WorldWideScience

Sample records for alpha lipoic acid

  1. Diabetes and alpha lipoic acid

    Directory of Open Access Journals (Sweden)

    Issy eLaher

    2011-11-01

    Full Text Available Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E and glutathione. It also boosts antioxidant defense system through Nrf2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that a lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy.

  2. Curative role of lactulose, L-carnitine, alpha-lipoic acid and ...

    African Journals Online (AJOL)

    Original Research Article. Curative role of lactulose, L-carnitine, alpha-lipoic acid and combination of L-carnitine and alpha-lipoic acid in a rat model of acute hepatic encephalopathy: Biochemical ..... from its ability to counteract ROS generation and exhibited beneficial role in the treatment of chronic liver diseases [24].

  3. Lipoic Acid

    Directory of Open Access Journals (Sweden)

    Ramazan Tetikcok

    2015-09-01

    Full Text Available Lipoic acid, which is defined as a miralce antioxidan, is used by many departments. Eventhough clinical using data are very limited , it is used in treatment of diabetic neuropathy, physical therapy and rehabilitation clinic, dermatology clinic, geriatric clinics. It has usage area for cosmetic purposes. Although there are reports there are the direction of the effectiveness in these areas, the works done are not enough. Today lipoic acid , used in many areas ,is evaluated as universal antioxidant [J Contemp Med 2015; 5(3.000: 206-209

  4. A study of the antioxidant effect of alpha lipoic acids on sperm quality

    Directory of Open Access Journals (Sweden)

    Siti Fatimah Ibrahim

    2008-01-01

    Full Text Available OBJECTIVE: Assisted reproductive techniques are useful in helping infertile couples achieve successful conception. Initial studies have shown that sperm cryopreservation, one step in assisted reproduction, causes a dramatic reduction in sperm quality. This has been attributed to, among other things, free radical activities. The aim of the present study was to minimize this oxidative attack by adding an antioxidant into the sperm microenvironment. Alpha lipoic acids were selected for this purpose for their efficient free radical scavenging properties and solubility in lipid and aqueous phases. METHODS: For this investigation, semen from six Boer bucks was pooled. Seminal analysis of the baseline prior to incubation of samples with different concentrations of Alpha lipoic acids (0.00625, 0.0125, 0.025, 0.05, 0.1 mmol/ml was performed, and post-seminal analysis was conducted after a one-hour incubation. The comet assay was used to observe the effect of Alpha lipoic acids on sperm DNA integrity. Statistical analysis using an unpaired t-test with a significance level of p<0.05 was then performed. RESULTS: Our results indicate that the sperm motility rate was improved after incubation with Alpha lipoic acids at a concentration of 0.02 mmol/ml. This concentration was also capable of reducing DNA damage. CONCLUSION: In conclusion, Alpha lipoic acids renders cryoprotection to sperm, thereby improving sperm quality.

  5. Dietary alpha-Lipoic Acid Alters Piglet Neurodevelopment

    Directory of Open Access Journals (Sweden)

    Austin T Mudd

    2016-05-01

    Full Text Available Introduction: Alpha-lipoic acid (a-LA is an antioxidant shown to ameliorate age-associated impairments of brain and cardiovascular function. Human milk is known to have high antioxidant capacity, however the role of antioxidants in the developing brain is largely uncharacterized. This exploratory study aimed to examine the dose response effects of a-LA on piglet growth and neurodevelopment. Methods: Beginning at 2 d of age, 31 male pigs received one of three diets: control (CONT [0 mg a-LA/100g], low a-LA (LOW [120 mg a-LA/100g], or high a-LA (HIGH [240 mg a-LA/100g]. From 14 to 28 d of age, pigs were subjected to spatial T-maze assessment and macrostructural and microstructural neuroimaging procedures were performed at 31 d of age.Results: No differences due to diet were observed for bodyweight gain or intestinal weight and length. Spatial T-maze assessment did not reveal learning differences due to diet in proportion of correct choices or latency to choice measures. Diffusion tensor imaging revealed decreased (P = 0.01 fractional anisotropy (FA in the internal capsule of HIGH fed pigs compared with both the CONT (P < 0.01 and LOW (P = 0.03 fed pigs, which were not different from one another. Analysis of axial diffusivity (AD within the internal capsule revealed a main effect of diet (P < 0.01 in which HIGH fed piglets exhibited smaller (P < 0.01 rates of diffusion compared with CONT piglets, but HIGH fed piglets were not different (P = 0.12 than LOW fed piglets. Tract-based spatial statistics, a comparison of FA values along white matter tracts, revealed 1,650 voxels where CONT piglets exhibited higher (P < 0.05 values compared with HIGH fed piglets. Conclusion: The lack of differences in intestinal and bodyweight measures among piglets indicate a-LA supplementation does not impact overall growth, regardless of concentration. Additionally, no observed differences between CONT and LOW fed piglets in behavior and neuroimaging measures indicate a

  6. Alpha lipoic acid : a new treatment for neuropathic pain in patients with diabetes?

    NARCIS (Netherlands)

    Mijnhout, G. S.; Alkhalaf, A.; Kleefstra, N.; Bibo, H. J. G.

    Background: Neuropathic pain is difficult to treat. We identified those studies in the literature in which the effectiveness of alpha lipoic acid as a treatment for neuropathic pain was evaluated. Methods: Systematic literature review. The databases MEDLINE and EMBASE were searched using the

  7. Alpha Lipoic Acid for Symptomatic Peripheral Neuropathy in Patients with Diabetes : A Meta-Analysis of Randomized Controlled Trials

    NARCIS (Netherlands)

    Mijnhout, Gerritje S.; Kollen, Boudewijn J.; Alkhalaf, Alaa; Kleefstra, Nanno; Bilo, Henk J. G.

    2012-01-01

    Objective. We performed a systematic review of the literature to evaluate the effects of alpha lipoic acid for symptomatic peripheral neuropathy in patients with diabetes mellitus. Research design and methods. The databases MEDLINE and EMBASE were searched using the key words "lipoic acid",

  8. Effects of alpha-lipoic acids on sperm membrane integrity during liquid storage of boar semen

    Directory of Open Access Journals (Sweden)

    Laura Parlapan

    2015-05-01

    Full Text Available Preliminary studies have shown that sperm membrane from swine shows high sensitivity to cryopreservation process, causing a dramatic reduction in sperm quality. This has been attributed to the production of reactive oxygen species, that cause lipid peroxidation in sperm membranes. The aim of the present study was to minimize the oxidative attack by adding different concentration of alpha-lipoic acid into the sperm liquid storage at 17ºC for 7 days. Freshly ejaculated boar semen was diluted with Beltsville Thawing Solution (BTS and supplemented with 5 levels of alpha-lipoic  acid (0.015, 0.02, 0.05, 0.1, 0.15 mmol/ml. The membrane integrity was evaluated at days 0, 1, 3, 5 and 7 of liquid preservation, using flow cytometer FACSCanto II (BD Biociencias systems. The experiment indicate that supplementation of alpha-lipoic  acid to the semen liquid storage extender improve sperm membrane

  9. Alpha-lipoic acid as a pleiotropic compound with potential therapeutic use in diabetes and other chronic diseases.

    Science.gov (United States)

    Gomes, Marilia Brito; Negrato, Carlos Antonio

    2014-01-01

    Alpha-lipoic acid is a naturally occurring substance, essential for the function of different enzymes that take part in mitochondria's oxidative metabolism. It is believed that alpha-lipoic acid or its reduced form, dihydrolipoic acid have many biochemical functions acting as biological antioxidants, as metal chelators, reducers of the oxidized forms of other antioxidant agents such as vitamin C and E, and modulator of the signaling transduction of several pathways. These above-mentioned actions have been shown in experimental studies emphasizing the use of alpha-lipoic acid as a potential therapeutic agent for many chronic diseases with great epidemiological as well economic and social impact such as brain diseases and cognitive dysfunctions like Alzheimer disease, obesity, nonalcoholic fatty liver disease, burning mouth syndrome, cardiovascular disease, hypertension, some types of cancer, glaucoma and osteoporosis. Many conflicting data have been found concerning the clinical use of alpha-lipoic acid in the treatment of diabetes and of diabetes-related chronic complications such as retinopathy, nephropathy, neuropathy, wound healing and diabetic cardiovascular autonomic neuropathy. The most frequent clinical condition in which alpha-lipoic acid has been studied was in the management of diabetic peripheral neuropathy in patients with type 1 as well type 2 diabetes. Considering that oxidative stress, a imbalance between pro and antioxidants with excessive production of reactive oxygen species, is a factor in the development of many diseases and that alpha-lipoic acid, a natural thiol antioxidant, has been shown to have beneficial effects on oxidative stress parameters in various tissues we wrote this article in order to make an up-to-date review of current thinking regarding alpha-lipoic acid and its use as an antioxidant drug therapy for a myriad of diseases that could have potential benefits from its use.

  10. Effect of alpha-lipoic acid on endometrial implants in an experimental rat model.

    Science.gov (United States)

    Pınar, Neslihan; Soylu Karapınar, Oya; Özcan, Oğuzhan; Özgür, Tümay; Bayraktar, Suphi

    2017-10-01

    To investigate the antioxidant and anti-inflammatory effects of alpha-lipoic acid (ALA) in the treatment of endometriosis in an experimental rat model by evaluating biochemical and histopathologic parameters. Experimental endometriosis was induced by the peritoneal implantation of autologous endometrial tissue. The rats were randomly divided into two groups with eight rats each. Group I was intraperitoneally administered ALA 100 mg/kg/day for 14 days. Group II was intraperitoneally administered saline solution at the same dosage and over the same period. Endometrial implant volume was measured in both groups both pre- and post-treatment. Tumor necrosis factor alpha (TNF-α) was measured in peritoneal fluid. Total antioxidant status (TAS), total oxidant status (TOS), and oxidative stress index (OSI) were assessed in serum. The implants were histopathologically evaluated. In the ALA group, the serum TOS and OSI levels, the endometrial implant volumes, the TNF-α levels in serum and peritoneal fluid, and the histopathologic scores were significantly lower compared to the control group (P < 0.05). Alpha-lipoic acid may have a therapeutic potential in the treatment of endometriosis due to its antioxidant and anti-inflammatory effects. © 2017 Société Française de Pharmacologie et de Thérapeutique.

  11. Alpha-Lipoic acid supplementation inhibits oxidative damage, accelerating chronic wound healing in patients undergoing hyperbaric oxygen therapy

    Czech Academy of Sciences Publication Activity Database

    Alleva, R.; Nasole, E.; Di Donato, F.; Borghi, B.; Neužil, Jiří; Tomasetti, M.

    2005-01-01

    Roč. 333, č. 2 (2005), s. 404-410 ISSN 0006-291X Institutional research plan: CEZ:AV0Z50520514 Keywords : alpha-lipoic acid * chronic wound * ROS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.000, year: 2005

  12. Alpha Lipoic Acid Plus Omega-3 Fatty Acids for Vestibulodynia Associated With Painful Bladder Syndrome.

    Science.gov (United States)

    Murina, Filippo; Graziottin, Alessandra; Felice, Raffaele; Gambini, Dania

    2017-03-01

    This study assessed the effectiveness of alpha lipoic acid (ALA) plus omega-3 polyunsaturated fatty acids (n-3 PUFAs) in combination with amitriptyline therapy in patients with vestibulodynia/painful bladder syndrome (VBD/PBS). Women with VBD/PBS were randomly assigned to receive amitriptyline or amitriptyline plus a commercially available preparation (ALAnerv Age; Alfa Wassermann, Bologna, Italy) containing, in 2 capsules, ALA 600 mg plus docosahexaenoic acid 250 mg and eicosapentaenoic acid 16.67 mg. Symptoms of burning and pain were assessed using a 10-cm visual analog scale and the short form of the McGill-Melzack Pain Questionnaire. Among 84 women who were randomized, the mean ± standard deviation dose of amitriptyline was 21.7 ± 6.6 mg/day, without statistical difference between the two groups. Pain, as assessed using both the pain rating index of the visual analog scale and the short-form McGill Pain Questionnaire, decreased significantly in both trial groups, with a greater effect seen with the addition of ALA and n-3 PUFAs. The addition of ALA/n-3 PUFAs to amitriptyline treatment was also associated with improvements in dyspareunia and pelvic floor muscle tone. The overall incidence of adverse events was low, and none led to treatment discontinuation. The addition of ALA/n-3 PUFAs to amitriptyline treatment in patients with VBD/PBS appears to improve outcomes and may allow for a lower dosage of amitriptyline, which may lead to fewer adverse effects. Copyright © 2017 The Society of Obstetricians and Gynaecologists of Canada/La Société des obstétriciens et gynécologues du Canada. Published by Elsevier Inc. All rights reserved.

  13. A rare cause of status epilepticus; alpha lipoic acid intoxication, case report and review of the literature.

    Science.gov (United States)

    Tolunay, Orkun; Çelik, Tamer; Kömür, Mustafa; Gezgin, Ali Emre; Kaya, Musa Soner; Çelik, Ümit

    2015-11-01

    Alpha lipoic acid is a powerful antioxidant widely used for the supplementary treatment of diabetic neuropathy. Intoxication with alpha lipoic acid is very rare. There is no reported dose of safety in children. A 14-month-old previously healthy girl was referred to our hospital with the diagnosis of drug intoxication. She was admitted to the emergency department with lethargy and continuing involuntary movements for several hours after she had ingested an unknown amount of alpha lipoic acid. On admission she was lethargic and had myoclonic seizures involving all extremities. She had no fever and laboratory examinations were normal except for mild metabolic acidosis. The seizures were unresponsive to bolus midazolam, phenytoin infusion and levetiracetam infusion. She was taken to the pediatric intensive care unit with the diagnosis of status epilepticus. After failure of the treatment with midazolam infusion she was intubated and thiopental sodium infusion was started. Her myoclonic seizures were controlled with thiopental sodium infusion. After 48 h intubation and mechanical ventilation thiopental sodium was gradually reduced and then stopped. Following the withdraw of thiopental sodium, she was seizure free on her discharge on the 8th day. Alpha lipoic acid and derivatives cause side effects in children like refractory convulsions. They are frequently rendered as vitamins by diabetic patients and are left at places where children can easily access them. Therefore, when faced with refractory convulsions in children who have had no disease before, intoxication by medicaments with alpha lipoic acid should be taken into consideration. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  14. Redox Homeostasis of Albumin in Relation to Alpha-Lipoic Acid and Dihydrolipoic Acid

    Directory of Open Access Journals (Sweden)

    Pinar Atukeren

    2010-01-01

    Full Text Available Albumin represents the predominant circulating antioxidant agent in plasma exposed to continuous oxidative stress and a change in serum albumin structure accounts for its antioxidant properties. Alterations in the redox status of albumin may result in impairments of its biological properties. Alpha-lipoic acid (LA, a naturally occurring thiol compound found in virtually all species, is a potent antioxidant with high efficacy which is also involved in the chelation of metal ions, regeneration of antioxidants, and repair of oxidatively damaged proteins. In human body LA is rapidly reduced to dihydrolipoic acid (DHLA after intake into the cell. Both, LA and DHLA are amphipathic molecules which act as antioxidants both in hydrophilic and lipophilic environments. The present study aimed to investigate the antioxidant/pro-oxidant effects of LA and DHLA due to their concentrations in metal-catalyzed protein oxidation (MCO of human serum albumin (HSA. Progressive oxidative modification of albumin was found in MCO system by an increased content of protein hydroperoxides (POOH, protein carbonyl groups (PCO which is the former's major breakdown product, and other protein oxidation markers such as advanced oxidized protein products (AOPP and protein thiol groups (P-SH. The possible antioxidant protective effects of LA and DHLA were observed with 25 µM and 50 µM; DHLA being more influential. Protein oxidation parameters were found to be lower and P-SH levels seemed higher. However, prooxidant effects of both LA and DHLA came on the scene with increased concentrations of 75 µM and 100 µM where the latter seemed the most hazardous with contradicted results. It is clear that the loss of biological activity of human serum albumin by MCO system appears of medical relevance and if LA exerts similar effects seen in the present study, it is possible that cellular prooxidant activity can also result consuming this unique antioxidant in certain doses.

  15. Effect of Combined Treatment with Alpha Lipoic Acid and Acetyl-L-Carnitine on Vascular Function and Blood Pressure in Coronary Artery Disease Patients

    OpenAIRE

    McMackin, Craig J.; Widlansky, Michael E.; Hamburg, Naomi M.; Huang, Alex L.; Weller, Susan; Holbrook, Monika; Gokce, Noyan; Hagen, Tory M.; Keaney, John F.; Vita, Joseph A.

    2007-01-01

    Mitochondria produce reactive oxygen species that may contribute to vascular dysfunction. Alpha-lipoic acid and acetyl-L-carnitine reduce oxidative stress and improve mitochondrial function. In a double blind, crossover study, we examined the effects of combined alpha-lipoic acid /acetyl-L-carnitine treatment and placebo (eight weeks per treatment) on vasodilator function and blood pressure in 36 subjects with coronary artery disease. Active treatment increased brachial artery diameter by 2.3...

  16. Impact evaluation of {alpha}-lipoic acid in gamma-irradiated erythrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Desouky, Omar S., E-mail: omardesouky@yahoo.co [Biophysics Lab, Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT), AEA, POB 29, Madinat Nasr, Cairo (Egypt); Selim, Nabila S.; Elbakrawy, Eman M. [Biophysics Lab, Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT), AEA, POB 29, Madinat Nasr, Cairo (Egypt); Rezk, Rezk A. [Physics Department, Faculty of Science, Helwan University, Cairo (Egypt)

    2011-03-15

    This work is intended to study in vitro the ability of lipoic acid to protect erythrocytes against the oxidative damage resulting from exposure to gamma radiation through measurement of their rheological properties and to study the effects of detergent on their membrane solubility and permeability. Different doses of gamma radiation were applied: the most recommended and applied dose (25 Gy), and two higher doses, namely 50 and 100 Gy. The effect of addition of lipoic acid as well as its effect as a radioprotector was tested. The obtained results show changes in structural integrity of the erythrocyte cell membrane components as a result of oxidative damage due to gamma radiation that could be improved by pre-treatment with the antioxidant lipoic acid.

  17. Alpha-lipoic acid potently inhibits peroxynitrite-mediated DNA strand breakage and hydroxyl radical formation: implications for the neuroprotective effects of alpha-lipoic acid.

    Science.gov (United States)

    Jia, Zhenquan; Zhu, Hong; Vitto, Michael J; Misra, Bhaba R; Li, Yunbo; Misra, Hara P

    2009-03-01

    Alpha-lipoic acid (LA) has recently been reported to afford protection against neurodegenerative disorders in humans and experimental animals. However, the mechanisms underlying LA-mediated neuroprotection remain an enigma. Because peroxynitrite has been extensively implicated in the pathogenesis of various forms of neurodegenerative disorders, this study was undertaken to investigate the effects of LA in peroxynitrite-induced DNA strand breaks, a critical event leading to peroxynitrite-elicited cytotoxicity. Incubation of phi X-174 plasmid DNA with the 3-morpholinosydnonimine (SIN-1), a peroxynitrite generator, led to the formation of both single- and double-stranded DNA breaks in a concentration- and time-dependent fashion. The presence of LA at 100-1,600 microM was found to significantly inhibit SIN-1-induced DNA strand breaks in a concentration-dependent manner. The consumption of oxygen induced by 250 microM SIN-1 was found to be decreased in the presence of high concentrations of LA (400-1,600 microM), indicating that LA at these concentrations may affect the generation of peroxynitrite from auto-oxidation of SIN-1. It is observed that incubation of the plasmid DNA with authentic peroxynitrite resulted in a significant formation of DNA strand breaks, which could also be dramatically inhibited by the presence of LA (100-1,600 microM). EPR spectroscopy in combination with spin-trapping experiments, using 5,5-dimethylpyrroline-N-oxide (DMPO) as spin trap, resulted in the formation of DMPO-hydroxyl radical adduct (DMPO-OH) from authentic peroxynitrite and LA at 50-1,600 microM inhibited the adduct signal. Taken together, these studies demonstrate for the first time that LA can potently inhibit peroxynitrite-mediated DNA strand breakage and hydroxyl radical formation. In view of the critical involvement of peroxynitrite in the pathogenesis of various neurodegenerative diseases, the inhibition of peroxynitrite-mediated DNA damage by LA may be responsible, at least

  18. Protective Effect of Alpha Lipoic Acid on Rat Sciatic Nerve Ischemia Reperfusion Damage

    Directory of Open Access Journals (Sweden)

    Ozan Turamanlar

    2015-06-01

    Full Text Available Background: Alpha lipoic acid is a potent antioxidant that plays numerous roles in human health. This study examined the effect of ALA on rat sciatic nerve ischemia reperfusion damage. Aims: Protective effect of alpha lipoic acid (ALA on sciatic nerve following ischemia-reperfusion in rats was investigated by using light microscopy and biochemical methods. Provided that the protective effect of ALA on sciatic nerve is proven, we think the damage to the sciatic nerve that has already occurred or might occur in patients for various reasons maybe prevented or stopped by giving ALA in convenient doses. Study Design: Animal experiment. Methods: Forty-two adult male Sprague-Dawley rats (250-300 grams were used in this study. Rats were randomly divided into six groups including one control (Group 1, one sham (Group 2, two ischemia-reperfusion (Groups 3 and 4 and two treatment groups (Groups5 and 6. Doses of 60 and 100 mg/kg ALA were given (Group 5 and 6 intra peritoneally twice, 1 and 24 hours before the ischemia to each treatment group. Ischemia was carried out the abdominal aorta starting from the distal part of the renal vein for two hours followed by reperfusion for three hours. In immunohistochemical methods, fibronectin immunoreactivity was analyzed. For biochemical analyses, the tissues were taken in eppendorf microtubes and superoxide dismutase (SOD and glutathione peroxidase (GSHPx enzyme activities as well as malondialdehyde (MDA and nitricoxide (NO levels were measured. Results: Fibronectin was observed to have increased significantly in the ischemia group; on the other hand, it was observed to have decreased in parallel to the doses in the ALA groups. Biochemical studies showed that SOD and GSHPx declined with ischemia-reperfusion, but the activities of these enzymes were increased in the treatment groups in parallel with the dose. It was found that increased MDA levels with ischemia-reperfusion were decreased in parallel with ALA dose

  19. Curative role of lactulose, L-carnitine, alpha-lipoic acid and ...

    African Journals Online (AJOL)

    Purpose: To determine whether a combination L-carnitine and α-lipoic acid (ALA) can alleviate the toxic effects of thioacetamide (TAA) via their potent antioxidant and free radical-scavenging activities. Methods: Rats were injected with TAA for 3 days to induce acute hepatic failure. TAA induced rats were treated with each of ...

  20. Effect of Alpha-lipoic Acid Supplementation on Serum Lipid Profile in Women with Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Elham Mirtaheri

    2014-09-01

    Conclusions: In the present study, serum lipid profile was not significantly affected by ALA intervention. However, ALA supplementation aiming at prevention or treatment of dyslipidemia in RA patients should be further investigated. Keywords: Lipoic acid, Supplementation, Rheumatoid arthritis, Women, Lipid profile

  1. [Use of alpha-lipoic acid and omega-3 in postpartum pain treatment].

    Science.gov (United States)

    Costantino, D; Guaraldi, C; Costantino, M; Bounous, V E

    2015-10-01

    Postpartum pain is a frequent condition that negatively affects women's quality of life, interferring with everyday life. Analgesic drugs and surgery are often contraindicated in pregnancy and during breast feeding. This review of the literature aims to evaluate the rational of the association of lipoic acid and omega-3 employ in the management of postpartum pain. Lipoic acid is a cofactor essential in mitochondrial metabolism with antioxidant and anti-inflammatory activity. Lipoic acid has been shown to be effective in neuropatic pain treatment in patients with sciatica, carpal tunnel syndrome and diabetic neuropathy. Omega-3 are known for their anti-inflammatory and neurotrophic activity. The peripheral and central activity of both substances allows to act on neuroinflammation mechanisms thus reducing cronicization of pain and also determining a potential improvement of women's emotional status. The preliminary data here presented confirm the positive effect of this association on the treatment of postpartum perineal pain. The supplementation of lipoic acid in association with omega-3 seems effective and safe for the treatment of chronic postpartum pain, allowing a pathogenetic approach to neuroinflammation, thus reducing the consumption of analgesic drugs, often contraindicated during breast-feeding.

  2. Is it time to reassess alpha lipoic acid and niacinamide therapy in schizophrenia?

    Science.gov (United States)

    Seybolt, Sheila E J

    2010-12-01

    As sulfur containing thiols, alpha lipoic acid (ALA) and its reduced form dihydrolipoic acid (DHLA) are powerful antioxidants and free radical scavengers capable of performing many of the same functions as glutathione (GSH). ALA supplementation may help protect mitochondria from oxidative stress, a possible mechanism contributing to certain forms of brain diseases called schizophrenia. Shortly before the advent of antipsychotic medications, two small studies found ALA relieved psychiatric symptoms in schizophrenia. More recently, animal studies have shown ALA augmentation improves mitochondrial function. At pharmaceutical levels, niacinamide helps preserve mitochondrial membrane integrity and acts as an antioxidant. ALA is a precursor for lipoamide, an essential mitochondrial coenzyme and niacinamide is a component of niacinamide adenine dinucleotide (NAD). NADH, the reduced form of NAD, is involved in the reduction of ALA to DHLA within the mitochondria. This is relevant to contemporary research because DHLA increases GSH and low GSH levels contribute to mitochondrial dysfunction and oxidative stress which have been implicated in the pathophysiology of schizophrenia. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. Protective Role of Alpha Lipoic Acid Against Disorders Induced by Gamma Radiation

    International Nuclear Information System (INIS)

    Abd El Azeem, Kh.N.M.

    2011-01-01

    Ionizing radiation interacts with living cells, causing a variety of biochemical changes depending on exposed and absorbed doses, duration of exposure, interval after exposure and susceptibility of tissues to ionizing radiation. So, it may increase the oxidative stress and damage of body organs. Alpha-lipoic acid (ALA-also known as thioctic acid) appears to be readily absorbed from an oral dose and converts easily to its reduced form, dihydro lipoic acid (DHLA), in many tissues of the body. ALA can neutralize free radicals in both fatty and watery regions of cells. The present study has been designed to evaluate the possible efficiency of ALA as antioxidant and radio-protector against radiation induced oxidative stress in different organs (liver, kidney and heart) in rats through estimation of the activity of markers of serum liver, kidney and heart function, in addition to the histopathological differentiation of these organs by light and electron microscope. Five equal groups were conducted for the study: control, ALA (30 mg/kg body wt), irradiated (each rat was exposed to 6 Gy as a fractionated dose of gamma (γ) radiation), irradiated plus ALA (each rat received ALA for 9 days simultaneously during exposure) and ALA plus irradiation plus ALA groups (each rat received ALA for a week pre-exposure plus 9 days during exposure). Radiation doses were fractionated dose levels of 2 Gy each 3 days to reach accumulative dose of 6 Gy. After 3 days of each exposure rats were sacrificed, except, those left for recovery test one month after last exposure. The results revealed that whole body γ-irradiation of rats induces oxidative stress in liver, kidney and heart obviously manifested by significant elevation in alanine and aspartate transaminase ( ALT and AST), alkaline phosphatase (ALP), urea, creatinine and creatine kinase (CK-MB). ALA treated-irradiated rats showed lower significantly values indicating remarkable improvement in all measured parameters and

  4. Alpha-lipoic acid protects cardiomyocytes against hypoxia/reoxygenation injury by inhibiting autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Xueming; Chen, Aihua, E-mail: aihuachen2012@sina.com; Yang, Pingzhen; Song, Xudong; Liu, Yingfeng; Li, Zhiliang; Wang, Xianbao; Wang, Lizi; Li, Yunpeng

    2013-11-29

    Highlights: •We observed the cell viability and death subjected to H/R in H9c2 cardiomyocytes. •We observed the degree of autophagy subjected to H/R in H9c2 cardiomyocytes. •LA inhibited the degree of autophagy in parallel to the enhanced cell survival. •LA inhibited the autophagy in parallel to the decreased total cell death. •We concluded that LA protected cardiomyocytes against H/R by inhibiting autophagy. -- Abstract: Hypoxia/reoxygenation (H/R) is an important in vitro model for exploring the molecular mechanisms and functions of autophagy during myocardial ischemia/reperfusion (I/R). Alpha-lipoic acid (LA) plays an important role in the etiology of cardiovascular disease. Autophagy is widely implicated in myocardial I/R injury. We assessed the degree of autophagy by pretreatment with LA exposed to H/R in H9c2 cell based on the expression levels of Beclin-1, LC3II/LC3I, and green fluorescent protein-labeled LC3 fusion proteins. Autophagic vacuoles were confirmed in H9c2 cells exposed to H/R using transmission electron microscopy. Our findings indicated that pretreatment with LA inhibited the degree of autophagy in parallel to the enhanced cell survival and decreased total cell death in H9c2 cells exposed to H/R. We conclude that LA protects cardiomyocytes against H/R injury by inhibiting autophagy.

  5. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing.

    Science.gov (United States)

    Shen, Tao; Jiang, Zhong-Liang; Li, Cong-Jun; Hu, Xiao-Chen; Li, Qing-Wang

    2016-04-01

    Alpha-lipoic acid (ALA) is known to be a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar spermatozoa and its antioxidant effect on boar spermatozoa during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0 or 10.0 mg/ml) of ALA were added to the extender used to freeze boar semen, and the effects on the quality and endogenous antioxidant enzyme activities of frozen-thawed spermatozoa were assessed. The results indicated that the addition of ALA to the extender resulted in a higher percentage of motile spermatozoa post-thaw (P < 0.05). The activities of superoxide dismutase, lactate dehydrogenase, glutamic-oxaloacetic transaminase and catalase improved after adding ALA to the extender (P < 0.05). Artificial insemination results showed that pregnancy rate and litter size were significantly higher at 6.0 mg/ml in the ALA group than in the control group (P < 0.05). In conclusion, ALA conferred a cryoprotective capacity to the extender used for boar semen during the process of freezing-thawing, and the optimal concentration of ALA for the frozen extender was 6.0 mg/ml.

  6. Protective effects of alpha lipoic acid on high glucose-induced neurotoxicity in PC12 cells.

    Science.gov (United States)

    Najafi, Rezvan; Sharifi, Ali Mohammad; Hosseini, Asieh

    2015-06-01

    Hyperglycemia plays an important role in the development of diabetic neuropathy. In this study, we investigated the protective effects of alpha lipoic acid (ALA) against high glucose-induced neurotoxicity in PC12 cells as a suitable in vitro model for studying neuronal functions. PC12 cells were treated with high glucose (25 mg/ml for 24 h) in the absence and presence of ALA (100 μM for 24 h). The viability of PC12 cells was estimated by using MTT assay. The expression of pro- apoptotic Bax, anti- apoptotic Bcl-2 and caspase 3 protein were evaluated by western blotting. The reactive oxygen species (ROS) levels were determined with 2,7-dichlorodihydro- fluorescein diacetate (H2DCFDA). Biochemical markers of oxidative stress were assessed by using the total antioxidant power (TAP), lipid peroxidation (LPO), ADP/ATP ratio, activity of antioxidant enzymes catalase (CAT) and superoxide dismutase (SOD). Pretreatment of PC12 cells with ALA, significantly improved high glucose-induced toxicity by increasing activity of antioxidant enzymes CAT and SOD in the PC12 cell. It also increased the concentrations of TAP. An elevated level of cell death and ROS in high glucose conditions, diminished with ALA treatment. Over expression of Bax and caspase 3 protein, elevation of ADP/ATP ratio and LPO level in high glucose- treated PC12 cells, were significantly reduced by ALA. It was concluded that ALA attenuates neurotoxicity induced by high glucose in PC12 cells.

  7. Alpha-lipoic acid induces sodium iodide symporter expression in TPC-1 thyroid cancer cell line

    International Nuclear Information System (INIS)

    Choi, Hyun-Jeung; Kim, Tae Yong; Ruiz-Llorente, Sergio; Jeon, Min Ji; Han, Ji Min; Kim, Won Gu; Shong, Young Kee; Kim, Won Bae

    2012-01-01

    Introduction: Patients with metastatic thyroid cancers that do not uptake iodine need effective therapeutic option. Differentiation-inducing agents have been tried to restore functional expression of sodium iodide symporter (NIS) without success. Our objective was to assess the effect of alpha-lipoic acid (ALA), known as potential antioxidant, on expression of sodium iodide symporter in thyroid cancer cells. Methods: Human thyroid cancer-derived cell lines, TPC-1, were treated with ALA, and changes in NIS mRNA and protein expression were measured. ALA's effect on NIS gene promoter was evaluated, and functional NIS expression was assessed by iodide uptake assay. Results: Treatment with ALA increased NIS mRNA expression up to ten folds of control dose-dependently after 24 h of exposure. ALA increased NIS promoter activity, and increased iodide uptake by 1.6 fold. ALA induced expression of NIS protein, but had no significant effect on the plasma membrane trafficking. ALA increased phosphorylation of CREB and nuclear translocation of pCREB, and co-treatment of ALA and trichostatin A increased iodide uptake by three folds in TPC-1 cells. Conclusions: ALA is a potential agent to increase NIS transcription in TPC-1. It could be used as an adjunctive agent to increase efficacy of radioiodine therapy if combined with a strategy to increase NIS protein trafficking to cell membrane.

  8. [Alpha lipoic acid and its antioxidant against cancer and diseases of central sensitization].

    Science.gov (United States)

    Durand, Marisa; Mach, Núria

    2013-01-01

    The alpha lipoic acid (ALA) may control and limit the production of free radicals, influencing the development of pathologies such cancer or central sensitization diseases. However, the molecular mechanisms are still not elucidated. The objective of the present review is to contrast the antioxidant properties of ALA in the prevention and development of pathologies related to the oxidative stress. In this work, more than 100 articles published during the last 20 years that relate ALA consumption and pathologies related to the oxidative stress have been analysed. The articles have been obtained from different specialized databases (PubMed central, Web of science, Elsevier Journal, Science Direct) and included experiments in animals, cells, and humans. Domains evaluated included ALA, central sensitization diseases, free radicals, and ALA. Results from in vitro and laboratory animals experiments demonstrate that ALA controls the cell apoptosis of different type of cancers through out the increase of reactive oxygen species, and decrease of cell growth. Moreover, results demonstrated that ALA presents an antioxidant capacity and the ability to regenerate other antioxidants, which is essential to treat the central sensitization diseases. The ALA plays a significant role as antioxidant and prooxidant in cancer and central sensitization diseases, although more extensive studies are required to determine the clinical significance in humans. Copyright © AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

  9. Modulatory effects of alpha-lipoic acid (ALA) administration on insulin sensitivity in obese PCOS patients.

    Science.gov (United States)

    Genazzani, A D; Shefer, K; Della Casa, D; Prati, A; Napolitano, A; Manzo, A; Despini, G; Simoncini, T

    2017-10-31

    To evaluate the efficacy of alpha-lipoic acid (ALA) administration on hormonal and metabolic parameters of obese PCOS patients. A group of 32 obese PCOS patients were selected after informed consent. 20 patients referred to have first grade relatives with diabetes type I or II. Hormonal and metabolic parameters as well as OGTT were evaluated before and after 12 weeks of ALA integrative administration (400 mg per os every day). ALA administration significantly decreased insulin, glucose, BMI and HOMA index. Hyperinsulinemia and insulin response to OGTT decreased both as maximal response (Δmax) and as AUC. PCOS with diabetes relatives showed the decrease also of triglyceride and GOT. Interestingly in all PCOS no changes occurred on all hormonal parameters involved in reproduction such as LH, FSH, and androstenedione. ALA integrative administration at a low dosage as 400 mg daily improved the metabolic impairment of all PCOS patients especially in those PCOS with familiar diabetes who have a higher grade of risk of NAFLD and predisposition to diabetes.

  10. The impact of alpha-lipoic acid on amikacin-induced nephrotoxicity.

    Science.gov (United States)

    Asci, Halil; Saygin, Mustafa; Cankara, Fatma Nihan; Bayram, Dilek; Yesilot, Sukriye; Candan, Ibrahim Aydin; Ilhan, Ilter

    2015-02-01

    Amikacin (AK) is an antibacterial drug, but it has remarkable nephrotoxic and ototoxic side effects due to increase in reactive oxygen radicals. This study was established to determine the possible protective effects of alpha-lipoic acid (ALA), a powerful antioxidant, on AK-induced nephrotoxicity. Three different groups of rats (n = 6) were administered saline (control), AK (1.2 g/kg, intraperitoneally), ALA (100 mg/kg, p.o.) and AK combination (ALA one day before the AK for five days). Renal function, oxidative stress markers and histological changes were evaluated at the end of the experiment. Malondialdehyde was increased as an indicator of free radical formation in AK-induced group and decreased with ALA treatment. While catalase activity was increased significantly, superoxide dismutase and glutathione peroxidase activities were not statistically significant increased with ALA treatment. The result showed that AK enhanced levels of urea, creatinine and blood urea nitrogen in serum significantly. Administration of ALA reduced these levels of biochemical markers. Histopathological observations were confirmed by biochemical findings. In conclusion, ALA is suggested to be a potential candidate to ameliorate AK-induced nephrotoxicity.

  11. The Antioxidant Cofactor Alpha-Lipoic Acid May Control Endogenous Formaldehyde Metabolism in Mammals

    Directory of Open Access Journals (Sweden)

    Anastasia V. Shindyapina

    2017-12-01

    Full Text Available The healthy human body contains small amounts of metabolic formaldehyde (FA that mainly results from methanol oxidation by pectin methylesterase, which is active in a vegetable diet and in the gastrointestinal microbiome. With age, the ability to maintain a low level of FA decreases, which increases the risk of Alzheimer's disease and dementia. It has been shown that 1,2-dithiolane-3-pentanoic acid or alpha lipoic acid (ALA, a naturally occurring dithiol and antioxidant cofactor of mitochondrial α-ketoacid dehydrogenases, increases glutathione (GSH content and FA metabolism by mitochondrial aldehyde dehydrogenase 2 (ALDH2 thus manifests a therapeutic potential beyond its antioxidant property. We suggested that ALA can contribute to a decrease in the FA content of mammals by acting on ALDH2 expression. To test this assumption, we administered ALA in mice in order to examine the effect on FA metabolism and collected blood samples for the measurement of FA. Our data revealed that ALA efficiently eliminated FA in mice. Without affecting the specific activity of FA-metabolizing enzymes (ADH1, ALDH2, and ADH5, ALA increased the GSH content in the brain and up-regulated the expression of the FA-metabolizing ALDH2 gene in the brain, particularly in the hippocampus, but did not impact its expression in the liver in vivo or in rat liver isolated from the rest of the body. After ALA administration in mice and in accordance with the increased content of brain ALDH2 mRNA, we detected increased ALDH2 activity in brain homogenates. We hypothesized that the beneficial effects of ALA on patients with Alzheimer's disease may be associated with accelerated ALDH2-mediated FA detoxification and clearance.

  12. In vitro evaluation of chitosan-coated liposome containing both coenzyme Q10 and alpha-lipoic acid: Cytotoxicity, antioxidant activity, and antimicrobial activity.

    Science.gov (United States)

    Zhao, Guodong; Hu, Caibiao; Xue, Ying

    2018-04-01

    Chitosan-coated liposome containing both coenzyme Q10 and alpha-lipoic acid (CCAL) was a novel multifunctional nano delivery system exhibited long-term stability at room temperature and high encapsulation efficiency. Which containing two kinds of antioxidants (coenzyme Q10 and alpha-lipoic acid) and two antibacterial agents (chitosan and alpha-lipoic acid). However, the further biocompatibility, such as cytotoxicity and antioxidant activity, and antimicrobial activity of CCAL, has not been systematically evaluated. This study aims to evaluate the cytotoxicity, antioxidant activity and antimicrobial activity of CCAL. This article evaluated the in vitro cytotoxicity and antioxidant activity of CCAL by CCK8 assay, and antimicrobial activity on Staphylococcus aureus and Escherichia coli was investigated. For antioxidant activity study, CCAL displayed significant antioxidant effect when compared with control group (Pcytotoxicity and artificial preservatives free. © 2017 Wiley Periodicals, Inc.

  13. Possible role of alpha-lipoic acid in the treatment of peripheral nerve injuries

    Directory of Open Access Journals (Sweden)

    Ranieri Maurizio

    2010-08-01

    Full Text Available Abstract Recent findings on the antioxidant effects of pretreatment with α-lipoic acid (α-LA on the crush injury of rat sciatic nerve confirm the possible usefulness of α-LA administration in humans with peripheral nerve injuries. We discussed this issue in relation with our recent results in which the combined employment of α-LA and γ-linolenic acid with a rehabilitation program for six weeks reduced sensory symptoms and neuropathic pain in patients with compressive radiculopathy syndrome from disc-nerve root conflict in comparison with patients submitted to rehabilitation program alone for six weeks.

  14. Cardiac fibrosis and dysfunction in experimental diabetic cardiomyopathy are ameliorated by alpha-lipoic acid

    Directory of Open Access Journals (Sweden)

    Li Chun-jun

    2012-06-01

    Full Text Available Abstract Background Alpha-lipoic acid (ALA, a naturally occurring compound, exerts powerful protective effects in various cardiovascular disease models. However, its role in protecting against diabetic cardiomyopathy (DCM has not been elucidated. In this study, we have investigated the effects of ALA on cardiac dysfunction, mitochondrial oxidative stress (MOS, extracellular matrix (ECM remodeling and interrelated signaling pathways in a diabetic rat model. Methods Diabetes was induced in rats by I.V. injection of streptozotocin (STZ at 45 mg/kg. The animals were randomly divided into 4 groups: normal groups with or without ALA treatment, and diabetes groups with or without ALA treatment. All studies were carried out 11 weeks after induction of diabetes. Cardiac catheterization was performed to evaluate cardiac function. Mitochondrial oxidative biochemical parameters were measured by spectophotometeric assays. Extracellular matrix content (total collagen, type I and III collagen was assessed by staining with Sirius Red. Gelatinolytic activity of Pro- and active matrix metalloproteinase-2 (MMP-2 levels were analyzed by a zymogram. Cardiac fibroblasts differentiation to myofibroblasts was evaluated by Western blot measuring smooth muscle actin (α-SMA and transforming growth factor–β (TGF-β. Key components of underlying signaling pathways including the phosphorylation of c-Jun N-terminal kinase (JNK, p38 MAPK and ERK were also assayed by Western blot. Results DCM was successfully induced by the injection of STZ as evidenced by abnormal heart mass and cardiac function, as well as the imbalance of ECM homeostasis. After administration of ALA, left ventricular dysfunction greatly improved; interstitial fibrosis also notably ameliorated indicated by decreased collagen deposition, ECM synthesis as well as enhanced ECM degradation. To further assess the underlying mechanism of improved DCM by ALA, redox status and cardiac remodeling associated

  15. Effects of alpha-lipoic acid supplementation on growth performance, antioxidant capacity and biochemical parameters for ammonia-exposed broilers.

    Science.gov (United States)

    Lu, Min; Bai, Jie; Wei, Fengxian; Xu, Bin; Sun, Quanyou; Li, Jie; Wang, Gaili; Tang, Xiangfang; Zhang, Hongfu; Yin, Qingqiang; Li, Shaoyu

    2017-08-01

    In order to estimate the effect of alpha-lipoic acid (LA) supplementation on relieving ammonia stress of broilers, 180 22-day-old male broilers were assigned to three groups, six replicates in each group and 10 birds per replicate. The three groups were: (1) a control group without ammonia stress; (2) exposure to 70 ppm atmospheric ammonia (AM); (3) exposure to 70 ppm atmospheric ammonia and administration of 300 mg/kg LA (AM + LA). The experimental period was 3 weeks. Results showed that average daily weight gain was increased and feed conversion ratio was decreased in the AM + LA group, compared with the AM group (P ammonia stress to restore broiler production performance to normal levels. © 2016 Japanese Society of Animal Science.

  16. Palladium alpha-lipoic acid complex formulation enhances activities of Krebs cycle dehydrogenases and respiratory complexes I-IV in the heart of aged rats.

    Science.gov (United States)

    Sudheesh, N P; Ajith, T A; Janardhanan, K K; Krishnan, C V

    2009-08-01

    Age-related decline in the capacity to withstand stress, such as ischemia and reperfusion, results in congestive heart failure. Though the mechanisms underlying cardiac decay are not clear, age dependent somatic damages to mitochondrial DNA (mtDNA), loss of mitochondrial function, and a resultant increase in oxidative stress in heart muscle cells may be responsible for the increased risk for cardiovascular diseases. The effect of a safe nutritional supplement, POLY-MVA, containing the active ingredient palladium alpha-lipoic acid complex, was evaluated on the activities of the Krebs cycle enzymes such as isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, and malate dehydrogenase as well as mitochondrial complexes I, II, III, and IV in heart mitochondria of aged male albino rats of Wistar strain. Administration of 0.05 ml/kg of POLY-MVA (which is equivalent to 0.38 mg complexed alpha-lipoic acid/kg, p.o), once daily for 30 days, was significantly (pKrebs cycle dehydrogenases, and mitochondrial electron transport chain complexes. The unique electronic and redox properties of palladium alpha-lipoic acid complex appear to be a key to this physiological effectiveness. The results strongly suggest that this formulation might be effective to protect the aging associated risk of cardiovascular and neurodegenerative diseases.

  17. Evaluation of Eudragit® Retard Polymers for the Microencapsulation of Alpha-Lipoic Acid.

    Science.gov (United States)

    Pecora, Tiziana M G; Musumeci, Teresa; Musumeci, Lucrezia; Fresta, Massimo; Pignatello, Rosario

    2016-01-01

    Microencapsulation of natural antioxidants in polymeric systems represents a possible strategy for improving the oral bioavailability of compounds that are otherwise poorly soluble. α-lipoic acid (ALA) was microencapsulated with polymethacrylate polymers (blends at various ratios of Eudragit® RS100 and RL100 resins). Microspheres were produced by solvent displacement of an ethanol cosolution of ALA and polymers; the microsuspensions were then freeze-dried, using trehalose as a cryoprotector. Microspheres were characterized in the solid state for micromeritic properties and drug loading, as well as by infrared spectroscopy, powder X-ray diffractometry and differential scanning calorimetry. The antioxidant activity of free and encapsulated ALA was assessed by the 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay. In vitro release studies, performed in simulated gastric (pH 1.2) and intestinal fluid (pH 6.8), showed that, depending on polymer composition and drug-to-polymer ratio, ALA release can be slowed down, compared to the dissolution pattern of the free drug. Solid-state characterization confirmed the chemical stability of ALA in the microspheres, suggesting that ALA did not develop strong interactions with the polymer and was present in an amorphous or a disordered-crystalline state within the polymer network. As indicated by the DPPH assay, the microencapsulation of ALA in Eudragit® Retard matrices did not alter its antioxidant activity. ALA was effectively encapsulated in Eudragit® Retard matrices, showing a chemical stability up to 6 months at room conditions and at 40°C. Moreover, since the drug maintained its antioxidant activity in vitro, the potential application of these microparticulate systems for oral administration would deserve further studies.

  18. Protective Effects of Alpha-Lipoic Acid on Oleic Acid-Induced Acute Lung Injury in Rats

    Directory of Open Access Journals (Sweden)

    Funda Gülcü Bulmuş

    2013-09-01

    Full Text Available Background: Oxidative stress is believed to be an important factor in the pathogenesis of acute lung injury (ALI. Aims: The aim of this study was to investigate the possible protective role of alpha-lipoic acid (α-LA on oleic acid (OA-induced ALI in rats. Study Design: Animal experiment. Methods: A total of thirty-five rats were divided into five groups in the study. Group 1 served as a control group. Rats in Group 2 (α-LA were administered α-LA intraperitoneally at a dose of 100 mg/kg body weight (BW. Rats in Group 3 (OA were administered OA intravenously at a dose of 100 mg/kg BW. In Group 4 (pre-OA-α-LA, α-LA was given 15 minutes prior to OA infusion, and in Group 5 (post-OA-α-LA, α-LA was given two hours after OA infusion. Four hours after the OA infusion, rats were decapitated. Blood samples were collected to measure serum levels of malondialdehyde (MDA and glutathione (GSH, and the levels of activity for superoxide dismutase (SOD, catalase (CAT and glutathione peroxidase (GSH-Px. Lung tissue samples were taken for histopathological examination. Results: Exposure to OA resulted in increases in serum MDA levels (p<0.001, as well as histopathological lesions in lung tissue, and decreases in CAT (p<0.05, GSH-Px (p<0.05 activities and GSH (p<0.05 levels. On the other hand, MDA levels were decreased significantly (p<0.001, while CAT (p<0.05, GSH-Px (p<0.01 activities and GSH (p<0.05 levels were increased significantly in the pre-OA-α-LA group compared with the OA group. Conclusion: α-LA was found to lessen oxidative stress and to have positive effects on antioxidants in cases of OA-induced ALI. In conclusion, α-LA appears to have protective effects against ALI and potential for the prevention of ALI.

  19. Role of alpha-lipoic acid in the management of anemia in patients with chronic renal failure undergoing hemodialysis

    Directory of Open Access Journals (Sweden)

    El-Nakib GA

    2013-08-01

    Full Text Available Gehad A El-Nakib,1 Tarek M Mostafa,2 Tarek M Abbas,4 Mamdouh M El-Shishtawy,3 Mokhtar M Mabrouk,2 Mohammed A Sobh41Mansoura University Hospitals, Mansoura, Egypt; 2Faculty of Pharmacy, Tanta University, Tanta, Egypt; 3Faculty of Pharmacy, Mansoura University, Mansoura, Egypt; 4Urology and Nephrology Centre, Faculty of Medicine, Mansoura University, Mansoura, EgyptIntroduction: Anemia associated with chronic kidney disease is a serious complication necessitating expenditure of huge medical efforts and resources. This study investigates the role of alpha-lipoic acid (ALA in end stage renal disease patients undergoing hemodialysis. By the virtue of its antioxidative effects, ALA is expected to act as an erythropoietin (EPO adjuvant, and also has extended beneficial effects on endothelial dysfunction.Methods: Forty-four patients undergoing hemodialysis and receiving EPO were randomized into two groups: the first group received ALA 600 mg once daily for 3 months; while the other group represented the control group. Parameters measured at baseline and at end of study were hemoglobin, EPO doses, EPO resistance index (ERI, iron store indices, malondialdehyde, oxidized low-density lipoprotein (ox-LDL, interleukin-6 (IL-6, tumor necrosis factor-α (TNF-α, and asymmetric dimethylarginine (ADMA, as well as routine laboratory follow-up.Results: EPO doses and ERI were significantly decreased in the treatment group, while they did not change in the control group. Hemoglobin, iron store indices, malondialdehyde, oxidized ox-LDL, IL-6, TNF-α, and ADMA were similar in both treatment and control groups at baseline, and did not change by the end of study period. Likewise, routine laboratory measures were not affected by the treatment.Conclusion: ALA could be used in hemodialysis patients to reduce requirements for EPO. However, larger and longer term studies are required to clarify the exact role of ALA in hemodialysis as well as in pre-hemodialysis patients

  20. Effect of Oral Alpha Lipoic Acid in Preventing the Genesis of Canine Diabetic Cataract: A Preliminary Study.

    Science.gov (United States)

    Williams, David L

    2017-03-16

    Blinding cataract is a significant effect of canine diabetes with 75% of animals affected two years after diagnosis. Lens opacification occurs primarily through the generation of sorbitol, a sugar alcohol, through the action of aldose reductase (AR). The osmotic effect of sorbitol draws water into the lens, causing opacification. Inhibition of AR should thus prevent the generation of cataracts. A topical AR inhibitor has been shown to have this effect, as has the commercially available neutraceutical OcuGLO, containing the AR inhibitor alpha lipoic acid (ALA) together with other plant-based antioxidants. Here a comparison is made between the number of diabetic dogs developing cataracts when given oral ALA alone and those given a mix containing ascorbic acid and tocopherol. Animals given ALA developed significantly fewer lens opacities than those given conventional antioxidants. Cataracts which formed occurred at a significantly greater duration after the commencement of treatment than those on the antioxidant mix. Although this is a small study conducted over a short period, the significant benefit of ALA in diabetic dogs is a reason to evaluate these effects in larger trials. As AR is involved in diabetic retinopathy and neuropathy, this enzyme inhibitor may be worthy of evaluation in preventing these conditions in human diabetics also.

  1. Influence of alpha-lipoic acid on nicotine-induced lung and liver damage in experimental rats.

    Science.gov (United States)

    Ateyya, Hayam; Nader, Manar A; Attia, Ghalia M; El-Sherbeeny, Nagla A

    2017-05-01

    Nicotine mediates some of the injurious effects caused by consuming tobacco products. This work aimed at investigating the defensive role of alpha-lipoic acid (ALA) with its known antioxidant and antiinflammatory effect in nicotine-induced lung and liver damage. Rats were arranged into 4 groups: control, nicotine, ALA, and ALA-nicotine groups. Oxidative stress and antioxidant status were determined by assessing thiobarbituric acid reactive substances (TBARS), superoxide dismutase (SOD), and glutathione (GSH) levels in lung and liver. Liver enzymes and lipid profiles were measured and pulmonary and hepatic damage were assessed by histopathological examination. Also, serum levels of transforming growth factor beta 1 (TGF-β1) and vascular cell adhesion molecule 1 (VCAM-1) were determined. The results revealed an increase in TBARS in tissues and a reduction in both SOD and GSH activity in the nicotine-treated rats. Nicotine induced high levels of liver enzymes, TGF-β1, VCAM-1, and dyslipidemia with histopathological changes in the lung and liver. ALA administration along with nicotine attenuated oxidative stress and normalized the SOD and GSH levels, ameliorated dyslipidemia, and improved TGF-β1 and VCAM-1 with better histopathology of the lung and liver. The study data revealed that ALA may be beneficial in alleviating nicotine-induced oxidative stress, dyslipidemia, and both lung and liver damage.

  2. Effect of Oral Alpha Lipoic Acid in Preventing the Genesis of Canine Diabetic Cataract: A Preliminary Study

    Directory of Open Access Journals (Sweden)

    David L. Williams

    2017-03-01

    Full Text Available Blinding cataract is a significant effect of canine diabetes with 75% of animals affected two years after diagnosis. Lens opacification occurs primarily through the generation of sorbitol, a sugar alcohol, through the action of aldose reductase (AR. The osmotic effect of sorbitol draws water into the lens, causing opacification. Inhibition of AR should thus prevent the generation of cataracts. A topical AR inhibitor has been shown to have this effect, as has the commercially available neutraceutical OcuGLO, containing the AR inhibitor alpha lipoic acid (ALA together with other plant-based antioxidants. Here a comparison is made between the number of diabetic dogs developing cataracts when given oral ALA alone and those given a mix containing ascorbic acid and tocopherol. Animals given ALA developed significantly fewer lens opacities than those given conventional antioxidants. Cataracts which formed occurred at a significantly greater duration after the commencement of treatment than those on the antioxidant mix. Although this is a small study conducted over a short period, the significant benefit of ALA in diabetic dogs is a reason to evaluate these effects in larger trials. As AR is involved in diabetic retinopathy and neuropathy, this enzyme inhibitor may be worthy of evaluation in preventing these conditions in human diabetics also.

  3. Pathological effects of cigarettes on the reproductive system and the protective effects of alpha-lipoic acid in female rats.

    Science.gov (United States)

    Asci, Halil; Erol, Onur; Ellidag, Hamit Yasar; Tola, Esra Nur; Savran, Mehtap; Ozmen, Ozlem

    2018-01-01

    Cigarette smoking (CS) has some detrimental effects that occur via oxidative stress (OS). The aim of this work was to demonstrate the pathological and immunohistochemical effects of CS and the protective effects of a strong antioxidant alpha lipoic acid (ALA) on CS-induced genital system changes in a rat model. Twenty-eight female rats were randomly allocated to three groups as control, CS-exposed, and CS-exposed and ALA-treated. Reproductive tract organs were collected for biochemical and pathological examinations. In the CS group, OS markers increased in the tissues of both the ovary and fallopian tubes. Decreased follicle numbers in the ovary, marked cilial loss in the fallopian tubes, and pathologic changes in the uterus were observed in the CS group. Positive calcitonin gene-related peptide (CGRP), caspase 3α, hypoxia-inducible factor 1α (HIF-1α), tumor necrosis factor-α (TNF-α) immunoreactions were observed in uterine tissues and HIF-1α immunoreactions in tubal and uterine epithelial cells of the CS group. ALA reversed all these findings effectively. CS has negative effects on the female reproductive system via HIF-1α in tuba uterina and HIF-1α, HIF-2α, TNF-α, caspase 3, and CGRP in the uterus, and ALA could protect against the negative effects of CS on the female reproductive system.

  4. The effectiveness of evening primrose oil and alpha lipoic acid in recovery of nerve function in diabetic rats

    Directory of Open Access Journals (Sweden)

    Abeer Mohamed Rashad

    2011-09-01

    Full Text Available Objectives: Diabetic polyneuropathy is a serious complication of diabetes mellitus and the most frequent neuropathy worldwide. Evening primrose oil (EPO is rich in omega-6 essential fatty acid component and gamma-linolenic acid. Alpha lipoic acid (ALPA has a protective effect against lipid peroxidation and helps in scavenging free radicals. Data regarding the effect of treatment with EPO on diabetic parameters and neuropathic manifestations are conflicting. This study aimed to determine the therapeutic efficacy of EPO and ALPA in correcting diabetic parameters and functional and structural neuropathic manifestations in streptozotocin (STZ induced diabetic rats.Materials and methods: In this study, the effects of two week oral treatment with EPO (1.25 g/kg was compared to that of ALPA (100 mg/kg and insulin (2 IU/day, utilized singly or in combination.Results: Compared with untreated diabetic rats, EPO and ALPA resulted in reduction of serum levels of glucose (p<0.05, total cholesterol (p<0.01, triglycerides (p<0.01, low density lipoprotein cholesterol (p<0.01, thiobarbituric acid reactive substance (a marker of oxidative stress (p<0.05, and increased in levels of high density lipoprotein cholesterol (p<0.05 and total antioxidant capacity (p<0.05. Enhanced positive effect was observed with combination therapy.Conclusion: This work indicates that EPO and ALPA, particularly when used in combination, improve glycemic control, lipid abnormalities and antioxidant capacity, thus restore the impaired functional properties of peripheral nerves to a great extent. J Clin Exp Invest 2011; 2 (3: 245-253.

  5. Lens and cornea lesions of rats fed corn syrup and the protective effects of alpha lipoic acid.

    Science.gov (United States)

    Gunes, Alime; Ozmen, Ozlem; Saygın, Mustafa; Ascı, Halil; Tok, Levent; Tok, Ozlem; Dıncoglu, Dılnur

    2016-03-01

    To examine the pathological findings that occurred in the lens and cornea and biochemical findings in the lens of rats fed with corn syrup and the protective effects of alpha lipoic acid (ALA). Twenty-four rats were randomly divided into three groups. Group I served as the control group. Group II was used as the study group; the rats were treated with 30% corn sugar solution for 10 weeks. Group III was the treatment group. Corn syrup was given by the oral route to the rats during the study, and ALA (100 mg/kg) was added to the treatment 4 weeks after the study began. At the end of the experiment, central corneal thickness (CCT) was measured in all rats with an ultrasonic pachymeter. Then the right eyes of the rats were enucleated for histopathological examination of the cornea and lens. The left lenses were homogenized for biochemical analyses. The lenses of the rats treated with corn syrup revealed severe damage; many lens fibers appeared swollen and ruptured with large vacuoles near the lens epithelium. In addition, malondialdehyde (MDA) levels, a parameter of oxidative stress, increased but not significantly in Group II; however. ALA treatment decreased MDA levels significantly. Antioxidant enzyme and catalase (CAT) activities were significantly decreased in Group II, and ALA treatment increased these activities; however, the increase was not significant. Changes were observed in the cornea such as epithelial alterations, subepithelial vacuolizations, collagen fibers loss in the stromal layer, interruptions in the subepithelial basement membrane and central corneal thickening. Corn syrup can cause severe damage in rat lenses and corneas. However, ALA ameliorates the effect of corn syrup-related lesions on the cornea and lens.

  6. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    Directory of Open Access Journals (Sweden)

    Y. Li

    2014-06-01

    Full Text Available Alpha-lipoic acid (α-LA is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1. Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05 change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver.

  7. Erythrocyte osmotic fragility and lipid peroxidation following chronic co-exposure of rats to chlorpyrifos and deltamethrin, and the beneficial effect of alpha-lipoic acid

    Directory of Open Access Journals (Sweden)

    Chidiebere Uchendu

    2014-01-01

    Full Text Available The present study aimed to evaluate the effect of chronic co-exposure to chlorpyrifos (CPF and deltamethrin (DLT on erythrocyte osmotic fragility, lipid peroxidation and the ameliorative effect of alpha-lipoic acid (ALA on erythrocyte fragility. Thirty-six male Wistar rats divided into six groups of six rats each were used for the study. Groups I (S/oil and II (ALA were given soya oil (2 ml/kg and ALA (60 mg/kg, respectively. Rats in group III (DLT and IV (CPF were exposed to DLT (6.25 mg/kg and CPF (4.75 mg/kg (1/20th of the previously determined LD50 of 125 mg/kg and 95 mg/kg, respectively, over a period of 48 h. Rats in group V (CPF + DLT were co-exposed to CPF (4.75 mg/kg and DLT (6.25 mg/kg, while those in group VI (ALA + CPF + DLT were pretreated with ALA (60 mg/kg and then co-exposed to CPF and DLT, 45 min later. The treatments were administered by gavage once daily for a period of 16 weeks. Blood collected at the end of the experimental period were analyzed for erythrocyte osmotic fragility and malondialdehyde (MDA concentration. The study showed that chronic co-exposure to CPF and DLT resulted in an increase in erythrocyte fragility and MDA concentration which were ameliorated by supplementation with alpha-lipoic acid. The study concluded that repeated co-exposure to CPF and DLT elevated erythrocyte fragility probably due to increased lipid peroxidation, and pretreatment with alpha-lipoic acid ameliorated these alterations.

  8. Alpha-lipoic acid effects on brain glial functions accompanying double-stranded RNA antiviral and inflammatory signaling.

    Science.gov (United States)

    Scumpia, Philip O; Kelly-Scumpia, Kindra; Stevens, Bruce R

    2014-01-01

    Double-stranded RNAs (dsRNA) serve as viral ligands that trigger innate immunity in astrocytes and microglial, as mediated through Toll-like receptor 3 (TLR3) and dsRNA-dependent protein kinase (PKR). Beneficial transient TLR3 and PKR anti-viral signaling can become deleterious when events devolve into inflammation and cytotoxicity. Viral products in the brain cause glial cell dysfunction, and are a putative etiologic factor in neuropsychiatric disorders, notably schizophrenia, bipolar disorder, Parkinson's, and autism spectrum. Alpha-lipoic acid (LA) has been proposed as a possible therapeutic neuroprotectant. The objective of this study was to test our hypothesis that LA can control untoward antiviral mechanisms associated with neural dysfunction. Utilizing rat brain glial cultures (91% astrocytes:9% microglia) treated with PKR- and TLR3-ligand/viral mimetic dsRNA, polyinosinic-polycytidylic acid (polyI:C), we report in vitro glial antiviral signaling and LA reduction of the effects of this signaling. LA blunted the dsRNA-stimulated expression of IFNα/β-inducible genes Mx1, PKR, and TLR3. And in polyI:C treated cells, LA promoted gene expression of rate-limiting steps that benefit healthy neural redox status in glutamateric systems. To this end, LA decreased dsRNA-induced inflammatory signaling by downregulating IL-1β, IL-6, TNFα, iNOS, and CAT2 transcripts. In the presence of polyI:C, LA prevented cultured glial cytotoxicity which was correlated with increased expression of factors known to cooperatively control glutamate/cystine/glutathione redox cycling, namely glutamate uptake transporter GLAST/EAAT1, γ-glutamyl cysteine ligase catalytic and regulatory subunits, and IL-10. Glutamate exporting transporter subunits 4F2hc and xCT were downregulated by LA in dsRNA-stimulated glia. l-Glutamate net uptake was inhibited by dsRNA, and this was relieved by LA. Glutathione synthetase mRNA levels were unchanged by dsRNA or LA. This study demonstrates the protective

  9. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging

    Science.gov (United States)

    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida

    2015-01-01

    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA. PMID:26788510

  10. Clinical Usefulness of Oral Supplementation with Alpha-Lipoic Acid, Curcumin Phytosome, and B-Group Vitamins in Patients with Carpal Tunnel Syndrome Undergoing Surgical Treatment

    Directory of Open Access Journals (Sweden)

    Giorgio Pajardi

    2014-01-01

    Full Text Available We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS, scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n=60 served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n=60 received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation. Patients in Group C (n=60 received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05. Moreover, patients in Group B had a significantly lower number of positive Phalen’s tests at 3 months compared with the other study groups (P<0.05. We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve.

  11. A Comparative Study of Effects of Omega‑3 Fatty Acids, Alpha Lipoic ...

    African Journals Online (AJOL)

    We also observed decrease in fasting blood glucose in the three treatment group but it was not statistically significant (Gr. I = 0.51, Gr. II = 0.05, Gr. III = 0.22,. Gr. IV = 0.88). Conclusion: ALA, Omega 3 fatty acid and vitamin E can be used as add on therapy in patients with type 2 diabetes mellitus to improve insulin sensitivity ...

  12. Effect of saponified high fat sunflower oilcake and lipoic acid ...

    African Journals Online (AJOL)

    unsaturated fatty acids (PUFA) are toxic to cellulolytic bacteria and are also saturated in the rumen. Stabilization of residual oil in sunflower oilcake by conversion into calcium salts would be advantageous. Alpha lipoic acid acts as an anti-oxidant to ...

  13. Sperm quality after swim up and density gradient centrifugation sperm preparation with supplementation of alpha lipoic acid (ALA): A preliminary study

    Science.gov (United States)

    Lestari, Silvia W.; Lestari, Sarah H.; Pujianto, Dwi A.

    2018-02-01

    Intra uterine insemination (IUI) as one of the treatment for infertility, persists low success rate. A factor that contributes to the unsuccessful of IUI is sperm preparation, performed through Swim-up (SU) and Density Gradient Centrifugation (DGC) methods. Furthermore, studies have shown that Alpha Lipoic Acid (ALA) is a potent antioxidant that could enhance the sperm motility and protect the DNA integrity of the sperm [1]. This study is aimed to re-evaluate the efficiency of the DGC and SU methods in selecting sperm before being transferred for IUI by the supplementation of ALA based on the sperm DNA integrity. Semen samples were obtained from 13 men from partners of women who are infertile (normozoospermia) and underwent IUI. Semen analysis based on the guideline of World Health Organization (WHO) 2010 was performed to measure the sperm motility and velocity, before and after sperm preparation. Then, samples were incubated with Alpha Lipoic Acid (ALA) in 0.625 mg (ALA 1), 1.25 mg (ALA 2) and 2.5 mg (ALA 3). The Sperm Chromatin Dispersion (SCD) test was performed to evaluate the sperm DNA Fragmentation Index (DFI). The percentage of motile sperm was higher in prepared sperm (post-DGC and post-SU) than in whole semen. Furthermore, the percentage of motile sperm was higher in post-DGC compared to post-SU. The level of DFI after the supplementation of ALA was decreased in prepared sperm compared to the whole semen. ALA was proved capable to select the better sperm quality with decreased sperm DNA fragmentation of prepared sperm in the all of DFI category.

  14. A new regulatory mechanism for bacterial lipoic acid synthesis

    OpenAIRE

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60?years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physi...

  15. Effect of myo-inositol and alpha-lipoic acid on oocyte quality in polycystic ovary syndrome non-obese women undergoing in vitro fertilization: a pilot study.

    Science.gov (United States)

    Rago, R; Marcucci, I; Leto, G; Caponecchia, L; Salacone, P; Bonanni, P; Fiori, C; Sorrenti, G; Sebastianelli, A

    2015-01-01

    The aim of the present study was to evaluate the effectiveness of the combined administration of myo-inositol and α-lipoic acid in polycystic ovary syndrome (PCOS) patients with normal body mass index (BMI), who had previously undergone intracytoplasmic sperm injection (ICSI) and received myo-inositol alone. Thirty-six of 65 normal-weight patients affected by PCOS who did not achieve pregnancy and one patient who had a spontaneous abortion were re-enrolled and given a cycle of treatment with myo-inositol and α-lipoic acid. For all female partners of the treated couples, the endocrine-metabolic and ultrasound parameters, ovarian volume, oocyte and embryo quality, and pregnancy rates were assessed before and after three months of treatment and compared with those of previous in vitro fertilization (IVF) cycle(s). After supplementation of myo-inositol with α-lipoic acid, insulin levels, BMI and ovarian volume were significantly reduced compared with myo-inositol alone. No differences were found in the fertilization and cleavage rate or in the mean number of transferred embryos between the two different treatments, whereas the number of grade 1 embryos was significantly increased, with a significant reduction in the number of grade 2 embryos treated with myo-inositol plus α-lipoic acid. Clinical pregnancy was not significantly different with a trend for a higher percentage for of myo-inositol and α-lipoic acid compared to the myo-inositol alone group. Our preliminary data suggest that the supplementation of myo-inositol and α-lipoic acid in PCOS patients undergoing an IVF cycle can help to improve their reproductive outcome and also their metabolic profiles, opening potential for their use in long-term prevention of PCOS.

  16. Alpha-lipoic acid protects oxidative stress, changes in cholinergic system and tissue histopathology during co-exposure to arsenic-dichlorvos in rats.

    Science.gov (United States)

    Dwivedi, Nidhi; Flora, Govinder; Kushwaha, Pramod; Flora, Swaran J S

    2014-01-01

    We investigated protective efficacy of α-lipoic acid (LA), an antioxidant against arsenic and DDVP co-exposed rats. Biochemical variables suggestive of oxidative stress, neurological dysfunction, and tissue histopathological alterations were determined. Male rats were exposed either to 50 ppm sodium arsenite in drinking water or in combination with DDVP (4 mg/kg, subcutaneously) for 10 weeks. α-Lipoic acid (50mg/kg, pos) was also co-administered in above groups. Arsenic exposure led to significant oxidative stress along, hepatotoxicity, hematotoxicity and altered brain biogenic amines levels accompanied by increased arsenic accumulation in blood and tissues. These altered biochemical variables were supported by histopathological examinations leading to oxidative stress and cell death. These biochemical alterations were significantly restored by co-administration of α-lipoic acid with arsenic and DDVP alone and concomitantly. The results indicate that arsenic and DDVP induced oxidative stress and cholinergic dysfunction can be significantly protected by the supplementation of α-lipoic acid. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Myoinositol combined with alpha-lipoic acid may improve the clinical and endocrine features of polycystic ovary syndrome through an insulin-independent action.

    Science.gov (United States)

    De Cicco, Simona; Immediata, Valentina; Romualdi, Daniela; Policola, Caterina; Tropea, Anna; Di Florio, Christian; Tagliaferri, Valeria; Scarinci, Elisa; Della Casa, Silvia; Lanzone, Antonio; Apa, Rosanna

    2017-09-01

    The aim of our study was to investigate the effects of a combined treatment with alpha-lipoic acid (ALA) and myoinositol (MYO) on clinical, endocrine and metabolic features of women affected by polycystic ovary syndrome (PCOS). In this pilot cohort study, forty women with PCOS were enrolled and clinical, hormonal and metabolic parameters were evaluated before and after a six-months combined treatment with ALA and MYO daily. Studied patients experienced a significant increase in the number of cycles in six months (p < 0.01). The free androgen index (FAI), the mean androstenedione and DHEAS levels significantly decreased after treatment (p < 0.05). Mean SHBG levels significantly raised (p < 0.01). A significant improvement in mean Ferriman-Gallwey (F-G) score (p < 0.01) and a significant reduction of BMI (p < 0.01) were also observed. A significant reduction of AMH levels, ovarian volume and total antral follicular count were observed in our studied women (p< 0.05). No significant changes occurred in gluco-insulinaemic and lipid parameters after treatment. The combined treatment of ALA and MYO is able to restore the menstrual pattern and to improve the hormonal milieu of PCOS women, even in the absence of apparent changes in insulin metabolism.

  18. Gas-saturated solution process to obtain microcomposite particles of alpha lipoic acid/hydrogenated colza oil in supercritical carbon dioxide.

    Science.gov (United States)

    Mishima, Kenji; Honjo, Masatoshi; Sharmin, Tanjina; Ito, Shota; Kawakami, Ryo; Kato, Takafumi; Misumi, Makoto; Suetsugu, Tadashi; Orii, Hideaki; Kawano, Hiroyuki; Irie, Keiichi; Sano, Kazunori; Mishima, Kenichi; Harada, Takunori; Ouchi, Mikio

    2016-09-01

    Alpha lipoic acid (ALA), an active substance in anti-aging products and dietary supplements, need to be masked with an edible polymer to obscure its unpleasant taste. However, the high viscosity of the ALA molecules prevents them from forming microcomposites with masking materials even in supercritical carbon dioxide (scCO2). Therefore, the purpose of this study was to investigate and develop a novel production method for microcomposite particles for ALA in hydrogenated colza oil (HCO). Microcomposite particles of ALA/HCO were prepared by using a novel gas-saturated solution (PGSS) process in which the solid-dispersion method is used along with stepwise temperature control (PGSS-STC). Its high viscosity prevents the formation of microcomposites in the conventional PGSS process even under strong agitation. Here, we disperse the solid particles of ALA and HCO in scCO2 at low temperatures and change the temperature stepwise in order to mix the melted ALA and HCO in scCO2. As a result, a homogeneous dispersion of the droplets of ALA in melted HCO saturated with CO2 is obtained at high temperatures. After the rapid expansion of the saturated solution through a nozzle, microcomposite particles of ALA/HCO several micrometers in diameter are obtained.

  19. Alpha-lipoic acid mitigates toxic-induced demyelination in the corpus callosum by lessening of oxidative stress and stimulation of polydendrocytes proliferation.

    Science.gov (United States)

    Sanadgol, Nima; Golab, Fereshteh; Askari, Hassan; Moradi, Fatemeh; Ajdary, Marziyeh; Mehdizadeh, Mehdi

    2018-02-01

    Multiple Sclerosis (MS), is a disease that degenerates myelin in central nervous system (CNS). Reactive oxygen species (ROSs) are toxic metabolites, and accumulating data indicate that ROSs-mediated apoptosis of oligodendrocytes (OLGs) plays a major role in the pathogenesis of MS under oxidative stress conditions. In this study, we investigated the role of endogenous antioxidant alpha-lipoic acid (ALA) as ROSs scavenger in the OLGs loss and myelin degeneration during cuprizone (cup)-induced demyelination in the experimental model of MS. Our results have shown that ALA treatment significantly increased population of mature OLGs (MOG + cells), as well as decreased oxidative stress (ROSs, COX-2 and PGE2) and apoptosis mediators (caspase-3 and Bax/Bcl2 ratio) in corpus callosum (CC). Surprisingly, ALA significantly stimulates population of NG2 chondroitin sulfate proteoglycan positive glia (NG2 + cells or polydendrocytes), from week 4 afterward. Accordingly ALA could prevents apoptosis, delays demyelination and recruits OLGs survival and regeneration mechanisms in CC. We conclude that ALA has protective effects against toxic demyelination via reduction of redox signaling, and alleviation of polydendrocytes vulnerability to excitotoxic challenge.

  20. Alpha lipoic acid (ALA modulates expression of apoptosis associated proteins in hippocampus of rats exposed during postnatal period to sodium arsenite (NaAsO2

    Directory of Open Access Journals (Sweden)

    Shilpi Dixit

    2015-01-01

    Full Text Available The present study focused on the role of exogenous alpha lipoic acid (ALA in amelioration of inorganic arsenic (iAs induced effects on apoptosis and apoptosis associated proteins in developing rat hippocampus. NaAsO2 (1.5/2.0 mg/kg bw alone or along with ALA (70 mg/kg bw was administered to rat pups (experimental groups by intraperitoneal (i.p. route from postnatal day (PND 4–15. Controls received no treatment/distilled water/ALA. On PND 16, the animals were perfusion fixed and the brains were processed for paraffin embedding (CV and TUNEL staining and cryopreservation (immunohistochemistry. The fresh brain tissue was used for Western blotting. Significant increase was observed in TUNEL positive cells and Bax (pro-apoptotic protein expression in hippocampal sub-regions of iAs alone treated groups, whereas Bcl-2 expression was intensified in animals receiving ALA with iAs. Densitometric analysis (Western blots revealed optimal restoration of Bax and Bcl-2 ratio in animals receiving ALA with iAs, thereby suggesting the protective role of ALA in iAs induced developmental neurotoxicity.

  1. Survival of buffalo bull spermatozoa: effect on structure and function due to alpha-lipoic acid and cholesterol-loaded cyclodextrin.

    Science.gov (United States)

    Fayyaz, M H; Ahmad, M; Ahmad, N

    2017-05-01

    Sperm survival depending upon integral membranes and function is imperative for fertilization. This study was designed to augment survival of buffalo spermatozoa using alpha-lipoic acid (ALA) and cholesterol-loaded cyclodextrin (CLC) during cryopreservation. Semen was frozen using 0, 0.5, 1, 1.5, 2 and 2.5 mmol L -1 ALA (experiment 1) and ALA or CLC separately or together (experiment 2). Semen was assessed for post-thaw motility, plasma membrane integrity (PMI), intact acrosome and plasma membrane (IACR-IPM) and DNA integrity at 0, 1.5, 3 and 4.5 hr of incubation. In experiment 1, use of 0.5 mmol L -1 ALA enhanced the sperm cryosurvival and post-thaw longevity than other groups up to 4.5 hr of incubation, and this concentration of ALA was used in second experiment with CLC. The results revealed higher (p sperm survival function and time of sperm attributes due to use of ALA than CLC and control. However, the sperm quality did not improve (p > .05) when ALA was combined with CLC. In conclusion, survival of buffalo bull spermatozoa during freeze-thawing and post-thaw incubation can be enhanced more with ALA than CLC or control, followed by CLC than control. However, there is no synergistic effect on survival of buffalo bull spermatozoa due to ALA and CLC. © 2016 Blackwell Verlag GmbH.

  2. Effects of Alpha Lipoic Acid on Multiple Cytokines and Biomarkers and Recurrence of Atrial Fibrillation Within 1 Year of Catheter Ablation.

    Science.gov (United States)

    Sardu, Celestino; Santulli, Gaetano; Santamaria, Matteo; Barbieri, Michelangela; Sacra, Cosimo; Paolisso, Pasquale; D'Amico, Fabio; Testa, Nicola; Caporaso, Igor; Paolisso, Giuseppe; Marfella, Raffaele; Rizzo, Maria Rosaria

    2017-05-01

    Catheter ablation (CA) is a procedure commonly used to restore sinus rhythm in patients with atrial fibrillation (AF). However, AF recurrence after CA remains a relevant clinical issue. We tested the effects of an oral antioxidant treatment (alpha lipoic acid [ALA]) on AF recurrence post-CA. Patients with paroxysmal AF have been enrolled in a randomized, prospective, double-blind, controlled placebo trial. After CA, patients have been randomly assigned to receive ALA oral supplementation (ALA group) or placebo (control group) and evaluated at baseline and after a 12-month follow-up: 73 patients completed the 12-month follow-up (ALA: 33 and control: 40). No significant difference has been detected between the 2 groups at baseline. Strikingly, 1 year after CA, ALA therapy significantly reduced serum markers of inflammation. However, there was no significant difference in AF recurrence events at follow-up comparing ALA with placebo group. Multivariate analysis revealed that the only independent prognostic risk factor for AF recurrence after CA is age. In conclusion, ALA therapy reduces serum levels of common markers of inflammation in ablated patients. Nevertheless, ALA does not prevent AF recurrence after an ablative treatment. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. New arguments for beneficial effects of alpha-lipoic acid on the cardiovascular system in the course of type 2 diabetes.

    Science.gov (United States)

    Dworacka, Marzena; Chukanova, Galina; Iskakova, Saule; Kurmambayev, Yergen; Wesołowska, Anna; Frycz, Bartosz A; Jagodziński, Paweł P; Dworacki, Grzegorz

    2018-02-07

    Alpha-lipoic acid (ALA), widely known as an antioxidant, modifies also serum levels of angiogenic factors in type 2 diabetic patients. These pharmacological activities may influence the status of the cardiovascular system. Taking into consideration that diabetes is related to the increased cardiovascular risk we investigated several effects of ALA on angiogenic factors in the myocardium and in the aortal wall using a rat model of type 2 diabetes. Diabetes was induced in Wistar rats by a fat-rich diet and by intraperitoneal injection of a small dose of streptozotocin (30 mg/kg). Animals were divided into 3 groups: ALA-treated type 2 diabetes rat model, placebo-treated type 2 diabetes rat model and placebo-treated non-diabetic rats. ALA was administered orally once a day, 20 mg/kg, for 8 consecutive weeks. mRNA VEGF, VEGF-R1 and VEGF-R2 expression was measured in the myocardium and the aortal wall, simultaneously with circulating VEGF and circulating endothelial cells (cEC) and endothelial progenitor cells (cEPC). ALA induced pro-angiogenic effect in the myocardium of rats with diabetes increasing mRNA VEGF expression and decreasing mRNA VEGFR-1 expression, while in the aortal wall ALA increased mRNA VEGFR-2 and VEGFR-1 expression. cVEGF in the ALA-treated group was higher comparing to both control groups. It was revealed that cEC percentage in the ALA-treated group was decreased with no effect on the percentage of cEPC. In summary, the current data provide novel findings about potential beneficial effects of ALA on angiogenic factors in the cardiovascular system, especially on myocardium, in the course of type 2 diabetes. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Potential administration of lipoic acid and coenzyme Q against ...

    African Journals Online (AJOL)

    Potential administration of lipoic acid and coenzyme Q against adipogensis: target for weight reduction. ... prevents its accumulation in visceral tissues. Further studies should be carried out to examine the mechanistic signals of these nutrients that helps in weight = management. Keywords: lipolysis, obesity, lipoic acid, Co-Q ...

  5. Effects of Dietary Alpha-lipoic Acid and Acetyl-L-carnitine on Growth Performance and Meat Quality in Arbor Acres Broilers

    Directory of Open Access Journals (Sweden)

    Yong Zhang

    2014-07-01

    Full Text Available An experiment was conducted to evaluate the effects of dietary alpha-lipoic acid (LA and acetyl-L-carnitine (ALC on growth performance, carcass characteristics and meat quality in Arbor Acres broilers. A total of 486 1-d-old male Arbor Acres broilers were randomly allocated to 9 dietary treatments, 9 treatments were group A (0 mg/kg LA and 0 mg/kg ALC, group B (50 mg/kg LA and 0 mg/kg ALC, group C (100 mg/kg LA and 0 mg/kg ALC, group D (0 mg/kg LA and 50 mg/kg ALC, group E (50 mg/kg LA and 50 mg/kg ALC, group F (100 mg/kg LA and 50 mg/kg ALC, group G (0 mg/kg LA and 100 mg/kg ALC, group H (50 mg/kg LA and 100 mg/kg ALC, group I (100 mg/kg LA and 100 mg/kg ALC. Birds were slaughtered at 42 days old. Average daily gain (ADG, average feed intake (AFI, feed conversion rate (FCR, eviscerated rate, breast muscle percentage, thigh muscle percentage, abdominal fat percentage, liver weight, muscle color (L* value, a* value, b* value, pH values at 45 min and 24 h postmortem were measured. Results showed that there existed an interaction between LA and ALC in growth performance of broilers, carcass traits and meat quality. The overall result is that high level of LA and ALC led to lower AFI, ADG (p<0.01, lower abdominal fat percentage, liver weight (p<0.01, lower L* value, a* value, and b* value of breast muscle, L* value of thigh muscle (p<0.05, and higher FCR (p<0.01, eviscerated rate (p<0.01, breast muscle percentage, thigh muscle percentage (p<0.05, a* value, pH 45 min and pH 24 h of thigh muscle (p<0.01. These results suggested that dietary LA and ALC contributed to the improvement of meat quality in broilers.

  6. Lipoic acid and diabetes: Effect of dihydrolipoic acid administration ...

    Indian Academy of Sciences (India)

    Relative α-lipoic acid content of diabetic livers was considerably less than that of normal livers as determined by gas chromatography. It was not possible to detect any dihydrolipoic acid in the livers. Biochemical abnormalities such as hyperglycaemia, ketonemia, reduction in liver glycogen and impaired incorporation of ...

  7. Synthesis and antioxidant efficiency of a new amphiphilic spin-trap derived from PBN and lipoic acid.

    Science.gov (United States)

    Durand, G; Polidori, A; Salles, J P; Prost, M; Durand, P; Pucci, B

    2003-08-18

    The synthesis of a new amphiphilic antioxidant called PBNLP and derived from both alpha-phenyl-N-tert-butyl nitrone (PBN) and lipoic acid was described. Grafting a lactobionamide moiety onto the aromatic group of the PBN provided the water solubility of this compound. In vitro preliminary biological evaluations of its antioxidant capacity were performed using the KRL biological test based on free radical-induced hemolysis. The PBNLP induces a protection of erythrocytes against exogenous free radicals higher than that measured with lipoic acid or PBN alone or with lipoic acid or PBN derivatives in admixtures.

  8. Dietary lipoic acid-dependent changes in the activity and mRNA levels of hepatic lipogenic enzymes in rats.

    Science.gov (United States)

    Huong, Doan Thi Thanh; Ide, Takashi

    2008-07-01

    Effects of dietary alpha-lipoic acid on hepatic and serum lipid concentrations and the activity and mRNA levels of lipogenic enzymes were examined in rats. Rats were fed experimental diets containing varying amounts of lipoic acid (0, 1, 2.5, 5 g/kg) for 21 d. Lipoic acid profoundly decreased serum and liver concentrations of TAG, and also lowered serum concentrations of phospholipid and NEFA, and the concentration of cholesterol in the liver. A hypoglycaemic effect of this compound was also observed. Lipoic acid dose-dependently decreased the activity and mRNA levels of fatty acid synthase, ATP-citrate lyase, glucose 6-phosphate dehydrogenase, malic enzyme and pyruvate kinase in the liver despite that reductions were considerably attenuated in the NADPH-producing enzymes. This compound also dose-dependently lowered the mRNA levels of spot 14, adiponutrin, stearoyl-CoA desaturase 1, and Delta5- and Delta6-desaturases. In addition, lipoic acid dose-dependently lowered serum concentrations of insulin and leptin, but increased those of adiponectin. Lipoic acid appeared to reduce hepatic lipogenesis and hence decreases serum and liver lipid levels. Alterations in serum concentrations of insulin and (or) adiponectin may trigger this consequence.

  9. Neuroprotective effects of α-lipoic acid against hypoxic– ischemic ...

    African Journals Online (AJOL)

    Purpose: To explore the neuroprotective efficacy of α-lipoic acid (ALA) against hypoxic-ischemic encephalopathy (HIE) in neonatal rats. Methods: Forty-eight rats (P7-pups) were randomly assigned to one of four groups: group I received saline; group II (HI) underwent unilateral carotid artery ligation and hypoxia (92 % N2 ...

  10. Amelioration of Behavioural, Biochemical, and Neurophysiological Deficits by Combination of Monosodium Glutamate with Resveratrol/Alpha-Lipoic Acid/Coenzyme Q10 in Rat Model of Cisplatin-Induced Peripheral Neuropathy

    Directory of Open Access Journals (Sweden)

    Naini Bhadri

    2013-01-01

    Full Text Available Cisplatin or cis-diamminedichloroplatinum (II (CDDP is a cytotoxic chemotherapeutic agent with dose-dependent peripheral neuropathy as a foremost side effect characterised by ataxia, pain, and sensory impairment. Cumulative drug therapy of CDDP is known to produce severe oxidative damage. It mainly targets and accumulates in dorsal root ganglia that in turn cause damage resulting in secondary nerve fibre axonopathy. In the present study, we investigated the neuroprotective effect of the combination of monosodium glutamate (MSG with three individual antioxidants, that is, resveratrol, alpha-lipoic acid (ALA, and coenzyme Q10 (CoQ10, in cisplatin (2 mg/kg i.p. twice weekly induced peripheral neuropathy in rats. After 8 weeks of treatment the degree of neuroprotection was determined by measuring behavioral and electrophysiological properties and sciatic nerve lipid peroxidation, as well as glutathione and catalase levels. The results suggested that pretreatment with the combination of MSG (500 mg/kg/day po with resveratrol (10 mg/kg/day i.p. or ALA (20 mg/kg/day i.p. or CoQ10 (10 mg/kg weekly thrice i.p. exhibited neuroprotective effect. The maximum neuroprotection of MSG was observed in the combination with resveratrol.

  11. A new regulatory mechanism for bacterial lipoic acid synthesis.

    Science.gov (United States)

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  12. Evaluation of lipoic acid topical application on rats skin wound healing.

    Science.gov (United States)

    Külkamp-Guerreiro, Irene Clemes; Souza, Marielly Nunes; Bianchin, Mariana Domingues; Isoppo, Mateus; Freitas, Joana Sachetti; Alves, João Alex; Piovezan, Anna Paula; Pohlmann, Adriana Raffin; Guterres, Sílvia Stanisçuaski

    2013-10-01

    To evaluate the effects of lipoic acid (thioctic acid) topical application on wound healing on rats skin, and the consequences of lipoic acid nanoencapsulation on this process. The model used was the healing activity on wounds induced by surgical incision on rats skin (n = 44). The parameters analyzed (11 days) were wound healing rate and histology (vascular proliferation, polymorphonuclear or mononuclear cells, and collagen synthesis or reepithelialization), after application of free lipoic acid or lipoic acid- loaded nanocapsules. The antioxidant activity of these formulations was evaluated by lipid peroxidation test. It was demonstrated for the first time that the topical application of lipoic acid improves wound healing. On the seventh day after surgery, the animals treated with lipoic acid showed increased healing rate (60.7 ± 8.4%) compared to the negative control group (43.0 ± 17.4%), as so improvement of histological parameters. The nanoencapsulation reverted the pro-oxidant activity presented in vitro by lipoic acid, whereas diminished wound repair. The topical application of lipoic acid produced an increase in the skin wound healing, which may be related to its pro-oxidant activity. On the other hand, the nanoencapsulation of the lipoic acid reversed the pro-oxidant activity, although presented minor healing activity.

  13. Alpha-Lipoic Acid Alleviates High-Glucose Suppressed Osteogenic Differentiation of MC3T3-E1 Cells via Antioxidant Effect and PI3K/Akt Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Kai Dong

    2017-08-01

    Full Text Available Background/Aims: Patients with diabetes mellitus have a higher risk of dental implant failure. One major cause is high-glucose induced oxidative stress. Alpha-lipoic acid (ALA, a naturally occurring compound and dietary supplement, has been established as a potent antioxidant that is a strong scavenger of free radicals. However, few studies have yet investigated the effect of ALA on osteogenic differentiation of osteoblasts cultured with high glucose medium. The aim of this study is to investigate the effects of ALA on the osteoblastic differentiation in MC3T3-E1 cells under high glucose condition. Methods: MC3T3-E1 cells were divided into 4 groups including normal glucose (5.5 mM group (control, high glucose (25.5 mM group, high glucose + 0.1 mM ALA group, and high glucose + 0.2 mM ALA group. The proliferation, osteogenic differentiation and mineralization of cells were evaluated by MTT assay, alkaline phosphatase (ALP activity assay, alizarin red staining and real time-polymerase chain reaction. High-glucose induced oxidative damage was also assessed by the production of reactive oxygen species (ROS and superoxide dismutase (SOD. Western blots were performed to examine the role of PI3K/Akt pathway. Results: The proliferation, osteogenic differentiation and mineralization of MC3T3-E1 cells were significantly decreased by the ROS induced by high-glucose. All observed oxidative damage and osteogenic dysfunction induced were inhibited by ALA. Moreover, the PI3K/Akt pathway was activated by ALA. Conclusions: We demonstrate that ALA may attenuate high-glucose mediated MC3T3-E1 cells dysfunction through antioxidant effect and modulation of PI3K/Akt pathway.

  14. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation.

    Science.gov (United States)

    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed

    2015-06-01

    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue. © 2015 The Authors. International Journal of Experimental Pathology © 2015 International Journal of Experimental Pathology.

  15. Enantioselective Pharmacokinetics of α-Lipoic Acid in Rats

    Directory of Open Access Journals (Sweden)

    Ryota Uchida

    2015-09-01

    Full Text Available α-Lipoic acid (LA is widely used for nutritional supplements as a racemic mixture, even though the R enantiomer is biologically active. After oral administration of the racemic mixture (R-α-lipoic acid (RLA and S-α-lipoic acid (SLA mixed at the ratio of 50:50 to rats, RLA showed higher plasma concentration than SLA, and its area under the plasma concentration-time curve from time zero to the last (AUC was significantly about 1.26 times higher than that of SLA. However, after intravenous administration of the racemic mixture, the pharmacokinetic profiles, initial concentration (C0, AUC, and half-life (T1/2 of the enantiomers were not significantly different. After oral and intraduodenal administration of the racemic mixture to pyrolus-ligated rats, the AUCs of RLA were significantly about 1.24 and 1.32 times higher than that of SLA, respectively. In addition, after intraportal administration the AUC of RLA was significantly 1.16 times higher than that of SLA. In conclusion, the enantioselective pharmacokinetics of LA in rats arose from the fraction absorbed multiplied by gastrointestinal availability (FaFg and hepatic availability (Fh, and not from the total clearance.

  16. A dual action of alpha-lipoic acid in the brain: an electrophysiological evaluation Dupla ação do ácido alfa-lipoico no encéfalo: uma avaliação eletrofisiológica

    Directory of Open Access Journals (Sweden)

    Otoni Cardoso do Vale

    2003-09-01

    Full Text Available Oxidative stress causes metabolic and structural abnormalities during reperfusion. In an animal model of electrophysiological evaluation of cerebral ischemia-reperfusion, alpha-lipoic acid effect on the oxidative stress was studied by mean absolute amplitude of EEG spectra evaluation. The left carotideal infusion of 3.03 mM alpha-lipoic acid in Wistar rats after cerebral ischemia and reperfusion caused initial reduction and partial final recuperation of the various EEG spectral frequency mean absolute amplitudes (pEstresse oxidativo causa anormalidades metabólicas e estruturais durante reperfusão após isquemia. Em um modelo animal de avaliação eletrofisiológica de isquemia-reperfusão, o efeito da infusão do ácido alfa-lipóico sobre o estresse oxidativo foi estudado por meio da avaliação da média das amplitudes absolutas dos espectros eletrencefalográficos. A infusão intracarotídea esquerda de ácido alfa-lipoic 3,03 mM em ratos Wistar após isquemia-reperfusão cerebral causou significante redução inicial e recuperação parcial final da média das amplitudes absolutas dos vários espectros eletro - encefalográficos (p<0,05. A infusão intracarotídea esquerda de ácido alfa-lipoic 6,06 mM significantemente reverteu a depressão induzida da média das amplitudes absolutas médias dos espectros teta e delta. Houve, contudo, maior depressão da média das amplitudes absolutas de quase todos os espctros com infusão de ácido alfa-lipóico 60,6 mM. Estas observações sugerem que, dependendo da concentração administrada, o ácido alfa-lipoic tem duplo efeito, protegendo da isquemia em baixas concentrações e piorando este processo em doses altas.

  17. Research and Application of Lipoic Acid in Plants

    Science.gov (United States)

    Xiao, Renjie; Wang, Xiran; Jiang, Leiyu; Tang, Haoru

    2018-01-01

    Lipoic acid is a kind of small molecular compound with strong oxidizing properties. It has been widely used in medicine and has achieved good results since its discovery. However, it is less used in plants, and the biosynthetic pathway is not clear. The content in the plant is mainly measured by high-performance liquid chromatography(HPLC). At present, it is mainly used as an additive to the culture medium for plant tissue culture and Agrobacterium-mediated plant genetic transformation, in order to reduce the browning rate of explants, improve Agrobacterium-mediated genetic transformation efficiency.

  18. Antioxidant effect of erdosteine and lipoic acid in ovarian ischemia-reperfusion injury.

    Science.gov (United States)

    Dokuyucu, R; Karateke, A; Gokce, H; Kurt, R K; Ozcan, O; Ozturk, S; Tas, Z A; Karateke, F; Duru, M

    2014-12-01

    To investigate the effects of erdosteine and alpha lipoic acid (ALA) in a rat model of ovarian ischaemia-reperfusion injury. Forty-eight female Wistar albino rats were separated, at random, into six groups of eight rats. The groups were classified as: sham, torsion, detorsion, detorsion+erdosteine 100mg/kg, detorsion+alpha lipoic acid (ALA) 100mg/kg, and detorsion+erdosteine+ALA. The investigators executing the biochemical and histological analyses were blinded to the randomization until the end of the study. The TOS (Total Oxidant Status) and OSI (Oxidative Stress Index) levels are higher in the Torsion and Detorsion groups when compared with the ones in the Sham group (pOSI and total histological score in the sham, torsion and detorsion groups (r=0.765, pOSI in the rats that received erdosteine and/or ALA were significantly lower compared with the sham, torsion and detorsion groups (pOSI were lower in the detorsion+erdosteine+ALA group compared with the detorsion+erdosteine and detorsion+ALA groups (pmodel; combination treatment had a greater effect than either agent alone. Treatment with erdosteine and/or ALA was found to preserve the loss of reproductive capacity normally observed after ovarian torsion. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. THE COMBINATION OF α-LIPOIC ACID INTAKE WITH ECCENTRIC EXERCISE MODULATES ERYTHROPOIETIN RELEASE

    Directory of Open Access Journals (Sweden)

    B. Morawin

    2014-08-01

    Full Text Available The generation of reactive nitrogen/oxygen species (RN/OS represents an important mechanism in erythropoietin (EPO expression and skeletal muscle adaptation to physical and metabolic stress. RN/OS generation can be modulated by intense exercise and nutrition supplements such as α-lipoic acid, which demonstrates both anti- and pro-oxidative action. The study was designed to show the changes in the haematological response through the combination of α-lipoic acid intake with running eccentric exercise. Sixteen healthy young males participated in the randomised and placebo-controlled study. The exercise trial involved a 90-min run followed by a 15-min eccentric phase at 65% VO2max (-10% gradient. It significantly increased serum concentrations of nitric oxide (NO, hydrogen peroxide (H2O2 and pro-oxidative products such as 8-isoprostanes (8-iso, lipid peroxides (LPO and protein carbonyls (PC. α-Lipoic acid intake (Thiogamma: 1200 mg daily for 10 days prior to exercise resulted in a 2-fold elevation of serum H2O2 concentration before exercise, but it prevented the generation of NO, 8-iso, LPO and PC at 20 min, 24 h, and 48 h after exercise. α-Lipoic acid also elevated serum EPO level, which highly correlated with NO/H2O2 ratio (r=0.718, P<0.01. Serum total creatine kinase (CK activity, as a marker of muscle damage, reached a peak at 24 h after exercise (placebo 732 ± 207 IU · L-1, α-lipoic acid 481 ± 103 IU · L-1, and correlated with EPO (r = 0.478, P<0.01 in the α-lipoic acid group. In conclusion, the intake of high α-lipoic acid modulates RN/OS generation, enhances EPO release and reduces muscle damage after running eccentric exercise.

  20. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid

    Directory of Open Access Journals (Sweden)

    Magdalena Godlewska

    2015-01-01

    Full Text Available The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT. In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ=348 nm (i.e., the spectral band of the obtained reaction product. Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1–10 μmol L−1. Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5–50 μmol L−1. Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value.

  1. Effect of the Antioxidant Lipoic Acid in Aortic Phenotype in a Marfan Syndrome Mouse Model

    Directory of Open Access Journals (Sweden)

    Maria C. Guido

    2018-01-01

    Full Text Available Marfan syndrome (MFS cardiovascular manifestations such as aortic aneurysms and cardiomyopathy carry substantial morbidity/mortality. We investigated the effects of lipoic acid, an antioxidant, on ROS production and aortic remodeling in a MFS mgΔloxPneo mouse model. MFS and WT (wild-type 1-month-old mice were allocated to 3 groups: untreated, treated with losartan, and treated with lipoic acid. At 6 months old, echocardiography, ROS production, and morphological analysis of aortas were performed. Aortic ROS generation in 6-month-old MFS animals was higher at advanced stages of disease in MFS. An unprecedented finding in MFS mice analyzed by OCT was the occurrence of focal inhomogeneous regions in the aortic arch, either collagen-rich extremely thickened or collagen-poor hypotrophic regions. MFS animals treated with lipoic acid showed markedly reduced ROS production and lower ERK1/2 phosphorylation; meanwhile, aortic dilation and elastic fiber breakdown were unaltered. Of note, lipoic acid treatment associated with the absence of focal inhomogeneous regions in MFS animals. Losartan reduced aortic dilation and elastic fiber breakdown despite no change in ROS generation. In conclusion, oxidant generation by itself seems neutral with respect to aneurysm progression in MFS; however, lipoic acid-mediated reduction of inhomogeneous regions may potentially associate with less anisotropy and reduced chance of dissection/rupture.

  2. Fructose diet-induced skin collagen abnormalities are prevented by lipoic acid.

    Science.gov (United States)

    Thirunavukkarasu, V; Nandhini, A T Anitha; Anuradha, C V

    2004-01-01

    Nonenzymatic glycation of proteins, leading to chemical modification and cross-linking are of importance in the pathology of diabetic complications. We studied the effect alpha-lipoic acid (LA) on the content and characteristics of the protein collagen from skin of high-fructose fed rats. The rats were divided into 4 groups of 6 each. Two groups of rats were fed with a high fructose diet (60 g/100 g diet) and administered either LA (35 mg/kg b.w., i.p) (FRU+LA) or 0.2 ml vehicle (saline) (FRU) for 45 days. The other 2 groups were fed with control diet containing starch (60 g/100 g diet) and administered either saline (CON) or lipoic acid (CON+LA). The rats were maintained for 45 days and then sacrificed. Plasma glucose, insulin, fructosamine, protein glycation, and blood glycated hemoglobin (HbA1C) were measured. Collagen was isolated from skin and the physicochemical properties of collagen were studied. Fructose administration caused accumulation of collagen in skin. Extensive cross-linking was evidenced by enhanced glycation and AGE-linked fluorescence. Increased peroxidation and changes in physicochemical properties such as shrinkage temperature, aldehyde content, solubililty pattern, susceptibility to denaturing agents were observed in fructose-fed rats. SDS gel pattern of collagen from these rats showed elevated beta component of type I collagen. These changes were alleviated by the simultaneous administration of LA. Administration of LA to fructose-fed rats had a positive influence on both quantitative and qualitative properties of collagen. The results suggest a mechanism for the ability of LA to delay diabetic complications.

  3. Physiological and Histopathological Investigations on the Effects of -Lipoic Acid in Rats Exposed to Malathion

    Directory of Open Access Journals (Sweden)

    Atef M. Al-Attar

    2010-01-01

    Full Text Available The present study was designed to evaluate the influence of -lipoic acid treatment in rats exposed to malathion. Forty adult male rats were used in this study and distributed into four groups. Animals of group 1 were untreated and served as control. Rats of group 2 were orally given malathion at a dose level of 100 mg/kg body weight (BW for a period of one month. Experimental animals of group 3 were orally given -lipoic acid at a dose level of 20 mg/kg BW and after 3 hours exposed to malathion at the same dose given to group 2. Rats of group 4 were supplemented with -lipoic acid at the same dose given to group 3. The activities of serum glutamic oxaloacetic acid transaminase (GOT, glutamic pyruvic acid transaminase (GPT, alkaline phosphatase (ALP, and acid phosphatase (ACP, and the values of creatinine, urea, and uric acid were statistically increased, while the values of total protein and total albumin were significantly decreased in rats exposed to malathion. Moreover, administration of malathion for one month resulted in damage of liver and kidney structures. Administration of -lipoic acid before malathion exposure to rat can prevent severe alterations of hematobiochemical parameters and disruptions of liver and kidney structures. In conclusion, this study obviously demonstrated that pretreatment with -lipoic acid significantly attenuated the physiological and histopathological alterations induced by malathion. Also, the present study identifies new areas of research for development of better therapeutic agents for liver, kidney, and other organs' dysfunctions and diseases.

  4. Therapy of Primary Hypothyroidism with α-Lipoic Acid Review of Studies Results

    Directory of Open Access Journals (Sweden)

    A.V. Savustyanenko

    2016-05-01

    Full Text Available Primary hypothyroidism occurs in the general population with an incidence of 0.5–1 %, and includes congenital and acquired (due to autoimmune thyroiditis, after surgical removal of the thyroid gland or treatment with radioactive iodine forms. The basic treatment of primary hypothyroidism is replacement therapy with L-thyroxine. Combined administration of L-thyroxine and α-lipoic acid resulted in more marked decrease of oxidative stress, hyperlipidemia, hyperactivity of the immune system, endothelial dysfunction and neurological disorders, observed in patients with primary hypothyroidism, as compared to monotherapy with L-thyroxine. α-lipoic acid use was effective in adults and children, in case of parenteral and/or oral administration.

  5. The importance of 1,2-dithiolane structure in α-lipoic acid for the downregulation of cell surface β1-integrin expression of human bladder cancer cells.

    Science.gov (United States)

    Yamasaki, Masao; Soda, Shozen; Sakakibara, Yoichi; Suiko, Masahito; Nishiyama, Kazuo

    2014-01-01

    Here, we show that cell surface β1-integrin expression, cell adhesion to fibronectin, migration, and invasion were all significantly inhibited by α-lipoic acid. These effects were not observed when cells were treated with dihydrolipoic acid or caprylic acid. These data reveal that the 1,2-dithiolane structure plays an important role in the action of α-lipoic acid.

  6. Investigation of Enantioselective Membrane Permeability of α-Lipoic Acid in Caco-2 and MDCKII Cell

    Directory of Open Access Journals (Sweden)

    Ryota Uchida

    2016-01-01

    Full Text Available α-Lipoic acid (LA contains a chiral carbon and exists as two enantiomers (R-α-lipoic acid (RLA and S-α-lipoic acid (SLA. We previously demonstrated that oral bioavailability of RLA is better than that of SLA. This difference arose from the fraction absorbed multiplied by gastrointestinal availability (Fa × Fg and hepatic availability (Fh in the absorption phase. However, it remains unclear whether Fa and/or Fg are involved in enantioselectivity. In this study, Caco-2 cells and Madin–Darby canine kidney strain II cells were used to assess the enantioselectivity of membrane permeability. LA was actively transported from the apical side to basal side, regardless of the differences in its steric structure. Permeability rates were proportionally increased in the range of 10–250 µg LA/mL, and the permeability coefficient did not differ significantly between enantiomers. Hence, we conclude that enantioselective pharmacokinetics arose from the metabolism (Fh or Fg × Fh, and definitely not from the membrane permeation (Fa in the absorption phase.

  7. Lipoic acid suppresses portal endotoxemia-induced steatohepatitis and pancreatic inflammation in rats.

    Science.gov (United States)

    Tian, Yu-Feng; He, Chih-Tsueng; Chen, Yu-Ting; Hsieh, Po-Shiuan

    2013-05-14

    To examine the effect of α-lipoic acid (LA) on mild portal endotoxemia-induced steatohepatitis and associated pancreatic abnormalities in fructose-fed rats. Rats were randomly assigned into two groups with a regular or 60% fructose-enriched diet for 8 wk. After fructose feeding for 4 wk, rats were further divided into four subgroups: with intraportal saline (FPV), with intraportal saline plus administration of LA (FPV + LA), with lipopolysaccharide (LPS) infusion (FPLPS), and with LPS infusion plus administration of LA (FPLPS + LA). Rats were treated with LPS using intraportal infusion while LA was administered orally. Metabolite levels, superoxide levels, inflammatory markers, malondialdehyde content, glutathione content and toll-like receptor 4 (TLR4) gene expression were all measured using standard biochemical techniques. Pancreatic insulin secretion was evaluated by a hyperglycemic clamp technique. Histology of liver and pancreas tissues were evaluated using hematoxylin and eosin staining and immunohistochemistry. Fructose-induced elevation in plasma C-reactive protein, amylase, superoxide, white blood cell count as well as in hepatic and pancreatic contents of malondialdehyde, tumor necrosis factor alpha and interleukin-6 were increased in animals treated with LPS and reversed with LA administration. The augmented hepatic gene expression of TLR4 in fructose-fed rats was further increased in those with intraportal LPS infusion, which was partially reversed by LA administration. Pathological examination showed inflammatory changes and leukocyte infiltration in hepatic and pancreatic islets of animals treated with LPS but were rarely observed in those with LA treatment. In addition to affects on the liver, impaired pancreatic insulin secretion seen in fructose-fed rats was deteriorated in with LPS treatment and partially reversed with LA administration. These data suggest LA could significantly suppress mild portal-endotoxemia but not fructose-induced liver and

  8. Effects of Lipoic Acid on Antiapoptotic Genes in Control and Ethanol-Treated Fetal Rhombencephalic Neurons

    Science.gov (United States)

    Antonio, Angeline M.; Gillespie, Roberta A.; Druse, Mary J.

    2011-01-01

    This laboratory showed that ethanol augments apoptosis in fetal rhombencephalic neurons and co-treatment with alpha-lipoic acid (LA) or one of several other antioxidants prevents ethanol-associated apoptosis. Because ethanol increases oxidative stress, which causes apoptosis, it is likely that some of the neuroprotective effects of LA and other antioxidants involve classical antioxidant actions. Considering the reported link of LA with pro-survival cell signaling, it is also possible that LA’s neuroprotective effects involve additional mechanisms. The present study investigated the effects of LA on ethanol-treated fetal rhombencephalic neurons with regard to oxidative stress and up-regulation of the pro-survival genes Xiap and Bcl-2. We included parallel gene expression studies with N-acetyl cysteine (NAC) to determine whether LA’s effects on Xiap and Bcl-2 were shared by other antioxidants. We also used enzyme inhibitors to determine which signaling pathway(s) might be involved with the effects of LA. The results of this investigation showed that LA treatment of ethanol-treated neurons exerted several pro-survival effects. LA blocked two pro-apoptotic changes, i.e., the ethanol-associated rise in ROS and caspase-3. LA also up-regulated the expression genes that encode the anti-apoptotic proteins Bcl-2 and Xiap by a mechanism that involves NF-κB. NAC also up-regulated Bcl-2 and Xiap. Thus, the neuroprotective effects of LA and NAC could involve up-regulation of pro-survival genes as well as their classical antioxidant actions. PMID:21303669

  9. Lipoic Acid Use and Functional Outcomes after Thrombolysis in Patients with Acute Ischemic Stroke and Diabetes.

    Directory of Open Access Journals (Sweden)

    Kang-Ho Choi

    Full Text Available Alpha-lipoic acid (aLA is a strong antioxidant commonly used for treating diabetic polyneuropathy. Previously, we demonstrated the neurorestorative effects of aLA after cerebral ischemia in rats. However, its effects on patients with stroke remain unknown. We investigated whether patients treated with aLA have better functional outcomes after acute ischemic stroke (AIS and reperfusion therapy than patients not receiving aLA.In this retrospective study of 172 prospectively registered patients with diabetes and AIS treated with tissue plasminogen activator (tPA, we investigated the relationship between aLA use and functional outcome both after 3 months and after 1 year. The functional outcomes included occurrence of hemorrhagic transformation (HT, early neurological deterioration (END, and early clinical improvement (ECI. Favorable outcomes were defined as modified Rankin Scale (mRS scores of 0-2.Of the 172 patients with AIS and diabetes, 47 (27.3% used aLA. In the entire cohort, favorable outcomes occurred at significantly higher rates both at 3 months and at 1 year in those treated with aLA. The risks for END and HT were lower and the occurrence of ECI was higher in patients treated with aLA. In multivariable analysis, aLA use was associated with favorable outcomes both at 3 months and at 1 year. Age, HT, and increased National Institutes of Health Stroke Scale scores were negative predictors of a favorable outcome.The use of aLA in patients with AIS and diabetes who are treated with tPA is associated with favorable outcomes. These results indicate that aLA could be a useful intervention for the treatment of AIS after reperfusion therapy.

  10. Lipoic acid effects on glutamate and taurine concentrations in rat hippocampus after pilocarpine-induced seizures

    Directory of Open Access Journals (Sweden)

    P S Santos

    2011-01-01

    Full Text Available Pilocarpine-induced seizures can be mediated by increases in oxidative stress and by cerebral amino acid changes. The present research suggests that antioxidant compounds may afford some level of neuroprotection against the neurotoxicity of seizures in cellular level. The objective of the present study was to evaluate the lipoic acid (LA effects in glutamate and taurine contents in rat hippocampus after pilocarpine-induced seizures. Wistar rats were treated intraperitoneally (i.p. with 0.9% saline (Control, pilocarpine (400 mg/kg, Pilocarpine, LA (10 mg/kg, LA, and the association of LA (10 mg/kg plus pilocarpine (400 mg/kg, that was injected 30 min before of administration of LA (LA plus pilocarpine. Animals were observed during 24 h. The amino acid concentrations were measured using high-performance liquid chromatograph (HPLC. In pilocarpine group, it was observed a significant increase in glutamate content (37% and a decrease in taurine level (18% in rat hippocampus, when compared to control group. Antioxidant pretreatment significantly reduced the glutamate level (28% and augmented taurine content (32% in rat hippocampus, when compared to pilocarpine group. Our findings strongly support amino acid changes in hippocampus during seizures induced by pilocarpine, and suggest that glutamate-induced brain damage plays a crucial role in pathogenic consequences of seizures, and imply that strong protective effect could be achieved using lipoic acid through the release or decrease in metabolization rate of taurine amino acid during seizures.

  11. Assessment of the role of α-lipoic acid against the oxidative stress of induced iron overload

    Directory of Open Access Journals (Sweden)

    Yasser F. Ali

    2015-01-01

    Full Text Available This work was aimed to study the protective role of α-lipoic acid against the oxidative damage of induced iron overload. Iron (Fe overload is a complication of the treatment, by chronic transfusion, of a number of genetic diseases associated with inadequate red cell production (anemias and of other genetic diseases that lead to excessive iron absorption from the diet. Male rats were injected ip with 5 mg/kg body weight ferrous sulfate for 50 days. The animals were injected ip with α-lipoic acid 20 mg per kg body weight for 21 days. Serum iron, Total Iron Binding Capacity (TIBC, Malonyldialdehyde (MDA, Electron paramagnetic resonance (EPR spectroscopy, UV-visible absorption spectrum of hemoglobin and osmotic fragility were studied. Results showed significant increase in serum iron, total iron binding capacity, and malonyldialdehyde levels in iron-loaded rats. Treatment with lipoic acid (LA resulted in decreasing serum iron and TIBC levels by 47%and 29% respectively. At the same time the lipoic acid decreased the level of the MDA in liver, brain and plasma by 54%, 42% and 74% respectively. Also LA diminished the effect of iron-induced free radicals on erythrocyte membrane integrity; it decreased the elevated average osmotic fragility and decreased the elevated rate of hemolysis. Results from UV-visible spectrophotometric measurement of hemoglobin revealed that no oxidative changes of hemoglobin occurred in iron-loaded rats. EPR spectra showed increased in non-heme ferric ions Fe+3 and free radicals in iron-loaded rats. Whereas the injection of the lipoic acid leads to decreased in such toxic result. In conclusion, these observations suggested that lipoic acid might be a beneficial antioxidant that can be effective for limiting damage from oxidative stress of iron overload.

  12. Homology modeling of Homo sapiens lipoic acid synthase: Substrate docking and insights on its binding mode.

    Science.gov (United States)

    Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay

    2017-05-07

    Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Grafting of 4-aminomethylbenzensulfonamide-lipoic acid conjugate on gold nanoparticles

    Science.gov (United States)

    Stiti, M.; Bouzit, H.; Abdaoui, M.; Winum, J. Y.

    2012-02-01

    In this paper, we describe the synthesis of goldnanoparticles bearing aminomethylbenzensulfonamide via a lipoyl moiety. The resulting stable nanoparticles with an average size of 4.0 nm have been achieved by a facile and high-yielding one phase method, by the action of 4-aminomethylbenzensulfonamide-lipoic acid bioconjugate on chloroauric acide, using dimethylsulfoxide (DMSO) as the solvent and sodium tetrahydridoborate (NaBH4) as the reducing agent. UV-vis absorption, transmission electron microscopy (TEM) and X-ray diffraction were used to analyse the morphology and the structure of the obtained nanoparticles. Preliminary study shows that these new nanoparticles are endowed with highly and specific inhibitory activity for the isoform (IX) of carbonic anhydrase over expressed in many cancers, and are therefore attractive candidate to be used both in diagnosis and in treatment of tumours.

  14. Lipoic acid and redox status in barley plants subjected to salinity and elevated CO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Lopez, U.; Robredo, A.; Mena-Petite, A.; Munoz-Rueda, A. (Univ. del Pais Vasco/EHU, Dept. de Biologia Vegetal y Ecologia, Bilbao (Spain)); Lacuesta, M. (Univ. del Pais Vasco/EHU, Dept. de Biologia Vegetal y Ecologia, Vitoria-Gasteiz (Spain)); Sgherri, C.; Navari-Izzo, F. (Univ. di Pisa, Dipartimento di Chimica e Biotecnologie Agrarie, Pisa (Italy))

    2010-02-15

    Future environmental conditions will include elevated concentrations of salt in the soil and an elevated concentration of CO{sub 2}in the atmosphere. Because these environmental changes will likely affect reactive oxygen species (ROS) formation and cellular antioxidant metabolism in opposite ways, we analyzed changes in cellular H{sub 2}O{sub 2} and non-enzymatic antioxidant metabolite [lipoic acid (LA), ascorbate (ASA), glutathione (GSH)] content induced by salt stress (0, 80, 160 or 240 mM NaCl) under ambient (350 mumol mol-1) or elevated (700 mumol mol-1) CO{sub 2}concentrations in two barley cultivars (Hordeum vulgare L.) that differ in sensitivity to salinity (cv. Alpha is more sensitive than cv. Iranis). Under non-salinized conditions, elevated CO{sub 2}increased LA content, while ASA and GSH content decreased. Under salinized conditions and ambient CO{sub 2}, ASA increased, while GSH and LA decreased. At 240 mM NaCl, H{sub 2}O{sub 2} increased in Alpha and decreased in Iranis. When salt stress was imposed at elevated CO{sub 2}, less oxidative stress and lower increases in ASA were detected, while LA was constitutively higher. The decrease in oxidative stress could have been because of less ROS formation or to a higher constitutive LA level, which might have improved regulation of ASA and GSH reductions. Iranis had a greater capacity to synthesize ASA de novo and had higher constitutive LA content than did Alpha. Therefore, we conclude that elevated CO{sub 2}protects barley cultivars against oxidative damage. However, the magnitude of the positive effect is cultivar specific. (author)

  15. Lipoic acid decreases Mcl-1, Bcl-xL and up regulates Bim on ovarian carcinoma cells leading to cell death.

    Science.gov (United States)

    Kafara, Perrine; Icard, Philippe; Guillamin, Marilyne; Schwartz, Laurent; Lincet, Hubert

    2015-06-12

    Ovarian carcinoma is the leading cause of death from gynecological cancer because there is risk of chemoresistance. As previously demonstrated in our laboratory, Alpha-lipoic acid (LA), a co-factor for metabolic enzymes, suppresses the tumor growth. In this study, we have researched the mechanisms that are responsible for the activity of LA. We have studied the mechanisms of LA in two ovarian cancer cell lines, a cisplatin sensitive one, IGROV1 and its resistant counterpart, IGROV1-R10. These cells have been exposed to lipoic acid at various concentrations. Cell proliferation, cell cycle repartition and nuclear staining with DAPI were recorded. Western blot analyses were performed to detect various proteins implied in apoptotic cell death pathways. To investigate the formation of ROS, the oxidation of CM-DCFH2-DA were also determined. LA suppressed growth proliferation and induced apoptosis in both ovarian cell lines. Moreover, LA provoked a down regulation of two anti-apoptotic proteins, Mcl-1 and Bcl-xL protein and a strong induction of the BH3-only protein Bim. Furthermore, LA induced ROS generation which could be involved in the CHOP induction which is known to activate the Bim translation. Our results reveal novel actions of LA which could explain the anti-tumoral effects of the LA. Therefore, LA seems to be a promising compound for ovarian cancer treatment.

  16. In Vivo Roles of Fatty Acid Biosynthesis Enzymes in Biosynthesis of Biotin and α-Lipoic Acid in Corynebacterium glutamicum.

    Science.gov (United States)

    Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki

    2017-10-01

    For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase

  17. The issue of HPLC determination of endogenous lipoic acid in human plasma.

    Science.gov (United States)

    Sechovcová, Soňa; Královcová, Pavla; Kanďár, Roman; Ventura, Karel

    2018-05-01

    Lipoic acid (LA) is used extensively as a therapeutic agent for the treatment of various diseases. Many methods have been reported for the determination of LA plasma levels and its metabolites after its supplementation, but available information concerning endogenous plasma levels is still scarce. Studies which directly focused on determining the endogenous plasma levels provided highly controversial results, endogenous plasma levels of LA: 2.4 and 4.9 nmol/L respectively. However, the levels of free LA in the plasma of nonsupplemented voluntary blood donors were not detectable in all cases. The presented results of our study show that endogenous concentrations of LA are <1.85 nmol/L. Copyright © 2017 John Wiley & Sons, Ltd.

  18. Multilayer emulsions as a strategy for linseed oil and α-lipoic acid micro-encapsulation: study on preparation and in vitro characterization.

    Science.gov (United States)

    Huang, Juan; Wang, Qiang; Li, Tong; Xia, Nan; Xia, Qiang

    2018-01-04

    Linseed oil and α-lipoic acid are bioactive ingredients, which play an important role in human nutrition and health. However, their application in functional foods is limited because of their instabilities and poor solubilities in hydrophilic matrices. Multilayer emulsions are particularly useful to protect encapsulated bioactive ingredients. The aim of this study was to fabricate multilayer emulsions by a high-pressure homogenization method to encapsulate linseed oil and α-lipoic acid simultaneously. Tween 20 and lecithin were used as surfactants to stabilize the oil droplets of primary emulsions. Multilayer emulsions were produced by using an electrostatic layer-by-layer deposition process of lecithin-chitosan membranes. Thermal treatment exhibited that chitosan encapsulation could improve the thermal stability of primary emulsions. During in vitro digestion, it was found that chitosan encapsulation had little effect on the lipolysis of linseed oil and bioaccessibility of α-lipoic acid. The oxidation stability of linseed oil in multilayer emulsions was improved effectively by chitosan encapsulation and α-lipoic acid. Chitosan encapsulation could inhibit the degradation of α-lipoic acid. A physical stability study indicated that multilayer emulsions had good centrifugal, dilution and storage stabilities. Multilayer emulsion is an effective delivery system to incorporate linseed oil and α-lipoic acid into functional foods and beverages. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  19. Oral co-administration of α-lipoic acid, quercetin and captopril prevents gallium arsenide toxicity in rats.

    Science.gov (United States)

    Bhatt, Kapil; Flora, S J S

    2009-07-01

    Gallium arsenide (GaAs), an inter-metallic semiconductor, known to exhibit superior optical and electronic properties compared to silicon, promotes its use in semiconductor industries. Extensive use of GaAs will inevitably lead to an increase in the exposure of workers manufacturing these products. Antioxidants are exogenous or endogenous compounds acting in several ways, including scavenging reactive oxygen species (ROS) or their precursors, inhibiting ROS formation, and binding metal ions needed for the catalysis of ROS generation. In the present study we investigated the protective efficacy of α-lipoic acid, quercetin and captopril individually against gallium arsenide exposure. Co-administration of α-lipoic acid with GaAs was most effective in reducing GaAs induced inhibition of blood δ-aminolevulinic acid dehydratase (ALAD) activity, liver, kidney and brain reduced glutathione (GSH) level and elevation of oxidized glutathione (GSSG). Captopril, on the other hand was effective in reducing thiobarbituric acid reactive substance (TBARS) levels, while quercetin reduced ROS in liver and kidney. The results suggest comparatively better preventive efficacy of concomitant α-lipoic acid administration during Gallium arsenide exposure compared to quercetin and captopril in preventing GaAs induced oxidative stress. Copyright © 2009 Elsevier B.V. All rights reserved.

  20. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    International Nuclear Information System (INIS)

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory

    2014-01-01

    Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks

  1. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    Energy Technology Data Exchange (ETDEWEB)

    Keith, Dove; Finlay, Liam; Butler, Judy [Linus Pauling Institute, Oregon State University (United States); Gómez, Luis; Smith, Eric [Linus Pauling Institute, Oregon State University (United States); Biochemistry Biophysics Department, Oregon State University (United States); Moreau, Régis [Linus Pauling Institute, Oregon State University (United States); Hagen, Tory, E-mail: Tory.Hagen@oregonstate.edu [Linus Pauling Institute, Oregon State University (United States); Biochemistry Biophysics Department, Oregon State University (United States)

    2014-07-18

    Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks.

  2. Alfa-lipoic acid and superoxide dismutase in the management of chronic neck pain: a prospective randomized study

    OpenAIRE

    Letizia Mauro, G.; Cataldo, P.; Barbera, G.; Sanfilippo, A.

    2014-01-01

    Background and Objective Since oxidative stress plays a pathogenetic role in chronic neck pain (CNP), we investigated whether a combination of α-lipoic acid (ALA) and superoxide dismutase (SOD) might improve pain control and the efficacy of physiotherapy (“multimodal therapy”) in patients with CNP. Setting This study was conducted in the Rehabilitation Unit of the Department of Surgical and Oncological Sciences at the University Policlinic in Palermo, Italy. Design and Patients This was a pro...

  3. Bace1 activity impairs neuronal glucose metabolism: rescue by beta-hydroxybutyrate and lipoic acid

    Directory of Open Access Journals (Sweden)

    John A Findlay

    2015-10-01

    Full Text Available Glucose hypometabolism and impaired mitochondrial function in neurons have been suggested to play early and perhaps causative roles in Alzheimer’s disease (AD pathogenesis. Activity of the aspartic acid protease, beta-site amyloid precursor protein (APP cleaving enzyme 1 (BACE1, responsible for beta amyloid peptide generation, has recently been demonstrated to modify glucose metabolism. We therefore examined, using a human neuroblastoma (SH-SY5Y cell line, whether increased BACE1 activity is responsible for a reduction in cellular glucose metabolism. Overexpression of active BACE1, but not a protease-dead mutant BACE1, protein in SH-SY5Y cells reduced glucose oxidation and the basal oxygen consumption rate, which was associated with a compensatory increase in glycolysis. Increased BACE1 activity had no effect on the mitochondrial electron transfer process but was found to diminish substrate delivery to the mitochondria by inhibition of key mitochondrial decarboxylation reaction enzymes. This BACE1 activity-dependent deficit in glucose oxidation was alleviated by the presence of beta hydroxybutyrate or α-lipoic acid. Consequently our data indicate that raised cellular BACE1 activity drives reduced glucose oxidation in a human neuronal cell line through impairments in the activity of specific tricarboxylic acid cycle enzymes. Because this bioenergetic deficit is recoverable by neutraceutical compounds we suggest that such agents, perhaps in conjunction with BACE1 inhibitors, may be an effective therapeutic strategy in the early-stage management or treatment of AD.

  4. Bioavailability of an R-α-Lipoic Acid/γ-Cyclodextrin Complex in Healthy Volunteers

    Directory of Open Access Journals (Sweden)

    Naoko Ikuta

    2016-06-01

    Full Text Available R-α-lipoic acid (R-LA is a cofactor of mitochondrial enzymes and a very strong antioxidant. R-LA is available as a functional food ingredient but is unstable against heat or acid. Stabilized R-LA was prepared through complexation with γ-cyclodextrin (CD, yielding R-LA/CD. R-LA/CD was orally administered to six healthy volunteers and showed higher plasma levels with an area under the plasma concentration-time curve that was 2.5 times higher than that after oral administration of non-complexed R-LA, although the time to reach the maximum plasma concentration and half-life did not differ. Furthermore, the plasma glucose level after a single oral administration of R-LA/CD or R-LA was not affected and no side effects were observed. These results indicate that R-LA/CD could be easily absorbed in the intestine. In conclusion, γ-CD complexation is a promising technology for delivering functional but unstable ingredients like R-LA.

  5. Lipoic acid and ascorbic acid affect plasma free amino acids selectively in the teleost fish pacu (Piaractus mesopotamicus).

    Science.gov (United States)

    Terjesen, Bendik F; Park, Kwan; Tesser, Marcelo B; Portella, Maria C; Zhang, Yongfang; Dabrowski, Konrad

    2004-11-01

    Most studies on the antioxidants, lipoic acid (LA) and ascorbic acid (AA), focused on species that, unlike teleost fish, are not scurvy-prone, and are able to synthesize AA. The antioxidant properties of LA may make it useful in aquaculture nutrition, but several effects must first be investigated, and we address here plasma free amino acids (FAA). In mammals, LA and AA in high doses were claimed to alter plasma FAA profile; to our knowledge, however, no data are available in fish. We therefore studied the effects of dietary LA and AA on plasma FAA in the South American teleost fish pacu, which is being used increasingly in aquaculture. LA treatment decreased concentrations of 18 of 23 individual FAA; specifically, dispensable and total FAA were significantly affected. Ornithine was elevated (+26%) in LA-treated fish and significantly decreased ratios of plasma [Arg]/[Orn] and other individual [FAA]/[Orn] were observed. LA and AA both affected sulfur FAA concentrations. Plasma cystine levels were significantly increased in the LA-supplemented groups. AA had little effect on most amino acids, and no interaction with LA was detected. AA supplementation did, however, significantly lower taurine (-42%) and cystathionine (-31%) levels in plasma. No effect on the branched chain:aromatic amino acid ratios was observed. The data indicate that at the dietary level studied, LA and AA independently affect selected plasma FAA in pacu, and suggest that any use of LA in particular as a dietary supplement should take into account an altered plasma FAA profile.

  6. Role of catalase and superoxide dismutase activities on oxidative stress in the brain of a phenylketonuria animal model and the effect of lipoic acid.

    Science.gov (United States)

    Moraes, Tarsila Barros; Jacques, Carlos Eduardo Diaz; Rosa, Andrea Pereira; Dalazen, Giovana Reche; Terra, Melaine; Coelho, Juliana Gonzalez; Dutra-Filho, Carlos Severo

    2013-03-01

    Phenylketonuria (PKU) is an inherited metabolic disorder caused by deficiency of phenylalanine hydroxylase which leads to accumulation of phenylalanine and its metabolites in tissues of patients with severe neurological involvement. Recently, many studies in animal models or patients have reported the role of oxidative stress in PKU. In the present work we studied the effect of lipoic acid against oxidative stress in rat brain provoked by an animal model of hyperphenylalaninemia (HPA), induced by repetitive injections of phenylalanine and α-methylphenylalanine (a phenylalanine hydroxylase inhibitor) for 7 days, on some oxidative stress parameters. Lipoic acid prevented alterations on catalase (CAT) and superoxide dismutase (SOD), and the oxidative damage of lipids, proteins, and DNA observed in HPA rats. In addition, lipoic acid diminished reactive species generation compared to HPA group which was positively correlated to SOD/CAT ratio. We also observed that in vitro Phe inhibited CAT activity while phenyllactic and phenylacetic acids stimulated superoxide dismutase activity. These results demonstrate the efficacy of lipoic acid to prevent oxidative stress induced by HPA model in rats. The possible benefits of lipoic acid administration to PKU patients should be considered.

  7. Are anti-inflammatory properties of lipoic acid associated with the formation of hydrogen sulfide?

    Science.gov (United States)

    Dudek, Magdalena; Bilska-Wilkosz, Anna; Knutelska, Joanna; Mogilski, Szczepan; Bednarski, Marek; Zygmunt, Małgorzata; Iciek, Małgorzata; Sapa, Jacek; Bugajski, Dominik; Filipek, Barbara; Włodek, Lidia

    2013-01-01

    Lipoic acid (LA) was shown to possess anti-inflammatory properties. In this study, we present evidence supporting the hypothesis that the anti-inflammatory properties of LA are associated with the formation of hydrogen sulfide (H2S). The study was conducted on male albino Swiss mice. The animals were treated with carrageenan by subcutaneous (sc) injection into the right hind paw to induce acute inflammation. Animals were treated intraperitoneally (ip) with LA (30, 50 and 100 mg/kg) or indomethacin (20 mg/kg) 30 min before carrageenan administration. The control group was given ip the vehicle (1% Tween 80) 30 min before carrageenan administration. Additional experiment involved ip combined treatment of mice with glibenclamide (10 mg/kg) or glibenclamide (10 mg/kg) and LA(100 mg/kg) 30 min before carrageenan administration. LA, indomethacin and glibenclamide were suspended in 1% Tween 80. At 1, 2 and 3 h after treatment with carrageenan the degree of the paw edema was evaluated by the measurement of the paw volume using aqueous plethysmometer. Injection of carrageenan into the mouse hind paw increased paw volume. The increase in paw edema was completely suppressed by pretreatment with LA. The reduction of paw edema by LA was abolished by pretreatment with the K(ATP) channel antagonist, glibenclamide. Our findings demonstrate for the first time in vivo that the anti-inflammatory activity of LA might be connected with the formation of H2S.

  8. α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    International Nuclear Information System (INIS)

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.

    2006-01-01

    α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity

  9. In Vivo Anti-inflammatory Activity of Lipoic Acid Derivatives in Mice 

    Directory of Open Access Journals (Sweden)

    Brunon Kwiecień

    2013-04-01

    Full Text Available Background: In mammals lipoic acid (LA and its reduced form dihydrolipoic acid (DHLA function as cofactors for multienzymatic complexes catalyzing the decarboxylation of α-ketoacids. Moreover, LA is used as a drug in a variety of diseases including inflammatory diseases. The aim of the study was to examine anti-inflammatory properties of LA metabolites.Material/methods:The present paper reports the chemical synthesis of 2,4-bismethylthio-butanoic acid (BMTBA and tetranor-dihydrolipoic acid (tetranor-DHLA. BMTBA is one of the biotransformation products of LA, while tetranor-DHLA is an analogue of DHLA. Structural identity of these compounds was confirmed by 1H NMR. These compounds were assessed for their anti-inflammatory activity in mice. For this purpose, the zymosan-induced peritonitis and the carrageenan-induced hind paw edema animal models were applied.Results/conclusions: The obtained results indicated that the early vascular permeability measured at 30 min of zymosan-induced peritonitis was significantly inhibited in groups receiving BMTBA (10, 30, 50 mg/kg. The early infiltration of neutrophils measured at 4 hours of zymosan-induced peritonitis was inhibited in the group receiving BMTBA (50 mg/kg and tetranor-DHLA (50 mg/kg. The results indicated that the increase in paw edema was significantly inhibited in the groups receiving BMTBA (50, 100 mg/kg and tetranor-DHLA (30, 50 mg/kg. In summary, the present studies clearly demonstrated that both BMTBA and tetranor-DHLA were able to act as anti-inflammatory agents. This is the first study examining in vivo the anti-inflammatory properties of LA metabolites.

  10. (R-(+-α-Lipoic acid protected NG108-15 cells against H2O2-induced cell death through PI3K-Akt/GSK-3β pathway and suppression of NF-κβ-cytokines

    Directory of Open Access Journals (Sweden)

    Kamarudin MNA

    2014-10-01

    Full Text Available Muhamad Noor Alfarizal Kamarudin, Nur Afiqah Mohd Raflee, Sharifah Salwa Syed Hussein, Jia Ye Lo, Hadi Supriady, Habsah Abdul KadirInstitute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, MalaysiaAbstract: Alpha-lipoic acid, a potent antioxidant with multifarious pharmacological benefits has been reported to be neuroprotective in several neuronal models and used to treat neurological disorders such as Alzheimer’s disease. Nonetheless, conclusive mechanisms of alpha-lipoic acid for its protective effects particularly in NG108-15 cells have never been investigated. In this study, the intricate neuroprotective molecular mechanisms by (R-(+-alpha-lipoic acid (R-LA against H2O2-induced cell death in an in vitro model of neurodegeneration were elucidated. Pretreatment with R-LA (2 hours significantly increased NG108-15 cell viability as compared to H2O2-treated cells and mitigated the induction of apoptosis as evidenced by Hoechst 33342/propidium iodide staining. R-LA (12.5–50 µM aggrandized the reduced glutathione over glutathione disulfide ratio followed by a reduction in the intracellular reactive oxygen species level and an increase in mitochondrial membrane potential following H2O2 exposure. Moreover, pretreatment with R-LA stimulated the activation of PI3K-Akt through mTORC1 and mTORC2 components (mTOR, rictor and raptor and production of antiinflammatory cytokine, IL-10 which led to the inactivation of glycogen synthase kinase-3β (GSK-3β and reduction of both Bax/Bcl2 and Bax/Bcl-xL ratios, accompanied by inhibition of the cleaved caspase-3. Additionally, this observation was preceded by the suppression of NF-κβ p65 translocation and production of proinflammatory cytokines (IL-6 and TNF-α. The current findings accentuate new mechanistic insight of R-LA against apoptogenic and brain inflammatory factors in a neuronal model. These results further advocate the therapeutic potential of R-LA for

  11. Regulation of ischemic cell death by the lipoic acid-palladium complex, Poly MVA, in gerbils.

    Science.gov (United States)

    Antonawich, Francis J; Fiore, Susan M; Welicky, Lauren M

    2004-09-01

    Modulation of ischemic cell death can be accomplished via a multitude of mechanisms, such as quenching radical species, providing alternative energy sources, or altering glutamate excitation. Transient cerebral ischemia will induce apoptotic cell death selectively to hippocampal cornus ammon's field 1 of the hippocampus (CA1) pyramidal cells, while neighboring CA3 and dentate neurons are spared. Poly MVA is a dietary supplement based on the nontoxic chemotherapeutic lipoic acid-palladium complex (LAPd). LAPd is a liquid crystal that works in cancer cells by transferring excess electrons from membrane fatty acids to DNA via the mitochondria. Therefore, by its structural nature and action as a redox shuttle, it can both quench radicals as well as provide energy to the mitochondria. To understand the role of LAPd in regulating ischemic cell death, we studied Poly MVA. Male Mongolian gerbils were subjected to 5 min of bilateral carotid artery occlusion under a controlled temperature environment (37.0-38.0 degrees C). Animals were injected with physiological saline or either 30, 50, or 70 mg/kg of Poly MVA every 24 h beginning immediately after the occlusion until being sacrificed on experimental day 4. Damage was evaluated by analyzing nesting behavior and conducting blinded measures of viable CA1 lengths. All Poly MVA treatment dosages significantly (p transient global ischemia, only the LAPd complex, which quenches radicals and provides energy to stabilize the mitochondria, offers such significant protection. Thus, the administration of Poly MVA may be a potent neuroprotective agent for victims of transient ischemic attack (TIA), cardiac arrest, anesthetic accidents, or drowning.

  12. A Clinical Trial about a Food Supplement Containing α-Lipoic Acid on Oxidative Stress Markers in Type 2 Diabetic Patients

    Directory of Open Access Journals (Sweden)

    Giuseppe Derosa

    2016-10-01

    Full Text Available The aim of this study was to evaluate the effect of a food supplement containing α-lipoic acid and of a placebo on glyco-metabolic control and on oxidative stress markers in type 2 diabetics. We randomized 105 diabetics to either a supplementation containing 600 mg of α-lipoic acid, 165 mg of L-carnosin, 7.5 mg of zinc, and vitamins of group B, or a placebo, for three months. We evaluated body mass index, fasting plasma glucose (FPG, post-prandial-glucose (PPG, glycated hemoglobin (HbA1c, fasting plasma insulin (FPI, HOMA-index (HOMA-IR, lipid profile, high sensitivity C-reactive protein (Hs-CRP, superoxide dismutase (SOD, glutathione peroxidase (GSH-Px, malondialdehyde (MDA. There was a reduction of FPG, PPG, and HbA1c with the food supplement containing α-lipoic acid compared with a baseline, and with the placebo. Concerning lipid profile, we observed a reduction of LDL-C, and Tg with the food supplement, compared with both the baseline, and the placebo. There was a reduction of Hs-CRP with the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. An increase of SOD, and GSH-Px, and a decrease of MDA were reached by the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. We can conclude that the food supplement containing α-lipoic acid, L-carnosin, zinc, and vitamins of group B improved glycemic control, lipid profile, and anti-oxidative stress markers.

  13. Determination of lipoic acid in human urine by capillary zone electrophoresis.

    Science.gov (United States)

    Kubalczyk, Paweł; Głowacki, Rafał

    2017-07-01

    Fast, simple, and accurate CE method enabling determination of lipoic acid (LA) in human urine has been developed and validated. LA is a disulfide-containing natural compound absorbed from the organism's diet. Due to powerful antioxidant activity, LA has been used for prevention and treatment of various diseases and disorders, e.g. cardiovascular diseases, neurodegenerative disorders, and cancer. The proposed analytical procedure consists of liquid-liquid sample extraction, reduction of LA with tris(2-carboxyethyl)phosphine, derivatization with 1-benzyl-2-chloropyridinium bromide (BCPB) followed by field amplified sample injection stacking, capillary zone electrophoresis separation, and ultraviolet-absorbance detection of LA-BCPB derivative at 322 nm. Effective baseline electrophoretic separation was achieved within 6 min under the separation voltage of 20 kV (∼80 μA) using a standard fused-silica capillary (effective length 51.5 cm, 75 μm id) and BGE consisted of 0.05 mol/L borate buffer adjusted to pH 9. The experimentally determined limit of detection for LA in urine was 1.2 μmol/L. The calibration curve obtained for LA in urine showed linearity in the range 2.5-80 μmol/L, with R 2 0.9998. The relative standard deviation of the points of the calibration curve was lower than 10%. The analytical procedure was successfully applied to analysis of real urine samples from seven healthy volunteers who received single 100 mg dose of LA. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Potential Therapeutic Effects of Lipoic Acid on Memory Deficits Related to Aging and Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Patrícia Molz

    2017-12-01

    Full Text Available The aging process comprises a series of organic alterations, affecting multiple systems, including the nervous system. Aging has been considered the main risk factor for the advance of neurodegenerative diseases, many of which are accompanied by cognitive impairment. Aged individuals show cognitive decline, which has been associated with oxidative stress, as well as mitochondrial, and consequently energetic failure. Lipoic acid (LA, a natural compound present in food and used as a dietary supplement, has been considered a promising agent for the treatment and/or prevention of neurodegenerative disorders. In spite of a number of preclinical studies showing beneficial effects of LA in memory functioning, and pointing to its neuroprotective potential effect, to date only a few studies have examined its effects in humans. Investigations performed in animal models of memory loss associated to aging and neurodegenerative disorders have shown that LA improves memory in a variety of behavioral paradigms. Moreover, cell and molecular mechanisms underlying LA effects have also been investigated. Accordingly, LA displays antioxidant, antiapoptotic, and anti-inflammatory properties in both in vivo and in vitro studies. In addition, it has been shown that LA reverses age-associated loss of neurotransmitters and their receptors, which can underlie its effects on cognitive functions. The present review article aimed at summarizing and discussing the main studies investigating the effects of LA on cognition as well as its cell and molecular effects, in order to improve the understanding of the therapeutic potential of LA on memory loss during aging and in patients suffering from neurodegenerative disorders, supporting the development of clinical trials with LA.

  15. α-Lipoic Acid Mitigates Arsenic-Induced Hematological Abnormalities in Adult Male Rats

    Directory of Open Access Journals (Sweden)

    Sonali Ghosh

    2017-05-01

    Full Text Available Background: Arsenic toxicity is a major global health problem and exposure via contaminated drinking water has been associated with hematological and other systemic disorders. The present investigation has been conducted in adult male rats to evaluate the protective ability of α-lipoic acid (ALA against such hematological disorders. Methods: Twenty-four adult male Wister rats (b.wt.130±10g were grouped and accordingly group I (control received the normal diet, group II (treated was given arsenic orally for 28 consecutive days as arsenic trioxide (3 mg/kgbw/rat/day whereas group III (supplemented received the same dose of arsenic along with ALA (25 mg/kgbw/rat/day as oral supplement. Hematological profile, plasma oxidant/antioxidant status, and erythrocyte morphology were assessed. Statistical analysis was done by one-way ANOVA using SPSS software (version 16.0. Results: Arsenic exposure caused reduction of erythrocyte (P=0.021, leucocyte (P<0.001, and hemoglobin (P=0.031 associated with echinocytic transformation as evidenced by light and scanning electron microscopic studies. The other significantly altered parameters include increased mean corpuscular volume (P=0.041 and lymphocytopenia (P<0.001 with insignificant neutropenia and eosinophilia. Altered serum oxidative balance as evidenced by decreased TAS (P<0.001 and increased TOS (P<0.001 with OSI (P<0.001 was also noted. The dietary supplementation of ALA has a beneficial effect against the observed (P<0.05 arsenic toxicities. It brings about the protection by restoring the hematological redox and inflammatory status near normal in treated rats. Arsenic-induced morphological alteration of erythrocytes was also partially attenuated by ALA supplementation. Conclusion: It is concluded that arsenicosis is associated with hematological alterations and ALA co-supplementation can partially alleviate these changes in an experimental male rat model.

  16. Age-dependent modulation of synaptic plasticity and insulin mimetic effect of lipoic acid on a mouse model of Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Harsh Sancheti

    Full Text Available Alzheimer's disease is a progressive neurodegenerative disease that entails impairments of memory, thinking and behavior and culminates into brain atrophy. Impaired glucose uptake (accumulating into energy deficits and synaptic plasticity have been shown to be affected in the early stages of Alzheimer's disease. This study examines the ability of lipoic acid to increase brain glucose uptake and lead to improvements in synaptic plasticity on a triple transgenic mouse model of Alzheimer's disease (3xTg-AD that shows progression of pathology as a function of age; two age groups: 6 months (young and 12 months (old were used in this study. 3xTg-AD mice fed 0.23% w/v lipoic acid in drinking water for 4 weeks showed an insulin mimetic effect that consisted of increased brain glucose uptake, activation of the insulin receptor substrate and of the PI3K/Akt signaling pathway. Lipoic acid supplementation led to important changes in synaptic function as shown by increased input/output (I/O and long term potentiation (LTP (measured by electrophysiology. Lipoic acid was more effective in stimulating an insulin-like effect and reversing the impaired synaptic plasticity in the old mice, wherein the impairment of insulin signaling and synaptic plasticity was more pronounced than those in young mice.

  17. Α-lipoic acid supplementation up-regulates antioxidant capacity in adults with G6PD deficiency.

    Science.gov (United States)

    Georgakouli, Kalliopi; Deli, Chariklia K; Zalavras, Athanasios; Fatouros, Ioannis G; Kouretas, Dimitrios; Koutedakis, Yiannis; Jamurtas, Athanasios Z

    2013-11-01

    The purpose of this study was to examine the effect of α-lipoic acid (LA) supplementation on blood redox status in individuals with glucose-6-phosphate dehydrogenase (G6PD) deficiency. Eight adults with G6PD deficiency (D group) and eight controls with normal G6PD levels (N group) participated in this study. Participants received LA (600 mg/day) for 28 days. At baseline, 2 and 4 weeks after supplementation, venous blood was collected for analysis of reduced glutathione (GSH), catalase, protein carbonyls (PC), thiobarbituric acid reactive substances (TBARS), total antioxidant capacity (TAC), bilirubin, uric acid (UA) and hemoglobin (Hb) levels. Baseline GSH was lower (PG6PD deficiency. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant potential and lipid stability of meat

    Science.gov (United States)

    2013-01-01

    Background Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. Methods The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. Results The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010–11 & 2011–12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. Conclusion In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio

  19. Bioprotective carnitinoids: lipoic acid, butyrate, and mitochondria-targeting to treat radiation injury: mitochondrial drugs come of age.

    Science.gov (United States)

    Steliou, Kosta; Faller, Douglas V; Pinkert, Carl A; Irwin, Michael H; Moos, Walter H

    2015-06-01

    Preclinical Research Given nuclear-power-plant incidents such as the 2011 Japanese Fukushima-Daiichi disaster, an urgent need for effective medicines to protect against and treat the harmful biological effects of radiation is evident. To address such a challenge, we describe potential strategies herein including mitochondrial and epigenetic-driven methods using lipoic and butyric acid ester conjugates of carnitine. The antioxidant and other therapeutically beneficial properties of this class of agents may protect against ionizing radiation and resultant mitochondrial dysfunction. Recent studies of the compounds described herein reveal the potential-although further research and development is required to prove the effectiveness of this approach-to provide field-ready radiation-protective drugs. © 2015 Wiley Periodicals, Inc.

  20. The Protective Effect of Lipoic Acid on Selected Cardiovascular Diseases Caused by Age-Related Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Beata Skibska

    2015-01-01

    Full Text Available Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system.

  1. The Protective Effect of Lipoic Acid on Selected Cardiovascular Diseases Caused by Age-Related Oxidative Stress

    Science.gov (United States)

    Goraca, Anna

    2015-01-01

    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system. PMID:25949771

  2. Effect of α-lipoic acid on free radical processes in serum of rats on high fat diet

    Directory of Open Access Journals (Sweden)

    Marcin Cichoń

    2017-06-01

    Full Text Available Background: Oils are often fried which reduces their beneficial biological and nutritional properties, contributing to disturbances in homeostasis. Some antioxidant substances can improve stability of oils. The aim of the study was to examine the effect of α-lipoic acid (ALA on the concentration of sulfhydryl groups, lipid peroxides, malondialdehyde, creatinine and urea in serum of rats fed high fat diet for 3 months. Material and Methods: Thirty six Wistar rats were equally divided into 6 groups: the control group on standard breeding diet (SB, oxidized oil (OU group on SB with 10% oxidized oil, ALA10 group on SB with ALA 10 mg/kg of body weight (b.w., OU+ALA10 group on SB with oxidized oil and ALA (10 mg/kg b.w., ALA50 group on SB with ALA in a dose of 50 mg/kg b.w., OU+ALA50 group on SB with oxidized oil and ALA (50 mg/kg b.w.. Oil was oxidized in 180°C for 6 h. Results: We observed decrease in concentration of protein sulfhydryl (PSH groups in all study groups except for ALA10 vs. control group (C and increase in OU+ALA10 and OU+ALA50 vs. OU; increase in the lipid hydroperoxide (LHP concentration in OU, OU+ALA10 and OU+ALA50 vs. C and decrease in all study groups vs. OU; increase of malondialdehyde (MDA in OU vs. all other groups. And also increase in creatinine and urea concentration in OU group. Conclusions: High fat diet rich in oxidized oil intensifies the lipid peroxidation process and oxidation of sulfhydryl groups. It can also impair kidney function. Administration of lipoic acid in a dose of 10 mg/kg b.w. inhibits the lipid peroxidation and protects sulfhydryl groups. Med Pr 2017;68(3:391–399

  3. Lipoic acid increases the expression of genes involved in bone formation in mice fed a high-fat diet.

    Science.gov (United States)

    Xiao, Ying; Cui, Jue; Shi, Yonghui; Le, Guowei

    2011-04-01

    Antioxidant lipoic acid (LA) has been reported to have a potential prophylactic effect on bone loss induced by high-fat diet (HFD). The aim of this work was to examine the hypothesis that LA decreases bone resorption-related gene expression and increases bone formation-related gene expression in HFD-fed mice, preventing a shift in the bone metabolism balance toward resorption. Male C57BL/6 mice were fed a normal diet, HFD, or HFD plus 0.1% LA for 12 weeks. The bone metabolism-related genes differentially expressed between mice fed HFD and those fed HFD supplemented with LA were identified through complementary DNA microarray. The supplemental LA significantly increased bone mineral density and bone antioxidant capacity in mice fed HFD (P LA induced the decreased expression of genes associated with bone resorption, such as Mmp9 (1.9-fold) and Ctsk (2.3-fold), and increased those genes associated with bone formation, such as Col1a1 (1.3-fold) and Alp1 (1.5-fold). Furthermore, LA upregulated many genes involved in the Igf signaling pathway, such as Igf-1 (increased 1.7-fold), and downregulated genes involved in the p53 apoptotic pathway, such as p53 (decreased 2.3-fold), thus attenuating the HFD-induced inhibition of bone formation. Lipoic acid induced upregulation of Il12a (2.1-fold) and downregulation of Tgfbr1 (4.3-fold) and Il17a (11.3-fold), which may reduce bone resorption. In summary, LA supplementation during HFD could affect bone density, altering gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Acetyl-L-carnitine and α-lipoic acid affect rotenone-induced damage in nigral dopaminergic neurons of rat brain, implication for Parkinson's disease therapy.

    Science.gov (United States)

    Zaitone, Sawsan A; Abo-Elmatty, Dina M; Shaalan, Aly A

    2012-01-01

    Although the mechanisms of neurodegeneration in Parkinson's disease are not fully understood, mitochondrial dysfunction, oxidative stress and environmental toxins may be involved. The current research was directed to investigate the protective role of two bioenergetic antioxidants, acetyl-L-carnitine and α-lipoic acid, in rotenone-parkinsonian rats. Ninety six male rats were divided into five groups. Group I is the vehicle-injected group, group II is the disease control group and was injected with six doses of rotenone (1.5 mg/kg/48 h, s.c.). Groups III, IV and V received rotenone in addition to acetyl-L-carnitine (100 mg/kg/day, p.o.), α-lipoic acid (50 mg/kg/day, p.o.) or their combination, respectively. Results showed that rotenone-treated rats exhibited bradykinesia and motor impairment in the open-field and square bridge tests. In addition, ATP level was decreased whereas lipid peroxides and protein carbonyls increased in the striata of rotenone-treated rats as compared to vehicle-treated rats. Treatment with acetyl-L-carnitine or α-lipoic acid improved the motor performance and reduced the level of lipid peroxides in rat brains as compared to rotenone group. Further, ATP production was enhanced along with acetyl-L-carnitine treatments (p≤0.05). Taken together, our study reinforces the view that acetyl-L-carnitine and α-lipoic acid are promising candidates for neuroprotection in Parkinson's disease. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Coenzyme Q10 and α-lipoic acid: antioxidant and pro-oxidant effects in plasma and peripheral blood lymphocytes of supplemented subjects.

    Science.gov (United States)

    Silvestri, Sonia; Orlando, Patrick; Armeni, Tatiana; Padella, Lucia; Brugè, Francesca; Seddaiu, Giovanna; Littarru, Gian Paolo; Tiano, Luca

    2015-07-01

    Reactive oxygen species not only cause damage but also have a physiological role in the protection against pathogens and in cell signalling. Mitochondrial nutrients, such as coenzyme Q10 and α-lipoic acid, beside their acknowledged antioxidant activities, show interesting features in relation to their redox state and consequent biological activity. In this study, we tested whether oral supplementation with 200 mg/day of coenzyme Q10 alone or in association with 200 mg/die of α-lipoic acid for 15 days on 16 healthy subjects was able to modulate the oxidative status into different compartments (plasma and cells), in basal condition and following an oxidative insult in peripheral blood lymphocytes exposed in vitro to H2O2. Data have shown that tested compounds produced antioxidant and bioenergetic effects improving oxidative status of the lipid compartment and mitochondrial functionality in peripheral blood lymphocytes. Simultaneously, an increased intracellular reactive oxygen species level was observed, although they did not lead to enhanced DNA oxidative damage. Coenzyme Q10 and α-lipoic acid produced beneficial effects also steering intracellular redox poise toward a pro-oxidant environment. In contrast with other antioxidant molecules, pro-oxidant activities of tested mitochondrial nutrients and consequent oxidant mediated signalling, could have important implications in promoting adaptive response to oxidative stress.

  6. α-lipoic acid suppresses neuronal excitability and attenuates colonic hypersensitivity to colorectal distention in diabetic rats

    Directory of Open Access Journals (Sweden)

    Sun Y

    2017-07-01

    Full Text Available Yan Sun,1,* Pan-Pan Yang,1,* Zhen-Yuan Song,2 Yu Feng,1 Duan-Min Hu,1 Ji Hu,1 Guang-Yin Xu,3 Hong-Hong Zhang1,3 1Department of Endocrinology, The Second Affiliated Hospital of Soochow University, Suzhou, People’s Republic of China; 2Department of Endocrinology, The East District of Suzhou Municipal Hospital, Suzhou, People’s Republic of China; 3Jiangsu Key Laboratory of Translational Research and Therapy for Neuro-Psycho-Diseases, Institute of Neuroscience, Soochow University, Suzhou, People’s Republic of China *These authors contributed equally to this work Aim: Patients with long-standing diabetes often demonstrate intestinal dysfunction, characterized as constipation or colonic hypersensitivity. Our previous studies have demonstrated the roles of voltage-gated sodium channels NaV1.7 and NaV1.8 in dorsal root ganglion (DRG in colonic hypersensitivity of rats with diabetes. This study was designed to determine roles of antioxidant α-lipoic acid (ALA on sodium channel activities and colonic hypersensitivity of rats with diabetes. Methods: Streptozotocin was used to induce diabetes in adult female rats. Colonic sensitivity was measured by behavioral responses to colorectal distention in rats. The excitability and sodium channel currents of colon projection DRG neurons labeled with DiI were measured by whole-cell patch-clamp recordings. The expressions of NaV1.7 and NaV1.8 of colon DRGs were measured by western blot analysis. Results: ALA treatment significantly increased distention threshold in responding to colorectal distension in diabetic rats compared with normal saline treatment. ALA treatment also hyperpolarized the resting membrane potentials, depolarized action potential threshold, increased rheobase, and decreased frequency of action potentials evoked by ramp current stimulation. Furthermore, ALA treatment also reduced neuronal sodium current densities of DRG neurons innervating the colon from rats with diabetes. In addition, ALA

  7. Proteomic and biochemical responses of canola (Brassica napus L.) exposed to salinity stress and exogenous lipoic acid.

    Science.gov (United States)

    Yıldız, Mustafa; Akçalı, Nermin; Terzi, Hakan

    2015-05-01

    To evaluate the mitigating effects of exogenous lipoic acid (LA) on NaCl toxicity, proteomic, biochemical and physiological changes were investigated in the leaves of canola (Brassica napus L.) seedlings. Salinity stress decreased the growth parameters and contents of ascorbate (AsA) and glutathione (GSH), and increased the contents of malondialdehyde (MDA), proline, cysteine and the activities of antioxidant enzymes such as superoxide dismutase (SOD), guaiacol peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX). The foliar application of LA alleviated the toxic effects of salinity stress on canola seedlings and notably decreased MDA content and increased growth parameters, cysteine content, and activities of CAT and POD. In the proteomic analyses, total proteins from the leaves of control, LA, NaCl and NaCl+LA treated-seedlings were separated using two-dimensional gel electrophoresis (2-DE). A total of 28 proteins were differentially expressed. Of these, 21 proteins were successfully identified by MALDI-TOF/TOF MS. These proteins had functions related to photosynthesis, stress defense, energy metabolism, signal transduction, protein folding and stabilization indicating that LA might play important roles in salinity through the regulation of photosynthesis, stress defense and signal transduction related proteins. The proteomic findings have provided new insight to reveal the effect of LA on salinity stress for the first time. Copyright © 2015 Elsevier GmbH. All rights reserved.

  8. α-Lipoic acid and superoxide dismutase in the management of chronic neck pain: a prospective randomized study.

    Science.gov (United States)

    Letizia Mauro, Giulia; Cataldo, Pietro; Barbera, Giuseppa; Sanfilippo, Antonio

    2014-03-01

    Since oxidative stress plays a pathogenetic role in chronic neck pain (CNP), we investigated whether a combination of α-lipoic acid (ALA) and superoxide dismutase (SOD) might improve pain control and the efficacy of physiotherapy ("multimodal therapy") in patients with CNP. This study was conducted in the Rehabilitation Unit of the Department of Surgical and Oncological Sciences at the University Policlinic in Palermo, Italy. This was a prospective, randomized, open study in outpatients. Patients randomly received either physiotherapy alone (group 2; n = 45) or a combination of ALA 600 mg and SOD 140 IU daily in addition to physiotherapy (group 1; n = 51), for 60 days. Pain was assessed by a visual analogue scale (VAS) and a modified Neck Pain Questionnaire (mNPQ). Treatment compliance and safety were also evaluated. Both groups experienced a significant reduction in the VAS and mNPQ scores after 1 month; however, while no further improvement was observed in group 2 at 60 days, group 1 showed a further VAS reduction (p physiotherapy (p = 0.048). No drug reaction was observed. Use of ALA/SOD in combination with physiotherapy may be a useful approach to CNP, being antioxidants that act on nerve inflammation and disease progression. These preliminary observations suggest that some interesting goals (better pain control and physical wellbeing) can be achieved by multimodal therapy in CNP patients.

  9. Lipoic acid, but not tempol, preserves vascular compliance and decreases medial calcification in a model of elastocalcinosis.

    Science.gov (United States)

    Bassi, E; Liberman, M; Martinatti, M K; Bortolotto, L A; Laurindo, F R M

    2014-02-01

    Vascular calcification decreases compliance and increases morbidity. Mechanisms of this process are unclear. The role of oxidative stress and effects of antioxidants have been poorly explored. We investigated effects of the antioxidants lipoic acid (LA) and tempol in a model of atherosclerosis associated with elastocalcinosis. Male New Zealand white rabbits (2.5-3.0 kg) were fed regular chow (controls) or a 0.5% cholesterol (chol) diet+104 IU/day vitamin D2 (vitD) for 12 weeks, and assigned to treatment with water (vehicle, n=20), 0.12 mmol·kg-1·day-1 LA (n=11) or 0.1 mmol·kg-1·day-1 tempol (n=15). Chol+vitD-fed rabbits developed atherosclerotic plaques associated with expansive remodeling, elastic fiber disruption, medial calcification, and increased aortic stiffness. Histologically, LA prevented medial calcification by ∼60% and aortic stiffening by ∼60%. LA also preserved responsiveness to constrictor agents, while intima-media thickening was increased. In contrast to LA, tempol was associated with increased plaque collagen content, medial calcification and aortic stiffness, and produced differential changes in vasoactive responses in the chol+vitD group. Both LA and tempol prevented superoxide signals with chol+vitD. However, only LA prevented hydrogen peroxide-related signals with chol+vitD, while tempol enhanced them. These data suggest that LA, opposite to tempol, can minimize calcification and compliance loss in elastocalcionosis by inhibition of hydrogen peroxide generation.

  10. Complementary Cholesterol-Lowering Response of a Phytosterol/α-Lipoic Acid Combination in Obese Zucker Rats.

    Science.gov (United States)

    Rideout, Todd C; Carrier, Bradley; Wen, Shin; Raslawsky, Amy; Browne, Richard W; Harding, Scott V

    2016-01-01

    To investigate the cholesterol-lowering effectiveness of a phytosterol/α-lipoic acid (PS/αLA) therapy, thirty-two male Zucker rats were randomly assigned to 1 of 4 diets for 30 days: (i) high fat diet (HF, 40% energy from fat); (ii) HF diet supplemented with 3% phytosterols; (iii) HF diet supplemented with 0.25% αLA; or (iv) HF diet supplemented with PS (3%) and αLA (0.25%, PS/αLA). Compared with the HF diet, combination PS/αLA proved more effective in reducing non-HDL cholesterol (-55%) than either the PS (-24%) or the αLA (-25%) therapies alone. PS supplementation did not affect LDL particle number, however, αLA supplementation reduced LDL particle number when supplemented alone (-47%) or in combination with PS (-54%). Compared with the HF-fed animals, evidence of increased HDL-particle number was evident in all treatment groups to a similar extent (21-22%). PS-mediated interruption of intestinal cholesterol absorption was evident by increased fecal cholesterol loss (+52%) and compensatory increase in HMG-CoA reductase mRNA (1.6 fold of HF), however, αLA supplementation did not affect fecal cholesterol loss. Hepatic mRNA and protein expression patterns suggested that αLA modulated multiple aspects of cholesterol homeostasis including reduced synthesis (HMG-CoA reductase mRNA, 0.7 fold of HF), reduced bile acid synthesis (CYP7a1 expression, 0.17 of HF), and increased cholesterol clearance (reduced PCSK9 mRNA, 0.5 fold of HF; increased LDLr protein, 2 fold of HF). Taken together, this data suggests that PS and αLA work through unique and complementary mechanisms to provide a superior and more comprehensive cholesterol lowering response than either therapy alone.

  11. Effect of α-lipoic acid combined with mecobalamine therapy on urodynamics and oxidative damage of nerve in patients with diabetic neurogenic bladder

    Directory of Open Access Journals (Sweden)

    Ming-Bao Ye

    2016-11-01

    Full Text Available Objective: To analyze the effect of α-lipoic acid combined with mecobalamine therapy on urodynamics and oxidative damage of nerve in patients with diabetic neurogenic bladder. Methods: A total of 78 patients with diabetic neurogenic bladder were randomly divided into observation group and control group (n=39, control group received conventional therapy and observation group received conventional therapy + α-lipoic acid combined with mecobalamine therapy. Before treatment and after one course of treatment, urodynamic indexes, peripheral nerve conduction latency time and serum indexes of two groups were detected respectively. Results: After one course of treatment, RUV, Pdet, FS, T and C value as well as ROS, MDA, SP, NPY and ChAT content of both groups were significantly lower than those before treatment, MFR value as well as GSH, SOD, BDNF and CNTF content was significantly higher than those before treatment, and the sensory conduction latency time of median nerve and ulnar nerve as well as motor conduction latency time of median nerve and peroneal nerve were shorter than those before treatment (P<0.05; RUV, Pdet, FS, T and C value as well as ROS, MDA, SP, NPY and ChAT content of observation group were significantly lower than those of control group, MFR value as well as GSH, SOD, BDNF and CNTF content was significantly higher than those of control group, and the sensory conduction latency time of median nerve and ulnar nerve as well as motor conduction latency time of median nerve and peroneal nerve were significantly shorter than those of control group (P<0.05. Conclusions: α-lipoic acid combined with mecobalamine therapy can optimize the urodynamics in patients with diabetic neurogenic bladder and also reduce the oxidative damage of nerve, and it is an effective solution for treatment of such disease.

  12. Effect of α-lipoic acid combined with nerve growth factor on bone metabolism, oxidative stress and nerve conduction function after femoral fracture surgery

    Directory of Open Access Journals (Sweden)

    An-Jun Cao

    2017-11-01

    Full Text Available Objective: To discuss the effect of 毩 -lipoic acid combined with nerve growth factor on bone metabolism, oxidative stress and nerve conduction function after femoral fracture surgery. Methods: A total of 110 patients with femoral fracture who received surgical treatment in the hospital between January 2015 and January 2017 were collected and divided into the control group (n=55 and study group (n=55 by random number table. Control group received postoperative nerve growth factor therapy, and study group received postoperative 毩 -lipoic acid combined with nerve growth factor therapy. The differences in the contents of bone metabolism and oxidative stress indexes as well as the levels of nerve conduction function indexes were compared between the two groups before and after treatment. Results: Before treatment, the differences in the contents of bone metabolism and oxidative stress indexes as well as the levels of nerve conduction function indexes were not statistically significant between the two groups. After treatment, serum bone metabolism indexes BGP and PⅠNP contents of study group were higher than those of control group while CTX-Ⅰ and TRAP contents were lower than those of control group; serum oxidative stress indexes TAC, CAT and SOD contents of study group were higher than those of control group while MDA content was lower than that of control group; limb nerve conduction velocity SCV and MCV levels of study group were higher than those of control group. Conclusion: 毩 -lipoic acid combined with nerve growth factor therapy after femoral fracture surgery can effectively balance osteoblast/ osteoclast activity, reduce oxidative stress and improve limb nerve conduction velocity.

  13. α-lipoic acid inhibits oxidative stress in testis and attenuates testicular toxicity in rats exposed to carbimazole during embryonic period

    Directory of Open Access Journals (Sweden)

    P. Prathima

    Full Text Available The aim of this study was to evaluate the probable protective effect of α-lipoic acid against testicular toxicity in rats exposed to carbimazole during the embryonic period. Time-mated pregnant rats were exposed to carbimazole from the embryonic days 9–21. After completion of the gestation period, all the rats were allowed to deliver pups and weaned. At postnatal day 100, F1 male pups were assessed for the selected reproductive endpoints. Gestational exposure to carbimazole decreased the reproductive organ indices, testicular daily sperm count, epididymal sperm variables viz., sperm count, viable sperm, motile sperm and HOS-tail coiled sperms. Significant decrease in the activity levels of 3β- and 17β-hydroxysteroid dehydrogenases and expression of StAR mRNA levels with a significant increase in the total cholesterol levels were observed in the testis of experimental rats over the controls. These events were also accompanied by a significant reduction in the serum testosterone levels in CBZ exposed rats, indicating reduced steroidogenesis. In addition, the deterioration of the testicular architecture and reduced fertility ability were noticed in the carbimazole exposed rats. Significant reduction in the activity levels of superoxide dismutase, catalase, glutathione reductase, glutathione peroxidase and reduced glutathione content with a significant increase in the levels of lipid peroxidation were observed in the testis of carbimazole exposed rats over the controls. Conversely, supplementation of α-lipoic acid (70 mg/Kg bodyweight ameliorated the male reproductive health in rats exposed to carbimazole during the embryonic period as evidenced by enhanced reproductive organ weights, selected sperm variables, testicular steroidogenesis, and testicular enzymatic and non-enzymatic antioxidants. To conclude, diminished testicular antioxidant balance associated with reduced spermatogenesis and steroidogenesis might be responsible

  14. Study of the therapeutic effects of Lactobacillus and α-lipoic acid against dimethylnitrosamine-induced liver fibrosis in rats

    Directory of Open Access Journals (Sweden)

    Khairy M.A. Zoheir

    2014-12-01

    Full Text Available Lactobacillus (LB and α-lipoic acid (ALA were investigated to compare their protective effects against dimethylnitrosamine (DMN-induced liver fibrosis in rats. Animals were either injected intraperitoneally with DMN to induce hepatic fibrosis, or were left untreated (negative control. For the DMN + LB and DMN + ALA treatment groups, at two weeks of DMN treatment LB or ALA was added to the feed and supplementation continued until the experimental endpoint at sixty days. At the study endpoint, expression of IL-1β, IL-6, IL-10, TNF-α, IFN-γ, TGF-β1, COL1-α1 genes and the concentration of glutathione and malondialdehyde were measured in liver tissues, while GOT, GPT, and ALP concentrations were measured in blood. Body weights remained higher in NC and DMN + LB groups compared to DMN and DMN + ALA groups, while activity of GOT and GPT in serum was lower in DMN + LB and DMN + ALA groups compared to the DMN group. Compared to other treatment groups, in the DMN group expression of both TGF-β1 and, COL1-α1 mRNAs and pro-inflammatory cytokines increased, while that of 1L-10 decreased. Furthermore, LB and ALA treatments increased antioxidant activity of glutathione and decreased malondialdehyde in comparison to the DMN group. Between LB and ALA treatments, glutathione concentration was higher in the DMN + LB group, while malondialdehyde was lower. Our results indicate that both LB and ALA exert hepatoprotective effects against DMN-induced liver fibrosis. Their beneficial effects may be partly associated with down-regulation of both TGF-β1 and COL1-α1 signaling, which may be accounted for reduction of increased oxidative stress and TNF-α production.

  15. Lipoic acid, but not tempol, preserves vascular compliance and decreases medial calcification in a model of elastocalcinosis

    Directory of Open Access Journals (Sweden)

    E. Bassi

    2014-02-01

    Full Text Available Vascular calcification decreases compliance and increases morbidity. Mechanisms of this process are unclear. The role of oxidative stress and effects of antioxidants have been poorly explored. We investigated effects of the antioxidants lipoic acid (LA and tempol in a model of atherosclerosis associated with elastocalcinosis. Male New Zealand white rabbits (2.5-3.0 kg were fed regular chow (controls or a 0.5% cholesterol (chol diet+104 IU/day vitamin D2 (vitD for 12 weeks, and assigned to treatment with water (vehicle, n=20, 0.12 mmol·kg-1·day-1 LA (n=11 or 0.1 mmol·kg-1·day-1 tempol (n=15. Chol+vitD-fed rabbits developed atherosclerotic plaques associated with expansive remodeling, elastic fiber disruption, medial calcification, and increased aortic stiffness. Histologically, LA prevented medial calcification by ∼60% and aortic stiffening by ∼60%. LA also preserved responsiveness to constrictor agents, while intima-media thickening was increased. In contrast to LA, tempol was associated with increased plaque collagen content, medial calcification and aortic stiffness, and produced differential changes in vasoactive responses in the chol+vitD group. Both LA and tempol prevented superoxide signals with chol+vitD. However, only LA prevented hydrogen peroxide-related signals with chol+vitD, while tempol enhanced them. These data suggest that LA, opposite to tempol, can minimize calcification and compliance loss in elastocalcionosis by inhibition of hydrogen peroxide generation.

  16. Efficacy and safety of prostaglandin E1 plus lipoic acid combination therapy versus monotherapy for patients with diabetic peripheral neuropathy.

    Science.gov (United States)

    Jiang, De-Qi; Li, Ming-Xing; Ma, Yan-Jiao; Wang, Yan; Wang, Yong

    2016-05-01

    The aim of this report was to evaluate the efficacy and safety of prostaglandin E1 (PGE1) plus lipoic acid (LA) for the treatment of diabetic peripheral neuropathy (DPN) compared with that of PGE1 or LA monotherapy. Randomized controlled trials (RCT) published up to 3 August 2014 were reviewed. A random or fixed effect model was used to analyze outcomes expressed as risk ratios (RR) or mean difference (MD) with a 95% confidence interval (CI). I(2) statistic was used to assess heterogeneity. Subgroup and sensitivity analyses were performed. The outcomes measured were as follows: clinical efficacy, median motor nerve conduction velocity (MNCV), median sensory nerve conduction velocity (SNCV), peroneal MNCV, peroneal SNCV and adverse effects. Thirty-one RCT with 2676 participants were included. Clinical efficacy of PGE1+LA combination therapy was significantly better than monotherapy (p<0.00001, RR=1.32, 95% CI 1.26 to 1.38). Compared with monotherapy, PGE1+LA combination therapy led to significant improvements in median MNCV (p<0.00001, MD=4.69, 95% CI 3.16 to 6.23), median SNCV (p<0.00001, MD=5.46, 95% CI 4.04 to 6.88), peroneal MNCV (p<0.00001, MD=5.19, 95% CI 3.71 to 6.67) and peroneal SNCV (p<0.00001, MD=5.50, 95% CI 3.30 to 7.70). There were no serious adverse events associated with drug intervention. PGE1+LA combination therapy is superior to PGE1 or LA monotherapy for improvement of neuropathic symptoms and nerve conduction velocities in patients with DPN. These findings should be further validated by larger well-designed and high-quality RCT. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Effects of α-lipoic acid on endothelial function in aged diabetic and high-fat fed rats

    Science.gov (United States)

    Sena, C M; Nunes, E; Louro, T; Proença, T; Fernandes, R; Boarder, M R; Seiça, R M

    2007-01-01

    Background and purpose: This study was conducted to investigate the effects of α-lipoic acid (α-LA) on endothelial function in diabetic and high-fat fed animal models and elucidate the potential mechanism underlying the benefits of α-LA. Experimental approach: Plasma metabolites reflecting glucose and lipid metabolism, endothelial function, urinary albumin excretion (UAE), plasma and aortic malondialdehyde (MDA) and urinary 8-hydroxydeoxyguanosine (8-OHdG) were assessed in non-diabetic controls (Wistar rats), untreated Goto-Kakizaki (GK) diabetic and high-fat fed GK rats (fed with atherogenic diet only, treated with α-LA and treated with vehicle, for 3 months). Vascular eNOS, nitrotyrosine, carbonyl groups and superoxide anion were also assessed in the different groups. Key results: α-LA and soybean oil significantly reduced both total and non-HDL serum cholesterol and triglycerides induced by atherogenic diet. MDA, carbonyl groups, vascular superoxide and 8-OHdG levels were higher in GK and high-fat fed GK groups and fully reversed with α-LA treatment. High-fat fed GK diabetic rats showed significantly reduced endothelial function and increased UAE, effects ameliorated with α-LA. This endothelial dysfunction was associated with decreased NO production, decreased expression of eNOS and increased vascular superoxide production and nitrotyrosine expression. Conclusions and implications: α-LA restores endothelial function and significantly improves systemic and local oxidative stress in high-fat fed GK diabetic rats. Improved endothelial function due to α-LA was at least partially attributed to recoupling of eNOS and increased NO bioavailability and represents a pharmacological approach to prevent major complications associated with type 2 diabetes. PMID:17906683

  18. Structural Analysis of Crystalline R(+)-α-Lipoic Acid-α-cyclodextrin Complex Based on Microscopic and Spectroscopic Studies.

    Science.gov (United States)

    Ikuta, Naoko; Endo, Takatsugu; Hosomi, Shota; Setou, Keita; Tanaka, Shiori; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Takahashi, Kenji; Terao, Keiji; Matsugo, Seiichi

    2015-10-16

    R(+)-α-lipoic acid (RALA) is a naturally-occurring substance, and its protein-bound form plays significant role in the energy metabolism in the mitochondria. RALA is vulnerable to a variety of physical stimuli, including heat and UV light, which prompted us to study the stability of its complexes with cyclodextrins (CDs). In this study, we have prepared and purified a crystalline RALA-αCD complex and evaluated its properties in the solid state. The results of ¹H NMR and PXRD analyses indicated that the crystalline RALA-αCD complex is a channel type complex with a molar ratio of 2:3 (RALA:α-CD). Attenuated total reflection/Fourier transform infrared analysis of the complex showed the shift of the C=O stretching vibration of RALA due to the formation of the RALA-αCD complex. Raman spectroscopic analysis revealed the significant weakness of the S-S and C-S stretching vibrations of RALA in the RALA-αCD complex implying that the dithiolane ring of RALA is almost enclosed in glucose ring of α-CD. Extent of this effect was dependent on the direction of the excitation laser to the hexagonal morphology of the crystal. Solid-state NMR analysis allowed for the chemical shift of the C=O peak to be precisely determined. These results suggested that RALA was positioned in the α-CD cavity with its 1,2-dithiolane ring orientated perpendicular to the plane of the α-CD ring.

  19. α-lipoic acid ameliorates n-3 highly-unsaturated fatty acids induced lipid peroxidation via regulating antioxidant defenses in grass carp (Ctenopharyngodon idellus).

    Science.gov (United States)

    Shi, Xiao-Chen; Jin, Ai; Sun, Jian; Yang, Zhou; Tian, Jing-Jing; Ji, Hong; Yu, Hai-Bo; Li, Yang; Zhou, Ji-Shu; Du, Zhen-Yu; Chen, Li-Qiao

    2017-08-01

    This study evaluated the protective effect of α-lipoic acid (LA) on n-3 highly unsaturated fatty acids (HUFAs)-induced lipid peroxidation in grass carp. The result indicated that diets with n-3 HUFAs increased the production of malondialdehyde (MDA) (P fatty acid composition of muscle and liver (P < 0.05). Furthermore, LA significantly promoted the activity of antioxidant enzymes in serum, muscle and liver of grass carp (P < 0.05), including superoxide dismutase (SOD), catalase (CAT), and glutathione s-transferase (GST). The further results showed that LA significantly elevated mRNA expression of antioxidant enzymes with promoting the mRNA expression of NF-E2-related nuclear factor 2 (Nrf2) and decreasing Kelch-like-ECH-associated protein 1 (Keap1) mRNA level. From the above, these results suggested that LA could attenuate n-3 HUFAs-induced lipid peroxidation, remit the toxicity of the lipid peroxidant, and protect n-3 HUFAs against lipid peroxidation to promote its deposition in fish, likely strengthening the activity of antioxidant enzymes through regulating mRNA expressions of antioxidant enzyme genes via mediating Nrf2-Keap1 signaling pathways. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. A Regenerative Antioxidant Protocol of Vitamin E and α-Lipoic Acid Ameliorates Cardiovascular and Metabolic Changes in Fructose-Fed Rats

    Directory of Open Access Journals (Sweden)

    Jatin Patel

    2011-01-01

    Full Text Available Type 2 diabetes is a major cause of cardiovascular disease. We have determined whether the metabolic and cardiovascular changes induced by a diet high in fructose in young adult male Wistar rats could be prevented or reversed by chronic intervention with natural antioxidants. We administered a regenerative antioxidant protocol using two natural compounds: α-lipoic acid together with vitamin E (α-tocopherol alone or a tocotrienol-rich fraction, given as either a prevention or reversal protocol in the food. These rats developed glucose intolerance, hypertension, and increased collagen deposition in the heart together with an increased ventricular stiffness. Treatment with a fixed combination of vitamin E (either α-tocopherol or tocotrienol-rich fraction, 0.84 g/kg food and α-lipoic acid (1.6 g/kg food normalized glucose tolerance, blood pressure, cardiac collagen deposition, and ventricular stiffness in both prevention and reversal protocols in these fructose-fed rats. These results suggest that adequate antioxidant therapy can both prevent and reverse the metabolic and cardiovascular damage in type 2 diabetes.

  1. Co-administration of α-lipoic acid and glutathione is associated with no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels during the treatment of neuroborreliosis with intravenous ceftriaxone.

    Science.gov (United States)

    Puri, Basant K; Hakkarainen-Smith, Jaana S; Derham, Anne; Monro, Jean A

    2015-09-01

    While pharmacotherapy with intravenous ceftriaxone, a third-generation cephalosporin, is a potential treatment of Lyme neuroborreliosis, there is concern that it can cause the formation of biliary sludge, leading to hepatobiliary complications such as biliary colic, jaundice and cholelithiasis, which are reflected in changes in serum levels of bilirubin and markers of cholestatic liver injury (alkaline phosphatase and γ-glutamyltranspeptidase). It has been suggested that the naturally occurring substances α-lipoic acid and glutathione may be helpful in preventing hepatic disease. α-Lipoic acid exhibits antioxidant, anti-inflammatory and anti-apoptotic activities in the liver, while glutathione serves as a sulfhydryl buffer. The aim of this study was to determine whether co-administration of α-lipoic acid and glutathione is associated with significant changes in serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase during the treatment of Lyme neuroborreliosis with long-term intravenous ceftriaxone. Serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase were measured in 42 serologically positive Lyme neuroborreliosis patients before and after long-term treatment with intravenous ceftriaxone (2-4 g daily) with co-administration of oral/intravenous α-lipoic acid (600 mg daily) and glutathione (100 mg orally or 0.6-2.4 g intravenously daily). None of the patients developed biliary colic and there were no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels over the course of the intravenous ceftriaxone treatment (mean length 75.0 days). Co-administration of α-lipoic acid and glutathione is associated with no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels during the treatment of neuroborreliosis with intravenous ceftriaxone.

  2. Curative role of lactulose, L-carnitine, alpha-lipoic acid and ...

    African Journals Online (AJOL)

    Malondialdehyde (MDA) and nitric oxide (NO) while antioxidant enzyme activities of glutathione peroxidase (GPX) and superoxide dismutase (SOD) ... tap water ad libitum compliance with the guidelines of the National Research Council ..... Lactulose and molecular hydrogen has been found to activate the expression of ...

  3. A Comparative Study of Effects of Omega‑3 Fatty Acids, Alpha Lipoic ...

    African Journals Online (AJOL)

    Statistical analysis was carried out by paired t-test by using SPSS software version 11 (SPSS, Chicago, USA). Results: Analysis of baseline (V1) vs. end of treatment period (V2) parameters, showed significant decrease in HbA1c in the three treatment group. We also observed decrease in fasting blood glucose in the three ...

  4. Pipecolic acid induces oxidative stress in vitro in cerebral cortex of young rats and the protective role of lipoic acid

    NARCIS (Netherlands)

    Dalazen, Giovana Reche; Terra, Melaine; Jacques, Carlos Eduardo Diaz; Coelho, Juliana G; Freitas, Raylane; Mazzola, Priscila Nicolao; Dutra-Filho, Carlos Severo

    Pipecolic acid (PA) levels are increased in severe metabolic disorders of the central nervous system such as Zellweger syndrome, infantile Refsum disease, neonatal adrenoleukodystrophy and hyperlysinemia. The affected individuals present progressive neurological dysfunction, hypotonia and growth

  5. the Early Effects of Gamma radiation on the diurnal changes of Some Biochemical Parameters and the Role of α-lipoic acid as an Antioxidant in Male Albino rats

    International Nuclear Information System (INIS)

    Abdel-Fattah, K.I.; Yacoub, S.F.; Abdel-Aziz, N.

    2013-01-01

    In mammals most of the physiological and behavioral systems such as sleep-wake cycle, cardiovascular activity, endocrine system, blood pressure, body temperature and hepatic metabolism are regulated by the circadian clock. The aim of the present work was to investigate the disturbances induced after gamma irradiation on the metabolic diurnal rhythm and the role of α-alpha lipoic acid (ALA) in preventing/or decreasing these disorders in rat. Male Swiss albino rats were divided into 4 groups, one of which served as a normal control group, the second group was exposed to a single whole body gamma radiation dose of 6Gy, the third group was treated by gavage with ALA 100 mg/kg/day for 20 days and the fourth one was orally administered with ALA 100 mg/kg/day for 20 days before whole body gamma radiation at a dose of 6Gy. Rats were irradiated at 10 am and sacrificed at 11 am, 12 pm, 1 pm and 2 pm and then the biochemical analyses were performed. The results showed a significant increase in the level of lipid peroxidation products (MDA) at all time intervals. A significant increase was recorded also in the amount of free radicals at 11 am and 2 pm, and pyruvic acid level at 12 pm and 2 pm. A significant reduction of glutathione level (GSH) was recorded at 12 pm, 1 pm and 2 pm in the liver of the irradiated rats. Furthermore, a significant increase was registered in blood glucose level and blood aminotransferase activities (AST, ALT) in irradiated rats. Administration of ALA has significantly attenuated the radiation induced oxidative damage. It could be concluded that the biochemical changes induced by whole body gamma irradiation of rats are dependent on the circadian cycle. Further investigations are necessary to understand these complicated relations.

  6. Early vs. late intervention of high fat/low dose streptozotocin treated C57Bl/6J mice with enalapril, α-lipoic acid, menhaden oil or their combination: Effect on diabetic neuropathy related endpoints.

    Science.gov (United States)

    Yorek, Matthew S; Obrosov, Alexander; Shevalye, Hanna; Coppey, Lawrence J; Kardon, Randy H; Yorek, Mark A

    2017-04-01

    We have previously demonstrated that enalapril, α-lipoic acid and menhaden (fish) oil has potential as a treatment for diabetic peripheral neuropathy. In this study we sought to determine the efficacy of these treatments individually or in combination on multiple neuropathic endpoints in a high fat fed low dose streptozotocin treated mouse, a model of type 2 diabetes, following early or late intervention. Four or twelve weeks after the onset of hyperglycemia, diabetic mice were treated with enalapril, α-lipoic acid, menhaden oil or their combination for 12 weeks. Afterwards, endpoints including glucose tolerance, motor and sensory nerve conduction velocity, thermal nociception, and intraepidermal and cornea nerve fiber density was determined. Glucose clearance was impaired in diabetic mice and significantly improved only with combination treatment and early intervention. Diabetes caused steatosis, slowing of motor and sensory nerve conduction velocity, thermal hypoalgesia and reduction in intraepidermal and cornea nerve fiber density. Treating diabetic mice with enalapril, α-lipoic acid or menhaden oil partially protected diabetic mice from these deficits, whereas the combination of these three treatments was more efficacious following early or late intervention. These studies suggest that a combination therapy may be more effective for treating neural complications of type 2 diabetes. Published by Elsevier Ltd.

  7. Synthesis of Selective Butyrylcholinesterase Inhibitors Coupled between α-Lipoic Acid and Polyphenols by Using 2-(Piperazin-1-yl)ethanol Linker

    Energy Technology Data Exchange (ETDEWEB)

    Yeun, Go Heun; Lee, Seung Hwan; LIm, Yong Bae; Lee, Hye Sook; Lee, Bong Ho; Park, Jeong Ho [Hanbat National Univ., Daejeon (Korea, Republic of); Won, Mooho [Kangwon National Univ., Chuncheon (Korea, Republic of)

    2013-04-15

    In the previous paper (Bull. Korean Chem. Soc., 2011, 32, 2997), the hybrid molecules between α-lipoic acid (ALA) and polyphenols (PPs) connected with neutral 2-(2-aminoethoxy)ethanol linker (linker-1) showed new biological activity such as butyrylcholinesterase (BuChE) inhibition. In order to increase the binding affinity of the hybrid compounds to cholinesterase (ChE), the neutral 2-(2-aminoethoxy)ethanol (linker 1) was switched to the cationic 2-(piperazin-1-yl)ethanol linker (linker 2). The IC{sub 50} values of the linker-2 hybrid molecules for BuChE inhibition were lower than those of linker-1 hybrid molecules (except 9-2) and they also had the same great selectivity for BuChE over AChE (> 800 fold) as linker-1 hybrid molecules. ALA-acetyl caffeic acid (10-2, ALA-AcCA) was shown as an effective inhibitor of BuChE (IC{sub 50} = 0.44 ± 0.24 μM). A kinetic study using 7-2 showed that it is the same mixed type inhibition as 7-1. Its inhibition constant (Ki) to BuChE is 4.3 ± 0.09 μM.

  8. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading

    Science.gov (United States)

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan

    2015-01-01

    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with ClinicalTrials.gov Identifier: NCT02439879. PMID:26345602

  9. Supplementation with α-lipoic acid, CoQ10, and vitamin E augments running performance and mitochondrial function in female mice.

    Directory of Open Access Journals (Sweden)

    Arkan Abadi

    Full Text Available Antioxidant supplements are widely consumed by the general public; however, their effects of on exercise performance are controversial. The aim of this study was to examine the effects of an antioxidant cocktail (α-lipoic acid, vitamin E and coenzyme Q10 on exercise performance, muscle function and training adaptations in mice. C57Bl/J6 mice were placed on antioxidant supplement or placebo-control diets (n = 36/group and divided into trained (8 wks treadmill running (n = 12/group and untrained groups (n = 24/group. Antioxidant supplementation had no effect on the running performance of trained mice nor did it affect training adaptations; however, untrained female mice that received antioxidants performed significantly better than placebo-control mice (p ≤ 0.05. Furthermore, antioxidant-supplemented females (untrained showed elevated respiratory capacity in freshly excised muscle fibers (quadriceps femoris (p ≤ 0.05, reduced oxidative damage to muscle proteins (p ≤ 0.05, and increased expression of mitochondrial proteins (p ≤ 0.05 compared to placebo-controls. These changes were attributed to increased expression of proliferator-activated receptor gamma coactivator 1α (PGC-1α (p ≤ 0.05 via activation of AMP-activated protein kinase (AMPK (p ≤ 0.05 by antioxidant supplementation. Overall, these results indicate that this antioxidant supplement exerts gender specific effects; augmenting performance and mitochondrial function in untrained females, but does not attenuate training adaptations.

  10. Triple-combination treatment with oral α-lipoic acid, betamethasone injection, and NB-UVB for non-segmental progressive vitiligo.

    Science.gov (United States)

    Li, Li; Li, Lu; Wu, Yan; Gao, Xing-Hua; Chen, Hong-Duo

    2016-06-01

    Vitiligo is an acquired depigmenting disease with uncertain etiopathogenesis and the treatment modalities need to be consistently updated. To evaluate a triple-combination treatment with oral α-lipoic acid (ALA), betamethasone injection, and narrowband ultraviolet B (NB-UVB) on vitiligo. Patients with non-segmental and progressive vitiligo lesions were randomly assigned to two groups. The treatment group and the control group were respectively treated with oral ALA and placebo, in combination with betamethasone injection and NB-UVB. The effectiveness and adverse events were evaluated by investigators and patients before and after treatment. Fifty non-segmental progressive vitiligo patients were enrolled in the study. The treatment period was 6 months. In treatment group, over 40% patients achieved > 50% improvement and ≥ 5 satisfaction score by 3-month therapy (M3). This percentage increased to 90% at M6. Treatment group achieved better efficacy than control group at M3, while no difference was seen at M6. The combined treatment with oral ALA, betamethasone injection, and NB-UVB was effective and safe on non-segmental progressive vitiligo. ALA could accelerate the initial response of repigmentation.

  11. Ameliorative effects of α-lipoic acid on high-fat diet-induced oxidative stress and glucose uptake impairment of T cells.

    Science.gov (United States)

    Cui, Jue; Huang, Dejian; Zheng, Yi

    2016-10-01

    The incidence of obesity and metabolic disease continues to rise, mainly associated with consumption of a high-fat diet (HFD). Previous studies have indicated that HFD could disturb the immune system, leading to immunodeficiency and inflammation. Several mechanisms have been postulated to account for immunodeficiency associated with HFD, one being oxidative stress. To further investigate the effects of HFD on glucose metabolism and proliferative capability of T cells and the protective effects of α-lipoic acid (LA), male C57BL/6J mice were fed a normal chow (10% fat), an HFD (60% fat), an LA supplement (HFD +0.1%LA), and a N-acetyl-L-cysteine supplement (HFD +0.1% NAC) for 10 weeks. Results showed that 10-week HFD increased intracellular reactive oxygen species (ROS) production, induced oxidative stress state formation, inhibited glucose uptake, decreased ATP concentration, reduced proliferative rate, and dampened IL-2 production of T cells of mice. Administration of LA significantly alleviated these changes induced by HFD. These findings reveal that oxidative stress of T cells caused by HFD may be a key factor leading to glucose metabolism reduction and proliferative capability and function impairment of T cells. LA, as a potent agonist, could promote Nrf2 nuclear translocation and up-regulate expression of Nrf2 target genes (Ho-1 and Prdx1), which can eliminate excess ROS and restore redox balance of cells.

  12. Does lipoic acid consumption affect the cytokine profile in multiple sclerosis patients: a double-blind, placebo-controlled, randomized clinical trial.

    Science.gov (United States)

    Khalili, Mohammad; Azimi, Amirreza; Izadi, Vajihe; Eghtesadi, Shahryar; Mirshafiey, Abbas; Sahraian, Mohamad Ali; Motevalian, Abbas; Norouzi, Abbas; Sanoobar, Meisam; Eskandari, Ghazaleh; Farhoudi, Mehdi; Amani, Firouz

    2014-01-01

    A limited amount of data exists regarding the effect of lipoic acid (LA), an oral antioxidant supplement, on cytokine profiles among multiple sclerosis (MS) patients. We aimed to assess the effect of daily consumption of LA on the cytokine profiles in MS patients. In this double-blind, placebo-controlled, randomized clinical trial, 52 relapsing-remitting MS patients with an age range of 18-50 years were recruited into 2 groups: LA consumption (1,200 mg/day) or placebo. Patients followed their prescribed supplements for 12 weeks. Fasting blood samples for cytokine profile measurement were collected at baseline and after the intervention. Anthropometric parameters were measured based on the standard guidelines. INF-γ, ICAM-1, TGF-β and IL-4 were significantly reduced in the LA group compared to the placebo group [(INF-γ: 0.82 ± 0.2 vs. 0.2 ± 0.2 pg/ml, p consumption of 1,200 mg LA per day beneficially affects several inflammatory cytokines including INF-γ, ICAM-1 TGF-β and IL-4. Further investigations are needed to verify the beneficial role of LA on other cytokine profiles among MS patients.

  13. Supplementation with α-Lipoic Acid, CoQ10, and Vitamin E Augments Running Performance and Mitochondrial Function in Female Mice

    Science.gov (United States)

    Abadi, Arkan; Crane, Justin D.; Ogborn, Daniel; Hettinga, Bart; Akhtar, Mahmood; Stokl, Andrew; MacNeil, Lauren; Safdar, Adeel; Tarnopolsky, Mark

    2013-01-01

    Antioxidant supplements are widely consumed by the general public; however, their effects of on exercise performance are controversial. The aim of this study was to examine the effects of an antioxidant cocktail (α-lipoic acid, vitamin E and coenzyme Q10) on exercise performance, muscle function and training adaptations in mice. C57Bl/J6 mice were placed on antioxidant supplement or placebo-control diets (n = 36/group) and divided into trained (8 wks treadmill running) (n = 12/group) and untrained groups (n = 24/group). Antioxidant supplementation had no effect on the running performance of trained mice nor did it affect training adaptations; however, untrained female mice that received antioxidants performed significantly better than placebo-control mice (p ≤ 0.05). Furthermore, antioxidant-supplemented females (untrained) showed elevated respiratory capacity in freshly excised muscle fibers (quadriceps femoris) (p ≤ 0.05), reduced oxidative damage to muscle proteins (p ≤ 0.05), and increased expression of mitochondrial proteins (p ≤ 0.05) compared to placebo-controls. These changes were attributed to increased expression of proliferator-activated receptor gamma coactivator 1α (PGC-1α) (p ≤ 0.05) via activation of AMP-activated protein kinase (AMPK) (p ≤ 0.05) by antioxidant supplementation. Overall, these results indicate that this antioxidant supplement exerts gender specific effects; augmenting performance and mitochondrial function in untrained females, but does not attenuate training adaptations. PMID:23565271

  14. Novel Synthetic PEGylated Conjugate of α-Lipoic Acid and Tempol Reduces Cell Death in a Neuronal PC12 Clonal Line Subjected to Ischemia.

    Science.gov (United States)

    Lahiani, Adi; Hidmi, Adel; Katzhendler, Jehoshua; Yavin, Ephraim; Lazarovici, Philip

    2016-10-19

    α-Lipoic acid (α-LA), a natural thiol antioxidant, and Tempol, a synthetic free radical scavenger, are known to confer neuroprotection following ischemic insults in both in vivo and in vitro models. The aim of this study was to synthesize and characterize a conjugate of α-LA and Tempol linked by polyethylene glycol (PEG) in order to generate a more efficacious neuroprotectant molecule. AD3 (α-Tempol ester-ω-lipo ester PEG) was synthesized, purified, and characterized by flash chromatography and reverse phase high pressure liquid chromatography and by 1 H nuclear magnetic resonance, infrared spectroscopy, and mass spectrometry. AD3 conferred neuroprotection in a PC12 pheochromocytoma cell line of dopaminergic origin, exposed to oxygen and glucose deprivation (OGD) insult measured by LDH release. AD3 exhibited EC 50 at 10 μM and showed a 2-3-fold higher efficacy compared to the precursor moieties, indicating an intrinsic potent neuroprotective activity. AD3 attenuated by 25% the intracellular redox potential, by 54% lipid peroxidation and prevented phosphorylation of ERK, JNK, and p38 by 57%, 22%, and 21%, respectively. Cumulatively, these findings indicate that AD3 is a novel conjugate that confers neuroprotection by attenuation of MAPK phosphorylation and by modulation of the redox potential of the cells.

  15. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading

    Directory of Open Access Journals (Sweden)

    Hector Garcia-Alcala

    2015-01-01

    Full Text Available Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid for 4 weeks (phase 1. Subsequently, responders were randomized to receive ALA (600 mg qd; n=16 or to ALA withdrawal (n=17 for 16 weeks (phase 2. During phase 1, the Total Symptom Score (TSS decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p<0.05 and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p<0.05. In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid administration of ALA, subsequent treatment with ALA (600 mg qd over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with ClinicalTrials.gov Identifier: NCT02439879.

  16. Attenuation of Glucose-Induced Myoglobin Glycation and the Formation of Advanced Glycation End Products (AGEs by (R-α-Lipoic Acid In Vitro

    Directory of Open Access Journals (Sweden)

    Hardik Ghelani

    2018-02-01

    Full Text Available High-carbohydrate containing diets have become a precursor to glucose-mediated protein glycation which has been linked to an increase in diabetic and cardiovascular complications. The aim of the present study was to evaluate the protective effect of (R-α-lipoic acid (ALA against glucose-induced myoglobin glycation and the formation of advanced glycation end products (AGEs in vitro. Methods: The effect of ALA on myoglobin glycation was determined via the formation of AGEs fluorescence intensity, iron released from the heme moiety of myoglobin and the level of fructosamine. The extent of glycation-induced myoglobin oxidation was measured via the levels of protein carbonyl and thiol. Results: The results showed that the co-incubation of ALA (1, 2 and 4 mM with myoglobin (1 mg/mL and glucose (1 M significantly decreased the levels of fructosamine, which is directly associated with the decrease in the formation of AGEs. Furthermore, ALA significantly reduced the release of free iron from myoglobin which is attributed to the protection of myoglobin from glucose-induced glycation. The results also demonstrated a significant protective effect of ALA on myoglobin from oxidative damage, as seen from the decreased protein carbonyls and increased protein thiols. Conclusion: The anti-glycation properties of ALA suggest that ALA supplementation may be beneficial in the prevention of AGEs-mediated diabetic and cardiovascular complications.

  17. Restoration of dioxin-induced damage to fetal steroidogenesis and gonadotropin formation by maternal co-treatment with α-lipoic acid.

    Directory of Open Access Journals (Sweden)

    Takayuki Koga

    Full Text Available 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, an endocrine disruptor, causes reproductive and developmental toxic effects in pups following maternal exposure in a number of animal models. Our previous studies have demonstrated that TCDD imprints sexual immaturity by suppressing the expression of fetal pituitary gonadotropins, the regulators of gonadal steroidogenesis. In the present study, we discovered that all TCDD-produced damage to fetal production of pituitary gonadotropins as well as testicular steroidogenesis can be repaired by co-treating pregnant rats with α-lipoic acid (LA, an obligate co-factor for intermediary metabolism including energy production. While LA also acts as an anti-oxidant, other anti-oxidants; i.e., ascorbic acid, butylated hydroxyanisole and edaravone, failed to exhibit any beneficial effects. Neither wasting syndrome nor CYP1A1 induction in the fetal brain caused through the activation of aryl hydrocarbon receptor (AhR could be attenuated by LA. These lines of evidence suggest that oxidative stress makes only a minor contribution to the TCDD-induced disorder of fetal steroidogenesis, and LA has a restorative effect by targeting on mechanism(s other than AhR activation. Following a metabolomic analysis, it was found that TCDD caused a more marked change in the hypothalamus, a pituitary regulator, than in the pituitary itself. Although the components of the tricarboxylic acid cycle and the ATP content of the fetal hypothalamus were significantly changed by TCDD, all these changes were again rectified by exogenous LA. We also provided evidence that the fetal hypothalamic content of endogenous LA is significantly reduced following maternal exposure to TCDD. Thus, the data obtained strongly suggest that TCDD reduces the expression of fetal pituitary gonadotropins to imprint sexual immaturity or disturb development by suppressing the level of LA, one of the key players serving energy production.

  18. α-Lipoic acid ameliorates foam cell formation via liver X receptor α-dependent upregulation of ATP-binding cassette transporters A1 and G1.

    Science.gov (United States)

    Cheng, Li-Ching; Su, Kuo-Hui; Kou, Yu Ru; Shyue, Song-Kun; Ching, Li-Chieh; Yu, Yuan-Bin; Wu, Yuh-Lin; Pan, Ching-Chian; Lee, Tzong-Shyuan

    2011-01-01

    α-Lipoic acid (α-LA), a key cofactor in cellular energy metabolism, has protective activities in atherosclerosis, yet the detailed mechanisms are not fully understood. In this study, we examined whether α-LA affects foam cell formation and its underlying molecular mechanisms in murine macrophages. Treatment with α-LA markedly attenuated oxidized low-density lipoprotein (oxLDL)-mediated cholesterol accumulation in macrophages, which was due to increased cholesterol efflux. Additionally, α-LA treatment dose-dependently increased protein levels of ATP-binding cassette transporter A1 (ABCA1) and ABCG1 but had no effect on the protein expression of SR-A, CD36, or SR-BI involved in cholesterol homeostasis. Furthermore, α-LA increased the mRNA expression of ABCA1 and ABCG1. The upregulation of ABCA1 and ABCG1 by α-LA depended on liver X receptor α (LXRα), as evidenced by an increase in the nuclear levels of LXRα and LXRE-mediated luciferase activity and its prevention of the expression of ABCA1 and ABCG1 after inhibition of LXRα activity by the pharmacological inhibitor geranylgeranyl pyrophosphate (GGPP) or knockdown of LXRα expression with small interfering RNA (siRNA). Consistently, α-LA-mediated suppression of oxLDL-induced lipid accumulation was abolished by GGPP or LXRα siRNA treatment. In conclusion, LXRα-dependent upregulation of ABCA1 and ABCG1 may mediate the beneficial effect of α-LA on foam cell formation. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. The impact of α-Lipoic acid on cell viability and expression of nephrin and ZNF580 in normal human podocytes.

    Science.gov (United States)

    Leppert, Ulrike; Gillespie, Allan; Orphal, Miriam; Böhme, Karen; Plum, Claudia; Nagorsen, Kaj; Berkholz, Janine; Kreutz, Reinhold; Eisenreich, Andreas

    2017-09-05

    Human podocytes (hPC) are essential for maintaining normal kidney function and dysfunction or loss of hPC play a pivotal role in the manifestation and progression of chronic kidney diseases including diabetic nephropathy. Previously, α-Lipoic acid (α-LA), a licensed drug for treatment of diabetic neuropathy, was shown to exhibit protective effects on diabetic nephropathy in vivo. However, the effect of α-LA on hPC under non-diabetic conditions is unknown. Therefore, we analyzed the impact of α-LA on cell viability and expression of nephrin and zinc finger protein 580 (ZNF580) in normal hPC in vitro. Protein analyses were done via Western blot techniques. Cell viability was determined using a functional assay. hPC viability was dynamically modulated via α-LA stimulation in a concentration-dependent manner. This was associated with reduced nephrin and ZNF580 expression and increased nephrin phosphorylation in normal hPC. Moreover, α-LA reduced nephrin and ZNF580 protein expression via 'kappa-light-chain-enhancer' of activated B-cells (NF-κB) inhibition. These data demonstrate that low α-LA had no negative influence on hPC viability, whereas, high α-LA concentrations induced cytotoxic effects on normal hPC and reduced nephrin and ZNF580 expression via NF-κB inhibition. These data provide first novel information about potential cytotoxic effects of α-LA on hPC under non-diabetic conditions. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Effects of prostaglandin E1 plus methylcobalamin alone and in combination with lipoic acid on nerve conduction velocity in patients with diabetic peripheral neuropathy: A meta-analysis.

    Science.gov (United States)

    Jiang, De-Qi; Li, Ming-Xing; Wang, Yan; Wang, Yong

    2015-05-06

    This report was to evaluate the efficacy of lipoic acid, prostaglandin E1 and methylcobalamin (L+P+M) for the treatment of diabetic peripheral neuropathy (DPN) in comparison with that of prostaglandin E1 plus methylcobalamin (P+M), in order to provide the basis and reference for clinical rational drug use. Randomized controlled trials (RCTs) of L+P+M for DPN published up to 3rd August, 2014 were searched. A random or fixed effect model was used to analyze outcomes which were expressed as risk ratios (RRs) or mean difference (MD) with a 95% confidence interval (CI). Eighteen RCTs with 1410 participants were included. Clinical efficacy of L+P+M therapy was significantly better than P+M therapy (fifteen trials; RR 1.32, 95% CI 1.24-1.41, P<0.00001, I(2)=32%). As compared with P+M therapy, the pooled effects of L+P+M therapy on nerve conduction velocities (NCVs) were (fifteen trials; MD 4.70, 95% CI 3.77-5.63, P<0.00001, I(2)=79%) for median MNCV, (thirteen trials; MD 4.73, 95% CI 3.69-5.77, P<0.00001, I(2)=85%) for median SNCV, (sixteen trials; MD 4.22, 95% CI 3.32-5.12, P<0.00001, I(2)=83%) for peroneal MNCV, (fourteen trials; MD 3.09, 95% CI 2.04-4.14, P<0.00001, I(2)=82%) for peroneal SNCV. There was no serious adverse events associated with drugs intervention. L+P+M therapy was superior to P+M therapy for improvement of clinical efficacy and NCVs in DPN patients. These findings should be further verified by high-quality RCTs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. The effect of dietary α-lipoic acid, betaine, l-carnitine, and swimming on the obesity of mice induced by a high-fat diet.

    Science.gov (United States)

    Jang, Aera; Kim, Dongwook; Sung, Ki-Seung; Jung, Samooel; Kim, Hyun Joo; Jo, Cheorun

    2014-08-01

    We evaluate the effect of supplementation, at 300 mg kg(-1) body weight (BW), with the antioxidants α-lipoic acid (AL), betaine (BT), l-carnitine (LC), and the combination of these and exercise on obesity induced by a 9 week high-fat diet (HFD) in mice. Healthy 5 week-old male C57BL/6J mice were divided into 9 groups: (1) CON, control group fed with a commercial mice chow containing 10% crude fat; (2) HFD, high fat diet group fed with a commercial mice chow containing 60% crude fat; (3) HFD-AL, HFD group fed with AL; (4) HFD-BT, HFD group fed with BT; (5) HFD-LC, HFD group fed with LC; (6) HFD-SW, HFD with swimming as an exercise; (7) HFD-SWAL, HFD-AL with swimming; (8) HFD-SWBT, HFD-BT with swimming, and (9) HFD-SWLC, HFD-LC with swimming. The BW of mice with LC and swimming reduced the increase of BW after 9 weeks. Relative adipose tissue weights were reduced by the combinations of antioxidant supplementation and swimming. Levels of serum glucose and leptin were reduced in the HFD-SWLC group when compared with the HFD group. Serum triglyceride and total cholesterol and the size of adipose were also decreased in the HFD-LC and HFD-SWLC groups. These results show that LC at a dose of 300 mg kg(-1) BW was the most effective for reducing fat accumulation in mice with HFD for 9 weeks. In addition, exercise should be given in combination to enhance the BW reduction and serum lipid level.

  2. α-Lipoic Acid Inhibits Helicobacter pylori-Induced Oncogene Expression and Hyperproliferation by Suppressing the Activation of NADPH Oxidase in Gastric Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Eunyoung Byun

    2014-01-01

    Full Text Available Hyperproliferation and oncogene expression are observed in the mucosa of Helicobacter pylori- (H. pylori- infected patients with gastritis or adenocarcinoma. Expression of oncogenes such as β-catenin and c-myc is related to oxidative stress. α-Lipoic acid (α-LA, a naturally occurring thiol compound, acts as an antioxidant and has an anticancer effect. The aim of this study is to investigate the effect of α-LA on H. pylori-induced hyperproliferation and oncogene expression in gastric epithelial AGS cells by determining cell proliferation (viable cell numbers, thymidine incorporation, levels of reactive oxygen species (ROS, NADPH oxidase activation (enzyme activity, subcellular levels of NADPH oxidase subunits, activation of redox-sensitive transcription factors (NF-κB, AP-1, expression of oncogenes (β-catenin, c-myc, and nuclear localization of β-catenin. Furthermore, we examined whether NADPH oxidase mediates oncogene expression and hyperproliferation in H. pylori-infected AGS cells using treatment of diphenyleneiodonium (DPI, an inhibitor of NADPH oxidase. As a result, α-LA inhibited the activation of NADPH oxidase and, thus, reduced ROS production, resulting in inhibition on activation of NF-κB and AP-1, induction of oncogenes, nuclear translocation of β-catenin, and hyperproliferation in H. pylori-infected AGS cells. DPI inhibited H. pylori-induced activation of NF-κB and AP-1, oncogene expression and hyperproliferation by reducing ROS levels in AGS cells. In conclusion, we propose that inhibiting NADPH oxidase by α-LA could prevent oncogene expression and hyperproliferation occurring in H. pylori-infected gastric epithelial cells.

  3. Synthesis and coupling reactions of alpha,alpha-dialkylated amino acids with nucleobase side chains.

    OpenAIRE

    Azumaya, I; Aebi, R; Kubik, S; Rebek, J

    1995-01-01

    Several di- and tripeptides containing protected purine (adenine) and pyrimidine (thymine) residues on their side chains were synthesized. The parent amino acids alpha, alpha-dialkylated in a symmetrical manner. An effective coupling procedure was developed for these sterically hindered amino acids: the fluoren-9-ylmethyloxycarbonyl-protected amino acid was dehydrated to its oxazolinone form, which was coupled in good yields with amino esters in hot tetrachloroethane.

  4. Effect of baseline plasma fatty acids on eicosapentaenoic acid levels in individuals supplemented with alpha-linolenic acid.

    Science.gov (United States)

    DeFilippis, Andrew P; Harper, Charles R; Cotsonis, George A; Jacobson, Terry A

    2009-01-01

    We previously reported a >50% increase in mean plasma eicosapentaenoic acid levels in a general medicine clinic population after supplementation with alpha-linolenic acid. In the current analysis, we evaluate the variability of changes in eicosapentaenoic acid levels among individuals supplemented with alpha-linolenic acid and evaluated the impact of baseline plasma fatty acids levels on changes in eicosapentaenoic acid levels in these individuals. Changes in eicosapentaenoic acid levels among individuals supplemented with alpha-linolenic acid ranged from a 55% decrease to a 967% increase. Baseline plasma fatty acids had no statistically significant effect on changes in eicosapentaenoic levels acid after alpha-linolenic acid supplementation. Changes in eicosapentaenoic acid levels varied considerably in a general internal medicine clinic population supplemented with alpha-linolenic acid. Factors that may impact changes in plasma eicosapentaenoic acid levels after alpha-linolenic acid supplementation warrant further study.

  5. Least median of squares and iteratively re-weighted least squares as robust linear regression methods for fluorimetric determination of α-lipoic acid in capsules in ideal and non-ideal cases of linearity.

    Science.gov (United States)

    Korany, Mohamed A; Gazy, Azza A; Khamis, Essam F; Ragab, Marwa A A; Kamal, Miranda F

    2018-03-26

    This study outlines two robust regression approaches, namely least median of squares (LMS) and iteratively re-weighted least squares (IRLS) to investigate their application in instrument analysis of nutraceuticals (that is, fluorescence quenching of merbromin reagent upon lipoic acid addition). These robust regression methods were used to calculate calibration data from the fluorescence quenching reaction (∆F and F-ratio) under ideal or non-ideal linearity conditions. For each condition, data were treated using three regression fittings: Ordinary Least Squares (OLS), LMS and IRLS. Assessment of linearity, limits of detection (LOD) and quantitation (LOQ), accuracy and precision were carefully studied for each condition. LMS and IRLS regression line fittings showed significant improvement in correlation coefficients and all regression parameters for both methods and both conditions. In the ideal linearity condition, the intercept and slope changed insignificantly, but a dramatic change was observed for the non-ideal condition and linearity intercept. Under both linearity conditions, LOD and LOQ values after the robust regression line fitting of data were lower than those obtained before data treatment. The results obtained after statistical treatment indicated that the linearity ranges for drug determination could be expanded to lower limits of quantitation by enhancing the regression equation parameters after data treatment. Analysis results for lipoic acid in capsules, using both fluorimetric methods, treated by parametric OLS and after treatment by robust LMS and IRLS were compared for both linearity conditions. Copyright © 2018 John Wiley & Sons, Ltd.

  6. Safety and efficacy of an add-on therapy with curcumin phytosome and piperine and/or lipoic acid in subjects with a diagnosis of peripheral neuropathy treated with dexibuprofen

    Directory of Open Access Journals (Sweden)

    Di Pierro F

    2013-07-01

    Full Text Available Francesco Di Pierro,1 Roberto Settembre2 1Scientific Department, Velleja Research, Milan, Italy; 2Neurosurgery Department, Di Venere Hospital, Bari, Italy Abstract: We conducted an 8-week, open, randomized controlled clinical trial on 141 subjects affected by neuropathic pain to investigate the role of an adjunctive therapy added to the administration of dexibuprofen (400 mg twice a day and based on a multi-ingredient formula (Lipicur, consisting of lipoic acid plus curcumin phytosome and piperine, in patients with a diagnosis of lumbar sciatica, lumbar disk herniation, and/or lumbar canal stenosis (96 subjects, or with carpal tunnel syndrome (45 subjects. A total of 135 participants completed the study. Treatment with the multi-ingredient formula (Lipicur reduced neuropathic pain by more than 66% in both conditions (subjects with lumbar sciatica and with carpal tunnel syndrome, and these reductions were statistically significant. Moreover, the treatment reduced dexibuprofen use by about 40%. An add-on therapy with only lipoic acid has not shown any significant results. On the basis of its safety and efficacy, Lipicur could be considered an effective complementary therapy to be added to conventional treatments to achieve better efficacy in reducing neuropathic pain. Keywords: curcumin, phytosome, piperine, dexibuprofen, neuropathic pain

  7. Sterically hindered C(alpha, alpha)-disubstituted alpha-amino acids: synthesis from alpha-nitroacetate and incorporation into peptides.

    Science.gov (United States)

    Fu, Y; Hammarström, L G; Miller, T J; Fronczek, F R; McLaughlin, M L; Hammer, R P

    2001-10-19

    The preparation of sterically hindered and polyfunctional C(alpha,alpha)-disubstituted alpha-amino acids (alpha alpha AAs) via alkylation of ethyl nitroacetate and transformation into derivatives ready for incorporation into peptides are described. Treatment of ethyl nitroacetate with N,N-diisopropylethylamine (DIEA) in the presence of a catalytic amount of tetraalkylammonium salt, followed by the addition of an activated alkyl halide or Michael acceptor, gives the doubly C-alkylated product in good to excellent yields. Selective nitro reduction with Zn in acetic acid or hydrogen over Raney Ni gives the corresponding amino ester that, upon saponification, can be protected with the fluorenylmethyloxycarbonyl (Fmoc) group. The first synthesis of an orthogonally protected, tetrafunctional C(alpha,alpha)-disubstituted analogue of aspartic acid, 2,2-bis(tert-butylcarboxymethyl)glycine (Bcmg), is described. Also, the sterically demanding C(alpha,alpha)-dibenzylglycine (Dbg) has been incorporated into a peptide using solid-phase synthesis. It was found that once sterically congested Dbg is at the peptide N-terminus, further chain extension becomes very difficult using uronium or phosphonium salts (PyAOP, PyAOP/HOAt, HATU). However, preformed amino acid symmetrical anhydride couples to N-terminal Dbg in almost quantitative yield in nonpolar solvent (dichloroethane-DMF, 9:1).

  8. Studies of iso-alpha-acids : analysis, purification, and stability.

    NARCIS (Netherlands)

    Khatib, Alfi

    2006-01-01

    The female cones of hop (Humulus lupulus L.) are added to beer, providing taste and flavour and contributing to the stability of foam. The main constituents of hop related to these properties are generically known as alpha-acids. During the brewing process, these acids are isomerized, resulting in

  9. [Antihypoxic effect of 3-hydroxypyridine and succinic acid derivatives and their nootropic action in alloxan diabetes].

    Science.gov (United States)

    Volchegorskiĭ, I A; Rassokhina, L M; Miroshnichenko, I Iu

    2011-01-01

    Relationship between the antihypoxic effect of 3-hydroxypyridine and succinic acid derivatives (emoxipine, reamberin and mexidol) and their effect on conditional learning, glycemia, and lipidemia was studied in rats with alloxan-induced diabetes. In parallel, the analogous relationship was investigated for alpha-lipoic acid that is regarded as a "gold standard" in treatment of diabetic neuropathy. It was established that single administration of emoxipine and mexidol in mice in doses equivalent to therapeutic-range doses in humans produces antihypoxic effect manifested by increased resistance to acute hypoxic hypoxia in test animals. Alpha-lipoic acid is inferior to emoxipin and mexidol in the degree of antihypoxic action. Reamberin does not exhibit this effect. The introduction of emoxipin, reamberin, mexidol, and alpha-lipoic acid in rats with alloxan diabetes during 7 or 14 days in doses equivalent to therapeutic-range doses in humans corrects conditional learning disorders in direct relationship with the antihypoxic activity of these drugs. The development of the nootropic effect of emoxipin, mexidol, and alpha-lipoic acid is related to a decrease in hyperglycemia and hyperlipidemia in rats with alloxan diabetes. The nootropic action of reamberin is accompanied by a transient hypoglycemizing effect and aggravation of dyslipidemic disorders. The antihypoxic activity of investigated drugs determines the direction and expression of their lipidemic effect, but is not correlated with the hypoglycemizing action these drugs on test animals with alloxan diabetes.

  10. Impaired Corneal Sensation and Nerve Loss in a Type 2 Rat Model of Chronic Diabetes Is Reversible With Combination Therapy of Menhaden Oil, α-Lipoic Acid, and Enalapril.

    Science.gov (United States)

    Davidson, Eric P; Coppey, Lawrence J; Shevalye, Hanna; Obrosov, Alexander; Kardon, Randy H; Yorek, Mark A

    2017-06-01

    This study investigated the efficacy of monotherapy versus combination of menhaden oil, α-lipoic acid, and enalapril on corneal sensation and morphometry and other neuropathy-related endpoints in a rat model of type 2 diabetes. Male Sprague-Dawley rats (aged 12 weeks) were fed a high-fat diet for 8 weeks followed by 30 mg/kg streptozotocin. After 16 weeks of hyperglycemia, 12-week treatments consisting of menhaden oil, α-lipoic acid, enalapril, or their combination were initiated. Before and after treatments, we performed analyses of multiple neural and vascular endpoints including corneal sensitivity, corneal nerve density, vascular reactivity of epineurial arterioles, motor and sensory nerve conduction velocity, intraepidermal nerve fiber density, and thermal nociception. Before treatment, all the neural and vascular endpoints in diabetic rats were impaired. Treating diabetic rats with monotherapy was effective in improving neural and vascular deficits with menhaden oil being most efficacious. However, the combination therapy provided the greatest benefit and improved/reversed all nerve and vascular deficits. The effect of combination therapy on corneal relative sensitivity and structure (in mm/mm), primary endpoints for this study, for control, diabetic, and diabetic treated rats was 4.2 ± 1.4 and 7.5 ± 0.5, 12.1 ± 1.3* and 3.8 ± 0.2*, and 6.6 ± 2.3 and 7.3 ± 0.5, respectively (*P < 0.05 compared with control rats; P < 0.05 compared with diabetic rats). These studies suggest that a combination therapeutic approach may be most effective for treating vascular and neural complications of type 2 diabetes.

  11. Genotoxicity evaluation of alpha-linolenic acid-diacylglycerol oil

    Directory of Open Access Journals (Sweden)

    Hiroshi Honda

    Full Text Available The alpha-linolenic acid (ALA-diacylglycerol (DAG oil is an edible oil enriched with DAG (>80% and ALA (>50%. Although DAG oil, which mainly consists of oleic and linoleic acids has no genotoxic concerns, the fatty acid composition could affect the chemical property of DAG. Therefore, the purpose of this study was to evaluate the genotoxicity of ALA-DAG oil using standard genotoxicity tests in accordance with the OECD guidelines. ALA-DAG oil showed negative results in the bacterial reverse mutation test (Ames test and in vitro micronucleus test in cultured Chinese hamster lung cells with and without metabolic activation, and in the in vivo bone marrow micronucleus test in mice. Our results did not show any genotoxicity, suggesting that the fatty acid composition had no deleterious effects. We conclude that ALA-DAG oil had no genotoxicity concerns under the testing conditions. Keywords: Alpha-linolenic acid-rich diacylglycerol, Diacylglycerol, Alpha-linolenic acid, Fatty acid composition, Genotoxicity

  12. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  13. Palladium-Catalyzed alpha-Arylation of Tetramic Acids

    DEFF Research Database (Denmark)

    Storgaard, Morten; Dorwald, F. Z.; Peschke, B.

    2009-01-01

    A mild, racemization-free, palladium-Catalyzed alpha-arylation of tetramic acids (2,4-pyrrolidinediones) has been developed. Various amino acid-derived tetramic acids were cleanly arylated by treatment with 2 mol % of Pd(OAc)(2), 4 mol % of a sterically demanding biaryl phosphine, 2.3 equiv of K2CO...... no effect on their reactivity: both electron-rich and electron-poor aryl chlorides and bromides or triflates led to good yields. Ortho-substituted aryl halides and heteroaryl halides, however, did not undergo the title reaction....

  14. Binding of [alpha, alpha]-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design

    Energy Technology Data Exchange (ETDEWEB)

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P.; Thorn, Katherine J.; Christianson, David W. (MIT); (Episcopal U); (Rutgers); (Drexel); (Penn)

    2011-10-21

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of {alpha},{alpha}-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2-methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional {alpha}-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase.

  15. The effects of lipoic acid and α-tocopherol supplementation on the lipid profile and insulin sensitivity of patients with type 2 diabetes mellitus: a randomized, double-blind, placebo-controlled trial.

    Science.gov (United States)

    de Oliveira, Andreia Madruga; Rondó, Patrícia Helen Carvalho; Luzia, Liania Alves; D'Abronzo, Francisco Homero; Illison, Vanessa Kristine

    2011-05-01

    Antioxidants probably play an important role in the etiology of type 2 diabetes (DM2). This study evaluated the effects of supplementation with lipoic acid (LA) and α-tocopherol on the lipid profile and insulin sensitivity of DM2 patients. A randomized, double-blind, placebo-controlled trial involving 102 DM2 patients divided into four groups to receive daily supplementation for 4 months with: 600 mg LA (n = 26); 800 mg α-tocopherol (n = 25); 800 mg α-tocopherol + 600 mg LA (n = 25); placebo (n = 26). Plasma α-tocopherol, lipid profile, glucose, insulin, and the HOMA index were determined before and after supplementation. Differences within and between groups were compared by ANOVA using Bonferroni correction. Student's t-test was used to compare means of two independent variables. The vitamin E/total cholesterol ratio improved significantly in patients supplemented with vitamin E+LA and vitamin E alone (p ≤ 0.001). There were improvements of the lipid fractions in the groups receiving LA and vitamin E alone or in combination, and on the HOMA index in the LA group, but not significant. The results suggest that LA and vitamin E supplementation alone or in combination did not affect the lipid profile or insulin sensitivity of DM2 patients. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  16. A highly enantioselective amino acid-catalyzed route to functionalized alpha-amino acids.

    Science.gov (United States)

    Córdova, Armando; Notz, Wolfgang; Zhong, Guofu; Betancort, Juan M; Barbas, Carlos F

    2002-03-06

    The development of syntheses providing enantiomerically pure alpha-amino acids has intrigued generations of chemists and been the subject of intense research. This report describes a general approach to functionalized alpha-amino acids based on catalytic asymmetric synthesis. Proline catalyzed Mannich-type reactions of N-PMP-protected alpha-imino ethyl glyoxylate with a variety of unmodified ketones to provide functionalized alpha-amino acids in high yields with excellent regio-, diastereo-, and enantioselectivities. Study of seven examples yielded six with product ee values of > or = 99%. In reactions involving ketone donors where diastereoisomeric products could be formed, two adjacent stereogenic centers were created simultaneously upon carbon-carbon bond formation with complete syn-stereocontrol. Significantly, this methodology utilizes readily available and rather inexpensive starting materials, does not require any preactivation of substrates or metal ion assistance, and can be carried out on a gram scale under operationally simple reaction conditions. The keto-functionality present in the products provides a particularly attractive site for versatile modifications. This study compliments and extends our bioorganic approach to asymmetric synthesis to a versatile synthon class. Given that we have shown that a variety of optically active amino acids can be synthesized with proline catalysis, where an L-amino acid begets other L-amino acids, our results may stimulate thoughts concerning prebiotic syntheses of optically active amino acids based on this route.

  17. PROCESS FOR HYDROGENOLYSIS OF ALPHA-HYDROXY ESTERS OR ACIDS USING A HETEROGENEOUS CATALYST

    DEFF Research Database (Denmark)

    2017-01-01

    The present invention relates to a method for hydrogenolysis of alpha-hydroxy esters or acids, comprising reacting the alpha-hydroxy ester or acid in the presence of a heterogeneous catalyst. The present invention also relates to a method for producing propionic acid ester, and the use of any...... of the methods for the production of propionic acid esters, such as alkyl propionate....

  18. NAP alpha-aminoisobutyric acid (IsoNAP).

    Science.gov (United States)

    Gozes, Illana; Schirer, Yulie; Idan-Feldman, Anat; David, Merav; Furman-Assaf, Sharon

    2014-01-01

    We set out to identify NAP (davunetide) analogs, providing neuroprotection and reducing tau pathology, specifically addressing protection against protein misfolding. NAP (NAPVSIPQ, intranasal formulation AL-108) is a drug candidate that (1) had a statistically significant impact on two measures, namely digit span and delayed-match-to-sample, tests of verbal recall and visual working memory, respectively, in patient population of mild cognitive impairment [preceding Alzheimer's disease (AD)] and (2) protected functional activities of daily living in schizophrenia patients. Previous preclinical studies have shown that stabilization of NAP by replacement of all L-amino acids by D-amino acids resulted in an active peptide, D-NAP. Other NAP mimetics are now explored. A new NAP analog was designed that included replacement of the proline residues by alpha-aminoisobutyric acid to enhance β-sheet breaker characteristics, thereby reducing protein misfolding. Three lines of investigations were chosen: (1) protection against the AD-associated amyloid β (1-42), Aβ1-42, peptide toxicity in cell cultures; (2) inhibition of AD-associated tau aggregation in vitro; and (3) cognitive protection in a mouse model of deficiencies of the NAP parent protein, activity-dependent neuroprotective protein (ADNP), exhibiting tau pathology and neurodegeneration. NAP alpha-aminoisobutyric acid (IsoNAP) protected neurons against AD-associated Aβ1-42-toxicity, inhibited the aggregation of the tau-derived peptide VQIVYK (important for the aggregation of tau into paired helical filaments, which form the tangles found in AD and related disorders), and protected cognitive functions in a model of ADNP deficiency. With AD being the major tauopathy, novel NAP derivatives that reduce tauopathy and provide neuroprotection as well as cognitive protection are of scientific and clinical interest.

  19. Characteristic of aromatic amino acid substitution at alpha 96 of hemoglobin.

    Science.gov (United States)

    Choi, Jong-Whan; Lee, Jong Hyuk; Lee, Kwang Ho; Lee, Hyean-Woo; Sohn, Joon Hyung; Yoon, Joon Ho; Yeh, Byung-Il; Park, Seung Kyu; Lee, Kyu Jae; Kim, Hyun-Won

    2005-01-31

    Replacement of valine by tryptophan or tyrosine at position alpha96 of the alpha chain (alpha96Val), located in the alpha(1)beta(2) subunit interface of hemoglobin leads to low oxygen affinity hemoglobin, and has been suggested to be due to the extra stability introduced by an aromatic amino acid at the alpha96 position. The characteristic of aromatic amino acid substitution at the alpha96 of hemoglobin has been further investigated by producing double mutant r Hb (alpha42Tyr --> Phe, alpha96Val --> Trp). r Hb (alpha42Tyr --> Phe) is known to exhibit almost no cooperativity in binding oxygen, and possesses high oxygen affinity due to the disruption of the hydrogen bond between alpha42Tyr and beta99Asp in thealpha(1)beta(2) subunit interface of deoxy Hb A. The second mutation, alpha96Val -->Trp, may compensate the functional defects of r Hb (alpha42Tyr --> Phe), if the stability due to the introduction of trypophan at the alpha 96 position is strong enough to overcome the defect of r Hb (alpha42Tyr --> Phe). Double mutant r Hb (alpha42Tyr --> Phe, alpha96Val --> Trp) exhibited almost no cooperativity in binding oxygen and possessed high oxygen affinity, similarly to that of r Hb (alpha42Tyr --> Phe). (1)H NMR spectroscopic data of r Hb (alpha42Tyr --> Phe, alpha96Val --> Trp) also showed a very unstable deoxy-quaternary structure. The present investigation has demonstrated that the presence of the crucible hydrogen bond between alpha 42Tyr and beta 99Asp is essential for the novel oxygen binding properties of deoxy Hb (alpha96Val --> Trp) .

  20. TNF-alpha and IL-6 synergistically inhibit ketogenesis from fatty acids and alpha-ketoisocaproate in isolated rat hepatocytes.

    Science.gov (United States)

    Pailla, K; Lim, S K; De Bandt, J P; Aussel, C; Giboudeau, J; Troupel, S; Cynober, L; Blonde-Cynober, F

    1998-01-01

    During sepsis, lipid metabolism is shunted toward triacylglycerol synthesis and hepatic lipogenesis. A decrease in ketogenesis from free fatty acids also is observed, probably mediated by cytokines involved in host response to infection. Whether such an inhibition of ketogenesis occurs with other ketone body precursors such as ketoacids is not known. The aim of this study was to determine the effects of tumor necrosis factor alpha (TNF-alpha) and interleukin 6 (IL-6) on hepatic ketone body production from octanoic acid, a medium-chain fatty acid, and from alpha-ketoisocaproate (KIC), the ketoanalogue of leucine. The experiments were conducted in cultured hepatocytes isolated from 24-hour-fasted Sprague-Dawley rats. Hepatocyte monolayers were incubated for 6 hours, with either KIC or octanoic acid (1 mmol/L), in the presence of glucagon and TNF-alpha (25 micro/L) IL-6 (15 microg/L) and/or IL-6. Acetoacetate, beta-hydroxybutyrate, and free fatty acids were determined in culture medium by enzymatic methods and KIC was measured by high-performance liquid chromatography. KIC and octanoic acid uptake by hepatocytes was 79% and 92%, respectively, over 6 hours, and cytokines had no influence. However, TNF-alpha and IL-6 caused inhibition of ketogenesis from alpha-ketoisocaproate (5.6% +/- 2.3% and 4.4% +/- 3.0%, respectively), and from octanoic acid (7.9% +/- 2.9%, 5.7% +/- 3.2%, respectively). In addition, when the two cytokines were present together in the culture medium, the inhibition was enhanced (inhibition of ketogenesis from KIC: 14.0% +/- 4.8%; from octanoic acid: 11.6% +/- 3.4%). In our experimental conditions, cytokines mediate an inhibition of ketogenesis; this process could be explained by a direct effect of cytokines on metabolic pathways of octanoic acid and KIC oran indirect effect by modification of the mitochondrial redox state.

  1. Effect of Alpha Linolenic Acid Supplementation on Serum Prostate Specific Antigen (PSA): Results from the Alpha Omega Trial

    NARCIS (Netherlands)

    Brouwer, I.A.; Geleijnse, J.M.; Klaasen, V.M.; Smit, L.A.; Giltay, E.J.; de Goede, G.J.; Heijboer, A.C.; Kromhout, D.; Katan, M.B.

    2013-01-01

    Background: Alpha linolenic acid (ALA) is the major omega-3 fatty acid in the diet. Evidence on health effects of ALA is not conclusive, but some observational studies found an increased risk of prostate cancer with higher intake of ALA. We examined the effect of ALA supplementation on serum

  2. Effect of alpha linolenic acid supplementation on serum prostate specific antigen (PSA): results from the alpha omega trial

    NARCIS (Netherlands)

    Brouwer, Ingeborg A.; Geleijnse, Johanna M.; Klaasen, Veronique M.; Smit, Liesbeth A.; Giltay, Erik J.; de Goede, Janette; Heijboer, Annemieke C.; Kromhout, Daan; Katan, Martijn B.

    2013-01-01

    Alpha linolenic acid (ALA) is the major omega-3 fatty acid in the diet. Evidence on health effects of ALA is not conclusive, but some observational studies found an increased risk of prostate cancer with higher intake of ALA. We examined the effect of ALA supplementation on serum concentrations of

  3. Alterations on monoamines concentration in rat hippocampus produced by lipoic acid Alterações na concentração de monoaminas no hipocampo de ratos produzidas pelo ácido lipóico

    Directory of Open Access Journals (Sweden)

    Ítala Mônica de Sales Santos

    2010-06-01

    Full Text Available The purposes of the present study were to verify monoamines (dopamine (DA, norepinephrine (NE, serotonin (5-HT, and their metabolites (3,4-hydroxyphenylacetic acid (DOPAC, homovanillic acid (HVA and 5-hydroxyindoleacetic acid (5-HIAA contents in rat hippocampus after lipoic acid (LA administration. Wistar rats were treated with 0.9% saline (i.p., control group and LA (10, 20 or 30 mg/kg, i.p., LA10, LA20 and LA30 groups, respectively. After the treatments all groups were observed for 24 h. The NE and DA levels were increased only in 20 mg/kg dose of LA in rat hippocampus. Serotonin content and in their metabolite 5-HIAA levels was decreased in same dose of LA. On the other hand, in DOPAC and HVA levels did not show any significant change. The alterations in hippocampal monoamines can be suggested as a possible of brain mechanism of action from this antioxidant. The outcome of the study may have therapeutic implications in the treatment of neurodegenerative diseases.O objetivo do presente estudo foi verificar a concentração das monoaminas (dopamina (DA, norepinefrina (NA, serotonina (5-HT, e seus metabólitos (ácido 3,4-hidroxifenil (DOPAC, ácido homovanílico (HVA e 5 ácido hydroxiindolacético (5-HIAA no hipocampo de ratos após administração do ácido lipóico (AL. Ratos Wistar foram tratados com solução salina 0,9% (i.p., grupo controle e AL (10, 20 ou 30 mg/kg, i.p., AL10, AL20 e AL30 grupos, respectivamente. Após os tratamentos todos os grupos foram observados durante 24 h. O conteúdo de DA no hipocampo de ratos foi aumentado apenas com AL na dose de 20 mg/kg dose. A concentração de serotonina e do seu metabólito 5-HIAA também foi diminuída com esta dose de AL. Por outro lado, os níveis de DOPAC e de HVA não mostrram nenhuma mudança significativa. As alterações na concentração das monoaminas hipocampais podem ser sugeridas como um possível mecanismo de ação cerebral deste antioxidante. O resultado do estudo pode

  4. A highly selective route to linear alpha olefins from biomass-derived lactones and unsaturated acids.

    Science.gov (United States)

    Wang, Dong; Hakim, Sikander H; Alonso, David Martin; Dumesic, James A

    2013-08-14

    This work demonstrates the use of Lewis-acid catalysts, such as gamma-alumina and tungstated alumina, for selective production of linear alpha olefins by decarboxylation of lactones and unsaturated carboxylic acids.

  5. Concominant extracellular accumulation of alpha-keto acids and higher alcohols by Zygosaccharomyces rouxii

    NARCIS (Netherlands)

    Sluis, van der C.; Rahardjo, Y.S.P.; Smit, B.A.; Kroon, P.J.; Hartmans, S.; Schure, ter E.G.; Tramper, J.; Wijffels, R.H.

    2002-01-01

    Alpha-keto acids are key intermediates in the formation of higher alcohols, important flavor components in soy sauce, and produced by the salt-tolerant yeast Zygosaccharomyces rouxii. Unlike most of the higher alcohols, the alpha-keto acids are usually not extracellularly accumulated by Z. rouxii

  6. Inhibition of steroid 5 alpha-reductase by specific aliphatic unsaturated fatty acids.

    Science.gov (United States)

    Liang, T; Liao, S

    1992-01-01

    Human or rat microsomal 5 alpha-reductase activity, as measured by enzymic conversion of testosterone into 5 alpha-dihydrotestosterone or by binding of a competitive inhibitor, [3H]17 beta-NN-diethulcarbamoyl-4-methyl-4-aza-5 alpha-androstan-3-one ([3H]4-MA) to the reductase, is inhibited by low concentrations (less than 10 microM) of certain polyunsaturated fatty acids. The relative inhibitory potencies of unsaturated fatty acids are, in decreasing order: gamma-linolenic acid greater than cis-4,7,10,13,16,19-docosahexaenoic acid = cis-6,9,12,15-octatetraenoic acid = arachidonic acid = alpha-linolenic acid greater than linoleic acid greater than palmitoleic acid greater than oleic acid greater than myristoleic acid. Other unsaturated fatty acids such as undecylenic acid, erucic acid and nervonic acid, are inactive. The methyl esters and alcohol analogues of these compounds, glycerols, phospholipids, saturated fatty acids, retinoids and carotenes were inactive even at 0.2 mM. The results of the binding assay and the enzymic assay correlated well except for elaidic acid and linolelaidic acid, the trans isomers of oleic acid and linoleic acid respectively, which were much less active than their cis isomers in the binding assay but were as potent in the enzymic assay. gamma-Linolenic acid had no effect on the activities of two other rat liver microsomal enzymes: NADH:menadione reductase and glucuronosyl transferase. gamma-Linolenic acid, the most potent inhibitor tested, decreased the Vmax. and increased Km values of substrates, NADPH and testosterone, and promoted dissociation of [3H]4-MA from the microsomal reductase. gamma-Linolenic acid, but not the corresponding saturated fatty acid (stearic acid), inhibited the 5 alpha-reductase activity, but not the 17 beta-dehydrogenase activity, of human prostate cancer cells in culture. These results suggest that unsaturated fatty acids may play an important role in regulating androgen action in target cells. PMID:1637346

  7. The effects of $\\alpha$-lactalbumin and whey protein concentrate on $\\alpha$-amino acids, calcium and phosphorus levels in blood and gastrointestinal tract of rats

    OpenAIRE

    Pantako, Odile; Amiot, Jean

    2001-01-01

    International audience; The effects of two dietary proteins on $\\alpha$-amino acids, calcium and phosphorus concentrations in plasma, stomach and intestine were investigated in rats trained to consume, in a single two-hour daily meal, diets containing $\\alpha$-lactalbumin ($\\alpha$-la) or whey protein concentrate (WPC) for two weeks. The results indicated that the concentrations of calcium and phosphorus in the gastrointestinal tract and that of $\\alpha$-amino acids in portal vein were not si...

  8. Phytanic acid alpha-oxidation: decarboxylation of 2-hydroxyphytanoyl-CoA to pristanic acid in human liver

    NARCIS (Netherlands)

    Verhoeven, N. M.; Wanders, R. J.; Schor, D. S.; Jansen, G. A.; Jakobs, C.

    1997-01-01

    The degradation of the first intermediate in the alpha-oxidation of phytanic acid, 2-hydroxyphytanoyl-CoA, was investigated. Human liver homogenates were incubated with 2-hydroxyphytanoyl-CoA or 2-hydroxyphytanic acid, after which formation of 2-ketophytanic acid and pristanic acid were studied.

  9. Activation of peroxisome proliferator-activated receptor-{alpha} enhances fatty acid oxidation in human adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Joo-Young; Hashizaki, Hikari; Goto, Tsuyoshi; Sakamoto, Tomoya; Takahashi, Nobuyuki [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Kawada, Teruo, E-mail: fat@kais.kyoto-u.ac.jp [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan)

    2011-04-22

    Highlights: {yields} PPAR{alpha} activation increased mRNA expression levels of adipocyte differentiation marker genes and GPDH activity in human adipocytes. {yields} PPAR{alpha} activation also increased insulin-dependent glucose uptake in human adipocytes. {yields} PPAR{alpha} activation did not affect lipid accumulation in human adipocytes. {yields} PPAR{alpha} activation increased fatty acid oxidation through induction of fatty acid oxidation-related genes in human adipocytes. -- Abstract: Peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) is a key regulator for maintaining whole-body energy balance. However, the physiological functions of PPAR{alpha} in adipocytes have been unclarified. We examined the functions of PPAR{alpha} using human multipotent adipose tissue-derived stem cells as a human adipocyte model. Activation of PPAR{alpha} by GW7647, a potent PPAR{alpha} agonist, increased the mRNA expression levels of adipocyte differentiation marker genes such as PPAR{gamma}, adipocyte-specific fatty acid-binding protein, and lipoprotein lipase and increased both GPDH activity and insulin-dependent glucose uptake level. The findings indicate that PPAR{alpha} activation stimulates adipocyte differentiation. However, lipid accumulation was not changed, which is usually observed when PPAR{gamma} is activated. On the other hand, PPAR{alpha} activation by GW7647 treatment induced the mRNA expression of fatty acid oxidation-related genes such as CPT-1B and AOX in a PPAR{alpha}-dependent manner. Moreover, PPAR{alpha} activation increased the production of CO{sub 2} and acid soluble metabolites, which are products of fatty acid oxidation, and increased oxygen consumption rate in human adipocytes. The data indicate that activation of PPAR{alpha} stimulates both adipocyte differentiation and fatty acid oxidation in human adipocytes, suggesting that PPAR{alpha} agonists could improve insulin resistance without lipid accumulation in adipocytes. The expected

  10. Uptake of neutral alpha- and beta-amino acids by human proximal tubular cells

    DEFF Research Database (Denmark)

    Jessen, H; Røigaard, H; Jacobsen, Christian

    1996-01-01

    experiments revealed that all the neutral amino acids tested reduced the uptake of AIB, whereas there was no effect of taurine, L-aspartic acid, and L-arginine. By contrast, the influx of beta-alanine was only drastically reduced by beta-amino acids, whereas the inhibition by neutral alpha-amino acids...... was relatively low. Nor did L-arginine and L-aspartic acid affect the uptake of beta-alanine into AHKE cells. Comparison with the results obtained for normal (NHKE) and immortalized (IHKE) embryonic cells suggested an unaltered expression of the types of transport carriers for neutral alpha- and beta-amino acids...

  11. Appearance and cellular distribution of lectin-like receptors for alpha 1-acid glycoprotein in the developing rat testis

    DEFF Research Database (Denmark)

    Andersen, U O; Bøg-Hansen, T C; Kirkeby, S

    1996-01-01

    A histochemical avidin-biotin technique with three different alpha 1-acid glycoprotein glycoforms showed pronounced alterations in the cellular localization of two alpha 1-acid glycoprotein lectin-like receptors during cell differentiation in the developing rat testis. The binding of alpha 1-acid...

  12. Effect of alpha-linolenic, capric and lauric acid on the fatty acid biosynthesis in Staphylococcus aureus.

    Science.gov (United States)

    Sado-Kamdem, Sylvain L; Vannini, Lucia; Guerzoni, M Elisabetta

    2009-02-28

    The antimicrobial activity of alpha-linolenic, capric and lauric acids on Staphylococcus aureus was studied in relation to their effect on the de novo fatty acid biosynthesis. Labelled acetate was used as integrated carbon source and traced in the de novo fatty acid by using a GC-Mass spectrometer and the single ion monitoring (SIM) technique. The detection of the incorporation of the labelled carbon into the individual cell fatty acids (FAs) provided an insight into the different effects of alpha-linolenic, capric and lauric acids on the FA biosynthesis. The results suggested that FAs pathway is the major target of alpha-linolenic acid and that other enzymes in addition to FabI are involved in S. aureus response mechanism when medium chain fatty acids are present.

  13. Enantiodifferentiation of alpha-hydroxyalkanephosphonic acids in 31P NMR with application of alpha-cyclodextrin as chiral discriminating agent.

    Science.gov (United States)

    Rudzińska, Ewa; Dziedzioła, Gabriela; Berlicki, Lukasz; Kafarski, Paweł

    2010-01-01

    Alpha-cyclodextrin was shown to be convenient chemical shift reagent for determination of the enantiomeric composition of alpha-hydroxyphosphonic acids by means of 31P NMR. The developed methodology appeared to be reliable, repetitive, easy to perform and simple for interpretation. Enantiomeric discrimination in the 31P NMR spectra for 12 of 13 studied hydroxyphosphonates was achieved, with baseline separation of resonances obtained for eight compounds. In those cases, the chemical nonequivalence values ranged from 0.069 to 0.313 ppm. The studies showed that enantioselectivity is strongly influenced by the solution pD and the optimal condition was found at pD 2 or 10 depending on the guest structure. On the basis of the ROESY spectra the complexation modes of selected hydroxyphosphonates with alpha-cyclodextrin was postulated. Copyright 2009 Wiley-Liss, Inc.

  14. Alternate method of source preparation for alpha spectrometry: no electrodeposition, no hydrofluoric acid

    International Nuclear Information System (INIS)

    Hiromu Kurosaki; Lambert, S.B.; Rao, G.R.; Mueller, R.J.

    2017-01-01

    An alternate method of preparing actinide alpha counting sources was developed in place of electrodeposition or lanthanide fluoride micro-precipitation. The method uses lanthanide hydroxide micro-precipitation to avoid the use of hazardous hydrofluoric acid. It provides a quicker, simpler, and safer way of preparing actinide alpha counting sources in routine, production-type laboratories that process many samples daily. (author)

  15. Alternate method of source preparation for alpha spectrometry: No electrodeposition, no hydrofluoric acid

    International Nuclear Information System (INIS)

    Kurosaki, Hiromu; Mueller, Rebecca J.; Lambert, Susan B.; Rao, Govind R.

    2016-01-01

    An alternate method of preparing actinide alpha counting sources was developed in place of electrodeposition or lanthanide fluoride micro-precipitation. The method uses lanthanide hydroxide micro-precipitation to avoid the use of hazardous hydrofluoric acid. Lastly, it provides a quicker, simpler, and safer way of preparing actinide alpha counting sources in routine, production-type laboratories that process many samples daily.

  16. Performance of Alpha Fetoprotein in Combination with Alpha-1-acid Glycoprotein for Diagnosis of Hepatocellular Carcinoma Among Liver Cirrhosis Patients

    Directory of Open Access Journals (Sweden)

    Rino A Gani

    2016-05-01

    Full Text Available Aim: to evaluate the use of alpha-1-acid glycoprotein (AAG for diagnosing hepatocellular carcinoma (HCC, and to combine with alpha fetoprotein (AFP as part of routine examination in liver cirrhosis patients. Methods: this is a diagnostic study using cross-sectional design. A hundred and six patients were included in this study. Baseline data such as age, gender, AFP, AAG, peripheral blood count, AST and ALT were consecutively collected from liver cirrhosis patients with or without HCC. Serum AAG were measured quantitatively using immunoturboditimetric assay and AFP with enzyme immune assay (EIA. Statistical analysis were done using SPSS 13.0. Data comparisons between group were done using Mann-Whitney test. Diagnostic performance for each marker alone was compared to the surrogate use of both markers (combined parallel approach in HCC cases. Results: receiver operating characteristic (ROC analysis showed that area under the curve for AFP AAG combination was 88.1% and higher than AFP only (86.2% or AAG only (76.5% with sensitivity of 83%, 73% and 44%, respectively, at specificity of >80%. Conclusion: our study showed that combination of AFP and AAG is superior than either marker alone in diagnosing HCC in liver cirrhosis patients. Combination of AFP and AAG may be used to prompt early diagnosis screening of HCC. Key words: alpha fetoprotein, alpha-1-acid glycoprotein, biomarker, liver cancer

  17. alpha-Lipoic acid modulates extracellular matrix and angiogenesis gene expression in non-healing wounds treated with hyperbaric oxygen therapy

    Czech Academy of Sciences Publication Activity Database

    Alleva, R.; Tomasetti, M.; Sartini, D.; Emanuelli, M.; Nasole, E.; Di Donato, F.; Borghi, B.; Santarelli, L.; Neužil, Jiří

    2008-01-01

    Roč. 14, 3-4 (2008), s. 175-183 ISSN 1076-1551 Institutional research plan: CEZ:AV0Z50520514; CEZ:AV0Z50520701 Keywords : angiogenesis mediators * wound repair * matrix metalloproteinase expression Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.411, year: 2008

  18. Method for high specific bioproductivity of .alpha.,.omega.-alkanedicarboxylic acids

    Science.gov (United States)

    Mobley, David Paul; Shank, Gary Keith

    2000-01-01

    This invention provides a low-cost method of producing .alpha.,.omega.-alkanedicarboxylic acids. Particular bioconversion conditions result in highly efficient conversion of fatty acid, fatty acid ester, or alkane substrates to diacids. Candida tropicalis AR40 or similar yeast strains are grown in a medium containing a carbon source and a nitrogen source at a temperature of 31.degree. C. to 38.degree. C., while additional carbon source is continuously added, until maximum cell growth is attained. Within 0-3 hours of this point, substrate is added to the culture to initiate conversion. An .alpha.,.omega.-alkanedicarboxylic acid made according to this method is also provided.

  19. Response of Substituted Indoleacetic Acids in the Indolo-alpha-pyrone Fluorescence Determination

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen; Böttger, M.; Kaiser, P.

    1978-01-01

    The method of indolo-.alpha.-pyrone fluorescence-determination of IAA was investigated to study possible interference from 4-chloro-indoleacetic acid and 5-hydroxyindoleacetic acid, which occur naturally. Both compounds show about 40% of the fluorescence of IAA after conversion into their .alpha.......-pyrones. Other halogenated indoleacetic acids show between zero and 60% of the fluorescence of IAA. Apparently the concentration of IAA cannot be determined in crude extracts in the presence of 4-chloro- or 5-hydroxy-indoleacetic acid, because separate determinations of each of these compounds are not possible...

  20. High alpha-linolenic acid flaxseed (Linum usitatissimum): some nutritional properties in humans.

    Science.gov (United States)

    Cunnane, S C; Ganguli, S; Menard, C; Liede, A C; Hamadeh, M J; Chen, Z Y; Wolever, T M; Jenkins, D J

    1993-03-01

    Although high alpha-linolenic acid flaxseed (Linum usitatissimum) is one of the richest dietary sources of alpha-linolenic acid and is also a good source of soluble fibre mucilage, it is relatively unstudied in human nutrition. Healthy female volunteers consumed 50 g ground, raw flaxseed/d for 4 weeks which provided 12-13% of energy intake (24-25 g/100 g total fat). Flaxseed raised alpha-linolenic acid and long-chain n-3 fatty acids in both plasma and erythrocyte lipids, as well as raising urinary thiocyanate excretion 2.2-fold. Flaxseed also lowered serum total cholesterol by 9% and low-density-lipoprotein-cholesterol by 18%. Changes in plasma alpha-linolenic acid were equivalent when 12 g alpha-linolenic acid/d was provided as raw flaxseed flour (50 g/d) or flaxseed oil (20 g/d) suggesting high bioavailability of alpha-linolenic acid from ground flaxseed. Test meals containing 50 g carbohydrate from flaxseed or 25 g flaxseed mucilage each significantly decreased postprandial blood glucose responses by 27%. Malondialdehyde levels in muffins containing 15 g flaxseed oil or flour/kg were similar to those in wheat-flour muffins. Cyanogenic glycosides (linamarin, linustatin, neolinustatin) were highest in extracted flaxseed mucilage but were not detected in baked muffins containing 150 g flaxseed/kg. We conclude that up to 50 g high-alpha-linolenic acid flaxseed/d is palatable, safe and may be nutritionally beneficial in humans by raising n-3 fatty acids in plasma and erythrocytes and by decreasing postprandial glucose responses.

  1. Synthesis and evaluation of novel [alpha]-heteroaryl-phenylpropanoic acid derivatives as PPAR[alpha/gamma] dual agonists

    Energy Technology Data Exchange (ETDEWEB)

    Casimiro-Garcia, Agustin; Bigge, Christopher F.; Davis, Jo Ann; Padalino, Teresa; Pulaski, James; Ohren, Jeffrey F.; McConnell, Patrick; Kane, Christopher D.; Royer, Lori J.; Stevens, Kimberly A.; Auerbach, Bruce; Collard, Wendy; McGregor, Christine; Song, Kun; Pfizer

    2010-09-27

    The synthesis of a new series of phenylpropanoic acid derivatives incorporating an heteroaryl group at the {alpha}-position and their evaluation for binding and activation of PPAR{alpha} and PPAR{gamma} are presented in this report. Among the new compounds, (S)-3-{l_brace}4-[3-(5-methyl-2-phenyl-oxazol-4-yl)-propyl]-phenyl{r_brace}-2-1,2,3-triazol-2-yl-propionic acid (17j), was identified as a potent human PPAR{alpha}/{gamma} dual agonist (EC{sub 50} = 0.013 and 0.061 {micro}M, respectively) with demonstrated oral bioavailability in rat and dog. 17j was shown to decrease insulin levels, plasma glucose, and triglycerides in the ZDF female rat model. In the human apolipoprotein A-1/CETP transgenic mouse model 17j produced increases in hApoA1 and HDL-C and decreases in plasma triglycerides. The increased potency for binding and activation of both PPAR subtypes observed with 17j when compared to previous analogs in this series was explained based on results derived from crystallographic and modeling studies.

  2. Activity of L-alpha-amino acids at the promiscuous goldfish odorant receptor 5.24

    DEFF Research Database (Denmark)

    Christiansen, Bolette; Wellendorph, Petrine; Bräuner-Osborne, Hans

    2006-01-01

    The goldfish odorant receptor 5.24 is a member of family C of G protein-coupled receptors and is closely related to the human receptor GPRC6A. Receptor 5.24 has previously been shown to have binding affinity for L-alpha-amino acids, especially the basic amino acids arginine and lysine. Here we...

  3. Beta-alanine/alpha-ketoglutarate aminotransferase for 3-hydroxypropionic acid production

    Science.gov (United States)

    Jessen, Holly Jean [Chanhassen, MN; Liao, Hans H [Eden Prairie, MN; Gort, Steven John [Apple Valley, MN; Selifonova, Olga V [Plymouth, MN

    2011-10-04

    The present disclosure provides novel beta-alanine/alpha ketoglutarate aminotransferase nucleic acid and protein sequences having increased biological activity. Also provided are cells containing such enzymes, as well as methods of their use, for example to produce malonyl semialdehyde and downstream products thereof, such as 3-hydroxypropionic acid and derivatives thereof.

  4. Beta-alanine/alpha-ketoglutarate aminotransferase for 3-hydroxypropionic acid production

    Science.gov (United States)

    Jessen, Holly Jean; Liao, Hans H; Gort, Steven John; Selifonova, Olga V

    2014-11-18

    The present disclosure provides novel beta-alanine/alpha ketoglutarate aminotransferase nucleic acid and protein sequences having increased biological activity. Also provided are cells containing such enzymes, as well as methods of their use, for example to produce malonyl semialdehyde and downstream products thereof, such as 3-hydroxypropionic acid and derivatives thereof.

  5. Production of alpha-hydroxy carboxylic acids and esters from higher sugars using tandem catalyst systems

    Energy Technology Data Exchange (ETDEWEB)

    Orazov, Marat; Davis, Mark E.

    2017-11-07

    The present disclosure is directed to methods and composition used in the preparation of alpha-hydroxy carboxylic acids and esters from higher sugars using a tandem catalyst system comprising retro-aldol catalysts and Lewis acid catalysts. In some embodiments, these alpha-hydroxy carboxylic acids may be prepared from pentoses and hexoses. The retro-aldol and Lewis catalysts may be characterized by their respective ability to catalyze a 1,2-carbon shift reaction and a 1,2-hydride shift reaction on an aldose or ketose substrate.

  6. Deorphanization of GPRC6A: a promiscuous L-alpha-amino acid receptor with preference for basic amino acids

    DEFF Research Database (Denmark)

    Wellendorph, Petrine; Hansen, Kasper B; Balsgaard, Anders

    2005-01-01

    . To identify agonists at this orphan receptor, we faced the challenges of achieving surface expression in mammalian cell lines and establishing an appropriate functional assay. Generating a chimeric receptor construct, h6A/5.24, containing the ligand binding amino-terminal domain (ATD) of hGPRC6A...... with the signal transducing transmembrane and C terminus of the homologous goldfish 5.24 receptor allowed us to overcome these obstacles. Homology modeling of the hGPRC6A ATD based on the crystal structure of the metabotropic glutamate receptor subtype 1 predicted interaction with alpha-amino acids...... and was employed to rationally select potential ligands. Measurement of Ca2+-dependent chloride currents in Xenopus laevis oocytes facilitated the deorphanization of h6A/5.24 and identification of L-alpha-amino acids as agonists. The most active agonists were basic L-alpha-amino acids, L-Arg, L-Lys, and L...

  7. Alpha-mangostin inhibits intracellular fatty acid synthase and induces apoptosis in breast cancer cells

    OpenAIRE

    Li, Ping; Tian, Weixi; Ma, Xiaofeng

    2014-01-01

    Background Fatty acid synthase (FAS) has been proven over-expressed in human breast cancer cells and consequently, has been recognized as a target for breast cancer treatment. Alpha-mangostin, a natural xanthone found in mangosteen pericarp, has a variety of biological activities, including anti-cancer effect. In our previous study, alpha-mangostin had been found both fast-binding and slow-binding inhibitions to FAS in vitro. This study was designed to investigate the activity of alpha-mangos...

  8. Thioesterase activity and acyl-CoA/fatty acid cross-talk of hepatocyte nuclear factor-4{alpha}.

    Science.gov (United States)

    Hertz, Rachel; Kalderon, Bella; Byk, Tamara; Berman, Ina; Za'tara, Ghadeer; Mayer, Raphael; Bar-Tana, Jacob

    2005-07-01

    Hepatocyte nuclear factor-4alpha (HNF-4alpha) activity is modulated by natural and xenobiotic fatty acid and fatty acyl-CoA ligands as a function of their chain length, unsaturation, and substitutions. The acyl-CoA site of HNF-4alpha is reported here to consist of the E-F domain, to bind long-chain acyl-CoAs but not the respective free acids, and to catalyze the hydrolysis of bound fatty acyl-CoAs. The free acid pocket, previously reported in the x-ray structure of HNF-4alpha E-domain, entraps fatty acids but excludes acyl-CoAs. The acyl-CoA and free acid sites are distinctive and noncongruent. Free fatty acid products of HNF-4alpha thioesterase may exchange with free acids entrapped in the fatty acid pocket of HNF-4alpha. Cross-talk between the acyl-CoA and free fatty acid binding sites is abrogated by high affinity, nonhydrolyzable acyl-CoA ligands of HNF-4alpha that inhibit its thioesterase activity. Hence, HNF-4alpha transcriptional activity is controlled by its two interrelated acyl ligands and two binding sites interphased in tandem by the thioesterase activity. The acyl-CoA/free-acid and receptor/enzyme duality of HNF-4alpha extends the paradigm of nuclear receptors.

  9. Regulation of human sterol 27-hydroxylase gene (CYP27A1) by bile acids and hepatocyte nuclear factor 4alpha (HNF4alpha).

    Science.gov (United States)

    Chen, Wenling; Chiang, John Y L

    2003-08-14

    Mitochondrial sterol 27-hydroxylase (CYP27A1) catalyses sterol side-chain oxidation of bile acid synthesis from cholesterol, and the first reaction of the acidic bile acid biosynthetic pathway. Hydrophobic bile acids suppress human CYP27A1 gene reporter activity when assayed in human hepatocellular blastoma HepG2 cells. Bile acids also inhibit CYP27A1 reporter activity in human embryonic kidney 293 cells. A putative bile acid response element (BARE) was mapped to a region downstream of nt -147 of the human CYP27A1 gene, within which a binding site for a liver-specific nuclear receptor, HNF4alpha, is identified. HNF4alpha strongly stimulates CYP27A1 gene transcription and mutation of its binding site markedly reduced promoter activity. Results suggest that human CYP27A1 gene transcription is suppressed by bile acids and HNF4alpha plays a pivotal role in transcriptional regulation of this gene.

  10. Effect of alpha linolenic acid supplementation on serum prostate specific antigen (PSA): results from the alpha omega trial.

    Science.gov (United States)

    Brouwer, Ingeborg A; Geleijnse, Johanna M; Klaasen, Veronique M; Smit, Liesbeth A; Giltay, Erik J; de Goede, Janette; Heijboer, Annemieke C; Kromhout, Daan; Katan, Martijn B

    2013-01-01

    Alpha linolenic acid (ALA) is the major omega-3 fatty acid in the diet. Evidence on health effects of ALA is not conclusive, but some observational studies found an increased risk of prostate cancer with higher intake of ALA. We examined the effect of ALA supplementation on serum concentrations of prostate-specific antigen (PSA), a biomarker for prostate cancer. The Alpha Omega Trial (ClinicalTrials.gov Identifier: NCT00127452) was a double-blind, placebo-controlled trial of ALA and the fish fatty acids eicosapentanoic acid (EPA) and docosahexanoic acid (DHA) on the recurrence of cardiovascular disease, using a 2×2 factorial design. Blood was collected at the start and the end of the intervention period. The present analysis included 1622 patients with a history of a myocardial infarction, aged 60-80 years with an initial PSA concentration PSA (both continuously and as a dichotomous outcome, cut-off point: >4 ng/mL). Mean serum PSA increased by 0.42 ng/mL on placebo (n = 815) and by 0.52 ng/mL on ALA (n = 807), a difference of 0.10 (95% confidence interval: -0.02 to 0.22) ng/mL (P = 0·12). The odds ratio for PSA rising above 4 ng/mL on ALA versus placebo was 1.15 (95% CI: 0.84-1.58). An additional amount of 2 g of ALA per day increased PSA by 0.10 ng/mL, but the confidence interval ranged from -0.02 to 0.22 ng/mL and included no effect. Therefore, more studies are needed to establish whether or not ALA intake has a clinically significant effect on PSA or prostate cancer. ClinicalTrials.gov; Identifier: NCT00127452. URL: http://www.clinicaltrials.gov/ct2/show/NCT00127452.

  11. [Regulation of ursolic acid on TNF-alpha and collagen in silicotic rats].

    Science.gov (United States)

    Peng, Haibing; Cao, Fuyuan; Wang, Jianxing; Zhao, Xia; Han, Shuying

    2014-07-01

    To explore the regulation of ursolic acid on the expressions of TNF-alpha and collagen on Silicotic Rats. Seventy-five Wistar rats (class SPF) were divided into there groups according to the randomized block design, namely, control, model, ursolic acid groups with twenty-five rats in each group. SiO2 powders (250 mg/kg) were douched in the trachea of rat to make the silicotic model in model and ursolic acid groups. Ursolic acid (40 mg/kg) was injected into stomach cavity in ursolic acid group from the second day of SiO2, while the rats in control group were given sodium chloride in the same condition for 28 consecutive days. All rats were put to death on the 7th,14th and 28th day. TNF-alpha contents in serum were detected by ELISA. Total collagen contents in lung tissue were determined by hydroxyproline kits. Collagen I and III in lung tissue were investigated by western blot technique. After four weeks of intervention, the contents of TNF-alpha in serum of the model group had rised, showing statistically significant difference in each time compared to those of the control group (P Ursolic acid had depressant effect on the contents of TNF-alpha (P content of total collagen was significantly improved in model group (P ursolic acid depressed the expression of total collagen protein compared to those of the model group (P ursolic acid and model groups were similar with the total collagen. Ursolic acid could decrease the expressions of TNF-alpha and collagen in the process of silicosis fibrosis.

  12. Novel alpha-hydroxy phosphonic acids via castor oil

    Science.gov (United States)

    Hydroxy fatty acids (HFAs) have found a number of uses in today’s market, with uses ranging from materials to pharmaceuticals. Castor oil has served as a versatile HFA; its principle component, ricinoleic acid, can be isolated from castor oil and has been modified extensively for a number of applica...

  13. An NMR and ab initio quantum chemical study of acid-base equilibria for conformationally constrained acidic alpha-amino acids in aqueous solution

    DEFF Research Database (Denmark)

    Nielsen, Peter Aadal; Jaroszewski, Jerzy W.; Norrby, Per-Ola

    2001-01-01

    The protonation states of a series of piperidinedicarboxylic acids (PDAs), which are conformationally constrained acidic alpha -amino acids, have been studied by C-13 NMR titration in water. The resulting data have been correlated with theoretical results obtained by HF/6-31+G* calculations using...

  14. Asthma induction in mice leads to appearance of alpha2-3- and alpha2-6-linked sialic acid residues in respiratory goblet-like cells

    DEFF Research Database (Denmark)

    Kirkeby, Svend; Jensen, Niels-Erik Viby; Mandel, Ulla

    2008-01-01

    incubation with the sialic acid detecting agents, while the goblet-like cells expressed both alpha2-3- and alpha2-6-linked sialic acid residues in the asthmatic animals. The lectins but not the antibodies reacted with intestinal goblet cells. Instead, an antibody recognizing a disialoganglioside, stained......Allergic asthmatic inflammation in mice was induced by sensitization with ovalbumin and lipopolysaccharide from Escherichia coli and visualized in the airways of asthmatic mice by spatial and temporal changes of carbohydrates containing sialic acid residues. Immunohistochemistry was used...... to demonstrate binding of lectins and antibodies that detect alpha2-3- and alpha2-6-linked sialic acid residues. After sensitization and challenge, the histology of the lung changed markedly, and goblet-like cells appeared, most likely caused by Clara cell metaplasia. Normal Clara cells showed no reaction after...

  15. Treatment of alpha-bearing combustible wastes using acid digestion

    International Nuclear Information System (INIS)

    Lerch, R.E.; Allen, C.R.; Blasewitz, A.G.

    1977-11-01

    Acid digestion has been developed at the Hanford Engineering Development Laboratory (HEDL) in Richland, Washington to reduce the volume of combustible nuclear waste materials, while converting them to an inert, noncombustible residue. A 100 kg/day test unit has recently been constructed to demonstrate the process using radioactively contaminated combustible wastes. The unit, called the Radioactive Acid Digestion Test Unit (RADTU) was completed in September 1977 and is currently undergoing cold shakedown tests. Hot operation is expected in May 1978. Features of RADTU include: storage and transfer station for incoming wastes, a feed preparation station, an extrusion feed mechanism for transfer of the waste to the acid digester, the acid digester, a residue recovery system, and an off-gas treatment system

  16. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    OpenAIRE

    Kuhn, H; Fietzek, P P; Lampen, J O

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

  17. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    Science.gov (United States)

    Kuhn, H; Fietzek, P P; Lampen, J O

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis. PMID:6172418

  18. Chemical reactivity of {alpha}-isosaccharinic acid in heterogeneous alkaline systems

    Energy Technology Data Exchange (ETDEWEB)

    Glaus, M. A.; Loon, L. R. Van

    2009-05-15

    Cellulose degradation under alkaline conditions is of relevance for the mobility of many radionuclides in the near-field of a cementitious repository for radioactive waste, because metal-binding degradation products may be formed. Among these, {alpha}- isosaccharinic acid ({alpha}-ISA) is the strongest complexant. The prediction of the equilibrium concentration of {alpha}-ISA in cement pore water is therefore an important step in the assessment of the influence of cellulose degradation products on the speciation of radionuclides in such environments. The present report focuses on possible chemical transformation reactions of {alpha}-ISA in heterogeneous alkaline model systems containing either Ca(OH){sub 2} or crushed hardened cement paste. The transformation reactions were monitored by measuring the concentration of {alpha}-ISA by high performance anion exchange chromatography and the formation of reaction products by high performance ion exclusion chromatography. The overall loss of organic species from solution was monitored by measuring the concentration of non-purgeable organic carbon. The reactions were examined in diluted and compacted suspensions, at either 25 {sup o}C or 90 {sup o}C, and under anaerobic atmospheres obtained by various methods. It was found that {alpha}-ISA was transformed under all conditions tested to some extent. Reaction products, such as glycolate, formate, lactate and acetate, all compounds with less complexing strength than {alpha}-ISA, were detected. The amount of reaction products identified by the chromatographic technique applied was {approx} 50 % of the amount of {alpha}-ISA reacted. Sorption of {alpha}-ISA to Ca(OH){sub 2} contributed only to a minor extent to the loss of {alpha}-ISA from the solution phase. As the most important conclusion of the present work it was demonstrated that the presence of oxidising agents had a distinctive influence on the turnover of {alpha}-ISA. Under aerobic conditions {alpha}-ISA was

  19. Effect of Storage Duration and Atmosphere on the Content and Price of Hop Alpha Bitter Acids

    Directory of Open Access Journals (Sweden)

    Rybka A.

    2017-12-01

    Full Text Available The quality of hops is significantly affected by the content of alpha bitter acids. Maintaining it with minimum losses lies within the competence of both the hop grower and processor depending on how they follow the optimum harvest technology, storage conditions, and post-harvest hop processing. That indicator is considerably affected by the hop storage method, i.e. whether the warehouse is air-conditioned or not, as well as the storage duration. The alpha bitter acid content should not be reduced during storage. The objective of this paper is an analysis of the alpha bitter acid content in the Saaz hop variety in a technological sequence of operations starting with drying at the grower and finishing with six-month storing at the processor, with three storage variants: an air-conditioned warehouse, non-conditioned warehouse, and a variant in which the square bale is moved after 60 days from a non-conditioned warehouse into an air-conditioned warehouse. The analysis of samples to identify the alpha bitter acid content was carried out by means of the ASBC Hops-6 and the HPLC EBC 7.7 methods. Practically in all cases the alpha content declines, although if a square bale is placed in an air-conditioned warehouse this decline is the lowest depending on the storage duration. The economic analysis shows a significant profit referring to the price of alpha contained in 1 t of hops stored in an air-conditioned warehouse. At the date of 1/11/2015 this profit was 14 706 CZK, at the date of 4/1/2016 it was 7646 CZK, and at 1/3/2016 the profit was 6587 CZK.

  20. A Multicomponent UV Analysis of ["alpha"]- and ["beta"]-Acids in Hops

    Science.gov (United States)

    Egts, Haley; Durben, Dan J.; Dixson, John A.; Zehfus, Micheal H.

    2012-01-01

    A method is presented for the determination of ["alpha"]- and ["beta"]-acids (humulones and lupulones) in a hops sample using a multicomponent UV spectroscopic analysis of a methanolic hop extract. When compared with standard methods, this lab can be considered "greener" because it uses smaller volumes of safer solvents (methanol instead of…

  1. Effects of L-ascorbic acid and alpha-tocopherol on biochemical ...

    African Journals Online (AJOL)

    Background: The purpose of this study is to determine the effect of L-ascorbic acid and alpha-tocopherol as well as combination of these vitamins with or without exposure to physical exercise on intensity of lipid peroxidation, activity of xanthine oxidase, activity of total antioxidative system, concentration of glutathione, and ...

  2. Synthesis of Novel N-9-Substituted Purine Derivatives from Polymer Supported alpha-Amino Acids

    Czech Academy of Sciences Publication Activity Database

    Vanda, D.; Jorda, Radek; Lemrová, B.; Volná, T.; Kryštof, Vladimír; McMaster, C.; Soural, M.

    2015-01-01

    Roč. 17, č. 7 (2015), s. 426-432 ISSN 2156-8952 R&D Projects: GA MŠk(CZ) LO1204; GA MŠk(CZ) LO1304 Institutional support: RVO:61389030 Keywords : alpha-amino acids * solid-phase synthesis * purine derivatives Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.317, year: 2015

  3. The effects of alpha-lactalbumin and whey protein concentrate on alpha-amino acids, calcium and phosphorus levels in blood and gastrointestinal tract of rats.

    Science.gov (United States)

    Pantako, O T; Amiot, J

    2001-01-01

    The effects of two dietary proteins on alpha-amino acids, calcium and phosphorus concentrations in plasma, stomach and intestine were investigated in rats trained to consume, in a single two-hour daily meal, diets containing a-lactalbumin (alpha-la) or whey protein concentrate (WPC) for two weeks. The results indicated that the concentrations of calcium and phosphorus in the gastrointestinal tract and that of a-amino acids in portal vein were not significantly influenced by the nature of diets. The amount of alpha-amino acids in the gastrointestinal tract of rats fed on WPC diet was significantly (p < 0.001) higher than that of alpha-la group. The levels of insoluble calcium and insoluble phosphorus in the small intestine were significantly (p < 0.001) higher in alpha-la group than in WPC group. These results indicated that the kinetics of alpha-amino acids, calcium and phosphorus were differently influenced by the nature of diet ingested, the sampling time and the sites of sample collections.

  4. Alpha-mangostin inhibits intracellular fatty acid synthase and induces apoptosis in breast cancer cells.

    Science.gov (United States)

    Li, Ping; Tian, Weixi; Ma, Xiaofeng

    2014-06-03

    Fatty acid synthase (FAS) has been proven over-expressed in human breast cancer cells and consequently, has been recognized as a target for breast cancer treatment. Alpha-mangostin, a natural xanthone found in mangosteen pericarp, has a variety of biological activities, including anti-cancer effect. In our previous study, alpha-mangostin had been found both fast-binding and slow-binding inhibitions to FAS in vitro. This study was designed to investigate the activity of alpha-mangostin on intracellular FAS activity in FAS over-expressed human breast cancer cells, and to testify whether the anti-cancer activity of alpha-mangostin may be related to its inhibitory effect on FAS. We evaluated the cytotoxicity of alpha-mangostin in human breast cancer MCF-7 and MDA-MB-231 cells. Intracellular FAS activity was measured by a spectrophotometer at 340 nm of NADPH absorption. Cell Counting Kit assay was used to test the cell viability. Immunoblot analysis was performed to detect FAS expression level, intracellular fatty acid accumulation and cell signaling (FAK, ERK1/2 and AKT). Apoptotic effects were detected by flow cytometry and immunoblot analysis of PARP, Bax and Bcl-2. Small interfering RNA was used to down-regulate FAS expression and/or activity. Alpha-mangostin could effectively suppress FAS expression and inhibit intracellular FAS activity, and result in decrease of intracellular fatty acid accumulation. It could also reduce cell viability, induce apoptosis in human breast cancer cells, increase in the levels of the PARP cleavage product, and attenuate the balance between anti-apoptotic and pro-apoptotic proteins of the Bcl-2 family. Moreover, alpha-mangostin inhibited the phosphorylation of FAK. However, the active forms of AKT, and ERK1/2 proteins were not involved in the changes of FAS expression induced by alpha-mangostin. Alpha-mangostin induced breast cancer cell apoptosis by inhibiting FAS, which provide a basis for the development of xanthone as an agent for

  5. Kinetic studies of acid inactivation of alpha-amylase from Aspergillus oryzae

    DEFF Research Database (Denmark)

    Carlsen, Morten; Nielsen, Jens Bredal; Villadsen, John

    1996-01-01

    The stability of alpha-amylase from Aspergillus oryzae has been studied at different pH. The enzyme is extremely stable at neutral pH (pH 5-8), whereas outside this pH-range a substantial loss of activity is observed. The acid-inactivation of alpha-amylase from A. oryzae was monitored on...... regains part of its activity, and the reactivation process also follows first-order kinetics. The irreversible loss of activity is found not to result from a protease contamination of the protein samples. A proposed model, where irreversibly inactivated a-amylase is formed both directly from the active...

  6. Phenylalanine Aminomutase-Catalyzed Addition of Ammonia to Substituted Cinnamic Acids : a Route to Enantiopure alpha- and beta-Amino Acids

    NARCIS (Netherlands)

    Szymanski, Wiktor; Wu, Bian; Weiner, Barbara; de Wildeman, Stefaan; Feringa, B.L.; B. Janssen, Dick

    2009-01-01

    An approach is described for the synthesis of aromatic alpha- and beta-amino acids that Uses phenylalanine aminomutase to catalyze a highly enantioselective addition of ammonia to substituted cinnamic acids. The reaction has a broad scope and yields Substituted alpha- and beta-phenylalanines with

  7. Synthesis and applications of silicon-containing alpha-amino acids.

    Science.gov (United States)

    Mortensen, Matthew; Husmann, Ralph; Veri, Elisabetta; Bolm, Carsten

    2009-04-01

    Amino acids serve not only as monomers for proteins and enzymes but also as important players in signal transduction pathways. They belong to the abundant feedstock of the pharmaceutical, food science and agrochemical industries, and some are used as catalysts or ligand components. In recent years, non-proteogenic amino acids have taken on important roles. This tutorial review summarises the progress in the development of strategies to construct silicon-containing alpha-amino acid frameworks and the studies concerned with their structure and activity. It shall be of interest for the synthesis and biosciences communities.

  8. Activation of peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, Rino [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Takahashi, Nobuyuki, E-mail: nobu@kais.kyoto-u.ac.jp [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Murota, Kaeko [Department of Life Science, School of Science and Engineering, Kinki University, Osaka 770-8503 (Japan); Yamada, Yuko [Laboratory of Physiological Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Niiya, Saori; Kanzaki, Noriyuki; Murakami, Yoko [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Moriyama, Tatsuya [Department of Applied Cell Biology, Graduate School of Agriculture, Kinki University, Nara 631-8505 (Japan); Goto, Tsuyoshi; Kawada, Teruo [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan)

    2011-06-24

    Highlights: {yields} PPAR{alpha} activation increased mRNA expression levels of fatty acid oxidation-related genes in human intestinal epithelial Caco-2 cells. {yields} PPAR{alpha} activation also increased oxygen consumption rate and CO{sub 2} production and decreased secretion of triglyceride and ApoB from Caco-2 cells. {yields} Orally administration of bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and CO{sub 2} production in small intestinal epithelial cells. {yields} Treatment with bezafibrate decreased postprandial serum concentration of triglyceride after oral injection of olive oil in mice. {yields} It suggested that intestinal lipid metabolism regulated by PPAR{alpha} activation suppresses postprandial lipidemia. -- Abstract: Activation of peroxisome proliferator-activated receptor (PPAR)-{alpha} which regulates lipid metabolism in peripheral tissues such as the liver and skeletal muscle, decreases circulating lipid levels, thus improving hyperlipidemia under fasting conditions. Recently, postprandial serum lipid levels have been found to correlate more closely to cardiovascular diseases than fasting levels, although fasting hyperlipidemia is considered an important risk of cardiovascular diseases. However, the effect of PPAR{alpha} activation on postprandial lipidemia has not been clarified. In this study, we examined the effects of PPAR{alpha} activation in enterocytes on lipid secretion and postprandial lipidemia. In Caco-2 enterocytes, bezafibrate, a potent PPAR{alpha} agonist, increased mRNA expression levels of fatty acid oxidation-related genes, such as acyl-CoA oxidase, carnitine palmitoyl transferase, and acyl-CoA synthase, and oxygen consumption rate (OCR) and suppressed secretion levels of both triglycerides and apolipoprotein B into the basolateral side. In vivo experiments revealed that feeding high-fat-diet containing bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and

  9. VITAMIN C, VITAMIN A AND ALPHA HYDROXY ACID IN BENGKOANG (Pachyrhizus Erosus

    Directory of Open Access Journals (Sweden)

    Ardian Widyatmoko

    2016-04-01

    Full Text Available Bengkoang or Pachyrhizus erosus has been used as a traditional cosmetic material since many years ago. Until now, many cosmetic preparations using bengkoang as a main material have been produced by cosmetic industries, mainly for skin care, whitening and sunscreen preparation. However, content of vitamin A, vitamin C and alpha hydroxyl acid has not been discovered yet. These compounds are essential in skin care process because of their activities in cell regeneration, antioxidant as well as peeling of dead skin cell layer. The aim of this research is to provide information about the content of three compounds in bengkoang. Vitamin A has been analysed by spectrophotometer, vitamin C analysed using titration method and alpha hydroxyl acid analysed using gas chromatography. The result showed that concentrations of vitamin A and vitamin C are 179.21 ± 8.19 ppm and 0.31 ± 0.06 %, respectively. Meanwhile the content of alpha hydroxyl acid was 0.80 ± 0.01% (measured as glycolic acid.

  10. Gibberellic acid-stimulated alpha-amylase secretion and phospholipid metabolism in wheat aleurone tissue.

    OpenAIRE

    Mirbahar, R B; Laidman, D L

    1982-01-01

    1. Turnovers of [14C]glycerol-labelled phospholipids in wheat aleurone tissue have been measured by using a pulse-decay technique. The most metabolically active phospholipids were phosphatidylcholine, phosphatidylinositol, phosphatidylethanolamine and phosphatidylglycerol. 2. Gibberellic acid action on the tissue led to breakdown of phosphatidylcholine and stimulated turnover of the other phosphatides concomitant with the secretion of alpha-amylase from the tissue. After pulse-labelling of th...

  11. Insufficient intake of alpha-linolenic fatty acid (18:3n-3 during pregnancy and associated factors

    Directory of Open Access Journals (Sweden)

    Letícia Garcia VASCONCELOS

    Full Text Available ABSTRACT Objective: To analyze alpha-linolenic fatty acid intake in two cohorts of pregnant women, and to identify factors associated with alpha-linolenic acid intake. Methods: This is a cohort study involving pregnant women with low obstetric risk (N=353 in public health system from a municipality of São Paulo state, Brazil. In each trimester, two 24-hour food recalls were collected. Descriptive analyses of dietary lipid profiles were performed, followed by a multiple comparison test. According to the trimester of pregnancy, differences were assessed using the mean difference test. To evaluate the adequacy of linoleic fatty acid and alpha-linolenic acid intake, the adequate intake test was used. The association between alpha-linolenic acid intake adequacy and maternal characteristics was investigated using a binary logistic regression model. Results: Total lipids intake and the percentage contribution to dietary energy met recommended levels. One-third of the diets demonstrated a lower than daily recommended intake of alpha-linolenic acid. Overweight pregnant women were twice as likely to have inadequate alpha-linolenic acid intake. Pregnant women from a more disadvantaged socioeconomic situation had greater risks of inadequate intake. Conclusion: Over-intake of lipids is not problematic, but quality is an issue, with one third of the pregnant women and their fetuses exposed to adverse effects due to low intake of omega-3 fatty acids, indicating important nutritional vulnerability in this population.

  12. Molecular Basis of Prodrug Activation by Human Valacyclovirase, an [alpha]-Amino Acid Ester Hydrolase

    Energy Technology Data Exchange (ETDEWEB)

    Lai, Longsheng; Xu, Zhaohui; Zhou, Jiahai; Lee, Kyung-Dall; Amidon, Gordon L. (Michigan)

    2008-07-08

    Chemical modification to improve biopharmaceutical properties, especially oral absorption and bioavailability, is a common strategy employed by pharmaceutical chemists. The approach often employs a simple structural modification and utilizes ubiquitous endogenous esterases as activation enzymes, although such enzymes are often unidentified. This report describes the crystal structure and specificity of a novel activating enzyme for valacyclovir and valganciclovir. Our structural insights show that human valacyclovirase has a unique binding mode and specificity for amino acid esters. Biochemical data demonstrate that the enzyme hydrolyzes esters of {alpha}-amino acids exclusively and displays a broad specificity spectrum for the aminoacyl moiety similar to tricorn-interacting aminopeptidase F1. Crystal structures of the enzyme, two mechanistic mutants, and a complex with a product analogue, when combined with biochemical analysis, reveal the key determinants for substrate recognition; that is, a flexible and mostly hydrophobic acyl pocket, a localized negative electrostatic potential, a large open leaving group-accommodating groove, and a pivotal acidic residue, Asp-123, after the nucleophile Ser-122. This is the first time that a residue immediately after the nucleophile has been found to have its side chain directed into the substrate binding pocket and play an essential role in substrate discrimination in serine hydrolases. These results as well as a phylogenetic analysis establish that the enzyme functions as a specific {alpha}-amino acid ester hydrolase. Valacyclovirase is a valuable target for amino acid ester prodrug-based oral drug delivery enhancement strategies.

  13. Multicomponent diversity and enzymatic enantioselectivity as a route towards both enantiomers of alpha-amino acids : A model study

    NARCIS (Netherlands)

    Szymanski, Wiktor; Ostaszewski, Ryszard

    2006-01-01

    A model study on a new, enantioconvergent method for the synthesis of chiral, nonracemic alpha-amino acids is presented. alpha-Acetoxyamides obtained in a Passerini multicomponent reaction are selectively hydrolyzed by Wheat Germ lipase. Studies on conversion of the thus obtained, enantiomerically

  14. Fatty Acid Amide Hydrolase (FAAH) Inhibition Enhances Memory Acquisition through Activation of PPAR-alpha Nuclear Receptors

    Science.gov (United States)

    Mazzola, Carmen; Medalie, Julie; Scherma, Maria; Panlilio, Leigh V.; Solinas, Marcello; Tanda, Gianluigi; Drago, Filippo; Cadet, Jean Lud; Goldberg, Steven R.; Yasar, Sevil

    2009-01-01

    Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of anandamide (a cannabinoid CB[subscript 1]-receptor ligand) and oleoylethanolamide and palmitoylethanolamide (OEA and PEA, ligands for alpha-type peroxisome proliferator-activated nuclear receptors, PPAR-alpha) when and where they are naturally released in the brain.…

  15. Immunotoxicity of perfluorooctanoic acid and perfluorooctane sulfonate and the role of peroxisome proliferator-activated receptor alpha

    Science.gov (United States)

    Peroxisome proliferators, including perfluorooctanoic acid (PFOA), are environmentally widespread and persistent and multiple toxicities have been reported in experimental animals and humans. These compounds trigger biological activity via activation of the alpha isotype of pero...

  16. Isolation of linoleic and alpha-linolenic acids as COX-1 and -2 inhibitors in rose hip.

    Science.gov (United States)

    Jäger, A K; Petersen, K N; Thomasen, G; Christensen, S Brøgger

    2008-07-01

    Rose hip has previously shown clinical efficacy in the treatment of osteoarthritis, and organic solvent extracts of rose hip have showed inhibition of cyclooxygenase-1 and -2. A petroleum ether extract of rose hip was fractioned by VLC on silica; on a C-18 column and by HPLC. Each step was COX-1/2 activity-guided. The bioassay-guided fractionation led to the isolation of linoleic acid (the IC50 for COX-1 was 85 microm and 0.6 microM for COX-2) and alpha-linolenic acid (the IC50 for COX-1 was 52 microM and 12 microM for COX-2). The COX-2/COX-1 ratio was 0.007 for linoleic acid and 0.2 for alpha-linolenic acid. Linoleic acid and alpha-linolenic acid contribute to the COX-1 and -2 inhibitory activity of rose hip.

  17. INFLUENCE OF ALPHA-1-ACID GLYCOPROTEIN UPON PRODUCTION OF CYTOKINES BY PERIPHERAL BLOOD MONONUCLEARS

    Directory of Open Access Journals (Sweden)

    М. V. Osikov

    2007-01-01

    Full Text Available Abstract. Alpha-1-acid glycoprotein (orosomucoid is a multifunctional acute phase reactant belonging to the family of lipocalines from plasma alpha-2 globulin fraction. In present study, we investigated dosedependent effects of orosomucoid upon secretion of IL-1â, IL-2, IL-3, IL-4 by mononuclear cells from venous blood of healthy volunteers. Mononuclear cells were separated by means of gradient centrifugation, followed by incubation for 24 hours with 250, 500, or 1000 mcg of orosomucoid per ml RPMI-1640 medium (resp., low, medium and high dose. The levels of cytokine production were assayed by ELISA technique. Orosomucoid-induced secretion of IL-1â and IL-4 was increased, whereas IL-3 secretion was inhibited. IL-2 production was suppressed at low doses of orosomucoid, and stimulated at medium and high doses. The effect of alpha-1-acid glycoprotein upon production of IL-2, IL-3 and IL-4 was dose-dependent. Hence, these data indicate that orosomucoid is capable of modifying IL-1â, IL-2, IL-3, and IL-4 secretion by blood mononuclear cells.

  18. Quantitation of alpha-linolenic acid elongation to eicosapentaenoic and docosahexaenoic acid as affected by the ratio of n6/n3 fatty acids

    Directory of Open Access Journals (Sweden)

    Somoza Veronika

    2009-02-01

    Full Text Available Abstract Background Conversion of linoleic acid (LA and alpha-linolenic acid (ALA to their higher chain homologues in humans depends on the ratio of ingested n6 and n3 fatty acids. Design and methods In order to determine the most effective ratio with regard to the conversion of ALA to eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA, human hepatoma cells were incubated with varying ratios of [13C] labeled linoleic acid ([13C]LA- and alpha-linolenic acid ([13C]ALA-methylesters. Regulative cellular signal transduction pathways involved were studied by determinations of transcript levels of the genes encoding delta-5 desaturase (D5D and delta-6 desaturase (D6D, peroxisome proliferator-activated receptor alpha (PPARα and sterol regulatory element binding protein 1c (SREBP-1c. Mitogen-activated protein kinase kinase 1 (MEK1 and mitogen-activated protein kinase kinase kinase 1 (MEKK1 were also examined. Results Maximum conversion was observed in cells incubated with the mixture of [13C]LA/[13C]ALA at a ratio of 1:1, where 0.7% and 17% of the recovered [13C]ALA was converted to DHA and EPA, respectively. Furthermore, differential regulation of enzymes involved in the conversion at the transcript level, dependent on the ratio of administered n6 to n3 fatty acids in human hepatocytes was demonstrated. Conclusion Formation of EPA and DHA was highest at an administered LA/ALA ratio of 1:1, although gene expression of PPARα, SREBP-1c and D5D involved in ALA elongation were higher in the presence of ALA solely. Also, our findings suggest that a diet-induced enhancement of the cell membrane content of highly unsaturated fatty acids is only possible up to a certain level.

  19. Is there A Role for Alpha-Linolenic Acid in the Fetal Programming of Health?

    Directory of Open Access Journals (Sweden)

    Alicia I. Leikin-Frenkel

    2016-03-01

    Full Text Available The role of ω3 alpha linolenic acid (ALA in the maternal diet during pregnancy and lactation, and its effect on the prevention of disease and programming of health in offspring, is largely unknown. Compared to ALA, ω3 docosahexaenoic (DHA and eicosapentaenoic (EPA acids have been more widely researched due to their direct implication in fetal neural development. In this literature search we found that ALA, the essential ω3 fatty acid and metabolic precursor of DHA and EPA has been, paradoxically, almost unexplored. In light of new and evolving findings, this review proposes that ALA may have an intrinsic role, beyond the role as metabolic parent of DHA and EPA, during fetal development as a regulator of gene programming for the prevention of metabolic disease and promotion of health in offspring.

  20. Is there A Role for Alpha-Linolenic Acid in the Fetal Programming of Health?

    Science.gov (United States)

    Leikin-Frenkel, Alicia I

    2016-03-23

    The role of ω3 alpha linolenic acid (ALA) in the maternal diet during pregnancy and lactation, and its effect on the prevention of disease and programming of health in offspring, is largely unknown. Compared to ALA, ω3 docosahexaenoic (DHA) and eicosapentaenoic (EPA) acids have been more widely researched due to their direct implication in fetal neural development. In this literature search we found that ALA, the essential ω3 fatty acid and metabolic precursor of DHA and EPA has been, paradoxically, almost unexplored. In light of new and evolving findings, this review proposes that ALA may have an intrinsic role, beyond the role as metabolic parent of DHA and EPA, during fetal development as a regulator of gene programming for the prevention of metabolic disease and promotion of health in offspring.

  1. Individual Amino Acid Supplementation Can Improve Energy Metabolism and Decrease ROS Production in Neuronal Cells Overexpressing Alpha-Synuclein.

    Science.gov (United States)

    Delic, Vedad; Griffin, Jeddidiah W D; Zivkovic, Sandra; Zhang, Yumeng; Phan, Tam-Anh; Gong, Henry; Chaput, Dale; Reynes, Christian; Dinh, Vinh B; Cruz, Josean; Cvitkovic, Eni; Placides, Devon; Frederic, Ernide; Mirzaei, Hamed; Stevens, Stanley M; Jinwal, Umesh; Lee, Daniel C; Bradshaw, Patrick C

    2017-09-01

    Parkinson's disease (PD) is a neurodegenerative disorder characterized by alpha-synuclein accumulation and loss of dopaminergic neurons in the substantia nigra (SN) region of the brain. Increased levels of alpha-synuclein have been shown to result in loss of mitochondrial electron transport chain complex I activity leading to increased reactive oxygen species (ROS) production. WT alpha-synuclein was stably overexpressed in human BE(2)-M17 neuroblastoma cells resulting in increased levels of an alpha-synuclein multimer, but no increase in alpha-synuclein monomer levels. Oxygen consumption was decreased by alpha-synuclein overexpression, but ATP levels did not decrease and ROS levels did not increase. Treatment with ferrous sulfate, a ROS generator, resulted in decreased oxygen consumption in both control and alpha-synuclein overexpressing cells. However, this treatment only decreased ATP levels and increased ROS production in the cells overexpressing alpha-synuclein. Similarly, paraquat, another ROS generator, decreased ATP levels in the alpha-synuclein overexpressing cells, but not in the control cells, further demonstrating how alpha-synuclein sensitized the cells to oxidative insult. Proteomic analysis yielded molecular insights into the cellular adaptations to alpha-synuclein overexpression, such as the increased abundance of many mitochondrial proteins. Many amino acids and citric acid cycle intermediates and their ester forms were individually supplemented to the cells with L-serine, L-proline, L-aspartate, or L-glutamine decreasing ROS production in oxidatively stressed alpha-synuclein overexpressing cells, while diethyl oxaloacetate or L-valine supplementation increased ATP levels. These results suggest that dietary supplementation with individual metabolites could yield bioenergetic improvements in PD patients to delay loss of dopaminergic neurons.

  2. The application of glutamic acid alpha-decarboxylase for the valorization of glutamic acid

    NARCIS (Netherlands)

    Lammens, T.M.; Biase, De Daniela; Franssen, M.C.R.; Scott, E.L.; Sanders, J.P.M.

    2009-01-01

    Glutamic acid is an important constituent of waste streams from biofuels production. It is an interesting starting material for the synthesis of nitrogen containing bulk chemicals, thereby decreasing the dependency on fossil fuels. On the pathway from glutamic acid to a range of molecules, the

  3. Lipoic acid increases glutathione peroxidase, Na+, K+-ATPase and acetylcholinesterase activities in rat hippocampus after pilocarpine-induced seizures? O ácido lipóico aumenta as atividades da glutationa peroxidase, da Na+, K+-ATPase e da acetilcolinesterase no hipocampo de ratos após convulsões induzidas por pilocarpina?

    Directory of Open Access Journals (Sweden)

    Geane Felix de Souza

    2010-08-01

    Full Text Available In the present study we investigated the effects of lipoic acid (LA on acetylcholinesterase (AChE, glutathione peroxidase (GPx and Na+, K+-ATPase activities in rat hippocampus during seizures. Wistar rats were treated with 0.9% saline (i.p., control group, lipoic acid (20 mg/kg, i.p., LA group, pilocarpine (400 mg/kg, i.p., P400 group, and the association of pilocarpine (400 mg/kg, i.p. plus LA (20 mg/kg, i.p., 30 min before of administration of P400 (LA plus P400 group. After the treatments all groups were observed for 1 h. In P400 group, there was a significant increase in GPx activity as well as a decrease in AChE and Na+, K+-ATPase activities after seizures. In turn, LA plus P400 abolished the appearance of seizures and reversed the decreased in AChE and Na+, K+-ATPase activities produced by seizures, when compared to the P400 seizing group. The results from the present study demonstrate that preadministration of LA abolished seizure episodes induced by pilocarpine in rat, probably by increasing AChE and Na+, K+-ATPase activities in rat hippocampus.No presente estudo nós investigamos os efeitos do ácido lipóico (AL sobre as atividades da acetilcolinesterase (AChE, da glutationa peroxidase (GPx e da Na+, K+-ATPase no hipocampo de ratos durante crises convulsivas. Ratos Wistar foram tratados com solução salina a 0,9% (i.p., grupo controle, ácido lipóico (20 mg/kg, i.p., grupo AL, pilocarpina (400 mg/kg, i.p., grupo P400, e a associação de AL (20 mg/kg, i.p. com a pilocarpina (400 mg/kg, i.p., 30 min antes da administração de pilocarpina (grupo AL + P400. Após os tratamentos todos os grupos foram observados durante 1 h. No grupo P400, houve um aumento significativo na atividade da GPx, assim como uma diminuição das atividades da AChE e Na+, K+-ATPase. Por sua vez, o pré-tratamento com AL aboliu o aparecimento de convulsões e reverteu a diminuição das atividades da AChE e da Na+, K+-ATPase causadas pelas convulsões, quando

  4. Essential role for retinoic acid in the promotion of CD4+ T cell effector responses via retinoic acid receptor alpha

    Science.gov (United States)

    Hall, J.A.; Cannons, J.L.; Grainger, J.R.; Santos, L.M. Dos; Hand, T.W.; Naik, S.; Wohlfert, E.A.; Chou, D.B.; Oldenhove, G.; Robinson, M.; Grigg, M.E.; Kastenmayer, R.; Schwartzberg, P.L.; Belkaid, Y.

    2012-01-01

    SUMMARY Vitamin A and its metabolite, retinoic acid (RA), have recently been implicated in the regulation of immune homeostasis via the peripheral induction of regulatory T cells. Here we show that RA is also required to elicit proinflammatory CD4+ helper T cell responses to infection and mucosal vaccination. Retinoic acid receptor alpha (RARα) is the critical mediator of these effects. Strikingly, antagonism of RAR signaling and deficiency in RARα(Rara−/−) results in a cell autonomous CD4+ T cell activation defect. Altogether, these findings reveal a fundamental role for the RA/RARα axis in the development of both regulatory and inflammatory arms of adaptive immunity and establish nutritional status as a broad regulator of adaptive T cell responses. PMID:21419664

  5. Decreased levels of alpha-1-acid glycoprotein are related to the mortality of septic patients in the emergency department

    Directory of Open Access Journals (Sweden)

    Romualdo Barroso-Sousa

    2013-01-01

    Full Text Available OBJECTIVE: To determine the validity of alpha-1-acid glycoprotein as a novel biomarker for mortality in patients with severe sepsis. METHODS: We prospectively included patients with severe sepsis or septic shock at the emergency department at a single tertiary referral teaching hospital. All of the patients were enrolled within the first 24 hours of emergency department admission, and clinical data and blood samples were obtained. As the primary outcome, we investigated the association of serum levels of alpha-1-acid glycoprotein and 96-hour mortality with logistic regression analysis and generalized estimating equations adjusted for age, sex, shock status and Acute Physiology and Chronic Health Evaluation II score. RESULTS: Patients with septic shock had lower alpha-1-acid glycoprotein levels at the time of emergency department admission compared to patients without shock (respectively, 149.1 ±42.7 vs. 189.8 ±68.6; p = 0.005. Similarly, non-survivors in the first 96 hours were also characterized by lower levels of alpha-1-acid glycoprotein at the time of emergency department admission compared to survivors (respectively, 132.18 ±50.2 vs. 179.8 ±61.4; p = 0.01. In an adjusted analysis, alpha-1-acid glycoprotein levels ≤120 mg/dL were significantly associated with 96-hour mortality (odds ratio = 14.37; 95% confidence interval = 1.58 to 130.21. CONCLUSION: Septic shock patients exhibited lower circulating alpha-1-acid glycoprotein levels than patients without shock. Alpha-1-acid glycoprotein levels were independently associated with 96-hour mortality in individuals with severe sepsis.

  6. Influence of ascorbic acid on in vivo amidation of alpha-melanocyte stimulating hormone in guinea pig pituitary

    DEFF Research Database (Denmark)

    Fenger, M; Hilsted, L

    1988-01-01

    The effect of ascorbic acid depletion on the amidation of alphamelanocyte stimulating hormone (alpha MSH) was studied in vivo in guinea pig pituitary. After four weeks, the concentration of ascorbic acid was 1.20 +/- 0.11 mumol/g tissue (mean +/- SD) in the pituitary and 0.34 +/- 0.07 mumol/g tis...

  7. Mechanisms of activation of muscle branched-chain alpha-keto acid dehydrogenase during exercise in man

    DEFF Research Database (Denmark)

    Van Hall, Gerrit; MacLean, D A; Saltin, B

    1996-01-01

    1. Exercise leads to activation (dephosphorylation) of the branched-chain alpha-keto acid dehydrogenase (BCKADH). Here we investigate the effect of low pre-exercise muscle glycogen content and of branched-chain amino acid (BCAA) ingestion on the activity of BCKADH at rest and after 90 min of one...

  8. Influence of ascorbic acid on in vivo amidation of alpha-melanocyte stimulating hormone in guinea pig pituitary

    DEFF Research Database (Denmark)

    Fenger, M; Hilsted, L

    1988-01-01

    The effect of ascorbic acid depletion on the amidation of alphamelanocyte stimulating hormone (alpha MSH) was studied in vivo in guinea pig pituitary. After four weeks, the concentration of ascorbic acid was 1.20 +/- 0.11 mumol/g tissue (mean +/- SD) in the pituitary and 0.34 +/- 0.07 mumol......-39) immunoreactivity was observed in the depleted guinea pigs. Gel chromatography and reversed-phase high-performance luquid chromatography showed that the alpha MSH and ACTH (1-14) immunoreactivity was of low molecular weight and partly mono- or diacetylated. Depletion of ascorbic acid had no influence on the degree...... of acetylation of alpha MSH and ACTH (1-14). It is concluded that depletion of ascorbic acid reduces the in vivo amidation of ACTH (1-14) in the guinea pig pituitary....

  9. Mirrors in the PDB: left-handed alpha-turns guide design with D-amino acids.

    Science.gov (United States)

    Annavarapu, Srinivas; Nanda, Vikas

    2009-09-22

    Incorporating variable amino acid stereochemistry in molecular design has the potential to improve existing protein stability and create new topologies inaccessible to homochiral molecules. The Protein Data Bank has been a reliable, rich source of information on molecular interactions and their role in protein stability and structure. D-amino acids rarely occur naturally, making it difficult to infer general rules for how they would be tolerated in proteins through an analysis of existing protein structures. However, protein elements containing short left-handed turns and helices turn out to contain useful information. Molecular mechanisms used in proteins to stabilize left-handed elements by L-amino acids are structurally enantiomeric to potential synthetic strategies for stabilizing right-handed elements with D-amino acids. Propensities for amino acids to occur in contiguous alpha(L) helices correlate with published thermodynamic scales for incorporation of D-amino acids into alpha(R) helices. Two backbone rules for terminating a left-handed helix are found: an alpha(R) conformation is disfavored at the amino terminus, and a beta(R) conformation is disfavored at the carboxy terminus. Helix capping sidechain-backbone interactions are found which are unique to alpha(L) helices including an elevated propensity for L-Asn, and L-Thr at the amino terminus and L-Gln, L-Thr and L-Ser at the carboxy terminus. By examining left-handed alpha-turns containing L-amino acids, new interaction motifs for incorporating D-amino acids into right-handed alpha-helices are identified. These will provide a basis for de novo design of novel heterochiral protein folds.

  10. In vivo studies of the biosynthesis of alpha-eleostearic acid in the seed of Momordica charantia L

    International Nuclear Information System (INIS)

    Liu, L.; Hammond, E.G.; Nikolau, B.J.

    1997-01-01

    In vivo radiotracer experiments using 14C-labeled acetate, oleate, linoleate, and linolenate were conducted to investigate the biosynthesis of alpha-eleostearic acid in the seeds of Momordica charantia. With the exception of [14C]linolenate, all of these precursors radioactively labeled alpha-eleostearate. Kinetics of the time course of metabolism of the radioactive precursors indicate that linoleate is the acyl precursor of alpha-eleostearate and that its conversion to alpha-eleostearate occurs while the acyl moiety is esterified to PC. Pulse-chase experiments with 14C-labeled acetate or linoleate provided additional corroborative evidence that linoleoyl PC is the precursor of alpha-eleostearoyl PC

  11. The radiolysis of CMPO: effects of acid, metal complexation and alpha vs. gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J. Mincher; Stephen P. Mezyk; Gary S. Groenewold

    2016-05-01

    Abstract The group actinide/lanthanide complexing agent octylphenylcarbamoylmethyl phosphine oxide (CMPO) has been examined for its radiation stability by measuring the kinetics of its reactions with free radicals in both the aqueous and organic phases for the free and metal-complexed ligand, identifying its degradation products for both alpha and gamma irradiation, measuring the effects on solvent extraction performance, and measuring the G-values for its degradation under various conditions. This includes the G-values for CMPO in the absence of, and in contact with the acidic aqueous phase, where it is shown that the acidic aqueous phase provides radio-protection for this ligand. It was found that both solvent and metal complexation affect the kinetics of the reaction of the •NO3 radical, a product of HNO3 radiolysis, with CMPO. For example, CMPO complexed with lanthanides has a rate constant for this reaction an order of magnitude higher than for the free ligand, and the reaction for the free ligand in the organic phase is about three times faster than in the aqueous phase. In steady state radiolysis kinetics it was determined that HNO3, although not NO3- anion, provides radio-protection to CMPO, with the G-value for its degradation decreasing with increasing acidity, until it was almost completely suppressed by irradiation in contact with 5 M HNO3. The same degradation products were produced by irradiation with alpha and gamma-sources, except that the relative abundances of these products varied. For example, the product of C-C bond scission was produced only in low amounts for gamma-radiolysis, but it was an important product for samples irradiated with a He ion beam. These results are compared to the new data appearing in the literature on DGA radiolysis, since CMPO and the DGAs both contain the amide functional group.

  12. Stereochemistry of the peroxisomal branched-chain fatty acid alpha- and beta-oxidation systems in patients suffering from different peroxisomal disorders

    NARCIS (Netherlands)

    Ferdinandusse, S.; Rusch, H.; van Lint, A. E. M.; Dacremont, G.; Wanders, R. J. A.; Vreken, P.

    2002-01-01

    Phytanic acid (3,7,11,15-tetramethylhexadecanoic acid) is a branched-chain fatty acid derived from dietary sources and broken down in the peroxisome to pristanic acid (2,6,10,14-tetramethylpentadecanoic acid) via alpha-oxidation. Pristanic acid then undergoes beta-oxidation in peroxisomes. Phytanic

  13. Threshold changes in rat brain docosahexaenoic acid incorporation and concentration following graded reductions in dietary alpha-linolenic acid

    Science.gov (United States)

    Taha, Ameer Y.; Chang, Lisa; Chen, Mei

    2016-01-01

    Background This study tested the dietary level of alpha-linolenic acid (α-LNA, 18:3n-3) sufficient to maintain brain 14C-Docosahexaenoic acid (DHA, 22:6n-3) metabolism and concentration following graded α-LNA reduction. Methods 18–21 day male Fischer-344 (CDF) rats were randomized to the AIN-93G diet containing as a % of total fatty acids, 4.6% (“n-3 adequate”), 3.6%, 2.7%, 0.9% or 0.2% (“n-3 deficient”) α-LNA for 15 weeks. Rats were intravenously infused with 14C-DHA to steady state for 5 minutes, serial blood samples collected to obtain plasma and brains excised following microwave fixation. Labeled and unlabeled DHA concentrations were measured in plasma and brain to calculate the incorporation coefficient, k*, and incorporation rate, Jin. Results Compared to 4.6% α-LNA controls, k* was significantly increased in ethanolamine glycerophospholipids in the 0.2% α-LNA group. Circulating unesterified DHA and brain incorporation rates (Jin) were significantly reduced at 0.2% α-LNA. Brain total lipid and phospholipid DHA concentrations were reduced at or below 0.9% α-LNA. Conclusion Threshold changes for brain DHA metabolism and concentration were maintained at or below 0.9% dietary α-LNA, suggesting the presence of homeostatic mechanisms to maintain brain DHA metabolism when dietary α-LNA intake is low. PMID:26869088

  14. New enzymatic method of chiral amino acid synthesis by dynamic kinetic resolution of amino acid amides: use of stereoselective amino acid amidases in the presence of alpha-amino-epsilon-caprolactam racemase.

    Science.gov (United States)

    Yamaguchi, Shigenori; Komeda, Hidenobu; Asano, Yasuhisa

    2007-08-01

    D- and L-amino acids were produced from L- and D-amino acid amides by D-aminopeptidase from Ochrobactrum anthropi C1-38 and L-amino acid amidase from Pseudomonas azotoformans IAM 1603, respectively, in the presence of alpha-amino-epsilon-caprolactam racemase from Achromobacter obae as the catalyst by dynamic kinetic resolution of amino acid amides.

  15. Tumor necrosis factor alpha is associated with insulin-mediated suppression of free fatty acids and net lipid oxidation in HIV-infected patients with lipodystrophy

    DEFF Research Database (Denmark)

    Haugaard, Steen B; Andersen, Ove; Pedersen, SB

    2006-01-01

    Tumor necrosis factor alpha (TNF-alpha) stimulates lipolysis in man. We examined whether plasma TNF-alpha is associated with the degree by which insulin suppresses markers of lipolysis, for example, plasma free fatty acid (FFA) and net lipid oxidation (LIPOX) rate in HIV-infected patients...

  16. The effect of physically applied alpha hydroxyl acids on the skin pore and comedone.

    Science.gov (United States)

    Kim, S J; Baek, J H; Koh, J S; Bae, M I; Lee, S J; Shin, M K

    2015-10-01

    Alpha hydroxy acids (AHA) have been recognized as commonly used therapy for acne. Our studies examined whether an additional effect of physical treatment using chemical peeling combined with negative pressure and compared with AHA treatment only occurs in acne-prone subjects. The chemical peeling agent used 4% of an AHA solution (mixture of 1000 mL of carbonated water, 20 mL of glycolic acid and 20 mL of lactic acid). All subjects' faces were randomly divided into test and control groups. The test group was treated with chemical peeling combined with a physical effect, and the control group applied chemical peeling alone. For the 23 healthy females (average age: 30.17 ± 5.06 year), we measured sebum output level by light transmission, pore area and number by optical image analyser, and comedone counting before treatment and at 1, 2 and 4 weeks after a single treatment. Compared to the before treatment, whiteheads and blackheads were significantly decreased at 1, 2 and 4 weeks in the test group (P Pore area and number significantly decreased at 1 week (P pore size and seborrhoea. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  17. Alpha1-acid glycoprotein post-translational modifications: a comparative two dimensional electrophoresis based analysis

    Directory of Open Access Journals (Sweden)

    P. Roncada

    2010-04-01

    Full Text Available Alpha1-acid glycoprotein (AGP is an immunomodulatory protein expressed by hepatocytes in response to the systemic reaction that follows tissue damage caused by inflammation, infection or trauma. A proteomic approach based on two dimensional electrophoresis, immunoblotting and staining of 2DE gels with dyes specific for post-translational modifications (PTMs such as glycosylation and phosphorylation has been used to evaluate the differential interspecific protein expression of AGP purified from human, bovine and ovine sera. By means of these techniques, several isoforms have been identified in the investigated species: they have been found to change both with regard to the number of isoforms expressed under physiological condition and with regard to the quality of PTMs (i.e. different oligosaccharidic chains, presence/absence of phosphorilations. In particular, it is suggested that bovine serum AGP may have one of the most complex pattern of PTMs among serum proteins of mammals studied so far.

  18. Novel tricyclic-alpha-alkyloxyphenylpropionic acids: dual PPARalpha/gamma agonists with hypolipidemic and antidiabetic activity.

    Science.gov (United States)

    Sauerberg, Per; Pettersson, Ingrid; Jeppesen, Lone; Bury, Paul S; Mogensen, John P; Wassermann, Karsten; Brand, Christian L; Sturis, Jeppe; Wöldike, Helle F; Fleckner, Jan; Andersen, Anne-Sofie T; Mortensen, Steen B; Svensson, L Anders; Rasmussen, Hanne B; Lehmann, Søren V; Polivka, Zdenek; Sindelar, Karel; Panajotova, Vladimira; Ynddal, Lars; Wulff, Erik M

    2002-02-14

    Synthesis and structure-activity relationships of tricyclic alpha-ethoxy-phenylpropionic acid derivatives guided by in vitro PPARalpha and PPARgamma transactivation data and computer modeling led to the identification of the novel carbazole analogue, 3q, with dual PPARalpha (EC(50) = 0.36 microM) and PPARgamma (EC(50) = 0.17 microM) activity in vitro. Ten days treatment of db/db mice with 3q improved the insulin sensitivity, as measured by OGTT, better than that seen with both pioglitazone and rosiglitazone treatment, suggesting in vivo PPARgamma activity. Likewise, 3q lowered plasma triglycerides and cholesterol in high cholesterol fed rats after 4 days treatment, indicating in vivo PPARalpha activity. Investigations of the pharmacokinetics of selected compounds suggested that extended drug exposure improved the in vivo activity of in vitro active compounds.

  19. An NMR and ab initio quantum chemical study of acid-base equilibria for conformationally constrained acidic alpha-amino acids in aqueous solution.

    Science.gov (United States)

    Nielsen, P A; Jaroszewski, J W; Norrby, P O; Liljefors, T

    2001-03-07

    The protonation states of a series of piperidinedicarboxylic acids (PDAs), which are conformationally constrained acidic alpha-amino acids, have been studied by (13)C NMR titration in water. The resulting data have been correlated with theoretical results obtained by HF/6-31+G calculations using the polarizable continuum model (PCM) for the description of water. The PDAs are highly ionizable and contain one or two possible internal hydrogen bonds. In the present study, we show that the PCM model is able to reproduce the relative stabilities of the different protonation states of the PDAs. Furthermore, our results show that prediction of relative pK(a) values for two different types of ionizable functional groups covering a pK(a) range from 1.6 to 12.1 is possible with a high degree of accuracy.

  20. Synthesis of omega-hydroxy carboxylic acids and alpha,omega-dimethyl ketones using alpha,omega-diols as alkylating agents.

    Science.gov (United States)

    Iuchi, Yosuke; Hyotanishi, Megumi; Miller, Brittany E; Maeda, Kensaku; Obora, Yasushi; Ishii, Yasutaka

    2010-03-05

    Synthesis of omega-hydroxy carboxylic acids and alpha,omega-dimethyl diketones was successfully achieved by using alpha,omega-diols as alkylating agents under the influence of an iridium catalyst. For example, the alkylation of butyl cyanoacetate with 1,13-tridecanediol in the presence of [IrCl(cod)](2) or [IrCl(coe)(2)](2) gave rise to butyl 2-cyano-15-hydroxypentadecanoate in good yield which is easily converted to cyclopentadecanolide (CPDL). In addition, the alkylation of acetone with 1,10-decanediol in the presence of [IrCl(cod)](2) and KOH resulted in an important muscone precursor, 2,15-hexadecanedione (HDDO), in good yield.

  1. Alpha-Linolenic Acid: An Omega-3 Fatty Acid with Neuroprotective Properties—Ready for Use in the Stroke Clinic?

    Directory of Open Access Journals (Sweden)

    Nicolas Blondeau

    2015-01-01

    Full Text Available Alpha-linolenic acid (ALA is plant-based essential omega-3 polyunsaturated fatty acids that must be obtained through the diet. This could explain in part why the severe deficiency in omega-3 intake pointed by numerous epidemiologic studies may increase the brain’s vulnerability representing an important risk factor in the development and/or deterioration of certain cardio- and neuropathologies. The roles of ALA in neurological disorders remain unclear, especially in stroke that is a leading cause of death. We and others have identified ALA as a potential nutraceutical to protect the brain from stroke, characterized by its pleiotropic effects in neuroprotection, vasodilation of brain arteries, and neuroplasticity. This review highlights how chronic administration of ALA protects against rodent models of hypoxic-ischemic injury and exerts an anti-depressant-like activity, effects that likely involve multiple mechanisms in brain, and may be applied in stroke prevention. One major effect may be through an increase in mature brain-derived neurotrophic factor (BDNF, a widely expressed protein in brain that plays critical roles in neuronal maintenance, and learning and memory. Understanding the precise roles of ALA in neurological disorders will provide the underpinnings for the development of new therapies for patients and families who could be devastated by these disorders.

  2. Rapid One-Step Selection Method for Generating Nucleic Acid Aptamers: Development of a DNA Aptamer against alpha-Bungarotoxin

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.

    2012-01-01

    in one-step, technique is required for developing aptamers in limited time period. Principal Findings: Herein, we present a simple one-step selection of DNA aptamers against alpha-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed...

  3. Pharmacological characterization of mouse GPRC6A, an L-alpha-amino-acid receptor modulated by divalent cations

    DEFF Research Database (Denmark)

    Christiansen, B; Hansen, K B; Wellendorph, P

    2007-01-01

    GPRC6A is a novel member of family C of G protein-coupled receptors with so far unknown function. We have recently described both human and mouse GPRC6A as receptors for L-alpha-amino acids. To date, functional characterization of wild-type GPRC6A has been impaired by the lack of activity in quan...

  4. Increased alpha-linolenic acid intake lowers C-reactive protein, but has no effect on markers of atherosclerosis

    NARCIS (Netherlands)

    Bemelmans, WJE; Lefrandt, JD; Feskens, EJM; van Haelst, PL; Broer, J; Meyboom-de Jong, B; May, JF; Cohen Tervaert, Jan; Smit, AJ

    Objective: To investigate the effects of increased alpha-linolenic acid (ALA)-intake on intima-media thickness (IMT), oxidized low-density lipoprotein (LDL) antibodies, soluble intercellular adhesion molecule-1 (sICAM-1), C-reactive protein (CRP), and interleukins 6 and 10. Design: Randomized

  5. Pyruvate: immunonutritional effects on neutrophil intracellular amino or alpha-keto acid profiles and reactive oxygen species production

    NARCIS (Netherlands)

    Mathioudakis, D.; Engel, J.; Welters, I.D.; Dehne, M.G.; Matejec, R.; Harbach, H.; Henrich, M.; Schwandner, T.; Fuchs, M.; Weismuller, K.; Scheffer, G.J.; Muhling, J.

    2011-01-01

    For the first time the immunonutritional role of pyruvate on neutrophils (PMN), free alpha-keto and amino acid profiles, important reactive oxygen species (ROS) produced [superoxide anion (O(2) (-)), hydrogen peroxide (H(2)O(2))] as well as released myeloperoxidase (MPO) acitivity has been

  6. Alpha-mangostin attenuates diabetic nephropathy in association with suppression of acid sphingomyelianse and endoplasmic reticulum stress.

    Science.gov (United States)

    Liu, Tingting; Duan, Wang; Nizigiyimana, Paul; Gao, Lin; Liao, Zhouning; Xu, Boya; Liu, Lerong; Lei, Minxiang

    2018-02-05

    Diabetic nephropathy is a common complication of diabetes, but there are currently few treatment options. The aim of this study was to gain insight into the effect of alpha-mangostin on diabetic nephropathy and possible related mechanisms. Goto-Kakizaki rats were used as a diabetic model and received alpha-mangostin or desipramine treatment with normal saline as a control. Ten age-matched Sprague Dawley rats were used as normal controls and treated with normal saline. At week 12, blood glucose, albuminuria, apoptosis and renal pathologic changes were assessed. Protein levels for acid sphingomyelinase, glucose-regulated protein 78, phosphorylated PKR-like ER-resident kinase, activated transcription factor 4, CCAAT/enhancer-binding protein, homologous protein), and cleaved-caspase12 were measured. The level of acid sphingomyelinase was significantly increased, and ER stress was activated in diabetic rat kidneys when compared to the control animals. When acid sphingomyelinase was inhibited by alpha-mangostin, the expression of ER stress-related proteins was down-regulated in association with decreased levels of diabetic kidney injury. Alpha-mangostin, an acid sphingomyelinase inhibitor plays a protective role in diabetic neuropathy by relieving ER stress induced-renal cell apoptosis. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. “CLEAR BRANDY” PRODUCTION USING ALPHA ACID EXTRACT FROM HOPS IN THE BIOCIDAL CONTROL OF THE FERMENTATION PROCESS

    Directory of Open Access Journals (Sweden)

    Tassiana Amélia de Oliveira e Silva

    2016-01-01

    Full Text Available The major problem in the production of “clear brandy” is the contamination of the must by bacteria of the species Lactobacillus. To overcome this problem, this work intends to evaluate the usage of the alpha acids from hop extract (Humulus lupulus as antibacterial agent during brandy production. In addition, the maximum cell recycling was evaluated during the clear brandy production. Preliminary experiments using the Sabourand synthetic medium added with 40 ppm of the alpha acids reduced the cell viability of L. casei and L. plantarum bacteria from 108 CFU.mL-1 to 105 CFU.mL-1 and showed no effect in the growth of Saccharomyces cerevisiae. These experiments were conducted at 120 rpm and 25°C. The clear brandy production (200 L using the same alpha acids concentration (40 ppm and Saccharomyces cerevisiae cell recycling (14 times showed no contamination by bacteria. Then, the clear brandy was distilled in a 160 L cooper distiller. The clear brandy produced with and without alpha acids, was analyzed in the Laboratory of Alcohol and Beverages as well as in the Laboratory of Spectroscopy of the Cuban Research Institute of the Sugarcane Derivatives (ICIDCA in Spanish in Havana and showed similarities in their composition and sensorial chemical analysis.

  8. Role of retinoid-X receptor-alpha in the suppression of rat bile acid coenzyme A-amino acid N-acyltransferase in liver during sepsis.

    Science.gov (United States)

    Chen, Yen-Hsu; Hong, I-Chu; Kuo, Kung-Kai; Hsu, Hseng-Kuang; Hsu, Chin

    2007-07-01

    Sepsis causes intrahepatic cholestasis and leads to hepatic failure. However, the pathophysiology of hepatic events is unclear. Expression of rat hepatic bile acid coenzyme A-amino acid N-acyltransferase (rBAT), a major enzyme for the conjugation of bile acids, is significantly decreased during sepsis. rBAT transcriptional regulation is mainly by a heterodimer of farnesoid-X receptor (FXR) and retinoid-X receptor-alpha (RXR-alpha) via the inverted repeat 1 sequence. During sepsis, nuclear receptors and translocation of RXR-alpha from cytosol to nucleus decrease. The purpose of this study was to further clarify the mechanisms of RXR-alpha-mediated rBAT regulation during polymicrobial sepsis and with dexamethasone treatment. Polymicrobial sepsis was induced in rats by cecal ligation and puncture (CLP). Liver tissues obtained 3, 6, 9, and 18 h after CLP were studied, and hepatocytes were isolated from rats with sepsis. Post-CLP decreases were observed in mRNA levels of rBAT (6 h), protein levels of rBAT (6 h), RXR-alpha (6 h), and FXR (9 h). DNA binding activity of FXR/RXR significantly decreased at 6 h after CLP. Dexamethasone reversed sepsis-inhibited RXR-alpha expression and the binding activity of FXR/RXR to rBAT DNA as well as rBAT protein expression. The results suggest that suppression of rBAT occurs at the transcriptional level, and the decrease in RXR-alpha by septic insult may play a critical role in rBAT suppression at the early stage of polymicrobial sepsis.

  9. Nutritional Effect of Alpha-Linolenic Acid on Honey Bee Colony Development (Apis Mellifera L.

    Directory of Open Access Journals (Sweden)

    Ma Lanting

    2015-12-01

    Full Text Available Alpha-linolenic acid (ALA, which is an n-3 polyunsaturated fatty acid (PUFA, influences honey bee feed intake and longevity. The objective of this study was to research the effect of six dietary ALA levels on the growth and development of Apis mellifera ligustica colonies. In the early spring, a total of 36 honey bee colonies of equal size and queen quality were randomly allocated into 6 groups. The six groups of honey bees were fed a basal diet with supplementation of ALA levels at 0 (group A, 2 (group B, 4 (group C, 6 (group D, 8 (group E, and 10% (group F. In this study, there were significant effects of pollen substitute ALA levels on the feeding amounts of the bee colony, colony population, sealed brood amount, and weight of newly emerged workers (P<0.05. The workers’ midgut Lipase (LPS activity of group C was significantly lower than that of the other groups (P<0.01. The worker bees in groups B, C, and D had significantly longer lifespans than those in the other groups (P<0.05. However, when the diets had ALA concentrations of more than 6%, the mortality of the honey bees increased (P<0.01. These results indicate that ALA levels of 2 ~ 4% of the pollen substitute were optimal for maintaining the highest reproductive performance and the digestion and absorption of fatty acids in honey bees during the period of spring multiplication. Additionally, ALA levels of 2 ~ 6% of the pollen substitute, improved worker bee longevity.

  10. The role of amino acid alpha38 in the control of oxygen binding to human adult and embryonic haemoglobin Portland.

    OpenAIRE

    Zheng, T; Brittain, T; Watmough, N J; Weber, R E

    1999-01-01

    The role of the amino acid at position alpha(38) in haemoglobin has been probed using site-directed mutagenesis. When the Thr residue at position alpha(38) (which is totally conserved in all mammals) is changed to a Gln, the equilibrium properties of the protein are significantly altered. Equilibrium and kinetic data show that the R-state properties of the protein are essentially unaffected by the mutation whilst the allosteric equilibrium and T-state properties are changed. Mutation of the n...

  11. Dose effect of alpha-linolenic acid on PUFA conversion, bioavailability, and storage in the hamster.

    Science.gov (United States)

    Morise, Anne; Combe, Nicole; Boué, Carole; Legrand, Philippe; Catheline, Daniel; Delplanque, Bernadette; Fénart, Evelyne; Weill, Pierre; Hermier, Dominique

    2004-04-01

    If an increased consumption of alpha-linolenic acid (ALA) is to be promoted in parallel with that of n-3 long-chain-rich food, it is necessary to consider to what extent dietary ALA can be absorbed, transported, stored, and converted into long-chain derivatives. We investigated these processes in male hamsters, over a broad range of supply as linseed oil (0.37, 3.5, 6.9, and 14.6% energy). Linoleic acid (LA) was kept constant (8.5% energy), and the LA/ALA ratio was varied from 22.5 to 0.6. The apparent absorption of individual FA was very high (>96%), and that of ALA remained almost maximum even at the largest supply (99.5%). The capacity for ALA transport and storage had no limitation over the chosen range of dietary intake. Indeed, ALA intake was significantly correlated with ALA level not only in cholesteryl esters (from 0.3 to 9.7% of total FA) but also in plasma phospholipids and red blood cells (RBC), which makes blood components extremely reliable as biomarkers of ALA consumption. Similarly, ALA storage in adipose tissue increased from 0.85 to 14% of total FA and was highly correlated with ALA intake. As for bioconversion, dietary ALA failed to increase 22:6n-3, decreased 20:4n-6, and efficiently increased 20:5n-3 (EPA) in RBC and cardiomyocytes. EPA accumulation did not tend to plateau, in accordance with identical activities of delta5- and delta6-desaturases in all groups. Dietary supply of ALA was therefore a very efficient means of improving the 20:4n-6 to 20:5n-3 balance.

  12. Comparative sorption of benzo[alpha]phrene to different humic acids and humin in sediments.

    Science.gov (United States)

    Zhang, Jinghuan; He, Mengchang; Shi, Yehong

    2009-07-30

    Sediment/soil organic matter (SOM) is the predominant sorbents for hydrophobic organic compounds (HOCs). The identification and comparison of sorption characterization of HOCs by different organic matter fractions are essential to predict the fate and transport of HOCs in soils and sediments. The objectives of this paper are to compare the sorption of benzo[alpha]phrene (BaP) to the humic acid (HA) and humin (HM) extracted from different sediments. The HA and HM were extracted with 0.1M NaOH from five sediments in different areas in China, and their sorption isotherms for BaP were determined. All sorption isotherms were nonlinear and nonlinearity increased in the order HA

  13. Effects of Socio demographic factors on plasma ascorbic acid and alpha tocopherol anti oxidants during pregnancy

    International Nuclear Information System (INIS)

    Sylvester, I.E.; Paul, A.

    2010-01-01

    Objectives: To assess the plasma levels of vitamins C and E at the various stages of pregnancy and to correlate their plasma levels with the socio-demographic factors of pregnant Nigerians. Methodology: The pregnant cases (n=180) were randomly selected according to gestational ages. And the controls (n=20) were non-pregnant women of the same age. Plasma levels of both vitamins were assayed with well established laboratory methods. Results: The mean plasma vitamins C and E in the pregnant cases was lower (by 17-23%) than controls across the three trimesters, p<0.0001. The correlation of vitamin C versus maternal age was significant; r = - 0.59, p<0.05; the mean plasma level of vitamin C declined by 57% as the maternal age increases from 22-37 years. Conclusion: The mean plasma Ascorbic acid and Alpha-tocopherol are reduced during pregnancy and socio-demographic factors have mild effects on the plasma levels of these vitamins. (author)

  14. The conjugated linoleic acid isomer trans-9,trans-11 is a dietary occurring agonist of liver X receptor {alpha}

    Energy Technology Data Exchange (ETDEWEB)

    Ecker, Josef; Liebisch, Gerhard [Institute of Clinical Chemistry, University of Regensburg (Germany); Patsch, Wolfgang [Department of Laboratory Medicine, Hospital of Salzburg (Austria); Schmitz, Gerd, E-mail: gerd.schmitz@klinik.uni-regensburg.de [Institute of Clinical Chemistry, University of Regensburg (Germany)

    2009-10-30

    Conjugated linoleic acid (CLA) isomers are dietary fatty acids that modulate gene expression in many cell types. We have previously reported that specifically trans-9,trans-11 (t9,t11)-CLA induces expression of genes involved in lipid metabolism of human macrophages. To elucidate the molecular mechanism underlying this transcriptional activation, we asked whether t9,t11-CLA affects activity of liver X receptor (LXR) {alpha}, a major regulator of macrophage lipid metabolism. Here we show that t9,t11-CLA is a regulator of LXR{alpha}. We further demonstrate that the CLA isomer induces expression of direct LXR{alpha} target genes in human primary macrophages. Knockdown of LXR{alpha} with RNA interference in THP-1 cells inhibited t9,t11-CLA mediated activation of LXR{alpha} including its target genes. To evaluate the effective concentration range of t9,t11-CLA, human primary macrophages were treated with various doses of CLA and well known natural and synthetic LXR agonists and mRNA expression of ABCA1 and ABCG1 was analyzed. Incubation of human macrophages with 10 {mu}M t9,t11-CLA led to a significant modulation of ABCA1 and ABCG1 transcription and caused enhanced cholesterol efflux to high density lipoproteins and apolipoprotein AI. In summary, these data show that t9,t11-CLA is an agonist of LXR{alpha} in human macrophages and that its effects on macrophage lipid metabolism can be attributed to transcriptional regulations associated with this nuclear receptor.

  15. Cytotoxic lipidic {alpha}-amino acids from the zoanthid Protopalythoa variabilis from the Northeastern coast of Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Wilke, Diego Veras; Jimenez, Paula Christine; Pessoa, Claudia; Moraes, Manoel Odorico de; Costa-Lotufo, Leticia Veras [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Faculdade de Medicina. Dept. de Fisiologia e Farmacologia], e-mail: lvcosta@secrel.com.br, e-mail: lvcosta@ufc.br; Araujo, Renata Mendonca; Silva, Wildson Max Barbosa da; Silveira, Edilberto Rocha; Pessoa, Otilia Deusdenia Loiola; Braz-Filho, Raimundo [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Dept. de Quimica Organica e Inorganica; Lopes, Norberto Peporine [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Ciencias Farmaceuticas. Dept. de Fisica e Quimica

    2009-07-01

    Two lipidic {alpha}-amino acids 1a and 1b were isolated from the zoanthid Protopalythoa variabilis using a bioguided fractionation for cytotoxic activity. The structures of the metabolites were determined by spectroscopic methods, including NMR (nuclear magnetic resonance) {sup 1}H and {sup 13}C, IR infrared) and high resolution mass spectrometry (positive mode). The cytotoxic activity of the crude extract, as well as of the mixture of 1a and 1b were measured in vitro using the MTT assay for four human tumor cell lines. This finding has important biological and chemical implications for this type of compound. This is the first report of lipidic {alpha}-amino acids from natural sources, as well as of their cytotoxic activity. (author)

  16. cPLA2alpha-evoked formation of arachidonic acid and lysophospholipids is required for exocytosis in mouse pancreatic beta-cells

    DEFF Research Database (Denmark)

    Juhl, Kirstine; Høy, Marianne; Olsen, Hervør L

    2003-01-01

    Using capacitance measurements, we investigated the effects of intracellularly applied recombinant human cytosolic phospholipase A2 (cPLA2alpha) and its lipolytic products arachidonic acid and lysophosphatidylcholine on Ca2+-dependent exocytosis in single mouse pancreatic beta-cells. cPLA2alpha...... from 70-80 to 280-300. cPLA2alpha-stimulated exocytosis was antagonized by the specific cPLA2 inhibitor AACOCF3. Ca2+-evoked exocytosis was reduced by 40% in cells treated with AACOCF3 or an antisense oligonucleotide against cPLA2alpha. The action of cPLA2alpha was mimicked by a combination...... of arachidonic acid and lysophosphatidylcholine (470% stimulation) in which each compound alone doubled the exocytotic response. Priming of insulin-containing secretory granules has been reported to involve Cl- uptake through ClC-3 Cl- channels. Accordingly, the stimulatory action of cPLA2alpha was inhibited...

  17. High-performance liquid chromatographic separation of carminic acid, alpha- and beta-bixin, and alpha- and beta-norbixin, and the determination of carminic acid in foods.

    Science.gov (United States)

    Lancaster, F E; Lawrence, J F

    1996-05-03

    During a study of natural food colours, a simple and reliable high-performance liquid chromatography system was developed for use with cochineal and annato. An isocratic mobile phase, consisting of methanol and 6% aqueous acetic acid, resolved bixin and norbixin, while a gradient system was used to separate carminic acid and the annato compounds. The carminic acid contents of cochineal extract, carmine and carmine hydrosoluble were determined using an isocratic mobile phase (40:60, v/v). The detection limit for carminic acid in the various products was approximately 100 ng/g. Carminic acid was determined quantitatively in fruit beverages, yogurt and candies. It was demonstrated that, because of decomposition, carminic acid was not suitable for use in candies when manufacturing temperatures above 100 degrees C were required. Most membrane filters are not suitable for use with cochineal solutions, but a cellulose membrane filter did not adsorb carminic acid and was used successfully to remove impurities from water-based cochineal products and food extracts containing carminic acid.

  18. NMR study of the preparation of 6 {alpha}, 7 {beta}-dihydroxyvouacapan-17 beta-oic acid mannich base derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Flavio Jose Leite dos; Pilo-Veloso, Dorila [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte (Brazil). Inst. de Ciencias Exatas. Dept. Quimica]. E-mail: dorila@zeus.qui.ufmg.br; Ferreira-Alves, Dalton L. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte (Brazil). Inst. de Ciencias Biologicas. Dept. de Farmacologia

    2007-07-01

    This work presents four new Mannich base compounds obtained by the Mannich reaction of a {delta}-keto-lactone derivative of 6{alpha}, 7{beta}-dihydroxyvouacapan- 17{beta}-oic acid, a furano diterpene isolated from the hexane extract of Pterodon polygalaeflorus Benth fruits, which shows anti-inflammatory and analgesic activities. The use of 1D and 2D NMR (COSY, DEPT-135, HMBC, HMQC) spectroscopy made it possible to characterize the new compounds. (author)

  19. The effect of alpha-linolenic acid supplementation on ADHD symptoms in children: a randomized controlled double-blind study

    Directory of Open Access Journals (Sweden)

    Gal eDubnov-Raz

    2014-10-01

    Full Text Available Background: Attention Deficit-Hyperactivity Disorder (ADHD is the most common neuro-developmental disorder in childhood. Its pharmacologic treatment mostly includes methylphenidate, yet many parents seek alternative, natural, therapeutic options, commonly omega-3 fatty acids. Previous studies of supplementation with fish oil or long-chain omega-3 fatty acids to children with ADHD yielded mixed results. The use of alpha-linolenic acid, a medium-chained, plant-based omega-3 fatty acid (18:3 n-3, has not been sufficiently examined in this population. Methods: Forty untreated children with ADHD, aged 6-16 years, were randomized to receive either 2gr/day of oil containing 1gr alpha-linolenic acid or placebo, for 8 weeks. Before and after supplementation, the children underwent a physician assessment of ADHD symptoms and a computerized continuous performance functions test. The children's parents and teachers filled out Conners' and DSM questionnaires. Results: Seventeen (42.5% children completed the study, 8 in the supplementation group, 9 in the placebo group. Main drop-out reasons were capsule size, poor compliance, and a sense of lack of effect. No significant difference was found in any of the measured variables tested before and after supplementation, in both study groups. No between-group difference was found in the changes of the various measures of ADHD symptoms throughout the study period.Conclusion: Supplementation of 2gr/day of oil containing 1gr alpha-linolenic acid did not significantly reduce symptoms in children with ADHD. Future studies in this field should consider an alternative method to deliver the oil, a higher dose, and a larger sample size.

  20. Retinol, alpha-tocopherol and fatty acid content in Bulgarian black Sea fish species

    Directory of Open Access Journals (Sweden)

    Stancheva, M.

    2012-06-01

    Full Text Available The aim of the present study was to measure and evaluate the total lipids, fatty acid profile, retinol content and alpha-tocopherol content in the edible tissue of four commercially important fish species from the Bulgarian Black sea: Sprat (Sprattus sprattus, Round Goby (Neogobius rattan, Black Sea Horse Mackerel (Trahurus medditeraneus ponticus and Shad (Alosa pontica. Fat soluble vitamins were analyzed simultaneously using an HPLC system. The highest content of retinol was established in the Sprat (142.3 ± 4.4 μg/100g and the highest content of alphatocopherol was found in the Black Sea Horse Mackerel (1112.7 ± 39.2 μg/100g. The fatty acid (FA composition was analyzed by GC/MS. The content of omega 3 (n3 FAs was significantly higher (p , 0.001 than the content of omega 6 (n6 FAs in each of the analyzed fish samples. The n6/n3 FA ratio was within the recommended range (0.20–1.50 for Sprat, Round Goby and Shad. Relatively high levels of retinol and alpha-tocopherol, FA composition, n3/n6 FA and PUFA/SFA ratios indicate that these fish species have good nutritional quality.

    El objeto de la investigación presentada es definir y comparar los lípidos totales, el perfil de ácidos grasos y el contenido de retinol y alfa-tocoferol en el tejido comestible de cuatro especies de peces con importancia comercial del Mar Negro búlgaro —espadín (Sprattus Sprattus, gobio de boca negra (Neogobius Melanostomus, chicharro (Trachurus Trachurus y sábalo del Mar Negro (Caspialosa Pontica. Dos vitaminas liposolubles son analizadas simultáneamente mediante cromatografía líquida de alta eficacia (HPLC. El contenido mayor de retinol se encuentra en el espadín (142.3 ± 4.4 μg/100g, y de alfa-tocoferol en el chicharro (1112.7 ± 39.2 μg/100g. El contenido de ácidos grasos ha sido analizado mediante cromatografía gaseosa/espectrometría de masas (GC/MS. El contenido de ácidos grasos (AG

  1. The Mechanism of Rh-Catalyzed Transformation of Fatty Acids to Linear Alpha olefins

    Directory of Open Access Journals (Sweden)

    Sondre H. Hopen Eliasson

    2017-12-01

    Full Text Available Linear alpha olefins (LAOs are key commodity chemicals and petrochemical intermediates that are currently produced from fossil resources. Fatty acids are the obvious renewable starting material for LAOs, which can be obtained via transition-metal-catalyzed decarbonylative dehydration. However, even the best catalysts that have been obtained to date, which are based on palladium, are not active and stable enough for industrial use. To provide insight for design of better catalysts, we here present the first computationally derived mechanism for another attractive transition-metal for this reaction, rhodium. By comparing the calculated mechanisms and free energy profiles for the two metals, Pd and Rh, we single out important factors for a facile, low-barrier reaction and for a stable catalyst. While the olefin formation is rate limiting for both of the metals, the rate-determining intermediate for Rh is, in contrast to Pd, the starting complex, (PPh32Rh(COCl. This complex largely draws its stability from the strength of the Rh(I–CO bond. CO is a much less suitable ligand for the high-oxidation state Rh(III. However, for steric reasons, rhodium dissociates a bulkier triphenylphosphine and keeps the carbonyl during the oxidative addition, which is less favorable than for Pd. When compared to Pd, which dissociates two phosphine ligands at the start of the reaction, the catalytic activity of Rh also appears to be hampered by its preference for high coordination numbers. The remaining ancillary ligands leave less space for the metal to mediate the reaction.

  2. Matrice lipidique et biodisponibilité de l’acide alpha-linolénique

    Directory of Open Access Journals (Sweden)

    Couëdelo Leslie

    2017-03-01

    Full Text Available Les acides gras poly-insaturés (AGPI de la série oméga-3 (ω3 ont un rôle important dans la prévention de certaines pathologies. En plus d’être nécessaires dans des conditions physiologiques particulières (développement pré- et post-natal, croissance (Riediger et al., 2009. J Am Diet Assoc 109 : 668–679, ils sont associés à des effets santé en termes de prévention, notamment au niveau de pathologies cardiovasculaires, inflammatoires, certains cancers et certaines maladies neuro-dégénératives (De Lorgeril et al., 1994. Lancet 343 : 1454–1459 ; Simopoulos, 2008. Exp Biol Med (Maywood, NJ 233 : 674–688. Cependant, les dernières études épidémiologiques montrent que les apports en AGPI ω3, et notamment en acide alpha-linolénique (ALA, précurseur métabolique des AGPI à longue chaîne ω3, sont deux fois inférieurs aux recommandations de l’Agence national de sécurité sanitaire, de l’alimentation, de l’environnement et du travail (ANSES, 2011. Outre la nécessité d’augmenter l’apport en ALA, il est désormais nécessaire de prendre en considération les facteurs qui améliorent sa biodisponibilité. Dans ce contexte, nous avons testé plusieurs paramètres susceptibles de moduler le devenir métabolique de l’ALA. Nos recherches ont mis en évidence que plusieurs paramètres physiques et chimiques, tels que l’émulsification d’une huile linolénique avec de la lécithine de soja, la position de l’ALA sur le squelette glycérique du triglycéride alimentaire mais aussi la composition de la matrice permettraient de moduler la biodisponibilité et le devenir métabolique de l’ALA dans l’organisme.

  3. The sequence and crystal structure of the alpha-amino acid ester hydrolase from Xanthomonas citri define a new family of beta-lactam antibiotic acylases

    NARCIS (Netherlands)

    Barends, Thomas; Polderman - Tijmes, Jolanda; Jekel, PA; Hensgens, CMH; de Vries, Erik; Janssen, DB; Dijkstra, Bauke W.

    2003-01-01

    alpha-Amino acid ester hydrolases (AEHs) catalyze the hydrolysis and synthesis of esters and amides with an alpha-amino group. As such, they can synthesize beta-lactam antibiotics from acyl compounds and beta-lactam nuclei obtained from the hydrolysis of natural antibiotics. This article describes

  4. The implications of particle energy and acidic media on gross alpha and gross beta determination using liquid scintillation

    Energy Technology Data Exchange (ETDEWEB)

    Zapata-Garcia, D. [Laboratori de Radiologia Ambiental (LRA), Departament de Quimica Analitica, Universitat de Barcelona, Marti i Franques, 1-11 Planta 3, E-08028 Barcelona (Spain); Llaurado, M., E-mail: montse.llaurado@ub.edu [Laboratori de Radiologia Ambiental (LRA), Departament de Quimica Analitica, Universitat de Barcelona, Marti i Franques, 1-11 Planta 3, E-08028 Barcelona (Spain); Rauret, G. [Laboratori de Radiologia Ambiental (LRA), Departament de Quimica Analitica, Universitat de Barcelona, Marti i Franques, 1-11 Planta 3, E-08028 Barcelona (Spain)

    2012-04-15

    The interaction of humans with radioactivity present in the environment from natural and artificial sources necessitates an evaluation of its risk on human health. Gross alpha and gross beta activities can provide a rapid evaluation of the radioactive content of a sample and can be simultaneously determined by using liquid scintillation counters. However, calibration of the liquid scintillation counter is required and is affected by many factors, such as particle energy and the acidity of the media. This study investigates what effect the particle energy used for calibration has on misclassification and how to account for this misclassification in routine measurements. The variability in measurement produced by the final pH, as well as any acids used in sample treatment, was also studied. These results showed that the most commonly used acid for these types of analyses, HNO{sub 3}, produced a high amount of misclassifications at very low pH. The results improved when HCl was used to adjust the sample to low pH. - Highlights: Black-Right-Pointing-Pointer We study the effect of alpha and beta energies on PSA optimisation. Black-Right-Pointing-Pointer The optimum PSA shifts to higher values as the alpha energy increases. Beta energies do not affect it. Black-Right-Pointing-Pointer We study the effect of pH on the simultaneous determination of gross alpha/beta activities. Black-Right-Pointing-Pointer HNO{sub 3} produces a high amount of misclassification at very low pH. Black-Right-Pointing-Pointer The results improve when HCl is used to adjust the sample to low pH.

  5. Possible protective role of pregnenolone-16 alpha-carbonitrile in lithocholic acid-induced hepatotoxicity through enhanced hepatic lipogenesis.

    Science.gov (United States)

    Miyata, Masaaki; Nomoto, Masahiro; Sotodate, Fumiaki; Mizuki, Tomohiro; Hori, Wataru; Nagayasu, Miho; Yokokawa, Shinya; Ninomiya, Shin-ichi; Yamazoe, Yasushi

    2010-06-25

    Lithocholic acid (LCA) feeding causes both liver parenchymal and cholestatic damages in experimental animals. Although pregnenolone-16 alpha-carbonitrile (PCN)-mediated protection against LCA-induced hepatocyte injury may be explained by induction of drug metabolizing enzymes, the protection from the delayed cholestasis remains incompletely understood. Thus, the PCN-mediated protective mechanism has been studied from the point of modification of lipid metabolism. At an early stage of LCA feeding, an imbalance of biliary bile acid and phospholipid excretion was observed. Co-treatment with PCN reversed the increase in serum alanine aminotransferase (ALT) as well as alkaline phosphatase (ALP) activities and hepatic hydrophobic bile acid levels. LCA feeding decreased hepatic mRNA levels of several fatty acid- and phospholipid-related genes before elevation of serum ALT and ALP activities. On the other hand, PCN co-treatment reversed the decrease in the mRNA levels and hepatic levels of phospholipids, triglycerides and free fatty acids. PCN co-treatment also reversed the decrease in biliary phospholipid output in LCA-fed mice. Treatment with PCN alone increased hepatic phospholipid, triglyceride and free fatty acid concentrations. Hepatic fatty acid and phosphatidylcholine synthetic activities increased in mice treated with PCN alone or PCN and LCA, compared to control mice, whereas these activities decreased in LCA-fed mice. These results suggest the possibility that PCN-mediated stimulation of lipogenesis contributes to the protection from lithocholic acid-induced hepatotoxicity. (c) 2010 Elsevier B.V. All rights reserved.

  6. Zeolite-catalysed preparation of alpha-hydroxy carboxylic acids and esters thereof

    OpenAIRE

    Taarning, Esben; Shunmugavel, Saravanamurugan; Holm, Martin Spangsberg

    2010-01-01

    A process for the production of lactic acid and 2-hydroxy-3-butenoic acid or esters thereof by conversion of glucose, fructose, sucrose, xylose and glycolaldehyde dissolved in a solvent in presence of a solid Lewis acidic catalyst.

  7. Zeolite-catalysed preparation of alpha-hydroxy carboxylic acids and esters thereof

    DEFF Research Database (Denmark)

    2010-01-01

    A process for the production of lactic acid and 2-hydroxy-3-butenoic acid or esters thereof by conversion of glucose, fructose, sucrose, xylose and glycolaldehyde dissolved in a solvent in presence of a solid Lewis acidic catalyst.......A process for the production of lactic acid and 2-hydroxy-3-butenoic acid or esters thereof by conversion of glucose, fructose, sucrose, xylose and glycolaldehyde dissolved in a solvent in presence of a solid Lewis acidic catalyst....

  8. Reduction of 3 alpha-hydroxy-5 beta-chol-6-en-24-oic acid to lithocholic acid in rats

    International Nuclear Information System (INIS)

    Kimura, K.; Ogura, M.

    1988-01-01

    After [24- 14 C]delta 6-lithocholic acid was injected into the cecum of rats, [ 14 C]lithocholic acid was identified as a metabolite in feces. When the labeled delta 6-bile acid was injected intraperitoneally into bile-fistula rats, radioactivity excreted in bile was contained most abundantly in the taurine-conjugated fraction of bile acids. In the fraction, taurine conjugate of [ 14 C]delta 6-lithocholic acid but of neither [ 14 C]lithocholic acid nor other bile acids was found. The results showed that [24- 14 C]delta 6-lithocholic acid was reduced to [ 14 C]lithocholic acid by the intestinal flora but not by the liver, which, however, was capable of conjugating delta 6-lithocholic acid with taurine

  9. Dynamic kinetic resolution of amino acid amide catalyzed by D-aminopeptidase and alpha-amino-epsilon-caprolactam racemase.

    Science.gov (United States)

    Asano, Yasuhisa; Yamaguchi, Shigenori

    2005-06-01

    Amino acid amide racemizing activity was discovered in alpha-amino-epsilon-caprolactam (ACL) racemase (EC 5. 1. 1. 15) from Achromobacter obae. The enzymatic synthesis of d-alanine from l-alanine amide has been demonstrated by use of d-aminopeptidase (DAP; EC 3. 4. 11. 19) from Ochrobactrum anthropi C1-38 and ACL racemase. The conversion of 45 mM l-alanine amide was carried out at 30 degrees C for 7 h; l-alanine amide was completely converted to d-alanine, and no l-alanine was detected. The result of successive enzymatic reaction shows that the combination of ACL racemase and DAP can be applied for dynamic kinetic resolution of dl-amino acid amides to yield d-amino acids.

  10. Weak and saturable protein-surfactant interactions in the denaturation of apo-alpha-lactalbumin by acidic and lactonic sophorolipid

    Directory of Open Access Journals (Sweden)

    Kell K Andersen

    2016-11-01

    Full Text Available Biosurfactants are of growing interest as sustainable alternatives to fossil-fuel-derived chemical surfactants, particularly for the detergent industry. To realize this potential, it is necessary to understand how they affect proteins which they may encounter in their applications. However knowledge of such interactions is limited. Here we present a study of the interactions between the model protein apo-alpha-lactalbumin and the biosurfactant sophorolipid (SL produced by the yeast Starmerella bombicola. SL occurs both as an acidic and a lactonic form; the lactonic form (lactSL is sparingly soluble and has a lower critical micelle concentration than the acidic form (acidSL. We show that acidSL affects apo-aLA in a similar way to the related glycolipid biosurfactant rhamnolipid (RL, with the important difference that RL is also active below the cmc in contrast to acidSL. Using isothermal titration calorimetry data, we show that acidSL has weak and saturable interactions with apo-aLA at low concentrations; due to the relatively low cmc of acidSL (which means that the monomer concentration is limited to ca. 0-1 mM SL, it is only possible to observe interactions with monomeric acidSL at high apo-aLA concentrations. However, the denaturation kinetics of apo-aLA in the presence of acidSL are consistent with a collaboration between monomeric and micellar surfactant species, similar to RL and nonionic or zwitterionic surfactants. Inclusion of lactSL as mixed micelles with acidSL lowers the cmc and this effectively reduces the rate of unfolding, emphasizing that SL like other biosurfactants is a gentle anionic surfactant. Our data highlight the potential of these biosurfactants for future use in the detergent industry.

  11. The peroxisome proliferator-activated receptor alpha-selective activator ciprofibrate upregulates expression of genes encoding fatty acid oxidation and ketogenesis enzymes in rat brain.

    Science.gov (United States)

    Cullingford, Tim E; Dolphin, Colin T; Sato, Hitoshi

    2002-04-01

    Activated peroxisome proliferator activated receptor alpha (PPAR alpha) protects against the cellular inflammatory response, and is central to fatty acid-mediated upregulation of the gene encoding the key ketogenic enzyme mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase (mHS). We have previously demonstrated both PPAR alpha and mHS expression in brain, implying that brain-targeted PPAR alpha activators may likewise up-regulate mHS expression in brain. Thus, to attempt pharmacological activation of brain PPAR alpha in vivo, we have administered to rats two drugs with previously defined actions in rat brain, namely the PPAR alpha-selective activator ciprofibrate and the pan-PPAR activator valproate. Using the sensitive and discriminatory RNase protection co-assay, we demonstrate that both ciprofibrate and valproate induce mHS expression in liver, the archetypal PPAR alpha-expressing organ. Furthermore, ciprofibrate potently increases mHS mRNA abundance in rat brain, together with lesser increases in two other PPAR alpha-regulated mRNAs. Thus we demonstrate, for the first time, up-regulation of expression of PPAR alpha-dependent genes including mHS in brain, with implications in the increased elimination of neuro-inflammatory lipids and concomitant increased production of neuro-protective ketone bodies.

  12. Asymmetric Synthesis of Carbon-11 Labelled alpha-Amino Acids for PET

    NARCIS (Netherlands)

    Popkov, Alexander; Elsinga, Philip H.

    2013-01-01

    For PET applications in oncological and neurological diagnostics, amino acids have been studied both clinically and pre-clinically during the last 35 years. Nowadays two applications of labelled amino acids for visualisation of tumours attract the main attention: [C-11] or [F-18]amino acids as

  13. Alpha-Linolenic Acid Intake and 10-Year Incidence of Coronary Heart Disease and Stroke in 20,000 Middle-Aged Men and Women in The Netherlands

    NARCIS (Netherlands)

    Goede, de J.; Verschuren, W.M.M.; Boer, J.M.A.; Kromhout, D.; Geleijnse, J.M.

    2011-01-01

    Background - Whether intake of alpha-linolenic acid (ALA), the plant-derived n-3 polyunsaturated fatty acid (PUFA), could prevent cardiovascular diseases is not yet clear. We examined the associations of ALA intake with 10-year incidence of coronary heart disease (CHD) and stroke in the Netherlands.

  14. Effect of an increased intake of alpha-linolenic acid and group nutritional education on cardiovascular risk factors : the Mediterranean Alpha-linolenic Enriched Groningen Dietary Intervention (MARGARIN) study

    NARCIS (Netherlands)

    Bemelmans, W.J.; Broer, J.; Feskens, E.J.; Smit, A.J.; Muskiet, F.A.; Lefrandt, J.D.; Bom, V.J.; May, J.F.; Meyboom-de Jong, B.

    Background: The effect of long-term increased intakes of alpha-linolenic acid (ALA; 18:3n-3) on cardiovascular risk factors is unknown. Objectives: Our objectives were to assess the effect of increased ALA intakes on cardiovascular risk factors and the estimated risk of ischemic heart disease (IHD)

  15. Oxygen evolution on alpha-lead dioxide electrodes in methanesulfonic acid

    International Nuclear Information System (INIS)

    Oury, Alexandre; Kirchev, Angel; Bultel, Yann

    2012-01-01

    Highlights: ► Oxygen evolution on α-PbO 2 in methanesulfonic acid medium. ► The reaction kinetics is slower in MSA than in sulphuric acid. ► The hydrated lead dioxide layer affects the reaction kinetics. ► A high MSA concentration leads to lower O 2 evolution. - Abstract: This work examines the oxygen evolution reaction (OER) taking place on α-PbO 2 electrode in methanesulfonic acid (MSA) medium and in sulphuric acid as a comparison, by means of cyclic voltammetry (CVA) and electrochemical impedance spectroscopy (EIS), for soluble lead acid flow battery applications. The influence of MSA concentration on OER is studied. EIS measurements highlighted the impact of the hydrated lead dioxide layer upon decreasing MSA or sulphuric acid concentration. The evolution of the Tafel curves plotted from EIS measurements and quasi-stationary currents while varying acid concentration was interpreted in the light of this hydrated layer which could enhance the electrocatalytic activity when it is thin, and on the contrary act as an electronic barrier when growing for low acid concentration. Both EIS and CVA revealed that OER on lead dioxide is less favoured in MSA than in sulphuric acid. It is finally concluded that a high-concentrated MSA electrolyte is better for lead acid flow battery application in terms of oxygen evolution.

  16. Corrosion inhibition of mild steel in 1 M HCl solution by henna extract: A comparative study of the inhibition by henna and its constituents (Lawsone, Gallic acid, {alpha}-D-Glucose and Tannic acid)

    Energy Technology Data Exchange (ETDEWEB)

    Ostovari, A. [Technical Inspection Engineering Department, Petroleum University of Technology, Abadan (Iran, Islamic Republic of)], E-mail: A.Ostovari@gmail.com; Hoseinieh, S.M.; Peikari, M. [Technical Inspection Engineering Department, Petroleum University of Technology, Abadan (Iran, Islamic Republic of); Shadizadeh, S.R. [Petroleum Engineering Department, Petroleum University of Technology, Abadan (Iran, Islamic Republic of); Hashemi, S.J. [Technical Inspection Engineering Department, Petroleum University of Technology, Abadan (Iran, Islamic Republic of)

    2009-09-15

    The inhibitive action of henna extract (Lawsonia inermis) and its main constituents (lawsone, gallic acid, {alpha}-D-Glucose and tannic acid) on corrosion of mild steel in 1 M HCl solution was investigated through electrochemical techniques and surface analysis (SEM/EDS). Polarization measurements indicate that all the examined compounds act as a mixed inhibitor and inhibition efficiency increases with inhibitor concentration. Maximum inhibition efficiency (92.06%) is obtained at 1.2 g/l henna extract. Inhibition efficiency increases in the order: lawsone > henna extract > gallic acid > {alpha}-D-Glucose > tannic acid. Also, inhibition mechanism and thermodynamic parameters are discussed.

  17. Mechanistic studies of catalytic hydrogenation: gas tritiation and deuteration of 2-acetamidoacrylic acid and alpha-acetamidocinnamic acid

    International Nuclear Information System (INIS)

    Tang, Y.S.; Morimoto, H.; Un, S.; Rapoport, H.

    1986-01-01

    The difference of labeling in heterogeneous catalytic gas tritiations of 2-acetamidocinnamic acid and 2-acetamidoacrylic acid is demonstrated by 3 H NMR spectroscopy. The nonequivalent addition of tritium to the double bond of 2-acetamidoacrylic acid is due to simultaneous hydrogen-tritium exchange during adsorption on the catalyst surface. A new mechanistic interpretation has been proposed to explain the behavior of this substrate. These conclusions were substantiated by mass spectrometry results obtained using D 2 and deuterated solvents. Steric effects on vinylic exchange studied by GLRC were also reported. 2 refs.; 6 figs.; 3 tabs

  18. Effect of omega-3 fatty acids on kidney function after myocardial infarction: The Alpha Omega Trial

    NARCIS (Netherlands)

    Hoogeveen, E.K.; Geleijnse, J.M.; Kromhout, D.; Stijnen, T.; Gemen, E.F.; Kusters, R.; Giltay, E.J.

    2014-01-01

    Background and objectives Kidney function gradually decreases with age, and myocardial infarction accelerates this deterioration. Omega-3 (n-3) fatty acids may slow down the decline of kidney function. The effect of marine and plant-derived n-3 fatty acids on kidney function in patients after

  19. Chemical conversion of alpha-Keto acids in relation to flavour formation in fermented foods

    NARCIS (Netherlands)

    Smit, B.A.; Engels, W.J.M.; Alewijn, M.; Lommerse, G.; Kippersluijs, E.A.H.; Wouters, J.T.M.; Smit, G.

    2004-01-01

    Formation of flavor compounds from branched-chain -keto acids in fermented foods such as cheese is believed to be mainly an enzymatic process, while the conversion of phenyl pyruvic acid, which is derived from phenylalanine, also proceeds chemically. In this research, the chemical conversion of

  20. A New alpha-Glucosidase Inhibitor, 10-Hydroxy-8(E)-Octadecenoic Acid

    Science.gov (United States)

    In our continuous effort to screen natural products for their anti-microbial and enzyme inhibitor activities, we found that 10-Hydroxy-8(E)-Octadecenoic acid (HOD) exhibited strong anti- a-glucosidase (EC 3.2.1.20) activity. HOD is an intermediate in the bioconversion of oleic acid to 7,10-dihydrox...

  1. Spectroscopic and thermodynamic studies on ferulic acid - Alpha-2-macroglobulin interaction

    Science.gov (United States)

    Rehman, Ahmed Abdur; Sarwar, Tarique; Arif, Hussain; Ali, Syed Saqib; Ahsan, Haseeb; Tabish, Mohammad; Khan, Fahim Halim

    2017-09-01

    Ferulic acid is a major phenolic acid found in numerous plant species in conjugated form. It binds to enzymes and oligomeric proteins and modifies their structure and function. This study was designed to examine the interaction of ferulic acid, an active ingredient of some important medicines, with α2M, a key serum proteinase, under physiological conditions. The mechanism of interaction was studied by spectroscopic techniques such as, UV-visible absorption, fluorescence spectroscopy, circular dichroism along with isothermal titration calorimetry. Fluorescence quenching of α2M by ferulic acid demonstrated the formation of α2M-ferulic acid complex by static quenching mechanism. Binding parameters calculated by Stern-Volmer method showed that ferulic acid binds to α2M with moderate affinity of the order of ∼104 M-1. The thermodynamic signatures reveal that binding was enthalpy driven and hydrogen bonding played a major role in ferulic acid-α2M binding. CD spectra analysis suggests very little conformational changes in α2M on ferulic acid binding.

  2. Response of Substituted Indoleacetic Acids in the Indolo-alpha-pyrone Fluorescence Determination

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen; Böttger, M.; Kaiser, P.

    1978-01-01

    .-pyrones. Other halogenated indoleacetic acids show between zero and 60% of the fluorescence of IAA. Apparently the concentration of IAA cannot be determined in crude extracts in the presence of 4-chloro- or 5-hydroxy-indoleacetic acid, because separate determinations of each of these compounds are not possible...

  3. An effective route to fluorine containing asymmetric alpha-aminophosphonates using chiral Bronsted acid catalyst.

    Science.gov (United States)

    Bhadury, Pinaki S; Zhang, Yuping; Zhang, Sha; Song, Baoan; Yang, Song; Hu, Deyu; Chen, Zhuo; Xue, Wei; Jin, Linhong

    2009-05-01

    Asymmetric addition of dialkyl phosphites (--CH2CH3, --CH2CH2CH3, --CH(CH3)2, --CH2(CH2)3CH3, --CH2CH2OCH3 and --CH2CH2OC2H5) induced by chiral organocatalyst e.g. (R)- and (S)-3,3'-[3,5-bis(trifluoromethyl)phenyl]2-1,1'-binaphthyl phosphate on fluorinated aldimines derived from cinnamaldehyde has been found effective to give new bioactive alpha-aminophosphonates in good yields (58-73%) and high enantiomeric excess (64.6%-90.6%) under mild conditions.

  4. Sorption of acetaminophen, 17alpha-ethynyl estradiol, nalidixic acid, and norfloxacin to silica, alumina. and a hydrophobic medium.

    Science.gov (United States)

    Lorphensri, Oranuj; Intravijit, Jittipong; Sabatini, David A; Kibbey, Tohren C G; Osathaphan, Khemarath; Saiwan, Chintana

    2006-04-01

    Two pure minerals and a hydrophobic medium were selected to study sorption of pharmaceuticals. The sorption of four pharmaceuticals, acetaminophen (analgesic), 17alpha-ethynyl estradiol (synthetic hormone), nalidixic acid (antibiotic), and norfloxacin (antibiotic), was evaluated with silica, alumina, and Porapak P (a hydrophobic medium). Alumina and silica were selected to represent positively charged and negatively charged aquifer mineral surfaces at neutral pH, respectively, while Porapak P was selected to represent the hydrophobic organic content of an aquifer medium. At neutral pH, acetaminophen, the least hydrophobic pharmaceutical, showed no significant sorption to any of the media, while 17alpha-ethynyl estradiol, the most hydrophobic pharmaceutical, showed significant sorption to Porapak P. Nalidixic acid, which has a carboxyl functional group that is anionic at neutral pH, showed significant adsorption to the positively charged alumina. Norfloxacin, with both a carboxyl (anionic) and a piperazynyl (cationic) group, can exist in four forms (neutral, cationic, anionic, and zwitterionic) depending on the aqueous pH. Norfloxacin also showed significant adsorption than nalidixic acid. Both nalidixic acid and norfloxacin adsorbed to silica and Porapak P to a much lower extent. The pH dependence of nalidixic acid and norfloxacin adsorption to silica and alumina was also studied by varying the pH between 4 and 11. The maximum adsorption of nalidixic acid to alumina occurred near its pKa (pH approximately 6), where the combination of cationic alumina and anionic nalidixic produced maximum adsorption. The maximum adsorption of norfloxacin to alumina was observed at pH approximately 7, which was the region where the zwitterionic form dominated. This research demonstrates that the adsorption of ionizable pharmaceuticals is strongly dependent on the system pH, the pharmaceutical properties (pKa and hydrophobicity), and the nature of the surface charge (point of zero

  5. Growth arrest and decrease of alpha-SMA and type I collagen expression by palmitic acid in the rat hepatic stellate cell line PAV-1.

    Science.gov (United States)

    Abergel, Armand; Sapin, Vincent; Dif, Nicolas; Chassard, Christophe; Darcha, Claude; Marcand-Sauvant, Julie; Gaillard-Martinie, Brigitte; Rock, Edmond; Dechelotte, Pierre; Sauvant, Patrick

    2006-05-01

    Liver fibrosis is characterized by an activation of hepatic stellate cells (HSC). During primary culture HSC evolve from a quiescent into an activated phenotype which is characterized by alpha-smooth muscle actin (alpha-SMA) up-regulation, increase in cell growth, and extracellular matrix secretion. HSC culture with trans-resveratrol can lead to deactivation of myofibroblast-like HSC. We used an HSC line, PAV-1, to check the role of retinol and palmitic acid in the deactivation process of HSC. Using mass and metabolic-based methods, Western blot and immunocytochemistry assays, we demonstrated that treatment with palmitic acid (75 muM) alone or in combination with retinol (2 muM) significantly decreased cell proliferation and alpha-SMA expression. We also established that the association of both compounds strongly decreased collagen type I expression. Our results suggest the potential use of palmitic acid alone or in combination with retinol to induce HSC deactivation.

  6. Vegetable oils rich in alpha linolenic acid increment hepatic n-3 LCPUFA, modulating the fatty acid metabolism and antioxidant response in rats.

    Science.gov (United States)

    Rincón-Cervera, Miguel Ángel; Valenzuela, Rodrigo; Hernandez-Rodas, María Catalina; Barrera, Cynthia; Espinosa, Alejandra; Marambio, Macarena; Valenzuela, Alfonso

    2016-08-01

    Alpha-linolenic acid (C18:3 n-3, ALA) is an essential fatty acid and the metabolic precursor of long-chain polyunsaturated fatty acids (LCPUFA) from the n-3 family with relevant physiological and metabolic roles: eicosapentaenoic acid (C20:5 n-3, EPA) and docosahexaenoic acid (C22:6 n-3, DHA). Western diet lacks of suitable intake of n-3 LCPUFA and there are recommendations to increase the dietary supply of such nutrients. Seed oils rich in ALA such as those from rosa mosqueta (Rosa rubiginosa), sacha inchi (Plukenetia volubis) and chia (Salvia hispanica) may constitute an alternative that merits research. This study evaluated hepatic and epididymal accretion and biosynthesis of n-3 LCPUFA, the activity and expression of Δ-5 and Δ-6 desaturase enzymes, the expression and DNA-binding activity of PPAR-α and SREBP-1c, oxidative stress parameters and the activity of antioxidative enzymes in rats fed sunflower oil (SFO, 1% ALA) as control group, canola oil (CO, 10% ALA), rosa mosqueta oil (RMO, 33% ALA), sacha inchi oil (SIO, 49% ALA) and chia oil (ChO, 64% ALA) as single lipid source. A larger supply of ALA increased the accretion of n-3 LCPUFA, the activity and expression of desaturases, the antioxidative status, the expression and DNA-binding of PPAR-α, the oxidation of fatty acids and the activity of antioxidant enzymes, whereas the expression and DNA-binding activity of SREBP-1c transcription factor and the biosynthetic activity of fatty acids declined. Results showed that oils rich in ALA such as SIO and ChO may trigger metabolic responses in rats such as those produced by n-3 PUFA. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Copper(II) 12-metallacrown-4 complexes of alpha-, beta- and gamma-aminohydroxamic acids: a comparative thermodynamic study in aqueous solution.

    Science.gov (United States)

    Tegoni, Matteo; Remelli, Maurizio; Bacco, Dimitri; Marchiò, Luciano; Dallavalle, Francesco

    2008-05-28

    A complete thermodynamic study of the protonation and Cu(II) complex formation equilibria of a series of alpha- and beta-aminohydroxamic acids in aqueous solution was performed. The thermodynamic parameters obtained for the protonation of glycine-, (S)-alpha-alanine-, (R,S)-valine-, (S)-leucine-, beta-alanine- and (R)-aspartic-beta-hydroxamic acids were compared with those previously reported for gamma-amino- and (S)-glutamic-gamma-hydroxamic acids. The enthalpy/entropy parameters calculated for the protonation microequilibria of these three types of ligands are in very good agreement with the literature values for simple amines and hydroxamic acids. The pentanuclear complexes [Cu5L4H(-4)]2+ contain the ligands acting as (NH2,N-)-(O,O-) bridging bis-chelating and correspond to 12-metallacrown-4 (12-MC-4) which are formed by self-assembly between pH 4 and 6 with alpha-aminohydroxamates (HL), while those with beta- and gamma-derivatives exist in a wider pH range (4-11). The stability order of these metallomacrocycles is beta- > alpha- > gamma-aminohydroxamates. The formation of 12-MC-4 with alpha-aminohydroxamates is entropy-driven, and that with beta-derivatives is enthalpy-driven, while with gamma-GABAhydroxamate both effects occur. These results are interpreted on the basis of specific enthalpies or entropy contributions related to chelate ring dimensions, charge neutralization and solvation-desolvation effects. The enthalpy/entropy parameters of 12-MC-4 with alpha-aminohydroxamic acids considered are also dependent on the optical purity of the ligands. Actually, that with (R,S)-valinehydroxamic acid presents an higher entropy and a lower enthalpy value than those of enantiopure ligands, although the corresponding stabilities are almost equivalent. Moreover, DFT calculations are in agreement with a more exothermic enthalpy found for metallacrowns with enantiomerically pure ligands.

  8. [(3)H]Epibatidine photolabels non-equivalent amino acids in the agonist binding site of Torpedo and alpha4beta2 nicotinic acetylcholine receptors.

    Science.gov (United States)

    Srivastava, Shouryadeep; Hamouda, Ayman K; Pandhare, Akash; Duddempudi, Phaneendra K; Sanghvi, Mitesh; Cohen, Jonathan B; Blanton, Michael P

    2009-09-11

    Nicotinic acetylcholine receptor (nAChR) agonists, such as epibatidine and its molecular derivatives, are potential therapeutic agents for a variety of neurological disorders. In order to identify determinants for subtype-selective agonist binding, it is important to determine whether an agonist binds in a common orientation in different nAChR subtypes. To compare the mode of binding of epibatidine in a muscle and a neuronal nAChR, we photolabeled Torpedo alpha(2)betagammadelta and expressed human alpha4beta2 nAChRs with [(3)H]epibatidine and identified by Edman degradation the photolabeled amino acids. Irradiation at 254 nm resulted in photolabeling of alphaTyr(198) in agonist binding site Segment C of the principal (+) face in both alpha subunits and of gammaLeu(109) and gammaTyr(117) in Segment E of the complementary (-) face, with no labeling detected in the delta subunit. For affinity-purified alpha4beta2 nAChRs, [(3)H]epibatidine photolabeled alpha4Tyr(195) (equivalent to Torpedo alphaTyr(190)) in Segment C as well as beta2Val(111) and beta2Ser(113) in Segment E (equivalent to Torpedo gammaLeu(109) and gammaTyr(111), respectively). Consideration of the location of the photolabeled amino acids in homology models of the nAChRs based upon the acetylcholine-binding protein structure and the results of ligand docking simulations suggests that epibatidine binds in a single preferred orientation within the alpha-gamma transmitter binding site, whereas it binds in two distinct orientations in the alpha4beta2 nAChR.

  9. Incorporation of conjugated linoleic and alpha linolenic fatty acids into Pimedolus maculatus fillets

    Directory of Open Access Journals (Sweden)

    Ana Beatriz Zanqui

    2013-09-01

    Full Text Available The objective of this study was to investigate the fatty acid composition of Pimedolus maculatus fillets of fish fed with different diets. The fish were submitted to an adaptation period (over 30 days and fed only a control diet (diet I. After this period, the fish were divided into two groups: one group received a diet enriched with flaxseed oil (diet II, and the other received a diet enriched with conjugated linoleic acid (CLA (diet III. Subsequent collections were undertaken after 25 and 50 days. Compared to the control samples, fish fed diet II showed an increase in concentrations of total fatty acid omega-3 (n-3 in the fillets, with an improvement ratio of n-6/n-3. The incorporation of CLA into fish fed diet III was successful. Supplementing the diet of Pimedolus maculatus with CLA and flaxseed oil led to improvements in nutritional quality and fatty acid profile of the fish fillets.

  10. Lipid metabolic dose response to dietary alpha-linolenic acid in monk parrot (Myiopsitta monachus).

    Science.gov (United States)

    Petzinger, Christina; Heatley, J J; Bailey, Christopher A; Bauer, John E

    2014-03-01

    Monk parrots (Myiopsitta monachus) are susceptible to atherosclerosis, a progressive disease characterized by the formation of plaques in the arteries accompanied by underlying chronic inflammation. The family of n-3 fatty acids, especially eicosapentaenoic acid (20:5n-3, EPA) and docosahexaenoic acid (22:6n-3, DHA), have consistently been shown to reduce atherosclerotic risk factors in humans and other mammals. Some avian species have been observed to convert α-linolenic acid (18:3n-3, ALA) to EPA and DHA (Htin et al. in Arch Geflugelk 71:258-266, 2007; Petzinger et al. in J Anim Physiol Anim Nutr, 2013). Therefore, the metabolic effects of including flaxseed oil, as a source of ALA, in the diet at three different levels (low, medium, and high) on the lipid metabolism of Monk parrots was evaluated through measuring plasma total cholesterol (TC), free cholesterol (FC), triacylglycerols (TAG), and phospholipid fatty acids. Feed intake, body weight, and body condition score were also assessed. Thus the dose and possible saturation response of increasing dietary ALA at constant linoleic acid (18:2n-6, LNA) concentration on lipid metabolism in Monk parrots (M. monachus) was evaluated. Calculated esterified cholesterol in addition to plasma TC, FC, and TAG were unaltered by increasing dietary ALA. The high ALA group had elevated levels of plasma phospholipid ALA, EPA, and docosapentaenoic acid (DPAn-3, 22:5n-3). The medium and high ALA groups had suppressed plasma phospholipid 20:2n-6 and adrenic acid (22:4n-6, ADA) compared to the low ALA group. When the present data were combined with data from a previous study (Petzinger et al. in J Anim Physiol Anim Nutr, 2013) a dose response to dietary ALA was observed when LNA was constant. Plasma phospholipid ALA, EPA, DPAn-3, DHA, and total n-3 were positively correlated while 20:2n-6, di-homo-gamma-linoleic acid (20:3n-6Δ7), arachidonic acid (20:4n-6), ADA, and total n-6 were inversely correlated with dietary en% ALA.

  11. Synthesis of. cap alpha. - and. beta. - Nor - lapachones, its properties in acid media and its reaction with N-bromosuccinamide

    Energy Technology Data Exchange (ETDEWEB)

    Pinto, A.V.; Pinto, M.doC.R.; de Oliveira, C.G.T. (Rio de Janeiro Univ. (Brazil). Nucleo de Pesquisas de Produtos Naturais; Universidade Federal Fluminense, Niteroi (Brazil). Inst. de Quimica)

    1982-03-01

    ..cap alpha..-nor-lapachone 4 and ..beta..-nor-lapachone 5 are obtained from nor-lapachol 6 by cyclization reactions using hydrochloric acid in AcOH for the first one and sulfuric acid for the latter. The compounds 4 and 5 are obtained in high yields. On the acid conditions the isomers are interchangeable, this approach is described in scheme II. Chemical reactions have been done with the derivatives 4 and 5 with N-bromosuccinamide, in carbon tetracloride and benzene. These two isomers have shown different chemical behavior, and this difference could be related to the quinoidal structure. Thus, in Cl/sub 4/, 4 reacted with one equivalent of NBS giving the expected product 8 (allyclic bromination). The ..beta..-isomer 5 furnished the product II and required two equivalents of the NBS for complete consumption of the starting material. Using benzene, as solvent, it is observed an anomalous behaviour in the reaction. Schemes IV and VI show the proposed mechanisms for the reaction products according to the hitherto evidence.

  12. Incorporation of alpha-Ketoglutaric Acid as a Fixed Bed Scrubber Media for the Neutralization of Hydrazine Family Hypergolic Fuels

    Science.gov (United States)

    DeVor, R. W.; Santiago-Maldonado, E.; Parkerson, J. K.

    2010-01-01

    A candidate scrubber media, alpha-ketoglutaric acid (aKGA) adsorbed onto a silica-based substrate was examined as a potential alternative to the hydrazine-family hypergolic fuel neutralization techniques currently utilized at NASA/Kennedy Space Center (KSC). Helvenson et. al. has indicated that aKGA will react with hydrazines to produce non-hazardous, possibly biodegradable products. Furthermore, the authors have previously tested and demonstrated the use of aKGA aqueous solutions as a replacement neutralizing agent for citric acid, which is currently used as a scrubbing agent in liquid scrubbers at KSC. Specific properties examined include reaction efficiency, the loading capacity of aKGA onto various silica substrates, and the comparison of aKGA media performance to that of the citric acid vapor scrubber systems at KSC and a commercial vapor scrubber media. Preliminary investigations showed hydrophobic aerogel particles to be an ideal substrate for the deposition of the aKGA. Current studies have shown that the laboratory produced aKGA-Aerogel absorbent media are more efficient and cost effective than a commercially available fixed bed scrubber media, although much less cost effective than liquid-based citric acid scrubbers (although possibly safer and less labor intensive). A comparison of all three alternative scrubber technologies (liquid aKGA, solid-phase aKGA, and commercially available sorbent materials) is given considering both hypergolic neutralization capabilities and relative costs (as compared to the current citric acid scrubbing technology in use at NASA/KSC).

  13. Efficacy and safety of a new superficial chemical peel using alpha-hydroxy acid, vitamin C and oxygen for melasma.

    Science.gov (United States)

    Kim, Won-Serk

    2013-02-01

    Facial skin pigmentary disorders can be resistant to conventional treatment. Superficial chemical peel is an effective and safe treatment in pigmentary problems including melasma, post-inflammatory hyperpigmentation and aging spots. To assess the efficacy and safety of new superficial chemical peel (Melasma peel, Theraderm®), this is composed of alpha-hydroxy acid (AHAs), vitamin C and oxygen for melasma. Twenty-five ethnic Korean patients (Fitzpatrick skin phototypes IV and V) with moderate to severe melasma were enrolled. The patients underwent four treatments at 1-2-week intervals for 8 weeks. Clinical improvement was evaluated on a 5-point scale by participants and by the same dermatologist, and adverse effects were checked during the study. Improvement in the degree of pigmentation, pores, and evenness were noted. Significant clinical improvement of hyperpigmentation was evident. No adverse effects were reported. New superficial chemical peel using AHAs, vitamin C and oxygen is an effective and very safe treatment for melasma.

  14. Empiric mathematical model for predicting the content of alpha-acids in hop (Humulus lupulus L.) cv. Aurora.

    Science.gov (United States)

    Srečec, Siniša; Ceh, Barbara; Ciler, Tanja Savić; Rus, Alenka Ferlež

    2013-12-01

    The aim of this research is to find a simple mathematical model due to sum of effective temperatures and rainfalls from second germination after spring pruning till the technological maturity of hop cones, in order to achieve reliable prognosis of alpha-acids content in hop cv. Aurora. After mathematical analyses of experimental data by Eurequa Formulize 0.96 Beta software 17 equations were offered, and after substituting the values of dependent and independent variables in all equations only one equation was chosen with p = 0.034 (pmaturity of hop cones. Coefficients k 1 , k 2 and k 3 are determined for cultivar Aurora (53.8, 453 and 1.33, respectively).

  15. Highly glycosylated alpha1-acid glycoprotein is synthesized in myelocytes, stored in secondary granules, and released by activated neutrophils

    DEFF Research Database (Denmark)

    Theilgaard-Mönch, Kim; Jacobsen, Lars C; Rasmussen, Thomas

    2005-01-01

    enriched in promyelocytes, myelocytes/metamyelocytes (MYs), and BM neutrophils. These analyses demonstrated a transient, high mRNA expression of genuine secondary/tertiary granule proteins and AGP in MYs. In agreement with this, immunocytochemistry revealed the presence of AGP protein and the secondary...... granule protein lactoferrin in cells from the MY stage and throughout granulocytic differentiation. Immunoelectron microscopy demonstrated the colocalization of AGP and lactoferrin in secondary granules of neutrophils. This finding was substantiated by the failure to detect AGP and lactoferrin in blood......Alpha-1-acid glycoprotein (AGP) is an acute-phase protein produced by hepatocytes and secreted into plasma in response to infection/injury. We recently assessed the transcriptional program of terminal granulocytic differentiation by microarray analysis of bone marrow (BM) populations highly...

  16. An antiaging skin care system containing alpha hydroxy acids and vitamins improves the biomechanical parameters of facial skin

    Directory of Open Access Journals (Sweden)

    Tran D

    2014-12-01

    Full Text Available Diana Tran, Joshua P Townley, Tanya M Barnes, Kerryn A Greive Ego Pharmaceuticals, Braeside, Victoria, Australia Background: The demand for antiaging products has dramatically increased in recent years, driven by an aging population seeking to maintain the appearance of youth. This study investigates the effects of an antiaging skin care system containing alpha hydroxy acids (AHAs in conjunction with vitamins B3, C, and E on the biomechanical parameters of facial skin. Methods: Fifty two volunteers followed an antiaging skin care regimen comprising of cleanser, eye cream, day moisturizer, and night moisturizer for 21 days. Wrinkle depth (Ry and skin roughness (Ra were measured by skin surface profilometry of the crow's feet area, and skin elasticity parameters R2 (gross elasticity, R5 (net elasticity, R6 (viscoelastic portion, and R7 (recovery after deformation were determined for facial skin by cutometer, preapplication and after 7, 14, and 21 days. Volunteers also completed a self-assessment questionnaire. Results: Compared to baseline, Ry and Ra significantly improved by 32.5% (P<0.0001 and 42.9% (P<0.0001, respectively, after 21 days of antiaging skin care treatment. These results were observed by the volunteers with 9 out of 10 discerning an improvement in skin texture and smoothness. Compared to baseline, R2 and R5 significantly increased by 15.2% (P<0.0001 and 12.5% (P=0.0449, respectively, while R6 significantly decreased by 17.7% (P<0.0001 after 21 days. R7 increased by 9.7% after 21 days compared to baseline but this was not significant over this time period. Conclusion: An antiaging skin care system containing AHAs and vitamins significantly improves the biomechanical parameters of the skin including wrinkles and skin texture, as well as elasticity without significant adverse effects. Keywords: alpha hydroxy acids, antiaging, nicotinamide, vitamin C, vitamin E, profilometry, cutometer

  17. Short-term supplementation of low-dose gamma-linolenic acid (GLA), alpha-linolenic acid (ALA), or GLA plus ALA does not augment LCP omega 3 status of Dutch vegans to an appreciable extent

    NARCIS (Netherlands)

    Fokkema, M R; Brouwer, D A; Hasperhoven, M B; Martini, I A; Muskiet, F A

    2000-01-01

    Vegans do not consume meat and fish and have therefore low intakes of long chain polyunsaturated fatty acids (LCP). They may consequently have little negative feedback inhibition from dietary LCP on conversion of alpha -linolenic acid (ALA) to the LCP omega 3 eicosapentaenoic (EPA) and

  18. Detection of PML-retinoic acid receptor-alpha fusion transcripts in acute promyelocytic leukemia with trisomy 8 but without t(15;17).

    Science.gov (United States)

    Ikeda, K; Sasaki, K; Tasaka, T; Nagai, M; Kawanishi, K; Takahara, J; Irino, S

    1994-03-01

    Chromosome translocation t(15;17), the breakpoints of which are in the PML gene on chromosome 15 and retinoic acid receptor-alpha (RAR alpha) gene on chromosome 17, is specifically found in acute promyelocytic leukemia (APL). Clinically typical APL without t(15;17) and with the PML-RAR alpha fusion transcripts or rearrangements in PML and/or RAR alpha gene has been reported, suggesting submicroscopic changes at the molecular level without apparent t(15;17) or observation of normal metaphases. Trisomy 8 is common in APL as a secondary chromosomal abnormality in addition to t(15;17), as well as in acute myelogenous leukemia in general, but it is rare as a sole chromosomal anomaly in APL. PML-RAR alpha fusion transcript was detected in an APL case with trisomy 8 but without t(15;17), indicating that the leukemic cells lacked t(15;17) and still expressed the PML-RAR alpha fusion transcripts. This indicates that the same submicroscopic molecular changes as in APL with t(15;17) do occur in APL without t(15;17) and supports the use of molecular analysis for PML-RAR alpha fusion in APL.

  19. Oleic acid and peanut oil high in oleic acid reverse the inhibitory effect of insulin production of the inflammatory cytokine TNF-alpha both in vitro and in vivo systems.

    Science.gov (United States)

    Vassiliou, Evros K; Gonzalez, Andres; Garcia, Carlos; Tadros, James H; Chakraborty, Goutam; Toney, Jeffrey H

    2009-06-26

    Chronic inflammation is a key player in pathogenesis. The inflammatory cytokine, tumor necrosis factor-alpha is a well known inflammatory protein, and has been a therapeutic target for the treatment of diseases such as Rheumatoid Arthritis and Crohn's Disease. Obesity is a well known risk factor for developing non-insulin dependent diabetes melitus. Adipose tissue has been shown to produce tumor necrosis factor-alpha, which has the ability to reduce insulin secretion and induce insulin resistance. Based on these observations, we sought to investigate the impact of unsaturated fatty acids such as oleic acid in the presence of TNF-alpha in terms of insulin production, the molecular mechanisms involved and the in vivo effect of a diet high in oleic acid on a mouse model of type II diabetes, KKAy. The rat pancreatic beta cell line INS-1 was used as a cell biological model since it exhibits glucose dependent insulin secretion. Insulin production assessment was carried out using enzyme linked immunosorbent assay and cAMP quantification with competitive ELISA. Viability of TNF-alpha and oleic acid treated cells was evaluated using flow cytometry. PPAR-gamma translocation was assessed using a PPRE based ELISA system. In vivo studies were carried out on adult male KKAy mice and glucose levels were measured with a glucometer. Oleic acid and peanut oil high in oleic acid were able to enhance insulin production in INS-1. TNF-alpha inhibited insulin production but pre-treatment with oleic acid reversed this inhibitory effect. The viability status of INS-1 cells treated with TNF-alpha and oleic acid was not affected. Translocation of the peroxisome proliferator- activated receptor transcription factor to the nucleus was elevated in oleic acid treated cells. Finally, type II diabetic mice that were administered a high oleic acid diet derived from peanut oil, had decreased glucose levels compared to animals administered a high fat diet with no oleic acid. Oleic acid was found to

  20. Phytanic acid alpha-oxidation: accumulation of 2-hydroxyphytanic acid and absence of 2-oxophytanic acid in plasma from patients with peroxisomal disorders

    NARCIS (Netherlands)

    ten Brink, H. J.; Schor, D. S.; Kok, R. M.; Poll-The, B. T.; Wanders, R. J.; Jakobs, C.

    1992-01-01

    A stable isotope dilution method was developed for the measurement of 2-hydroxyphytanic acid and 2-oxophytanic acid in plasma. In plasma from healthy individuals and from patients with Refsum's disease, 2-hydroxyphytanic acid was found at levels less than 0.2 mumol/l, whereas the acid accumulated in

  1. Novel Type of alpha-Amino Acid Derived Imidazolium Ionic Liquids

    Czech Academy of Sciences Publication Activity Database

    Marek, Aleš; Bureš, F.; Kulhánek, J.

    2014-01-01

    Roč. 46, č. 21 (2014), s. 2937-2944 ISSN 0039-7881 Institutional support: RVO:61388963 Keywords : chiral ionic liquids * amino acid * imidazole * imidazolium salts * chiral pool Subject RIV: CC - Organic Chemistry Impact factor: 2.689, year: 2014

  2. Chondrogenic potential of macroporous biodegradable cryogels based on synthetic poly(.alpha.-amino acids)

    Czech Academy of Sciences Publication Activity Database

    Sedlačík, Tomáš; Acar, O. K.; Studenovská, Hana; Kotelnikov, Ilya; Kučka, Jan; Konečná, Z.; Zikmund, T.; Kaiser, J.; Köse, G. T.; Rypáček, František

    2018-01-01

    Roč. 14, č. 2 (2018), s. 228-238 ISSN 1744-683X Institutional support: RVO:61389013 Keywords : poly(amino acids) * cryogelation * scaffold Subject RIV: CD - Macromolecular Chemistry OBOR OECD: Polymer science Impact factor: 3.889, year: 2016

  3. The Effects of Ppar Delta and Alpha Agonist on Fatty Acid and ...

    African Journals Online (AJOL)

    The peroxisome proliferator-activated receptors of the nuclear receptor superfamily are het-erodimers with the 9-cis retinoic acid receptor and bind to specific peroxisome proliferators re-sponse elements to regulate the transcription of their target genes resulting in the regulation of lipid, metabolism, glucose homeostasis ...

  4. Elaidic acid sustains LPS and TNF-alpha induced ICAM-1 and VCAM-I expression on human bone marrow endothelial cells (HBMEC).

    Science.gov (United States)

    Sanadgol, Nima; Mostafaie, Ali; Bahrami, Gholamreza; Mansouri, Kamran; Ghanbari, Fariba; Bidmeshkipour, Ali

    2010-08-01

    Elaidic acid, the predominant trans-fatty acid in industrially hydrogenated oils, exists on high levels in Iranian hydrogenated oils and margarines. This study was undertaken to investigate the effect of elaidic acid and its cis-counterpart oleic acid on expression of ICAM-1 and VCAM-1 on human bone marrow endothelial cells (HBMECs). HBMEC were pre-treated with TNF-alpha or LPS for induction of the adhesion molecules expression, and then treated with elaidic acid or oleic acid. Soluble and cell associated forms of ICAM-1 and VCAM-1 were quantified by ELISA and Western blot. Our findings indicated that oleic acid suppresses VCAM-1 and ICAM-1 expression on HBMEC near to the basal level. Conversely, elaidic acid maintained the level of VCAM-1 and ICAM-1 up-regulated by TNF-alpha or LPS. It is suggested that elaidic acid could keep the HBMEC at the stimulated phenotype. These findings provide further support on the detrimental effects of elaidic acid in promotion and induction of cardiovascular diseases (CVD). 2010 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  5. Modulation of phenytoin teratogenicity and embryonic covalent binding by acetylsalicylic acid, caffeic acid, and alpha-phenyl-N-t-butylnitrone: implications for bioactivation by prostaglandin synthetase

    International Nuclear Information System (INIS)

    Wells, P.G.; Zubovits, J.T.; Wong, S.T.; Molinari, L.M.; Ali, S.

    1989-01-01

    Teratogenicity of the anticonvulsant drug phenytoin is thought to involve its bioactivation by cytochromes P-450 to a reactive arene oxide intermediate. We hypothesized that phenytoin also may be bioactivated to a teratogenic free radical intermediate by another enzymatic system, prostaglandin synthetase. To evaluate the teratogenic contribution of this latter pathway, an irreversible inhibitor of prostaglandin synthetase, acetylsalicylic acid (ASA), 10 mg/kg intraperitoneally (ip), was administered to pregnant CD-1 mice at 9:00 AM on Gestational Days 12 and 13, 2 hr before phenytoin, 65 mg/kg ip. Other groups were pretreated 2 hr prior to phenytoin administration with either the antioxidant caffeic acid or the free radical spin trapping agent alpha-phenyl-N-t-butylnitrone (PBN). Caffeic acid and PBN were given ip in doses that respectively were up to 1.0 to 0.05 molar equivalents to the dose of phenytoin. Dams were killed on Day 19 and the fetuses were assessed for teratologic anomalies. A similar study evaluated the effect of ASA on the in vivo covalent binding of radiolabeled phenytoin administered on Day 12, in which case dams were killed 24 hr later on Day 13. ASA pretreatment produced a 50% reduction in the incidence of fetal cleft palates induced by phenytoin (p less than 0.05), without significantly altering the incidence of resorptions or mean fetal body weight. Pretreatment with either caffeic acid or PBN resulted in dose-related decreases in the incidence of fetal cleft palates produced by phenytoin, with maximal respective reductions of 71 and 82% at the highest doses of caffeic acid and PBN (p less than 0.05)

  6. Synthesis of gamma,delta-unsaturated and delta,epsilon-unsaturated alpha-amino acids from fragmentation of gamma- and delta-lactones.

    Science.gov (United States)

    Tarver, James E; Joullié, Madeleine M

    2004-02-06

    A noncoded amino acid of cyclomarin A (1) was synthesized in a racemic fashion. The method employs a six-membered ring template to control the relative stereochemistry and introduction of the functional groups. Ultimately, Pd-catalyzed fragmentation of the lactone provided gamma,delta-unsaturated and delta,epsilon-unsaturated alpha-amino acids. A Pd-catalyzed ring opening of a gamma-lactone is also reported.

  7. Alpha-Linolenic Acid Confers Neuroprotection and Improves Behavioral Deficits After Soman Exposure: Involvement of Neurogenesis Through an mTOR-Mediated Pathway

    Science.gov (United States)

    2015-01-15

    ALPHA-LINOLENIC ACID CONFERS NEUROPROTECTION AND IMPROVES BEHAVIORAL DEFICITS AFTER SOMAN EXPOSURE: INVOLVEMENT OF NEUROGENESIS THROUGH...soman exposure: involvement of neurogenesis through an mTOR-mediated pathway" Name of Candidate: Tetsade CB Piermartiri Doctor of Philosophy Degree...IMPROVES BEHAVIORAL DEFICITS AFTER SOMAN EXPOSURE: INVOLVEM OF NEUROGENESIS THROUGH AN mTOR-MEDIATED PATHWAY" is appropriately acknowledged and, beyond

  8. A sandwich ELISA for porcine alpha-1acid glycoprotein (pAGP, ORM-1) and further demonstration of its use to evaluate growth potential in newborn pigs

    Science.gov (United States)

    A simple, reproducible sandwich ELISA was developed to measure porcine alpha-1 acid glycoprotein (pAGP, ORM-1) in pig plasma. Pig AGP isolated from serum was purchased and a polyclonal antisera was prepared in rabbits using the whole pAGP molecule as immunogen. The antiserum was affinity-purified...

  9. Identification of the catalytic residues of alpha-amino acid ester hydrolase from Acetobacter turbidans by labeling and site-directed mutagenesis

    NARCIS (Netherlands)

    Polderman - Tijmes, Jolanda j.; Jekel, Peter A.; Jeronimus-Stratingh, CM; Bruins, Andries P.; van der Laan, Jan-Metske; Sonke, Theo; Janssen, Dick B.

    2002-01-01

    The alpha-amino acid ester hydrolase from Acetobacter turbidans ATCC 9325 is capable of hydrolyzing and synthesizing the side chain peptide bond in beta-lactam antibiotics. Data base searches revealed that the enzyme contains an active site serine consensus sequence Gly-X-Ser-Tyr-X-Gly that is also

  10. Synthesis of .alpha.-Amino Acids via Asymmetric Phase Transfer-Catalyzed Alkylation of Achiral Niclkel(II) Complexes of Glycine-Derived Schiff bases

    Czech Academy of Sciences Publication Activity Database

    Belokon, Y. N.; Bespalova, N. B.; Churkina, T. D.; Císařová, I.; Ezernitskaya, M. G.; Harutyunyan, S. R.; Hrdina, R.; Kagan, H. B.; Kočovský, P.; Kochetkov, K. A.; Larionov, O. G.; Lysenko, K. A.; North, M.; Polášek, Miroslav; Peregudov, A. S.; Prisyazhnyuk, V. V.; Vyskočil, Š.

    2003-01-01

    Roč. 125, - (2003), s. 12860-12870 ISSN 0002-7863 R&D Projects: GA ČR GP203/01/D051 Institutional research plan: CEZ:AV0Z4040901 Keywords : .alpha.amino acids * achiral nickel(II) * glycine-derived schiff bases Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.516, year: 2003

  11. Microencapsulation of H. pluvialis oleoresins with different fatty acid composition: Kinetic stability of astaxanthin and alpha-tocopherol.

    Science.gov (United States)

    Bustamante, Andrés; Masson, Lilia; Velasco, Joaquín; Del Valle, José Manuel; Robert, Paz

    2016-01-01

    Haematococcus pluvialis is a natural source of astaxanthin (AX). However, AX loses its natural protection when extracted from this microalga. In this study, a supercritical fluid extract (SFE) of H. pluvialis was obtained and added to oils with different fatty acid compositions (sunflower oil (SO) or high oleic sunflower oil (HOSO)). The oleoresins of H. pluvialis ((SO+SFE) and (HOSO+SFE)) were encapsulated with Capsul by spray drying. The stability of the oleoresins and powders were studied at 40, 50 and 70° C. AX and alpha-tocopherol (AT) degradation followed a zero-order and first-order kinetic model, respectively, for all systems. The encapsulation of oleoresins improved the stability of AX and AT to a greater extent in oleoresins with a monounsaturated fatty acid profile, as shown by the significantly lowest degradation rate constants and longest half-lives. Therefore, the encapsulation of H. pluvialis oleoresins is an alternative to developing a functional ingredient for healthy food design. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Suppression of cardiac myocyte hypertrophy by conjugated linoleic acid: role of peroxisome proliferator-activated receptors alpha and gamma.

    Science.gov (United States)

    Alibin, Caroline P; Kopilas, Melanie A; Anderson, Hope D I

    2008-04-18

    Conjugated linoleic acid (CLA) refers to a naturally occurring mixture of positional and geometric isomers of linoleic acid. Evidence suggests that CLA is a dietary constituent and nutraceutical with anti-cancer, insulin-sensitizing, immunomodulatory, weight-partitioning, and cardioprotective properties. The aim of this study was to evaluate the effects of intervention with CLA on cardiac hypertrophy. In vitro, CLA prevented indicators of cardiomyocyte hypertrophy elicited by endothelin-1, including cell size augmentation, protein synthesis, and fetal gene activation. Similar anti-hypertrophic effects of CLA were observed in hypertrophy induced by angiotensin II, fibroblast growth factor, and mechanical strain. CLA may inhibit hypertrophy through activation of peroxisome proliferator-activated receptors (PPARs). CLA stimulated PPAR activity in cardiomyocytes, and the anti-hypertrophic effects of CLA were blocked by genetic and pharmacological inhibitors of PPAR isoforms alpha and gamma. CLA may disrupt hypertrophic signaling by stimulating diacylglycerol kinase zeta, which decreases availability of diacylglycerol and thereby inhibits the protein kinase Cepsilon pathway. In vivo, dietary CLA supplementation significantly reduced blood pressure and cardiac hypertrophy in spontaneously hypertensive heart failure rats. These data suggest that dietary supplementation with CLA may be a viable strategy to prevent pathological cardiac hypertrophy, a major risk factor for heart failure.

  13. Novel (E)-alpha-[(1H-indol-3-yl)methylene]benzeneacetic acids as endothelin receptor ligands.

    Science.gov (United States)

    Pittalà, Valeria; Romeo, Giuseppe; Materia, Luisa; Salerno, Loredana; Siracusa, Maria Angela; Modica, Maria; Mereghetti, Ilario; Cagnotto, Alfredo; Russo, Filippo

    2005-09-01

    Endothelin-1 (ET-1), a peptide of 21 amino acid residues, is the most potent vasoconstrictor substance known and now it is understood to be one of a family of three mammalian vasoactive peptides that also includes ET-2 and ET-3. The endothelins (ETs) affect multiple organ systems and seem to be involved in the pathogenesis of many diseases such as hypertension, pulmonary hypertension, atherosclerosis, apoptosis inhibition and angiogenesis. The ETs exert their effects via activation of two distinct G-protein coupled receptor subtypes termed ET(A) and ET(B). To date a number of ET receptor ligands with good affinity and selectivity is known, nevertheless these compounds belong only to few chemical classes. The aim of this work was the identification of a "hit compound" with novel chemical structure, endowed with reasonable ET affinity and selectivity. Accordingly, a new class of (E)-alpha-[(1H-indol-3-yl)methylene]benzeneacetic acid derivatives (1-23) was synthesized for evaluation of their binding profiles.

  14. Chrysophanic Acid Suppresses Adipogenesis and Induces Thermogenesis by Activating AMP-activated Protein Kinase Alpha in vivo and in vitro

    Directory of Open Access Journals (Sweden)

    Hara Lim

    2016-12-01

    Full Text Available Chrysophanic acid (CA is a member of the anthraquinone family abundant in rhubarb, a widely used herb for obesity treatment in Traditional Korean Medicine. Though several studies have indicated numerous features of CA, no study has yet reported the effect of CA on obesity. In this study, we tried to identify the anti-obesity effects of CA. By using 3T3-L1 adipocytes and primary cultured brown adipocytes as in vitro models, high-fat diet (HFD-induced obese mice, and zebrafish as in vivo models, we determined the anti-obesity effects of CA. CA reduced weight gain in HFD-induced obese mice. They also decreased lipid accumulation and the expressions of adipogenesis factors including peroxisome proliferator-activated receptor gamma (PPARγ and CCAAT/enhancer-binding protein alpha (C/EBPα in 3T3-L1 adipocytes. In addition, uncoupling protein 1 (UCP1 and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1α, the brown fat specific thermogenic genes, were up-regulated in brown adipocytes by CA treatment. Furthermore, when co-treated with Compound C, the AMP-activated protein kinase (AMPK inhibitor, CA was able to restore the activation of AMPKα in both types of adipocytes, indicating the multi-controlling effect of CA was partially via the AMPKα pathway. Given all together, these results indicate that CA can ameliorate obesity by controlling the adipogenic and thermogenic pathway at the same time. On these bases we suggest the new potential of CA as an anti-obese pharmacotherapy.

  15. Effect of capric, lauric and alpha-linolenic acids on the division time distributions of single cells of Staphylococcus aureus.

    Science.gov (United States)

    Sado Kamdem, S; Guerzoni, M E; Baranyi, J; Pin, C

    2008-11-30

    The effect of non-inhibitory concentrations of capric, lauric and alpha-linolenic acids (C10:0, C12:0 and C18:3 respectively) on the division time distribution of single cells of Staphylococcus aureus was evaluated at pH 7 and pH 5. The effect of the initial cell concentration on the lag time of growing cell populations was also assessed. The statistical properties of the division times (defined as the time interval from birth to next binary fission for a single cell) were studied using the method of Elfwing et al. [Elfwing, A., Le Marc, Y., Baranyi, J., Ballagi, A., 2004. Observing the growth and division of large number of individual bacteria using image analysis. Applied and Environmental Microbiology 70, 675-678]. The division times were significantly longer in the presence of free fatty acids than in the control. Shorter division intervals were detected at pH 7 than at pH 5 in the control experiment and in the presence of C10:0. However, both C12:0 and C18:3 slowed down the growth, regardless of the pH. The observed division time distributions were used to simulate growth curves from different inoculum sizes using the stochastic birth process described by Pin and Baranyi [Pin, C., Baranyi, J., 2006. Kinetics of single cells: observation and modelling of a stochastic process. Applied and Environmental Microbiology 72, 2163-2169]. The output of the simulation results were compared with observed data. The lag times fitted to simulated growth curves were in good agreement with those fitted to growth curves measured by plate counts. The averaged out effect of the population masked the effect of the free fatty acids and pH on the division times of single cells.

  16. Acetylsalicylic acid regulates MMP-2 activity and inhibits colorectal invasion of murine B16F0 melanoma cells in C57BL/6J mice: effects of prostaglandin F(2)alpha.

    Science.gov (United States)

    Tsai, Chin-Shaw Stella; Luo, Shue-Fen; Ning, Chung-Chu; Lin, Chien-Liang; Jiang, Ming-Chung; Liao, Ching-Fong

    2009-08-01

    Epidemiological studies indicate that acetylsalicylic acid may reduce the risk of mortality due to colon cancers. Metastasis is the major cause of cancer death. Matrix metalloproteinases (MMPs) play important roles in tumor invasion regulation, and prostaglandin F(2)alpha (PGF(2)alpha) is a key stimulator of MMP production. Thus, we investigated whether acetylsalicylic acid regulated MMP activity and the invasion of cancer cells and whether PGF(2)alpha attenuated acetylsalicylic acid-inhibited invasion of cancer cells. Gelatin-based zymography assays showed that acetylsalicylic acid inhibited the MMP-2 activity of B16F0 melanoma cells. Matrigel-based chemoinvasion assays showed that acetylsalicylic acid inhibited the invasion of B16F0 cells. Acetylsalicylic acid can inhibit PGF(2)alpha synthesis and PGF(2)alpha is a key stimulator of MMP-2 production. Our data showed that PGF(2)alpha treatment attenuated the acetylsalicylic acid-inhibited invasion of B16F0 cells. In animal experiments, acetylsalicylic acid reduced colorectal metastasis of B16F0 cells in C57BL/6J mice by 44%. Our results suggest that PGF(2)alpha is a therapeutic target for metastasis inhibition and acetylsalicylic acid may possess anti-metastasis ability.

  17. Binding diversity of monoclonal antibodies to alpha(2-->8) polysialic acid conjugated to outer membrane vesicle via adipic acid dihydrazide.

    Science.gov (United States)

    Devi, S J; Karpas, A B; Frasch, C E

    1996-07-01

    Murine monoclonal antibodies (mAbs) were generated using group B Neisseria meningitidis and Escherichia coli K1 polysaccharides (PSs) conjugated to outer membrane vesicle (OMV) via adipic acid dihydrazide, and were used to identify the immunodeterminants expressed on these capsular PSs. Ten mAbs representative of IgM and all subclasses of IgG were obtained which recognized diverse immunodeterminants on alpha(2-->8) polysialic acid (PSA). The specificity of mAbs to different antigenic determinants was assessed by their differential binding to PSA attached to a solid phase by different methods and confirmed by absorption studies. Two mAbs from the E. coli K1 fusion were directed to the O-acetyl epitope and the rest reacted with both the PSs only when attached to a solid phase by certain means. The methods by which PSA was coated on the solid phase had an impact on the epitope expression and binding pattern. At the concentrations used, the O-acetyl-specific mAbs, IgG1 and IgG3 mAbs were not bactericidal against group B N. meningitidis, whereas other mAbs were. The conjugates B and K1 PSs present to the murine immune system different antigenic determinants, some of which elicit bactericidal antibodies.

  18. Conjugated linoleic acid induces apoptosis through estrogen receptor alpha in human breast tissue

    International Nuclear Information System (INIS)

    Wang, Li-Shu; Huang, Yi-Wen; Liu, Suling; Yan, Pearlly; Lin, Young C

    2008-01-01

    Conjugated linoleic acid (CLA), a naturally occurring fatty acid found in ruminant products such as milk and beef, has been shown to possess anti-cancer activities in in vivo animal models and in vitro cell culture systems. In human breast cancer, the overall duration of estrogen exposure is the most important risk factor for developing estrogen-responsive breast cancer. Accordingly, it has been suggested that estrogen exposure reduces apoptosis through the up-regulation of the anti-apoptosis protein, Bcl-2. Bcl-2, an anti-apoptotic protein, regulates apoptosis and plays a crucial role in the development and growth regulation of normal and cancerous cells. Our research interest is to examine the effects of CLA on the induction of apoptosis in human breast tissues. The localization of Bcl-2 in both normal and cancerous human breast tissues was determined by immunohistochemical staining and the Bcl-2 protein expression was tested by western blot analysis. Co-culture of epithelial cells and stromal cells was carried out in the presence or absence of CLA to evaluate apoptosis in the context of a cell-cell interaction. The results showed that both normal and cancerous breast tissues were positive for Bcl-2 staining, which was higher overall in mammary ducts but very low in the surrounding stromal compartment. Interestingly, by quantifying the western blot data, basal Bcl-2 protein levels were higher in normal breast epithelial cells than in cancerous epithelial cells. Furthermore, treatment with 17β-estradiol (E 2 ) stimulated growth and up-regulated Bcl-2 expression in estrogen responsive breast epithelial cells; however, these carcinogenic effects were diminished by either CLA or 4-Hydroxytamoxifen (Tam) and were suppressed further by the combination of CLA and Tam. In both one cell type cultured and co-culture systems, CLA induced cell apoptosis in ERα transfected MDA-MB-231 cells but not in the wild type MDA-MB-231 cells. These data, therefore, demonstrate that

  19. Functional bread with n-3 alpha linolenic acid from whole chia (Salvia hispanica L.) flour.

    Science.gov (United States)

    Luna Pizarro, Patricia; Almeida, Eveline Lopes; Coelho, Alessandra Silva; Sammán, Norma Cristina; Hubinger, Miriam Dupas; Chang, Yoon Kil

    2015-07-01

    This work proposed to study the effects of the addition of whole chia flour (WCF) on the technological, nutritional and sensory qualities of bread. Different WCF contents (0 and 20 %) and vital gluten (VG) (0 and 4 %) were added to bread according to a 2(2) central composite rotational design. WCF decreased the specific volume, lightness and hue angle of the bread loaves, but did not affect the chroma values. WCF and VG contributed to maintenance of the moisture content of the loaves during the storage period. The increased firmness found with the addition of high levels of WCF (more than 10 %) was countered by larger amounts of VG (more than 2 %). The optimum loaf (10 % WCF and 2 % VG) showed 26 % more lipids, 19 % more protein and 11 % more ash than the standard loaf (0 % WCF and 0 % VG). A better lipid profile was also found (higher omega-3 fatty acid content and a better omega-6/omega-3 ratio). Both breads were positively rated in the sensory profile analysis.

  20. Ascorbic acid, but not dehydroascorbic acid increases intracellular vitamin C content to decrease Hypoxia Inducible Factor -1 alpha activity and reduce malignant potential in human melanoma.

    Science.gov (United States)

    Fischer, Adam P; Miles, Sarah L

    2017-02-01

    Accumulation of hypoxia inducible factor-1 alpha (HIF-1α) in malignant tissue is known to contribute to oncogenic progression and is inversely associated with patient survival. Ascorbic acid (AA) depletion in malignant tissue may contribute to aberrant normoxic activity of HIF-1α. While AA supplementation has been shown to attenuate HIF-1α function in malignant melanoma, the use of dehydroascorbic acid (DHA) as a therapeutic means to increase intracellular AA and modulate HIF-1α function is yet to be evaluated. Here we compared the ability of AA and DHA to increase intracellular vitamin C content and decrease the malignant potential of human melanoma by reducing the activity of HIF-1α. HIF-1α protein accumulation was evaluated by western blot and transcriptional activity was evaluated by reporter gene assay using a HIF-1 HRE-luciferase plasmid. Protein expressions and subcellular localizations of vitamin C transporters were evaluated by western blot and confocal imaging. Intracellular vitamin C content following AA, ascorbate 2-phosphate (A2P), or DHA supplementation was determined using a vitamin C assay. Malignant potential was accessed using a 3D spheroid Matrigel invasion assay. Data was analyzed by One or Two-way ANOVA with Tukey's multiple comparisons test as appropriate with pascorbic acid as an adjuvant cancer therapy remains under investigated. While AA and A2P were capable of modulating HIF-1α protein accumulation/activity, DHA supplementation resulted in minimal intracellular vitamin C activity with decreased ability to inhibit HIF-1α activity and malignant potential in advanced melanoma. Restoring AA dependent regulation of HIF-1α in malignant cells may prove beneficial in reducing chemotherapy resistance and improving treatment outcomes. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  1. Negligible penetration of incidental amounts of alpha-hydroxy acid from rinse-off personal care products in human skin using an in vitro static diffusion cell model.

    Science.gov (United States)

    Okuda, M; Donahue, D A; Kaufman, L E; Avalos, J; Simion, F A; Story, D C; Sakaguchi, H; Fautz, R; Fuchs, A

    2011-12-01

    Alpha-hydroxy acids (AHAs), primarily glycolic and lactic acids, are widely used in cosmetics to alleviate dyspigmentation, photodamage, and other aging skin conditions and as pH adjusters. Glycolic acid reportedly enhances skin damage after repeated ultraviolet light exposure, e.g., increased sunburn cell formation. This study assessed potential in vitro skin penetration of lactic acid and malic acid incorporated into rinse-off personal care products, compared with rinse-off and leave-on exposures to glycolic acid (10%, pH 3.5) in a reference lotion. Radiolabeled AHA-fortified shampoo, conditioner, and lotion were evenly applied as single doses to human epidermal membranes mounted in static diffusion cells (not occluded). Exposures were 1-3 min (rinse-off) or 24 h (leave-on). Epidermal penetration of malic acid and lactic acid from the rinse-off shampoo and conditioner, respectively, was negligible, with >99% removed by rinsing, a negligible portion remaining in the stratum corneum (≤0.15%), and even less penetrating into the viable epidermis (≤0.04%). Glycolic acid penetration from the leave-on reference lotion was 1.42 μg equiv./cm2/h, with total absorbable dose recovery (receptor fluid plus epidermis) of 2.51%, compared to 0.009%, 0.003%, and 0.04% for the rinse-off reference lotion, shampoo (malic acid), and conditioner (lactic acid) exposures, respectively. Dermal penetration of AHAs into human skin is pH-, concentration-, and time-dependent. Alpha-hydroxy acids in rinse-off shampoos and conditioners are almost entirely removed from the skin within minutes by rinsing (resulting in negligible epidermal penetration). This suggests that ultraviolet radiation-induced skin effects of AHA-containing rinse-off products are negligible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. The Roles of Alpha-Momorcharin and Jasmonic Acid in Modulating the Response of Momordica charantia to Cucumber Mosaic Virus.

    Science.gov (United States)

    Yang, Ting; Meng, Yao; Chen, Li-Juan; Lin, Hong-Hui; Xi, De-Hui

    2016-01-01

    Alpha-momorcharin (α-MMC) is a type-I ribosome inactivating protein with a molecular weight of 29 kDa that is found in Momordica charantia , and has been shown to be effective against a broad range of human viruses as well as having anti-tumor activities. However, the role of endogenous α-MMC under viral infection and the mechanism of the anti-viral activities of α-MMC in plants are still unknown. To study the effect of α-MMC on plant viral defense and how α-MMC increases plant resistance to virus, the M. charantia - cucumber mosaic virus (CMV) interaction system was investigated. The results showed that the α-MMC level was positively correlated with the resistance of M. charantia to CMV. α-MMC treatment could alleviate photosystem damage and enhance the ratio of glutathione/glutathione disulfide in M. charantia under CMV infection. The relationship of α-MMC and defense related phytohormones, and their roles in plant defense were further investigated. α-MMC treatment led to a significant increase of jasmonic acid (JA) and vice versa, while there was no obvious relevance between salicylic acid and α-MMC. In addition, reactive oxygen species (ROS) were induced in α-MMC-pretreated plants, in a similar way to the ROS burst in JA-pretreated plants. The production of ROS in both ibuprofen (JA inhibitor) and (α-MMC+ibuprofen)-pretreated plants was reduced markedly, leading to a greater susceptibility of M. charantia to CMV. Our results indicate that the anti-viral activities of α-MMC in M. charantia may be accomplished through the JA related signaling pathway.

  3. Cleft lip with or without cleft palate: Associations with transforming growth factor alpha and retinoic acid receptor loci

    Energy Technology Data Exchange (ETDEWEB)

    Chenevix-Trench, G.; Jones, K. (Queensland Inst. of Medical Research (Australia) Univ. of Queensland (Australia)); Green, A.C.; Duffy, D.L.; Martin, N.G. (Queensland Inst. of Medical Research (Australia))

    1992-12-01

    The first association study of cleft lip with or without cleft palate (CL/P), with candidate genes, found an association with the transforming growth-factor alpha (TGFA) locus. This finding has since been replicated, in whole or in part, in three independent studies. Here the authors extend their original analysis of the TGFA TaqI RFLP to two other TGFA RFLPs and seven other RFLPs at five candidate genes in 117 nonsyndromic cases of CL/P and 113 controls. The other candidate genes were the retinoic acid receptor (RARA), the bcl-2 oncogene, and the homeobox genes 2F, 2G, and EN2. Significant associations with the TGFA TaqI and BamHI RFLPs were confirmed, although associations of clefting with previously reported haplotypes did not reach significance. Of particular interest, in view of the known teratogenic role of retinoic acid, was a significant association with the RARA PstI RFLP (P = .016; not corrected for multiple testing). The effect on risk of the A2 allele appears to be additive, and although the A2A2 homozygote only has an odds ratio of about 2 and recurrence risk to first-degree relatives ([lambda][sub 1]) of 1.06, because it is so common it may account for as much as a third of the attributable risk of clefting. There is no evidence of interaction between the TGFA and RARA polymorphisms on risk, and jointly they appear to account for almost half the attributable risk of clefting. 43 refs., 1 fig., 4 tabs.

  4. Oral delivery of Acid Alpha Glucosidase epitopes expressed in plant chloroplasts suppresses antibody formation in treatment of Pompe mice.

    Science.gov (United States)

    Su, Jin; Sherman, Alexandra; Doerfler, Phillip A; Byrne, Barry J; Herzog, Roland W; Daniell, Henry

    2015-10-01

    Deficiency of acid alpha glucosidase (GAA) causes Pompe disease in which the patients systemically accumulate lysosomal glycogen in muscles and nervous systems, often resulting in infant mortality. Although enzyme replacement therapy (ERT) is effective in treating patients with Pompe disease, formation of antibodies against rhGAA complicates treatment. In this report, we investigated induction of tolerance by oral administration of GAA expressed in chloroplasts. Because full-length GAA could not be expressed, N-terminal 410-amino acids of GAA (as determined by T-cell epitope mapping) were fused with the transmucosal carrier CTB. Tobacco transplastomic lines expressing CTB-GAA were generated through site-specific integration of transgenes into the chloroplast genome. Homoplasmic lines were confirmed by Southern blot analysis. Despite low-level expression of CTB-GAA in chloroplasts, yellow or albino phenotype of transplastomic lines was observed due to binding of GAA to a chloroplast protein that has homology to mannose-6 phosphate receptor. Oral administration of the plant-made CTB-GAA fusion protein even at 330-fold lower dose (1.5 μg) significantly suppressed immunoglobulin formation against GAA in Pompe mice injected with 500 μg rhGAA per dose, with several-fold lower titre of GAA-specific IgG1 and IgG2a. Lyophilization increased CTB-GAA concentration by 30-fold (up to 190 μg per g of freeze-dried leaf material), facilitating long-term storage at room temperature and higher dosage in future investigations. This study provides the first evidence that oral delivery of plant cells is effective in reducing antibody responses in ERT for lysosomal storage disorders facilitating further advances in clinical investigations using plant cell culture system or in vitro propagation. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  5. The Roles of Alpha-Momorcharin and Jasmonic Acid in Modulating the Response of Momordica charantia to Cucumber Mosaic Virus

    Science.gov (United States)

    Yang, Ting; Meng, Yao; Chen, Li-Juan; Lin, Hong-Hui; Xi, De-Hui

    2016-01-01

    Alpha-momorcharin (α-MMC) is a type-I ribosome inactivating protein with a molecular weight of 29 kDa that is found in Momordica charantia, and has been shown to be effective against a broad range of human viruses as well as having anti-tumor activities. However, the role of endogenous α-MMC under viral infection and the mechanism of the anti-viral activities of α-MMC in plants are still unknown. To study the effect of α-MMC on plant viral defense and how α-MMC increases plant resistance to virus, the M. charantia–cucumber mosaic virus (CMV) interaction system was investigated. The results showed that the α-MMC level was positively correlated with the resistance of M. charantia to CMV. α-MMC treatment could alleviate photosystem damage and enhance the ratio of glutathione/glutathione disulfide in M. charantia under CMV infection. The relationship of α-MMC and defense related phytohormones, and their roles in plant defense were further investigated. α-MMC treatment led to a significant increase of jasmonic acid (JA) and vice versa, while there was no obvious relevance between salicylic acid and α-MMC. In addition, reactive oxygen species (ROS) were induced in α-MMC-pretreated plants, in a similar way to the ROS burst in JA-pretreated plants. The production of ROS in both ibuprofen (JA inhibitor) and (α-MMC+ibuprofen)-pretreated plants was reduced markedly, leading to a greater susceptibility of M. charantia to CMV. Our results indicate that the anti-viral activities of α-MMC in M. charantia may be accomplished through the JA related signaling pathway. PMID:27881976

  6. The effect of alpha-ketoglutaric acid on tyrosinase activity and conformation: Kinetics and molecular dynamics simulation study.

    Science.gov (United States)

    Gou, Lin; Lee, Jinhyuk; Yang, Jun-Mo; Park, Yong-Doo; Zhou, Hai-Meng; Zhan, Yi; Lü, Zhi-Rong

    2017-12-01

    Alpha-ketoglutaric acid (AKG) is naturally found in organisms and is a well-known intermediate in the production of ATP or GTP in the Krebs cycle. We elucidated the effects of AKG on tyrosinase activity and conformation via methods of inhibition kinetics integrated with molecular dynamics (MD) simulations. AKG was found to be a reversible inhibitor of tyrosinase (IC 50 =15±0.5mM) and induced parabolic slope mixed-type inhibition. Based on our newly established equation, the dissociation constant (K islope ) was determined to be 7.93±0.31mM. The spectrofluorimetry studies showed that AKG mainly induced regional changes in the active site of tyrosinase, which reflects the flexibility of the active site. The computational docking and molecular dynamics (MD) simulations further demonstrated that AKG could interact with several residues near the substrate-binding site located in the tyrosinase active site pocket. Our study provides insight into the mechanism by which energy-producing intermediates such as AKG inhibit tyrosinase through its ketone groups. Also, AKG could be a potential natural antipigmentation agent due to its non-toxic property. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Determination of human serum alpha1-acid glycoprotein and albumin binding of various marketed and preclinical kinase inhibitors.

    Science.gov (United States)

    Zsila, Ferenc; Fitos, Ilona; Bencze, Gyula; Kéri, György; Orfi, László

    2009-01-01

    There are about 380 protein kinase inhibitors in drug development as of today and 15 drugs have been marketed already for the treatment of cancer. This time 139 validated kinase targets are in the focus of drug research of pharmaceutical companies and big efforts are made for the development of new, druglike kinase inhibitors. Plasma protein binding is an important factor of the ADME profiling of a drug compound. Human serum albumin (HSA) and alpha(1)-acid glycoprotein (AAG) are the most relevant drug carriers in blood plasma. Since previous literature data indicated that AAG is the principal plasma binding component of some kinase inhibitors the present work focuses on the comprehensive evaluation of AAG binding of a series of marketed and experimental kinase inhibitors by using circular dichroism (CD) spectroscopy approach. HSA binding was also evaluated by affinity chromatography. Protein binding interactions of twenty-six kinase inhibitors are characterized. The contribution of AAG and HSA binding data to the pharmacokinetic profiles of the investigated therapeutic agents is discussed. Structural, biological and drug binding properties of AAG as well as the applicability of the CD method in studying drug-protein binding interactions are also briefly reviewed.

  8. Amino acid-dependent activation of liver estrogen receptor alpha integrates metabolic and reproductive functions via IGF-1.

    Science.gov (United States)

    Della Torre, Sara; Rando, Gianpaolo; Meda, Clara; Stell, Alessia; Chambon, Pierre; Krust, Andrée; Ibarra, Cristian; Magni, Paolo; Ciana, Paolo; Maggi, Adriana

    2011-02-02

    Throughout evolution, organisms have devised strategies to limit fertility in case of prolonged starvation. In mammals, the liver plays a central role in the orchestration of mechanisms allowing for the maintenance of energy homeostasis. We here demonstrate that dietary amino acids regulate the transcriptional activity of hepatic estrogen receptor alpha (ERα) through an mTOR-dependent mechanism. As a result of ERα activation, hepatic IGF-1 mRNA and blood IGF-1 are increased. Conversely, calorie restriction or selective ablation of ERα in the liver decrease blood IGF-1 to levels inadequate for the correct proliferation of the lumen epithelium in the uterus and the progression of the estrous cycle. We propose that the liver acts as critical mediator of energetic and reproductive functions responsible for the blockade of the estrous cycle in case of protein scarcity. Our findings may provide novel insights to understand the cause of selected forms of infertility and metabolic alterations in women after menopause. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Neutral and anionic duality of 1,2,4-triazole {alpha}-amino acid scaffold in 1D coordination polymers

    Energy Technology Data Exchange (ETDEWEB)

    Naik, Anil D.; Dirtu, Marinela M.; Garcia, Yann, E-mail: yann.garcia@uclouvain.be [Universite Catholique de Louvain, Institute of Condensed Matter and Nanosciences, MOST - Inorganic Chemistry (Belgium)

    2012-03-15

    A tiny supramolecular synthon, 4H-1,2,4-triazol-4-yl acetic acid (HGlytrz) which is bifunctional by design having an electronic asymmetry and conformational flexibility has been introduced to synthesize iron(II) complexes. Having 1,2,4-triazole or carboxylic extremities on the same framework HGlytrz could display dual functionality by acting as a neutral as well as anionic ligand based on the possibility of deprotonation of carboxylic group. Four new iron(II) HGlytrz complexes with ClO{sub 4{sup -}} (1), NO{sub 3}-bar (2), BF{sub 4{sup -}} (3) and CF{sub 3}SO{sub 3b}ar (4) anions were prepared. Formulation of their composition which is complicated due to ligand deprotonation is discussed. Unlike its ester protected counterpart ethyl-4H-1,2,4-triazol-4-yl-acetate ({alpha}Glytrz) which show hysteretic room temperature spin crossover, 1-4 remain in the high-spin state as revealed by {sup 57}Moessbauer spectroscopy. Prospects of such 1D coordination polymers with dangling unbounded carboxylic entities in the realm of self-assembled monolayer (SAM) are discussed.

  10. A single amino acid residue, Ala 105, confers 16alpha-hydroxylase activity to human cytochrome P450 17alpha-hydroxylase/17,20 lyase.

    Science.gov (United States)

    Swart, Amanda C; Storbeck, Karl-Heinz; Swart, Pieter

    2010-04-01

    In adrenal steroidogenesis, CYP17 catalyses the 17alpha-hydroxylation of pregnenolone and progesterone and the subsequent 17,20-lyase reaction, yielding adrenal androgens. The enzyme exhibits distinctly different selectivities towards these substrates in various species. CYP17 has also been shown to exhibit 16alpha-hydroxylase activity towards progesterone in some species, with only human and chimp CYP17 catalysing the biosynthesis of substantial amounts of 16-OHprogesterone. The 16alpha-hydroxylase activity was investigated by introducing an Ala105Leu substitution into human CYP17. The converse mutation, Leu105Ala was introduced into the baboon, goat and pig enzymes. Wt human CYP17 converted approximately 30% progesterone to 16-OHprogesterone while the Ala105Leu mutant converted negligible amounts to 16-OHprogesterone ( approximately 9%), comparable to wt CYP17 of the other three species when expressed in COS-1 cells. The ratio of 17-hydroxylated products to 16-OHprogesterone of human CYP17 was 2.7 and that of the mutant human construct 10.5. Similar ratios were observed for human and goat CYP17 with the corresponding Ala or Leu residues. Although the Leu105Ala mutation of both baboon and pig CYP17 exhibited the same trend regarding the ratios, the rate of progesterone conversion was reduced. Coexpression with cytochrome b(5) significantly decreased the ratio of 17-hydroxylated products to 16-OHprogesterone in the Leu105 constructs, while effects were negligible with Ala at this position. Homology models show that Ala105 faces towards the active pocket in the predicted B'-C domain of CYP17. The smaller residue allows more flexibility of movement in the active pocket than Leu, presenting both the C16 and C17 of progesterone to the iron-oxy complex. 2010 Elsevier Ltd. All rights reserved.

  11. Effects of lactic acid bacteria in kimoto on sake brewing. Part 2. ; Promotion mechanism of enzymolysis in rice by teichoic acid. Kimotochu no nyusankin no seishu jozo ni oyobosu eikyo. 2. ; Kimotochu no nyusankin ni yuraisuru teikosan no. alpha. kamai yokai sokushin sayo kisaku

    Energy Technology Data Exchange (ETDEWEB)

    Mizoguchi, H.; Tsurumoto, M.; Furukawa, A.; Kawasaki, T. (Kikumasamune Sake Brewing Co. Ltd, Hyogo (Japan))

    1991-07-25

    In order to elucidate promotion mechanism of dissolution of {alpha}-rice (pregelatinized rice) by teichoic acid. adsorption of teichoic acid and {alpha}-amylase onto rice protein oryzenin was investigated by experiments. Teichoic acid was adsorbed well onto oryzenin and reduced adsorption of {alpha}-amylase. Adsorption of {alpha}-amylase onto rice powder was decreased logarithmically in proportion to the teichoic acid added. Both teichoic acid and {alpha}-amylase were adsorbed by histone, abundant in basic amino acids, and by anion-exchange resin. Adsorption of {alpha}-amylase onto them was reduced by coexistence with teichoic acid. As the results of experiments, it was inferred that teichoic acid became dissolvable through autolysis by lactic acid bacteria in kimoto, changed the state of electric charge on oryzenin surfaces through adsorption onto oryzenin by phosphoric group, decreasing adsorption of {alpha}-amylase onto oryzenin and increasing free {alpha}-amylase in the liquid phase, and thus increased the dissolution of {alpha}-rice. 9 refs., 6 figs., 3 tabs.

  12. Decreased agonist sensitivity of human GABA(A) receptors by an amino acid variant, isoleucine to valine, in the alpha1 subunit.

    Science.gov (United States)

    Westh-Hansen, S E; Rasmussen, P B; Hastrup, S; Nabekura, J; Noguchi, K; Akaike, N; Witt, M R; Nielsen, M

    1997-06-25

    Recombinant human GABA(A) receptors were investigated in vitro by coexpression of cDNAs coding for alpha1, beta2, and gamma2 subunits in the baculovirus/Sf-9 insect cell system. We report that a single amino acid exchange (isoleucine 121 to valine 121) in the N-terminal, extracellular part of the alpha1 subunit induces a marked decrease in agonist GABA(A) receptor ligand sensitivity. The potency of muscimol and GABA to inhibit the binding of the GABA(A) receptor antagonist [3H]SR 95531 (2-(3-carboxypropyl)-3-amino-6-(4-methoxyphenyl)pyridazinium bromide) was higher in receptor complexes of alpha1(ile 121) beta2gamma2 than in those of alpha1(val 121) beta2gamma2 (IC50 values were 32-fold and 26-fold lower for muscimol and GABA, respectively). The apparent affinity of the GABA(A) receptor antagonist bicuculline methiodide to inhibit the binding of [3H]SR 95531 did not differ between the two receptor complex variants. Electrophysiological measurements of GABA induced whole-cell Cl- currents showed a ten-fold decrease in the GABA(A) receptor sensitivity of alpha1 (val 121) beta2gamma2 as compared to alpha1(ile 121) beta2gamma2 receptor complexes. Thus, a relatively small change in the primary structure of the alpha1 subunit leads to a decrease selective for GABA(A) receptor sensitivity to agonist ligands, since no changes were observed in a GABA(A) receptor antagonist affinity and benzodiazepine receptor binding.

  13. Gamma-aminobutyric acid (GABA) and pentobarbital induce different conformational rearrangements in the GABA A receptor alpha1 and beta2 pre-M1 regions.

    Science.gov (United States)

    Mercado, Jose; Czajkowski, Cynthia

    2008-05-30

    Gamma-aminobutyric acid (GABA) binding to GABA(A) receptors (GABA(A)Rs) triggers conformational movements in the alpha(1) and beta(2) pre-M1 regions that are associated with channel gating. At high concentrations, the barbiturate pentobarbital opens GABA(A)R channels with similar conductances as GABA, suggesting that their open state structures are alike. Little, however, is known about the structural rearrangements induced by barbiturates. Here, we examined whether pentobarbital activation triggers movements in the GABA(A)R pre-M1 regions. Alpha(1)beta(2) GABA(A)Rs containing cysteine substitutions in the pre-M1 alpha(1) (K219C, K221C) and beta(2) (K213C, K215C) subunits were expressed in Xenopus oocytes and analyzed using two-electrode voltage clamp. The cysteine substitutions had little to no effect on GABA and pentobarbital EC(50) values. Tethering chemically diverse thiol-reactive methanethiosulfonate reagents onto alpha(1)K219C and alpha(1)K221C affected GABA- and pentobarbital-activated currents differently, suggesting that the pre-M1 structural elements important for GABA and pentobarbital current activation are distinct. Moreover, pentobarbital altered the rates of cysteine modification by methanethiosulfonate reagents differently than GABA. For alpha(1)K221Cbeta(2) receptors, pentobarbital decreased the rate of cysteine modification whereas GABA had no effect. For alpha(1)beta(2)K215C receptors, pentobarbital had no effect whereas GABA increased the modification rate. The competitive GABA antagonist SR-95531 and a low, non-activating concentration of pentobarbital did not alter their modification rates, suggesting that the GABA- and pentobarbital-mediated changes in rates reflect gating movements. Overall, the data indicate that the pre-M1 region is involved in both GABA- and pentobarbital-mediated gating transitions. Pentobarbital, however, triggers different movements in this region than GABA, suggesting their activation mechanisms differ.

  14. Evidence for the inhibition of the terminal step of ruminal alpha-linolenic acid biohydrogenation by condensed tannins.

    Science.gov (United States)

    Khiaosa-Ard, R; Bryner, S F; Scheeder, M R L; Wettstein, H-R; Leiber, F; Kreuzer, M; Soliva, C R

    2009-01-01

    Effects of condensed tannins (CT), either via extract or plant-bound, and saponin extract on ruminal biohydrogenation of alpha-linolenic acid (ALA) were investigated in vitro. Grass-clover hay served as basal diet (control). The control hay was supplemented with extracts contributing either CT from Acacia mearnsii [7.9% of dietary dry matter (DM)] or saponins from Yucca schidigera (1.1% of DM). The fourth treatment consisted of dried sainfoin (Onobrychis viciifolia), a CT-containing forage legume, in an amount also providing 7.9% CT in dietary DM. All diets were supplemented with linseed oil at a level contributing 60% of total dietary ALA in all treatments. Diets were incubated for 10 d (n = 4) in the rumen simulation technique system, using the last 5 d for statistical evaluation. Fatty acids were analyzed in feed, feed residues, incubation fluid, and its effluent. Data were subjected to ANOVA considering diet and experimental run as main effects. Both CT treatments reduced ruminal fiber and crude protein degradation, and lowered incubation fluid ammonia concentration. Only the CT extract suppressed methane formation and shifted microbial populations toward bacteria at cost of protozoa. The saponin extract remained without clear effects on fermentation characteristics except for increased protozoal counts. The extent of ALA biohydrogenation was 20% less with the CT plant, but this probably resulted from reduced organic matter degradability rather than from an inhibition of biohydrogenation. After incubation analysis of incubation fluid effluent and feed residues showed a considerable proportion of the 3 biohydrogenation intermediates, cis-9, trans-11, cis-15 C18:3, trans-11, cis-15 C18:2, and trans-11 C18:1, which did not occur in the initial feeds. Only the CT-extract diet led to a different profile in the effluent compared with the control diet with trans-11 C18:1 being considerably increased at cost of C18:0. This could have been achieved by suppressing

  15. Internode length in Pisum. Gene na may block gibberellin synthesis between ent-7. cap alpha. -hydroxykaurenoic acid and biggerellin A/sub 12/-aldehyde. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Ingram, T.J.; Reid, J.B.

    1987-04-01

    The elongation response of the gibberellin (GA) deficient genotypes na, ls, and lh of peas (Pisum sativum L.) to a range of GA-precursors was examined. Plants possessing gene na did not respond to precursors in the GA biosynthetic pathway prior to GA/sub 12/-aldehyde. In contrast, plants possessing lh and ls responded as well as wild-type plants (dwarfed with AMO-1618) to these compounds. The results suggest that GA biosynthesis is blocked prior to ent-kaurene in the lh and ls mutants and between ent-7..cap alpha..-hydroxykaurenoic acid and GA/sub 12/-aldehyde in the na mutant. Feeds of ent(/sup 3/H)kaurenoic acid and (/sup 2/H)GA/sub 12/-aldehyde to a range of genotypes supported the above conclusions. The na line WL1766 was shown by gas chromatography-mass spectrometry (GC-MS) to metabolize(/sup 2/H)GA/sub 12/-aldehyde to a number of (/sup 2/H)C/sub 19/-GAs including GA/sub 1/. However, there was no indication in na genotypes for the metabolism of ent-(/sup 3/H)kaurenoic acid to these GAs. In contrast, the expanding shoot tissue of all Na genotypes examined metabolized ent-(/sup 3/H)kaurenoic acid to radioactive compounds that co-chromatographed with GA/sub 1/, GA/sub 8/, GA/sub 20/, and GA/sub 29/. However, insufficient material was present for unequivocal identification of the metabolites. The radioactive profiles from HPLC of extracts of the node treated with ent-(/sup 3/H)kaurenoic acid were similar for both Na and na plants and contained ent-16..cap alpha..,17-dihydroxykaurenoic acid and ent-6..cap alpha..,7..cap alpha..,16..beta..,17-tetrahydroxykaurenoic acid (both characterized by GC-MS), suggesting that the metabolites arose from side branches of the main GA-biosynthetic pathway. Thus, both Na and na plants appear capable of ent-7..cap alpha..-hydroxylation.

  16. Providing male rats deficient in iron and n-3 fatty acids with iron and alpha-linolenic acid alone affects brain serotonin and cognition differently from combined provision.

    Science.gov (United States)

    Baumgartner, Jeannine; Smuts, Cornelius M; Zimmermann, Michael B

    2014-06-13

    We recently showed that a combined deficiency of iron (ID) and n-3 fatty acids (n-3 FAD) in rats disrupts brain monoamine metabolism and produces greater memory deficits than ID or n-3 FAD alone. Providing these double-deficient rats with either iron (Fe) or preformed docosahexaenoic acid (DHA)/eicosapentaenoic acid (EPA) alone affected brain monoamine pathways differently from combined repletion and even exacerbated cognitive deficits associated with double-deficiency. Iron is a co-factor of the enzymes responsible for the conversion of alpha-linolenic acid (ALA) to EPA and DHA, thus, the provision of ALA with Fe might be more effective in restoring brain EPA and DHA and improving cognition in double-deficient rats than ALA alone. In this study we examined whether providing double-deficient rats with ALA and Fe, alone or in combination, can correct deficits in monoamine metabolism and cognition associated with double-deficiency. Using a 2 × 2 design, male rats with concurrent ID and n-3 FAD were fed an Fe + ALA, Fe + n-3 FAD, ID + ALA, or ID + n-3 FAD diet for 5 weeks (postnatal day 56-91). Biochemical measures, and spatial working and reference memory (using the Morris water maze) were compared to age-matched controls. In the hippocampus, we found a significant Fe × ALA interaction on DHA: Compared to the group receiving ALA alone, DHA was significantly higher in the Fe + ALA group. In the brain, we found significant antagonistic Fe × ALA interactions on serotonin concentrations. Provision of ALA alone impaired working memory compared with age-matched controls, while in the reference memory task ALA provided with Fe significantly improved performance. These results indicate that providing either iron or ALA alone to double-deficient rats affects serotonin pathways and cognitive performance differently from combined provision. This may be partly explained by the enhancing effect of Fe on the conversion of ALA to EPA and DHA.

  17. Composite poly-L-lactic acid/poly-({alpha},{beta})-DL-aspartic acid/collagen nanofibrous scaffolds for dermal tissue regeneration

    Energy Technology Data Exchange (ETDEWEB)

    Ravichandran, Rajeswari [Healthcare and Energy Materials Laboratory, Nanoscience and Nanotechnology Initiative, Faculty of Engineering, National University of Singapore, 117576 (Singapore); Department of Mechanical Engineering, National University of Singapore, 117576 (Singapore); Venugopal, Jayarama Reddy, E-mail: nnijrv@nus.edu.sg [Healthcare and Energy Materials Laboratory, Nanoscience and Nanotechnology Initiative, Faculty of Engineering, National University of Singapore, 117576 (Singapore); Sundarrajan, Subramanian [Healthcare and Energy Materials Laboratory, Nanoscience and Nanotechnology Initiative, Faculty of Engineering, National University of Singapore, 117576 (Singapore); Department of Mechanical Engineering, National University of Singapore, 117576 (Singapore); Mukherjee, Shayanti [Healthcare and Energy Materials Laboratory, Nanoscience and Nanotechnology Initiative, Faculty of Engineering, National University of Singapore, 117576 (Singapore); Sridhar, Radhakrishnan [Healthcare and Energy Materials Laboratory, Nanoscience and Nanotechnology Initiative, Faculty of Engineering, National University of Singapore, 117576 (Singapore); Department of Mechanical Engineering, National University of Singapore, 117576 (Singapore); Ramakrishna, Seeram, E-mail: seeram@nus.edu.sg [Healthcare and Energy Materials Laboratory, Nanoscience and Nanotechnology Initiative, Faculty of Engineering, National University of Singapore, 117576 (Singapore); Department of Mechanical Engineering, National University of Singapore, 117576 (Singapore)

    2012-08-01

    Tissue engineering scaffolds for skin tissue regeneration is an ever expounding area of research, as the products that meet the necessary requirements are far and elite. The nanofibrous poly-L-lactic acid/poly-({alpha},{beta})-DL-aspartic acid/Collagen (PLLA/PAA/Col I and III) scaffolds were fabricated by electrospinning and characterized by SEM, contact angle and FTIR analysis for skin tissue regeneration. The cell-scaffold interactions were analyzed by cell proliferation and their morphology observed in SEM. The results showed that the cell proliferation was significantly increased (p {<=} 0.05) in PLLA/PAA/Col I and III scaffolds compared to PLLA and PLLA/PAA nanofibrous scaffolds. The abundance and accessibility of adipose derived stem cells (ADSCs) may prove to be novel cell therapeutics for dermal tissue regeneration. The differentiation of ADSCs was confirmed using collagen expression and their morphology by CMFDA dye extrusion technique. The current study focuses on the application of PLLA/PAA/Col I and III nanofibrous scaffolds for skin tissue engineering and their potential use as substrate for the culture and differentiation of ADSCs. The objective for inclusion of a novel cell binding moiety like PAA was to replace damaged extracellular matrix and to guide new cells directly into the wound bed with enhanced proliferation and overall organization. This combinatorial epitome of PLLA/PAA/Col I and III nanofibrous scaffold with stem cell therapy to induce the necessary paracrine signalling effect would favour faster regeneration of the damaged skin tissues. - Highlights: Black-Right-Pointing-Pointer Differentiation of adipose derived stem cells in the presence of bFGF for wound healing Black-Right-Pointing-Pointer Introduction of PAA as ECM mimetic cell binding moiety Black-Right-Pointing-Pointer Combination of PLLA/PAA/Col I and III nanofibers and stem cell therapy for skin regeneration.

  18. Fibrates suppress bile acid synthesis via peroxisome proliferator-activated receptor-alpha-mediated downregulation of cholesterol 7 alpha-hydroxylase and sterol 27-hydroxylase expression

    NARCIS (Netherlands)

    Post, SM; Duez, H; Gervois, PP; Staels, B; Kuipers, F; Princen, HMG

    2001-01-01

    Fibrates are hypolipidemic drugs that affect the expression of genes involved in lipid metabolism by activating peroxisome proliferator-activated receptors (PPARs). Fibrate treatment causes adverse changes in biliary lipid composition and decreases bile acid excretion, leading to an increased

  19. aguA, the gene encoding an extracellular alpha-glucuronidase from Aspergillus tubingensis, is specifically induced on xylose and not on glucuronic acid.

    Science.gov (United States)

    de Vries, R P; Poulsen, C H; Madrid, S; Visser, J

    1998-01-01

    An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.

  20. Free fatty acids induce ER stress and block antiviral activity of interferon alpha against hepatitis C virus in cell culture

    Directory of Open Access Journals (Sweden)

    Gunduz Feyza

    2012-08-01

    Full Text Available Abstract Background Hepatic steatosis is recognized as a major risk factor for liver disease progression and impaired response to interferon based therapy in chronic hepatitis C (CHC patients. The mechanism of response to interferon-alpha (IFN-α therapy under the condition of hepatic steatosis is unexplored. We investigated the effect of hepatocellular steatosis on hepatitis C virus (HCV replication and IFN-α antiviral response in a cell culture model. Methods Sub-genomic replicon (S3-GFP and HCV infected Huh-7.5 cells were cultured with a mixture of saturated (palmitate and unsaturated (oleate long-chain free fatty acids (FFA. Intracytoplasmic fat accumulation in these cells was visualized by Nile red staining and electron microscopy then quantified by microfluorometry. The effect of FFA treatment on HCV replication and IFN-α antiviral response was measured by flow cytometric analysis, Renilla luciferase activity, and real-time RT-PCR. Results FFA treatment induced dose dependent hepatocellular steatosis and lipid droplet accumulation in the HCV replicon cells was confirmed by Nile red staining, microfluorometry, and by electron microscopy. Intracellular fat accumulation supports replication more in the persistently HCV infected culture than in the sub-genomic replicon (S3-GFP cell line. FFA treatment also partially blocked IFN-α response and viral clearance by reducing the phosphorylation of Stat1 and Stat2 dependent IFN-β promoter activation. We show that FFA treatment induces endoplasmic reticulum (ER stress response and down regulates the IFNAR1 chain of the type I IFN receptor leading to defective Jak-Stat signaling and impaired antiviral response. Conclusion These results suggest that intracellular fat accumulation in HCV cell culture induces ER stress, defective Jak-Stat signaling, and attenuates the antiviral response, thus providing an explanation to the clinical observation regarding how hepatocellular steatosis influences IFN

  1. Biodegradable interpolyelectrolyte complexes based on methoxy poly(ethylene glycol)-b-poly(alpha,L-glutamic acid) and chitosan.

    Science.gov (United States)

    Luo, Kun; Yin, Jingbo; Song, Zhijiang; Cui, Lei; Cao, Bin; Chen, Xuesi

    2008-10-01

    We synthesized methoxy poly(ethylene glycol)-b-poly(alpha,L-glutamic acid) (mPEGGA) diblock copolymer by ring-opening polymerization of N-carboxy anhydride of gamma-benzyl-L-glutamate (NCA) using amino-terminated methoxy polyethylene glycol (mPEG) as macroinitiator. Polyelectrolyte complexation between mPEGGA as neutral-block-polyanion and chitosan (CS) as polycation has been scrutinized in aqueous solution as well as in the solid state. Water-soluble polyelectrolyte complexes (PEC) can be formed only under nonstoichiometric condition while phase separation is observed when approaching 1:1 molar mixing ratio in spite of the existence of hydrophilic mPEG block. This is likely due to mismatch in chain length between polyanion block of the copolymer and the polycation or hydrogen bonding between the components. Hydrodynamic size of primary or soluble PEC is determined to be about 200 nm, which is larger than those reported in some literatures. The increase in polyion chain length of the copolymer leads to the increase in the hydrodynamic size of the water-soluble PEC. Formation of spherical micelles by the mPEGGA/CS complex at nonstoichiometirc condition has been confirmed by the scanning electron microscopy observation and transmission electron microscopy observations. The homopolymer CS experiences attractive interaction with both mPEGA and PGA blocks within the copolymer. Competition of hydrogen bonding and electrostatic force in the system or hydrophilic mPEG segments weakens the electrostatic interaction between the oppositely charged polyions. The existence of hydrogen bonding restrains the mobility of mPEG chains of the copolymer and completely prohibits crystallization of mPEG segments. In vitro culture of human fibroblasts indicates that mPEGGA/CS-based materials have potential in biomedical application, especially in tissue engineering.

  2. Alpha Hydroxy Acids

    Science.gov (United States)

    ... 114 adverse dermatologic experience reports for AHA-containing skin care products between 1992 and February 2004, with the ... 1, pages 21-27). These studies confirmed previous industry studies indicating that applying AHAs to the skin results in increased UV sensitivity. After four weeks ...

  3. Towards stereoselective radiosynthesis of alpha-[C-11]methylsubstituted aromatic alpha-amino acids - a challenge of creation of quaternary asymmetric centre in a very short time

    Czech Academy of Sciences Publication Activity Database

    Popkov, A.; Nádvorník, M.; Kružberská, Pavla; Lyčka, A.; Lehel, S.; Gillings, N.

    2007-01-01

    Roč. 50, 5-6 (2007), s. 370-374 ISSN 0362-4803 Institutional research plan: CEZ:AV0Z50070508 Keywords : asymmetric synthesis * alfa-methyl amino acids * carbon-11 Subject RIV: CE - Biochemistry Impact factor: 1.142, year: 2007

  4. Altered TNF-Alpha, Glucose, Insulin and Amino Acids in Islets Langerhans Cultured in a Microgravity Model System

    Science.gov (United States)

    Tobin, Brian W.; Leeper-Woodford, Sandra K.; Hashemi, Brian B.; Smith, Scott M.; Sams, Clarence F.

    2001-01-01

    The present studies were designed to determine effects of a microgravity model system upon lipopolysaccharide (LPS) stimulated tumor necrosis factor alpha (TNF-alpha) activity and indices of insulin and fuel homeostasis of pancreatic islets of Langerhans. Islets (1726+/-1 17,150 u IEU) from Wistar Furth rats were treated as: 1) HARV (High Aspect Ratio Vessel cell culture) , 2) HARV plus LPS, 3) static culture, 4) static culture plus LPS. TNF-alpha (L929 cytotoxicity assay) was significantly increased in LPS-induced HARV and static cultures, yet the increase was more pronounced in the static culture group (pinsulin concentration was demonstrated in the LPS stimulated HARV culture (palterations in LPS induced TNF-alpha production of pancreatic islets of Langerhans, favoring a lesser TNF activity in the HARV. These alterations in fuel homeostasis may be promulgated by gravity averaged cell culture methods or by three dimensional cell assembly.

  5. Maple syrup urine disease: The E1{beta} gene of human branched-chain {alpha}-ketoacid dehydrogenase complex has 11 rather than 10 exons, and the 3{prime} UTR in one of the two E1{beta} mRNAs arises from intronic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, J.L.; Chuang, D.T.; Cox, R.P. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States)

    1996-06-01

    Maple syrup urine disease (MSUD) or branched-chain ketoaciduria is caused by a deficiency in the mitochondrial branched-chain {alpha}-ketoacid dehydrogenase (BCKAD) complex. The clinical manifestations are characterized by accumulation of branched chain amino and {alpha}-ketoacids, which leads to severe cerebral edema with seizures, ketoacidosis, and mental retardation. The BCKAD complex comprises three catalytic components, i.e., a decarboxylase (E1) consisting of two E1{alpha} (M{sub r} = 46,000) and two E1{Beta} (M{sub r} = 37,500) subunits, a transacylase (E2) that contains 24 lipoic acid-bearing subunits, and a dehydrogenase (E3), which is a homodimeric flavoprotein. MSUD is genetically heterogeneous, since mutations in the E1{alpha} subunit (type IA MSUD), the E1{Beta} subunit (type IB), the E2 subunit (type II) and the E3 subunit (type III) have been described. The functional consequences of certain mutations in the BCKAD complex have been studied. 23 refs., 3 figs.

  6. Effects of acidic water and aluminum exposure on gill Na(+), K(+)-ATPase alpha-subunit isoforms, enzyme activity, physiology and return rates in Atlantic salmon (Salmo salar L.).

    Science.gov (United States)

    Nilsen, Tom O; Ebbesson, Lars O E; Kverneland, Ole G; Kroglund, Frode; Finstad, Bengt; Stefansson, Sigurd O

    2010-05-05

    Na(+), K(+)-ATPase (NKA) is involved, through its role as a major driving force for electrochemical gradients, in a range of transmembrane transport processes. Maintenance of homeostasis in anadromous salmonids requires modulation of several gill ion secretory proteins as part of the preparatory adaptation and acclimation to marine life. Atlantic salmon smolts were exposed to combinations of low pH and inorganic aluminum (acid/Al(i)) in freshwater (FW) and were then transferred to seawater (SW) for studies of post-smolt performance. Gill mRNA levels of four NKA-alpha isoforms (alpha1a, alpha1b, alpha1c and alpha3) of the catalytic NKA subunit and NKA enzyme activity were measured. Moderate acid/Al treatment (MOD, pH 5.9+/-0.3, 15+/-9microgl(-1)Al(i)) prevented the FW preparatory increase in NKA activity observed in control (CON, pH 6.9+/-0.1, 8+/-3microgl(-1)Al(i)) smolts, while high acid/Al treatment (SEV, pH 5.6+/-0.2, 30+/-7microgl(-1)Al(i)) caused a rapid and persistent reduction in NKA activity. Correspondingly, a 3.3-fold increase in plasma glucose levels in the SEV groups concurrent with a decrease in plasma chloride levels suggest that acid/Al exposed fish were stressed and experienced problems maintaining ion homeostasis. Gill NKA activities in acid/Al exposed groups were re-established after 28 days in SW. Both long (9 days) and short-term (2.5 days) treatments had significant impact on isoform-specific Na(+), K(+)-ATPase alpha-subunit mRNA abundance in the FW period. Acid/Al exposed groups lacked the preparatory increases in all NKA-alpha isoform mRNA levels seen in the CON group, except for alpha1a. In contrast to the other isoforms measured, alpha1a mRNA abundance decreased sharply upon SW transfer, supporting the hypothesis of isozyme shifting as a mechanism of altering the gill from an ion absorbing to an ion excreting tissue during smoltification and SW exposure. Adult return rates to the Imsa river were significantly reduced both in short-term (78

  7. Interaction between retinoid acid receptor-related orphan receptor alpha (RORA and neuropeptide S receptor 1 (NPSR1 in asthma.

    Directory of Open Access Journals (Sweden)

    Nathalie Acevedo

    Full Text Available Retinoid acid receptor-related Orphan Receptor Alpha (RORA was recently identified as a susceptibility gene for asthma in a genome-wide association study. To investigate the impact of RORA on asthma susceptibility, we performed a genetic association study between RORA single nucleotide polymorphisms (SNPs in the vicinity of the asthma-associated SNP (rs11071559 and asthma-related traits. Because the regulatory region of a previously implicated asthma susceptibility gene, Neuropeptide S receptor 1 (NPSR1, has predicted elements for RORA binding, we hypothesized that RORA may interact biologically and genetically with NPSR1. 37 RORA SNPs and eight NPSR1 SNPs were genotyped in the Swedish birth cohort BAMSE (2033 children and the European cross-sectional PARSIFAL study (1120 children. Seven RORA SNPs confined into a 49 kb region were significantly associated with physician-diagnosed childhood asthma. The most significant association with rs7164773 (T/C was driven by the CC genotype in asthma cases (OR = 2.0, 95%CI 1.36-2.93, p = 0.0003 in BAMSE; and 1.61, 1.18-2.19, p = 0.002 in the combined BAMSE-PARSIFAL datasets, respectively, and strikingly, the risk effect was dependent on the Gln344Arg mutation in NPSR1. In cell models, stimulation of NPSR1 activated a pathway including RORA and other circadian clock genes. Over-expression of RORA decreased NPSR1 promoter activity further suggesting a regulatory loop between these genes. In addition, Rora mRNA expression was lower in the lung tissue of Npsr1 deficient mice compared to wildtype littermates during the early hours of the light period. We conclude that RORA SNPs are associated with childhood asthma and show epistasis with NPSR1, and the interaction between RORA and NPSR1 may be of biological relevance. Combinations of common susceptibility alleles and less common functional polymorphisms may modify the joint risk effects on asthma susceptibility.

  8. The effects of short-term alpha-ketoisocaproic acid supplementation on exercise performance: a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Yarrow Joshua F

    2007-07-01

    Full Text Available Abstract Background This study examined the efficacy of short-term alpha-ketoisocaproic acid (KIC monotherapy supplementation immediately prior to moderate- and high-intensity single bout exercise performance. Methods Thirteen resistance trained men (22.8 ± 2.5 years; 81.6 ± 12.6 kg participated in a prospective, randomized, double blind, placebo controlled crossover experiment. Each subject completed one familiarization and four experimental trials with either 1.5 g or 9.0 g of either KIC or isocaloric placebo control (CONT, following an overnight fast. During the experimental trials, subjects consumed the supplement regimen and then completed leg and chest press repetitions to failure and 30 s of repeated maximal vertical jumping (VJ on a force plate. Results In this treatment regimen, no significant differences (p > 0.05 were observed between dosages or conditions for leg press (low CONT = 19.8 ± 0.4 SEM, low KIC = 21.0 ± 0.5, high CONT = 20.1 ± 0.3, high KIC = 22.4 ± 0.6 or chest press (low CONT = 18.1 ± 0.2, low KIC = 18.5 ± 0.3, high CONT = 17.8 ± 0.3, high KIC = 18.0 ± 0.3 repetitions to failure. Additionally, no significant differences were observed for peak or mean VJ performance (low CONT = 34.6 ± 2.2 cm and 28.6 ± 1.8 cm; low KIC = 35.6 ± 2.0 cm and 29.4 ± 1.6 cm; high CONT = 35.7 ± 2.1 cm and 29.4 ± 1.7 cm; high KIC = 34.8 ± 2.3 cm and 28.3 ± 1.7 cm, respectively. Conclusion Based on our results, we conclude that acute KIC ingestion by itself with no other ergogenic supplement, immediately prior to exercise, did not alter moderate- nor high-intensity single-bout exercise performance in young resistance-trained males. This study addressed single-dose single-bout performance events; the efficacy of KIC monotherapy supplementation on repeated high-intensity exercise bouts and long-term exercise training remains unknown.

  9. Estimation of free energy barriers in the cytoplasmic and mitochondrial aspartate aminotransferase reactions probed by hydrogen-exchange kinetics of C alpha-labeled amino acids with solvent

    International Nuclear Information System (INIS)

    Julin, D.A.; Wiesinger, H.; Toney, M.D.; Kirsch, J.F.

    1989-01-01

    The existence of the postulated quinonoid intermediate in the cytoplasmic aspartate amino-transferase catalyzed transamination of aspartate to oxaloacetate was probed by determining the extent of transfer of tritium from the C alpha position of tritiated L-aspartate to pyridoxamine 5'-phosphate in single turnover experiments in which washout from the back-reaction was obviated by product trapping. The maximum amount of transferred tritium observed was 0.7%, consistent either with a mechanism in which a fraction of the net transamination reaction proceeds through a quinonoid intermediate or with a mechanism in which this intermediate is formed off the main reaction pathway. It is shown that transfer of labeled hydrogen from the amino acid to cofactor cannot be used to differentiate a stepwise from a concerted transamination mechanism. The amount of tritium transferred is a function of the rate constant for torsional equilibration about the epsilon-amino group of Lys-258, the presumptive abstractor of the C alpha proton; the relative rate constants for hydrogen exchange with solvent versus cofactor protonation; and the tritium isotope effect on this ratio. The free energy barriers facing the covalent intermediate between aldimine and keto acid product (i.e., ketimine and possibly quinonoid) were evaluated relatively by comparing the rates of C alpha-hydrogen exchange in starting amino acid with the rates of keto acid formation. The value of theta (= kexge/kprod) was found to be 2.6 for the reaction of cytoplasmic isozyme with aspartate and ca. 0.5 for that of the mitochondrial form with glutamate

  10. Gene knockout of the alpha6 subunit of the gamma-aminobutyric acid type A receptor: lack of effect on responses to ethanol, pentobarbital, and general anesthetics.

    Science.gov (United States)

    Homanics, G E; Ferguson, C; Quinlan, J J; Daggett, J; Snyder, K; Lagenaur, C; Mi, Z P; Wang, X H; Grayson, D R; Firestone, L L

    1997-04-01

    The alpha6 subunit of the gamma-aminobutyric acid type A receptor (GABA(A)-R) has been implicated in mediating the intoxicating effects of ethanol and the motor ataxic effects of general anesthetics. To test this hypothesis, we used gene targeting in embryonic stem cells to create mice lacking a functional alpha6 gene. Homozygous mice are viable and fertile and have grossly normal cerebellar cytoarchitecture. Northern blot and reverse transcriptase-polymerase chain reaction analyses demonstrated that the targeting event disrupted production of functional alpha6 mRNA. Autoradiography of histological sections of adult brains demonstrated that diazepam-insensitive binding of [3H]Ro15-4513 to the cerebellar granule cell layer of wild-type mice was completely absent in homozygous mice. Cerebellar GABA(A)-R density was unchanged in the mutant mice; however, the apparent affinity for muscimol was markedly reduced. Sleep time response to injection of ethanol after pretreatment with vehicle or Ro15-4513 did not differ between genotypes. Sleep time response to injection of pentobarbital and loss of righting reflex and response to tail clamp stimulus in mice anesthetized with volatile anesthetics also did not differ between genotypes. Thus, the alpha6 subunit of the GABA(A)-R is not required for normal development, viability, and fertility and does not seem to be a critical or unique component of the neuronal pathway mediating the hypnotic effect of ethanol and its antagonism by Ro15-4513 in mice. Similarly, the alpha6 subunit does not seem to be involved in the behavioral responses to general anesthetics or pentobarbital.

  11. Alteration of alpha 1 Na+,K(+)-ATPase 86Rb+ influx by a single amino acid substitution

    International Nuclear Information System (INIS)

    Herrera, V.L.; Ruiz-Opazo, N.

    1990-01-01

    The sodium- and potassium-dependent adenosine triphosphatase (Na+,K(+)-ATPase) maintains the transmembrane Na+ gradient to which is coupled all active cellular transport systems. The R and S alleles of the gene encoding the Na+,K(+)-ATPase alpha 1 subunit isoform were identified in Dahl salt-resistant (DR) and Dahl salt-sensitive (DS) rats, respectively. Characterization of the S allele-specific Na+,K(+)-ATPase alpha 1 complementary DNA identified a leucine substitution of glutamine at position 276. This mutation alters the hydropathy profile of a region in proximity to T3(Na), the trypsin-sensitive site that is only detected in the presence of Na+. This mutation causes a decrease in the rubidium-86 influx of S allele-specific sodium pumps, thus marking a domain in the Na+,K(+)-ATPase alpha subunit important for K+ transport, and supporting the hypothesis of a putative role of these pumps in hypertension

  12. Alteration of alpha 1 Na+,K(+)-ATPase sup 86 Rb sup + influx by a single amino acid substitution

    Energy Technology Data Exchange (ETDEWEB)

    Herrera, V.L.; Ruiz-Opazo, N. (Boston Univ. School of Medicine, MA (USA))

    1990-08-31

    The sodium- and potassium-dependent adenosine triphosphatase (Na+,K(+)-ATPase) maintains the transmembrane Na+ gradient to which is coupled all active cellular transport systems. The R and S alleles of the gene encoding the Na+,K(+)-ATPase alpha 1 subunit isoform were identified in Dahl salt-resistant (DR) and Dahl salt-sensitive (DS) rats, respectively. Characterization of the S allele-specific Na+,K(+)-ATPase alpha 1 complementary DNA identified a leucine substitution of glutamine at position 276. This mutation alters the hydropathy profile of a region in proximity to T3(Na), the trypsin-sensitive site that is only detected in the presence of Na+. This mutation causes a decrease in the rubidium-86 influx of S allele-specific sodium pumps, thus marking a domain in the Na+,K(+)-ATPase alpha subunit important for K+ transport, and supporting the hypothesis of a putative role of these pumps in hypertension.

  13. Effects of alpha-linolenic acid vs. docosahexaenoic acid supply on the distribution of fatty acids among the rat cardiac subcellular membranes after a short- or long-term dietary exposure

    Directory of Open Access Journals (Sweden)

    Rousseau-Ralliard Delphine

    2009-03-01

    Full Text Available Abstract Background Previous work showed that the functional cardiac effect of dietary alpha-linolenic acid (ALA in rats requires a long feeding period (6 months, although a docosahexaenoic (DHA acid-supply affects cardiac adrenergic response after 2 months. However, the total cardiac membrane n-3 polyunsaturated fatty acid (PUFA composition remained unchanged after 2 months. This delay could be due to a specific reorganization of the different subcellular membrane PUFA profiles. This study was designed to investigate the evolution between 2 and 6 months of diet duration of the fatty acid profile in sarcolemmal (SL, mitochondrial (MI, nuclear (NU and sarcoplasmic reticulum (SR membrane fractions. Methods Male Wistar rats were randomly assigned to 3 dietary groups (n = 10/diet/period, either n-3 PUFA-free diet (CTL, or ALA or DHA-rich diets. After 2 or 6 months, the subcellular cardiac membrane fractions were separated by differential centrifugations and sucrose gradients. Each membrane profile was analysed by gas chromatography (GC after lipid extraction. Results As expected the n-3 PUFA-rich diets incorporated n-3 PUFA instead of n-6 PUFA in all the subcellular fractions, which also exhibited individual specificities. The diet duration increased SFA and decreased PUFA in SL, whereas NU remained constant. The SR and MI enriched in n-3 PUFA exhibited a decreased DHA level with ageing in the DHA and CTL groups. Conversely, the n-3 PUFA level remained unchanged in the ALA group, due to a significant increase in docosapentaenoic acid (DPA. N-3 PUFA rich diets lead to a better PUFA profile in all the fractions and significantly prevent the profile modifications induced by ageing. Conclusion With the ALA diet the n-3 PUFA content, particularly in SR and SL kept increasing between 2 and 6 months, which may partly account for the delay to achieve the modification of adrenergic response.

  14. EFFECTS OF L-ASCORBIC ACID AND ALPHA-TOCOPHEROL ON BIOCHEMICAL PARAMETERS OF SWIMMING-INDUCED OXIDATIVE STRESS IN SERUM OF GUINEA PIGS.

    Science.gov (United States)

    Bursać-Mitrović, Marija; Milovanović, Dragan R; Mitić, Radoslav; Jovanović, Danijela; Sovrlić, Miroslav; Vasiljević, Perica; Tomović, Jovica; Manojlović, Nedeljko

    2016-01-01

    The purpose of this study is to determine the effect of L-ascorbic acid and alpha-tocopherol as well as combination of these vitamins with or without exposure to physical exercise on intensity of lipid peroxidation, activity of xanthine oxidase, activity of total antioxidative system, concentration of glutathione, and activity of catalase in the serum of guinea pigs. The experimental measurements of intensity of lipid peroxidation, activity of xanthine oxidase, activity of total antioxidative system, concentration of glutathione, and activity of catalase were done in the serum of guinea pigs. The animals were exposed to the test load to achieve exhaustion and the test was terminated when the animal for the third time to sink into the water. The results of this study demonstrated that endurance exercise of guinea pigs induced oxidative stress response in terms of increased lipid peroxidation and activity of xanthine oxidase in the serum of experimental animals. Our study investigated the antioxidant activity of L-ascorbic acid and alpha-tocopherol also measuring three protective markers in the serum: total antioxidant activity, content of glutathione and activity of catalase. The results obtained show that the vitamins influence the concentrations of above mentioned biochemical parameters, which points out their protective effect of swimming-induced oxidative stress. Single or combined administration of L-ascorbic acid and alpha-tocopherol caused significant inhibition of these markers indicating the important antioxidant activity of the vitamins. Results lead to conclude that the combined treatments with vitamins with or without exposure to physical exercise showed the clear synergistic effect..

  15. ischemic brain injury in neonatal rats

    African Journals Online (AJOL)

    Alpha-lipoic acid (ALA) is an endogenous antioxidant synthesized mainly by the mitochondria of the liver, heart, ... Chemicals. Alpha-lipoic acid, dimethyl sulfoxide, and bromophenol blue were purchased from Sigma- ..... have been due to free-radical generation. Both. ALA doses (50 and 100 mg/kg) substantially improved ...

  16. The amino-terminal 200 amino acids of the plasma membrane Na+,K+-ATPase alpha subunit confer ouabain sensitivity on the sarcoplasmic reticulum Ca(2+)-ATPase.

    OpenAIRE

    Ishii, T; Takeyasu, K

    1993-01-01

    Cardiac glycosides such as G-strophanthin (ouabain) bind to and inhibit the plasma membrane Na+,K(+)-ATPase but not the sarcoplasmic reticulum (SR) Ca(2+)-ATPase, whereas thapsigargin specifically blocks the SR Ca(2+)-ATPase. The chimera [n/c]CC, in which the amino-terminal amino acids Met1 to Asp162 of the SR Ca(2+)-ATPase (SERCA1) were replaced with the corresponding portion of the Na+,K(+)-ATPase alpha 1 subunit (Met1 to Asp200), retained thapsigargin- and Ca(2+)-sensitive ATPase activity,...

  17. New entry for synthesis of N-acylhydrazones, pyridazinones, and 1,3,4-oxadiazin-6-ones from alpha-amino acid esters.

    Science.gov (United States)

    Yasui, Eiko; Wada, Masao; Takamura, Norio

    2007-11-01

    Versatile electrophiles N-acylhydrazones are synthesized via diazotization, reduction, and acylation of alpha-amino acid esters. Reduction of diazo esters with L-selectride or tributylphosphine affords the corresponding hydrazones in good yields. Both reducing agents give anti-hydrazones as the major product although the reactivity of each reductant is slightly different. The resulting hydrazones are acylated to give N-acylhydrazones, which are subjected to further reactions to give 1,3,4-oxadiazin-6-ones that serve as useful synthetic intermediates for the Diels-Alder reaction.

  18. Identification of a common amino acid polymorphism in the p85alpha regulatory subunit of phosphatidylinositol 3-kinase

    DEFF Research Database (Denmark)

    Hansen, Torben; Andersen, C B; Echwald, Søren Morgenthaler

    1997-01-01

    in a phenotype study. Single-strand conformational polymorphism and heteroduplex analysis of the coding region of the regulatory p85alpha subunit in cDNA isolated from human muscle tissue from 70 insulin-resistant NIDDM patients and 12 control subjects revealed three silent polymorphisms and a missense mutation...

  19. Influences of AMY1 gene copy number and protein expression on salivary alpha-amylase activity before and after citric acid stimulation in splenic asthenia children.

    Science.gov (United States)

    Yang, Zemin; Lin, Jing; Chen, Longhui; Zhang, Min; Yang, Xiaorong; Chen, Weiwen

    2015-06-01

    To compare the correlations between salivary alpha-amylase (sAA) activity and amylase, alpha 1 (salivary) gene (AMYl) copy number or its gene expression between splenic asthenia and healthy children, and investigate the reasons of attenuated sAA activity ratio before and after citric acid stimulation in splenic asthenia children. Saliva samples from 20 splenic asthenia children and 29 healthy children were collected before and after citric acid stimulation. AMYl copy number, sAA activity, and total sAA and glycosylated sAA contents were determined, and their correlations were analyzed. Although splenic asthenia and healthy children had no differences in AMY1 copy number, splenic asthenia children had positive correlations between AMY1 copy number and sAA activity before or after citric acid stimulation. Splenic asthenia children had a higher sAA glycosylated proportion ratio and glycosylated sAA content ratio, while their total sAA content ratio and sAA activity ratio were lower compared with healthy children. The glycosylated sAA content ratio was higher than the total sAA content ratio in both groups. Splenic asthenia and healthy children had positive correlations between total sAA or glycosylated sAA content and sAA activity. However, the role played by glycosylated sAA content in sAA activity in healthy children increased after citric acid stimulation, while it decreased in splenic asthenia children. Genetic factors like AMY1 copy number variations, and more importantly, sAA glycosylation abnormalities leading to attenuated sAA activity after citric acid stimulation, which were the main reasons of the attenuated sAA activity ratio in splenic asthenia children compared with healthy children.

  20. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Directory of Open Access Journals (Sweden)

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  1. Further evidence of a relationship between the retinoic acid receptor alpha locus and nonsyndromic cleft lip with or without cleft palate (CL [+-] P)

    Energy Technology Data Exchange (ETDEWEB)

    Shaw, D.; Field, L. (Univ. of Calgary (Canada)); Ray, A. (Univ. of Toronto (Canada)); Marazita, M. (Medical College of Virginia, Richmond, VA (United States))

    1993-11-01

    Chenevix-Trench et al. (1992) reported a significant difference between nonsyndromic cleft lip with or without cleft palate (CL [+-] P) cases and unrelated controls in the frequency of alleles at the retinoic acid receptor alpha (RARA) PstI RFLP located at 17q21.1. They also observed borderline significant (P = .055) differences between allele frequencies in subjects with cleft lip and palate (CL + P) compared with those with cleft lip only (CL). Retinoic acid (RA) is a known teratogen capable of producing cleft palate in rodents (Abbott and Birnbaum 1990). Chenevix-Tench et al. (1992) hypothesized that variation in susceptibility to the effects of RA in humans may result from alterations at the RARA locus. We have investigated association and linkage between CL [+-] P and a microsatellite marker (D17S579) located at 17q21 (Hall et al. 1992), selected for its proximity to RARA, in 14 extended multiplex families from rural West Bengal, India.

  2. Acid dissociation constant and apparent nucleophilicity of lysine-501 of the alpha-polypeptide of sodium and potassium ion activated adenosinetriphosphatase

    International Nuclear Information System (INIS)

    Xu, K.Y.

    1989-01-01

    A combination of competitive labeling with [ 3 H]acetic anhydride and immunoaffinity chromatography is described that permits the assignment of the acid dissociation constant and the absolute nucleophilicity of individual lysines in a native enzyme. The acid dissociation constant of lysine-501 of the alpha-polypeptide in native (Na+ + K+)-ATPase was determined. This lysine had a normal pKa of 10.4. The rate constant for the reaction of the free base of lysine-501 with acetic anhydride at 10 degrees C is 400 M-1 s-1. This value is only 30% that for a fully accessible lysine in a protein. The lower than normal apparent nucleophilicity suggests that lysine-501 is hindered from reacting with its intrinsic nucleophilicity by the tertiary structure of the enzyme and is consistent with its location within a pocket that forms the active site upon the surface of the native protein

  3. The esg locus of Myxococcus xanthus encodes the E1 alpha and E1 beta subunits of a branched-chain keto acid dehydrogenase.

    Science.gov (United States)

    Toal, D R; Clifton, S W; Roe, B A; Downard, J

    1995-04-01

    The esg locus of Myxococcus xanthus appears to control the production of a signal that must be transmitted between cells for the completion of multicellular development. DNA sequence analysis suggested that the esg locus encodes the E1 decarboxylase (composed of E1 alpha and E1 beta subunits) of a branched-chain keto acid dehydrogenase (BCKAD) that is involved in branched-chain amino acid (BCAA) metabolism. The properties of an esg::Tn5 insertion mutant supported this conclusion. These properties include: (i) the growth yield of the mutant was reduced with increasing concentrations of the BCAAs in the medium while the growth yield of wild-type cells increased, (ii) mutant extracts were deficient in BCKAD activity, and (iii) growth of the mutant in media with short branched-chain fatty acids related to the expected products of the BCKAD helped to correct the mutant defects in growth, pigmentation and development. The esg BCKAD appears to be involved in the synthesis of long branched-chain fatty acids since the mutant contained reduced levels of this class of compounds. Our results are consistent with a model in which the esg-encoded enzyme is involved in the synthesis of branched-chain fatty acids during vegetative growth, and these compounds are used later in cell-cell signalling during development.

  4. Postprandial lipid responses to an alpha-linolenic acid-rich oil, olive oil and butter in women: a randomized crossover trial.

    Science.gov (United States)

    Svensson, Julia; Rosenquist, Anna; Ohlsson, Lena

    2011-06-28

    Postprandial lipaemia varies with gender and the composition of dietary fat due to the partitioning of fatty acids between beta-oxidation and incorporation into triacylglycerols (TAGs). Increasing evidence highlights the importance of postprandial measurements to evaluate atherogenic risk. Postprandial effects of alpha-linolenic acid (ALA) in women are poorly characterized. We therefore studied the postprandial lipid response of women to an ALA-rich oil in comparison with olive oil and butter, and characterized the fatty acid composition of total lipids, TAGs, and non-esterified fatty acids (NEFAs) in plasma. A randomized crossover design (n = 19) was used to compare the postprandial effects of 3 meals containing 35 g fat. Blood samples were collected at regular intervals for 7 h. Statistical analysis was carried out with ANOVA (significant difference = P postprandial p-TAG and NEFA response in healthy pre-menopausal women was not significantly different after the intake of an ALA-rich oil, olive oil and butter. The ALA-rich oil significantly affected different plasma lipid fractions and improved the ratio of n-6 to n-3 fatty acids several hours postprandially.

  5. Ascorbic acid pre-treated quartz stimulates TNF-alpha release in RAW 264.7 murine macrophages through ROS production and membrane lipid peroxidation.

    Science.gov (United States)

    Scarfì, Sonia; Magnone, Mirko; Ferraris, Chiara; Pozzolini, Marina; Benvenuto, Federica; Benatti, Umberto; Giovine, Marco

    2009-03-19

    Inhalation of crystalline silica induces a pulmonary fibrotic degeneration called silicosis caused by the inability of alveolar macrophages to dissolve the crystalline structure of phagocytosed quartz particles. Ascorbic acid is capable of partially dissolving quartz crystals, leading to an increase of soluble silica concentration and to the generation of new radical sites on the quartz surface. The reaction is specific for the crystalline forms of silica. It has been already demonstrated an increased cytotoxicity and stronger induction of pro-inflammatory cyclooxygenase-2 (COX-2) by ascorbic acid pre-treated quartz (QA) compared to untreated quartz (Q) in the murine macrophage cell line RAW 264.7. Taking advantage of the enhanced macrophage response to QA as compared to Q particles, we investigated the first steps of cell activation and the contribution of early signals generated directly from the plasma membrane to the production of TNF-alpha, a cytokine that activates both inflammatory and fibrogenic pathways. Here we demonstrate that TNF-alpha mRNA synthesis and protein secretion are significantly increased in RAW 264.7 macrophages challenged with QA as compared to Q particles, and that the enhanced response is due to an increase of intracellular ROS. Plasma membrane-particle contact, in the absence of phagocytosis, is sufficient to trigger TNF-alpha production through a mechanism involving membrane lipid peroxidation and this appears to be even more detrimental to macrophage survival than particle phagocytosis itself. Taken together these data suggest that an impairment of pulmonary macrophage phagocytosis, i.e. in the case of alcoholic subjects, could potentiate lung disease in silica-exposed individuals.

  6. Mitochondrial Fatty Acid Synthesis Type II: More than Just Fatty Acids*

    OpenAIRE

    Hiltunen, J. Kalervo; Schonauer, Melissa S.; Autio, Kaija J.; Mittelmeier, Telsa M.; Kastaniotis, Alexander J.; Dieckmann, Carol L.

    2009-01-01

    Eukaryotes harbor a highly conserved mitochondrial pathway for fatty acid synthesis (FAS), which is completely independent of the eukaryotic cytosolic FAS apparatus. The activities of the mitochondrial FAS system are catalyzed by soluble enzymes, and the pathway thus resembles its prokaryotic counterparts. Except for octanoic acid, which is the direct precursor for lipoic acid synthesis, other end products and functions of the mitochondrial FAS pathway are still largel...

  7. Development of calcium-permeable alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors in cultured neocortical neurons visualized by cobalt staining

    DEFF Research Database (Denmark)

    Jensen, J B; Schousboe, A; Pickering, D S

    1998-01-01

    The developmental expression of calcium (Ca2+)-permeable alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainate receptors in cultured neocortical neurons was evaluated by using cobalt uptake, a histochemical method that identifies cells expressing Ca2+-permeable, non-N-methyl......The developmental expression of calcium (Ca2+)-permeable alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainate receptors in cultured neocortical neurons was evaluated by using cobalt uptake, a histochemical method that identifies cells expressing Ca2+-permeable, non......-N-methyl-D-aspartate (non-NMDA) receptors. At a concentration of 500 microM, AMPA was found to stimulate cobalt uptake only late in development, resulting in staining of 2.7%+/-0.3% of the neurons maintained in culture for 12 days in vitro (DIV). When AMPA receptor desensitization was blocked with 50 microM cyclothiazide......, the developmental profile of cobalt uptake mediated by 25 microM AMPA changed dramatically. The cobalt staining now appeared in young cultures (5 DIV), and the percentage of stained cells increased from 3.4%+/-0.2% at 5 DIV to 21.7%+/-1.6% at 12 DIV. The effect of 200 microM kainate was similar to that seen with 25...

  8. CACA-TOCSY with alternate {sup 13}C-{sup 12}C labeling: a {sup 13}C{sup {alpha}} direct detection experiment for mainchain resonance assignment, dihedral angle information, and amino acid type identification

    Energy Technology Data Exchange (ETDEWEB)

    Takeuchi, Koh [National Institute of Advanced Industrial Science and Technology (AIST), Biomedicinal Information Research Center (BIRC) (Japan); Frueh, Dominique P.; Sun, Zhen-Yu J.; Hiller, Sebastian; Wagner, Gerhard, E-mail: gerhard_wagner@hms.harvard.ed [Harvard Medical School, Department of Biological Chemistry and Molecular Pharmacology (United States)

    2010-05-15

    We present a {sup 13}C direct detection CACA-TOCSY experiment for samples with alternate {sup 13}C-{sup 12}C labeling. It provides inter-residue correlations between {sup 13}C{sup {alpha}} resonances of residue i and adjacent C{sup {alpha}s} at positions i - 1 and i + 1. Furthermore, longer mixing times yield correlations to C{sup {alpha}} nuclei separated by more than one residue. The experiment also provides C{sup {alpha}}-to-side chain correlations, some amino acid type identifications and estimates for {psi} dihedral angles. The power of the experiment derives from the alternate {sup 13}C-{sup 12}C labeling with [1,3-{sup 13}C] glycerol or [2-{sup 13}C] glycerol, which allows utilizing the small scalar {sup 3}J{sub CC} couplings that are masked by strong {sup 1}J{sub CC} couplings in uniformly {sup 13}C labeled samples.

  9. Postprandial lipid responses to an alpha-linolenic acid-rich oil, olive oil and butter in women: A randomized crossover trial

    Directory of Open Access Journals (Sweden)

    Rosenquist Anna

    2011-06-01

    Full Text Available Abstract Background Postprandial lipaemia varies with gender and the composition of dietary fat due to the partitioning of fatty acids between beta-oxidation and incorporation into triacylglycerols (TAGs. Increasing evidence highlights the importance of postprandial measurements to evaluate atherogenic risk. Postprandial effects of alpha-linolenic acid (ALA in women are poorly characterized. We therefore studied the postprandial lipid response of women to an ALA-rich oil in comparison with olive oil and butter, and characterized the fatty acid composition of total lipids, TAGs, and non-esterified fatty acids (NEFAs in plasma. Methods A randomized crossover design (n = 19 was used to compare the postprandial effects of 3 meals containing 35 g fat. Blood samples were collected at regular intervals for 7 h. Statistical analysis was carried out with ANOVA (significant difference = P Results No significant difference was seen in incremental area under the curve (iAUC plasma-TAG between the meals. ALA and oleic acid levels were significantly increased in plasma after ALA-rich oil and olive oil meals, respectively. Palmitic acid was significantly increased in plasma-TAG after the butter meal. The ratios of 18:2 n-6 to18:3 n-3 in plasma-TAGs, three and seven hours after the ALA-rich oil meal, were 1.5 and 2.4, respectively. The corresponding values after the olive oil meal were: 13.8 and 16.9; and after the butter meal: 9.0 and 11.6. Conclusions The postprandial p-TAG and NEFA response in healthy pre-menopausal women was not significantly different after the intake of an ALA-rich oil, olive oil and butter. The ALA-rich oil significantly affected different plasma lipid fractions and improved the ratio of n-6 to n-3 fatty acids several hours postprandially.

  10. A high-fat, high-oleic diet, but not a high-fat, saturated diet, reduces hepatic alpha-linolenic acid and eicosapentaenoic acid content in mice

    Science.gov (United States)

    Considerable research centers upon the role of linoleic acid (LNA; 18:2n6) as a competitive inhibitor of a-linolenic (ALA; 18:3n3) metabolism; however, little data exist as to the impact of saturated fatty acids (SFA) and monounsaturated fatty acids (MUFA) on ALA metabolism. We tested the hypothesi...

  11. [Effect of citric acid stimulation on salivary alpha-amylase, total protein, salivary flow rate and pH value in Pi deficiency children].

    Science.gov (United States)

    Yang, Ze-min; Chen, Long-hui; Lin, Jing; Zhang, Min; Yang, Xiao-rong; Chen, Wei-wen

    2015-02-01

    To compare the effect of citric acid stimulation on salivary alpha-amylase (sAA), total protein (TP), salivary flow rate, and pH value between Pi deficiency (PD) children and healthy children, thereby providing evidence for Pi controlling saliva theory. Twenty PD children were recruited, and 29 healthy children were also recruited at the same time. Saliva samples from all subjects were collected before and after citric acid stimulation. The sAA activity and amount, TP contents, salivary flow rate, and pH value were determined and compared. (1) Citric acid stimulation was able to significantly increase salivary flow rate, pH value, sAA activities, sAA specific activity and sAA amount (including glycosylated and non-glycosylated sAA amount) in healthy children (Pvalue, and glycosylated sAA levels in PD children (P0.05), salivary indices except salivary flow rate and glycosylated sAA levels decreased more in PD children. There was statistical difference in sAA activity ratio, sAA specific activity ratio, and the ratio of glycosylated sAA levels between PD children and healthy children (P<0.05). PD children had decreased response to citric acid stimulation.

  12. Acid-, base-, and lewis-acid-catalyzed heterolysis of methoxide from an alpha-hydroxy-beta-methoxy radical: models for reactions catalyzed by coenzyme B12-dependent diol dehydratase.

    Science.gov (United States)

    Xu, Libin; Newcomb, Martin

    2005-11-11

    [Reaction: see text].A model for glycol radicals was employed in laser flash photolysis kinetic studies of catalysis of the fragmentation of a methoxy group adjacent to an alpha-hydroxy radical center. Photolysis of a phenylselenylmethylcyclopropane precursor gave a cyclopropylcarbinyl radical that rapidly ring opened to the target alpha-hydroxy-beta-methoxy radical (3). Heterolysis of the methoxy group in 3 gave an enolyl radical (4a) or an enol ether radical cation (4b), depending upon pH. Radicals 4 contain a 2,2-diphenylcyclopropane reporter group, and they rapidly opened to give UV-observable diphenylalkyl radicals as the final products. No heterolysis was observed for radical 3 under neutral conditions. In basic aqueous acetonitrile solutions, specific base catalysis of the heterolysis was observed; the pK(a) of radical 3 was determined to be 12.5 from kinetic titration plots, and the ketyl radical formed by deprotonation of 3 eliminated methoxide with a rate constant of 5 x 10(7) s(-1). In the presence of carboxylic acids in acetonitrile solutions, radical 3 eliminated methanol in a general acid-catalyzed reaction, and rate constants for protonation of the methoxy group in 3 by several acids were measured. Radical 3 also reacted by fragmentation of methoxide in Lewis-acid-catalyzed heterolysis reactions; ZnBr2, Sc(OTf)3, and BF3 were found to be efficient catalysts. Catalytic rate constants for the heterolysis reactions were in the range of 3 x 10(4) to 2 x 10(6) s(-1). The Lewis-acid-catalyzed heterolysis reactions are fast enough for kinetic competence in coenzyme B12 dependent enzyme-catalyzed reactions of glycols, and Lewis-acid-catalyzed cleavages of beta-ethers in radicals might be applied in synthetic reactions.

  13. Association between fatty acid compositions and genotypes of FABP4 and LXR-alpha in Japanese Black cattle

    Directory of Open Access Journals (Sweden)

    Oyama Kenji

    2008-12-01

    Full Text Available Abstract Background Fatty acid composition has become an important trait in the beef industry in terms of beef flavor and decreasing the circulating concentration of LDL cholesterol. In this study, we examined the association between polymorphisms of six genes, adipocytes-type fatty acid binding protein (FABP4, liver X receptor α (LXRα, cytochrome b5 (Cyt b5, long-chain acyl-CoA synthetase (ACSL 1, ACSL4 and diacylglycerol acyltransferase 2 (DGAT2 and fatty acid composition. Results Sequence comparisons revealed 14 single nucleotide polymorphisms in six genes. Four of them, I74V and V110M in FABP4 and G51E and V133I in LXRα, were nonsynonymous substitutions. The associations between the genotypes and fatty acid compositions were analyzed by using 234 Japanese Black cattle. The genotypes of FABP4 I74V and LXRα V133I were significantly associated with palmitoleic acids (C16:1, P = 0.0086 and linoleic acid (C18:2, P = 0.0121 content in intramuscular fat, respectively. Conclusion Our findings suggest that the two polymorphisms of FABP4 I74V and LXRα V133I might be genetic factors in part associated with palmitoleic acid (FABP4 I74V and linoleic acid (LXRα V133I composition in intramuscular fat of Japanese Black cattle, respectively. Especially, FABP4 I74V had highly significant effect (P

  14. Alpha-fetoprotein (AFP) modulates the effect of serum albumin on brain development by restraining the neurotrophic effect of oleic acid.

    Science.gov (United States)

    García-García, Alejandro G; Polo-Hernández, Erica; Tabernero, Arantxa; Medina, José M

    2015-10-22

    We have previously shown that serum albumin controls perinatal rat brain development through the regulation of oleic acid synthesis by astrocytes. In fact, oleic acid synthesized and released by astrocytes promoted neurite growth, neuron migration and the arrangement of prospective synapses. In this work we show that alpha-fetoprotein (AFP) is also present in the brain during embryonic development, its concentrations peaking at E15.5 and at E19.5. However, after E19.5 AFP concentrations plummeted concurrently with a sharp increase in serum albumin concentrations. At E15.5, AFP is present in caudal regions of the brain, particularly in brain areas undergoing differentiation during this period, such as the thalamic reticular nucleus of the thalamus, the hypothalamus, the amygdala and the hippocampus. Albumin was not detected in the brain at E15.5 but stained brain cells substantially on day E19.5, showing a very similar distribution to that of AFP under the same circumstances. The concentrations of free oleic acid in the brain were inversely correlated with those of AFP, suggesting that the signals elicited by AFP and oleic acid can be inversely associated. GAP-43, a marker of axonal growth that is highly expressed by the presence of oleic acid, was not co-localized with AFP except in the marginal zone and areas delimiting the subplate. AFP prevented the increase in GAP-43 expression caused by the presence of oleic acid in neurons in primary culture in vitro and in organotypic cultures of embryonic rat brain ex vivo, suggesting that AFP may modulate the effect of serum albumin on brain development. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Variations in daily intakes of myristic and alpha-linolenic acids in sn-2 position modify lipid profile and red blood cell membrane fluidity.

    Science.gov (United States)

    Dabadie, Henry; Motta, Claude; Peuchant, Evelyne; LeRuyet, Pascale; Mendy, François

    2006-08-01

    The present study evaluated the effects of moderate intakes of myristic acid (MA), at 1.2% and 1.8% of total energy (TE), associated with a 0.9% TE intake of alpha-linolenic acid (ALA) on lipid and fatty acid profiles and red blood cell membrane fluidity. Twenty-nine monks without dyslipidaemia were enrolled in a 1-year nutritional study in which two experimental diets were tested for 3 months each: diet 1, MA 1.2 % and ALA 0.9%; diet 2, MA 1.8% and ALA 0.9%. A control diet (MA 1.2%, ALA 0.4%) was given 3 months before diets 1 and 2. Thus, two different levels of MA (1.2%, 1.8%) and ALA (0.4%, 0.9%) were tested. Intakes of other fatty acids were at recommended levels. Samples were obtained on completion of all three diets. For fluidity analysis, the red blood cells were labelled with 16-doxylstearate and the probe incorporated the membrane where relaxation-correlation time was calculated. Diet 1 was associated with a decrease in total cholesterol, in LDL-cholesterol, in triacylglycerols and in the ratio of total to HDL-cholesterol; ALA and EPA levels were increased in both phospholipids and cholesterol esters. Diet 2 was associated with a decrease in triacylglycerols and in the ratios of total to HDL-cholesterol and of triacylglycerols to HDL-cholesterol, and with an increase in HDL-cholesterol; EPA levels were decreased in phospholipids and cholesterol esters. Red blood cell membrane fluidity was increased in both diets (Pdiet 1, mainly in the oldest subjects. Intakes of myristic acid (1.2%TE) and ALA (0.9%TE), both mainly in the sn-2 position, were associated with favourable lipid and n-3 long-chain fatty acid profiles. These beneficial effects coexisted with particularly high membrane fluidity, especially among the oldest subjects.

  16. Synthesis and characterization of a lipidic alpha amino acid: solubility and interaction with serum albumin and lipid bilayers.

    Science.gov (United States)

    Filipe, Hugo A L; Coreta-Gomes, Filipe M; Velazquez-Campoy, Adrian; Almeida, Ana R; Peixoto, Andreia F; Pereira, Mariette M; Vaz, Winchil L C; Moreno, Maria J

    2013-04-04

    The lipidic α-amino acid with 11 carbons in the alkyl lateral chain (α-aminotridecanoic acid) was synthesized via multicomponent hydroformylation/Strecker reaction, which is a greener synthetic approach to promote this transformation relative to previously described methods. Its solubility and aggregation behavior in aqueous solutions was characterized, as well as the interaction with lipid bilayers. Lipidic amino acids are very promising molecules in the development of prodrugs with increased bioavailability due to the presence of the two polar functional groups and nonpolar alkyl chain. They are also biocompatible surfactants that may be used in the food and pharmaceutical industry. In this work we have conjugated the lipidic amino acid with a fluorescent polar group (7-nitrobenz-2-oxa-1,3-diazol-4-yl), to mimic drug conjugates, and its association with serum proteins and lipid bilayers was characterized. The results obtained indicate that conjugates of polar molecules with lipidic α-amino acid, via covalent attachment to the amine group, have a relatively high solubility in aqueous solutions due to their negative global charge. They bind to serum albumin with intermediate affinity and show a very high partition coefficient into lipid bilayers in the liquid-disordered state. The attachment of the polar group to the lipidic amino acid increased strongly the aqueous solubility of the amphiphile, although the partition coefficient into lipid membranes was not significantly reduced. Conjugation of polar drugs with lipidic amino acids is therefore an efficient approach to increase their affinity for biomembranes.

  17. Effect of Omega-3 Fatty Acid Supplementation on Plasma Fibroblast Growth Factor 23 Levels in Post-Myocardial Infarction Patients with Chronic Kidney Disease: The Alpha Omega Trial

    Directory of Open Access Journals (Sweden)

    Martin H. de Borst

    2017-11-01

    Full Text Available Fibroblast growth factor 23 (FGF23 is an independent risk factor for cardiovascular mortality in chronic kidney disease. Omega-3 (n-3 fatty acid consumption has been inversely associated with FGF23 levels and with cardiovascular risk. We examined the effect of marine n-3 fatty acids eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA and plant-derived alpha-linolenic acid (ALA on plasma FGF23 levels in post-myocardial infarction patients with chronic kidney disease. In the randomized double-blind Alpha Omega Trial, 4837 patients with a history of myocardial infarction aged 60–80 years (81% men were randomized to one of four trial margarines supplemented with a targeted additional intake of 400 mg/day EPA and DHA, 2 g/day ALA, EPA-DHA plus ALA, or placebo for 41 months. In a subcohort of 336 patients with an eGFR < 60 mL/min/1.73 m2 (creatinine-cystatin C-based CKD-EPI formula, plasma C-terminal FGF23 was measured by ELISA at baseline and end of follow-up. We used analysis of covariance to examine treatment effects on FGF23 levels adjusted for baseline FGF23. Patients consumed 19.8 g margarine/day on average, providing an additional amount of 236 mg/day EPA with 158 mg/day DHA, 1.99 g/day ALA or both, in the active intervention groups. Over 79% of patients were treated with antihypertensive and antithrombotic medication and statins. At baseline, plasma FGF23 was 150 (128 to 172 RU/mL (mean (95% CI. After 41 months, overall FGF23 levels had increased significantly (p < 0.0001 to 212 (183 to 241 RU/mL. Relative to the placebo, the treatment effect of EPA-DHA was indifferent, with a mean change in FGF23 (95% CI of −17 (−97, 62 RU/mL (p = 0.7. Results were similar for ALA (36 (−42, 115 RU/mL and combined EPA-DHA and ALA (34 (−44, 113 RU/mL. Multivariable adjustment, pooled analyses, and subgroup analyses yielded similar non-significant results. Long-term supplementation with modest quantities of EPA-DHA or ALA does not reduce plasma

  18. Retinoic acid dramatically enhances the arsenic trioxide-induced cell cycle arrest and apoptosis in retinoic acid receptor alpha-positive human T-cell lymphotropic virus type-I-transformed cells.

    Science.gov (United States)

    Darwiche, N; El-Sabban, M; Bazzi, R; Nasr, R; Al-Hashimi, S; Hermine, O; de Thé, H; Bazarbachi, A

    2001-01-01

    Adult T-cell leukemia/lymphoma, caused by the human T-cell lymphotropic virus type I, is an aggressive neoplasm of mature activated T cells that is generally resistant to conventional therapy. While arsenic trioxide (As) inhibits the growth and induces apoptosis in HTLV-I-infected T cells, synergistically, when combined with interferon-alpha, variable effects on growth with all trans retinoic acid treatment have been reported in ATL-derived cell lines and fresh ATL cells. In this study, we investigate the effects of ATRA alone or in combination with As in HTLV-I-transformed cells. Four HTLV-I-transformed cell lines (HuT-102, MT2, C8166 and C91PL) were treated with different doses of ATRA alone or in combination with As for one to three days. Cell growth was assessed by cell count with 3H-thymidine incorporation. Cell cycle distribution was assessed by propidium iodine-labeled DNA content by flow cytometry. Apoptosis was evaluated by Hoechst nuclear staining and annexin-V binding assays. Expression of retinoid receptors, the viral transactivator Tax, and the proteins bcl-2 and IkappaB-alpha proteins, was analysed by Western blot. Only C8166 cells were sensitive to the ATRA-induced growth inhibitory effect while HuT-102, MT2, and C91PL were resistant to ATRA treatment (up to 10(-5) M). The retinoid X receptor alpha and the retinoic acid receptor gamma (RARgamma) proteins were expressed in all four cell lines, while RARalpha protein was only detected in the HuT-102 and C8166 cells. The combination ATRA/As showed a highly synergistic effect on HuT-102 cells, and, to a lesser extent, on C8166 cells and resulted in a dramatic inhibition of cell proliferation and induction of massive apoptosis in HuT-102 cells, associated with caspase activation. While ATRA alone had no effect on Tax and IkappaB-alpha protein levels, ATRA increased the As-induced Tax degradation and the up-regulation of IkappaB-alpha protein. In contrast, the expression of bcl-2 protein was not

  19. Polyunsaturated fatty acids levels and initial presentation of somatic symptoms induced by interferon-alpha therapy in patients with chronic hepatitis C viral infection.

    Science.gov (United States)

    Chang, Jane Pei-Chen; Lai, Hsueh-Chou; Yang, Hui-Ting; Su, Wen-Pang; Peng, Cheng-Yuan; Gałecki, Piotr; Walczewska, Anna; Pariante, Carmine M; Su, Kuan-Pin

    2017-06-01

    Somatic symptoms are common in depressive disorder and are similar to sickness behaviors due to inflammatory activation after cytokine administration. Omega-3 polyunsaturated fatty acids (PUFAs) are natural anti-inflammatory agents and may reduce inflammation-induced behavioral changes. The aim of this study was to investigate the role of PUFAs on the development of somatic symptoms and depression in patients of hepatitis C virus infection (HCV) receiving interferon-alpha therapy (IFN-α) in a prospective manner. In this 24-week, prospective cohort study, 43 patients with chronic HCV ongoing IFN-α therapy were assessed with the mini-international neuropsychiatric interview for major depressive episodes and neurotoxicity rating scale (NRS) for somatic symptoms. One-third later developed IFN-α-induced depression (depression (DEP) group). As compared to subjects without depression, DEP group had higher NRS scores (P < 0.001), lower eicosapentaenoic acid (EPA) levels (P = 0.038) at week 2. Somatic symptoms, regardless of painful/non-painful characteristics, had positive association with arachidonic acid (P < 0.05), and negative association with EPA (P < 0.05). This study implies that early intervention with omega-3 PUFAs might be a promising strategy to prevent depression and somatic symptoms in patients receiving cytokine therapy.

  20. Effet de la dose d’acide alpha-linolénique alimentaire sur le métabolisme lipidique

    Directory of Open Access Journals (Sweden)

    Morise Anne

    2005-09-01

    Full Text Available The purpose of our study was to investigate the effects of high doses of ALA provided by linseed oil (containing 50% ALA on its own bioavailability and that of its derivatives as well as on lipid metabolism. We investigated in male hamsters the dose/response effects of ALA over a broad range of supply as linseed oil (1, 10, 20 and 41% of total fatty acids, FA, or 0.4, 3.6, 6.7 and 14.6% of total energy intake. ALA was substituted for oleic acid in order to keep constant linoleic acid (LA and saturated fatty acids which could interfere with the metabolism of n-3 PUFA and lipids, respectively. The capacity of ALA absorption, transport, storage and conversion into EPA had no limitation over the chosen range of dietary intake. However, dietary ALA failed to increase DHA content in plasma phospholipids. In parallel to the increase in EPA, arachidonic acid content decreased, resulting in an improved balance of 20 carbons FA. Moreover, in our atherogenic conditions, triglyceridemia decreased by 45% in response to 10% dietary ALA and was not affected by higher intakes. It was associated with lower hepatic activities of acetyl-CoA-carboxylase (up to – 29% and malic enzyme (up to – 42%, which were negatively correlated to ALA intake (r2 = 0.33 and r2 = 0.38, respectively. Substitution of 10% ALA for oleic acid increased cholesterolemia by 15% but, as in TG, higher ALA intakes did not amplify the response. The highest ALA intake (40% modified dramatically hepatobiliary metabolism of sterols. Thus, replacing 10% oleic acid by ALA is sufficient to improve its bioavailability and that of EPA, and to exert a beneficial hypotriglyceridemic effect, that may be counteracted by the slight increase in cholesterolemia. Higher intakes did not modify these parameters, but a very high dose resulted in adverse effects on sterol metabolism and does not seem appropriate for humans.

  1. Neurite outgrowth of murine cerebellar granule cells can be enhanced by aniracetam with or without alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA).

    Science.gov (United States)

    Fushiki, S; Matsumoto, K; Nagata, A

    1995-10-27

    To assess the neurotrophic effects of a nootropic drug, aniracetam, we studied neurite extension of mouse cerebellar granule cells in culture with low or with high K+ under different combinations of drugs and then immunohistochemically stained the cells with an antibody against L1, a neural cell adhesion molecule on cerebellar granule cells. Quantitative analyses using parameters of the total neurite length, maximal neurite length and number of branches disclosed that aniracetam, in the presence of high K+ and alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA), significantly enhanced neurite extension of cultured granule neurons. Aniracetam alone also stimulated neurite extension of cerebellar granule cells at a longer period of culture with low K+ showing a bell-shaped dose response curve with maximal effects at 10 microM. Aniracetam may influence remodeling of the neural network after injury.

  2. Deletion of N-terminal amino acids from human lecithin:cholesterol acyltransferase differentially affects enzyme activity toward alpha- and beta-substrate lipoproteins.

    Science.gov (United States)

    Vickaryous, Nicola K; Teh, Evelyn M; Stewart, Bruce; Dolphin, Peter J; Too, Catherine K L; McLeod, Roger S

    2003-03-21

    Lecithin:cholesterol acyltransferase (LCAT) is the enzyme responsible for generation of the majority of the cholesteryl esters (CE) in human plasma. Although most plasma cholesterol esterification occurs on high-density lipoprotein (HDL), via alpha-LCAT activity, esterification also occurs on low-density lipoprotein (LDL) via the beta-activity of the enzyme. Computer threading techniques have provided a three-dimensional model for use in the structure-function analysis of the core and catalytic site of the LCAT protein, but the model does not extend to the N-terminal region of the enzyme, which may mediate LCAT interaction with lipoprotein substrates. In the present study, we have examined the functional consequences of deletion of the highly conserved hydrophobic N-terminal amino acids (residues 1-5) of human LCAT. Western blot analysis showed that the mutant proteins (Delta 1-Delta 5) were synthesized and secreted from transfected COS-7 cells at levels approximately equivalent to those of wild-type hLCAT. The secreted proteins had apparent molecular weights of 67 kDa, indicating that they were correctly processed and glycosylated during cellular transit. However, deletion of the first residue of the mature LCAT protein (Delta 1 mutant) resulted in a dramatic loss of alpha-LCAT activity (5% of wild type using reconstituted HDL substrate, rHDL), although this mutant retained full beta-LCAT activity (108% of wild-type using human LDL substrate). Removal of residues 1 and 2 (Delta 2 mutant) abolished alpha-LCAT activity and reduced beta-LCAT activity to 12% of wild type. Nevertheless, LCAT Delta 1 and Delta 2 mutants retained their ability to bind to rHDL and LDL lipoprotein substrates. The dramatic loss of enzyme activity suggests that the N-terminal residues of LCAT may be involved in maintaining the conformation of the lid domain and influence activation by the alpha-LCAT cofactor apoA-I (in Delta 1) and/or loss of enzyme activity (in Delta 1-Delta 5). Since the

  3. Alpha-ketoadipic aciduria, a new inborn error of lysine metabolism; biochemical studies

    NARCIS (Netherlands)

    Przyrembel, Hildegard; Bachmann, Dorothea; Lombeck, Ingrid; Becker, K.; Wendel, U.; Wadman, S.K.; Bremer, H.J.

    1975-01-01

    Investigation of a psychomotorically retarded girl showed excretion of abnormal amounts of alpha-ketoadipic acid, alpha-hydroxyadipic acid, alpha-aminoadipic acid, 1,2-butenedicarboxylic acid and elevation of plasma alpha-aminoadipic acid levels. The identity of these metabolites was established by

  4. Syntheses of {gamma}-aminobutyric-1-{sup 14}C and of {alpha}-aminoadipic-6-{sup 14}C acid from methoxy-3 chloropropyl-magnesium and marked carbon dioxide; Syntheses de l'acide {gamma}-aminobutyrique{sup 14}C-1 et de l'acide {alpha}-aminoadipique {sup 14}C-6 a partir de methoxy-3 chloropropylmagnesium et d'anhydride carbonique marque

    Energy Technology Data Exchange (ETDEWEB)

    Phung Nhu Liem [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires, Departement des radioelements, Service des molecules marquees

    1967-04-01

    Carbonation of {gamma}-methoxypropyl-magnesium chloride by CO{sub 2} gives {gamma}-methoxy-butyric carboxylic-{sup 14}C acid with a yield of about 95 per cent. When the latter is treated successively with anhydrous HBr and with diazomethane, methyl carboxylic {gamma}-bromobutyrate-{sup 14}C is formed. This in turn gives {gamma}-amino-butyric carboxylic-{sup 14}C acid with an overall yield of 66 per cent with respect to Ba{sup 14}CO{sub 3}, when it is condensed with potassium phthalimide and hydrolyzed by acid. By reacting methyl-{gamma}-bromobutyrate-{sup 14}C with the sodium derivative of ethyl cyanacetamido-acetate in ethanol, followed by an acid hydrolysis, {alpha}-aminoadipic-6-{sup 14}C acid is obtained with an overall yield of 46 per cent with respect to Ba{sup 14}CO{sub 3}. (author) [French] La carbonatation du chlorure de {gamma}-methoxypropylmagnesium par {sup 14}CO{sub 2} donne l'acide {gamma}-methoxybutyrique carboxyle {sup 14}C avec un rendement d'environ 95 pour cent. Ce dernier traite successivement par HBr anhydre et par le diazomethane conduit au {gamma}-bromobutyrate de methyle carboxyle {sup 14}C. Celui-ci condense avec le phtalimide de potassium suivi d'une hydrolyse acide fournit l'acide {gamma}-aminobutyrique carboxyle {sup 14}C avec un rendement global de 66 pour cent par rapport a Ba{sup 14}CO{sub 3}. L'action du {gamma}-bromobutyrate de methyle {sup 14}C sur le derive sode du cyanacetamidoacetate d'ethyle dans l'ethanol suivie d'hydrolyse acide donne l'acide {alpha}-aminoadipique {sup 14}C-6 avec un rendement global de 46 pour cent par rapport a Ba{sup 14}CO{sub 3}. (auteur)

  5. Lactic Acid Bacteria Producing Inhibitor of Alpha Glucosidase Isolated from Ganyong (Canna Edulis) and Kimpul (Xanthosoma sagittifolium)

    Science.gov (United States)

    Nurhayati, Rifa; Miftakhussolikhah; Frediansyah, Andri; Lailatul Rachmah, Desy

    2017-12-01

    Type 2 diabetes is a disease that caused by the failure of insulin secretion by the beta cells of the pancreas and insulin resistance in peripheral levels. One therapy for diabetics is by inhibiting the activity of α-glucosidase. Lactic acid bacteria have the ability to inhibit of α-glucosidase activity. The aims of this research was to isolation and screening of lactic acid bacteria from ganyong tuber (Canna Edulis) and kimpul tuber (Xanthosoma sagittifolium), which has the ability to inhibit the activity of α-glucosidase. Eightteen isolates were identified as lactic acid bacteria and all of them could inhibit the activity of α-glukosidase. The GN 8 isolate was perform the highest inhibition acivity.

  6. Modification of Docosahexaenoic Acid Composition of Milk from Nursing Women Who Received Alpha Linolenic Acid from Chia Oil during Gestation and Nursing

    Directory of Open Access Journals (Sweden)

    Rodrigo Valenzuela

    2015-08-01

    Full Text Available α-Linolenic acid (ALA is the precursor of docosahexaenoic acid (DHA in humans, which is fundamental for brain and visual function. Western diet provides low ALA and DHA, which is reflected in low DHA in maternal milk. Chia oil extracted from chia (Salvia hispanica L., a plant native to some Latin American countries, is high in ALA (up to 60% and thereby is an alternative to provide ALA with the aim to reduce DHA deficits. We evaluated the modification of the fatty acid profile of milk obtained from Chilean mothers who received chia oil during gestation and nursing. Forty healthy pregnant women (22–35 years old tabulated for food consumption, were randomly separated into two groups: a control group with normal feeding (n = 21 and a chia group (n = 19, which received 16 mL chia oil daily from the third trimester of pregnancy until the first six months of nursing. The fatty acid profile of erythrocyte phospholipids, measured at six months of pregnancy, at time of delivery and at six months of nursing, and the fatty acid profile of the milk collected during the first six months of nursing were assessed by gas-chromatography. The chia group, compared to the control group, showed (i a significant increase in ALA ingestion and a significant reduction of linoleic acid (LA ingestion, no showing modification of arachidonic acid (AA, eicosapentaenoic acid (EPA and DHA; (ii a significant increase of erythrocyte ALA and EPA and a reduction of LA. AA and DHA were not modified; (iii a increased milk content of ALA during the six months of nursing, whereas LA showed a decrease. AA and EPA were not modified, however DHA increased only during the first three months of nursing. Consumption of chia oil during the last trimester of pregnancy and the first three months of nursing transiently increases the milk content of DHA.

  7. Modification of Docosahexaenoic Acid Composition of Milk from Nursing Women Who Received Alpha Linolenic Acid from Chia Oil during Gestation and Nursing.

    Science.gov (United States)

    Valenzuela, Rodrigo; Bascuñán, Karla; Chamorro, Rodrigo; Barrera, Cynthia; Sandoval, Jorge; Puigrredon, Claudia; Parraguez, Gloria; Orellana, Paula; Gonzalez, Valeria; Valenzuela, Alfonso

    2015-08-04

    α-Linolenic acid (ALA) is the precursor of docosahexaenoic acid (DHA) in humans, which is fundamental for brain and visual function. Western diet provides low ALA and DHA, which is reflected in low DHA in maternal milk. Chia oil extracted from chia (Salvia hispanica L.), a plant native to some Latin American countries, is high in ALA (up to 60%) and thereby is an alternative to provide ALA with the aim to reduce DHA deficits. We evaluated the modification of the fatty acid profile of milk obtained from Chilean mothers who received chia oil during gestation and nursing. Forty healthy pregnant women (22-35 years old) tabulated for food consumption, were randomly separated into two groups: a control group with normal feeding (n = 21) and a chia group (n = 19), which received 16 mL chia oil daily from the third trimester of pregnancy until the first six months of nursing. The fatty acid profile of erythrocyte phospholipids, measured at six months of pregnancy, at time of delivery and at six months of nursing, and the fatty acid profile of the milk collected during the first six months of nursing were assessed by gas-chromatography. The chia group, compared to the control group, showed (i) a significant increase in ALA ingestion and a significant reduction of linoleic acid (LA) ingestion, no showing modification of arachidonic acid (AA), eicosapentaenoic acid (EPA) and DHA; (ii) a significant increase of erythrocyte ALA and EPA and a reduction of LA. AA and DHA were not modified; (iii) a increased milk content of ALA during the six months of nursing, whereas LA showed a decrease. AA and EPA were not modified, however DHA increased only during the first three months of nursing. Consumption of chia oil during the last trimester of pregnancy and the first three months of nursing transiently increases the milk content of DHA.

  8. Steroidal Ribbons from (3 alpha,5 beta,20S)-3-Hycloxy-20-Methyl-Pregnan-21-oic Acid

    Czech Academy of Sciences Publication Activity Database

    Sperduto, C.; Smolková, M.; Jurášek, M.; Malachowska, M.; Venanzi, M.; Monti, D.; Mancini, G.; Wimmer, Zdeněk; Drašar, P.

    2016-01-01

    Roč. 13, č. 10 (2016), s. 711-717 ISSN 1570-1786 Institutional support: RVO:61389030 Keywords : etienic acid * amide bond * copper * networks * gelators * analogs * Aggregation * steroids ribbons * side chain shortening * supramolecular chemistry Subject RIV: CC - Organic Chemistry Impact factor: 0.730, year: 2016 http://www.eurekaselect.com/147510

  9. Potential use of carbon-11 labeled alpha-aminoisobutyric acid (AIB) as an in vivo tracer of amino acid uptake in differing metabolic states

    International Nuclear Information System (INIS)

    Conti, P.S.; Starnes, H.F.; Brennan, M.F.

    1986-01-01

    AIB has been used as a model amino acid for the evaluation of alanine-preferring amino acid transport. Hormonal factors and starvation alter the tissue distribution of amino acids, particularly in liver and muscle. With positron emission tomography and labeling of biochemical tracers with C-11, (t1/2=20.4 min), it is now possible to study amino acid kinetics in vivo using external imaging. In order to investigate the utility of C-11 AIB as an in vivo tracer of altered tissue metabolism, C-14 AIB was studied in groups of rats with either streptozotocin-induced diabetes, insulin-induced hypoglycemia or starvation. The data suggest an increased amino acid uptake in liver in starvation, an increased uptake in muscle in response to insulin and associated hypoglycemia and decreased transport in muscle in starvation, as seen by other investigators. These results suggest that C-11 AIB may be useful as an in vivo monitor of metabolic changes in body tissues

  10. Post-Training Intrahippocampal Injection of Synthetic Poly-Alpha-2,8-Sialic Acid-Neural Cell Adhesion Molecule Mimetic Peptide Improves Spatial Long-Term Performance in Mice

    Science.gov (United States)

    Florian, Cedrick; Foltz, Jane; Norreel, Jean-Chretien; Rougon, Genevieve; Roullet, Pascal

    2006-01-01

    Several data have shown that the neural cell adhesion molecule (NCAM) is necessary for long-term memory formation and might play a role in the structural reorganization of synapses. The NCAM, encoded by a single gene, is represented by several isoforms that differ with regard to their content of alpha-2,8-linked sialic acid residues (PSA) on their…

  11. Oxidative cleavage of ribofuranose 5-(alpha-hydroxyphosphonates): a route to erythrofuranose-based nucleoside phosphonic acids

    Czech Academy of Sciences Publication Activity Database

    Králíková, Šárka; Buděšínský, Miloš; Tomečková, Ivana; Rosenberg, Ivan

    2006-01-01

    Roč. 62, č. 41 (2006), s. 9742-9750 ISSN 0040-4020 R&D Projects: GA ČR GP203/04/P273; GA ČR GA203/05/0827; GA ČR GA202/05/0628 Institutional research plan: CEZ:AV0Z40550506 Keywords : AMP analogue * nucleoside phosphonic acid * sugar phosphonate Subject RIV: CC - Organic Chemistry Impact factor: 2.817, year: 2006

  12. Stability of the acetic acid-induced bladder irritation model in alpha chloralose-anesthetized female cats.

    Directory of Open Access Journals (Sweden)

    F Aura Kullmann

    Full Text Available Time- and vehicle-related variability of bladder and urethral rhabdosphincter (URS activity as well as cardiorespiratory and blood chemistry values were examined in the acetic acid-induced bladder irritation model in α-chloralose-anesthetized female cats. Additionally, bladder and urethra were evaluated histologically using Mason trichrome and toluidine blue staining. Urodynamic, cardiovascular and respiratory parameters were collected during intravesical saline infusion followed by acetic acid (0.5% to irritate the bladder. One hour after starting acetic acid infusion, a protocol consisting of a cystometrogram, continuous infusion-induced rhythmic voiding contractions, and a 5 min "quiet period" (bladder emptied without infusion was precisely repeated every 30 minutes. Administration of vehicle (saline i.v. occurred 15 minutes after starting each of the first 7 cystometrograms and duloxetine (1mg/kg i.v. after the 8(th. Acetic acid infusion into the bladder increased URS-EMG activity, bladder contraction frequency, and decreased contraction amplitude and capacity, compared to saline. Bladder activity and URS activity stabilized within 1 and 2 hours, respectively. Duloxetine administration significantly decreased bladder contraction frequency and increased URS-EMG activity to levels similar to previous reports. Cardiorespiratory parameters and blood gas levels remained consistent throughout the experiment. The epithelium of the bladder and urethra were greatly damaged and edema and infiltration of neutrophils in the lamina propria of urethra were observed. These data provide an ample evaluation of the health of the animals, stability of voiding function and appropriateness of the model for testing drugs designed to evaluate lower urinary tract as well as cardiovascular and respiratory systems function.

  13. The role of boronic acids in accelerating condensation reactions of [small alpha]-effect amines with carbonyls

    OpenAIRE

    Gillingham, Dennis

    2016-01-01

    A broad palette of bioconjugation reactions are available for chemical biologists, but an area that still requires investigation is high-rate constant reactions. These are indispensable in certain applications, particularly for in vivo labelling. Appropriately positioned boronic acids accelerate normally sluggish Schiff base condensations of α-effect nucleophiles by five orders of magnitude – providing a new entry to the rare set of reactions that have a rate constant above 100 M−1 s−1 under ...

  14. Structure-function relationships in the Na,K-ATPase. cap alpha. subunit: site-directed mutagenesis of glutamine-111 to arginine and asparagine-122 to aspartic acid generates a ouabain-resistant enzyme

    Energy Technology Data Exchange (ETDEWEB)

    Price, E.M.; Lingrel, J.B.

    1988-11-01

    Na,K-ATPases from various species differ greatly in their sensitivity to cardiac glycosides such as ouabain. The sheep and human enzymes are a thousand times more sensitive than the corresponding ones from rat and mouse. To define the region of the ..cap alpha..1 subunit responsible for this differential sensitivity, chimeric cDNAs of sheep and rat were constructed and expressed in ouabain-sensitive HeLa cells. The construct containing the amino-terminal half of the rat ..cap alpha..1 subunit coding region and carboxyl-terminal half of the sheep conferred the ouabain-resistant phenotype to HeLa cells while the reverse construct did not. This indicates that the determinants involved in ouabain sensitivity are located in the amino-terminal half of the Na,K-ATPase ..cap alpha.. subunit. By use of site-directed mutagenesis, the amino acid sequence of the first extracellular domain (H1-H2) of the sheep ..cap alpha..1 subunit was changed to that of the rat. When expressed in HeLa cells, this mutated sheep ..cap alpha..1 construct, like the rat/sheep chimera, was able to confer ouabain resistance to these cells. Furthermore, similar results were observed when HeLa cells were transfected with a sheep ..cap alpha..1 cDNA containing only two amino acid substitutions. The resistant cells, whether transfected with the rat ..cap alpha..1 cDNA, the rat/sheep chimera, or the mutant sheep ..cap alpha..1 cDNAs, exhibited identical biochemical characteristics including ouabain-inhibitable cell growth, /sup 86/Rb/sup +/ uptake, and Na,K-ATPase activity. These results demonstrate that the presence of arginine and aspartic acid on the amino end and carboxyl end, respectively, of the H1-H2 extracellular domain of the Na,K-ATPase ..cap alpha.. subunit together is responsible for the ouabain-resistant character of the rat enzyme and the corresponding residues in the sheep ..cap alpha..1 subunit (glutamine and asparagine) are somehow involved in ouabain binding.

  15. Uptake of 3-[{sup 125}I]iodo-{alpha}-methyl-L-tyrosine into colon cancer DLD-1 cells: characterization and inhibitory effect of natural amino acids and amino acid-like drugs

    Energy Technology Data Exchange (ETDEWEB)

    Shikano, Naoto [Department of Radiological Sciences, Ibaraki Prefectural University of Health Sciences, Ami-machi, Inashiki-gun, Ibaraki 300-0394 (Japan)], E-mail: sikano@ipu.ac.jp; Ogura, Masato [Department of Radiological Sciences, Ibaraki Prefectural University of Health Sciences, Ami-machi, Inashiki-gun, Ibaraki 300-0394 (Japan); Okudaira, Hiroyuki [School of Health Sciences, Faculty of Medicine, Kanazawa University, Kanazawa 920-0942 (Japan); Nakajima, Syuichi; Kotani, Takashi [Department of Radiological Sciences, Ibaraki Prefectural University of Health Sciences, Ami-machi, Inashiki-gun, Ibaraki 300-0394 (Japan); Kobayashi, Masato [School of Health Sciences, Faculty of Medicine, Kanazawa University, Kanazawa 920-0942 (Japan); Nakazawa, Shinya [Department of Radiological Sciences, Ibaraki Prefectural University of Health Sciences, Ami-machi, Inashiki-gun, Ibaraki 300-0394 (Japan); Baba, Takeshi; Yamaguchi, Naoto [Center for Medical Sciences, Ibaraki Prefectural University of Health Sciences, Ami-machi, Inashiki-gun, Ibaraki 300-0394 (Japan); Kubota, Nobuo [Department of Radiological Sciences, Ibaraki Prefectural University of Health Sciences, Ami-machi, Inashiki-gun, Ibaraki 300-0394 (Japan); Iwamura, Yukio [Center for Humanities and Sciences, Ibaraki Prefectural University of Health Sciences, Ami-machi, Inashiki-gun, Ibaraki 300-0394 (Japan); Kawai, Keiichi [School of Health Sciences, Faculty of Medicine, Kanazawa University, Kanazawa 920-0942 (Japan)

    2010-02-15

    Introduction: We examined 3-[{sup 123}I]iodo-{alpha}-methyl-L-tyrosine ([{sup 123}I]IMT) uptake and inhibition by amino acids and amino acid-like drugs in the human DLD-1 colon cancer cell line, to discuss correlation between the inhibition effect and structure. Methods: Expression of relevant neutral amino acid transporters was examined by real-time PCR with DLD-1 cells. The time course of [{sup 125}I]IMT uptake, contributions of transport systems, concentration dependence and inhibition effects by amino acids and amino acid-like drugs (1 mM) on [{sup 125}I]IMT uptake were examined. Results: Expression of system L (4F2hc, LAT1 and LAT2), system A (ATA1, ATA2) and system ASC (ASCT1) was strongly detected; system L (LAT3, LAT4) and MCT8 were weakly detected; and B{sup 0}AT was not detected. [{sup 125}I]IMT uptake in DLD-1 cells involved Na{sup +}-independent system L primarily and Na{sup +}-dependent system(s). Uptake of [{sup 125}I]IMT in Na{sup +}-free buffer followed Michaelis-Menten kinetics, with a K{sub m} of 78 {mu}M and V{sub max} of 333 pmol/10{sup 6} cells per minute. Neutral D- and L-amino acids with branched or aromatic large side chains inhibited [{sup 125}I]IMT uptake. Tyrosine analogues, tryptophan analogues, L-phenylalanine and p-halogeno-L-phenylalanines, and gamma amino acids [including 3,4-dihydroxy-L-phenylalanine (L-DOPA), DL-threo-{beta}-(3,4-dihydroxyphenyl)serine (DOPS), 4-[bis(2-chloroethyl)amino]-L-phenylalanine and 1-(aminomethyl)-cyclohexaneacetic acid] strongly inhibited [{sup 125}I]IMT uptake, but L-tyrosine methyl ester and R(+)/S(-)-baclofen weakly inhibited uptake. The substrates of system ASC and A did not inhibit [{sup 125}I]IMT uptake except L-serine and D/L-cysteine. Conclusions: [{sup 125}I]IMT uptake in DLD-1 cells involves mostly LAT1 and its substrates' (including amino acid-like drugs derived from tyrosine, tryptophan and phenylalanine) affinity to transport via LAT1. Whether transport of gamma amino acid analogues is

  16. Effects of structure on alpha C-H bond enthalpies of amino acid residues: relevance to H transfers in enzyme mechanisms and in protein oxidation.

    Science.gov (United States)

    Rauk, A; Yu, D; Taylor, J; Shustov, G V; Block, D A; Armstrong, D A

    1999-07-13

    The bond dissociation enthalpies (BDE) of all of the amino acid residues, modeled by HC(O)NHCH(R)C(O)NH(2) (PH(res)), were determined at the B3LYP/6-31G//B3LYP/6-31G level, coupled with isodesmic reactions. The results for neutral side chains with phi, psi angles approximately 180 degrees, approximately 180 degrees in ascending order, to an expected accuracy of +/-10 kJ mol(-)(1), are Asn 326; cystine 330; Asp 332; Gln 334; Trp 337; Arg 340; Lys 340; Met 343; His 344; Phe 344; Tyr 344; Leu 344; Ala 345; Cys 346; Ser 349; Gly 350; Ile 351; Val 352; Glu 354; Thr 357; Pro-cis 358; Pro-trans 369. BDEs calculated at the ROMP2/6-31G//B3LYP/6-31G level exhibit the same trends but are approximately 7 kJ mol(-)(1) higher. All BDEs are smaller than those of typical secondary or tertiary C-H bonds due to the phenomenon of captodative stabilization. The stabilization is reduced by changes in the phi,psi angles. As a result the BDEs increase by about 10 kJ mol(-)(1) in beta-sheet and 40 kJ mol(-)(1) in alpha-helical environments, respectively. In effect the alpha C-H BDEs can be "tuned" from about 345 to 400 kJ mol(-)(1) by adjusting the local environment. Some very significant effects of this are seen in the current literature on H-transfer processes in enzyme mechanisms and in oxidative damage to proteins. These observations are discussed in terms of the findings of the present study.

  17. Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.

    Science.gov (United States)

    Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P

    2016-09-01

    Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Neoasaia chiangmaiensis gen. nov., sp. nov., a novel osmotolerant acetic acid bacterium in the alpha-Proteobacteria.

    Science.gov (United States)

    Yukphan, Pattaraporn; Malimas, Taweesak; Potacharoen, Wanchern; Tanasupawat, Somboon; Tanticharoen, Morakot; Yamada, Yuzo

    2005-10-01

    An acetic acid bacterium, designated as isolate AC28(T), was isolated from a flower of red ginger (khing daeng in Thai; Alpinia purpurata) collected in Chiang Mai, Thailand, at pH 3.5 by use of a glucose/ethanol/acetic acid (0.3%, w/v) medium. A phylogenetic tree based on 16S rRNA gene sequences for 1,376 bases showed that isolate AC28(T) constituted a cluster along with the type strain of Kozakia baliensis. However, the isolate formed an independent cluster in a phylogenetic tree based on 16S-23S rDNA internal transcribed spacer (ITS) region sequences for 586 bases. Pair-wise sequence similarities of the isolate in 16S rRNA gene sequences for 1,457 bases were 93.0-88.3% to the type strains of Asaia, Kozakia, Swaminathania, Acetobacter, Gluconobacter, Gluconacetobacter, Acidomonas, and Saccharibacter species. Restriction analysis of 16S-23S rDNA ITS regions discriminated isolate AC28(T) from the type strains of Asaia and Kozakia species. Cells were non-motile. Colonies were pink, shiny, and smooth. The isolate produced acetic acid from ethanol. Oxidation of acetate and lactate was negative. The isolate grew on glutamate agar and mannitol agar. Growth was positive on 30% D-glucose (w/v) and in the presence of 0.35% acetic acid (w/v), but not in the presence of 1.0% KNO(3) (w/v). Ammoniac nitrogen was hardly assimilated on a glucose medium or a mannitol medium. Production of dihydroxyacetone from glycerol was weakly positive. The isolate did not produce a levan-like polysaccharide on a sucrose medium. Major isoprenoid quinone was Q-10. DNA base composition was 63.1 mol% G+C. On the basis of the results obtained, Neoasaia gen. nov. was proposed with Neoasaia chiangmaiensis sp. nov. The type strain was isolate AC28(T) (=BCC 15763(T) =NBRC 101099(T)).

  19. Apports alimentaires en acides linoléique et alpha-linolénique d’une population d’Aquitaine

    Directory of Open Access Journals (Sweden)

    Combe Nicole

    2001-03-01

    Full Text Available Les apports alimentaires quotidiens en acides linoléique (18:2 n-6 et alpha-linolénique (18:3 n-3 ont fait récemment l’objet de recommandations pour la population française (ANC 2001. Cependant, peu d’informations sont actuellement disponibles sur la situation réelle, en particulier vis-à-vis du 18:3 n-3. Cette étude montre que la consommation de 18:2 n-6, en Aquitaine (n = 140 femmes, représente en moyenne 4,4 % (± 1,8 de l’apport énergétique total (AET, valeur acceptable par rapport aux ANC (4 %. En revanche, l’apport en 18:3 n-3 est insuffisant (0,34 ± 0,1 % au lieu de 0,8 % recommandé. Dans cette population, le 18:3 n-3 est à 75 % d’origine animale. La contribution des huiles est faible (9 %. La teneur moyenne en 18:2 n-6 et 18:3 n-3 du tissu adipeux des sujets est respectivement égale à 14 % et 0,5 % des acides gras totaux. Dans le plasma, ce sont les esters de cholestérol (EC qui en véhiculent le plus (53 % de 18:2 n-6 et 0,42 % de 18:3 n-3. Cette étude met en évidence une corrélation positive entre les pourcentages de 18:2 n-6 dans les EC plasmatiques et ceux du tissu adipeux (r = 0,606 et p < 0,001, confirmant que cette fraction plasmatique est un « marqueur » non invasif des apports en acide linoléique.

  20. Effects of amino acid substitutions at beta 131 on the structure and properties of hemoglobin: evidence for communication between alpha 1 beta 1- and alpha 1 beta 2-subunit interfaces.

    Science.gov (United States)

    Chang, Chung-ke; Simplaceanu, Virgil; Ho, Chien

    2002-04-30

    Substitutions of Asn, Glu, and Leu for Gln at the beta131 position of the hemoglobin molecule result in recombinant hemoglobins (rHbs) with moderately lowered oxygen affinity and high cooperativity compared to human normal adult hemoglobin (Hb A). The mutation site affects the hydrogen bonds present at the alpha(1)beta(1)-subunit interface between alpha103His and beta131Gln as well as that between alpha122His and beta35Tyr. NMR spectroscopy shows that the hydrogen bonds are indeed perturbed; in the case of rHb (beta131Gln --> Asn) and rHb (beta131Gln --> Leu), the perturbations are propagated to the other alpha(1)beta(1)-interface H-bond involving alpha122His and beta35Tyr. Proton exchange measurements also detect faster exchange rates for both alpha(1)beta(1)-interface histidine side chains of the mutant rHbs in 0.1 M sodium phosphate buffer at pH 7.0 than for those of Hb A under the same conditions. In addition, the same measurements in 0.1 M Tris buffer at pH 7.0 show a much slower exchange rate for mutant rHbs and Hb A. One of the mutants, rHb (beta131Gln --> Asn), shows the conformational exchange of its interface histidines, and exchange rate measurements have been attempted. We have also conducted studies on the reactivity of the SH group of beta93Cys (a residue located in the region of the alpha(1)beta(2)-subunit interface) toward p-mercuribenzoate, and our results show that low-oxygen-affinity rHbs have a more reactive beta93Cys than Hb A in the CO form. Our results indicate that there is communication between the alpha(1)beta(1)- and alpha(1)beta(2)-subunit interfaces, and a possible communication pathway for the cooperative oxygenation of Hb A that allows the alpha(1)beta(1)-subunit interface to modulate the functional properties in conjunction with the alpha(1)beta(2) interface is proposed.

  1. Brain docosahexaenoic acid (DHA levels of young rats are related to alpha-linolenic acid (ALA levels and fat matrix of the diet: impact of dairy fat*

    Directory of Open Access Journals (Sweden)

    Delplanque Bernadette

    2011-11-01

    Full Text Available Dososahexaenoate (DHA is highly concentrated in mammalian nervous and visual systems and its deficiency during gestation, lactation and early life, could have dramatic impacts on brain functions and mental health. Achieving an appropriate DHA status in the neonatal brain is an important goal of neonatal nutrition. We evaluated how a-linolenic acid (ALA provided by different dietary fat matrices improved DHA content in the brains of both young male and female rats. Young rats born from dams fed during gestation and lactation with a low ALA diet (0.4% of fatty acids were subjected for 6 weeks after weaning to an anhydrous dairy fat blend-based diet that provided 1.5% ALA or to a palm oil blend-based diet that provided the same ALA level: either 1.5% ALA or 1.5% ALA and 0.12% DHA with 0.4% arachidonic acid (ARA. With each diet the n-6/ n-3 ratio was similar (10 to follow the values generally recommended for infant formula. Fatty acids analysis in whole brain showed that 1.5% ALA dairy fat blend was superior to both 1.5% ALA palm-oil blends, supplemented or not with dietary DHA, for increasing brain DHA. Females compared to males had significantly higher brain DHA with the 1.5% ALA palm-blend diet, but the dietary supplementation with DHA smoothed the differences by a specific increase of males DHA brain. In conclusion, dairy fat blend enriched with ALA appear to be an interesting strategy for achieving optimal DHA levels in the brain of post-weaning rats. Inclusion of dairy fat in infant formulas should be reconsidered.

  2. Retinoic acid receptor gamma impacts cellular adhesion, Alpha5Beta1 integrin expression and proliferation in K562 cells.

    Science.gov (United States)

    Kelley, Melissa D; Phomakay, Raynin; Lee, Madison; Niedzwiedz, Victoria; Mayo, Rachel

    2017-01-01

    The interplay between cellular adhesion and proliferation is complex; however, integrins, particularly the α5β1 subset, play a pivotal role in orchestrating critical cellular signals that culminate in cellular adhesion and growth. Retinoids modify the expression of a variety of adhesive/proliferative signaling proteins including α5β1 integrins; however, the role of specific retinoic acid receptors involved in these processes has not been elucidated. In this study, the effect of all-trans-retinoic acid receptor (RAR) agonists on K562 cellular adhesion, proliferation, and α5β1 integrin cell surface expression was investigated. RARγ agonist exposure increased K562 cellular adhesion to RGD containing extracellular matrix proteins fibronectin and FN-120 in a time- and concentration dependent manner, while RARα or RARβ agonist treatment had no effect on cellular adhesion. Due to the novel RARγ- dependent cellular adhesion response exhibited by K562 cells, we examined α5 and β1 integrin subunit expression when K562 cells were exposed to retinoid agonists or vehicle for 24, 48, 72 or 96 hours. Our data demonstrates no differences in K562 cell surface expression of the α5 integrin subunit when cells were exposed to RARα, RARβ, or RARγ agonists for all time points tested. In contrast, RARγ agonist exposure resulted in an increase in cell surface β1 integrin subunit expression within 48 hours that was sustained at 72 and 96 hours. Finally, we demonstrate that while exposure to RARα or RARβ agonists have no effect on K562 cellular proliferation, the RARγ agonist significantly dampens K562 cellular proliferation levels in a time- and concentration- dependent manner. Our study is the first to report that treatment with a RARγ specific agonist augments cellular adhesion to α5β1 integrin substrates, increases cell surface levels of the β1 integrin subunit, and dampens cellular proliferation in a time and concentration dependent manner in a human

  3. Phosphorylation of the retinoic acid receptor alpha induces a mechanical allosteric regulation and changes in internal dynamics.

    Directory of Open Access Journals (Sweden)

    Yassmine Chebaro

    2013-04-01

    Full Text Available Nuclear receptor proteins constitute a superfamily of proteins that function as ligand dependent transcription factors. They are implicated in the transcriptional cascades underlying many physiological phenomena, such as embryogenesis, cell growth and differentiation, and apoptosis, making them one of the major signal transduction paradigms in metazoans. Regulation of these receptors occurs through the binding of hormones, and in the case of the retinoic acid receptor (RAR, through the binding of retinoic acid (RA. In addition to this canonical scenario of RAR activity, recent discoveries have shown that RAR regulation also occurs as a result of phosphorylation. In fact, RA induces non-genomic effects, such as the activation of kinase signaling pathways, resulting in the phosphorylation of several targets including RARs themselves. In the case of RARα, phosphorylation of Ser369 located in loop L9-10 of the ligand-binding domain leads to an increase in the affinity for the protein cyclin H, which is part of the Cdk-activating kinase complex of the general transcription factor TFIIH. The cyclin H binding site in RARα is situated more than 40 Å from the phosphorylated serine. Using molecular dynamics simulations of the unphosphorylated and phosphorylated forms of the receptor RARα, we analyzed the structural implications of receptor phosphorylation, which led to the identification of a structural mechanism for the allosteric coupling between the two remote sites of interest. The results show that phosphorylation leads to a reorganization of a local salt bridge network, which induces changes in helix extension and orientation that affects the cyclin H binding site. This results in changes in conformation and flexibility of the latter. The high conservation of the residues implicated in this signal transduction suggests a mechanism that could be applied to other nuclear receptor proteins.

  4. Phase 2 Randomized Controlled Trial of Radiation Therapy Plus Concurrent Interferon-Alpha and Retinoic Acid Versus Cisplatin for Stage III Cervical Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Basu, Partha, E-mail: BasuP@iarc.fr [Screening Group, Early Detection and Prevention Section, International Agency for Research on Cancer, Lyon (France); Jenson, Alfred Bennett [James Graham Brown Cancer Center, University of Louisville, Louisville, Kentucky (United States); Majhi, Tapas; Choudhury, Prabir [Department of Radiation Oncology, Chittaranjan National Cancer Institute, Kolkata (India); Mandal, Ranajit; Banerjee, Dipanwita [Department of Gynecological Oncology, Chittaranjan National Cancer Institute, Kolkata (India); Biswas, Jaydip [Department of Surgical Oncology, Chittaranjan National Cancer Institute, Kolkata (India); Pan, Jianmin; Rai, Shesh Nath; Ghim, Shin je; Miller, Donald [James Graham Brown Cancer Center, University of Louisville, Louisville, Kentucky (United States)

    2016-01-01

    Purpose: Because a combination of retinoic acid, interferon-alpha, and radiation therapy demonstrated synergistic action and effectiveness to treat advanced cervical cancers in earlier studies, we designed this randomized phase 2 open-label trial to assess efficacy and safety of interferon alpha-2b (IFN) and 13-cis-retinoic acid (RA) administered concomitantly with radiation therapy (IFN-RA-radiation) to treat stage III cervical cancer. Methods and Materials: Stage III cervical cancer patients were randomized to study and control groups in a 1:1 ratio. All patients were treated with radiation therapy; study arm patients received IFN (3 × 10{sup 6} IU subcutaneously) 3 times a week for 4 weeks and daily RA (40 mg orally) for 30 days starting on day 1 of radiation, whereas control arm patients received weekly cisplatinum (40 mg/m{sup 2}) for 5 weeks during radiation. Patients were followed for 3 years. The primary endpoint was overall survival at 3 years. Results: Patients in the study (n=104) and control (n=105) groups were comparable for clinicopathological characteristics, radiation therapy–related variables and treatment response. Proportions of disease-free patients in the study and control groups were 38.5% and 44.8%, respectively, after median follow-up of 29.2 months. Hazard ratios were 0.67 (95% confidence interval [CI]: 0.44-1.01) and 0.69 (95% CI: 0.44-1.06) for overall and disease-fee survival, respectively, comparing the study group to control, and demonstrated an inferior outcome with RA-IFN-radiation, although differences were statistically nonsignificant. Kaplan-Meier curves of disease-free and overall survival probabilities also showed inferior survival in the study group compared to those in the control. Acute toxicities of chemoradiation were significantly higher with 2 acute toxicity-related deaths. Conclusions: Treatment with RA-IFN-radiation did not demonstrate survival advantage over chemoradiation despite being less toxic. The

  5. Novel 3alpha-methoxyserrat-14-en-21beta-ol (PJ-1) and 3beta-methoxyserrat-14-en-21beta-ol (PJ-2)-curcumin, kojic acid, quercetin, and baicalein conjugates as HIV agents.

    Science.gov (United States)

    Tanaka, Reiko; Tsujii, Hiroko; Yamada, Takeshi; Kajimoto, Tetsuya; Amano, Fumio; Hasegawa, Junya; Hamashima, Yoshio; Node, Manabu; Katoh, Kayoko; Takebe, Yutaka

    2009-07-15

    Sixteen novel compounds; 3alpha-methoxyserrat-14-en-21beta-ol (1) and 3beta-methoxyserrat-14-en-21beta-ol (2) and their curcumin, kojic acid, quercetin, and baicalein conjugates (3)-(18) were designed, synthesized, and evaluated for in vitro anti-HIV-1 reverse transcriptase (RT) activity in infected C8166-CCR5 cells, a human CD4(+) T-lymphocyte cell line. Among them, kojic acid derivatives, 9-12 showed significant biological activity. In particular, the compound 13, the conjugate of two molecules of 3alpha-methoxyserrat-14-en-21beta-ol (1) and one molecule of kojic acid, exerted significant anti-HIV activity with an EC50 value of 0.12microg/mL.

  6. HLA-G mediated immune regulation is impaired by a single amino acid exchange in the alpha 2 domain.

    Science.gov (United States)

    Celik, Alexander A; Simper, Gwendolin S; Huyton, Trevor; Blasczyk, Rainer; Bade-Döding, Christina

    2018-03-29

    The trade-off from HLA class I expression to HLA-G expression support the immune evasion of malignant cells. The essential role of the virtually invariant HLA-G in immune tolerance, tumor immunology and its expression frequency in immune privileged tissues is known; however the specific importance of allelic subtypes in immune responses is still not well understood. HLA-G ∗ 01:01, ∗ 01:03 and ∗ 01:04 are the most prevalent allelic variants differing at residues 31 and 110, respectively. In cytotoxicity assays applying K562 cells transduced with the HLA-G variants as targets and NK cells as effectors the differential protective potential of HLA-G variants was analyzed. Their peptide profiles were determined utilizing soluble HLA technology. An increased protective potential of HLA-G ∗ 01:04 could be observed. All variants exhibit a unique peptide repertoire with marginal overlap, while G ∗ 01:04 differs in its peptide anchor profile substantially. The functional differences between HLA-G subtypes could be explained by the constraint of the bound peptides, modifying the pHLA-G accessible surface. For the first time a contribution of amino acid alterations within the HLA-G heavy chain for peptide selection and NK cell recognition could be observed. These results will be a step towards understanding immune tolerance and will guide towards personalized immune therapeutic strategies. Copyright © 2018. Published by Elsevier Inc.

  7. Identification of rare noncoding sequence variants in gamma-aminobutyric acid A receptor, alpha 4 subunit in autism spectrum disorder.

    Science.gov (United States)

    Griswold, Anthony J; Van Booven, Derek; Cuccaro, Michael L; Haines, Jonathan L; Gilbert, John R; Pericak-Vance, Margaret A

    2018-01-01

    Alterations of the gamma-aminobutyric acid (GABA) signaling system has been strongly linked to the pathophysiology of autism spectrum disorder (ASD). Genetic associations of common variants in GABA receptor subunits, in particular GABRA4 on chromosome 4p12, with ASD have been replicated by several studies. Moreover, molecular investigations have identified altered transcriptional and translational levels of this gene and protein in brains of ASD individuals. Since the genotyped common variants are likely not the functional variants contributing to the molecular consequences or underlying ASD phenotype, this study aims to examine rare sequence variants in GABRA4, including those outside the protein coding regions of the gene. We comprehensively re-sequenced the entire protein coding and noncoding portions of the gene and putative regulatory sequences in 82 ASD individuals and 55 developmentally typical pediatric controls, all homozygous for the most significant previously associated ASD risk allele (G/G at rs1912960). We identified only a single common, coding variant, and no association of any single marker or set of variants with ASD. Functional annotation of noncoding variants identified several rare variants in putative regulatory sites. Finally, a rare variant unique to ASD cases, in an evolutionary conserved site of the 3'UTR, shows a trend toward decreasing gene expression. Hence, GABRA4 rare variants in noncoding DNA may be variants of modest physiological effects in ASD etiology.

  8. Alpha cyano-4-hydroxy-3-methoxycinnamic acid inhibits proliferation and induces apoptosis in human breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Lamia Hamdan

    Full Text Available This study investigated the underlying mechanism of 4-hydroxy-3-methoxycinnamic acid (ACCA, on the growth of breast cancer cells and normal immortal epithelial cells, and compared their cytotoxic effects responses. Treatment of breast cancer cells (MCF-7, T47D, and MDA-231 with ACCA resulted in dose- and time-dependent decrease of cell proliferation, viability in colony formation assay, and programmed cell death (apoptosis with minimal effects on non-tumoral cells. The ability of ACCA to suppress growth in cancer cells not expressing or containing defects in p53 gene indicates a lack of involvement of this critical tumor suppressor element in mediating ACCA-induced growth inhibition. Induction of apoptosis correlated with an increase in Bax protein, an established inducer of programmed cell death, and the ratio of Bax to Bcl-2, an established inhibitor of apoptosis. We also documented the ability of ACCA to inhibit the migration and invasion of MDA-231 cells with ACCA in vitro. Additionally, tumor growth of MDA-231 breast cancer cells in vivo was dramatically affected with ACCA. On the basis of its selective anticancer inhibitory activity on tumor cells, ACCA may represent a promising therapeutic drug that should be further evaluated as a chemotherapeutic agent for human breast cancer.

  9. The omega-3 fatty acid, eicosapentaenoic acid (EPA, prevents the damaging effects of tumour necrosis factor (TNF-alpha during murine skeletal muscle cell differentiation

    Directory of Open Access Journals (Sweden)

    Pearson Stephen

    2008-07-01

    Full Text Available Abstract Background Eicosapentaenoic acid (EPA is a ώ-3 polyunsaturated fatty acid with anti-inflammatory and anti-cachetic properties that may have potential benefits with regards to skeletal muscle atrophy conditions where inflammation is present. It is also reported that pathologic levels of the pro-inflammatory cytokine tumour necrosis factor (TNF-α are associated with muscle wasting, exerted through inhibition of myogenic differentiation and enhanced apoptosis. These findings led us to hypothesize that EPA may have a protective effect against skeletal muscle damage induced by the actions of TNF-α. Results The deleterious effects of TNF-α on C2C12 myogenesis were completely inhibited by co-treatment with EPA. Thus, EPA prevented the TNF-mediated loss of MyHC expression and significantly increased myogenic fusion (p p p p p p Conclusion In conclusion, EPA has a protective action against the damaging effects of TNF-α on C2C12 myogenesis. These findings support further investigations of EPA as a potential therapeutic agent during skeletal muscle regeneration following injury.

  10. α-LIPOIC ACID AS MAINTENANCE THERAPY IN PATIENTS TREATED FOR PRETERM BIRTH

    OpenAIRE

    Salzano, E.; Iazzetta, R.; Palmieri, T.; Nazzaro, G.; Miranda, M.; Locci, M.

    2017-01-01

    Selected Abstracts of the 19th National Congress of the Italian Society of Perinatal Medicine (Società Italiana di Medicina Perinatale, SIMP); Naples (Italy); January 19-21, 2017 Guest Editors: Irene Cetin, Mariavittoria Locci ABS 1. THE “WOMAN AND CHILD HOSPITAL” ORGANIZED ON INTENSITY OF CARE IN VERONA: AN OPPORTUNITY TO PROMOTE MATERNAL AND PERINATAL HEALTH • C. Bovo, R. Bortolus, G. Ghirlanda, P. Biban, V. Bergamini, A. Bonetti, E. Allegrini, G. PiacentiniABS 2. CIRCULATING LEVELS OF NATU...

  11. R- –Lipoic acid and acetyl-L-carnitine optimal combinations in MPP ...

    African Journals Online (AJOL)

    Mitochondrial insufficiency and oxidative damage contribute to the etiopathology of Parkinson's disease (PD). However, there is a dearth of information on the protective activities against PD of mitochondrial nutrients, safe for coenzyme Q10. In the present study, the PD protective effects of two mitochondrial nutrients, ...

  12. Alpha-linolenic acid intake and 10-year incidence of coronary heart disease and stroke in 20,000 middle-aged men and women in the Netherlands.

    Directory of Open Access Journals (Sweden)

    Janette de Goede

    Full Text Available BACKGROUND: Whether intake of alpha-linolenic acid (ALA, the plant-derived n-3 polyunsaturated fatty acid (PUFA, could prevent cardiovascular diseases is not yet clear. We examined the associations of ALA intake with 10-year incidence of coronary heart disease (CHD and stroke in the Netherlands. METHODS: Data were collected from a general population of 20,069 generally healthy men and women, aged 20 to 65 years. Habitual diet was assessed at baseline (1993-1997 with a validated 178-item food frequency questionnaire. Incidences of CHD and stroke were assessed through linkage with mortality and morbidity registers. Hazard ratios (HR were calculated with multivariable Cox proportional hazards models, adjusted for age, gender, lifestyle, and dietary factors. RESULTS: During 8-13 years of follow-up, we observed 280 incident CHD events (19% fatal and 221 strokes (4% fatal. Intakes of energy-adjusted ALA in quintiles ranged from less than 1.0 g/d in the bottom quintile (Q1 to more than 1.9 g/d in the top quintile (Q5. ALA intake was not associated with incident CHD, with HRs varying between 0.89 and 1.01 (all p>0.05 in Q2-Q5 compared with the bottom quintile of ALA intake. For incident stroke, however, participants in Q2-Q5 had a 35-50% lower risk compared with the reference group. HRs were 0.65 (0.43-0.97, 0.49 (0.31-0.76, 0.53 (0.34-0.83, and 0.65 (0.41-1.04 for Q2-Q5 respectively. CONCLUSION: In this general Dutch population, ALA intake was not associated with incident CHD. The data suggested that a low intake of ALA may be a risk factor for incident stroke. These results warrant confirmation in other population-based studies and in trials.

  13. Alpha-linolenic acid intake and 10-year incidence of coronary heart disease and stroke in 20,000 middle-aged men and women in the Netherlands.

    Science.gov (United States)

    de Goede, Janette; Verschuren, W M Monique; Boer, Jolanda M A; Kromhout, Daan; Geleijnse, Johanna M

    2011-03-25

    Whether intake of alpha-linolenic acid (ALA), the plant-derived n-3 polyunsaturated fatty acid (PUFA), could prevent cardiovascular diseases is not yet clear. We examined the associations of ALA intake with 10-year incidence of coronary heart disease (CHD) and stroke in the Netherlands. Data were collected from a general population of 20,069 generally healthy men and women, aged 20 to 65 years. Habitual diet was assessed at baseline (1993-1997) with a validated 178-item food frequency questionnaire. Incidences of CHD and stroke were assessed through linkage with mortality and morbidity registers. Hazard ratios (HR) were calculated with multivariable Cox proportional hazards models, adjusted for age, gender, lifestyle, and dietary factors. During 8-13 years of follow-up, we observed 280 incident CHD events (19% fatal) and 221 strokes (4% fatal). Intakes of energy-adjusted ALA in quintiles ranged from less than 1.0 g/d in the bottom quintile (Q1) to more than 1.9 g/d in the top quintile (Q5). ALA intake was not associated with incident CHD, with HRs varying between 0.89 and 1.01 (all p>0.05) in Q2-Q5 compared with the bottom quintile of ALA intake. For incident stroke, however, participants in Q2-Q5 had a 35-50% lower risk compared with the reference group. HRs were 0.65 (0.43-0.97), 0.49 (0.31-0.76), 0.53 (0.34-0.83), and 0.65 (0.41-1.04) for Q2-Q5 respectively. In this general Dutch population, ALA intake was not associated with incident CHD. The data suggested that a low intake of ALA may be a risk factor for incident stroke. These results warrant confirmation in other population-based studies and in trials.

  14. Clenbuterol, a β2-adrenergic agonist, reciprocally alters PGC-1 alpha and RIP140 and reduces fatty acid and pyruvate oxidation in rat skeletal muscle.

    Science.gov (United States)

    Hoshino, Daisuke; Yoshida, Yuko; Holloway, Graham P; Lally, James; Hatta, Hideo; Bonen, Arend

    2012-02-01

    Clenbuterol, a β2-adrenergic agonist, reduces mitochondrial content and enzyme activities in skeletal muscle, but the mechanism involved has yet to be identified. We examined whether clenbuterol-induced changes in the muscles' metabolic profile and the intrinsic capacity of mitochondria to oxidize substrates are associated with reductions in the nuclear receptor coactivator PGC-1 alpha and/or an increase in the nuclear corepressor RIP140. In rats, clenbuterol was provided in the drinking water (30 mg/l). In 3 wk, this increased body (8%) and muscle weights (12-17%). In red (R) and white (W) muscles, clenbuterol induced reductions in mitochondrial content (citrate synthase: R, 27%; W, 52%; cytochrome-c oxidase: R, 24%; W, 34%), proteins involved in fatty acid transport (fatty acid translocase/CD36: R, 36%; W, 35%) and oxidation [β-hydroxyacyl CoA dehydrogenase (β-HAD): R, 33%; W, 62%], glucose transport (GLUT4: R, 8%; W, 13%), lactate transport monocarboxylate transporter (MCT1: R, 61%; W, 37%), and pyruvate oxidation (PDHE1α, R, 18%; W, 12%). Concurrently, only red muscle lactate dehydrogenase activity (25%) and MCT4 (31%) were increased. Palmitate oxidation was reduced in subsarcolemmal (SS) (R, 30%; W, 52%) and intermyofibrillar (IMF) mitochondria (R, 17%; W, 44%) along with reductions in β-HAD activity (SS: R, 17%; W, 51%; IMF: R, 20%; W, 57%). Pyruvate oxidation was only reduced in SS mitochondria (R, 20%; W, 28%), but this was not attributable solely to PDHE1α, which was reduced in both SS (R, 21%; W, 20%) and IMF mitochondria (R, 15%; W, 43%). These extensive metabolic changes induced by clenbuterol were associated with reductions in PGC-1α (R, 37%; W, 32%) and increases in RIP140 (R, 23%; W, 21%). This is the first evidence that clenbuterol appears to exert its metabolic effects via simultaneous and reciprocal changes in the nuclear receptor coactivator PGC-1α and the nuclear corepressor RIP140.

  15. Tetrahydro iso-alpha acids from hops improve glucose homeostasis and reduce body weight gain and metabolic endotoxemia in high-fat diet-fed mice.

    Directory of Open Access Journals (Sweden)

    Amandine Everard

    Full Text Available Obesity and related metabolic disorders such as insulin resistance and type 2 diabetes are associated with a low-grade inflammatory state possibly through changes in gut microbiota composition and the development of higher plasma lipopolysaccharide (LPS levels, i.e. metabolic endotoxemia. Various phytochemical compounds have been investigated as potential tools to regulate these metabolic features. Humulus lupulus L. (hops contains several classes of compounds with anti-inflammatory potential. Recent evidence suggests that hops-derived compounds positively impact adipocyte metabolism and glucose tolerance in obese and diabetic rodents via undefined mechanisms. In this study, we found that administration of tetrahydro iso-alpha acids (termed META060 to high-fat diet (HFD-fed obese and diabetic mice for 8 weeks reduced body weight gain, the development of fat mass, glucose intolerance, and fasted hyperinsulinemia, and normalized insulin sensitivity markers. This was associated with reduced portal plasma LPS levels, gut permeability, and higher intestinal tight junction proteins Zonula occludens-1 and occludin. Moreover, META060 treatment increased the plasma level of the anti-inflammatory cytokine interleukin-10 and decreased the plasma level of the pro-inflammatory cytokine granulocyte colony-stimulating factor. In conclusion, this research allows us to decipher a novel mechanism contributing to the positive effects of META060 treatment, and supports the need to investigate such compounds in obese and type 2 diabetic patients.

  16. Tetrahydro iso-alpha acids from hops improve glucose homeostasis and reduce body weight gain and metabolic endotoxemia in high-fat diet-fed mice.

    Science.gov (United States)

    Everard, Amandine; Geurts, Lucie; Van Roye, Marie; Delzenne, Nathalie M; Cani, Patrice D

    2012-01-01

    Obesity and related metabolic disorders such as insulin resistance and type 2 diabetes are associated with a low-grade inflammatory state possibly through changes in gut microbiota composition and the development of higher plasma lipopolysaccharide (LPS) levels, i.e. metabolic endotoxemia. Various phytochemical compounds have been investigated as potential tools to regulate these metabolic features. Humulus lupulus L. (hops) contains several classes of compounds with anti-inflammatory potential. Recent evidence suggests that hops-derived compounds positively impact adipocyte metabolism and glucose tolerance in obese and diabetic rodents via undefined mechanisms. In this study, we found that administration of tetrahydro iso-alpha acids (termed META060) to high-fat diet (HFD)-fed obese and diabetic mice for 8 weeks reduced body weight gain, the development of fat mass, glucose intolerance, and fasted hyperinsulinemia, and normalized insulin sensitivity markers. This was associated with reduced portal plasma LPS levels, gut permeability, and higher intestinal tight junction proteins Zonula occludens-1 and occludin. Moreover, META060 treatment increased the plasma level of the anti-inflammatory cytokine interleukin-10 and decreased the plasma level of the pro-inflammatory cytokine granulocyte colony-stimulating factor. In conclusion, this research allows us to decipher a novel mechanism contributing to the positive effects of META060 treatment, and supports the need to investigate such compounds in obese and type 2 diabetic patients.

  17. Electrospun polydimethylsiloxane/polyacrylonitrile/titanium dioxide nanofibers as a new coating for determination of alpha-linolenic acid in milk by direct immersion-solid phase nanoextraction.

    Science.gov (United States)

    Sadeghi, Sahar; Mollahosseini, Afsaneh

    2018-01-15

    In this study, polydimethylsiloxane/polyacrylonitrile/titanium dioxide (PDMS/PAN/TiO 2 ) nanofibers were synthesized via electrospinning method to extract and quantify alpha-linolenic acid (ALA, C18:3), as a model analyte, in milk by direct immersion-solid phase nanoextraction (DI-SPNE) with gas chromatography-flame ionization detector (GC-FID). The affecting factors on the electrospinning process such as, PDMS concentration, amount of TiO 2 nanoparticles (NPs), voltage, and electrospinning distance were optimized using Taguchi's orthogonal design. The SPNE experimental conditions such as, extraction time, agitation rate, pH and salt concentration, were also optimized using response surface methodology (RSM) based on a central composite design (CCD). Under optimized conditions, the resulting calibration curve was linear in the range of 1-4000ngmL -1 with R 2 =0.998. The intraday, interday, and fiber-to-fiber repeatability were calculated and the corresponding relative standard deviation was less than 9% in all the cases. The limit of detection and limit of quantification were found to be 0.2 and 0.6ngmL -1 , respectively. Omega-3 enriched milk was used as a real sample and the value of relative recoveries were measured to be in the range of 92-106%. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The mechanism of action of aniracetam at synaptic alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors: indirect and direct effects on desensitization.

    Science.gov (United States)

    Lawrence, J Josh; Brenowitz, Stephan; Trussell, Laurence O

    2003-08-01

    The mechanism of action of aniracetam on alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors was examined in outside-out patches and at glutamatergic synapses in neurons of the chick cochlear nucleus. A combination of rapid-flow analysis, using glutamate as an agonist, and kinetic modeling indicated that aniracetam slows both the rate of channel closing, and the microscopic rates of desensitization, even for partially liganded receptors. Little effect was observed on the rate of recovery from desensitization or on the response to the weakly desensitizing agonist kainate. Aniracetam's effects on receptor deactivation saturated at lower concentrations than its effects on desensitization, suggesting that cooperativity between homologous binding sites was required to regulate desensitization. Analysis of responses to paired pulses of agonist also indicated that AMPA receptors must desensitize partially even after agonist exposures too brief to permit rebinding. In the presence of aniracetam, evoked excitatory synaptic currents (EPSCs) and miniature EPSCs in low quantal-content conditions had decay times similar to the time course of receptor deactivation. Under these conditions, the time course of both transmitter release and clearance must be aniracetam decayed with a time course intermediate between deactivation and desensitization, suggesting that the time course of transmitter clearance is prolonged because of pooling of transmitter in the synaptic cleft. Moreover, by comparing the amounts of paired-pulse synaptic depression and patch desensitization prevented by aniracetam, we conclude that significant desensitization occurs in response to rebinding of transmitter to the AMPA receptors.

  19. The Retinoic acid receptor alpha (RARalpha) chimeric proteins PML-, PLZF-, NPM-, and NuMA-RARalpha have distinct intracellular localization patterns.

    Science.gov (United States)

    Hummel, Jeff L; Zhang, Tong; Wells, Richard A; Kamel-Reid, Suzanne

    2002-04-01

    Retinoic acid receptor alpha (RARalpha) gene rearrangement by reciprocal chromosome translocation is the molecular signature of acute promyelocytic leukemia (APL). Disruption of RARalpha function appears to be the likely cause of aberrant myelopoiesis observed in APL, because PML-RARalpha expression has been shown to deregulate the transcription of genes that control myelopoiesis. To target RARalpha chimeric proteins, we engineered epitope-tagged versions of PML-RARalpha, PLZF-RARalpha, NPM-RARalpha, and NuMA-RARalpha (X-RARalphaV5) and generated a panel of stable COS cell lines expressing X-RARalphaV5. Protein fractionation and Western analysis of these COS lines reveal that X-RARalpha proteins localize to both the cytoplasm and nucleus. NPM-RARalpha is predominantly nuclear whereas NuMA-RARalpha is predominantly cytoplasmic. Confocal immunofluorescent microscopy reveals that PML-RARalpha and PLZF-RARalpha share a primarily diffuse nuclear pattern that excludes the nucleolus. NPM-RARalpha is also diffuse in the nucleus but, in contrast to PML-RARalpha and PLZF-RARalpha, is strongly associated with the nucleolus. Strikingly, NuMA-RARalpha predominantly localizes throughout the cytoplasm in a microspeckled pattern. We further demonstrate that NPM and NuMA interact with NPM-RARalpha and NuMA-RARalpha, respectively. The distinct intracellular localization patterns and the shared ability of X-RARalpha to interact with their respective RARalpha partner proteins (X) further support the hypothesis that deregulation of these partners may play a role in APL pathogenesis.

  20. Tetrahydro iso-Alpha Acids from Hops Improve Glucose Homeostasis and Reduce Body Weight Gain and Metabolic Endotoxemia in High-Fat Diet-Fed Mice

    Science.gov (United States)

    Van Roye, Marie; Delzenne, Nathalie M.; Cani, Patrice D.

    2012-01-01

    Obesity and related metabolic disorders such as insulin resistance and type 2 diabetes are associated with a low-grade inflammatory state possibly through changes in gut microbiota composition and the development of higher plasma lipopolysaccharide (LPS) levels, i.e. metabolic endotoxemia. Various phytochemical compounds have been investigated as potential tools to regulate these metabolic features. Humulus lupulus L. (hops) contains several classes of compounds with anti-inflammatory potential. Recent evidence suggests that hops-derived compounds positively impact adipocyte metabolism and glucose tolerance in obese and diabetic rodents via undefined mechanisms. In this study, we found that administration of tetrahydro iso-alpha acids (termed META060) to high-fat diet (HFD)-fed obese and diabetic mice for 8 weeks reduced body weight gain, the development of fat mass, glucose intolerance, and fasted hyperinsulinemia, and normalized insulin sensitivity markers. This was associated with reduced portal plasma LPS levels, gut permeability, and higher intestinal tight junction proteins Zonula occludens-1 and occludin. Moreover, META060 treatment increased the plasma level of the anti-inflammatory cytokine interleukin-10 and decreased the plasma level of the pro-inflammatory cytokine granulocyte colony-stimulating factor. In conclusion, this research allows us to decipher a novel mechanism contributing to the positive effects of META060 treatment, and supports the need to investigate such compounds in obese and type 2 diabetic patients. PMID:22470484

  1. Studying the Impact of Presence of Alpha Acid Glycoprotein and Protein Glycoprotein in Chronic Myeloid Leukemia Patients Treated with Imatinib Mesylate in the State of Qatar

    Directory of Open Access Journals (Sweden)

    Nader I. Ai-Dewik

    2015-01-01

    Full Text Available Despite the efficacy of imatinib mesylate (IM in treating chronic myeloid leukemia (CML, there is a high degree of resistance. Alpha-1-acid glycoprotein may reduce drug efficacy through its ability to interact with IM and blocks it from reaching its target, while protein glycoprotein (PGP may reduce the intracellular concentration of the drug via an active pump mechanism. We thus investigated the correlation between AGP and PGP levels and the resistance/response to treatment. A total of 26 CML patients were investigated for AGP and PGP levels at diagnosis and during treatment. There was no significant difference or correlation between AGP levels and the different groups of patients. There was also no significant difference in the fluorescence intensities of PGP levels among the different patient groups. The resistance observed in our CML patient population could not be correlated with AGP and PGP levels. There was no significant pattern of AGP and PGP expression, irrespective of the response or resistance to treatment.

  2. Circular dichroism and absorption spectroscopic data reveal binding of the natural cis-carotenoid bixin to human alpha1-acid glycoprotein.

    Science.gov (United States)

    Zsila, Ferenc; Molnár, Péter; Deli, József; Lockwood, Samuel F

    2005-08-01

    Using circular dichroism (CD) and electronic absorption spectroscopy techniques, interaction of the natural dietary cis-carotenoid bixin with an important human plasma protein in vitro was demonstrated for the first time. The induced CD spectra of bixin obtained under physiological conditions (pH 7.4, 37 degrees C) revealed its binding to the serum acute-phase reactant alpha(1)-acid glycoprotein (AGP), a member of the lipocalin protein family. Spectral features of the extrinsic Cotton effects of bixin suggested the inclusion of a single, chirally distorted ligand molecule into the asymmetric protein environment. Compared with the absorption spectra obtained in ethanol and benzene, the strong red shift of the main absorption peak of AGP-bound bixin indicated that the proposed binding site was rich in aromatic residues, and also suggested that hydrophobic interactions were involved in the binding. Using the data obtained from the CD titration experiments, the association constant (Ka=4.5x10(5)M-1) and stoichiometry of the binding (0.15) were calculated. The low value of the stoichiometry was attributed to the structural polymorphism of AGP. To the authors' knowledge, the current study represents the first human lipocalin protein for which carotenoid binding affinity has been explored in vitro with these techniques.

  3. Promyelocytic Leukemia with No Retinoic Acid Receptor Alpha Abnormality but with RUNX1T1 Insertion to Chromosome 7q: A Classification and Management Dilemma

    Directory of Open Access Journals (Sweden)

    Kathleen Overholt

    2015-01-01

    Full Text Available A case of acute promyelocytic leukemia (APL with RUNX1T1 insertion to 7q is described and compared to reported cases of APL with negative retinoic acid receptor alpha (RARA abnormality. In this report, we describe the case of a 2-year-old boy who presented with bone pain and was found to have pancytopenia. Bone marrow examination showed morphologic and immunophenotypic findings typical of APL, but conventional cytogenetics, fluorescence in situ hybridization (FISH, and real-time polymerase chain reaction (RT-PCR showed no evidence of RARA rearrangements. The only cytogenetic abnormality found was a small insertion in 7q, and three copies of RUNX1T1. Gene sequencing results became available after initiating therapy but were not informative. We describe the rarity of such cases and discuss how the typical morphologic and immunophenotypic findings of APL, coupled with the definite absence of RARA rearrangement (by FISH and RT-PCR, present a diagnostic and classification dilemma, raising the possibility of an unknown alternative mechanism for the leukemogenesis and maturation arrest seen in other APL variants. The diagnostic challenges and urgent management issues this unusual case raises may justify including it, along with similar cases, in a separate subtype of acute myeloid leukemia (AML in future classifications.

  4. alpha-Mangostin enhances betulinic acid cytotoxicity and inhibits cisplatin cytotoxicity on HCT 116 colorectal carcinoma cells.

    Science.gov (United States)

    Aisha, Abdalrahim F A; Abu-Salah, Khalid M; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2012-03-08

    Despite the progress in colon cancer treatment, relapse is still a major obstacle. Hence, new drugs or drug combinations are required in the battle against colon cancer. α-Mangostin and betulinic acid (BA) are cytotoxic compounds that work by inducing the mitochondrial apoptosis pathway, and cisplatin is one of the most potent broad spectrum anti-tumor agents. This study aims to investigate the enhancement of BA cytotoxicity by α-mangostin, and the cytoprotection effect of α-mangostin and BA on cisplatin-induced cytotoxicity on HCT 116 human colorectal carcinoma cells. Cytotoxicity was investigated by the XTT cell proliferation test, and the apoptotic effects were investigated on early and late markers including caspases-3/7, mitochondrial membrane potential, cytoplasmic shrinkage, and chromatin condensation. The effect of α-mangostin on four signalling pathways was also investigated by the luciferase assay. α-Mangostin and BA were more cytotoxic to the colon cancer cells than to the normal colonic cells, and both compounds showed a cytoprotective effect against cisplatin-induced cytotoxicity. On the other hand, α-mangostin enhanced the cytotoxic and apoptotic effects of BA. Combination therapy hits multiple targets, which may improve the overall response to the treatment, and may reduce the likelihood of developing drug resistance by the tumor cells. Therefore, α-mangostin and BA may provide a novel combination for the treatment of colorectal carcinoma. The cytoprotective effect of the compounds against cisplatin-induced cytotoxicity may find applications as chemopreventive agents against carcinogens, irradiation and oxidative stress, or to neutralize cisplatin side effects.

  5. Buffett's Alpha

    DEFF Research Database (Denmark)

    Frazzini, Andrea; Kabiller, David; Heje Pedersen, Lasse

    Berkshire Hathaway has realized a Sharpe ratio of 0.76, higher than any other stock or mutual fund with a history of more than 30 years, and Berkshire has a significant alpha to traditional risk factors. However, we find that the alpha becomes insignificant when controlling for exposures to Betting-Against-Beta...... in publicly traded stocks versus wholly-owned private companies, we find that the former performs the best, suggesting that Buffett's returns are more due to stock selection than to his effect on management. These results have broad implications for market efficiency and the implementability of academic...

  6. The vitamin E analog, alpha-tocopheryloxyacetic acid enhances the anti-tumor activity of trastuzumab against HER2/neu-expressing breast cancer

    Directory of Open Access Journals (Sweden)

    Penichet Manuel L

    2011-11-01

    Full Text Available Abstract Background HER2/neu is an oncogene that facilitates neoplastic transformation due to its ability to transduce growth signals in a ligand-independent manner, is over-expressed in 20-30% of human breast cancers correlating with aggressive disease and has been successfully targeted with trastuzumab (Herceptin®. Because trastuzumab alone achieves only a 15-30% response rate, it is now commonly combined with conventional chemotherapeutic drugs. While the combination of trastuzumab plus chemotherapy has greatly improved response rates and increased survival, these conventional chemotherapy drugs are frequently associated with gastrointestinal and cardiac toxicity, bone marrow and immune suppression. These drawbacks necessitate the development of new, less toxic drugs that can be combined with trastuzumab. Recently, we reported that orally administered alpha-tocopheryloxyacetic acid (α-TEA, a novel ether derivative of alpha-tocopherol, dramatically suppressed primary tumor growth and reduced the incidence of lung metastases both in a transplanted and a spontaneous mouse model of breast cancer without discernable toxicity. Methods In this study we examined the effect of α-TEA plus HER2/neu-specific antibody treatment on HER2/neu-expressing breast cancer cells in vitro and in a HER2/neu positive human xenograft tumor model in vivo. Results We show in vitro that α-TEA plus anti-HER2/neu antibody has an increased cytotoxic effect against murine mammary tumor cells and human breast cancer cells and that the anti-tumor effect of α-TEA is independent of HER2/neu status. More importantly, in a human breast cancer xenograft model, the combination of α-TEA plus trastuzumab resulted in faster tumor regression and more tumor-free animals than trastuzumab alone. Conclusion Due to the cancer cell selectivity of α-TEA, and because α-TEA kills both HER2/neu positive and HER2/neu negative breast cancer cells, it has the potential to be effective and

  7. All-trans retinoic acid combined with 5-Aza-2 Prime -deoxycitidine induces C/EBP{alpha} expression and growth inhibition in MLL-AF9-positive leukemic cells

    Energy Technology Data Exchange (ETDEWEB)

    Fujiki, Atsushi [Department of Pediatrics, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, Kyoto (Japan); Imamura, Toshihiko, E-mail: imamura@koto.kpu-m.ac.jp [Department of Pediatrics, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sakamoto, Kenichi; Kawashima, Sachiko; Yoshida, Hideki; Hirashima, Yoshifumi; Miyachi, Mitsuru; Yagyu, Shigeki; Nakatani, Takuya [Department of Pediatrics, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sugita, Kanji [Department of Pediatrics, University of Yamanashi, Yamanashi (Japan); Hosoi, Hajime [Department of Pediatrics, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2012-11-16

    Highlights: Black-Right-Pointing-Pointer We tested whether ATRA and 5-Aza affect AML cell differentiation and growth. Black-Right-Pointing-Pointer Cell differentiation and growth arrest were induced in MLL-AF9-expressing cells. Black-Right-Pointing-Pointer Increased expression of C/EBP{alpha}, C/EBP{epsilon}, and PU.1 were also observed. Black-Right-Pointing-Pointer MLL-AF4/AF5q31-expressing cells are less sensitive to ATRA and 5-Aza. Black-Right-Pointing-Pointer Different MLL fusion has distinct epigenetic properties related to RA pathway. -- Abstract: The present study tested whether all-trans retinoic acid (ATRA) and 5-Aza-2 Prime -deoxycitidine (5-Aza) affect AML cell differentiation and growth in vitro by acting on the CCAAT/enhancer binding protein {alpha} (C/EBP{alpha}) and c-Myc axis. After exposure to a combination of these agents, cell differentiation and growth arrest were significantly higher in human and murine MLL-AF9-expressing cells than in MLL-AF4/AF5q31-expressing cells, which were partly associated with increased expression of C/EBP{alpha}, C/EBP{epsilon}, and PU.1, and decreased expression of c-Myc. These findings indicate that MLL-AF9-expressing cells are more sensitive to ATRA and 5-Aza, indicating that different MLL fusion proteins possess different epigenetic properties associated with retinoic acid pathway inactivation.

  8. Amino acid substitutions at the major insertion loop of Candida albicans sterol 14alpha-demethylase are involved in fluconazole resistance.

    Directory of Open Access Journals (Sweden)

    Nidia Alvarez-Rueda

    Full Text Available BACKGROUND: In the fungal pathogen Candida albicans, amino acid substitutions of 14alpha-demethylase (CaErg11p, CaCYP51 are associated with azole antifungals resistance. This is an area of research which is very dynamic, since the stakes concern the screening of new antifungals which circumvent resistance. The impact of amino acid substitutions on azole interaction has been postulated by homology modeling in comparison to the crystal structure of Mycobacterium tuberculosis (MT-CYP51. Modeling of amino acid residues situated between positions 428 to 459 remains difficult to explain to date, because they are in a major insertion loop specifically present in fungal species. METHODOLOGY/PRINCIPAL FINDING: Fluconazole resistance of clinical isolates displaying Y447H and V456I novel CaErg11p substitutions confirmed in vivo in a murine model of disseminated candidiasis. Y447H and V456I implication into fluconazole resistance was then studied by site-directed mutagenesis of wild-type CaErg11p and by heterogeneously expression into the Pichia pastoris model. CLSI modified tests showed that V447H and V456I are responsible for an 8-fold increase in fluconazole MICs of P. pastoris mutants compared to the wild-type controls. Moreover, mutants showed a sustained capacity for producing ergosterol, even in the presence of fluconazole. Based on these biological results, we are the first to propose a hybrid homology structure-function model of Ca-CYP51 using 3 different homology modeling programs. The variable position of the protein insertion loop, using different liganded or non-liganded templates of recently solved CYP51 structures, suggests its inherent flexibility. Mapping of recognized azole-resistant substitutions indicated that the flexibility of this region is probably enhanced by the relatively high glycine content of the consensus. CONCLUSIONS/SIGNIFICANCE: The results highlight the potential role of the insertion loop in azole resistance in the human

  9. SUPPRESSION OF MAMMARY CARCINOMAS BY ALPHA-LINOLENIC ACID: PART I. EFFECT OF EXTRACTION METHODS ON QUALITY AND GC-MS ANALYSIS OF OIL FROM FLAXSEED (LINUM USITATISSIMUM L.).

    OpenAIRE

    Vanita S. Bhat; Basavaraj Madhusudhan.

    2018-01-01

    Therapeutic role of alpha-linolenic acid (ALA) in human health and disease is gaining remarkable attention in food products, formulations and supplements. Flaxseed oil is also one among the best sources of ALA. In this paper, effectiveness of ultrasonic extraction of oil from finely ground flaxseed flour is compared to the other two conventional extraction methods. The yields of oils in cold pressed method (30.14%), ultrasonic extraction (48.05%) and Soxhlet extracted (43.01%) were measured. ...

  10. Mucoproteína versus alfa-1-glicoproteína ácida: o que quantificar? Mucoprotein versus alpha-1-acid glycoprotein: what should be measured?

    Directory of Open Access Journals (Sweden)

    Geraldo Picheth

    2002-01-01

    Full Text Available A quantificação sérica da alfa-1-glicoproteína (GPA ácida é útil no diagnóstico e no acompanhamento dos processos agudos resultantes de múltiplas causas. Esta proteína também pode ser estimada pela quantificação da mucoproteína (Muco, ensaio que reflete as glicoproteínas com elevado teor de açúcar, entre as quais a GPA é majoritária. O objetivo deste trabalho é verificar a correlação e a performance analítica das determinações de mucoproteína (Muco e alfa-1-glicoproteína ácida (GPA, propondo uma equação de regressão linear. Amostras de soros de 540 pacientes, com idades entre 10 e 79 anos (média de 34,6, predominando mulheres (71,3%, foram analisadas simultaneamente para Muco (Winzler, manual com reagentes próprios e GPA (imunoturbidimetria automatizada, Roche; Cobas mira. A análise de regressão, fixando a Muco como variável dependente, apresentou Muco (mg/dl em tirosina = 0,031 x GPA (mg/dl + 0,8 (r = 0,91; e, fixando o intercepto em zero, Muco = 0,039 x GPA (r = 0,98. A imprecisão interensaio foi de 23,4% e 5,2% (coeficiente de variação, respectivamente, para Muco e GPA. Conclusão: a elevada variabilidade analítica da quantificação da mucoproteína pelo método de Winzler recomenda que este ensaio seja substituído pela dosagem da alfa-1-glicoproteína ácida. Quando necessário, recomendamos estimar a mucoproteína, quantificando a alfa-1-glicoproteína ácida com ensaios de mesmo desempenho que o do utilizado neste trabalho, e usar a equação de regressão AGP (mg/dl x 0,039 = Muco (mg/dl em tirosina.The alpha-1-acid glycoprotein (AGP, orosomucoid serum measurement is useful in the diagnosis and management of acute processes of multiple causes. This protein can also be estimated by measuring the mucoprotein (Muco that reflects the serum glycoproteins with high levels of sugars, in which than AGP is the principal component. The analytical performance between Muco and AGP was analyzed and a linear

  11. Pharmacokinetics of hedgehog pathway inhibitor vismodegib (GDC-0449) in patients with locally advanced or metastatic solid tumors: the role of alpha-1-acid glycoprotein binding.

    Science.gov (United States)

    Graham, Richard A; Lum, Bert L; Cheeti, Sravanthi; Jin, Jin Yan; Jorga, Karin; Von Hoff, Daniel D; Rudin, Charles M; Reddy, Josina C; Low, Jennifer A; Lorusso, Patricia M

    2011-04-15

    In a phase I trial for patients with refractory solid tumors, hedgehog pathway inhibitor vismodegib (GDC-0449) showed little decline in plasma concentrations over 7 days after a single oral dose and nonlinearity with respect to dose and time after single and multiple dosing. We studied the role of GDC-0449 binding to plasma protein alpha-1-acid glycoprotein (AAG) to better understand these unusual pharmacokinetics. Sixty-eight patients received GDC-0449 at 150 (n = 41), 270 (n = 23), or 540 (n = 4) mg/d, with pharmacokinetic (PK) sampling at multiple time points. Total and unbound (dialyzed) GDC-0449 plasma concentrations were assessed by liquid chromatography/tandem mass spectrometry, binding kinetics by surface plasmon resonance-based microsensor, and AAG levels by ELISA. A linear relationship between total GDC-0449 and AAG plasma concentrations was observed across dose groups (R(2) = 0.73). In several patients, GDC-0449 levels varied with fluctuations in AAG levels over time. Steady-state, unbound GDC-0449 levels were less than 1% of total, independent of dose or total plasma concentration. In vitro, GDC-0449 binds AAG strongly and reversibly (K(D) = 13 μmol/L) and human serum albumin less strongly (K(D) = 120 μmol/L). Simulations from a derived mechanistic PK model suggest that GDC-0449 pharmacokinetics are mediated by AAG binding, solubility-limited absorption, and slow metabolic elimination. GDC-0449 levels strongly correlated with AAG levels, showing parallel fluctuations of AAG and total drug over time and consistently low, unbound drug levels, different from previously reported AAG-binding drugs. This PK profile is due to high-affinity, reversible binding to AAG and binding to albumin, in addition to solubility-limited absorption and slow metabolic elimination properties. ©2011 AACR.

  12. Age differences of salivary alpha-amylase levels of basal and acute responses to citric acid stimulation between Chinese children and adults

    Directory of Open Access Journals (Sweden)

    Zemin eYang

    2015-11-01

    Full Text Available It remains unclear how salivary alpha-amylase (sAA levels respond to mechanical stimuli in different age groups. In addition, the role played by the sAA gene (AMY1 copy number and protein expression (glycosylated and non-glycosylated in sAA activity has also been rarely reported. In this study, we analyzed saliva samples collected before and after citric acid stimulation from 47 child and 47 adult Chinese subjects. We observed that adults had higher sAA activity and sAA glycosylated levels (glycosylated sAA amount/total sAA amount in basal and stimulated saliva when compared with children, while no differences were found in total or glycosylated sAA amount between them. Interestingly, adults showed attenuated sAA activity levels increase over those of children after stimulation. Correlation analysis showed that total sAA amount, glycosylated sAA amount, and AMY1 copy number×total sAA amount were all positively correlated with sAA activity before and after stimulation in both groups. Interestingly, correlation r between sAA levels (glycosylated sAA amount and total sAA amount and sAA activity decreased after stimulation in children, while adults showed an increase in correlation r. In addition, the correlation r between AMY1 copy number×total sAA amount and sAA activity was higher than that between AMY1 copy number, total sAA amount and sAA activity, respectively. Taken together, our results suggest that total sAA amount, glycosylated sAA amount, and the positive interaction between AMY1 copy number and total sAA amount are crucial in influencing sAA activity before and after stimulation in children and adults.

  13. Interaction of new kinase inhibitors cabozantinib and tofacitinib with human serum alpha-1 acid glycoprotein. A comprehensive spectroscopic and molecular Docking approach

    Science.gov (United States)

    Ajmal, Mohammad Rehan; Abdelhameed, Ali Saber; Alam, Parvez; Khan, Rizwan Hasan

    2016-04-01

    In the current study we have investigated the interaction of newly approved kinase inhibitors namely Cabozantinib (CBZ) and Tofacitinib (TFB) with human Alpha-1 acid glycoprotein (AAG) under simulated physiological conditions using fluorescence quenching measurements, circular dichroism, dynamic light scattering and molecular docking methods. CBZ and TFB binds to AAG with significant affinity and the calculated binding constant for the drugs lie in the order of 104. With the increase in temperature the binding constant values decreased for both CBZ and TFB. The fluorescence resonance energy transfer (FRET) from AAG to CBZ and TFB suggested the fluorescence intensity of AAG was quenched by the two studied drugs via the formation of a non-fluorescent complex in the static manner. The molecular distance r value calculated from FRET is around 2 nm for both drugs, fluorescence spectroscopy data was employed for the study of thermodynamic parameters, standard Gibbs free energy change at 300K was calculated as - 5.234 kcal mol- 1 for CBZ-AAG interaction and - 6.237 kcal mol- 1 for TFB-AAG interaction, standard enthalpy change and standard entropy change for CBZ-AAG interaction are - 9.553 kcal mol- 1 and - 14.618 cal mol- 1K- 1 respectively while for AAG-TFB interaction, standard enthalpy and standard entropy change was calculated as 4.019 kcal mol- 1 and 7.206 cal mol- 1K- 1 respectively. Protein binding of the two drugs caused the tertiary structure alterations. Dynamic light scattering measurements demonstrated the reduction in the hydrodynamic radii of the protein. Furthermore molecular docking results suggested the Hydrophobic interaction and hydrogen bonding were the interactive forces in the binding process of CBZ to AAG while in case of TFB only hydrophobic interactions were found to be involved, overlap of the binding site for two studied drugs on the AAG molecule was revealed by docking results.

  14. 8-Quinolineboronic acid as a potential phosphorescent molecular switch for the determination of alpha-fetoprotein variant for the prediction of primary hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Liu Jiaming; Li Feiming; Liu Zhenbo; Lin Changqing; Lin Shaoqin; Lin Liping; Wang Xinxing; Li Zhiming

    2010-01-01

    8-Quinolineboronic acid phosphorescent molecular switch (8-QBA-PMS) in the 'off' state emitted weak room temperature phosphorescence (RTP) of 8-QBA on the acetylcellulose membrane (ACM) with the perturbation of Pb 2+ . When 8-QBA-PMS was used to label concanavalin agglutinin (Con A) to form 8-QBA-PMS-Con A based on the reaction between -OH of 8-QBA-PMS and -COOH of Con A, 8-QBA-PMS turned 'on' automatically due to its structure change, and RTP of the system increased 2.7 times. Besides, -NH 2 of 8-QBA-PMS-Con A could carry out affinity adsorption (AA) reaction with the -COOH of alpha-fetoprotein variant (AFP-V) to form the product Con A-AFP-V-Con A-8-QBA-PMS containing -NH-CO- bond, causing the RTP of the system to further increase. Moreover, the amount of AFP-V was linear to the ΔI p of the system in the range of 0.012-2.40 (fg spot -1 ). Thus, a new affinity sensitive adsorption solid substrate room temperature phosphorimetry using 8-QBA-PMS as labelling reagent (8-QBA-PMS-AASSRTP) for the determination of AFP-V was proposed with the detection limit (LD) of 9 x 10 -15 g mL -1 . It had been used to determine AFP-V in human serum with the results agreeing with enzyme-link immunoassay (ELISA), showing promise for the prediction of PHC due to the intimate association between AFP-V and primary hepatocellular carcinoma (PHC). The mechanism of the promethod was also discussed.

  15. Effect of Supplementation Purslane (Portulaca oleracea as a Source of Alpha-Linolenic Acid on Production Performance and Physical Quality of Egg of Laying Hens

    Directory of Open Access Journals (Sweden)

    Lilik Kartikasari

    2015-09-01

    Full Text Available The aim of the study was to evaluate the effects of inclusion plant source of n 3 fat in the form of alpha-linolenic acid (ALA, 18:3n-3 on the diets of layers on production performance and physical quality of eggs. A total of  125 Hy-Line Brown hens (38 weeks old were placed at individual cages and assigned to five dietary treatments. The dietary treatments were supplemented with 0, 1.5, 3.0, 4.5 and 6.0% purslane meal. Laying hens were fed for five weeks following a seven day adaptation period. Water and feed were provided ad libitum. Feed intake (FI measured weekly and feed consumption ratio (FCR was calculated at the end of the trial. A total of 25 egg yolk samples of day 35 (n = 5 egg yolks for each treatment were collected to analyse physical quality of eggs. The data were analyzed using Analysis of Variance (ANOVA. Differences between treatment means were further analyzed using Duncan's New Multiple Range Test (DMRT. Results showed that the incorporation of plants rich in ALA did not modify FI, FCR, and egg production. Supplementation of purslane meal in the diets had no effect on physical quality of eggs, including egg weight, yolk weight, albumen index, yolk index and Haugh Unit (HU. The average of egg weight and yolk weight were 60,5 and 15.3 g, respectively. Diet containing purslane meal increased yolk colour. In conclusion, laying hens that fed diet supplemented with purslane meal rich in ALA improved yolk colour and did not change the production performance of the laying hens or the qualities of the eggs.

  16. Complete amino acid sequence of the human alpha 5 (IV) collagen chain and identification of a single-base mutation in exon 23 converting glycine 521 in the collagenous domain to cysteine in an Alport syndrome patient

    DEFF Research Database (Denmark)

    Zhou, J; Hertz, Jens Michael; Leinonen, A

    1992-01-01

    We have generated and characterized cDNA clones providing the complete amino acid sequence of the human type IV collagen chain whose gene has been shown to be mutated in X chromosome-linked Alport syndrome. The entire translation product has 1,685 amino acid residues. There is a 26-residue signal...... peptide, a 1,430-residue collagenous domain starting with a 14-residue noncollagenous sequence, and a Gly-Xaa-Yaa-repeat sequence interrupted at 22 locations, and a 229-residue carboxyl-terminal noncollagenous domain. The calculated molecular weight of the mature alpha 5(IV) chain is 158,303. Analysis...

  17. Phenotypic consequences of deletion of the {gamma}{sub 3}, {alpha}{sub 5}, or {beta}{sub 3} subunit of the type A {gamma}-aminobutyric acid receptor in mice

    Energy Technology Data Exchange (ETDEWEB)

    Culia, C.T.; Stubbs, L.J.; Montgomery, C.S.; Russell, L.B.; Rinchik, E.M. [Oak Ridge National Lab., TN (United States)

    1994-03-29

    Three genes (Gabrg3, Gabra5, and Gabrb3) encoding the {gamma}{sub 3}, {alpha}{sub 5}, and {beta}{sub 3} subunits of the type A {gamma}-aminobutyric acid receptor, respectively, are known to map near the pink-eyed dilution (p) locus in mouse chromosome 7. This region shares homology with a segment of human chromosome 15 that is implicated in Angelman syndrome, an inherited neurobehavioral disorder. By mapping Gabrg3-Gabra5-Gabrb3-telomere. Like Gabrb3, neither the Gabra5 nor Gabrg3 gene is functionally imprinted in adult mouse brain. Mice deleted for all three subunits die at birth with a cleft palate, although there are rare survivors ({approximately} 5%) that do not have a cleft palate but do exhibit a neurological abnormality characterized by tremor, jerky gait, and runtiness. The authors have previously suggested that deficiency of the {beta}{sub 3} subunit may be responsible for the clefting defect. Most notably, however, in this report they describe mice carrying two overlapping, complementing p deletions that fail to express the {gamma}{sub 3} transcript, as well as mice from another line that express neither the {gamma}{sub 3} nor {alpha}{sub 5} transcripts. Surprisingly, mice from both of these lines are phenotypically normal and do not exhibit any of the neurological symptoms characteristic of the rare survivors that are deleted for all three ({gamma}{sub 3}, {alpha}{sub 5}, and {beta}{sub 3}) subunits. These mice therefore provide a whole-organism type A {gamma}-aminobutyric-acid receptor background that is devoid of any receptor subtypes that normally contain the {gamma}{sub 3} and/or {alpha}{sub 5} subunits. The absence of an overt neurological phenotype in mice lacking the {gamma}{sub 3} and/or {alpha}{sub 5} subunits also suggests that mutations in these genes are unlikely to provide useful animal models for Angelman syndrome in humans.

  18. Adiponectin levels are reduced, independent of polymorphisms in the adiponectin gene, after supplementation with alpha-linolenic acid among healthy adults.

    Science.gov (United States)

    Nelson, Tracy L; Stevens, James R; Hickey, Matthew S

    2007-09-01

    Our first aim was to determine whether an isocaloric intervention using alpha-linolenic acid (ALA) in the form of flaxseed oil would alter adiponectin levels among overweight, otherwise healthy, males and females, and our second aim was to test for any potential modification of this intervention by 2 single nucleotide polymorphisms (276 and 45) in the adiponectin gene. Subjects included healthy adult males and females (approximately 81% female; average age, 38 years) with increased waist circumference (mean, 99 cm) and body mass index (mean, 30 kg/m(2)) who were free of chronic disease, not taking medications, and sedentary. Subjects met weekly with a registered dietician for 8 weeks. The control subjects (n = 27) were instructed not to alter their habitual diet and the ALA group (n = 30) was instructed to follow an enriched ALA diet by using flaxseed oil capsules (increasing ALA to 5% of total energy intake) and to lower their dietary fat consumption by a commensurate amount. Diets were analyzed using the Food Intake and Analysis System (v. 3.0, University of Texas School of Public Health, 1998). Fasting blood samples were obtained before and after the 8-week intervention. We found significant decreases (P = .02) in adiponectin (10.12 microg/mL pre, 9.23 microg/mL post) in the ALA group as compared with the control group (7.93 microg/mL pre, 8.10 microg/mL post) after the intervention. We also saw a decline in adiponectin in all genotype groups with the greatest decline among those carrying the rare T allele of single nucleotide polymorphism 276. There were no significant changes in fasting insulin, glucose, or quantitative insulin sensitivity check index values as a result of this intervention. In conclusion, this study suggests that supplementing with ALA for 8 weeks may lower adiponectin levels among healthy individuals, and this effect appears to be independent of polymorphisms in the adiponectin gene. Although the change in adiponectin in response to the

  19. Alpha-tocopheryl polyethylene glycol succinate-emulsified poly(lactic-co-glycolic acid) nanoparticles for reversal of multidrug resistance in vitro

    Science.gov (United States)

    Wang, Ying; Guo, Miao; Lu, Yu; Ding, Li-Ying; Ron, Wen-Ting; Liu, Ya-Qing; Song, Fei-Fei; Yu, Shu-Qin

    2012-12-01

    Multidrug resistance (MDR) is one of the factors in the failure of anticancer chemotherapy. In order to enhance the anticancer effect of P-glycoprotein (P-gp) substrates, inhibition of the P-gp efflux pump on MDR cells is a good tactic. We designed novel multifunctional drug-loaded alpha-tocopheryl polyethylene glycol succinate (TPGS)/poly(lactic-co-glycolic acid) (PLGA) nanoparticles (TPGS/PLGA/SN-38 NPs; SN-38 is 7-ethyl-10-hydroxy-camptothecin), with TPGS-emulsified PLGA NPs as the carrier and modulator of the P-gp efflux pump and SN-38 as the model drug. TPGS/PLGA/SN-38 NPs were prepared using a modified solvent extraction/evaporation method. Physicochemical characterizations of TPGS/PLGA/SN-38 NPs were in conformity with the principle of nano-drug delivery systems (nDDSs), including a diameter of about 200 nm, excellent spherical particles with a smooth surface, narrow size distribution, appropriate surface charge, and successful drug-loading into the NPs. The cytotoxicity of TPGS/PLGA/SN-38 NPs to MDR cells was increased by 3.56 times compared with that of free SN-38. Based on an intracellular accumulation study relative to the time-dependent uptake and efflux inhibition, we suggest novel mechanisms of MDR reversal of TPGS/PLGA NPs. Firstly, TPGS/PLGA/SN-38 NPs improved the uptake of the loaded drug by clathrin-mediated endocytosis in the form of unbroken NPs. Simultaneously, intracellular NPs escaped the recognition of P-gp by MDR cells. After SN-38 was released from TPGS/PLGA/SN-38 NPs in MDR cells, TPGS or/and PLGA may modulate the efflux microenvironment of the P-gp pump, such as mitochondria and the P-gp domain with an ATP-binding site. Finally, the controlled-release drug entered the nucleus of the MDR cell to induce cytotoxicity. The present study showed that TPGS-emulsified PLGA NPs could be functional carriers in nDDS for anticancer drugs that are also P-gp substrates. More importantly, to enhance the therapeutic effect of P-gp substrates, this work

  20. Alpha-tocopheryl polyethylene glycol succinate-emulsified poly(lactic-co-glycolic acid) nanoparticles for reversal of multidrug resistance in vitro

    International Nuclear Information System (INIS)

    Wang Ying; Lu Yu; Ding Liying; Liu Yaqing; Yu Shuqin; Guo Miao; Ron Wenting; Song Feifei

    2012-01-01

    Multidrug resistance (MDR) is one of the factors in the failure of anticancer chemotherapy. In order to enhance the anticancer effect of P-glycoprotein (P-gp) substrates, inhibition of the P-gp efflux pump on MDR cells is a good tactic. We designed novel multifunctional drug-loaded alpha-tocopheryl polyethylene glycol succinate (TPGS)/poly(lactic-co-glycolic acid) (PLGA) nanoparticles (TPGS/PLGA/SN-38 NPs; SN-38 is 7-ethyl-10-hydroxy-camptothecin), with TPGS-emulsified PLGA NPs as the carrier and modulator of the P-gp efflux pump and SN-38 as the model drug. TPGS/PLGA/SN-38 NPs were prepared using a modified solvent extraction/evaporation method. Physicochemical characterizations of TPGS/PLGA/SN-38 NPs were in conformity with the principle of nano-drug delivery systems (nDDSs), including a diameter of about 200 nm, excellent spherical particles with a smooth surface, narrow size distribution, appropriate surface charge, and successful drug-loading into the NPs. The cytotoxicity of TPGS/PLGA/SN-38 NPs to MDR cells was increased by 3.56 times compared with that of free SN-38. Based on an intracellular accumulation study relative to the time-dependent uptake and efflux inhibition, we suggest novel mechanisms of MDR reversal of TPGS/PLGA NPs. Firstly, TPGS/PLGA/SN-38 NPs improved the uptake of the loaded drug by clathrin-mediated endocytosis in the form of unbroken NPs. Simultaneously, intracellular NPs escaped the recognition of P-gp by MDR cells. After SN-38 was released from TPGS/PLGA/SN-38 NPs in MDR cells, TPGS or/and PLGA may modulate the efflux microenvironment of the P-gp pump, such as mitochondria and the P-gp domain with an ATP-binding site. Finally, the controlled-release drug entered the nucleus of the MDR cell to induce cytotoxicity. The present study showed that TPGS-emulsified PLGA NPs could be functional carriers in nDDS for anticancer drugs that are also P-gp substrates. More importantly, to enhance the therapeutic effect of P-gp substrates, this work

  1. Suppression of alpha-tocopherol ether-linked acetic acid in VEGF-induced angiogenesis and the possible mechanisms in human umbilical vein endothelial cells

    International Nuclear Information System (INIS)

    Chuang, Cheng-Hung; Liu, Chia-Hua; Lu, Ta-Jung; Hu, Miao-Lin

    2014-01-01

    Alpha-tocopherol ether-linked acetic acid (α-TEA) has been reported to exhibit both anti-tumor and anti-metastatic activities in cell culture and animal studies. However, it is unclear whether α-TEA possesses anti-angiogenic effects. In this study, we investigated the effect of α-TEA on vascular endothelial growth factor (VEGF)-induced angiogenesis and matrix metalloproteinase (MMP) expression both in vitro and ex vivo. We found that the α-TEA inhibited tube formation, invasion, and migration in human umbilical vein endothelial cells (HUVECs) and that such actions were accompanied by reduced expression of MMP-2. α-TEA also inhibited ex vivo angiogenesis, as indicated by chicken egg chorioallantoic membrane assay. We further showed that α-TEA attenuated protein expression of VEGF receptor-2 (VEGFR-2)-mediated p38 mitogen-activated protein kinase (p38), phosphorylated p38, and focal adhesion kinase (FAK). Moreover, α-TEA (30 μM) significantly up-regulated protein expression of tissue inhibitors of MMP (TIMP)-2 (by 138%) and the metastasis suppressor gene nm23-H1 (by 54%). These results demonstrate that the anti-angiogenic effect of α-TEA both in vitro and ex vivo and its possible mechanistic action appears to involve the inhibition of MMP-2 level through VEGFR-2-mediated FAK and p38 signaling pathways and through up-regulation of TIMP-2 and nm23-H1 expression. - Graphical abstract: Possible mechanisms of α-TEA on inhibited angiogenesis of human umbilical vein endothelial cells. Brief summary In the present study, we have demonstrated that VEGF-mediated angiogenesis is significantly inhibited by α-TEA, and that this effect involves inhibition of MMP-2 level through VEGFR-2-mediated FAK and p38 signaling pathways related to invasion and migration. - Highlights: • The anti-angiogenic effect and the mechanistic action of α-TEA were investigated. • α-TEA significantly inhibited VEGF-mediated angiogenesis both in vitro and ex vivo. • α-TEA down

  2. Suppression of alpha-tocopherol ether-linked acetic acid in VEGF-induced angiogenesis and the possible mechanisms in human umbilical vein endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Cheng-Hung, E-mail: chchuang@hk.edu.tw [Department of Nutrition, Master Program of Biomedical Nutrition, Hungkuang University, 1018 Sec. 6 Taiwan Boulevard, Taichung 43302, Taiwan, ROC (China); Liu, Chia-Hua [Department of Food Science and Biotechnology, National Chung-Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC (China); Lu, Ta-Jung [Department of Chemistry, Institute of Technology and Innovation Management, National Chung-Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC (China); Hu, Miao-Lin, E-mail: mlhuhu@dragon.nchu.edu.tw [Department of Food Science and Biotechnology, National Chung-Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC (China)

    2014-12-15

    Alpha-tocopherol ether-linked acetic acid (α-TEA) has been reported to exhibit both anti-tumor and anti-metastatic activities in cell culture and animal studies. However, it is unclear whether α-TEA possesses anti-angiogenic effects. In this study, we investigated the effect of α-TEA on vascular endothelial growth factor (VEGF)-induced angiogenesis and matrix metalloproteinase (MMP) expression both in vitro and ex vivo. We found that the α-TEA inhibited tube formation, invasion, and migration in human umbilical vein endothelial cells (HUVECs) and that such actions were accompanied by reduced expression of MMP-2. α-TEA also inhibited ex vivo angiogenesis, as indicated by chicken egg chorioallantoic membrane assay. We further showed that α-TEA attenuated protein expression of VEGF receptor-2 (VEGFR-2)-mediated p38 mitogen-activated protein kinase (p38), phosphorylated p38, and focal adhesion kinase (FAK). Moreover, α-TEA (30 μM) significantly up-regulated protein expression of tissue inhibitors of MMP (TIMP)-2 (by 138%) and the metastasis suppressor gene nm23-H1 (by 54%). These results demonstrate that the anti-angiogenic effect of α-TEA both in vitro and ex vivo and its possible mechanistic action appears to involve the inhibition of MMP-2 level through VEGFR-2-mediated FAK and p38 signaling pathways and through up-regulation of TIMP-2 and nm23-H1 expression. - Graphical abstract: Possible mechanisms of α-TEA on inhibited angiogenesis of human umbilical vein endothelial cells. Brief summary In the present study, we have demonstrated that VEGF-mediated angiogenesis is significantly inhibited by α-TEA, and that this effect involves inhibition of MMP-2 level through VEGFR-2-mediated FAK and p38 signaling pathways related to invasion and migration. - Highlights: • The anti-angiogenic effect and the mechanistic action of α-TEA were investigated. • α-TEA significantly inhibited VEGF-mediated angiogenesis both in vitro and ex vivo. • α-TEA down

  3. Rho iso-alpha acids from hops inhibit the GSK-3/NF-κB pathway and reduce inflammatory markers associated with bone and cartilage degradation

    Directory of Open Access Journals (Sweden)

    Bland Jeffrey S

    2009-08-01

    Full Text Available Abstract Background Rho iso-alpha acids (RIAA from hops have been shown to have anti-inflammatory properties. To understand the mechanisms, we evaluated the effect of RIAA in cell signaling pathways and inflammatory markers using various in vitro models. We also investigated their therapeutic effect in mice with collagen-induced arthritis. Methods The LPS-stimulated RAW 264.7 macrophages were used to evaluate the effect of RIAA on the NF-κB and MAPK signaling pathways; phosphorylation of ERK1/2, p38 and JNK was assessed by western blotting and NF-κB binding by electrophoretic mobility shift assays. Effect on the NF-κB activity was evaluated by the luciferase reporter assays in LPS-stimulated RAW 264.7 cells. GSK-3α/β kinase activity was measured in cell-free assays. The inhibitory effect of RIAA on inflammatory markers was assessed by measuring nitric oxide in LPS-stimulated RAW 264.7 cells, RANKL-mediated TRAP activity in transformed osteoclasts, and TNF-α/IL-1β-mediated MMP-13 expression in SW1353 cells. Mice with collagen-induced arthritis were fed with RIAA for 2 weeks. Symptoms of joint swelling, arthritic index and joint damage were assessed. Results RIAA selectively inhibited the NF-κB pathway while having no effect on ERK1/2, p38 and JNK phosphorylation in LPS-stimulated RAW 264.7 cells. RIAA also inhibited GSK-3α/β kinase activity and GSK-3β dependent phosphorylation of β-catenin in RAW 264.7 cells. In addition, RIAA inhibited NF-κB-mediated inflammatory markers in various cell models, including nitric oxide in LPS-stimulated RAW 264.7 cells, RANKL-mediated TRAP activity in transformed osteoclasts, and TNF-α/IL-1β-mediated MMP-13 expression in SW1353 human chondrosarcoma cells. Finally, in a mouse model of collagen-induced arthritis, RIAA ameliorated joint damage as evidenced by significant reduction of the arthritis index and histology score; at 250 mg/kg-body weight, RIAA had efficacy similar to that of 20 mg

  4. Effects of DL-alpha-amino adipic acid on Müller cells in frog and chicken retinae in vivo: relation to ERG b wave, ganglion cell discharge and tectal evoked potentials.

    Science.gov (United States)

    Bonaventure, N; Roussel, G; Wioland, N

    1981-11-18

    In both frog and chicken, an intravitreal injection of DL-alpha-amino-adipic acid, (DL-alpha aaa) provoked a progressive depression and eventually the disappearance of the ERG b wave that was concomitant with severe damage to the Müller cells without any apparent damage to retinal neurons. Ganglion cell discharges as well as tectal evoked potentials were still recorded, i.e. a visual message was still generated in the retina and transmitted to the optic tectum, when the Müller cells had been damaged to as to provoke an abolition of the ERG b-wave. The whole of the drug-induced effects proved to be reversible.

  5. Brain Activity of Thioctic Acid Enantiomers: In Vitro and in Vivo Studies in an Animal Model of Cerebrovascular Injury

    Directory of Open Access Journals (Sweden)

    Seyed Khosrow Tayebati

    2013-02-01

    Full Text Available Oxidative stress is an imbalance between the production of free radicals and antioxidant defense mechanisms, potentially leading to tissue damage. Oxidative stress has a key role in the development of cerebrovascular and/or neurodegenerative diseases. This phenomenon is mainly mediated by an enhanced superoxide production by the vascular endothelium with its consequent dysfunction. Thioctic, also known as alpha-lipoic acid (1,2-dithiolane-3-pentanoic acid, is a naturally occurring antioxidant that neutralizes free radicals in the fatty and watery regions of cells. Both the reduced and oxidized forms of the compound possess antioxidant ability. Thioctic acid has two optical isomers designated as (+- and (−-thioctic acid. Naturally occurring thioctic acid is the (+-thioctic acid form, but the synthetic compound largely used in the market for stability reasons is a mixture of (+- and (−-thioctic acid. The present study was designed to compare the antioxidant activity of the two enantiomers versus the racemic form of thioctic acid on hydrogen peroxide-induced apoptosis in a rat pheochromocytoma PC12 cell line. Cell viability was evaluated by MTT (3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay and free oxygen radical species (ROS production was assessed by flow cytometry. Antioxidant activity of the two enantiomers and the racemic form of thioctic acid was also evaluated in spontaneously hypertensive rats (SHR used as an in vivo model of increased oxidative stress. A 3-h exposure of PC12 cells to hydrogen peroxide (H2O2 significantly decreased cell viability and increased levels of intracellular ROS production. Pre-treatment with racemic thioctic acid or (+-enantiomer significantly inhibited H2O2-induced decrease in cell viability from the concentration of 50 μmol/L and 20 μmol/L, respectively. Racemic thioctic acid and (+-salt decreased levels of intracellular ROS, which were unaffected by (−-thioctic acid. In the brain of

  6. Coulomb correction to elastic. alpha. -. alpha. scattering

    Energy Technology Data Exchange (ETDEWEB)

    Bera, P.K.; Jana, A.K.; Haque, N.; Talukdar, B. (Department of Physics, Visva-Bharati University, Santiniketan-731235, West Bengal, India (IN))

    1991-02-01

    The elastic {alpha}-{alpha} scattering is treated within the framework of a generalized phase-function method (GPFM). This generalization consists in absorbing the effect of Coulomb interaction in the comparison functions for developing the phase equation. Based on values of scattering phase shifts computed by the present method, it is concluded that the GPFM provides an uncomplicated approach to rigorous Coulomb correction in the {alpha}-{alpha} scattering.

  7. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.

    Science.gov (United States)

    Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas

    2007-09-01

    Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway.

  8. Intrahepatic expression of interferon alpha & interferon alpha ...

    African Journals Online (AJOL)

    kemrilib

    Alpha m-RNA while 30% only expressed Interferon Alpha Receptor m-RNA. Responders and non-responders to Interferon therapy ... expression of IFN Alpha Receptor mRNA. Regardless of the response to interferon, histological .... generation reverse hybridisation, line probe assay. (Inno-LiPA HCV II; Innogenetics, Ghent,.

  9. Dietary alpha-cyclodextrin lowers LDL-C and alters plasma fatty acid profile in LDLr-KO mice on a high-fat diet

    OpenAIRE

    Wagner, Elke M.; Catherine Jen, K-L; Artiss, Joseph D.; Remaley, Alan T.

    2008-01-01

    High dietary intake of saturated fat and cholesterol, and elevated low-density-lipoprotein (LDL) cholesterol levels are some of the modifiable risk factors for cardiovascular disease (CVD). Alpha-cyclodextrin (α-CD) when given orally has been shown in rats to increase fecal saturated fat excretion, and to reduce blood total cholesterol levels in obese hypertriglyceridemic subjects with type 2 diabetes. In this study, the effects of dietary α-CD on lipid metabolism in LDL receptor knock-out (L...

  10. The effects of TNF-alpha and inhibitors of arachidonic acid metabolism on human colon HT-29 cells depend on differentiation status

    Czech Academy of Sciences Publication Activity Database

    Kovaříková, Martina; Hofmanová, Jiřina; Souček, Karel; Kozubík, Alois

    2004-01-01

    Roč. 72, č. 1 (2004), s. 23-31 ISSN 0301-4681 R&D Projects: GA ČR GA525/01/0419; GA ČR GP524/02/P051; GA AV ČR IBS5004009 Institutional research plan: CEZ:AV0Z5004920 Keywords : colon cancer * cell differentiation * TNF-alpha Subject RIV: BO - Biophysics Impact factor: 4.481, year: 2004

  11. Evolution of Substrate Specificity within a Diverse Family of [beta/alpha]-Barrel-fold Basic Amino Acid Decarboxylases X-ray Structure Determination of Enzymes with Specificity for L-Arginine and Carboxynorspermidine

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Xiaoyi; Lee, Jeongmi; Michael, Anthony J.; Tomchick, Diana R.; Goldsmith, Elizabeth J.; Phillips, Margaret A. (Sungkyunkwan); (UTSMC)

    2010-08-26

    Pyridoxal 5{prime}-phosphate (PLP)-dependent basic amino acid decarboxylases from the {beta}/{alpha}-barrel-fold class (group IV) exist in most organisms and catalyze the decarboxylation of diverse substrates, essential for polyamine and lysine biosynthesis. Herein we describe the first x-ray structure determination of bacterial biosynthetic arginine decarboxylase (ADC) and carboxynorspermidine decarboxylase (CANSDC) to 2.3- and 2.0-{angstrom} resolution, solved as product complexes with agmatine and norspermidine. Despite low overall sequence identity, the monomeric and dimeric structures are similar to other enzymes in the family, with the active sites formed between the {beta}/{alpha}-barrel domain of one subunit and the {beta}-barrel of the other. ADC contains both a unique interdomain insertion (4-helical bundle) and a C-terminal extension (3-helical bundle) and it packs as a tetramer in the asymmetric unit with the insertions forming part of the dimer and tetramer interfaces. Analytical ultracentrifugation studies confirmed that the ADC solution structure is a tetramer. Specificity for different basic amino acids appears to arise primarily from changes in the position of, and amino acid replacements in, a helix in the {beta}-barrel domain we refer to as the 'specificity helix.' Additionally, in CANSDC a key acidic residue that interacts with the distal amino group of other substrates is replaced by Leu{sup 314}, which interacts with the aliphatic portion of norspermidine. Neither product, agmatine in ADC nor norspermidine in CANSDC, form a Schiff base to pyridoxal 5{prime}-phosphate, suggesting that the product complexes may promote product release by slowing the back reaction. These studies provide insight into the structural basis for the evolution of novel function within a common structural-fold.

  12. Effect of Omega-3 Fatty Acid Supplementation on Plasma Fibroblast Growth Factor 23 Levels in Post-Myocardial Infarction Patients with Chronic Kidney Disease : The Alpha Omega Trial

    NARCIS (Netherlands)

    de Borst, Martin H.; Baia, Leandro C.; Hoogeveen, Ellen K.; Giltay, Erik J.; Navis, Gerjan; Bakker, Stephan J. L.; Geleijnse, Johanna M.; Kromhout, Daan; Soedamah-Muthu, Sabita S.

    2017-01-01

    Fibroblast growth factor 23 (FGF23) is an independent risk factor for cardiovascular mortality in chronic kidney disease. Omega-3 (n-3) fatty acid consumption has been inversely associated with FGF23 levels and with cardiovascular risk. We examined the effect of marine n-3 fatty acids

  13. [The clinical biochemistry of hyperlipemia and hyperglycemia. Insulin and metabolism of fatty acids. Hypoglycemic effect of hyperlipemicpharmaceuticals].

    Science.gov (United States)

    Titov, V N; Rozhkova, T A; Ameliushkina, V A

    2014-03-01

    The regulation of metabolism of glucose is billions years older than system of insulin and biological function of locomotion (function of motion). Hence hypoglycemic effect of hormone is mediated by alteration of metabolism of fatty acids. The insulin in physiological way deprives mitochondrions a possibility to metabolize ketone bodies, short chain, medium chain and long chain fatty acids and 'forces" them to oxidize glucose which phylogenetically is not an optimal substrate. The relationships between fatty acids and glucose in the Rendle cycle have an effect only on autocrine level (in cell) determining alternation of biological reactions of exotrophia (after food intake) and endotrophia (beyond food intake) in biological function of alimentation (trophology). The most anti-diabetic pharmaceuticals are as insulin hyperlipemic by their mechanism of action. The decrease content of lipid substrates of oxidation in cytosol of cells and mitochondrions "are forced" to oxidize glucose. In these conditions, insulin enhances absorption of glucose by cells through glucose carriers--GLUT4. The derivatives of sulfonil-urea increase secretion of insulin by beta-cells of islets. The biguanidines bond in cytosol covalently and irreversibly ketone bodies taking them away from oxidation in mitochondrions. The fibrates, glitazones, flavonoids and flavones, lipoic tio-fatty acids. The endogenous eicosanoids, derivatives omega-3 and omega-6 of essential polyolefinic fatty acids and conjugated unsaturated fatty acids are the antagonists of receptors of activation of proliferation of peroxisomes. In peroxisomes, they enhance alpha-, beta- and omega-oxidation of all exogenous a physiological fatty acids and excess of palmitic saturated fatty acid forming hypolipidemia in cytozol. The hypolipidemic pharmaceuticals with effect of beta-blocker of oxidation stop absorption of fatty acids by mitochondrions. The omega-3 essential polvolefinic fatty acids, simultaneously with hypolipidemic

  14. Influence du taux d’acide alpha-linolénique de l’aliment sur la teneur en oméga-3 et les caractéristiques hédoniques de la viande de lapin. Revue bibliographique

    Directory of Open Access Journals (Sweden)

    Teillet Benoît

    2013-01-01

    Full Text Available Several publications are dealing with the influence of the omega 3 level in the feed, more particularly the alpha-linolenic acid level, on the rabbit meat level in this fatty acid, but only few of them deal with the use of the flaxseed. This review is a synthesis of the effects of the level of alpha-linolenic acid brought by the flaxseed on the omega 3 level of the rabbit meat. It shows a direct connection between the alpha-linolenic acid level in the feed and the omega 3 content of the rabbit meat. Besides, this enrichment decreases the saturated fatty acids level, the omega 6 level and consequently the omega 6/omega 3 ratio below 4. In consequence, the contribution of around 0.65% of alpha-linolenic acid in the feed by incorporation of flaxseed in the feed allows to bring in average 967 mg of omega 3 for 100 g of back or 459 mg for 100 kcal and 1004 mg of omega 3 for 100 g of shoulder or 483 mg for 100 kcal and consequently to claim the allegation “rich in omega 3”. This enrichment doesn’t modify the hedonic characteristics of the rabbit meat.

  15. Inhibition of c-Jun-N-terminal kinase increases cardiac peroxisome proliferator-activated receptor alpha expression and fatty acid oxidation and prevents lipopolysaccharide-induced heart dysfunction.

    Science.gov (United States)

    Drosatos, Konstantinos; Drosatos-Tampakaki, Zoi; Khan, Raffay; Homma, Shunichi; Schulze, P Christian; Zannis, Vassilis I; Goldberg, Ira J

    2011-10-21

    Septic shock results from bacterial infection and is associated with multi-organ failure, high mortality, and cardiac dysfunction. Sepsis causes both myocardial inflammation and energy depletion. We hypothesized that reduced cardiac energy production is a primary cause of ventricular dysfunction in sepsis. The JNK pathway is activated in sepsis and has also been implicated in impaired fatty acid oxidation in several tissues. Therefore, we tested whether JNK activation inhibits cardiac fatty acid oxidation and whether blocking JNK would restore fatty acid oxidation during LPS treatment. LPS treatment of C57BL/6 mice and adenovirus-mediated activation of the JNK pathway in cardiomyocytes inhibited peroxisome proliferator-activated receptor α expression and fatty acid oxidation. Surprisingly, none of the adaptive responses that have been described in other types of heart failure, such as increased glucose utilization, reduced αMHC:βMHC ratio or induction of certain microRNAs, occurred in LPS-treated mice. Treatment of C57BL/6 mice with a general JNK inhibitor (SP600125) increased fatty acid oxidati