, and 0% protein diets decreased the percentage of the active form of the enzyme to 58, 10, and 7% of the total, respectively. Fasting of chow-fed rats for 48 h had no effect on the activity state of hepatic branched-chain alpha-ketoacid dehydrogenase, i.e., 93% of the enzyme remained in the active state compared to 97% for chow-fed rats. However, hepatic enzyme of rats maintained on 8% protein diet was 10% active before starvation and 83% active after 2 days of starvation. Thus, dietary protein deficiency results in inactivation of hepatic branched-chain alpha-ketoacid dehydrogenase complex, presumably as a consequence of low hepatic levels of branched-chain alpha-ketoacids

Comprehensive functional characterization of the glycoside hydrolase family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification.

Science.gov (United States)

Nelson, Cassandra E; Attia, Mohamed A; Rogowski, Artur; Morland, Carl; Brumer, Harry; Gardner, Jeffrey G

2017-12-01

Lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1→3)/β(1→4) mixed-linkage glucan (MLG) and β(1→3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active enZymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach, we have delineated the physiological roles of the four C. japonicus glycoside hydrolase family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activity profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1→3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1→3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Potent, selective, orally bioavailable inhibitors of tumor necrosis factor-alpha converting enzyme (TACE): discovery of indole, benzofuran, imidazopyridine and pyrazolopyridine P1' substituents.

Science.gov (United States)

Lu, Zhonghui; Ott, Gregory R; Anand, Rajan; Liu, Rui-Qin; Covington, Maryanne B; Vaddi, Krishna; Qian, Mingxin; Newton, Robert C; Christ, David D; Trzaskos, James; Duan, James J-W

2008-03-15

Potent and selective inhibitors of tumor necrosis factor-alpha converting enzyme (TACE) were discovered with several new heterocyclic P1' groups in conjunction with cyclic beta-amino hydroxamic acid scaffolds. Among them, the pyrazolopyridine provided the best overall profile when combined with tetrahydropyran beta-amino hydroxamic acid scaffold. Specifically, inhibitor 49 showed IC(50) value of 1 nM against porcine TACE and 170 nM in the suppression of LPS-induced TNF-alpha of human whole blood. Compound 49 also displayed excellent selectivity over a wide panel of MMPs as well as excellent oral bioavailability (F%>90%) in rat n-in-1 PK studies.

Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

Science.gov (United States)

Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

2018-06-19

The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

Science.gov (United States)

Thao, Cao Phuong; Tien, Le Thi Thuy

2017-09-01

β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

Science.gov (United States)

Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

2015-01-01

Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

Microbial nitrilases: versatile, spiral forming, industrial enzymes.

Science.gov (United States)

Thuku, R N; Brady, D; Benedik, M J; Sewell, B T

2009-03-01

The nitrilases are enzymes that convert nitriles to the corresponding acid and ammonia. They are members of a superfamily, which includes amidases and occur in both prokaryotes and eukaryotes. The superfamily is characterized by having a homodimeric building block with a alpha beta beta alpha-alpha beta beta alpha sandwich fold and an active site containing four positionally conserved residues: cys, glu, glu and lys. Their high chemical specificity and frequent enantioselectivity makes them attractive biocatalysts for the production of fine chemicals and pharmaceutical intermediates. Nitrilases are also used in the treatment of toxic industrial effluent and cyanide remediation. The superfamily enzymes have been visualized as dimers, tetramers, hexamers, octamers, tetradecamers, octadecamers and variable length helices, but all nitrilase oligomers have the same basic dimer interface. Moreover, in the case of the octamers, tetradecamers, octadecamers and the helices, common principles of subunit association apply. While the range of industrially interesting reactions catalysed by this enzyme class continues to increase, research efforts are still hampered by the lack of a high resolution microbial nitrilase structure which can provide insights into their specificity, enantioselectivity and the mechanism of catalysis. This review provides an overview of the current progress in elucidation of structure and function in this enzyme class and emphasizes insights that may lead to further biotechnological applications.

Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

Science.gov (United States)

Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

1990-04-01

Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols

Directory of Open Access Journals (Sweden)

A. Korpi

2003-01-01

Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.

The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice

Directory of Open Access Journals (Sweden)

Fengdan Jin

2014-01-01

Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.

Combined effects of added beta glucan and black tea in breads on starch functionality.

Science.gov (United States)

Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

2015-03-01

Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

Kinetics of improved 1,4-alpha-D-glucan glucohydrolase biosynthesis from a newly isolated Aspergillus oryzae IIB-6 and parameter significance analysis by 2-factorial design.

Science.gov (United States)

Fatima, Bilqees; Ali, Sikander

2012-01-01

Sixteen different mould cultures viz. Aspergillus, Alternaria, Arthroderma, Trichoderma, Fusarium, Penicillium, Rhizopus and Chochliobolus were isolated from the soil samples of Qatar by serial dilution method. The preliminary screening of isolates was done by selecting initial colonies showing relatively bigger zones of starch hydrolysis on nutrient agar plates. The isolates were then subjected to secondary screening by submerged fermentation (SmF). The 1,4-α-D-glucan glucohydrolase (GGH) activity ranged from 1.906-12.675 U/ml/min. The product yield was analysed in dependence of mycelial morphology, biomass level and protein content. The isolate Aspergillus oryzae llB-6 which gave maximum enzyme production was incubated in M3 medium containing 20 g/l starch, 10 g/l lactose, 8.5 g/l yeast extract, 6 g/l corn steep liquor (CSL), 1.2 g/l MgSO4.7H2O, 1.3 g/l NH4Cl, 0.6 g/l CaCl2.2H2O, pH 5 at 30±2°C and 200 rpm. On the basis of kinetic variables, notably Qp (0.058±0.01(a) U/g/h), Yp/s (0.308±0.03(ab) U/g) and qp (0.210±0.032(abc) U/g fungal biomass/h), A. oryzae IIB-6 was found to be a hyper producer of GGH (LSD 0.0345) compared to A. kawachii IIB-2. A noticeable enhancement in enzyme activity of over 30% was observed (13.917±1.01 U/ml/min) when the process parameters viz. cultural conditions (pH 5, incubation period 72 h) and nutritional requirements (6 g/l CSL, 9.5 g/l yeast extract, 10 g/l starch, 20 g/l lactose) were further optimized using a 2-factorial Plackett-Burman design. The model terms were found to be highly significant (HS, p≤0.05), indicating the potential utility of the culture (dof~3).

Alkaline peroxide pretreatment of corn stover: effects of biomass, peroxide, and enzyme loading and composition on yields of glucose and xylose

Directory of Open Access Journals (Sweden)

Hodge David B

2011-06-01

Full Text Available Abstract Background Pretreatment is a critical step in the conversion of lignocellulose to fermentable sugars. Although many pretreatment processes are currently under investigation, none of them are entirely satisfactory in regard to effectiveness, cost, or environmental impact. The use of hydrogen peroxide at pH 11.5 (alkaline hydrogen peroxide (AHP was shown by Gould and coworkers to be an effective pretreatment of grass stovers and other plant materials in the context of animal nutrition and ethanol production. Our earlier experiments indicated that AHP performed well when compared against two other alkaline pretreatments. Here, we explored several key parameters to test the potential of AHP for further improvement relevant to lignocellulosic ethanol production. Results The effects of biomass loading, hydrogen peroxide loading, residence time, and pH control were tested in combination with subsequent digestion with a commercial enzyme preparation, optimized mixtures of four commercial enzymes, or optimized synthetic mixtures of pure enzymes. AHP pretreatment was performed at room temperature (23°C and atmospheric pressure, and after AHP pretreatment the biomass was neutralized with HCl but not washed before enzyme digestion. Standard enzyme digestion conditions were 0.2% glucan loading, 15 mg protein/g glucan, and 48 h digestion at 50°C. Higher pretreatment biomass loadings (10% to 20% gave higher monomeric glucose (Glc and xylose (Xyl yields than the 2% loading used in earlier studies. An H2O2 loading of 0.25 g/g biomass was almost as effective as 0.5 g/g, but 0.125 g/g was significantly less effective. Optimized mixtures of four commercial enzymes substantially increased post-AHP-pretreatment enzymatic hydrolysis yields at all H2O2 concentrations compared to any single commercial enzyme. At a pretreatment biomass loading of 10% and an H2O2 loading of 0.5 g/g biomass, an optimized commercial mixture at total protein loadings of 8 or 15 mg

Partial purification and characterization of {alpha}-amylases from one insecticide-resistant population of Sitophilus zeamais

Energy Technology Data Exchange (ETDEWEB)

Lopes, K.V.; Oliveira, M.G.A.; Paixao, G.P.; Visotto, L.E. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Bioquimica e Biologia Molecular; Veloso, R.V.S.; Marinho, J.S.; Guedes, R.N.C. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Animal; Oliveira, J.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Quimica

2008-07-01

Full text: {alpha}-Amylases (EC 3.2.1.1) constitute a family of endo-amylases that catalyze the hydrolysis of a-D- (1,4)-glucan linkages in st ach components and various other related carbohydrates. They play a central role in carbohydrate metabolism of animals, plants and microorganisms. Many insects, especially those that feed on grain products during larval and/or adult life, depend on their amylases for survival. This is particularly true for the Sitophilus zeamais Motschulsky, a cosmopolitan pest of stored products. It is mainly controlled by insecticides. Amylases from adults of S.zeamais insecticide-resistant were purified by using a sequential procedure of glycogen-complex precipitation and ion exchange chromatography. Specific activity increased from 58,0454 AU/dL/mg protein in the crude homogenate to 2558,8720 AU/dL/mg protein in the final purified sample. Amylase unit (AU/dL) refers to the amount of amylase that hydrolysis 10 mg starch in 30 min at 37 deg C. The purified amylase ran as a single protein band on SDS-PAGE. From a plot of log molecular weight against relative mobility in 10% acrylamide gel, molecular weight was estimated to be 56 kDa. The enzyme had a K{sub m} of 0,2243 g/L for soluble starch and was most active at ph 5,0. The temperature of major activity was 40 deg C. The activity of enzyme was unaffected by presence or absence of Cl{sup -} and Ca{sup 2+}.

Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

Directory of Open Access Journals (Sweden)

Daniela Fiocco

2012-05-01

Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

NARCIS (Netherlands)

Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

2010-01-01

Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

Directory of Open Access Journals (Sweden)

Reshma Davidson

Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

NCBI nr-aa BLAST: CBRC-PTRO-18-0038 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PTRO-18-0038 ref|ZP_01507184.1| glycogen/starch/alpha-glucan phosphorylases [Burkholderia phytofirm...ans PsJN] gb|EAV08329.1| glycogen/starch/alpha-glucan phosphorylases [Burkholderia phytofirmans PsJN] ZP_01507184.1 4.8 26% ...

The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

Science.gov (United States)

Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

2014-04-01

Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

Mining novel starch-converting Glycoside Hydrolase 70 enzymes from the Nestlé Culture Collection genome database : The Lactobacillus reuteri NCC 2613 GtfB

NARCIS (Netherlands)

Gangoiti, Joana; van Leeuwen, Sander S.; Meng, Xiangfeng; Duboux, Stéphane; Vafiadi, Christina; Pijning, Tjaard; Dijkhuizen, Lubbert

2017-01-01

The Glycoside hydrolase (GH) family 70 originally was established for glucansucrases of lactic acid bacteria (LAB) converting sucrose into α-glucan polymers. In recent years we have identified 3 subfamilies of GH70 enzymes (designated GtfB, GtfC and GtfD) as 4,6-α-glucanotransferases, cleaving

Structure-function relationships in the Na,K-ATPase. cap alpha. subunit: site-directed mutagenesis of glutamine-111 to arginine and asparagine-122 to aspartic acid generates a ouabain-resistant enzyme

Energy Technology Data Exchange (ETDEWEB)

Price, E.M.; Lingrel, J.B.

1988-11-01

Na,K-ATPases from various species differ greatly in their sensitivity to cardiac glycosides such as ouabain. The sheep and human enzymes are a thousand times more sensitive than the corresponding ones from rat and mouse. To define the region of the ..cap alpha..1 subunit responsible for this differential sensitivity, chimeric cDNAs of sheep and rat were constructed and expressed in ouabain-sensitive HeLa cells. The construct containing the amino-terminal half of the rat ..cap alpha..1 subunit coding region and carboxyl-terminal half of the sheep conferred the ouabain-resistant phenotype to HeLa cells while the reverse construct did not. This indicates that the determinants involved in ouabain sensitivity are located in the amino-terminal half of the Na,K-ATPase ..cap alpha.. subunit. By use of site-directed mutagenesis, the amino acid sequence of the first extracellular domain (H1-H2) of the sheep ..cap alpha..1 subunit was changed to that of the rat. When expressed in HeLa cells, this mutated sheep ..cap alpha..1 construct, like the rat/sheep chimera, was able to confer ouabain resistance to these cells. Furthermore, similar results were observed when HeLa cells were transfected with a sheep ..cap alpha..1 cDNA containing only two amino acid substitutions. The resistant cells, whether transfected with the rat ..cap alpha..1 cDNA, the rat/sheep chimera, or the mutant sheep ..cap alpha..1 cDNAs, exhibited identical biochemical characteristics including ouabain-inhibitable cell growth, /sup 86/Rb/sup +/ uptake, and Na,K-ATPase activity. These results demonstrate that the presence of arginine and aspartic acid on the amino end and carboxyl end, respectively, of the H1-H2 extracellular domain of the Na,K-ATPase ..cap alpha.. subunit together is responsible for the ouabain-resistant character of the rat enzyme and the corresponding residues in the sheep ..cap alpha..1 subunit (glutamine and asparagine) are somehow involved in ouabain binding.

Immune Enhancing Activity of β-(1,3)-Glucan Isolated from Genus Agrobacterium in Bone-Marrow Derived Macrophages and Mice Splenocytes.

Science.gov (United States)

Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun

2016-01-01

An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.

Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

Science.gov (United States)

Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

2013-10-01

Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

Characterization of the Paenibacillus beijingensis DSM 24997 GtfD and its glucan polymer products representing a new glycoside hydrolase 70 subfamily of 4,6-α-glucanotransferase enzymes

NARCIS (Netherlands)

Gangoiti, Joana; Lamothe, Lisa; van Leeuwen, Sander Sebastiaan; Vafiadi, Christina; Dijkhuizen, Lubbert

2017-01-01

Previously we have reported that the Gram-negative bacterium Azotobacter chroococcum NCIMB 8003 uses the 4,6-α-glucanotransferase GtfD to convert maltodextrins and starch into a reuteran-like polymer consisting of (α1→4) glucan chains connected by alternating (α1→4)/(α1→6) linkages and (α1→4,6)

Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

Science.gov (United States)

Shiota, E; Maekawa, M; Kono, T

2001-12-01

Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

DEFF Research Database (Denmark)

Madsen, A. M.; Tendal, K.; Thilsing, T.

2013-01-01

occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

Probing interactions between B-glucan and bile salts at atomic detail by ¹H-¹³C NMR assays

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G

2014-01-01

Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

DEFF Research Database (Denmark)

Jiménez, Natalia Ivonne Vera

by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

Alkylation of amide linkages and cleavage of the C chain in the enzyme-activated-substrate inhibition of alpha-chymotrypsin with N-nitrosamides

International Nuclear Information System (INIS)

Donadio, S.; Perks, H.M.; Tsuchiya, K.; White, E.H.

1985-01-01

Active-site-directed N-nitrosamides inhibit alpha-chymotrypsin through an enzyme-activated-substrate mechanism. In this work, the activation results in the release--in the active site--of benzyl carbonium ions, which alkylate and inhibit the enzyme. The final ratio of benzyl groups to enzyme molecules is 1.0, but the alkyl groups are scattered over a number of sites. Reduction and alkylation of the inhibited enzyme generate peptides insoluble in most media. Guanidine hydrochloride at 6 M proved a good solvent, and its use as an eluant on G-75 Sephadex permitted separation of the peptides. In the case of 14 C-labeled enzyme, such an approach has shown that all of the alkylation occurs on the C chain of the enzyme, the chain of which the active site is constructed. Chemical modification of the peptides with ethylenediamine and N-[3-(dimethylamino)propyl]-N'-ethylcarbodiimide rendered them soluble in dilute acid, permitting high-performance liquid chromatographic separation. Model studies have shown that the benzyl carbonium ions are highly reactive, alkylating amide linkages at both oxygen and nitrogen. Chromatography of this mixture and also 13 C NMR spectroscopy of the intact inhibited enzyme have shown that three major N-alkylations have occurred. Tryptic digestion of the C chain of chymotrypsin, which contains all of the alkylation sites, provides evidence that the stable N sites are principally located between residue 216 and residue 230

Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

Science.gov (United States)

Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

2017-03-07

The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

Effects of dietary yeastβ-glucan on nutrient digestibility and serum proifles in pre-ruminant Holstein calves

Institute of Scientific and Technical Information of China (English)

MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu

2015-01-01

This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.

Soluble inhibitors/deactivators of cellulase enzymes from lignocellulosic biomass.

Science.gov (United States)

Kim, Youngmi; Ximenes, Eduardo; Mosier, Nathan S; Ladisch, Michael R

2011-04-07

Liquid hot water, steam explosion, and dilute acid pretreatments of lignocellulose generate soluble inhibitors which hamper enzymatic hydrolysis as well as fermentation of sugars to ethanol. Toxic and inhibitory compounds will vary with pretreatment and include soluble sugars, furan derivatives (hydroxymethyl fulfural, furfural), organic acids (acetic, formic and, levulinic acid), and phenolic compounds. Their effect is seen when an increase in the concentration of pretreated biomass in a hydrolysis slurry results in decreased cellulose conversion, even though the ratio of enzyme to cellulose is kept constant. We used lignin-free cellulose, Solka Floc, combined with mixtures of soluble components released during pretreatment of wood, to prove that the decrease in the rate and extent of cellulose hydrolysis is due to a combination of enzyme inhibition and deactivation. The causative agents were extracted from wood pretreatment liquid using PEG surfactant, activated charcoal or ethyl acetate and then desorbed, recovered, and added back to a mixture of enzyme and cellulose. At enzyme loadings of either 1 or 25mg protein/g glucan, the most inhibitory components, later identified as phenolics, decreased the rate and extent of cellulose hydrolysis by half due to both inhibition and precipitation of the enzymes. Full enzyme activity occurred when the phenols were removed. Hence detoxification of pretreated woods through phenol removal is expected to reduce enzyme loadings, and therefore reduce enzyme costs, for a given level of cellulose conversion. Copyright © 2011 Elsevier Inc. All rights reserved.

Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

Science.gov (United States)

Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

2012-09-04

Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

Genetics Home Reference: alpha-mannosidosis

Science.gov (United States)

... the lysosomes , which are compartments that digest and recycle materials in the cell. Within lysosomes, the enzyme ... JC, Saftig P, Fogh J, Malm D. Natural history of alpha mannosidosis a longitudinal study. Orphanet J ...

Structure and kinetic investigation of Streptococcus pyogenes family GH38 alpha-mannosidase.

Directory of Open Access Journals (Sweden)

Michael D L Suits

2010-02-01

Full Text Available The enzymatic hydrolysis of alpha-mannosides is catalyzed by glycoside hydrolases (GH, termed alpha-mannosidases. These enzymes are found in different GH sequence-based families. Considerable research has probed the role of higher eukaryotic "GH38" alpha-mannosides that play a key role in the modification and diversification of hybrid N-glycans; processes with strong cellular links to cancer and autoimmune disease. The most extensively studied of these enzymes is the Drosophila GH38 alpha-mannosidase II, which has been shown to be a retaining alpha-mannosidase that targets both alpha-1,3 and alpha-1,6 mannosyl linkages, an activity that enables the enzyme to process GlcNAc(Man(5(GlcNAc(2 hybrid N-glycans to GlcNAc(Man(3(GlcNAc(2. Far less well understood is the observation that many bacterial species, predominantly but not exclusively pathogens and symbionts, also possess putative GH38 alpha-mannosidases whose activity and specificity is unknown.Here we show that the Streptococcus pyogenes (M1 GAS SF370 GH38 enzyme (Spy1604; hereafter SpGH38 is an alpha-mannosidase with specificity for alpha-1,3 mannosidic linkages. The 3D X-ray structure of SpGH38, obtained in native form at 1.9 A resolution and in complex with the inhibitor swainsonine (K(i 18 microM at 2.6 A, reveals a canonical GH38 five-domain structure in which the catalytic "-1" subsite shows high similarity with the Drosophila enzyme, including the catalytic Zn(2+ ion. In contrast, the "leaving group" subsites of SpGH38 display considerable differences to the higher eukaryotic GH38s; features that contribute to their apparent specificity.Although the in vivo function of this streptococcal GH38 alpha-mannosidase remains unknown, it is shown to be an alpha-mannosidase active on N-glycans. SpGH38 lies on an operon that also contains the GH84 hexosaminidase (Spy1600 and an additional putative glycosidase. The activity of SpGH38, together with its genomic context, strongly hints at a function

Impact of new ingredients obtained from brewer's spent yeast on bread characteristics.

Science.gov (United States)

Martins, Z E; Pinho, O; Ferreira, I M P L V O

2018-05-01

The impact of bread fortification with β-glucans and with proteins/proteolytic enzymes from brewers' spent yeast on physical characteristics was evaluated. β-Glucans extraction from spent yeast cell wall was optimized and the extract was incorporated on bread to obtain 2.02 g β-glucans/100 g flour, in order to comply with the European Food Safety Authority guidelines. Protein/proteolytic enzymes extract from spent yeast was added to bread at 60 U proteolytic activity/100 g flour. Both β-glucans rich and proteins/proteolytic enzymes extracts favoured browning of bread crust. However, breads with proteins/proteolytic enzymes addition presented lower specific volume, whereas the incorporation of β-glucans in bread lead to uniform pores that was also noticeble in terms of higher specific volume. Overall, the improvement of nutritional/health promoting properties is highlighted with β-glucan rich extract, not only due to bread β-glucan content but also for total dietary fibre content (39% increase). The improvement was less noticeable for proteins/proteolytic enzymes extract. Only a 6% increase in bread protein content was noted with the addition of this extract and higher protein content would most likely accentuate the negative impact on bread specific volume that in turn could impair consumer acceptance. Therefore, only β-glucan rich extract is a promising bread ingredient.

Multiplicity of 3-Ketosteroid-9 alpha-Hydroxylase Enzymes in Rhodococcus rhodochrous DSM43269 for Specific Degradation of Different Classes of Steroids

OpenAIRE

Petrusma, Mirjan; Hessels, Gerda; Dijkhuizen, Lubbert; van der Geize, Robert

2011-01-01

The well-known large catabolic potential of rhodococci is greatly facilitated by an impressive gene multiplicity. This study reports on the multiplicity of kshA, encoding the oxygenase component of 3-ketosteroid 9 alpha-hydroxylase, a key enzyme in steroid catabolism. Five kshA homologues (kshA1 to kshA5) were previously identified in Rhodococcus rhodochrous DSM43269. These KshA(DSM43269) homologues are distributed over several phylogenetic groups. The involvement of these KshA homologues in ...

(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

Science.gov (United States)

Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

2017-03-01

A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

Directory of Open Access Journals (Sweden)

A.C.C.F.F. De Paula

2005-06-01

Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

Science.gov (United States)

Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

2018-07-15

A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an a-glucan that forms complexes with low molecular weight galactan

NARCIS (Netherlands)

Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.

2010-01-01

An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.

Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions

International Nuclear Information System (INIS)

Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian

2012-01-01

Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)

Characterisation of a thiamine diphosphate-dependent alpha-keto acid decarboxylase from Proteus mirabilis JN458.

Science.gov (United States)

Wang, Biying; Bai, Yajun; Fan, Taiping; Zheng, Xiaohui; Cai, Yujie

2017-10-01

Alpha-keto acid decarboxylases can convert keto acids to their corresponding aldehydes, which are often volatile aroma compounds. The gene encoding α-keto acid decarboxylase in Proteus mirabilis JN458 was cloned, and the enzyme overexpressed in Escherichia coli BL21 (DE3), purified in high yield, and characterised. The molecular weight is 62.291kDa by MALDI-TOF MS, and optimum activity at pH 6.0 and 40-50°C. The enzyme is a typical decarboxylase, dependent on thiamine diphosphate and Mg 2+ as cofactors. For the decarboxylation reaction, the enzyme displayed a broad substrate range. Kinetic parameters were determined using 4-methyl-2-oxopentanoic acid, phenyl pyruvate and 3-methyl-2-oxopentanoic acid as substrates. K m and k cat values for phenyl pyruvate were 0.62mM and 77.38s -1 , respectively, and the k cat /K m value was 124.81mM -1 s -1 . The enzyme properties suggest it may act effectively under cheese ripening conditions. Copyright © 2017. Published by Elsevier Ltd.

Degradation of olive mill wastewater by the induced extracellular ligninolytic enzymes of two wood-rot fungi.

Science.gov (United States)

Zerva, Anastasia; Zervakis, Georgios I; Christakopoulos, Paul; Topakas, Evangelos

2017-12-01

Olive mill wastewater (OMWW) is a major problem in olive oil - producing countries, due to its high organic load and concentration in phenols that are toxic for marine life, plants and soil microorganisms. In the present study, two mushroom species were tested in regard to their OMWW's oxidative capacity, Pleurotus citrinopileatus LGAM 28684 and Irpex lacteus LGAM 238. OMWW (25% v/v) degradation was investigated for several culture conditions, namely pH, agitation speed, nitrogen-based supplements and their concentration. The selected values were pH 6, agitation rate 150 rpm, 30 g L -1 corn steep liquor as nitrogen source for P. citrinopileatus and 20 g L -1 diammonium tartrate for I. lacteus. The two strains performed well in cultures supplemented with OMWW, generating very high titers of oxidative enzymes and achieving more than 90% color and phenols reduction within a 24 days cultivation period. In addition, the amount of glucans present in the fungal biomass was assessed. Hence, P. citrinopileatus and I. lacteus appear as potent degraders of OMWW with the ability to use the effluent as a substrate for the production of biotechnologically important enzymes and valuable fungal glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

Tumor necrosis factor-alpha modulates effects of aryl hydrocarbon receptor ligands on cell proliferation and expression of cytochrome P450 enzymes in rat liver "stem-like" cells

Czech Academy of Sciences Publication Activity Database

Umannová, Lenka; Zatloukalová, Jiřina; Machala, M.; Krčmář, P.; Májková, Z.; Hennig, B.; Kozubík, Alois; Vondráček, Jan

2007-01-01

Roč. 99, č. 1 (2007), s. 79-89 ISSN 0388-1350 R&D Projects: GA ČR(CZ) GA524/05/0595 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : tumor necrosis factor-alpha * xenobiotic metabolizing enzymes * dioxin Subject RIV: BO - Biophysics

Expression and characterization of a recombinant maize CK-2 alpha subunit

DEFF Research Database (Denmark)

Boldyreff, B; Meggio, F; Dobrowolska, G

1993-01-01

to support the immunological data also by biochemical and biophysical experiments the availability of a recombinant CK-2 alpha from maize was a prerequisite. A maize cDNA clone of maize CK-2 alpha was expressed in the bacterial strain BL21 (DE3). The recombinant protein was purified to homogeneity; its......CKIIB, one of the CK-2 like enzymes which have been isolated from maize, has been shown to be a monomeric enzyme that cross-reacts with anti CK-2 alpha specific antibodies suggesting a possible relationship between the two proteins (Dobrowolska et al. (1992) Eur. J. Biochem. 204, 299-303). In order...... molecular mass on one-dimensional SDS PAGE was estimated to be 36.5 kDa. The calculated molecular mass according to the amino acid composition is 39,228 Da (332 amino acids). The recombinant maize CK-2 alpha (rmCK-2 alpha) exhibited mostly the same properties as the recombinant human CK-2 alpha (rhCK-2...

aguA, the gene encoding an extracellular alpha-glucuronidase from Aspergillus tubingensis, is specifically induced on xylose and not on glucuronic acid.

Science.gov (United States)

de Vries, R P; Poulsen, C H; Madrid, S; Visser, J

1998-01-01

An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.

Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels

Science.gov (United States)

Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.

2014-01-01

Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183

Mechanism and activation for allosteric adenosine 5'-monophosphate nucleosidase. Kinetic alpha-deuterium isotope effects for the enzyme-catalyzed hydrolysis of adenosine 5'-monophosphate and nicotinamide mononucleotide

International Nuclear Information System (INIS)

Skoog, M.T.

1986-01-01

The kinetic alpha-deuterium isotope effect on Vmax/Km for hydrolysis of NMN catalyzed by AMP nucleosidase at saturating concentrations of the allosteric activator MgATP2- is kH/kD = 1.155 +/- 0.012. This value is close to that reported previously for the nonenzymatic hydrolysis of nucleosides of related structure, suggesting that the full intrinsic isotope effect for enzymatic NMN hydrolysis is expressed under these conditions; that is, bond-changing reactions are largely or completely rate-determining and the transition state has marked oxocarbonium ion character. The kinetic alpha-deuterium isotope effect for this reaction is unchanged when deuterium oxide replaces water as solvent, corroborating this conclusion. Furthermore, this isotope effect is independent of pH over the range 6.95-9.25, for which values of Vmax/Km change by a factor of 90, suggesting that the isotope-sensitive and pH-sensitive steps for AMP-nucleosidase-catalyzed NMN hydrolysis are the same. Values of kH/kD for AMP nucleosidase-catalyzed hydrolysis of NMN decrease with decreasing saturation of enzyme with MgATP2- and reach unity when the enzyme is less than half-saturated with this activator. This requires that the rate-determining step changes from cleavage of the covalent C-N bond to one which is isotope-independent. In contrast to the case for NMN hydrolysis, AMP nucleosidase-catalyzed hydrolysis of AMP at saturating concentrations of MgATP2- shows a kinetic alpha-deuterium isotope effect of unity. Thus, covalent bond-changing reactions are largely or completely rate-determining for hydrolysis of a poor substrate, NMN, but make little or no contribution to rate-determining step for hydrolysis of a good substrate, AMP, by maximally activated enzyme. This behavior has several precedents

Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

Science.gov (United States)

Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

2018-05-01

Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

Rheological and gelation properties of rice starch modified with 4-alpha-glucanotransferase.

Science.gov (United States)

Lee, Kwang Yeon; Kim, Yong-Ro; Park, Kwan Hwa; Lee, Hyeon Gyu

2008-04-01

Rheological measurements were performed to characterize rice starch modified with 4-alpha-glucanotransferase (4alphaGTase) isolated from Thermus scotoductus, in terms of effects of the enzyme and starch concentration on flow behavior, gel strength, and melting and gelling kinetics of the modified rice starch. Consistency index decreased and flow behavior index increased with the level of enzyme treatment, and at high level of enzyme treatment, it demonstrated Bingham plastic behavior. As the level of enzyme decreased and the starch concentration increased, gelation time decreased and the final gel strength increased significantly. Regardless of treatment variables, all the modified starch gels melted at similar temperature.

Purification and physicochemical properties of. cap alpha. -amylase from irradiated wheat

Energy Technology Data Exchange (ETDEWEB)

Machaiah, J P; Vakil, U K [Bhabha Atomic Research Centre, Bombay (India). Biochemistry and Food Technology Div.

1981-06-01

..cap alpha..-Amylases from control and gamma-irradiated (at 0.2 and 2.0 kGy dose levels) wheat seedlings were purified to homogeneity and characterized. The molecular weight of the enzyme from a 2 kGy irradiated sample was slightly lower than that of the control; other general and catalytic properties also showed some differences. ..cap alpha..-Amylase from the irradiated (2kGy) sample had a narrow range of pH optimum and was inactivated faster at alkaline pH and by heat treatment than the enzyme from unirradiated wheat. A high apparent Michaelis constant (Ksub(m)) and a low maximal velocity (Vsub(max)) for the hydrolysis of soluble starch catalyzed by the enzyme from irradiated (2kGy) wheat, suggested some modifications in the formation of the substrate ..cap alpha..-amylase complex. Further, of the total number of amino acid residues lost on irradiation, dicarboxylic amino acids constituted the largest percentage; these structural alterations in the enzyme may be responsible for its partial inactivation. The total sugars liberated upon amylolysis of starch with the 2kGy irradiated enzyme were lower than control, and there was accumulation of higher maltodextrins in the place of maltose.

Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

Science.gov (United States)

Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

2012-04-01

Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

Starch modification with microbial alpha-glucanotransferase enzymes

NARCIS (Netherlands)

van der Maarel, Marc J. E. C.; Leemhuis, Hans

2013-01-01

Starch is an agricultural raw material used in many food and industrial products. It is present in granules that vary in shape in the form of amylose and amylopectin. Starch-degrading enzymes are used on a large scale in the production of sweeteners (high fructose corn syrup) and concentrated

5 alpha-reductase inhibitors and prostatic disease.

Science.gov (United States)

Schröder, F H

1994-08-01

5 alpha-Reductase inhibitors are a new class of substances with very specific effects on type I and type II 5 alpha R which may be of use in the treatment of skin disease, such as male pattern baldness, male acne and hirsutism, as well as prostatic hyperplasia and prostate cancer. At least two types of 5 alpha R inhibitors with a different pH optimum have been described. cDNA encoding for both the type I and the type II enzyme has been cloned. Most of the orally effective 5 alpha R inhibitors belong to the class of 4-azasteroids. The radical substituted in the 17 position of the steroid ring seems to be related to species specific variations and to the types of 5 alpha R enzymes in different species and organ systems. 5 alpha R inhibitors lead to a decrease of plasma DHT by about 65% while there is a slight rise in plasma testosterone. The decrease of tissue DHT in the ventral prostate of the intact rat, the dog and in humans is more pronounced and amounts to about 85%. There is a reciprocal rise of tissue T in these systems. The application of an inhibitor of 5 alpha R type II leads to a shrinkage of BPH in men by about 30%. In the rat a similar shrinkage accompanied by a significant decrease of total organ DNA occurs. This decrease, however, is not as pronounced as can be achieved with castration.(ABSTRACT TRUNCATED AT 250 WORDS)

Quantitative assessment of the effects of beta-glucan consumption on serum lipid profile and glucose level in hypercholesterolemic subjects.

Science.gov (United States)

Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S

2015-08-01

A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

Lactose in diet influences the degradation of mixed linked β(1-3;1-4)-D-glucan in the small intestine of pigs

DEFF Research Database (Denmark)

Knudsen, Knud Erik Bach

The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...

Dietary calcium phosphate content and oat β-glucan influence gastrointestinal microbiota, butyrate-producing bacteria and butyrate fermentation in weaned pigs.

Science.gov (United States)

Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G

2011-03-01

This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

Science.gov (United States)

Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

2015-04-01

Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

New ALPHA-2 magnet

CERN Multimedia

Anaïs Schaeffer

2012-01-01

On 21 June, members of the ALPHA collaboration celebrated the handover of the first solenoid designed for the ALPHA-2 experiment. The magnet has since been successfully installed and is working well.   Khalid Mansoor, Sumera Yamin and Jeffrey Hangst in front of the new ALPHA-2 solenoid. “This was the first of three identical solenoids that will be installed between now and September, as the rest of the ALPHA-2 device is installed and commissioned,” explains ALPHA spokesperson Jeffrey Hangst. “These magnets are designed to allow us to transfer particles - antiprotons, electrons and positrons - between various parts of the new ALPHA-2 device by controlling the transverse size of the particle bunch that is being transferred.” Sumera Yamin and Khalid Mansoor, two Pakistani scientists from the National Centre for Physics in Islamabad, came to CERN in February specifically to design and manufacture these magnets. “We had the chance to work on act...

A polymorphic variant in the human electron transfer flavoprotein alpha-chain (alpha-T171) displays decreased thermal stability and is overrepresented in very-long-chain acyl-CoA dehydrogenase-deficient patients with mild childhood presentation

DEFF Research Database (Denmark)

Bross, P; Pedersen, P; Nyholm, M

1999-01-01

The consequences of two amino acid polymorphisms of human electron transfer flavoprotein (alpha-T/I171 in the alpha-subunit and beta-M/T154 in the beta-subunit) on the thermal stability of the enzyme are described. The alpha-T171 variant displayed a significantly decreased thermal stability, wher....... This is compatible with a negative modulating effect of the less-stable alpha-T171 ETF variant in this group of VLCAD patients that harbor missense mutations in at least one allele and therefore potentially display residual levels of VLCAD enzyme activity. Udgivelsesdato: 1999-Jun...

Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

Science.gov (United States)

Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

2017-03-01

Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

Directory of Open Access Journals (Sweden)

Hirokazu Tokuyasu

2010-09-01

Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

High Molecular Weight Glucan of the Culinary Medicinal Mushroom Agaricus bisporus is an α-Glucan that Forms Complexes with Low Molecular Weight Galactan

Directory of Open Access Journals (Sweden)

Harry J. Wichers

2010-08-01

Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.

Enzyme-polyelectrolyte complexes in water-ethanol mixtures: negatively charged groups artificially introduced into alpha-chymotrypsin provide additional activation and stabilization effects.

Science.gov (United States)

Kudryashova, E V; Gladilin, A K; Vakurov, A V; Heitz, F; Levashov, A V; Mozhaev, V V

1997-07-20

Formation of noncovalent complexes between alpha-chymotrypsin (CT) and a polyelectrolyte, polybrene (PB), has been shown to produce two major effects on enzymatic reactions in binary mixtures of polar organic cosolvents with water. (i) At moderate concentrations of organic cosolvents (10% to 30% v/v), enzymatic activity of CT is higher than in aqueous solutions, and this activation effect is more significant for CT in complex with PB (5- to 7-fold) than for free enzyme (1.5- to 2.5-fold). (ii) The range of cosolvent concentrations that the enzyme tolerates without complete loss of catalytic activity is much broader. For enhancement of enzyme stability in the complex with the polycation, the number of negatively charged groups in the protein has been artificially increased by using chemical modification with pyromellitic and succinic anhydrides. Additional activation effect at moderate concentrations of ethanol and enhanced resistance of the enzyme toward inactivation at high concentrations of the organic solvent have been observed for the modified preparations of CT in the complex with PB as compared with an analogous complex of the native enzyme. Structural changes behind alterations in enzyme activity in water-ethanol mixtures have been studied by the method of circular dichroism (CD). Protein conformation of all CT preparations has not changed significantly up to 30% v/v of ethanol where activation effects in enzymatic catalysis were most pronounced. At higher concentrations of ethanol, structural changes in the protein have been observed for different forms of CT that were well correlated with a decrease in enzymatic activity. (c) 1997 John Wiley & Sons, Inc. Biotechnol Bioeng 55: 267-277, 1997.

In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2013-01-01

Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

Crystal Structure of Full-length Mycobacterium tuberculosis H37Rv Glycogen Branching Enzyme; Insights of N-Terminal [beta]-Sandwich in Sustrate Specifity and Enzymatic Activity

Energy Technology Data Exchange (ETDEWEB)

Pal, Kuntal; Kumar, Shiva; Sharma, Shikha; Garg, Saurabh Kumar; Alam, Mohammad Suhail; Xu, H. Eric; Agrawal, Pushpa; Swaminathan, Kunchithapadam (NU Sinapore); (Van Andel); (IMT-India)

2010-07-13

The open reading frame Rv1326c of Mycobacterium tuberculosis (Mtb) H37Rv encodes for an {alpha}-1,4-glucan branching enzyme (MtbGlgB, EC 2.4.1.18, Uniprot entry Q10625). This enzyme belongs to glycoside hydrolase (GH) family 13 and catalyzes the branching of a linear glucose chain during glycogenesis by cleaving a 1 {yields} 4 bond and making a new 1 {yields} 6 bond. Here, we show the crystal structure of full-length MtbGlgB (MtbGlgBWT) at 2.33-{angstrom} resolution. MtbGlgBWT contains four domains: N1 {beta}-sandwich, N2 {beta}-sandwich, a central ({beta}/{alpha}){sub 8} domain that houses the catalytic site, and a C-terminal {beta}-sandwich. We have assayed the amylase activity with amylose and starch as substrates and the glycogen branching activity using amylose as a substrate for MtbGlgBWT and the N1 domain-deleted (the first 108 residues deleted) Mtb{Delta}108GlgB protein. The N1 {beta}-sandwich, which is formed by the first 105 amino acids and superimposes well with the N2 {beta}-sandwich, is shown to have an influence in substrate binding in the amylase assay. Also, we have checked and shown that several GH13 family inhibitors are ineffective against MtbGlgBWT and Mtb{Delta}108GlgB. We propose a two-step reaction mechanism, for the amylase activity (1 {yields} 4 bond breakage) and isomerization (1 {yields} 6 bond formation), which occurs in the same catalytic pocket. The structural and functional properties of MtbGlgB and Mtb{Delta}108GlgB are compared with those of the N-terminal 112-amino acid-deleted Escherichia coli GlgB (EC{Delta}112GlgB).

The gram-negative bacterium Azotobacter chroococcum NCIMB 8003 employs a new glycoside hydrolase family 70 4,6-α-glucanotransferase enzyme (GtfD) to synthesize a reuteran like polymer from maltodextrins and starch

NARCIS (Netherlands)

Gangoiti, Joana; van Leeuwen, Sander S; Vafiadi, Christina; Dijkhuizen, Lubbert

BACKGROUND: Originally the glycoside hydrolase (GH) family 70 only comprised glucansucrases of lactic acid bacteria which synthesize α-glucan polymers from sucrose. Recently we have identified 2 novel subfamilies of GH70 enzymes represented by the Lactobacillus reuteri 121 GtfB and the

β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

Science.gov (United States)

Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

2017-11-01

The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

5alphaDH-DOC (5alpha-dihydro-deoxycorticosterone) activates androgen receptor in castration-resistant prostate cancer.

Science.gov (United States)

Uemura, Motohide; Honma, Seijiro; Chung, Suyoun; Takata, Ryo; Furihata, Mutsuo; Nishimura, Kazuo; Nonomura, Norio; Nasu, Yasutomo; Miki, Tsuneharu; Shuin, Taro; Fujioka, Tomoaki; Okuyama, Akihiko; Nakamura, Yusuke; Nakagawa, Hidewaki

2010-08-01

Prostate cancer often relapses during androgen-depletion therapy, even under the castration condition in which circulating androgens are drastically reduced. High expressions of androgen receptor (AR) and genes involved in androgen metabolism indicate a continued role for AR in castration-resistant prostate cancers (CRPCs). There is increasing evidence that some amounts of 5alpha-dihydrotestosterone (DHT) and other androgens are present sufficiently to activate AR within CRPC tissues, and enzymes involved in the androgen and steroid metabolism, such as 5alpha-steroid reductases, are activated in CRPCs. In this report, we screened eight natural 5alphaDH-steroids to search for novel products of 5alpha-steroid reductases, and identified 11-deoxycorticosterone (DOC) as a novel substrate for 5alpha-steroid reductases in CRPCs. 11-Deoxycorticosterone (DOC) and 5alpha-dihydro-deoxycorticosterone (5alphaDH-DOC) could promote prostate cancer cell proliferation through AR activation, and type 1 5alpha-steroid reductase (SRD5A1) could convert from DOC to 5alphaDH-DOC. Sensitive liquid chromatography-tandem mass spectrometric analysis detected 5alphaDH-DOC in some clinical CRPC tissues. These findings implicated that under an extremely low level of DHT, 5alphaDH-DOC and other products of 5alpha-steroid reductases within CRPC tissues might activate the AR pathway for prostate cancer cell proliferation and survival under castration.

B-Glucan exacerbates allergic asthma independent of fungal ...

Science.gov (United States)

BackgroundAllergic sensitization to fungi has been associated with asthma severity. As a result, it has been largely assumed that the contribution of fungi to allergic disease is mediated through their potent antigenicity.ObjectiveWe sought to determine the mechanism by which fungi affect asthma development and severity.MethodsWe integrated epidemiologic and experimental asthma models to explore the effect of fungal exposure on asthma development and severity.ResultsWe report that fungal exposure enhances allergen-driven TH2 responses, promoting severe allergic asthma. This effect is independent of fungal sensitization and can be reconstituted with β-glucan and abrogated by neutralization of IL-17A. Furthermore, this severe asthma is resistant to steroids and characterized by mixed TH2 and TH17 responses, including IL-13+IL-17+CD4+ double-producing effector T cells. Steroid resistance is dependent on fungus-induced TH17 responses because steroid sensitivity was restored in IL-17rc−/− mice. Similarly, in children with asthma, fungal exposure was associated with increased serum IL-17A levels and asthma severity.ConclusionOur data demonstrate that fungi are potent immunomodulators and have powerful effects on asthma independent of their potential to act as antigens. Furthermore, our results provide a strong rationale for combination treatment strategies targeting IL-17A for this subgroup of fungus-exposed patients with difficult-to-treat asthma. To describe th

Direct ethanol production from cellulosic materials at high temperature using the thermotolerant yeast Kluyveromyces marxianus displaying cellulolytic enzymes

Energy Technology Data Exchange (ETDEWEB)

Yanase, Shuhei; Yamada, Ryosuke; Ogino, Chiaki; Kondo, Akihiko [Kobe Univ. (Japan). Dept. of Chemical Science and Engineering; Hasunuma, Tomohisa; Tanaka, Tsutomu; Fukuda, Hideki [Kobe Univ. (Japan). Organization of Advanced Science and Technology

2010-09-15

To exploit cellulosic materials for fuel ethanol production, a microorganism capable of high temperature and simultaneous saccharification-fermentation has been required. However, a major drawback is the optimum temperature for the saccharification and fermentation. Most ethanol-fermenting microbes have an optimum temperature for ethanol fermentation ranging between 28 C and 37 C, while the activity of cellulolytic enzymes is highest at around 50 C and significantly decreases with a decrease in temperature. Therefore, in the present study, a thermotolerant yeast, Kluyveromyces marxianus, which has high growth and fermentation at elevated temperatures, was used as a producer of ethanol from cellulose. The strain was genetically engineered to display Trichoderma reesei endoglucanase and Aspergillus aculeatus {beta}-glucosidase on the cell surface, which successfully converts a cellulosic {beta}-glucan to ethanol directly at 48 C with a yield of 4.24 g/l from 10 g/l within 12 h. The yield (in grams of ethanol produced per gram of {beta}-glucan consumed) was 0.47 g/g, which corresponds to 92.2% of the theoretical yield. This indicates that high-temperature cellulose fermentation to ethanol can be efficiently accomplished using a recombinant K. marxianus strain displaying thermostable cellulolytic enzymes on the cell surface. (orig.)

Identification of UDPG-binding polypeptides and purified (1,3)-β-glucan synthase by photoaffinity labelling with 5-azido-UDPG

International Nuclear Information System (INIS)

Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.

1989-01-01

The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex

Isolation, characterization, and mechanistic studies of (-)-alpha-gurjunene synthase from Solidago canadensis.

Science.gov (United States)

Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A

1999-04-15

The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.

Extraction and chemical characterization of rye arabinoxylan and the effect of β-glucan on the mechanical and barrier properties of cast arabinoxylan films

DEFF Research Database (Denmark)

Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena

2013-01-01

.9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...

Feeding common carp Cyprinus carpio with β-glucan supplemented diet stimulates C-reactive protein and complement immune acute phase responses following PAMPs injection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave

2014-08-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Activity of enzymes that hydrolyze sucrose and raffinose in the first stages of germination of Lactuca sativa cv. Grand rapids. [Invertase, alpha-galactosidose, and sucrose synthetase were observed

Energy Technology Data Exchange (ETDEWEB)

Slabnik, E.; Calderon, P.; Diaz, H.

1981-01-01

The activities of enzymes capable of metabolizing raffinose and sucrose on achenes of lettuce were studied. During the first stages of germination, evidence was obtained for the occurrence of invertase in the endosperm and embryonic axis. Alpha-galactosidase was localized in the endosperm and cotyledons. Sucrose synthetase was present in the dry seed.

Divergent clinical outcomes of alpha-glucosidase enzyme replacement therapy in two siblings with infantile-onset Pompe disease treated in the symptomatic or pre-symptomatic state

OpenAIRE

Matsuoka, Takashi; Miwa, Yoshiyuki; Tajika, Makiko; Sawada, Madoka; Fujimaki, Koichiro; Soga, Takashi; Tomita, Hideshi; Uemura, Shigeru; Nishino, Ichizo; Fukuda, Tokiko; Sugie, Hideo; Kosuga, Motomichi; Okuyama, Torayuki; Umeda, Yoh

2016-01-01

Pompe disease is an autosomal recessive, lysosomal glycogen storage disease caused by acid ?-glucosidase deficiency. Infantile-onset Pompe disease (IOPD) is the most severe form and is characterized by cardiomyopathy, respiratory distress, hepatomegaly, and skeletal muscle weakness. Untreated, IOPD generally results in death within the first year of life. Enzyme replacement therapy (ERT) with recombinant human acid alpha glucosidase (rhGAA) has been shown to markedly improve the life expectan...

Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

Science.gov (United States)

Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

2016-12-17

Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

Inhibition of polymerases-alpha and -beta completely blocks DNA repair induced by UV irradiation in cultured mouse neuronal cells

International Nuclear Information System (INIS)

Licastro, F.; Sarafian, T.; Verity, A.M.; Walford, R.L.

1985-01-01

The effects of hydroxyurea, aphidicolin and dideoxythymidine on UV-induced DNA repair of mouse neuronal granular cells were studied. Aphidicolin, which is considered a specific inhibitor of polymerase-alpha, decreased spontaneous DNA synthesis by 93% and totally suppressed DNA repair. Dideoxythymidine, an inhibitor of polymerase-beta, was more potent in decreasing scheduled DNA synthesis than aphidicolin, and also completely blocked the UV-induced DNA repair. Hydroxyurea, a specific inhibitor of ribonucleotide reductase, inhibited scheduled DNA synthesis, but unscheduled DNA synthesis after UV irradiation was always well detectable. Our data suggest that in neuronal cells from 5 to 10 days old mice both polymerases-alpha and -beta are required for both DNA synthesis and repair. These two enzymes may act jointly in filling up the gaps along the DNA molecule and elongating the DNA chain

Study on preparation and effect of oligoβ-glucan and oligochitosan on immune stimulation white patches in the internal organs disease on Tra catfish (Pangasianodon hypophthalmus)

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai

2015-01-01

Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)

Production of fructose-containing syrup with enzymes

Energy Technology Data Exchange (ETDEWEB)

Helwiig-Nielsen, B

1981-01-01

A review on enzymic processes used for production of fructose- high syrup from starch including liquefaction by alpha-amylase, saccharification by amyloglucosidase, and isomerization with glucose isomerase.

Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet

Directory of Open Access Journals (Sweden)

Jie Zheng

2013-12-01

Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.

Enhancement of the immunity and body weight gain in broiler by feeding with the brewer yeast β-glucan degraded by gamma Co-60 radiation

International Nuclear Information System (INIS)

Le Quang Luan; Nguyen Thanh Long

2015-01-01

The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)

UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

International Nuclear Information System (INIS)

Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

1989-01-01

A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

Expression and kinetic properties of a recombinant 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzyme of human liver.

Science.gov (United States)

Deyashiki, Y; Tamada, Y; Miyabe, Y; Nakanishi, M; Matsuura, K; Hara, A

1995-08-01

Human liver cytosol contains multiple forms of 3 alpha-hydroxysteroid dehydrogenase and dihydrodiol dehydrogenase with hydroxysteroid dehydrogenase activity, and multiple cDNAs for the enzymes have been cloned from human liver cDNA libraries. To understand the relationship of the multiple enzyme froms to the genes, a cDNA, which has been reported to code for an isoenzyme of human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase, was expressed in Escherichia coli. The recombinant enzyme showed structural and functional properties almost identical to those of the isoenzyme purified from human liver. In addition, the recombinant isoenzyme efficiently reduced 5 alpha-dihydrotestosterone and 5 beta-dihydrocortisone, the known substrates of human liver 3 alpha-hydroxysteroid dehydrogenase and chlordecone reductase previously purified, which suggests that these human liver enzymes are identical. Furthermore, the steady-state kinetic data for NADP(+)-linked (S)-1-indanol oxidation by the recombinant isoenzyme were consistent with a sequential ordered mechanism in which NADP+ binds first. Phenolphthalein inhibited this isoenzyme much more potently than it did the other human liver dihydrodiol dehydrogenases, and was a competitive inhibitor (Ki = 20 nM) that bound to the enzyme-NADP+ complex.

β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

Science.gov (United States)

Shao, Yujing; Guo, Yuming; Wang, Zhong

2013-07-01

This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

Production and properties of alpha-amylase from thermophilic Bacillus sp. Produção e propriedades de alfa-amilase de Bacillus sp. termofílico

Directory of Open Access Journals (Sweden)

Carlos Alberto Martins Cordeiro

2002-01-01

Full Text Available alpha-amylase (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1 production by thermophilic Bacillus sp strain SMIA-2 cultivated in liquid media containing soluble starch reached a maximum at 48h, with levels of 57U/mL. Studies on the a-amylase characterization revealed that the optimum temperature for activity was 70ºC. The enzyme was stable for 2h at 50ºC, while at 60ºC, 70ºC and 90ºC, 4%, 13% and 38% of the original activities were lost, respectively. The optimum pH of the enzyme was 7.5. After incubation of crude enzyme solution for 24h at pH 7.5, a decrease of about 5% of its original activity was observed. The enzyme was strongly inhibited by Co2+, Cu2+ and Ba2+, but less affected by Ca2+, Mg2+, Ni2+, Sr2+ and Mn2+. The enzyme in 1M and 5M NaCl solutions the enzyme retained 70% and 47% of the original activity after 24h of incubation at 4ºC, respectively.A produção de alfa-amilase (1,4-alfa-D-glicano glicanohidrolase, EC 3.2.1.1 por um Bacillus sp cepa SMIA-2 cultivado em meios líquidos contendo amido solúvel, alcançou o máximo em 48h com níveis de 57U/mL. Estudos sobre a caracterização de alfa-amilase revelaram que a temperatura ótima de atividade desta enzima foi 70ºC. A enzima foi estável por 2h a 50ºC, enquanto que a 60ºC, 70ºC e 90ºC, 4%, 13% e 38% da atividade original foram perdidas, respectivamente. O pH ótimo da enzima foi 7,5. Após a incubação da enzima bruta por 24h a pH 7,5 observou-se um decréscimo em torno de 5% de sua atividade original. A enzima foi fortemente inibida por Co2+, Cu2+ e Ba2+, mas foi menos afetada por Ca2+, Mg2+, Ni2+, Sr2+ e Mn2+. Em solução de NaCl 1M e 5M, a enzima reteve 70% e 47% da sua atividade original após 24h a 4ºC, respectivamente.

Dronerarone acts as a selective inhibitor of 3,5,3'-triiodothyronine binding to thyroid hormone receptor-alpha1: in vitro and in vivo evidence

NARCIS (Netherlands)

van Beeren, H. C.; Jong, W. M. C.; Kaptein, E.; Visser, T. J.; Bakker, O.; Wiersinga, W. M.

2003-01-01

Dronedarone (Dron), without iodine, was developed as an alternative to the iodine-containing antiarrhythmic drug amiodarone (AM). AM acts, via its major metabolite desethylamiodarone, in vitro and in vivo as a thyroid hormone receptor alpha(1) (TRalpha(1)) and TRbeta(1) antagonist. Here we

β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

Science.gov (United States)

2015-01-01

The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983

Purification and properties of a thermostable pullulanase from Clostridium thermosulfurgenes EM1 which hydrolyses both. alpha. -1,6 and. alpha. -1,4-glycosidic linkages

Energy Technology Data Exchange (ETDEWEB)

Spreinat, A [Goettingen Univ. (Germany, F.R.). Inst. fuer Mikrobiologie; Antranikian, G [Technische Univ. Hamburg-Harburg, Hamburg (Germany, F. R.). Arbeitsbereich Biotechnologie 1

1990-08-01

A novel thermostable pullulanase, secreted by the thermophilic anaerobic bacterium Clostridium thermosulfurogenes EM1, was purified and characterized. Applying anion exchange chromatography and gel filtration the enzyme was purified 47-fold and had a specific activity of 200 units/mg. The molecular mass of this thermostable enzyme was determined to be 102 000 daltons and consisted of a single subunit. The enzyme was able to attack specifically the {alpha}-1,6-glycosidic linkages in pullulan and caused its complete hydrolysis to maltotriose. Surprisingly and unlike the enzyme from Klebsiella pneumoniae, the purified enzyme from this anaerobic thermophile exhibited, in addition to its debranching and pullulanase activity, an {alpha}-1,4 hydrolysing activity as well. By the action of this single polypeptide chain various branched and linear polysaccharides were completely converted to two major products, namely maltose and maltotriose. The K{sub m} values of this enzyme for pullulan and amylose were determined to be 1.33 mg/ml and 0.38 mg/ml, respectively. This debranching enzyme displays a temperature optimum at 60deg-65deg C and a pH optimum at 5.5-6.0. The application of this new class of pullulanase (pullulanase type II) in industry will significantly enhance the starch saccharification process. (orig.).

Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

Science.gov (United States)

Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

Immobilization of antibodies and enzyme-labeled antibodies by radiation polymerization

International Nuclear Information System (INIS)

Kumakura, M.; Kaetsu, I.; Suzuki, M.; Adachi, S.

1983-01-01

Immobilization of antibodies and enzyme-labeled antibodies by radiation polymerization at low temperatures was studied. The antibody activity of antibody was not affected by irradiation at an irradiation dose of below 8 MR and low temperatures. Immobilization of peroxidase-labeled anti-rabbit IgG goat IgG, anti-peroxidase, peroxidase, and anti-alpha-fetoprotein was carried out with hydrophilic and hydrophobic monomers. The activity of the immobilized enzyme-labeled antibody membranes varied with the thickness of the membranes and increased with decreasing membrane thickness. The activity of the immobilized antibody particles was varied by particle size. Immobilized anti-alpha-fetoprotein particles and membranes can be used for the assay of alpha-fetoprotein by the antigen-antibody reaction, such as a solid-phase sandwich method with high sensitivity

Yield of ethanol from enzyme-hydrolyzed yam (Dioscorea rotundata ...

African Journals Online (AJOL)

Fresh whole yam tubers and cocoyam corms were separately processed into flours by washing, peeling, blanching, slicing,drying and milling. The flours were enzyme-hydrolyzed by mixing 500g of flour with 2Lof water followed by treatment with a combination of bacterial alpha amylase, limit dextrinase and fungal alpha ...

Influence of chitosan and melanin-glucan complex onto gamma-exposure with low doses and acute stressful reaction

International Nuclear Information System (INIS)

Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.

2004-01-01

Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex

Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B.

2013-01-01

β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

Science.gov (United States)

Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

2017-01-01

This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

Effect of polyols on the native structure of {alpha}-chymotrypsin: A comparable study

Energy Technology Data Exchange (ETDEWEB)

Kumar, Awanish; Attri, Pankaj [Department of Chemistry, University of Delhi, Delhi - 110 007 (India); Venkatesu, Pannuru, E-mail: venkatesup@hotmail.com [Department of Chemistry, University of Delhi, Delhi - 110 007 (India)

2012-05-20

Highlights: Black-Right-Pointing-Pointer We have studied stability of {alpha}-chymotrypsin in polyols. Black-Right-Pointing-Pointer We have performed DSC, CD and fluorescence spectroscopy. Black-Right-Pointing-Pointer Our {Delta}G{sub u} of CT in polyol increase as polyol concentration increases. Black-Right-Pointing-Pointer All polyols acted as enhancers for CT stability. Black-Right-Pointing-Pointer Our results show that trehalose is strong stabilizer. - The influence of polyols on the structure and stability of {alpha}-chymotrypsin (CT) have been explored by using differential scanning calorimeter (DSC), circular dichroism (CD) and fluorescence spectroscopy. We have predicted the thermodynamic folding properties (transition temperature (T{sub m}), enthalpy change ({Delta}H), heat capacity change ({Delta}C{sub p}) and Gibbs free energy change ({Delta}G{sub u}) from DSC to understand the clear picture of folding studies of CT. All polyols (trehalose, sucrose, sorbitol, and glycerol) acted as enhancers for CT stability, with varying efficacies and efficiencies. The DSC, CD and fluorescence spectral analysis clearly showed the ability of polyols to protect the native structural conformation of enzyme and preventing the unfolding which occurs in the aqueous media. These results explicitly explain that stabilizing polyols are preferentially excluded from the surface of CT, since water has a higher tendency toward favourable interactions with functional groups of the CT than with polyols.

Structure, function and regulation of the enzymes in the starch biosynthetic pathway.

Energy Technology Data Exchange (ETDEWEB)

Geiger, Jim

2013-11-30

Starch is the major reserve polysaccharide in nature and accounts for the majority of the caloric intact of humans. It is also gaining importance as a renewable and biodegradable industrial material. There is burgeoning interest in increasing the amount and altering the properties of the plant starches by plant genetic modification. A rational approach to this effort will require a detailed, atomic-level understanding of the enzymatic processes that produce the starch granule. The starch granule is a complex particle made up of alternating layers of crystalline and amorphous lamellae. It consists of two types of polymer, amylose, a polymer of relatively long chains of α-1,4-linked glucans that contain virtually no branches, and amylopectin, which is highly branched and contains much shorter chains. This complex structure is synthesized by the coordinate activities of the starch synthases (SS), which elongate the polysaccharide chain by addition of glucose units via α-1,4 linkages using ADP- glucose as a donor, and branching enzymes (BE), which branch the polysaccharide chain by cleavage of α₋1,4 linkages and subsequent re-attachment via α₋1,6 linkages. Several isoforms of both starch synthase (SS) and branching enzyme (BE) are found in plants, including SSI, SSII, SSIII and granule- bound SS (GBSS), and SBEI, SBEIIa and SBEIIb. These isoforms have different activities and substrate and product specificities and play different roles in creating the granule and determining the properties of the resulting starch. The overarching goal of this proposal is to begin to understand the regulation and specificities of these enzymes at the atomic level. High-resolution X-ray structures of these enzymes bound to substrates and products will be determined to visualize the molecular interactions responsible for the properties of the enzymes. Hypotheses regarding these issues will then be tested using mutagenesis and enzyme assays. To date, we have determined the

Does alpha 1-acid glycoprotein act as a non-functional receptor for alpha 1-adrenergic antagonists?

Science.gov (United States)

Qin, M; Oie, S

1994-11-01

The ability of a variety of alpha 1-acid glycoproteins (AAG) to affect the intrinsic activity of the alpha 1-adrenergic antagonist prazosin was studied in rabbit aortic strip preparations. From these studies, the activity of AAG appears to be linked to their ability to bind the antagonist. However, a capability to bind prazosin was not the only requirement for this effect. The removal of sialic acid and partial removal of the galactose and mannose residues by periodate oxidation of human AAG all but eliminated the ability of AAG to affect the intrinsic pharmacologic activity of prazosin, although the binding of prazosin was not significantly affected. The presence of bovine AAG, a protein that has a low ability to bind prazosin, reduced the effect of human AAG on prazosin activity. Based upon these results, we propose that AAG is able to bind in the vicinity of the alpha 1-adrenoceptors, therefore extending the binding region for antagonists in such a way as to decrease the ability of the antagonist to interact with the receptor. The carbohydrate side-chains are important for the binding of AAG in the region of the adrenoceptor.

Purification, characterization, and substrate specificity of a glucoamylase with steroidal saponin-rhamnosidase activity from Curvularia lunata.

Science.gov (United States)

Feng, Bing; Hu, Wei; Ma, Bai-ping; Wang, Yong-ze; Huang, Hong-ze; Wang, Sheng-qi; Qian, Xiao-hong

2007-10-01

It has been previously reported that a glucoamylase from Curvularia lunata is able to hydrolyze the terminal 1,2-linked rhamnosyl residues of sugar chains at C-3 position of steroidal saponins. In this work, the enzyme was isolated and identified after isolation and purification by column chromatography including gel filtration and ion-exchange chromatography. Analysis of protein fragments by MALDI-TOF/TOF proteomics Analyzer indicated the enzyme to be 1,4-alpha-D-glucan glucohydrolase EC 3.2.1.3, GA and had considerable homology with the glucoamylase from Aspergillus oryzae. We first found that the glucoamylase was produced from C. lunata and was able to hydrolyze the terminal rhamnosyl of steroidal saponins. The enzyme had the general character of glucoamylase, which hydrolyze starch. It had a molecular mass of 66 kDa and was optimally active at 50 degrees C, pH 4, and specific activity of 12.34 U mg of total protein(-1) under the conditions, using diosgenin-3-O-alpha-L-rhamnopyranosyl(1-->4)-[alpha-L-rhamnopyranosyl (1-->2)]-beta-D-glucopyranoside (compound II) as the substrate. Furthermore, four kinds of commercial glucoamylases from Aspergillus niger were investigated in this work, and they had the similar activity in hydrolyzing terminal rhamnosyl residues of steroidal saponin.

Engineering N-terminal domain of tissue inhibitor of metalloproteinase (TIMP)-3 to be a better inhibitor against tumour necrosis factor-alpha-converting enzyme.

Science.gov (United States)

Lee, Meng-Huee; Verma, Vandana; Maskos, Klaus; Nath, Deepa; Knäuper, Vera; Dodds, Philippa; Amour, Augustin; Murphy, Gillian

2002-01-01

We previously reported that full-length tissue inhibitor of metalloproteinase-3 (TIMP-3) and its N-terminal domain form (N-TIMP-3) displayed equal binding affinity for tissue necrosis factor-alpha (TNF-alpha)-converting enzyme (TACE). Based on the computer graphic of TACE docked with a TIMP-3 model, we created a number of N-TIMP-3 mutants that showed significant improvement in TACE inhibition. Our strategy was to select those N-TIMP-3 residues that were believed to be in actual contact with the active-site pockets of TACE and mutate them to amino acids of a better-fitting nature. The activities of these mutants were examined by measuring their binding affinities (K(app)(i)) and association rates (k(on)) against TACE. Nearly all mutants at position Thr-2 exhibited slightly impaired affinity as well as association rate constants. On the other hand, some Ser-4 mutants displayed a remarkable increase in their binding tightness with TACE. In fact, the binding affinities of several mutants were less than 60 pM, beyond the sensitivity limits of fluorimetric assays. Further studies on cell-based processing of pro-TNF-alpha demonstrated that wild-type N-TIMP-3 and one of its tight-binding mutants, Ser-4Met, were capable of inhibiting the proteolytic shedding of TNF-alpha. Furthermore, the Ser-4Met mutant was also significantly more active (P<0.05) than the wild-type N-TIMP-3 in its cellular inhibition. Comparison of N-TIMP-3 and full-length TIMP-3 revealed that, despite their identical TACE-interaction kinetics, the latter was nearly 10 times more efficient in the inhibition of TNF-alpha shedding, with concomitant implications for the importance of the TIMP-3 C-terminal domain in vivo. PMID:11988096

BAKERY ENZYMES IN CEREAL TECHNOLOGIES

Directory of Open Access Journals (Sweden)

Václav Koman

2012-10-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE Bread is the most common and traditional food in the world. For years, enzymes such as malt and fungal alpha-amylase have been used in bread making. Due to the changes in the baking industry and the ever-increasing demand for more natural products, enzymes have gained real importance in bread-making. If an enzyme is added, it is often destroyed by the heat during the baking process. For generations, enzymes have been used for the improvement of texture and appearance, enhancement of nutritional values and generation of appealing flavours and aromas. Enzymes used in bakery industry constitute nearly one third of the market. The bakery products have undergone radical improvements in quality over the past years in terms of flavour, texture and shelf-life. The the biggest contributor for these improvementsis the usage of enzymes. Present work seeks to systematically describe bakery enzymes, their classification, benefits, usage and chemical reactions in the bread making process.doi:10.5219/193

Liver alpha-amylase gene expression as an early obesity biomarker.

Science.gov (United States)

Mojbafan, Marzieh; Afsartala, Zohreh; Amoli, Mahsa M; Mahmoudi, Mahdi; Yaghmaei, Parichehreh; Larijani, Bagher; Ebrahim-Habibi, Azadeh

2017-04-01

Obesity is a major health problem worldwide, for which preventive and therapeutic means are still needed. Alpha-amylase is a digestive enzyme whose inhibition has been targeted as a potential anti-obesity strategy. However, alpha-amylase gene expression has not been particularly attended to, and in contrast with pancreatic and salivary amylases, fewer studies have focused on liver alpha-amylase. The present study aimed at investigating the expression of alpha-amylase gene in obese and normal mice at RNA and protein level as well as acarbose effect on this gene expression in hepatocyte cell culture. Control and case groups were fed by normal mouse pellet and high-fat diet respectively, during 8 weeks. After this period, serum biochemical parameters including glucose, cholesterol, triglycerides, AST, ALT and alpha-amylase were assayed. Liver alpha-amylase gene was analyzed by real time PCR, and liver enzyme was assayed with Bernfeld and ELISA methods Hepatocyte cell culture derived from both group were also treated by acarbose and alpha-amylase activity and gene expression was analyzed by above mentioned methods. All biochemical factors showed an increase in obese mice, but the increase in ALT and AST were not statistically significant. Alpha-amylase levels were also increased in obese mice, both at RNA and protein level, while a decrease was seen in obese mice derived hepatocytes after acarbose treatment. Elevated liver alpha-amylase levels may be indicative of initial stages of obesity and the use of acarbose could be considered as a treatment of obesity which could be potentially effective at multiple levels. Copyright © 2016. Published by Elsevier Urban & Partner Sp. z o.o.

Influence of carbon source on alpha-amylase production by Aspergillus oryzae

DEFF Research Database (Denmark)

Carlsen, Morten; Nielsen, Jens

2001-01-01

on sucrose, fructose, glycerol, mannitol and acetate. During growth on acetate there was no production of alpha -amylase, whereas addition of small amounts of glucose resulted in alpha -amylase production. A possible induction by alpha -methyl-D-glucoside during growth on glucose was also investigated......, but this compound was not found to be a better inducer of alpha -amylase production than glucose. The results strongly indicate that besides acting as a repressor via the CreA protein, glucose acts as an inducer.......The influence of the carbon source on a-amylase production by Aspergillus oryzae was quantified in carbon-limited chemostat cultures. The following carbon sources were investigated: maltose, maltodextrin (different chain lengths), glucose, fructose, galactose, sucrose, glycerol, mannitol...

Produção, purificação, clonagem e aplicação de enzimas líticas Production, purification, cloning and application of lytic enzymes

Directory of Open Access Journals (Sweden)

Luciana Francisco Fleuri

2005-10-01

Full Text Available Lytic enzymes such as beta-1,3 glucanases, proteases and chitinases are able to hydrolyse, respectively, beta-1,3 glucans, mannoproteins and chitin, as well as the cell walls of many yeast species. Lytic enzymes are useful in a great variety of applications including the preparation of protoplasts; the extraction of proteins, enzymes, pigments and functional carbohydrates; pre-treatment for the mechanical rupture of cells; degradation of residual yeast cell mass for the preparation of animal feed; analysis of the yeast cell wall structure and composition; study of the yeast cell wall synthesis and the control of pathogenic fungi. This review presents the most important aspects with respect to lytic enzymes, especially their production, purification, cloning and application.

Identification of enzymes and quantification of metabolic fluxes in the wild type and in a recombinant Aspergillus oryzae strain

DEFF Research Database (Denmark)

Pedersen, Henrik; Carlsen, Morten; Nielsen, Jens Bredal

1999-01-01

Two alpha-amylase-producing strains of Aspergillus oryzae, a wild-type strain and a recombinant containing additional copies of the alpha-amylase gene, were characterized,vith respect to enzyme activities, localization of enzymes to the mitochondria or cytosol, macromolecular composition...

Evaluation of the Efficiency of Different Disruption Methods on Yeast Cell Wall Preparation for β-Glucan Isolation

Directory of Open Access Journals (Sweden)

Anna Bzducha-Wróbel

2014-12-01

Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.

The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

Directory of Open Access Journals (Sweden)

Vishukumar Aimanianda

2017-06-01

Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

Functional analysis of the Glucan Degradation Locus (GDL) in Caldicellulosiruptor bescii reveals essential roles of component glycoside hydrolases in plant biomass deconstruction.

Science.gov (United States)

Conway, Jonathan M; McKinley, Bennett S; Seals, Nathaniel L; Hernandez, Diana; Khatibi, Piyum A; Poudel, Suresh; Giannone, Richard J; Hettich, Robert L; Williams-Rhaesa, Amanda M; Lipscomb, Gina L; Adams, Michael W W; Kelly, Robert M

2017-10-06

The ability to hydrolyze microcrystalline cellulose is an uncommon feature in the microbial world, but one that can be exploited for conversion of lignocellulosic feedstocks into bio-based fuels and chemicals. Understanding the physiological and biochemical mechanisms by which microorganisms deconstruct cellulosic material is key to achieving this objective. The Glucan Degradation Locus (GDL) in the genomes of extremely thermophilic Caldicellulosiruptor species encodes polysaccharide lyases (PLs), unique cellulose binding proteins (tāpirins), and putative post-translational modifying enzymes, in addition to multi-domain, multi-functional glycoside hydrolases (GHs), thereby representing an alternative paradigm for plant biomass degradation, as compared to fungal or cellulosomal systems. To examine the individual and collective in vivo roles of the glycolytic enzymes, the six GHs in the GDL of Caldicellulosiruptor bescii were systematically deleted, and the extent to which the resulting mutant strains could solubilize microcrystalline cellulose (Avicel) and plant biomasses (switchgrass or poplar) was examined. Three of the GDL enzymes, Athe_1867 (CelA) (GH9-CBM3-CBM3-CBM3-GH48), Athe_1859 (GH5-CBM3-CBM3-GH44), and Athe_1857 (GH10-CBM3-CBM3-GH48), acted synergistically in vivo and accounted for 92% of naked microcellulose (Avicel) degradation. However, the relative importance of the GDL GHs varied for the plant biomass substrates tested. Furthermore, mixed cultures of mutant strains showed switchgrass solubilization depended on the secretome-bound enzymes collectively produced by the culture and not on the specific strain from which they came. These results demonstrate that certain GDL GHs are primarily responsible for the degradation of microcrystalline-containing substrates by C. bescii and provide new insights into the workings of a novel microbial mechanism for lignocellulose utilization. Importance The efficient and extensive degradation of complex

Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

1999-01-01

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

Modulation of intestinal inflammation by yeasts and cell wall extracts: strain dependence and unexpected anti-inflammatory role of glucan fractions.

Directory of Open Access Journals (Sweden)

Samir Jawhara

Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the

Optimization of Thermostable Alpha-Amylase Production Via Mix Agricultural-Residues and Bacillus amyloliquefaciens

Directory of Open Access Journals (Sweden)

Shalini RAI

2014-03-01

Full Text Available This study reports utilization of mixture of wheat and barley bran (1:1 for the production of thermostable alpha-amylase enzyme through a spore former, heat tolerant strain of Bacillus amyloliquefaciens in solid state fermentation. Maximum yield of alpha-amylase (252.77 U mL-1 was obtained in following optimized conditions, inoculums size 2 mL (2 × 106 CFU/mL, moisture 80%, pH 7±0.02, NaCl (3%, temperature 38±1°C, incubation for 72 h, maltose (1% and tryptone (1%. After SSF crude enzyme was purified via ammonium sulfate precipitation, ion exchange and column chromatography by DEAE Cellulose. Purified protein showed a molecular weight of 42 kDa by SDS-PAGE electrophoresis. After purification, purified enzyme was characterized against several enzymes inhibitors such as temperature, NaCl, pH, metal and surfactants. Pure enzyme was highly active over broad temperature (50-70°C, NaCl concentration (0.5-4 M, and pH (6-10 ranges, indicating it’s a thermoactive and alkali-stable nature. Moreover, CaCl2, MnCl2, =-mercaptoethanol were found to stimulate the amylase activity, whereas FeCl3, sodium dodecyl sulfate (SDS, CuCl3 and ethylenediaminetetraacetic acid (EDTA strongly inhibited the enzyme. Moreover, enzyme specificity and thermal stability conformed by degradation of different soluble starch up to 55°C. Therefore, the present study proved that the extracellular alpha-amylase extracted through wheat flour residues by organism B. amyloliquefaciens MCCB0075, both have considerable potential for industrial application owing to its properties.

Dissociation of branched-chain alpha-keto acid dehydrogenase kinase (BDK) from branched-chain alpha-keto acid dehydrogenase complex (BCKDC) by BDK inhibitors.

Science.gov (United States)

Murakami, Taro; Matsuo, Masayuki; Shimizu, Ayako; Shimomura, Yoshiharu

2005-02-01

Branched-chain alpha-keto acid dehydrogenase kinase (BDK) phosphorylates and inactivates the branched-chain alpha-keto acid dehydrogenase complex (BCKDC), which is the rate-limiting enzyme in the branched-chain amino acid catabolism. BDK has been believed to be bound to the BCKDC. However, recent our studies demonstrated that protein-protein interaction between BDK and BCKDC is one of the factors to regulate BDK activity. Furthermore, only the bound form of BDK appears to have its activity. In the present study, we examined effects of BDK inhibitors on the amount of BDK bound to the BCKDC using rat liver extracts. The bound form of BDK in the extracts of liver from low protein diet-fed rats was measured by an immunoprecipitation pull down assay with or without BDK inhibitors. Among the BDK inhibitors. alpha-ketoisocaproate, alpha-chloroisocaproate, and a-ketoisovalerate released the BDK from the complex. Furthermore, the releasing effect of these inhibitors on the BDK appeared to depend on their inhibition constants. On the other hand, clofibric acid and thiamine pyrophosphate had no effect on the protein-protein interaction between two enzymes. These results suggest that the dissociation of the BDK from the BCKDC is one of the mechanisms responsible for the action of some inhibitors to BDK.

Characterization of Polysaccharides from the Fruiting Bodies of Two Species of Genus Ganoderma (Agaricomycetes) and Determination of Water-Soluble β-D-Glucan Using High-Performance Liquid Chromatography.

Science.gov (United States)

Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song

2017-01-01

Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.

Identification of the molecular switch that regulates access of 5alpha-DHT to the androgen receptor.

Science.gov (United States)

Penning, Trevor M; Bauman, David R; Jin, Yi; Rizner, Tea Lanisik

2007-02-01

Pairs of hydroxysteroid dehydrogenases (HSDs) govern ligand access to steroid receptors in target tissues and act as molecular switches. By acting as reductases or oxidases, HSDs convert potent ligands into their cognate inactive metabolites or vice versa. This pre-receptor regulation of steroid hormone action may have profound effects on hormonal response. We have identified the HSDs responsible for regulating ligand access to the androgen receptor (AR) in human prostate. Type 3 3alpha-hydroxysteroid dehydrogenase (aldo-keto reductase 1C2) acts solely as a reductase to convert 5alpha-dihydrotestosterone (DHT), a potent ligand for the AR (K(d)=10(-11)M for the AR), to the inactive androgen 3alpha-androstanediol (K(d)=10(-6)M for the AR); while RoDH like 3alpha-HSD (a short-chain dehydrogenase/reductase (SDR)) acts solely as an oxidase to convert 3alpha-androstanediol back to 5alpha-DHT. Our studies suggest that aldo-keto reductase (AKRs) and SDRs function as reductases and oxidases, respectively, to control ligand access to nuclear receptors.

Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

Science.gov (United States)

Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

2018-05-14

Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

Science.gov (United States)

Alwis, K U; Mandryk, J; Hocking, A D

1999-09-01

Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

Science.gov (United States)

Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

2017-01-01

Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

A phase I/II trial of beta-(1,3/(1,6 D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy

Directory of Open Access Journals (Sweden)

Weitberg Alan B

2008-09-01

Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.

Effect of supplementation of Manno-Oligosaccharide and b-glucans on maize based meal on commercial broilers

Directory of Open Access Journals (Sweden)

R.C.Shendare

2008-01-01

Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15

The Potency of Dextranase from Arthrobacter sp. Strain B7 as Dental Plaque Removal

Directory of Open Access Journals (Sweden)

AFAF BAKTIR

2005-12-01

Full Text Available Dextranase of Arthrobacter sp. strain B7 (B7DEX enzyme was characterized in this study. This enzyme hydrolyzed sucrose and dextran, but not other glucans (starch, nigeran, cellulose, -soluble glucan. It also hydrolyzed glucan from dental plaque with the activity of 7.38 + 0.66 U/ml, where the activity toward dextran was 31.88 + 1.24 U/ml. The enzyme exhibited the pH optimum of 7 and the temperature optimum of 50 oC. Its optimum stability was at pH 7 and 50 oC. The enzyme was inhibited by Fe3+, Cu2+, Zn2+, and Ag+, but not by the anionic detergent (SDS and the nonionic detergent (Triton-X. The enzyme was activated by Ca2+, Na+, Mg2+, and saliva.

Potensi Enzim Dekstranase dari Arthrobacter sp. Galur B7 sebagai Penghambat Plak Gigi

Directory of Open Access Journals (Sweden)

AFAF BAKTIR

2005-12-01

Full Text Available Dextranase of Arthrobacter sp. strain B7 (B7DEX enzyme was characterized in this study. This enzyme hydrolyzed sucrose and dextran, but not other glucans (starch, nigeran, cellulose, β-soluble glucan. It also hydrolyzed glucan from dental plaque with the activity of 7.38 ± 0.66 U/ml, where the activity toward dextran was 31.88 ± 1.24 U/ml. The enzyme exhibited the pH optimum of 7 and the temperature optimum of 50 °C. Its optimum stability was at pH 7 and 50 °C. The enzyme was inhibited by Fe3+, Cu2+, Zn2+, and Ag+, but not by the anionic detergent (SDS and the nonionic detergent (Triton-X. The enzyme was activated by Ca2+, Na+, Mg2+, and saliva.

Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329

Science.gov (United States)

Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos

2013-01-01

Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729

The experience with setting-up radioimmunoassay for alpha-1 fetoprotein

International Nuclear Information System (INIS)

Fingerova, H.

1981-01-01

The decisive factor in the preparation of radioimmunological alpha-1-fetoprotein determination, provided sufficient commercial or own antisera and standards are available for calibration, is the quality of the preparation for labelling. Alpha-1-fetoprotein was separated by affinity chromatography using Sepharose with alpha-1-fetoprotein-bound antibodies. The isolates thus obtained were labelled with 125 I using enzyme and chloramine T and Iodogen techniques. The labelled alpha-1-fetoprotein can be used for RIA. In view of reduced immunoreactivity of the preparation, however, the performance of the radioimmunological determination has so far not matched the quality of imported kits. The technique is currently being optimized. (author)

The composition of accessory enzymes of Penicillium chrysogenum P33 revealed by secretome and synergistic effects with commercial cellulase on lignocellulose hydrolysis.

Science.gov (United States)

Yang, Yi; Yang, Jinshui; Liu, Jiawen; Wang, Ruonan; Liu, Liang; Wang, Fengqin; Yuan, Hongli

2018-06-01

Herein, we report the secretome of Penicillium chrysogenum P33 under induction of lignocellulose for the first time. A total of 356 proteins were identified, including complete cellulases and numerous hemicellulases. Supplementing a commercial cellulase with increasing dosage of P33 enzyme cocktail from 1 to 5 mg/g substrate increased the release of reducing sugars from delignified corn stover by 21.4% to 106.8%. When 50% cellulase was replaced by P33 enzyme cocktail, release of reducing sugars was 78.6% higher than with cellulase alone. Meanwhile, glucan and xylan conversion was increased by 37% and 106%, respectively. P33 enzyme cocktail also enhanced commercial cellulase hydrolysis against four different delignified lignocellulosic biomass. These findings demonstrate that mixing appropriate amount of P33 cocktail with cellulase improves polysaccharide hydrolysis, suggesting P33 enzymes have great potential for industrial applications. Copyright © 2018 Elsevier Ltd. All rights reserved.

Feeding common carp Cyprinus carpio with b-glucan supplemented \\ud diet stimulates C-reactive protein and complement immune acute\\ud phase responses following PAMPs injection

OpenAIRE

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave

2014-01-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...

Glucanos extracelulares bacterianos: estructura, biosíntesis y función Extreacellular bacterial glucans: structure, biosynthesis and function

Directory of Open Access Journals (Sweden)

Bárbara E. García Triana

2008-12-01

Full Text Available La caries dental es una de las enfermedades más frecuentes en el ser humano. En su etiología multifactorial, desempeñan un papel importante determinadas bacterias cariogénicas, que en interacción con la superficie del diente promueven su desmineralización. Dentro de los mecanismos mediadores de la adhesión bacteriana, se encuentra la producción de polisacáridos extracelulares bacterianos. En particular los glucanos sintetizados por las glucosiltransferasas, no solo permiten la adherencia, sino que también constituyen una fuente nutricional para las bacterias, por lo tanto, la actividad de dichas enzimas se considera un factor de virulencia bacteriana en la caries dental. Esta revisión bibliográfica tiene el objetivo de esclarecer los aspectos relacionados con la estructura, biosíntesis y función de los glucanos, y enfatizar en la aplicación de estos conocimientos en la prevención de la caries dental.Dental caries is one of the most common diseases in the human being. Certain cariogenic bacteria play an important role in its multifactorial etiology, since in their interaction with the dental surface they promote its demineralization. The production of extracellular bacterial polyssacharides is among the mechanisms mediating bacterial adhesion. The glucans synthesized by glycosyltransferases not only allow the adherence, but they also are a nutritional source for bacteria and that's why the activity of such enzymes is considered a factor of bacterial virulence in dental caries. This bibliographic review is aimed at making clear the aspects related to the structure, biosynthesis and function of glucans and at giving emphasis to the application of this knowledge in the prevention of dental caries.

Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

Science.gov (United States)

Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

2017-07-01

We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Physical and catalytic properties of alpha-amylase from Tenebrio molitor L. larvae.

Science.gov (United States)

Buonocore, V; Poerio, E; Silano, V; Tomasi, M

1976-01-01

The amylase from Tenebrio molitor L. larvae (yellow mealworm) was characterized according to a number of its molecular and catalytic properties. The insect amylase is a single polypeptide chain with mol.wt. 68000, an isoelectric point of 4.0 and a very low content of sulphur-containing amino acids. The enzyme is a Ca2+-protein and behaves as an alpha-amylase. Removal of Ca2+ by exhaustive dialysis against water causes the irreversible inactivation of the enzyme. Moreover, the enzyme is activated by the presence in the assay mixture of Cl-, or some other inorganic anions that are less effective than Cl-, and is inhibited by F-. Optimal conditions of pH and temperature for the enzymic activity are 5.8 and 37 degrees C. The insect amylase exhibits an identical kinetic behaviour toward starch, amylose and amylopectin; the enzyme hydrolyses glycogen with a higher affinity constant. Compared with the non-insect alpha-amylases described in the literature, Tenebrio molitor amylase has a lower affinity for starch. PMID:942374

Statistically designed optimisation of enzyme catalysed starch removal from potato pulp

DEFF Research Database (Denmark)

Thomassen, Lise Vestergaard; Meyer, Anne S.

2010-01-01

to obtain dietary fibers is usually accomplished via a three step, sequential enzymatic treatment procedure using a heat stable alpha-amylase, protease, and amyloglucosidase. Statistically designed experiments were performed to investigate the influence of enzyme dose, amount of dry matter, incubation time...... and temperature on the amount of starch released from the potato pulp. The data demonstrated that all the starch could be released from potato pulp in one step when 8% (w/w) dry potato pulp was treated with 0.2% (v/w) (enzyme/substrate (E/S)) of a thermostable Bacillus licheniformis alpha-amylase (Termamyl(R) SC...

Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

Science.gov (United States)

Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

2016-01-01

In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

Understanding the role of oat ß-glucan in oat-based dough systems

NARCIS (Netherlands)

Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.

2015-01-01

B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat

alpha-MSH and its receptors in regulation of tumor necrosis factor-alpha production by human monocyte/macrophages.

Science.gov (United States)

Taherzadeh, S; Sharma, S; Chhajlani, V; Gantz, I; Rajora, N; Demitri, M T; Kelly, L; Zhao, H; Ichiyama, T; Catania, A; Lipton, J M

1999-05-01

The hypothesis that macrophages contain an autocrine circuit based on melanocortin [ACTH and alpha-melanocyte-stimulating hormone (alpha-MSH)] peptides has major implications for neuroimmunomodulation research and inflammation therapy. To test this hypothesis, cells of the THP-1 human monocyte/macrophage line were stimulated with lipopolysaccharide (LPS) in the presence and absence of alpha-MSH. The inflammatory cytokine tumor necrosis factor (TNF)-alpha was inhibited in relation to alpha-MSH concentration. Similar inhibitory effects on TNF-alpha were observed with ACTH peptides that contain the alpha-MSH amino acid sequence and act on melanocortin receptors. Nuclease protection assays indicated that expression of the human melanocortin-1 receptor subtype (hMC-1R) occurs in THP-1 cells; Southern blots of RT-PCR product revealed that additional subtypes, hMC-3R and hMC-5R, also occur. Incubation of resting macrophages with antibody to hMC-1R increased TNF-alpha concentration; the antibody also markedly reduced the inhibitory influence of alpha-MSH on TNF-alpha in macrophages treated with LPS. These results in cells known to produce alpha-MSH at rest and to increase secretion of the peptide when challenged are consistent with an endogenous regulatory circuit based on melanocortin peptides and their receptors. Targeting of this neuroimmunomodulatory circuit in inflammatory diseases in which myelomonocytic cells are prominent should be beneficial.

Dietary β-glucan stimulate complement and C-reactive protein acute phase responses in common carp (Cyprinus carpio) during an Aeromonas salmonicida infection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave

2013-03-01

The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All

β-Glucan induces reactive oxygen species production in human neutrophils to improve the killing of Candida albicans and Candida glabrata isolates from vulvovaginal candidiasis.

Directory of Open Access Journals (Sweden)

Patricia de Souza Bonfim-Mendonça

Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.

Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

Directory of Open Access Journals (Sweden)

Vidyasagar Devaprasad Dedeepiya

2012-01-01

Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

alpha-Glucosidase-albumin conjugates: effect of chronic administration in mice

International Nuclear Information System (INIS)

Allen, T.M.; Murray, L.; Bhardwaj, D.; Poznansky, M.J.

1985-01-01

Enzyme albumin conjugates have been proposed as a means of increasing the efficacy of enzyme use in vivo and decreasing immune response to the enzyme. Particulate drug carriers, however, have a pronounced tendency to localize in the mononuclear phagocyte (reticuloendothelial) system. The authors have examined in mice the effect on phagocytic index, tissue distribution and organ size of continued administration of conjugates of alpha-glucosidase with either homologous or heterologous albumin. Mice received 10 X 2-mg injections of bovine serum albumin (BSA) or mouse serum albumin (MSA), either free, polymerized or conjugated with alpha-glucosidase. Experiments involving BSA had to be terminated before the end of the experiment because of anaphylaxis, but these reactions were less severe to the polymerized albumin than to free albumin. Free BSA, BSA polymer and BSA-enzyme conjugates all caused a decrease in phagocytic index after six injections. Mice receiving MSA showed no evidence of anaphylaxis, but mice receiving six or more injections of free MSA, MSA polymer or MSA-enzyme conjugate had significantly decreased phagocytic indices as compared to controls. Phagocytic indices had returned to normal by 7 days after the final injection. Tissue distribution of 125 I-labeled albumin preparations was determined in either naive or chronically injected mice

Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

Science.gov (United States)

Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

2017-04-08

While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

Serum concentrations of interleukin-1 alpha, interleukin-6 and tumor necrosis factor-alpha in neonatal sepsis and meningitis

International Nuclear Information System (INIS)

Fida, Nadia M.; Fadelallah, Mohamed F.; Al-Mughales, Jamil A.

2006-01-01

To investigate whether serum levels of interleukin-1alpha (IL-1alpha), IL-6, tumor necrosis factor alpha (TNF-alpha), C-reactive protein (CRP) are useful in the diagnosis of neonatal sepsis and meningitis and differentiate them. Blood samples were collected from 35 full term neonates with suspected infection who admitted to the Neonatology Unit, Pediatric Department, King Abdul-Aziz University Hospital, Jeddah, Saudi Arabia during January 2002 - June 2003. On the basis of laboratory and bacteriological results, newborns were classified into: sepsis (n=28), meningitis (n=7), and healthy controls (n=16). Sepsis groups were further subdivided according to culture results into: group 1 = proven sepsis (n=6), group 2 = clinical sepsis (n=14), and group 3 = possible-infected (n=8). Serum levels of IL-1alpha, IL-6, TNF-alpha were measured using Enzyme-Linked Immunosorbent Assay while CRP by nephelometer: In sepsis and meningitis patients, serum levels of CRP (p<0.01, p<0.05,) and IL-1alpha (p<0.001, p<0.05) were elevated than controls. C-reactive protein levels elevated in proven sepsis (p<0.001) and IL-1alpha elevated in all subgroups of sepsis (groups 1, 2, 3) compared with (p<0.05, p<0.001, p<0.01) controls. Interleukin-6, TNF-alpha showed no significant differences between studied groups. In sepsis and meningitis, IL-1alpha had a highest sensitivity (89%, 86%), and negative predictive values (89% and 93%). Interleukin-1alpha and CRP increased in neonatal sepsis and meningitis, but cannot differentiate between them. Interleukin-1alpha had a highest sensitivity in prediction of neonatal infection and its assessment may improve accuracy of diagnosis. (author)

Synthesis of cell wall xylans and glucans by golgi membranes

International Nuclear Information System (INIS)

Gibeaut, D.M.; Carpita, N.C.

1989-01-01

We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus

Purification and characterization of an N alpha-acetyltransferase from Saccharomyces cerevisiae.

Science.gov (United States)

Lee, F J; Lin, L W; Smith, J A

1988-10-15

N alpha-Acetyltransferase, which catalyzes the transfer of an acetyl group from acetyl coenzyme A to the alpha-NH2 group of proteins and peptides, was isolated from Saccharomyces cerevisiae and demonstrated by protein sequence analysis to be NH2-terminally blocked. The enzyme was purified 4,600-fold to apparent homogeneity by successive purification steps using DEAE-Sepharose, hydroxylapatite, DE52 cellulose, and Affi-Gel blue. The Mr of the native enzyme was estimated to be 180,000 +/- 10,000 by gel filtration chromatography, and the Mr of each subunit was estimated to be 95,000 +/- 2,000 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The enzyme has a pH optimum near 9.0, and its pI is 4.3 as determined by chromatofocusing on Mono-P. The enzyme catalyzed the transfer of an acetyl group to various synthetic peptides, including human adrenocorticotropic hormone (ACTH) (1-24) and its [Phe2] analogue, yeast alcohol dehydrogenase I (1-24), yeast alcohol dehydrogenase II (1-24), and human superoxide dismutase (1-24). These peptides contain either Ser or Ala as NH2-terminal residues which together with Met are the most commonly acetylated NH2-terminal residues (Persson, B., Flinta, C., von Heijne, G., and Jornvall, H. (1985) Eur. J. Biochem. 152, 523-527). Yeast enolase, containing a free NH2-terminal Ala residue, is known not to be N alpha-acetylated in vivo (Chin, C. C. Q., Brewer, J. M., and Wold, F. (1981) J. Biol. Chem. 256, 1377-1384), and enolase (1-24), a synthetic peptide mimicking the protein's NH2 terminus, was not acetylated in vitro by yeast acetyltransferase. The enzyme did not catalyze the N alpha-acetylation of other synthetic peptides including ACTH(11-24), ACTH(7-38), ACTH(18-39), human beta-endorphin, yeast superoxide dismutase (1-24). Each of these peptides has an NH2-terminal residue which is rarely acetylated in proteins (Lys, Phe, Arg, Tyr, Val, respectively). Among a series of divalent cations, Cu2+ and Zn2+ were demonstrated to be

Diagnostic value of alpha-fetoprotein in liver cancer

International Nuclear Information System (INIS)

Pervez, T.; Anwar, S.M.

2001-01-01

Objective: To determine diagnostic value of alpha-fetoproteins (alpha-FP) in liver cancer. Design: Prospective study. Place and duration of study: Department of clinical oncology services Hospital Lahore, during the period from February 1998 to February 2001. Subjects and Methods: Among 200 persons studied, 100 presented with liver mass, jaundice and other symptoms directing toward liver pathology, later confirmed histopathologically, as suffering from hepatocellular carcinoma (HCC) while the other 100 healthy subject came to the department for blood donation and were HBs Ag pasitive on blood screening. All these subjects under went blood test for alpha-FP. This tumor marker was analyzed by using enzyme immunoassay-based kit. Results: The alpha-FP positivity was statistically evaluated. In HCC this test was statistically significant with p value of <0.001. In this study sensitivity of alpha-FP was 72% specificity 89%, positive predictive value 86.7% and negative predictive value of 76.1%. Conclusion: This study showed that alpha-FP was a useful diagnostic tool in the diagnosis of HCC. (author)

β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

Directory of Open Access Journals (Sweden)

Sonja de Vries

Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

Hydrolysis of maize starch using amylolytic enzymes extracted from ...

African Journals Online (AJOL)

Amylases, a-amylase (EC 3.2.1.1, α-1, 4-glucan-4-glucanohydrolase) and glucoamylase (EC 3.2.1.3, α-1, 4; α-1, 6-glucan glucohydrolase; amyloglucosidase), extracted and partially purified from sorghum malt were used to hydrolyze maize starch. The process and products of the enzymatic hydrolysis were also compared ...

Supplementation with xylanase and β-xylosidase to reduce xylo-oligomer and xylan inhibition of enzymatic hydrolysis of cellulose and pretreated corn stover

Science.gov (United States)

2011-01-01

Background Hemicellulose is often credited with being one of the important physical barriers to enzymatic hydrolysis of cellulose, and acts by blocking enzyme access to the cellulose surface. In addition, our recent research has suggested that hemicelluloses, particularly in the form of xylan and its oligomers, can more strongly inhibit cellulase activity than do glucose and cellobiose. Removal of hemicelluloses or elimination of their negative effects can therefore become especially pivotal to achieving higher cellulose conversion with lower enzyme doses. Results In this study, cellulase was supplemented with xylanase and β-xylosidase to boost conversion of both cellulose and hemicellulose in pretreated biomass through conversion of xylan and xylo-oligomers to the less inhibitory xylose. Although addition of xylanase and β-xylosidase did not necessarily enhance Avicel hydrolysis, glucan conversions increased by 27% and 8% for corn stover pretreated with ammonia fiber expansion (AFEX) and dilute acid, respectively. In addition, adding hemicellulase several hours before adding cellulase was more beneficial than later addition, possibly as a result of a higher adsorption affinity of cellulase and xylanase to xylan than glucan. Conclusions This key finding elucidates a possible mechanism for cellulase inhibition by xylan and xylo-oligomers and emphasizes the need to optimize the enzyme formulation for each pretreated substrate. More research is needed to identify advanced enzyme systems designed to hydrolyze different substrates with maximum overall enzyme efficacy. PMID:21702938

Las β-(1®3-glucanas: moléculas inmunomoduladoras contaminantes de productos farmacéuticos β-(1®3-glucans as immunomodulating moléculas polluting pharmaceuticals

Directory of Open Access Journals (Sweden)

Zenia Pardo Ruiz

2012-03-01

Full Text Available Se realizó una búsqueda bibliográfica utilizando la base de datos Pubmed con énfasis en los artículos publicados en la última década. Como descriptores se utilizaron los siguientes: glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. Con la información disponible se realizó un análisis de los principales aspectos relacionados con el tema, que se exponen en el presente trabajo. Las b-(1®3-glucanas son polímeros de glucosa que se encuentran mayoritariamente en la pared celular de hongos, levaduras y plantas. Se consideran patrones moleculares asociados a patógenos y son reconocidas por varios receptores, siendo la dectina-1 el principal receptor de reconocimiento de estas estructuras. Sus propiedades inmunomoduladoras han sido informadas por varios autores. Se ha demostrado que potencian y sinergizan la acción de ligandos de Toll like receptors sobre la liberación de citoquinas proinflamatorias, aunque también han mostrado un perfil antiinflamatorio, cuestión que depende en gran medida de sus características estructurales. Las b-(1®3-glucanas son contaminantes importantes provenientes de los filtros de acetato de celulosa que se utilizan en la clarificación de parenterales hemoderivados, por tanto, es necesario estudiar las consecuencias de la presencia de estas moléculas inmunomoduladoras en inyectables. En esta revisión se resumen aspectos relacionados con el reconocimiento y actividad biológica de las b-(1®3-glucanas y se profundiza en estudios relacionados con su presencia en hemoderivados como principal contaminante. Finalmente se destaca la utilidad de la Prueba de Activación de Monocitos en la detección de las b-(1®3-glucanas en parenterales.A literature review was made in Pubmed database, making emphasis on papers published in the last decade. The subject headings for this search were glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. On the basis

Structural characterization of bioengineered α-D-glucans produced by mutant glucansucrase GTF180 enzymes of lactobacillus reuteri strain 180

NARCIS (Netherlands)

Leeuwen, S.S. van; Kralj, S.; Eeuwema, W.; Gerwig, G.J.; Dijkhuizen, L.; Kamerling, J.P.

2009-01-01

Mutagenesis of specific amino acid residues of the glucansucrase (GTF180) enzyme from Lactobacillus reuteri strain 180 yielded 12 mutant enzymes that produced modified exopolysaccharides (mEPSs) from sucrose. Ethanol-precipitated and purified mEPSs were subjected to linkage analysis, Smith

IL-17A acts via p38 MAPK to increase stability of TNF-alpha-induced IL-8 mRNA in human ASM.

Science.gov (United States)

Henness, Sheridan; van Thoor, Eveline; Ge, Qi; Armour, Carol L; Hughes, J Margaret; Ammit, Alaina J

2006-06-01

Human airway smooth muscle (ASM) plays an immunomodulatory role in asthma. Recently, IL-17A has become of increasing interest in asthma, being found at elevated levels in asthmatic airways and emerging as playing an important role in airway neutrophilia. IL-17A predominantly exerts its neutrophil orchestrating role indirectly via the induction of cytokines by resident airway structural cells. Here, we perform an in vitro study to show that although IL-17A did not induce secretion of the CXC chemokine IL-8 from ASM cells, IL-17A significantly potentiates TNF-alpha-induced IL-8 protein secretion and gene expression in a concentration- and time-dependent manner (P ASM cells, acting via a p38 MAPK-dependent posttranscriptional pathway to augment TNF-alpha-induced secretion of the potent neutrophil chemoattractant IL-8 from ASM cells.

Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

Directory of Open Access Journals (Sweden)

Andreas F. Haag

2010-01-01

Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

The Effects of Curcumin on Alpha Amylase in Diabetics Rats

Directory of Open Access Journals (Sweden)

Mahmood Najafian

2015-12-01

Full Text Available Background One of the therapeutic approaches to lower postprandial blood glucose is to inhibition breakdown of starch by inhibiting carbohydrate hydrolysis enzymes. Alpha-amylase catalyzes the hydrolysis of α-(1, 4-D-glycosidic linkages of starch and other glucose polymers. Inhibitors of this enzyme could be used in the treatment of diabetes. Objectives Based on this purpose we examined the effect of curcumin on alpha amylase and its IC50 and Ki. Materials and Methods In this experimental study, 60 rats were divided into two major groups, normal and diabetic, and each was subsequently divided into five subgroups. One of them as control group that received grape seed oil and four of them as experimental groups that received curcumin at 10, 20, 40 and 80 mg/kg (each group include six rats. Blood glucose levels were measured every three days. Serum insulin levels were measured three times, in the first day, middle and end of the experimental period. The activity of serum alpha amylase was measured in the end of experimental period. Results The results showed that curcumin is a competitive inhibitor for alpha amylase with IC50 = 51.32 µM and Ki = 20.17 µM. In both diabetic and normal groups in all doses nearly dose dependent manner reduced blood glucose and insulin levels. In both diabetic and normal groups decreased levels of serum alpha amylase activity. Conclusions It may be concluded that curcumin is a potent inhibitor of alpha amylase and has beneficial effects in the treatment of overweight and diabetes

Beta-D-xylosidase from Selenomonas ruminantium: thermodynamics of enzyme-catalyzed and noncatalyzed reactions

Science.gov (United States)

Beta-D-xylosidase/alpha-L-arabinofuranosidase from Selenomonas ruminantium (SXA) is the most active enzyme known for catalyzing hydrolysis of 1,4-beta-D-xylooligosaccharides to D-xylose. Temperature dependence for hydrolysis of 4-nitrophenyl-beta-D-xylopyranoside (4NPX), 4-nitrophenyl-alpha-L-arabi...

Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

Enzyme-lipid complex. Koso-shishitsu fukugotai

Energy Technology Data Exchange (ETDEWEB)

Okahata, Y; Ijiro, K [Tokyo Inst. of Technology., Tokyo (Japan)

1990-08-01

Enzyme, as unstable against organic solvent, being to be designed not to be quenched, organic solvent was tried to be made soluble by making enzyme-lipid complex. By mixing aqueous solution of enzyme with aqueous dispersion liquid of lipid, white powder was obtaind. Enzyme has monomolecular film through which reaction substance passes. Lipase-lipid complex, of which monomolecular film is qualified by hydrogen and other soft linkages, homogeneously dissolves in organic solvent and has a high activity, not given by the conventional qualification method. That activity being applied, asymmetrical esterificating reaction of alcohol could be done in organic solvent, containing high concentration reactive substance. While substance selectivity, not known in water, was obtained. Through reaction of amine with amino acid dielectrics in isooctane solvent by {alpha}-chymotrypsin-lipid complex, was indicated an exact substance selectivity. Enzyme-lipid complex dissolving in organic solvent, monomolecular film can be formed without being quenched on aqueous surface, which film can be utilized as sensor film. 10 refs., 5 figs. 1 tab.

Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.

OpenAIRE

Brisman, J; Belin, L

1991-01-01

alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase p...

(1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

Science.gov (United States)

Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

2011-08-15

Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

Science.gov (United States)

Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

2014-10-22

Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

Inhibition of steroid 5 alpha-reductase by specific aliphatic unsaturated fatty acids.

Science.gov (United States)

Liang, T; Liao, S

1992-01-01

Human or rat microsomal 5 alpha-reductase activity, as measured by enzymic conversion of testosterone into 5 alpha-dihydrotestosterone or by binding of a competitive inhibitor, [3H]17 beta-NN-diethulcarbamoyl-4-methyl-4-aza-5 alpha-androstan-3-one ([3H]4-MA) to the reductase, is inhibited by low concentrations (less than 10 microM) of certain polyunsaturated fatty acids. The relative inhibitory potencies of unsaturated fatty acids are, in decreasing order: gamma-linolenic acid greater than cis-4,7,10,13,16,19-docosahexaenoic acid = cis-6,9,12,15-octatetraenoic acid = arachidonic acid = alpha-linolenic acid greater than linoleic acid greater than palmitoleic acid greater than oleic acid greater than myristoleic acid. Other unsaturated fatty acids such as undecylenic acid, erucic acid and nervonic acid, are inactive. The methyl esters and alcohol analogues of these compounds, glycerols, phospholipids, saturated fatty acids, retinoids and carotenes were inactive even at 0.2 mM. The results of the binding assay and the enzymic assay correlated well except for elaidic acid and linolelaidic acid, the trans isomers of oleic acid and linoleic acid respectively, which were much less active than their cis isomers in the binding assay but were as potent in the enzymic assay. gamma-Linolenic acid had no effect on the activities of two other rat liver microsomal enzymes: NADH:menadione reductase and glucuronosyl transferase. gamma-Linolenic acid, the most potent inhibitor tested, decreased the Vmax. and increased Km values of substrates, NADPH and testosterone, and promoted dissociation of [3H]4-MA from the microsomal reductase. gamma-Linolenic acid, but not the corresponding saturated fatty acid (stearic acid), inhibited the 5 alpha-reductase activity, but not the 17 beta-dehydrogenase activity, of human prostate cancer cells in culture. These results suggest that unsaturated fatty acids may play an important role in regulating androgen action in target cells. PMID:1637346

Thyroid hormone coordinately regulates Na sup + -K sup + -ATPase. alpha. - and. beta. -subunit mRNA levels in kidney

Energy Technology Data Exchange (ETDEWEB)

McDonough, A.A.; Brown, T.A.; Horowitz, B.; Chiu, R.; Schlotterbeck, J.; Bowen, J.; Schmitt, C.A. (Univ. of Southern California School of Medicine, Los Angeles (USA))

1988-02-01

Synthesis of the sodium pump, Na{sup +}-K{sup +}-ATPase, is regulated by thyroid hormone in responsive tissues. The purpose of this study was to determine if triiodothyronine (T{sub 3}) regulates the concentration of the mRNAs coding for the two enzyme subunits, {alpha} and {beta}, and the time course of the response. A single dose of T{sub 3} was administered to hypothyroid rats that were killed at various times after injection. In the kidney cortexes of the T{sub 3}-injected animals, as well as hypothyroid and euthyroid rats, {alpha}- and {beta}-mRNA concentrations were measured by dot blot using cDNAs corresponding to the two mRNAs; {alpha}-subunit abundance was measured by Western blot using antibodies to the enzyme, and Na{sup +}-K{sup +}-ATPase activity was measured enzymatically. {alpha}- and {beta}-mRNAs increased coordinately to 1.6-fold over hypothyroid levels by 12 h after T{sub 3}. The authors conclude that T{sub 3} regulates Na{sup +}-K{sup +}-ATPase synthesis and activity by coordinately increasing the mRNAs of both the {alpha}- and {beta}-subunits of the enzyme.

Action of amylolytic and pullulytic enzymes from various anaerobic thermophiles on linear and branched glucose polymers

Energy Technology Data Exchange (ETDEWEB)

Koch, R [Goettingen Univ. (Germany, F.R.). Inst. fuer Mikrobiologie; Antranikian, G [Technische Univ. Hamburg-Harburg, Hamburg (Germany, F.R.). Arbeitsbereich Biotechnologie 1

1990-10-01

A detailed study has been conducted on the action of starch hydrolyzing enzymes from thermophilic anaerobic bacteria belonging to the genera Clostridium, Thermoanaerobacter and Thermobacteroides. The appearance of multiple bands on polyacrylamide gels with amylolytic as well as pullulytic activities was shown to be a general feature of bacteria investigated. Analysis of the hydrolysis products of each protein band clearly demonstrated the capability of these organisms to hydrolyze {alpha}-1,4-glycosidic bonds in linear oligosaccharides and {alpha}-1,6-glycosidic linkages in pullulan. Furthermore, the enzyme system of thermophilic bacteria investigated was also capable of attacking in the {alpha}-1,6-linkages in branched oligosaccharides. Due to the action of these thermoactive enzymes with multiple specificity an almost complete hydrolysis of raw starch and maltodextrin could be achieved under the same conditions and in one step. (orig.).

Mechanism of the lysosomal membrane enzyme acetyl coenzyme A: alpha-glucosaminide N-acetyltransferase

International Nuclear Information System (INIS)

Bame, K.J.

1986-01-01

Acetyl-CoA:α-glucosaminide N-acetyltransferase is a lysosomal membrane enzyme, deficient in the genetic disease Sanfilippo C syndrome. The enzyme catalyzes the transfer of an acetyl group from cytoplasmic acetyl-CoA to terminal α-glucosamine residues of heparan sulfate within the organelle. The reaction mechanism was examined using high purified lysosomal membranes from rat liver and human fibroblasts. The N-acetyltransferase reaction is optimal above pH 5.5 and a 2-3 fold stimulation of activity is observed in the presence of 0.1% taurodeoxycholate. Double reciprocal analysis and product inhibition studies indicate that the enzyme works by a Di-Iso Ping Pong Bi Bi mechanism. The binding of acetyl-CoA to the enzyme is measured by exchange label from [ 3 H]CoA to acetyl-CoA, and is optimal at pH's above 7.0. The acetyl-enzyme intermediate is formed by incubating membranes with [ 3 H]acetyl-CoA. The acetyl group can be transferred to glucosamine, forming [ 3 H]N-acetylglucosamine; the transfer is optimal between pH 4 and 5. Lysosomal membranes from Sanfilippo C fibroblasts confirm that these half reactions carried out by the N-acetyltransferase. The enzyme is inactivated by N-bromosuccinimide and diethylpyrocarbonate, indicating that a histidine is involved in the reaction. These results suggest that the histidine residue is at the active site of the enzyme. The properties of the N-acetyltransferase in the membrane, the characterization of the enzyme kinetics, the chemistry of a histidine mediated acetylation and the pH difference across the lysosomal membrane all support a transmembrane acetylation mechanism

Optimization of Thermostable Alpha-Amylase Production Via Mix Agricultural-Residues and Bacillus amyloliquefaciens

Directory of Open Access Journals (Sweden)

Shalini RAI

2014-03-01

Full Text Available This study reports utilization of mixture of wheat and barley bran (1:1 for the production of thermostable alpha-amylase enzyme through a spore former, heat tolerant strain of Bacillus amyloliquefaciens in solid state fermentation. Maximum yield of alpha-amylase (252.77 U mL-1 was obtained in following optimized conditions, inoculums size 2 mL (2 × 106 CFU/mL, moisture 80%, pH 7±0.02, NaCl (3%, temperature 38±1°C, incubation for 72 h, maltose (1% and tryptone (1%. After SSF crude enzyme was purified via ammonium sulfate precipitation, ion exchange and column chromatography by DEAE Cellulose. Purified protein showed a molecular weight of 42 kDa by SDS-PAGE electrophoresis. After purification, purified enzyme was characterized against several enzymes inhibitors such as temperature, NaCl, pH, metal and surfactants. Pure enzyme was highly active over broad temperature (50-70°C, NaCl concentration (0.5-4 M, and pH (6-10 ranges, indicating it’s a thermoactive and alkali-stable nature. Moreover, CaCl2, MnCl2, =-mercaptoethanol were found to stimulate the amylase activity, whereas FeCl3, sodium dodecyl sulfate (SDS, CuCl3 and ethylenediaminetetraacetic acid (EDTA strongly inhibited the enzyme. Moreover, enzyme specificity and thermal stability conformed by degradation of different soluble starch up to 55°C. Therefore, the present study proved that the extracellular alpha-amylase extracted through wheat flour residues by organism B. amyloliquefaciens MCCB0075, both have considerable potential for industrial application owing to its properties.

The C-terminal N-glycosylation sites of the human alpha1,3/4-fucosyltransferase III, -V, and -VI (hFucTIII, -V, adn -VI) are necessary for the expression of full enzyme activity.

Science.gov (United States)

Christensen, L L; Jensen, U B; Bross, P; Orntoft, T F

2000-09-01

The alpha1,3/4-fucosyltransferases are involved in the synthesis of fucosylated cell surface glycoconjugates. Human alpha1,3/4-fucosyltransferase III, -V, and -VI (hFucTIII, -V, and -VI) contain two conserved C-terminal N-glycosylation sites (hFucTIII: Asn154 and Asn185; hFucTV: Asn167 and Asn198; and hFucTVI: Asn153 and Asn184). In the present study, we have analyzed the functional role of these potential N-glycosylation sites, laying the main emphasis on the sites in hFucTIII. Tunicamycin treatment completely abolished hFucTIII enzyme activity while castanospermine treatment diminished hFucTIII enzyme activity to approximately 40% of the activity of the native enzyme. To further analyze the role of the conserved N-glycosylation sites in hFucTIII, -V, and -VI, we made a series of mutant genomic DNAs in which the asparagine residues in the potential C-terminal N-glycosylation sites were replaced by glutamine. Subsequently, the hFucTIII, -V, and -VI wild type and the mutants were expressed in COS-7 cells. All the mutants exhibited lower enzyme activity than the wild type and elimination of individual sites had different effects on the activity. The mutations did not affect the protein level of the mutants in the cells, but reduced the molecular mass as predicted. Kinetic analysis of hFucTIII revealed that lack of glycosylation at Asn185 did not change the Km values for the oligosaccharide acceptor and the nucleotide sugar donor. The present study demonstrates that hFucTIII, -V, and -VI require N-glycosylation at the two conserved C-terminal N-glycosylation sites for expression of full enzyme activity.

Synergisms in Alpha-glucosidase Inhibition and Antioxidant Activity of Camellia sinensis L. Kuntze and Eugenia uniflora L. Ethanolic Extracts

Science.gov (United States)

Vinholes, Juliana; Vizzotto, Márcia

2017-01-01

Background: Camellia sinensis, the most consumed and popular beverages worldwide, and Eugenia uniflora, a Brazilian native species, have been already confirmed to have beneficial effects in the treatment of diabetes mellitus. However, their potential acting together against an enzyme linked to this pathology has never been exploited. Objective: The aim of this study was to evaluate the inhibitory properties of individual and combined ethanolic extracts of the leaves of C. sinensis and E. uniflora over alpha-glucosidase, a key digestive enzyme used on the Type 2 diabetes mellitus (T2DM) control. In addition, their inhibitory activity against 2,2-diphenyl-1-picrylhydrazyl radical (DPPH•) and peroxyl radicals was also assayed. Materials and Methods: Enzyme inhibition and antioxidant potential were assessed based on in vitro assays. Total phenolic compounds, carotenoids, and chlorophylls A and B were achieved using spectrophotometric methods. Results: E. uniflora was almost 40 times more active on alpha-glucosidase than C. sinensis and combined extracts showed a significant synergistic effect with an obtained IC50 value almost 5 times lower than the theoretical value. C. sinensis extract was twice more active than E. uniflora concerning DPPH•, in contrast, E. uniflora was almost 10 times more effective than C. sinensis on inhibition of peroxyl radicals with a significant synergistic effect for combined extracts. The extracts activities may be related with their phytochemicals, mainly phenolic compounds, and chlorophylls. Conclusion: Combined C. sinensis and E. uniflora ethanolic extracts showed synergistic effect against alpha-glucosidase and lipid peroxidation. These herbal combinations can be used to control postprandial hyperglycemia and can also provide antioxidant defenses to patients with T2DM. SUMMARY Alfa-glucosidase and antioxidant Interaction between Camellia sinensis L. Kuntze and Eugenia uniflora L. ethanolic extracts was investigated.Extracts showed

Synergisms in Alpha-glucosidase Inhibition and Antioxidant Activity of Camellia sinensis L. Kuntze and Eugenia uniflora L. Ethanolic Extracts.

Science.gov (United States)

Vinholes, Juliana; Vizzotto, Márcia

2017-01-01

Camellia sinensis , the most consumed and popular beverages worldwide, and Eugenia uniflora , a Brazilian native species, have been already confirmed to have beneficial effects in the treatment of diabetes mellitus. However, their potential acting together against an enzyme linked to this pathology has never been exploited. The aim of this study was to evaluate the inhibitory properties of individual and combined ethanolic extracts of the leaves of C. sinensis and E. uniflora over alpha-glucosidase, a key digestive enzyme used on the Type 2 diabetes mellitus (T2DM) control. In addition, their inhibitory activity against 2,2-diphenyl-1-picrylhydrazyl radical (DPPH • ) and peroxyl radicals was also assayed. Enzyme inhibition and antioxidant potential were assessed based on in vitro assays. Total phenolic compounds, carotenoids, and chlorophylls A and B were achieved using spectrophotometric methods. E. uniflora was almost 40 times more active on alpha-glucosidase than C. sinensis and combined extracts showed a significant synergistic effect with an obtained IC 50 value almost 5 times lower than the theoretical value. C. sinensis extract was twice more active than E. uniflora concerning DPPH • , in contrast, E. uniflora was almost 10 times more effective than C. sinensis on inhibition of peroxyl radicals with a significant synergistic effect for combined extracts. The extracts activities may be related with their phytochemicals, mainly phenolic compounds, and chlorophylls. Combined C. sinensis and E. uniflora ethanolic extracts showed synergistic effect against alpha-glucosidase and lipid peroxidation. These herbal combinations can be used to control postprandial hyperglycemia and can also provide antioxidant defenses to patients with T2DM. Alfa-glucosidase and antioxidant Interaction between Camellia sinensis L. Kuntze and Eugenia uniflora L. ethanolic extracts was investigated.Extracts showed synergistic effect over alpha-glucosidase and peroxyl radicals

An enzyme to improve the ethanol production; Une enzyme pour ameliorer la production d'ethanol

Energy Technology Data Exchange (ETDEWEB)

Anon.

2005-07-01

The American firm Genecor launches a technology which allows to improve the production of ethanol from agricultural resources. This technology involves in particular a decrease of the energy consumption and of the production costs and a best yield. In the process, is used a mixture of enzymes composed of alpha-amylase and gluco-amylase. (O.M.)

Lactobacillus reuteri Strains Convert Starch and Maltodextrins into Homoexopolysaccharides Using an Extracellular and Cell-Associated 4,6-α-Glucanotransferase.

Science.gov (United States)

Bai, Yuxiang; Böger, Markus; van der Kaaij, Rachel Maria; Woortman, Albert Jan Jacob; Pijning, Tjaard; van Leeuwen, Sander Sebastiaan; van Bueren, Alicia Lammerts; Dijkhuizen, Lubbert

2016-04-13

Exopolysaccharides (EPS) of lactic acid bacteria (LAB) are of interest for food applications. LAB are well-known to produce α-glucan from sucrose by extracellular glucansucrases. Various Lactobacillus reuteri strains also possess 4,6-α-glucanotransferase (4,6-α-GTase) enzymes. Purified 4,6-α-GTases (e.g., GtfB) were shown to act on starches (hydrolysates), cleaving α1→4 linkages and synthesizing α1→6 linkages, yielding isomalto-/maltopolysaccharides (IMMP). Here we report that also L. reuteri cells with these extracellular, cell-associated 4,6-α-GTases synthesize EPS (α-glucan) from starches (hydrolysates). NMR, SEC, and enzymatic hydrolysis of EPS synthesized by L. reuteri 121 cells showed that these have similar linkage specificities but generally are much bigger in size than IMMP produced by the GtfB enzyme. Various IMMP-like EPS are efficiently used as growth substrates by probiotic Bifidobacterium strains that possess amylopullulanase activity. IMMP-like EPS thus have potential prebiotic activity and may contribute to the application of probiotic L. reuteri strains grown on maltodextrins or starches as synbiotics.

Importance of amylases for physiological quality in maize seeds

Directory of Open Access Journals (Sweden)

Camila Aparecida Lopes

2017-09-01

Full Text Available Seed quality is the result of the sum of genetic, physical, physiological and sanitary attributes that affect seed ability to perform vital functions related to germination, vigor, and longevity. The expression of genes associated with physiological quality can be assessed by means of germination and vigor analyses, as well as by transcript and protein analyses. The objective in this work was to review the relevance of amylase group enzymes to the physiological quality of maize seeds. Within this group, α-amylase (1,4-α-D-glucan glucanohydrolase E.C 3.2.1.1 plays an important role in starch hydrolysis, and is responsible for 90% of the amylolytic activity in maize seeds. It is responsible for starch conversion into sugars (e.g., destrin, which is used for embryo growth. β-amylase (1,4-α-D-glucan maltohydrolase E.C 3.2.1.2 catalyzes the release of maltose and dextrins from the non-reducing ends of starch. Research has shown that amylase enzymes are directly linked to physiological quality of maize seeds. Alpha- and beta-amylases are mainly involved in the germination process and seed heterosis, and can also be used as molecular markers associated with seed tolerance for drying.

Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

Science.gov (United States)

Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

2012-04-13

Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

[POLYMORPHISM OF ALFA-AMYLASE AND CONJUGATION IN COMMON WHEAT ENZYME TYPES WITH QUANTITATIVE TRAITS OF PLANTS].

Science.gov (United States)

Netsvetaev, V P; Bondarenko, L S; Motorina, I P

2015-01-01

Using polymorphism of alpha-amylase in the winter common wheat studied inheritance isoenzymes and its conjugation enzyme types with germinating grain on the "vine", grain productivity, plant height and time of ear formation. It is shown that the polymorphism isoenzyme of alpha-amylase wheat is limited by the presence of different loci whose products are similar in electrophoretic parameters. In this regard, one component of the enzyme can be controlling at one or two or three genes. Identification of a locus controlling alpha-amylase isoenzyme in the fast moving part of the electrophoretogram, designated as α-Amy-B7. Determine the distance of the locus to factor α-Amy-B6.

Direct ethanol production from cassava pulp using a surface-engineered yeast strain co-displaying two amylases, two cellulases, and {beta}-glucosidase

Energy Technology Data Exchange (ETDEWEB)

Apiwatanapiwat, Waraporn; Rugthaworn, Prapassorn [Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Ibaraki (Japan). Post-Harvest Science and Technology Div.; Kasetsart Univ., Bangkok (Thailand). Nanotechnology and Biotechnology Div.; Murata, Yoshinori; Kosugi, Akihiko; Arai, Takamitsu; Mori, Yutaka [Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Ibaraki (Japan). Post-Harvest Science and Technology Div.; Yamada, Ryosuke; Kondo, Akihiko [Kobe Univ. (Japan). Dept. of Chemical Science and Engineering

2011-04-15

In order to develop a method for producing fuel ethanol from cassava pulp using cell surface engineering (arming) technology, an arming yeast co-displaying {alpha}-amylase ({alpha}-AM), glucoamylase, endoglucanase, cellobiohydrase, and {beta}-glucosidase on the surface of the yeast cells was constructed. The novel yeast strain, possessing the activities of all enzymes, was able to produce ethanol directly from soluble starch, barley {beta}-glucan, and acid-treated Avicel. Cassava is a major crop in Southeast Asia and used mainly for starch production. In the starch manufacturing process, large amounts of solid wastes, called cassava pulp, are produced. The major components of cassava pulp are starch (approximately 60%) and cellulose fiber (approximately 30%). We attempted simultaneous saccharification and ethanol fermentation of cassava pulp with this arming yeast. During fermentation, ethanol concentration increased as the starch and cellulose fiber substrates contained in the cassava pulp decreased. The results clearly showed that the arming yeast was able to produce ethanol directly from cassava pulp without addition of any hydrolytic enzymes. (orig.)

Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. Copurification of HPr and α1-6 Glucan

NARCIS (Netherlands)

Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

1979-01-01

A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of

Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2014-01-01

Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.

Two novel, putatively cell wall-associated and glycosylphosphatidylinositol-anchored alpha-glucanotransferase enzymes of aspergillus niger

NARCIS (Netherlands)

Kaaij, van der Rachel; Yuan, X.-L.; Franken, A.; Ram, A. F. J.; Punt, P. J.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

In the genome sequence of Aspergillus niger CBS 513.88, three genes were identified with high similarity to fungal alpha-amylases. The protein sequences derived from these genes were different in two ways from all described fungal alpha-amylases: they were predicted to be

Bonds broken and formed during the mixed-linkage glucan : xyloglucan endotransglucosylase reaction catalysed by Equisetum hetero-trans-β-glucanase.

Science.gov (United States)

Simmons, Thomas J; Fry, Stephen C

2017-03-08

Mixed-linkage glucan∶xyloglucan endotransglucosylase (MXE) is one of the three activities of the recently characterised hetero-trans-β-glucanase (HTG), which among land plants is known only from Equisetum species. The biochemical details of the MXE reaction were incompletely understood - details that would promote understanding of MXE's role in vivo and enable its full technological exploitation. We investigated HTG's site of attack on one of its donor substrates, mixed-linkage (1→3),(1→4)-β-d-glucan (MLG), with radioactive oligosaccharides of xyloglucan as the acceptor substrate. Comparing three different MLG preparations, we showed that the enzyme favours those with a high content of cellotetraose blocks. The reaction products were analysed by enzymic digestion, thin-layer chromatography (TLC), high-pressure liquid chromatography (HPLC) and gel-permeation chromatography (GPC). Equisetum HTG consistently cleaved the MLG at the third consecutive β-(1→4)-bond following (towards the reducing terminus) a β-(1→3)-bond. It then formed a β-(1→4)-bond between the MLG and the non-reducing terminal glucose residue of the xyloglucan oligosaccharide, consistent with its xyloglucan endotransglucosylase/hydrolase subfamily membership. Using size-homogeneous barley MLG as the donor substrate, we showed that HTG does not favour any particular region of the MLG chain relative to the polysaccharide's reducing and non-reducing termini; rather, it selects its target cellotetraosyl unit stochastically along the MLG molecule. This work improves our understanding of how enzymes can exhibit promiscuous substrate specificities and provides the foundations to explore strategies for engineering novel substrate specificities into transglycanases. © 2017 The Author(s).

Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

2017-04-01

Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

Science.gov (United States)

de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

2017-12-20

A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

Directory of Open Access Journals (Sweden)

Asli Akyol

2014-09-01

Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

Science.gov (United States)

Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

2014-09-23

The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

Immobilization of enzymes by radiation

International Nuclear Information System (INIS)

Kaetsu, I.; Kumakura, M.; Yoshida, M.; Asano, M.; Himei, M.; Tamura, M.; Hayashi, K.

1979-01-01

Immobilization of various enzymes was performed by radiation-induced polymerization of glass-forming monomers at low temperatures. Alpha-amylase and glucoamylase were effectively immobilized in hydrophilic polymer carrier such as poly(2-hydroxyethyl methacrylate) and also in rather hydrophobic carrier such as poly(tetraethylene-glycol diacrylate). Immobilized human hemoglobin underwent the reversible oxygenation concomitantly with change of oxygen concentration outside of the matrices. (author)

NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1989-01-01

The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

Hydrolyses of alpha-naphthyl acetate, beta-naphthyl acetate, and acetyl-DL-phenylalanine beta-naphthyl ester

DEFF Research Database (Denmark)

Kirkeby, S; Moe, D

1983-01-01

Using simultaneous coupling azo dye techniques kidney enzymes active against alpha-naphthyl acetate, beta-naphthyl acetate, and acetyl-DL-phenylalanine beta-naphthyl ester are characterized. The enzymes show identical distribution in the section. The banding patterns in zymograms are the same after...

Production of Active Bacillus licheniformis Alpha-Amylase in Tobacco and its Application in Starch Liquefaction

NARCIS (Netherlands)

Pen, J; MOLENDIJK, L; Quax, Wim J.; SIJMONS, PC; VANOOYEN, AJJ; VANDENELZEN, PJM; RIETVELD, K; HOEKEMA, A

As a first example of the feasibility of producing industrial bulk enzymes in plants, we have expressed Bacillus licheniformis alpha-amylase in transgenic tobacco, and applied the seeds directly in starch liquification. The enzyme was properly secreted into the intercellular space, and maximum

Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

Directory of Open Access Journals (Sweden)

Eduardo Madrigal-Bujaidar

2015-06-01

Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.

Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.

Science.gov (United States)

Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G

2017-08-15

Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.

Science.gov (United States)

Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong

2014-03-19

A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.

Pie waste - A component of food waste and a renewable substrate for producing ethanol.

Science.gov (United States)

Magyar, Margaret; da Costa Sousa, Leonardo; Jayanthi, Singaram; Balan, Venkatesh

2017-04-01

Sugar-rich food waste is a sustainable feedstock that can be converted into ethanol without an expensive thermochemical pretreatment that is commonly used in first and second generation processes. In this manuscript we have outlined the pie waste conversion to ethanol through a two-step process, namely, enzyme hydrolysis using commercial enzyme products mixtures and microbial fermentation using yeast. Optimized enzyme cocktail was found to be 45% alpha amylase, 45% gamma amylase, and 10% pectinase at 2.5mg enzyme protein/g glucan produced a hydrolysate with high glucose concentration. All three solid loadings (20%, 30%, and 40%) produced sugar-rich hydrolysates and ethanol with little to no enzyme or yeast inhibition. Enzymatic hydrolysis and fermentation process mass balance was carried out using pie waste on a 1000g dry weight basis that produced 329g ethanol at 20% solids loading. This process clearly demonstrate how food waste could be efficiently converted to ethanol that could be used for making biodiesel by reacting with waste cooking oil. Copyright © 2017 Elsevier Ltd. All rights reserved.

A conformational switch in the inhibitory gamma-subunit of PDE6 upon enzyme activation by transducin.

Science.gov (United States)

Granovsky, A E; Artemyev, N O

2001-11-06

In response to light, a photoreceptor G protein, transducin, activates cGMP-phosphodiesterase (PDE6) by displacing the inhibitory gamma-subunits (Pgamma) from the enzyme's catalytic sites. Evidence suggests that the activation of PDE6 involves a conformational change of the key inhibitory C-terminal domain of Pgamma. In this study, the C-terminal region of Pgamma, Pgamma-73-85, has been targeted for Ala-scanning mutagenesis to identify the point-to-point interactions between Pgamma and the PDE6 catalytic subunits and to probe the nature of the conformational change. Pgamma mutants were tested for their ability to inhibit PDE6 and a chimeric PDE5-conePDE6 enzyme containing the Pgamma C-terminus-binding site of cone PDE. This analysis has revealed that in addition to previously characterized Ile86 and Ile87, important inhibitory contact residues of Pgamma include Asn74, His75, and Leu78. The patterns of mutant PDE5-conePDE6 enzyme inhibition suggest the interaction between the PgammaAsn74/His75 sequence and Met758 of the cone PDE6alpha' catalytic subunit. This interaction, and the interaction between the PgammaIle86/Ile87 and PDE6alpha'Phe777/Phe781 residues, is most consistent with an alpha-helical structure of the Pgamma C-terminus. The analysis of activation of PDE6 enzymes containing Pgamma mutants with Ala-substituted transducin-contact residues demonstrated the critical role of PgammaLeu76. Accordingly, we hypothesize that the initial step in PDE6 activation involves an interaction of transducin-alpha with PgammaLeu76. This interaction introduces a bend into the alpha-helical structure of the Pgamma C-terminus, allowing transducin-alpha to further twist the C-terminus thereby uncovering the catalytic pocket of PDE6.

Glutathione transferase mimics : Micellar catalysis of an enzymic reaction

NARCIS (Netherlands)

Lindkvist, Björn; Weinander, Rolf; Engman, Lars; Koetse, Marc; Engberts, Jan B.F.N.; Morgenstern, Ralf

1997-01-01

Substances that mimic the enzyme action of glutathione transferases (which serve in detoxification) are described. These micellar catalysts enhance the reaction rate between thiols and activated halogenated nitroarenes as well as alpha,beta-unsaturated carbonyls. The nucleophilic aromatic

Alpha amylase assisted synthesis of TiO2 nanoparticles: Structural characterization and application as antibacterial agents

International Nuclear Information System (INIS)

Ahmad, Razi; Mohsin, Mohd; Ahmad, Tokeer; Sardar, Meryam

2015-01-01

Graphical abstract: - Highlights: • Green synthesis of TiO 2 nanoparticles using an enzyme alpha amylase has been described. • The morphology and shape depends upon the concentration of the alpha amylase enzyme. • The biosynthesized nanoparticles show good bactericidal effect against both gram positive and gram negative bacteria. • The bactericidal effect was further confirmed by Confocal microscopy and TEM. - Abstract: The enzyme alpha amylase was used as the sole reducing and capping agent for the synthesis of TiO 2 nanoparticles. The biosynthesized nanoparticles were characterized by X-ray diffraction (XRD) and transmission electron microscopic (TEM) methods. The XRD data confirms the monophasic crystalline nature of the nanoparticles formed. TEM data shows that the morphology of nanoparticles depends upon the enzyme concentration used at the time of synthesis. The presence of alpha amylase on TiO 2 nanoparticles was confirmed by FTIR. The nanoparticles were investigated for their antibacterial effect on Staphylococcus aureus and Escherichia coli. The minimum inhibitory concentration value of the TiO 2 nanoparticles was found to be 62.50 μg/ml for both the bacterial strains. The inhibition was further confirmed using disc diffusion assay. It is evident from the zone of inhibition that TiO 2 nanoparticles possess potent bactericidal activity. Further, growth curve study shows effect of inhibitory concentration of TiO 2 nanoparticles against S. aureus and E. coli. Confocal microscopy and TEM investigation confirm that nanoparticles were disrupting the bacterial cell wall

Novel chitin/chitosan-glucan wound dressing: Isolation, characterization, antibacterial activity and wound healing properties

Czech Academy of Sciences Publication Activity Database

Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.

2016-01-01

Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016

Vitality Improvement of the Mediterranean Fruit Fly, Ceratitis capitata Wied 1- Measured by using dehydrogenase Enzyme Activities

International Nuclear Information System (INIS)

Salama, M.S.; Shoman, A.A.; Elbermawy, S.M.; Abul Yazid, I.

2000-01-01

The present study searches for the improvement vitality of the Mediterranean fruit fly, Ceratitis capitata Wied. Through the induction of a specific variance (mutation) in the genetic material. Several types of treatments that were thought to cause this mutation were used, as IGR's, temperature, formaldehyde, colchicine, alcohols, several types of larval rearing media and gamma-rays. Generally, the activities of the energy enzymes alpha-glycerophosphate dehydrogenase (alpha-GPDH) enzyme lactate dehydrogenase (LDH) enzyme and malate dehydrogenase (MDH) enzyme, when used as a direct measure for the fly vitality, increased due to treatments of the egg stage by the previously mentioned treatments specially by the usage of rice hulls in the larval rearing medium alone or followed by irradiation of the pupal stage with 90 Gy

Alpha chymotrypsin coated clusters of Fe3O4 nanoparticles for biocatalysis in low water media

Directory of Open Access Journals (Sweden)

Mukherjee Joyeeta

2012-11-01

Full Text Available Abstract Background Enzymes in low water containing non aqueous media are useful for organic synthesis. For example, hydrolases in such media can be used for synthetic purposes. Initial work in this area was carried out with lyophilized powders of enzymes. These were found to have poor activity. Drying (removing bulk water by precipitation turned out to be a better approach. As enzymes in such media are heterogeneous catalysts, spreading these precipitates over a large surface gave even better results. In this context, nanoparticles with their better surface to volume ratio provide obvious advantage. Magnetic nanoparticles have an added advantage of easy separation after the reaction. Keeping this in view, alpha chymotrypsin solution in water was precipitated over a stirred population of Fe3O4 nanoparticles in n-propanol. This led to alpha chymotrypsin activity coated over clusters of Fe3O4 nanoparticles. These preparations were found to have quite high transesterification activity in low water containing n-octane. Results Precipitation of alpha chymotrypsin over a stirred suspension of Fe3O4 nanoparticles (3.6 nm diameter led to the formation of enzyme coated clusters of nanoparticles (ECCNs. These clusters were also magnetic and their hydrodynamic diameter ranged from 1.2- 2.6 microns (as measured by dynamic light scattering. Transmission electron microscopy (TEM, showed that these clusters had highly irregular shapes. Transesterification assay of various clusters in anhydrous n-octane led to optimization of concentration of nanoparticles in suspension during precipitation. Optimized design of enzyme coated magnetic clusters of nanoparticles (ECCN 3 showed the highest initial rate of 465 nmol min-1 mg-1protein which was about 9 times higher as compared to the simple precipitates with an initial rate of 52 nmol min-1 mg-1 protein. Circular Dichroism (CD(with a spinning cell accessory showed that secondary structure content of the alpha

Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

Science.gov (United States)

We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

Rational Design of Adjuvant for Skin Delivery: Conjugation of Synthetic β-Glucan Dectin-1 Agonist to Protein Antigen.

Science.gov (United States)

Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C

2015-05-04

The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.

Supplementation with xylanase and β-xylosidase to reduce xylo-oligomer and xylan inhibition of enzymatic hydrolysis of cellulose and pretreated corn stover

Directory of Open Access Journals (Sweden)

Qing Qing

2011-06-01

Full Text Available Abstract Background Hemicellulose is often credited with being one of the important physical barriers to enzymatic hydrolysis of cellulose, and acts by blocking enzyme access to the cellulose surface. In addition, our recent research has suggested that hemicelluloses, particularly in the form of xylan and its oligomers, can more strongly inhibit cellulase activity than do glucose and cellobiose. Removal of hemicelluloses or elimination of their negative effects can therefore become especially pivotal to achieving higher cellulose conversion with lower enzyme doses. Results In this study, cellulase was supplemented with xylanase and β-xylosidase to boost conversion of both cellulose and hemicellulose in pretreated biomass through conversion of xylan and xylo-oligomers to the less inhibitory xylose. Although addition of xylanase and β-xylosidase did not necessarily enhance Avicel hydrolysis, glucan conversions increased by 27% and 8% for corn stover pretreated with ammonia fiber expansion (AFEX and dilute acid, respectively. In addition, adding hemicellulase several hours before adding cellulase was more beneficial than later addition, possibly as a result of a higher adsorption affinity of cellulase and xylanase to xylan than glucan. Conclusions This key finding elucidates a possible mechanism for cellulase inhibition by xylan and xylo-oligomers and emphasizes the need to optimize the enzyme formulation for each pretreated substrate. More research is needed to identify advanced enzyme systems designed to hydrolyze different substrates with maximum overall enzyme efficacy.

Functional analyses of multiple lichenin-degrading enzymes from the rumen bacterium Ruminococcus albus 8.

Science.gov (United States)

Iakiviak, Michael; Mackie, Roderick I; Cann, Isaac K O

2011-11-01

Ruminococcus albus 8 is a fibrolytic ruminal bacterium capable of utilization of various plant cell wall polysaccharides. A bioinformatic analysis of a partial genome sequence of R. albus revealed several putative enzymes likely to hydrolyze glucans, including lichenin, a mixed-linkage polysaccharide of glucose linked together in β-1,3 and β-1,4 glycosidic bonds. In the present study, we demonstrate the capacity of four glycoside hydrolases (GHs), derived from R. albus, to hydrolyze lichenin. Two of the genes encoded GH family 5 enzymes (Ra0453 and Ra2830), one gene encoded a GH family 16 enzyme (Ra0505), and the last gene encoded a GH family 3 enzyme (Ra1595). Each gene was expressed in Escherichia coli, and the recombinant protein was purified to near homogeneity. Upon screening on a wide range of substrates, Ra0453, Ra2830, and Ra0505 displayed different hydrolytic properties, as they released unique product profiles. The Ra1595 protein, predicted to function as a β-glucosidase, preferred cleavage of a nonreducing end glucose when linked by a β-1,3 glycosidic bond to the next glucose residue. The major product of Ra0505 hydrolysis of lichenin was predicted to be a glucotriose that was degraded only by Ra0453 to glucose and cellobiose. Most importantly, the four enzymes functioned synergistically to hydrolyze lichenin to glucose, cellobiose, and cellotriose. This lichenin-degrading enzyme mix should be of utility as an additive to feeds administered to monogastric animals, especially those high in fiber.

Unripe Fruit's Extract of Quince (Cydonia oblonga Miller as a Potent Alpha-amylase Inhibitor

Directory of Open Access Journals (Sweden)

Mostafa Koutb

2012-01-01

Full Text Available The use of alpha-amylase inhibitors has recently gained in popularity with the success and growth of carbohydrate restricted diets. In this study, two different stages from the unripe fruits of quince (Cydonia oblonga Miller have been tested for their potentiality in alpha-amylase inhibition as a key enzyme in carbohydrates assimilation. Our results revealed that addition of different concentrations from extracts (0, 2, 4, 6, 8mg of dry mass of each stage of unripe fruits resulted in drastically decrease in the enzymatic activity of alpha-amylase by the percent of (0%, 42.6%, 21%, 26.3%, and 16.9% for the stage 1. Extracts from the stage 2 were more effective in enzymatic inhibition (0%, 26.9%, 3.8%, 0.2%, and 0.4%. The GC/MS analysis revealed that quince extract contains (sorbitol, quinic acid, p-vinylphenol and cyclopropane carboxylic acid. To explore which components are involved in the inhibition process, two pure components of the quince extract (sorbitol and quinic acid were used in inhibition assay. Neither sorbitol nor quinic acid shows any significant inhibition; therefore, these two components could be excluded from the inhibition process. Our current study suggested that p-vinylphenol and cyclopropane carboxylic acid might act as a-amylase inhibitors in vitro separately or synergistically. The possible explanation for the presence of cyclopropane carboxylic acid (CPCA in this critical phase of the unripe fruit will be discussed. This study suggests that the unripe fruits of quince can be used as a natural starch blocker containing alpha-amylase inhibitors which would be of interest for people requiring carbohydrate restricted diets.

Diversity of function in the isocitrate lyase enzyme superfamily: the Dianthus caryophyllus petal death protein cleaves alpha-keto and alpha-hydroxycarboxylic acids.

Science.gov (United States)

Lu, Zhibing; Feng, Xiaohua; Song, Ling; Han, Ying; Kim, Alexander; Herzberg, Osnat; Woodson, William R; Martin, Brian M; Mariano, Patrick S; Dunaway-Mariano, Debra

2005-12-20

The work described in this paper was carried out to define the chemical function a new member of the isocitrate lyase enzyme family derived from the flowering plant Dianthus caryophyllus. This protein (Swiss-Prot entry Q05957) is synthesized in the senescent flower petals and is named the "petal death protein" or "PDP". On the basis of an analysis of the structural contexts of sequence markers common to the C-C bond lyases of the isocitrate lyase/phosphoenolpyruvate mutase superfamily, a substrate screen that employed a (2R)-malate core structure was designed. Accordingly, stereochemically defined C(2)- and C(3)-substituted malates were synthesized and tested as substrates for PDP-catalyzed cleavage of the C(2)-C(3) bond. The screen identified (2R)-ethyl, (3S)-methylmalate, and oxaloacetate [likely to bind as the hydrate, C(2)(OH)(2) gem-diol] as the most active substrates (for each, k(cat)/K(m) = 2 x 10(4) M(-)(1) s(-)(1)). In contrast to the stringent substrate specificities previously observed for the Escherichia coli isocitrate and 2-methylisocitrate lyases, the PDP tolerated hydrogen, methyl, and to a much lesser extent acetate substituents at the C(3) position (S configuration only) and hydoxyl, methyl, ethyl, propyl, and to a much lesser extent isobutyl substituents at C(2) (R configuration only). It is hypothesized that PDP functions in oxalate production in Ca(2+) sequestering and/or in carbon scavenging from alpha-hydroxycarboxylate catabolites during the biochemical transition accompanying petal senescence.

The Role of alpha-Glucosidase in Germinating Barley Grains

DEFF Research Database (Denmark)

Stanley, Duncan; Rejzek, Martin; Næsted, Henrik

2011-01-01

The importance of alpha-glucosidase in the endosperm starch metabolism of barley (Hordeum vulgare) seedlings is poorly understood. The enzyme converts maltose to glucose (Glc), but in vitro studies indicate that it can also attack starch granules. To discover its role in vivo, we took complementa...

Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

Science.gov (United States)

Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

2011-01-01

The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

Anti-inflammatory properties of the medicinal mushroom Cordyceps militaris might be related to its linear (1→3-β-D-glucan.

Directory of Open Access Journals (Sweden)

Fhernanda R Smiderle

Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.

Evaluation of the Activities of Antioxidant Enzyme and Lysosomal Enzymes of the Longissimus dorsi Muscle from Hanwoo (Korean Cattle) in Various Freezing Conditions

OpenAIRE

Kang, Sun Moon; Kang, Geunho; Seong, Pil-Nam; Park, Beomyoung; Kim, Donghun; Cho, Soohyun

2014-01-01

This study was conducted to evaluate the activities of antioxidant enzyme (glutathione peroxidase (GSH-Px)) and lysosomal enzymes (alpha-glucopyranosidase (AGP) and beta-N-acetyl-glucosaminidase (BNAG)) of the longissimus dorsi (LD) muscle from Hanwoo (Korean cattle) in three freezing conditions. Following freezing at -20, -60, and -196? (liquid nitrogen), LD samples (48 h post-slaughter) were treated as follows: 1) freezing for 14 d, 2) 1 to 4 freeze-thaw cycles (2 d of freezing in each cycl...

Near infrared spectra indicate specific mutant endosperm genes and reveal a new mechanism for substituting starch with (1-->3,1-->4)-[beta]-glucan in barley

DEFF Research Database (Denmark)

Munck, L.; Møller, B.; Jacobsen, Susanne

2004-01-01

-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....

The inhibitory effect of an extract of Sanguisorba officinalis L. on ultraviolet B-induced pigmentation via the suppression of endothelin-converting enzyme-1{alpha}

Energy Technology Data Exchange (ETDEWEB)

Hachiya, Akira; Kobayashi, Akemi; Ohuchi, Atsushi; Kitahara, Takashi; Takema, Yoshinori [Kao Biological Science Lab., Ichikai, Tochigi (Japan)

2001-06-01

Endothelin-1 (ET-1) has been reported to be expressed in human epidermis at both the gene and protein levels. ET-1 plays a pivotal role in ultraviolet B (UVB)-induced pigmentation due to its accentuated secretion after UVB irradiation and its function as a mitogen and as a melanogen for human melanocytes. We have recently found that endothelin-converting enzyme (ECE)-1{alpha} plays a constitutive role in the secretion of ET-1 by human keratinocytes and that an extract of Sanguisorba officinalis L. inhibits ECE activity in human endothelial cells, which predominantly express ECE-1{alpha}. In this report, to clarify the potential use of this botanical extract as a whitening agent, we examined whether this extract inhibits UVB-induced pigmentation in vivo. When this extract was applied to human keratinocytes after UVB irradiation, secretion of ET-1 by those cells was reduced, and this was accompanied by a concomitant increase in the secretion of inactive precursor Big endothelin-1. When hairless mice were exposed to UVB light and were treated with the extract, it suppressed the induction of ET-1 in the UVB-irradiated epidermis. In the course of UVB-induced pigmentation of brownish guinea pig skin, this extract significantly diminished pigmentation in UVB-exposed areas. These findings indicate that ECE-1{alpha} in keratinocytes plays a pivotal role in the induction of pigmentation following UVB irradiation and that an extract of S. officinalis, which inhibits ET-1 production in human keratinocytes, is a good ingredient for a whitening agent. (author)

Stabilization of {alpha}-amylase by using anionic surfactant during the immobilization process

Energy Technology Data Exchange (ETDEWEB)

El-Batal, A.I. [National Center for Radiation Research and Technology, P.O. Box 29, Nasr City, Cairo (Egypt); Atia, K.S. [Nuclear Research Center, Radioisotopes Applications Division, Abo-Zable, P.O. Box 13759, Cairo (Egypt)]. E-mail: ks_atia@yahoo.com; Eid, M. [National Center for Radiation Research and Technology, P.O. Box 29, Nasr City, Cairo (Egypt)

2005-10-01

This work describes the entrapment of {alpha}-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using {gamma} irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized {alpha}-amylase were studied. Covering of {alpha}-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized {alpha}-amylase was increased below the critical micelle concentration (cmc) (10mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized {alpha}-amylase showed a higher k{sub cat}/K{sub m} and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of {alpha}-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems.

Recombinant enzyme therapy for Fabry disease: Absence of editing of human alpha-galactosidase A mRNA

NARCIS (Netherlands)

Blom, Daniël; Speijer, Dave; Linthorst, Gabor E.; Donker-Koopman, Wilma G.; Strijland, Anneke; Aerts, Johannes M. F. G.

2003-01-01

For more than a decade, protein-replacement therapy has been employed successfully for the treatment of Gaucher disease. Recently, a comparable therapy has become available for the related lipid-storage disorder Fabry disease. Two differently produced recombinant alpha-galactosidase A (alpha-gal A)

N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

OpenAIRE

Kuhn, H; Fietzek, P P; Lampen, J O

1982-01-01

The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

Mutational analysis of target enzyme recognition of the beta-trefoil fold barley alpha-amylase/subtilisin inhibitor

DEFF Research Database (Denmark)

Bønsager, Birgit Christine; Nielsen, Per K.; Abou Hachem, Maher

2005-01-01

The barley alpha-amylase/subtilisin inhibitor ( BASI) inhibits alpha-amylase 2 (AMY2) with subnanomolar affinity. The contribution of selected side chains of BASI to this high affinity is discerned in this study, and binding to other targets is investigated. Seven BASI residues along the AMY2-BASI...... interface and four residues in the putative protease-binding loop on the opposite side of the inhibitor were mutated. A total of 15 variants were compared with the wild type by monitoring the alpha-amylase and protease inhibitory activities using Blue Starch and azoalbumin, respectively, and the kinetics...

Production of Cellulases, Xylanase, Pectinase, alpha-amylase and Protease Enzymes Cocktail by Bacillus spp. and Their Mixed Cultures with Candida tropicalis and Rhodotorula glutinis under Solid State Fermentation

International Nuclear Information System (INIS)

El-Batal, A.I.; Abo-State, M.A.

2006-01-01

A group of twelve locally isolated Bacillus species, B.megaterium (MAI and MA II), B.licheniformis (MLI and ML II); B. circulans, B. stearothermophilis, B.cereus, B.sphaericus, B. pumilus, B. laterosporus, B. coagulans and B. pantothenticus, were examined for the production of cellulases, xylanase, pectinase, alpha-amylase and protease enzymes cocktail on wheat bran under solid state fermentation (SSF). All species were found to be potent hydrolyzing enzymes producers and the superior producing species were B. megaterium MAI and B. licheniformis. On the other hand, both of them still produced highest enzyme titres when mixed with Candida tropicalis or Rhodotorula glutinis, yeast strains. The two superior bacterial strains produced the highest enzymatic activities when coculturing with C. tropicalis compared with coculturing with R. glutinis only or with both C. tropicalis and R. glutinis in combination. The inferior activities of cocultures (B. megaterinm MAI and R. glutinis) were enhanced in carboxymethyl cellulase (CMCase), filter paper cellulase (FPase), avecilase, xylanase, pectinase, -amylase and protease by gamma irradiation at dose 1.0 kGy with percent increase 8 %, 20 %, 10 %, 4 %, 31 %, 22 % and 34 %, respectively as compared with un-irradiated cocultures

Identification of two alpha-ketoglutarate-dependent dioxygenases in extracts of Rhodotorula glutinis catalyzing deoxyuridine hydroxylation

International Nuclear Information System (INIS)

Stubbe, J.

1985-01-01

Attempts to isolate deoxyuridine 2'-hydroxylase from Rhodotorula glutinis J. Biol. Chem. 258, 10551-10557) have led to the identification and partial purification of a newly recognized alpha-ketoglutarate-requiring oxygenase. This activity, designated deoxyuridine (uridine) 1'-hydroxylase, in the presence of iron and ascorbate, catalyzes the conversion of deoxyuridine (uridine), O 2 , and alpha-ketoglutarate to uracil, deoxyribonolactone (ribonolactone), CO 2 , and succinate. Incubation of [1'- 3 H]uridine with this activity results in time-dependent formation of uracil concomitant with production of CO 2 and 3H 2 O. Also reported in this paper is the partial purification and characterization of the alpha-ketoglutarate-requiring enzyme, deoxyuridine 2'-hydroxylase. Incubation of [2'-alpha- 3 H]deoxyuridine with this activity results in concomitant production of uridine and 3H 2 O. Incubation with [2'-beta- 3 H] deoxyuridine results in the production of uridine whose specific activity is identical to that of the starting material. This enzyme catalyzes the conversion of deoxyuridine to uridine with retention of configuration. No isotope effect is observed on this transformation

Effect of Barley and Enzyme on Performance, Carcass, Enzyme Activity and Digestion Parameters of Broilers

Directory of Open Access Journals (Sweden)

majid kalantar

2016-04-01

Full Text Available Introduction Corn has been recently used for producing ethanol fuel in the major corn-producing countries such as the US and Brazil. Recent diversion of corn for biofuel production along with the increased world's demand for this feedstuff has resulted in unprecedented rise in feed cost for poultry worldwide. Alternative grains such as wheat and barley can be successfully replaced for corn in poultry diets. These cereal grains can locally grow in many parts of the world as they have remarkably lower water requirement than corn. Wheat and barley are generally used as major sources of energy in poultry diets. Though the major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls (Olukosi et al. 2007; Mirzaie et al. 2012. NSPs are generally considered as anti-nutritional factors (Jamroz et al. 2002. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value (Olukosi et al. 2007.Wheat and barley are generally used as major sources of energy in poultry diets. The major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls. NSPs are generally considered as anti-nutritional factors. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value. The major part of NSPs in barley comprises polymers of (1→3 (1→4-β- glucans which could impede growth factors and consequently carcass quality through lowering the rate and amount of available nutrients in the mucosal surface of the intestinal. Materials and Methods This experiment was conducted to evaluate the effect of corn and barley based diets supplemented with multi-enzyme on growth, carcass, pancreas enzyme activity and physiological characteristics of broilers. A total number of 375 one day old

Antioxidant-enzyme reaction to the oxidative stress due to alpha-cypermethrin, chlorpyriphos, and pirimicarb in tomato (Lycopersicon esculentum Mill.).

Science.gov (United States)

Chahid, Karim; Laglaoui, Amin; Zantar, Said; Ennabili, Abdeslam

2015-11-01

Tomato (Lycopersicon esculentum Mill.) becomes one of the world's foremost vegetables, and its world production and consumption have increased fairly quickly. The capacity to induce oxidative stress in tomato plant, exposed to three xenobiotics such as alpha-cypermethrin, chlorpyriphos, and pirimicarb, was investigated by the evaluation of lipid peroxidation by measuring malondialdehyde (MDA) rate; also, we studied the response of tomato to this stress by assessing the response of superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), ascorbate peroxidase (APX), glutathione-s-transferase (GST), and glutathione reductase (GR). The effect of the insecticides was observed using four concentrations (25, 50, 75, and 100%) for germinating seeds and only the recommended concentration in agriculture (100%) for growing plants. Our results show an important accumulation of MDA, demonstrating the increase of lipid peroxidation in consequence of the excessive reactive oxygen species (ROS) production due to insecticide treatment. In response to this oxidative stress in tomato seedlings and plants, the activities of antioxidant-enzyme system were generally enhanced. The electrophoretic analysis showed also the apparition of new isoenzymes as the case for CAT and POD.

Use of β-glucan from spent brewer's yeast as a thickener in skimmed yogurt: Physicochemical, textural, and structural properties related to sensory perception.

Science.gov (United States)

Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren

2018-04-25

Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The effects of oat β-glucan incorporation on the quality, structure, consumer acceptance and glycaemic response of steamed bread.

Science.gov (United States)

Wang, Lei; Ye, Fayin; Feng, Liyuan; Wei, Fubin; Zhao, Guohua

2017-12-01

The objective of this study was to evaluate the effects of the incorporation of oat β-glucan (OβG) on the sensory and nutritional quality of steamed bread. Wheat flour was substituted with OβG at levels varying from 0 g/100 g to 5 g/100 g. The results showed that the products containing 1 g/100 g and 3 g/100 g OβG produced a comparable overall consumer acceptance while a significantly lower score was given to the product with 5 g/100 g. Nutritionally, the presence of OβG impeded in vitro starch hydrolysis by amylolytic enzymes. More importantly, the addition of OβG up to 5 g/100 g did bring about a lower in vitro predicted glycaemic index to steamed bread, but it generated insignificant effects on the in vivo glycaemic response. The current work first demonstrated the feasibility of fabricating OβG-enriched steamed bread and its nutritional superiority compared to the corresponding normal product. Modern methods of food elaboration and processing frequently reduce the content of dietary fiber (DF). Despite the well-known health benefits of DF consumption, average intake levels still fall far below recommended ones. Oat β-glucan (OβG) is a kind of indigestible polysaccharide with diverse bioactivity. This article evaluated the effects of OβG incorporation on quality, structure, consumer acceptance, and glycaemic response of steamed bread. The addition of less than 3 g/100 g of OβG had negligible effects on the consumer acceptance of steamed bread. The enrichment at 5 g/100 g indeed deteriorated the consumer acceptance. Moreover, OβG highly lowered the glycaemic response of steamed bread. The current work first demonstrated the feasibility of fabricating OβG-enriched steamed bread and its nutritional superiority compared to the corresponding normal product. OβG enriched steamed bread may offer an alternative to improve DF intake of residents. © 2017 Wiley Periodicals, Inc.

Purification and characterization of an alpha-amylase of Pichia burtonii isolated from the traditional starter "murcha" in Nepal.

Science.gov (United States)

Takeuchi, Akiko; Shimizu-Ibuka, Akiko; Nishiyama, Yoshitaka; Mura, Kiyoshi; Okada, Sanae; Tokue, Chiyoko; Arai, Soichi

2006-12-01

Among more than 20 yeast strains isolated from the traditional starter "murcha" in Nepal, we characterized a yeast that might be involved in saccharification. This strain, identified as Pichia burtonii, produced an extracellular amylolytic enzyme when cultured in the presence of starch in the medium. Since no amylase secreted by P. burtonii has yet been reported, we purified the enzyme and determined its N-terminal amino acid sequence. Together with the results of a hydrolyzing activity assay toward various substrates, it was found to be an alpha-amylase. The purified enzyme, named Pichia burtonii alpha-amylase (PBA), was a glycoprotein with an apparent molecular mass of 51 kDa. Enzyme activity was optimal at pH 5.0 at 40 degrees C. The enzyme retained 80% of its original activity after incubation under the optimal pH condition at 50 degrees C for 30 min. The activity was inhibited by metal ions such as Cd(2+), Cu(2+), Hg(2+), Al(3+), and Zn(2+).

Heavy enzymes--experimental and computational insights in enzyme dynamics.

Science.gov (United States)

Swiderek, Katarzyna; Ruiz-Pernía, J Javier; Moliner, Vicent; Tuñón, Iñaki

2014-08-01

The role of protein motions in the chemical step of enzyme-catalyzed reactions is the subject of an open debate in the scientific literature. The systematic use of isotopically substituted enzymes has been revealed as a useful tool to quantify the role of these motions. According to the Born-Oppenheimer approximation, changing the mass of the protein does not change the forces acting on the system but alters the frequencies of the protein motions, which in turn can affect the rate constant. Experimental and theoretical studies carried out in this field are presented in this article and discussed in the framework of Transition State Theory. Copyright © 2014 Elsevier Ltd. All rights reserved.

Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

Directory of Open Access Journals (Sweden)

Jorge S.B.

2003-01-01

Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.