Californium-252 sales and loans at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
King, L.J.
1987-01-01
The production and distribution in the United States of 252 Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252 Cf Industrial Sales/Loan Program and the 252 Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252 Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point
Superplastic deformation of P/M and I/M Al-Li based alloys
International Nuclear Information System (INIS)
Lederich, R.J.; Sastry, S.M.L.
1984-01-01
Incremental strain-rate and constant strain-rate cone-forming tests have been carried out at 450-550 C to investigate the superplastic forming characteristics of Al-Li-Cu-Mn, Al-Li-Cu-Mg-Zr, and Al-Li-Zn-Mg alloys processed by powder-metallurgy (P/M) and ingot-metallurgy (I/M) techniques. It is found that P/M Al-Li alloys containing 0.2 pct Zr are inherently superplastically formable without the need for extensive thermomechanical processing. I/M Al-Li alloys containing Zr are also superplastically formable. The mechanical properties of the superplastically formed and solution-treated-and-aged alloys are comparable to those of solution-treated-and-aged alloys before superplastic forming. 6 references
Use of californium-252 sources in Hungary for teaching and research
International Nuclear Information System (INIS)
Csikai, J.
1976-01-01
An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)
Development of crystal texture in R-lean RFeCoNbB (R = Nd, Pr) alloy during melt spinning processes
International Nuclear Information System (INIS)
Li, Wei; Li, Lanlan; Liu, Yanguo; Zhang, Xiangyi
2012-01-01
Highlights: ► We study the texture development during the melt spinning processes of R-lean alloys. ► A strong (0 0 l) texture parallel to the ribbon plane for (Nd,Pr) 2 Fe 14 B is obtained. ► The texture for R 2 Fe 14 B crystals can develop by a seeding effect of α-Fe texture. ► The anisotropic nanocomposite magnet yields M r = 0.78M s and large (BH) max = 25.2 MGOe. - Abstract: The formation of crystal texture of R 2 Fe 14 B nanocrystals in R–Fe–B (R = rare earth) alloys with low R content ( 2 Fe 14 B nanocrystals during the melt spinning processes of Nd 3.6 Pr 5.4 Fe 80 Co 3 NbB 7 by effectively employing the seeding effect of α-Fe nanocrystal texture. The (Nd,Pr) 2 Fe 14 B nanocrystals produced from the R-lean alloy at a wheel speed of 18 m/s show a strong (0 0 l) texture parallel to the ribbon plane, which yields a high remanence M r = 0.78M s and a large energy product (BH) max = 25.2 MGOe for the α-Fe/(Nd,Pr) 2 Fe 14 B nanocomposite ribbons. The present study provides a promising approach to prepare anisotropic nanocomposite magnets from R-lean alloys.
The Cryogenic Properties of Several Aluminum-Beryllium Alloys and a Beryllium Oxide Material
Gamwell, Wayne R.; McGill, Preston B.
2003-01-01
Performance related mechanical properties for two aluminum-beryllium (Al-Be) alloys and one beryllium-oxide (BeO) material were developed at cryogenic temperatures. Basic mechanical properties (Le., ultimate tensile strength, yield strength, percent elongation, and elastic modulus were obtained for the aluminum-beryllium alloy, AlBeMetl62 at cryogenic [-195.5"C (-320 F) and -252.8"C (-423"F)I temperatures. Basic mechanical properties for the Be0 material were obtained at cyrogenic [- 252.8"C (-423"F)] temperatures. Fracture properties were obtained for the investment cast alloy Beralcast 363 at cryogenic [-252.8"C (-423"F)] temperatures. The AlBeMetl62 material was extruded, the Be0 material was hot isostatic pressing (HIP) consolidated, and the Beralcast 363 material was investment cast.
International Nuclear Information System (INIS)
Horiuchi, Toshiaki; Kuwano, Kazuhiro; Satoh, Naohiro
2012-01-01
Some researchers recently point out that Ni based alloys used in nuclear power plants have the ordering tendency, which is a potential to decrease mechanical properties within the expected lifetime of the plants. In the present study, authors evaluated the effect of 8 alloying elements on the ordering tendency in Alloy690 based upon thermodynamic calculation by Thermo-Calc. It is clarified that the additive amount of Fe, Cr, Ti and Si, particularly Fe and Cr, was influential for the stability of Ni 2 M, while that of Mn, Cu, B and C had almost no effect for that. Authors therefore designed the Ni 2 M stabilized alloy by no addition of Fe in Alloy690. Ni 2 M is estimated to be stable even at 773 K in the Ni 2 M stabilized alloy. The influence by long range ordering or precipitating of Ni 2 M in Alloy690 for mechanical properties or SCC susceptibility is expected to be clarified by the sample obtained in the present study. (author)
PM alloy 625M for high strength corrosion resistant applications
International Nuclear Information System (INIS)
Rizzo, F.J.; Floreen, S.
1997-06-01
In applications where the combination of high strength and good corrosion resistance are required, there have been only a few alloys of choice. A new powder metallurgy alloy has been developed, PM 625M, a niobium modification of Alloy 625, as a material to fill this need. One area of particular interest is the nuclear power industry, where many problems have been encountered with bolts, springs, and guidepins. Mechanical properties and stress corrosion cracking data of PM 625M are presented in this paper
48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract.
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...
K-252a, a novel microbial product, inhibits smooth muscle myosin light chain kinase
International Nuclear Information System (INIS)
Nakanishi, S.; Yamada, K.; Kase, H.; Nakamura, S.; Nonomura, Y.
1988-01-01
Effects of K-252a, purified from the culture broth of Nocardiopsis sp., on the activity of myosin (light chain kinase were investigated. 1) K-252a affected three characteristic properties of chicken gizzard myosin-B, natural actomyosin, to a similar degree: the Ca 2+ -dependent activity of ATPase, superprecipitation, and the phosphorylation of the myosin light chain. 2) K-252a inhibited the activities of the purified myosin light chain kinase and a Ca 2+ -independent form of the enzyme which was constructed by cross-linking of myosin light chain kinase and calmodulin using glutaraldehyde. The degrees of inhibition by 3 x 10 -6 M K-252a were 69 and 48% of the control activities with the purified enzyme and the cross-linked complex, respectively. Chlorpromazine (3 x 10 -4 M), a calmodulin antagonist, inhibited the native enzyme, but not the cross-linked one. These results suggested that K-252a inhibited myosin light chain kinase by direct interaction with the enzyme, whereas chlorpromazine suppressed the enzyme activation by interacting with calmodulin. 3) The inhibition by K-252a of the cross-linked kinase was affected by the concentration of ATP, a phosphate donor. The concentration causing 50% inhibition was two orders magnitude lowere in the presence of 100 μM ATP than in the presence of 2 mM ATP. 4) Kinetic analyses using [γ- 32 P]ATP indicated that the inhibitory mode of K-252a was competitive with respect to ATP. These results suggest that K-252a interacts at the ATP-binding domain of myosin light chain kinase
International Nuclear Information System (INIS)
Kar, R.J.; Bohlen, J.W.; Chanani, G.R.
1984-01-01
In a Northrop research program on Al-Li based alloys, the microstructures and heat treatment characteristics of two Al-Li-Cu-Mg-Zr alloys, one I/M (ingot metallurgy) and one P/M (powder metallurgy), were examined and correlated with properties obtained. Prior work had shown that this alloy system has a high payoff potential for aircraft applications. Following solution-heat-treatments, the artificial aging response of these alloys was determined, using hardness measurements. Microstructural characterization of these alloys was carried out using optical metallography and transmission electron microscopy (TEM) and phases were identified using X-ray methods, electron diffraction and Auger electron spectroscopy. The tensile and fracture toughness properties of the alloys were determined for selected tempers. Scanning electron microscopic (SEM) fracture examination was carried out on fractured tensile and fracture toughness coupons. The mechanical properties obtained and fracture behavior observed were correlated with significant microstructural features. 16 references
New ternary ordered structures in CuMPt6 (M=3d elements) alloys
International Nuclear Information System (INIS)
Das, Ananda Kumar; Nakamura, Reo; Takahashi, Miwako; Ohshima, Ken-ichi; Iwasaki, Hiroshi; Shishido, Toetsu
2006-01-01
X-ray and electron diffraction measurements were performed to investigate the structure and ordering behaviour of the ternary alloys CuMPt 6 (M=Ti, V, Cr, Mn, Fe, Co, and Ni). X-ray polycrystalline diffraction patterns of all the speciments quenched from 1000degC have shown that a single phase is formed at this stoichiometric composition. The alloys with M=Cr, Mn, Co, and Ni have the face-centred cubic (fcc) structure, while in the alloys with M=Ti, V, and Fe ordering has occurred and the structure is of the Cu 3 Au type. On annealing at lower temperatures ordering has been induced in the alloys with M=Cr, Mn, and Co and the structure is of the Cu 3 Au type, though the ordering in the last alloy has remained incomplete. Detailed X-ray diffraction measurements on single crystals of the CuMnPt 6 alloy have revealed that further ordering takes place and structure changes from the Cu 3 Au type into the cubic ABC 6 type with the unit cell as large 2 x 2 x 2 as the fcc unit cell, a new observation of the double-step ordering in the ternary fcc alloy. The corresponding transition temperatures are T c =970(±5)degC and T cl =750(±5)degC. (author)
Summary on out-of-pile and in-pile properties of M5 alloy
International Nuclear Information System (INIS)
Zhao Wenjin
2001-01-01
The out-of-pile and in-pile corrosion, mechanical properties, microstructure,hydrogen absorption, creep and growth resistances of M5 alloy using as PWR fuel rod cladding materials developed by FRAMATOME in France has been summarized with reference to the literatures. The results obtained from in-pile irradiation tests show that the corrosion and hydrogen absorption resistances, creep and irradiation growth resistances of M5 alloy cladding are superior to that of the optimized Zircaloy-4. It could be estimated that the M5 alloy enables rod burnups close to 65GWd/tU to be reached
Directory of Open Access Journals (Sweden)
El-Sayed M. Sherif
2017-01-01
Full Text Available The corrosion of Ti-54M titanium alloy processed by hot rotary swaging and post-annealed to yield different grain sizes, in 2 M HCl solutions is reported. Two annealing temperatures of 800 °C and 940 °C, followed by air cooling and furnace cooling were used to give homogeneous grain structures of 1.5 and 5 μm, respectively. It has been found that annealing the alloy at 800 °C decreased the corrosion of the alloy, with respect to the hot swaged condition, through increasing its corrosion resistance and decreasing the corrosion current and corrosion rate. Increasing the annealing temperature to 940 °C further decreased the corrosion of the alloy.
International Nuclear Information System (INIS)
Yang, Kai; Zhang, Jinshan; Zong, Ximei; Wang, Wenxian; Xu, Chunxiang; Cheng, Weili; Nie, Kaibo
2016-01-01
The addition of boron to long-periodic stacking ordered (LPSO) phase-strengthened Mg–Zn–Y system alloys has been studied for the first time. The as-cast Mg 94 Zn 2.5 Y 2.5 Mn 1 alloy containing 0.003 wt% B with abundant LPSO phase and refined grains exhibited optimal mechanical performance with ultimate tensile strength and elongation of 252.5 MPa and 11.0%, respectively. - Highlights: • The effect of a trace amount of boron (B) on the formation of long-periodic stacking ordered (LPSO) phase was investigated. • Adding small amounts of B to the Mg–Zn–Y–Mn alloy can highly increase the volume fraction of LPSO phase. • The as-cast Mg–Zn–Y–Mn–B alloy has high strength (UTS=252.5 MPa) and good ductility (elongation=11.0%) in low Y/Zn ratio.
The development and characterization of a novel aluminum-copper-magnesium P/M alloy
Boland, Christopher Daniel
Powder metallurgy (P/M) is a metal fabrication process that is characterized by high yield and ability to be automated, as well as the resultant part complexity and reproducibility. This press and sinter process is favoured by the automotive industry. Aluminum alloy P/M parts are particularly attractive because they have a high strength to weight ratio and they can be made to have high corrosion and wear resistance. There are few commercial Al P/M alloys currently in use and they occupy a small portion of the market. To expand the use of aluminum in the industry a new alloy was created, modeled after the wrought AC2024 family of alloys. P/M 2324, with a nominal composition of Al-4.4Cu-1.5Mg, was assessed using physical, chemical and mechanical methods to help maximize alloy properties through processing. The objective of this work was to develop a viable industrial alloy. The investigation of 2324 included the evaluation of starting powders, starting composition, processing methods, secondary treatments, and industrial response. All blending and compacting was completed at Dalhousie University, while sintering was undertaken at Dalhousie and GKN Sinter Metals. The green alloy was assessed for best compaction pressure using green density and strength. The sintered alloy was assessed to determine the best press and sinter variables, using dimensional change, sintered density, apparent hardness, tensile properties and microscopy. These same sintered properties were tested to determine if sintering done on a laboratory scale could be replicated industrially. The viability of heat treatment was tested using differential scanning calorimetry, hardness and tensile properties. The alloy was also subject to modifications of Cu and Mg amounts, as well as to the addition of tin to the base composition. It was determined that compaction at 400MPa and sintering at 600°C for 20min produced the best properties for the sintered bodies. The resultant mechanical properties were
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...52Q.Seq.d/ Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC
2010-01-01
... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...
Oxide dispersion strengthened CoCrFeNiMn high-entropy alloy
Czech Academy of Sciences Publication Activity Database
Hadraba, Hynek; Chlup, Zdeněk; Dlouhý, Antonín; Dobeš, Ferdinand; Roupcová, Pavla; Vilémová, Monika; Matějíček, Jiří
2017-01-01
Roč. 689, MAR (2017), s. 252-256 ISSN 0921-5093 R&D Projects: GA ČR(CZ) GA14-25246S; GA ČR(CZ) GA14-22834S Institutional support: RVO:68081723 ; RVO:61389021 Keywords : Creep * High-entropy alloy (HEA) * Mechanical alloying * Oxide dispersion strength ened (ODS) alloy * Powder metallurgy * Spark plasma sintering Subject RIV: JG - Metallurgy; JG - Metallurgy (UFP-V) OBOR OECD: Materials engineering; Materials engineering (UFM-A); Materials engineering (UFP-V) Impact factor: 3.094, year: 2016
M5TM alloy high burnup behavior and worldwide licensing
International Nuclear Information System (INIS)
Mardon, J.P.; Hoffmann, P.B.; Garner, G.L.
2005-01-01
The in-reactor behavior of advanced PWR Zirconium alloys at burnups equal to or below licensing limits has been widely reported. Specifically, the advanced alloy M5 has demonstrated impressive improvements over Zircaloy-4 for fuel rod cladding and fuel assembly structural components. To demonstrate superiority of the alloy at burnups beyond current licensing limits, M5 has been operated in PWR at burnups exceeding 71 GWd/tU in the United States and 78 GWd/tU in Europe. Two extensive irradiation programs have been performed in the United States to demonstrate alloy M5 performance beyond current licensing limits. Four M5 TM fuel rods were exposed to four 24-month cycles in a 15x15 reactor beginning in 1995. Additionally, one 17x17 lead assembly containing M5 fuel rods and guide tubes was operated for four 18-month cycles beginning from 1997. Post-irradiation examinations (PIE) performed after all four cycles in the 15x15 demonstration program revealed excellent performance in the licensed burnup and in the high burnup stages of the experience. Examination of the 4th cycle 17x17 assembly will be accomplished in two stages the first of which is scheduled for June 2005. Moreover, several irradiation campaigns have been performed in Europe in order to confirm the excellent M5 in-pile behavior in demanding PWRs irradiation conditions with regard to void fraction, heat flux, lithium content and temperature. Results from the high burnup fuel examinations verify that the excellent performance achieved up to 62 GWd/tU was continued into higher burnup. The results of high burnup PIE campaigns for European and American PWR's are presented in this paper. Measured performance indicators include fuel assembly dimensional stability parameters (assembly length, fuel rod length, assembly bow, fuel rod bow, fuel rod radial creep and spacer grid width), oxidation measurements (fuel rod and guide tube) and hydrogen pick-up data (fuel rod). In the framework of PCI studies, power ramp
DWH MC 252: Subsurface Oil Transport
Beegle-Krause, C. J.; Boyer, T.; Murray, D.
2010-12-01
Before reaching the ocean surface, the oil and gas released from the DWH MC 252 blowout at 1500 m moves as a buoyant plume until the trapping depth and plume transition point are reached (Zheng et al 2002). At the transition point, the oil droplets and bubbles move independently of each other, and rise at a rate related to their diameter. The oil density, droplet size distribution and currents primarily determine the distribution of the oil between: Large droplets that rise quickly and create a surface expression of the oil. Moderate size droplets that rise over the course of days, and so spread out quite differently than the surface oil, and commonly do not reach the surface in large enough quantities to create a surface sheen. These droplets separate in the currents, particularly in the strong current shear in upper 500 m currents. Very tiny droplets that rise very slowly, over the course or weeks to months, and may be removed by dissolution, biodegradation or marine snow before ever reaching the surface. Modeling and observations (Joint Analysis Group, 2010) confirm the presence of a deep layer of oil and gas between approximately 1100 and 1300 m over the release location and spreading out along the isopycnal surfaces. Later in the event, a small oxygen depression was a proxy for where oil and gas had been. The DWH MC252 well is located at intermediate depth in the Gulf of Mexico (GoM). The water mass is Antarctic Intermediate Water, which enters and exits the GoM through the Yucatan Straits. Surface influences, such as Loop Current Frontal Eddies (e.g. Berger et al 2000) can reach down to these depths, and alter the flow within De Soto Canyon. The water mass containing the deep layer of oil droplets changes depth within the GoM, but does not reach above a depth of about 900 m. There are no physical processes that could cause this deep layer of oil to reach the continental shelf or the Florida Straits. Observed and historical hydrographic data, observations
Rotation and Morphology of Comet 252P/LINEAR
Woodney, Laura; Schambeau, Charles A.; Fernandez, Yanga R.
2017-10-01
Comet 252P/LINEAR had an incredibly close approach early in 2016 - minimum distance 0.036 AU on March 21 - that allowed detailed investigation of its behavior. Analysis of observations of the morphology of 252P have resulted in several possible rotational periods. Knight and Schleicher found that repetition of features in narrowband imaging from April 2016 indicated a period of 7.35 +/- 0.05 hr [1]. HST broadband data obtained by Li et al. in March and April partially fit the 7.35 hr period, but found 5.5 hr was a better fit for the April 4 r’ band data [2]. Given this discrepancy, additional observations may shed light on the true rotation state, and we present here the pieces of the puzzle obtained by our group.We observed 252P with the Kitt Peak National Observatory WIYN 0.9 m telescope on 7 nights: May 2 - 5 and June 6,8,9, 2016 using a Harris R filter. An oscillating jet is clearly visible in our data. While there is insufficient phase coverage to determine a best fit period from our data alone, we will present how our observations of the morphology fit the two proposed periods.[1] Knight, M.M and D.G. Schleicher. AAS, DPS Meeting #48, id.207.02, 2016 [2] Li, J.-Y. et al. AAS, DPS Meeting #48, id. 206.03, 2016.
Hayakawa, Y.; Makino, A.; Inoue, A.; Masumoto, T.
1996-01-01
In Fe-M-(B and/or O)(M=group IV A, V A elements) alloy films, nanocrystalline bcc phase are formed by annealing the amorphous single phase for Fe-M-B films, whereas the bcc nanocrystals are already formed in an as-deposited state for Fe-M-O or Fe-M-B-O) films. Among Fe-M-B films with various M elements, Fe-(Zr, Hf, Nb, Ta)-B alloy films exhibit high saturation magnetization (Is) above 1.4 T and high relative permeability (|μ|) above 1000 at 1MHz. The highest |μ| of 3460 at 1MHz is obtained fo...
Neutron activation analysis detection limits using 252Cf sources
International Nuclear Information System (INIS)
DiPrete, D.P.; Sigg, R.A.
2000-01-01
The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes
7 CFR 3565.252 - Housing types.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...
14 CFR 252.9 - Ventilation systems.
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...
Corrosion of Alloy 690 process pot by sulfate containing high level radioactive waste at feed stage
International Nuclear Information System (INIS)
Sengupta, P.; Soudamini, N.; Kaushik, C.P.; Jagannath; Mishra, R.K.; Kale, G.B.; Raj, K.; Das, D.; Sharma, B.P.
2008-01-01
Prolonged exposure of Alloy 690 process pot to sulfate containing high level radioactive waste leads to (a) depletion of Cr from the alloy, (b) intergranular attack and (c) building up of Cr 2 O 3 -Ni 2 O 3 -Fe 2 O 3 mixed oxide surface layer containing Na and Cs sulfate precipitates. Time dependence of material loss from Alloy 690 is found to follow a linear relationship of the type Δw (material loss) = -7.05 + 0.05t. Corrosion rate calculated for 2400 h exposure is 3.66 mpy. Cr and Ni leach rates obtained for the same sample are 1.61 g m -2 d -1 and 2.52 g m -2 d -1 , respectively. Ni leach rates followed a linear time dependence relationship of the type dNL Ni /dt (leach rate) = -0.09 + 0.027t, whereas Cr leach rates obeyed a non-linear relationship of the type dNL Cr /dt (leach rate) = 0.241 + 0.027t - 1.33 x 10 -4 t 1/2
Test and evaluation results of the 252Cf shuffler at the Savannah River Plant
International Nuclear Information System (INIS)
Crane, T.W.
1981-03-01
The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant
Californium-252: a remarkable versatile radioisotope
International Nuclear Information System (INIS)
Osborne-Lee, I.W.; Alexander, C.W.
1995-01-01
A product of the nuclear age, Californium-252 ( 252 Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252 Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252 Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252 Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252 Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252 Cf from ORNL is summarized herein
Californium-252: a remarkable versatile radioisotope
Energy Technology Data Exchange (ETDEWEB)
Osborne-Lee, I.W.; Alexander, C.W.
1995-10-10
A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.
Energy Technology Data Exchange (ETDEWEB)
Neamţu, B.V., E-mail: Bogdan.Neamtu@stm.utcluj.ro [Materials Science and Engineering Department, Technical University of Cluj-Napoca, 103-105, Muncii Avenue, 400641, Cluj-Napoca (Romania); Chicinaş, H.F.; Marinca, T.F. [Materials Science and Engineering Department, Technical University of Cluj-Napoca, 103-105, Muncii Avenue, 400641, Cluj-Napoca (Romania); Isnard, O. [Université Grenoble Alpes, Institut NEEL, F-38042, Grenoble (France); CNRS, Institut NEEL, 25 rue des martyrs, BP166, F-38042, Grenoble (France); Chicinaş, I. [Materials Science and Engineering Department, Technical University of Cluj-Napoca, 103-105, Muncii Avenue, 400641, Cluj-Napoca (Romania)
2016-07-15
Co-based amorphous alloys were prepared via wet mechanical alloying process starting from elemental powders. The reference alloy Co{sub 70}Fe{sub 4}Ni{sub 2}Si{sub 15}B{sub 9} (at. %) as well as the alloys derived from this composition by the substitution of 5 at.% of Zr or Ti for Si or B (Co{sub 70}Fe{sub 4}Ni{sub 2}Si{sub 15}B{sub 4}Zr{sub 5}, Co{sub 70}Fe{sub 4}Ni{sub 2}Si{sub 15}B{sub 4}Ti{sub 5}, Co{sub 70}Fe{sub 4}Ni{sub 2}Si{sub 10}B{sub 9}Zr{sub 5} and Co{sub 70}Fe{sub 4}Ni{sub 2}Si{sub 10}B{sub 9}Ti{sub 5}) are obtained in amorphous state, according to X-ray diffraction (XRD) investigation, after 40 h of milling. The calculated amount of amorphous fraction reaches 99% after 40 h of milling. The largest increase of the crystallisation temperature was induced by the substitution of Zr or Ti for Si while, regardless of the type of substitution, an important increase of the Curie temperature of the alloy was obtained. A Co-based solid solution, with Co{sub 2}Si and Co{sub 2}B phases, result after crystallisation of the amorphous alloys as proved by XRD investigations. Saturation magnetisation of the alloys decreases upon increasing milling time, however it remains larger than the saturation magnetisation of the reference alloy. This was discussed in correlation with the specificity of the wet mechanical alloying process and the influence of the chemical bonding between Co and metalloids atoms over the magnetic moment of Co. - Highlights: • Co–Fe–Ni–M-Si–B (M = Zr, Ti) amorphous powders were prepared by wet MA. • Amorphisation of the alloy is reached after 40 h of wet MA for any composition. • Magnetisation decrease upon increasing milling time. • Substituting 5% Zr/Ti for Si increases significantly the alloy's thermal stability. • Substitution of 5 at. % Zr/Ti for Si increases the saturation magnetisation by 20%.
Californium-252 radiotherapy sources for interstitial afterloading
International Nuclear Information System (INIS)
Permar, P.H.; Walker, V.W.
1976-01-01
Californium-252 neutron sources for interstitial afterloading were developed to investigate the value of this radionuclide in cancer therapy. Californium-252 seed assemblies contain essentially point sources of 252 Cf permanently sealed on 1-cm centers within a flexible plastic tube. The seed assemblies are fabricated with remotely operated, specially designed machines. The fabrication process involves the production of a Pt-10 percent Ir-clad wire with a 252 Cf 2 O 3 -Pd cermet core. The wire is swaged and drawn to size, cut to length, and welded in a Pt-10 percent Ir capsule 0.8 mm in diameter and 6 mm long. Each seed capsule contains approximately 0.5 microgram of 252 Cf. Because the effective half-life of 252 Cf is 2.6 years, the seed assemblies are not disposable and must be reused until their activities have decreased to unsuitable levels. The flexible plastic components must therefore have sufficient resistance to radiation damage to survive the neutron-plus-gamma radiation from 252 Cf. On the basis of accelerated irradiation tests with a large 252 Cf source, a recently developed fluoropolymer, ''Tefzel'' (trademark of E. I. du Pont de Nemours and Company) has adequate radiation resistance for this application. Californium-252 seed assembly systems are loaned by the United States Energy Research and Development Administration for clinical investigations under a protocol of the Radiation Therapy Oncology Group, U.S. National Cancer Institute
Formation of long-period stacking ordered structures in Mg88M5Y7 (M = Ti, Ni and Pb) casting alloys
International Nuclear Information System (INIS)
Jin, Qian-Qian; Fang, Can-Feng; Mi, Shao-Bo
2013-01-01
Highlights: •Apart from 18R-LPSO, 14H-LPSO structure was determined in the Mg-Ni-Y alloys. •The appearance of twin-related structure in 18R-LPSO structure results from the stacking faults in the stacking sequence of the closely packed planes. •A new (Pb, Mg) 2 Y phase with a body-centered orthorhombic structure was determined in the Mg-Pb-Y alloy. •No LPSO structures were found in the Mg-Pb-Y and Mg-Ti-Y casting alloys. -- Abstract: Formation of long-period stacking ordered (LPSO) structures is investigated in Mg 88 M 5 Y 7 (M = Ti, Ni and Pb) casting alloys by means of electron microscopy and X-ray diffraction. In the Mg 88 Ni 5 Y 7 casting alloy, 14H-LPSO structure is observed in a small amount, which coexists with 18R-LPSO structure. The appearance of stacking faults in 18R-LPSO structure results in twin-related structure in the stacking sequence of the closely packed planes. A new (Pb, Mg) 2 Y phase with a body-centered orthorhombic structure is determined in the Mg 88 Pb 5 Y 7 alloy. No LPSO structures are found in the Mg 88 Pb 5 Y 7 and Mg 88 Ti 5 Y 7 casting alloys. In terms of the atomic radius and heat of mixing, the formation ability of LPSO structure in the present alloys is discussed
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...
Hydrogen storage properties of LaMgNi3.6M0.4 (M = Ni, Co, Mn, Cu, Al) alloys
International Nuclear Information System (INIS)
Yang, Tai; Zhai, Tingting; Yuan, Zeming; Bu, Wengang; Xu, Sheng; Zhang, Yanghuan
2014-01-01
Highlights: • La–Mg–Ni system AB 2 -type alloys were prepared by induction melting. • Structures and lattice parameters were analysed by XRD. • Hydrogen absorption/desorption performances were studied. • Mechanisms of hydrogen absorption capacity fading were investigated. - Abstract: LaMgNi 3.6 M 0.4 (M = Ni, Co, Mn, Cu, Al) alloys were prepared through induction melting process. The phase compositions and crystal structures were characterised via X-ray diffraction (XRD). The hydrogen storage properties, including activation performance, hydrogen absorption capacity, cycle stability, alloy particle pulverisation and plateau pressure, were systemically investigated. Results show that Ni, Co, Mn and Cu substitution alloys exhibit multiphase structures comprising the main phase LaMgNi 4 and the secondary phase LaNi 5 . However, the secondary phase of the Al substitution alloy changes into LaAlNi 4 . The lattice parameters and cell volumes of the LaMgNi 4 phase follow the order Ni < Co < Al < Cu < Mn. Activation is simplified through partial substitution of Ni with Al, Cu and Co. The hydrogen absorption capacities of all of the alloys are approximately 1.7 wt.% at the first activation process; however, they rapidly decrease with increasing cycle number. In addition, the stabilities of hydriding and dehydriding cycles decrease in the order Al > Co > Ni > Cu > Mn. Hydriding processes result in numerous cracks and amorphisation of the LaMgNi 4 phase in the alloys. The p–c isotherms were determined by a Sieverts-type apparatus. Two plateaus were observed for the Ni, Co and Al substitution alloys, whereas only one plateau was found for Mn and Cu. This result was caused by the amorphisation of the LaMgNi 4 phase during the hydriding cycles. Reversible absorption and desorption of hydrogen are difficult to achieve. Substitutions of Ni with Co, Mn, Cu and Al significantly influence the reduction of hysteresis between hydriding and dehydriding
Californium-252 progress, report No. 7, April 1971
Energy Technology Data Exchange (ETDEWEB)
1971-12-31
This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.
Performance of V-4Cr-4Ti Alloy Exposed to the JFT-2M Tokamak Environment
International Nuclear Information System (INIS)
Johnson, W.R.; Trester, P.W.; Sengoku, S.; Ishiyama, S.; Fukaya, K.; Eto, M.; Oda, T.; Hirohata, Y.; Hino, T.; Tsai, H.
1999-01-01
A long-term test has been conducted in the JFT-2M tokamak fusion device to determine the effects of environmental exposure on the mechanical and chemical behavior of a V-4Cr-4Ti alloy. Test specimens of the alloy were exposed in the outward lower divertor chamber of JFT-2M in a region away from direct contact with the plasma and were preheated to 300 C just prior to and during selected plasma discharges. During their nine-month residence time in JFT-2M, the specimens experienced approximately 200 lower single-null divertor shots at 300 C, during which high energy particle fluxes to the preheated test specimens were significant, and approximately 2,010 upper single-null divertor shots and non-diverter shots at room temperature, for which high energy particle fluxes to and expected particle retention in the test specimens were very low. Data from post-exposure tests have indicated that the performance of the V-4Cr-4Ti alloy would not be significantly affected by environmental exposure to gaseous species at partial pressures typical for tokamak operation. Deuterium retention in the exposed alloy was also low (<2 ppm). Absorption of interstitial by the alloy was limited to the very near surface, and neither the strength nor the Charpy impact properties of the alloy appeared to be significantly changed from the exposure to the JFT-2M tokamak environment
Rotating speed effect on electronic transport behaviors of Ni–Nb–Zr–H glassy alloys
International Nuclear Information System (INIS)
Fukuhara, Mikio
2012-01-01
Highlights: ► The electronic transport behaviors of (Ni 0.39 Nb 0.25 Zr 0.35 ) 100−y H y (0 ≤ y ≤ 15) glassy alloys, which produced by rotating (or quenching) speeds of 3000 and 10,000 rpm, have been studied as a function of hydrogen content. ► The resistivity for (Ni 0.39 Nb 0.25 Zr 0.35 ) 97.8 H 2.2 alloy, produced by rotating speed of 10,000 rpm, displayed 0.1 nΩ cm, which is 0.01% of silver (1.62 μΩ cm) at room temperature, between 40 and 252 K. ► Supercooling of the molten alloy induces a superior ballistic conductor and a room-temperature Coulomb oscillation. - Abstract: The electronic transport behaviors of (Ni 0.39 Nb 0.25 Zr 0.35 ) 100−y H y (0 ≤ y ≤ 15) glassy alloys, produced by rotating (or quenching) speeds of 3000 and 10,000 rpm, have been studied as a function of hydrogen content. These alloys show semiconducting, superior ballistic transport, superconducting and electric current-induced Coulomb oscillation, as hydrogen content increases. The resistivity for (Ni 0.39 Nb 0.25 Zr 0.35 ) 97.8 H 2.2 alloy, produced by rotating speed of 10,000 rpm, displayed 0.1 nΩ cm, which is 0.01% of silver (1.62 μΩ cm) at room temperature, between 40 and 252 K. The Coulomb oscillation of the 10,000 rpm-(Ni 0.39 Nb 0.25 Zr 0.35 ) 95.2 H 4.8 alloy is about 4-fold larger than that of the 3000 rpm-(Ni 0.39 Nb 0.25 Zr 0.35 ) 91.1 H 8.9 alloy. Supercooling of the molten alloy induces a superior ballistic conductor and a room-temperature Coulomb oscillation at lower and higher hydrogen contents, respectively.
Design and verification of thermomechanical parameters of P/M Ti6Al4V alloy forging
Energy Technology Data Exchange (ETDEWEB)
Wojtaszek, Marek, E-mail: mwojtasz@metal.agh.edu.pl; Śleboda, Tomasz
2014-12-05
Highlights: • Thermomechanical parameters of P/M Ti6Al4V alloy processing were determined. • The use of the mixture of elemental powders allows reducing manufacturing costs. • Numerical modelling allowed to elaborate favourable parameters of forging. • The industrial trials of hot forging of P/M Ti6Al4V alloy were successful. - Abstract: This work is focused on the design of technology of forging high-quality Ti6Al4V alloy by means of powder metallurgy methods. A mixture of elemental powders, with the chemical composition of that of Ti6Al4V alloy, was used as a starting material for the investigation. Powder mixtures were fully densified by hot compaction under precisely controlled conditions. The mechanical properties of the obtained compacts were examined. The mechanical behaviour of the investigated alloy powder compacts was evaluated by compression test under various thermomechanical conditions using Gleeble simulator. The microstructure of powder compacts as well as P/M alloy samples deformed in compression tests was examined. All data obtained from the experimental tests were applied as boundary conditions for numerical simulation of forging of selected forgings. Basing on the results of both plastometric tests and simulations, thermomechanical parameters of the investigated alloy forging were determined. Designed parameters of forging technology were verified by forging trials performed in industrial conditions. The quality of the obtained forgings was examined by means of computed tomography.
Design and verification of thermomechanical parameters of P/M Ti6Al4V alloy forging
International Nuclear Information System (INIS)
Wojtaszek, Marek; Śleboda, Tomasz
2014-01-01
Highlights: • Thermomechanical parameters of P/M Ti6Al4V alloy processing were determined. • The use of the mixture of elemental powders allows reducing manufacturing costs. • Numerical modelling allowed to elaborate favourable parameters of forging. • The industrial trials of hot forging of P/M Ti6Al4V alloy were successful. - Abstract: This work is focused on the design of technology of forging high-quality Ti6Al4V alloy by means of powder metallurgy methods. A mixture of elemental powders, with the chemical composition of that of Ti6Al4V alloy, was used as a starting material for the investigation. Powder mixtures were fully densified by hot compaction under precisely controlled conditions. The mechanical properties of the obtained compacts were examined. The mechanical behaviour of the investigated alloy powder compacts was evaluated by compression test under various thermomechanical conditions using Gleeble simulator. The microstructure of powder compacts as well as P/M alloy samples deformed in compression tests was examined. All data obtained from the experimental tests were applied as boundary conditions for numerical simulation of forging of selected forgings. Basing on the results of both plastometric tests and simulations, thermomechanical parameters of the investigated alloy forging were determined. Designed parameters of forging technology were verified by forging trials performed in industrial conditions. The quality of the obtained forgings was examined by means of computed tomography
Health physics aspects of 252Cf
International Nuclear Information System (INIS)
Bhagwat, A.M.
1974-01-01
After briefly describing the methods of production, radioactive, chemical and biological properties of californium-252, its health physics aspects are reviewed in detail. Its external and internal radiation hazards can be minimised through control of radiation and contamination and proper shield design. Use of various shielding materials is evaluated. The following aspects are also discussed : (1) radiation detectors for neutrons and gamma radiation (2) personnel monitoring techniques (3) bioassay and (4) storage and transportation. (M.G.B.)
48 CFR 252.231-7000 - Supplemental cost principles.
2010-10-01
... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...
Effect of Iron and Magnesium on Alloy AL9M Structure and Properties
Bazhenov, V. E.; Koltygin, A. V.; Belov, V. D.
2017-09-01
The effect of iron impurity on the structure and properties of aluminum alloy AL9M, especially its action on magnesium distribution within the structure, is studied. The microstructure of a cast component of this alloy broken during operation is analyzed. It is shown that iron impurity has an unfavorable effect on structure and mechanical properties of a casting due to appearance of Al9Fe2Si and Al18Fe2Mg7Si10 intermetallics. Formation of these intermetallics consumes a considerable amount of magnesium and lowers the content of the Q(Al5Cu2Mg8Si6) strengthening phase in the alloy structure.
46 CFR 252.33 - Hull and machinery insurance.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...
International Nuclear Information System (INIS)
Jendrzejczyk-Handzlik, Dominika; Fitzner, Krzysztof
2011-01-01
The thermodynamic properties of the liquid Ag-Ga alloys were determined using e.m.f. and calorimetric methods. In the e.m.f. method, solid oxide galvanic cells were used with zirconia electrolyte. The cells of the type W,Ag x Ga (1-x) ,Ga 2 O 3 //ZrO 2 +(Y 2 O 3 )//FeO,Fe,W were used in the temperature range from 1098 K to 1273 K, and in the range of mole fraction from x Ga = 0.1 to x Ga = 1.0. At first, the Gibbs free energy of formation of pure solid gallium oxide, Ga 2 O 3 , from pure elements was derived. Using values of the measured e.m.f. for the cell with x Ga = 1.0, the following temperature dependence was obtained: Δ f G m,Ga 2 O 3 0 (±4kJ·mol -1 J)=-1061.7235+0.2899T/K. Next, the activity of the gallium was derived as a function of the alloy composition from the values of the measured e.m.f. Activities of silver were calculated using the Gibbs-Duhem equation. The drop calorimetric measurements were carried out at two temperatures, viz. 923 K and 1123 K, using a Setaram MHTC calorimeter. Integral enthalpies of mixing of liquid binary alloys were determined at those temperatures. Finally, thermodynamic properties of the liquid alloys were described with the Redlich-Kister equation using ThermoCalc software.
48 CFR 252.217-7010 - Performance.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...
Hydrogen storage properties of LaMgNi{sub 3.6}M{sub 0.4} (M = Ni, Co, Mn, Cu, Al) alloys
Energy Technology Data Exchange (ETDEWEB)
Yang, Tai [Department of Functional Material Research, Central Iron and Steel Research Institute, Beijing 100081 (China); Key Laboratory of Integrated Exploitation of Baiyun Obo Multi-Metal Resources, Inner Mongolia University of Science and Technology, Baotou 014010 (China); Zhai, Tingting; Yuan, Zeming; Bu, Wengang [Department of Functional Material Research, Central Iron and Steel Research Institute, Beijing 100081 (China); Xu, Sheng [Key Laboratory of Integrated Exploitation of Baiyun Obo Multi-Metal Resources, Inner Mongolia University of Science and Technology, Baotou 014010 (China); Zhang, Yanghuan, E-mail: zhangyh59@sina.com [Department of Functional Material Research, Central Iron and Steel Research Institute, Beijing 100081 (China); Key Laboratory of Integrated Exploitation of Baiyun Obo Multi-Metal Resources, Inner Mongolia University of Science and Technology, Baotou 014010 (China)
2014-12-25
Highlights: • La–Mg–Ni system AB{sub 2}-type alloys were prepared by induction melting. • Structures and lattice parameters were analysed by XRD. • Hydrogen absorption/desorption performances were studied. • Mechanisms of hydrogen absorption capacity fading were investigated. - Abstract: LaMgNi{sub 3.6}M{sub 0.4} (M = Ni, Co, Mn, Cu, Al) alloys were prepared through induction melting process. The phase compositions and crystal structures were characterised via X-ray diffraction (XRD). The hydrogen storage properties, including activation performance, hydrogen absorption capacity, cycle stability, alloy particle pulverisation and plateau pressure, were systemically investigated. Results show that Ni, Co, Mn and Cu substitution alloys exhibit multiphase structures comprising the main phase LaMgNi{sub 4} and the secondary phase LaNi{sub 5}. However, the secondary phase of the Al substitution alloy changes into LaAlNi{sub 4}. The lattice parameters and cell volumes of the LaMgNi{sub 4} phase follow the order Ni < Co < Al < Cu < Mn. Activation is simplified through partial substitution of Ni with Al, Cu and Co. The hydrogen absorption capacities of all of the alloys are approximately 1.7 wt.% at the first activation process; however, they rapidly decrease with increasing cycle number. In addition, the stabilities of hydriding and dehydriding cycles decrease in the order Al > Co > Ni > Cu > Mn. Hydriding processes result in numerous cracks and amorphisation of the LaMgNi{sub 4} phase in the alloys. The p–c isotherms were determined by a Sieverts-type apparatus. Two plateaus were observed for the Ni, Co and Al substitution alloys, whereas only one plateau was found for Mn and Cu. This result was caused by the amorphisation of the LaMgNi{sub 4} phase during the hydriding cycles. Reversible absorption and desorption of hydrogen are difficult to achieve. Substitutions of Ni with Co, Mn, Cu and Al significantly influence the reduction of hysteresis between
Historical review of californium-252 discovery and development
International Nuclear Information System (INIS)
Stoddard, D.H.
1985-01-01
This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252 Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed
International Nuclear Information System (INIS)
Gao, Song; Huang, Hao; Wu, Aimin; Yu, Jieyi; Gao, Jian; Dong, Xinglong; Liu, Chunjing; Cao, Guozhong
2016-01-01
A direct current arc-discharge method was applied to prepare the Sn–M (M=Fe, Al, Ni) bi-alloy nanoparticles. Thermodynamic is introduced to analyze the energy circumstances for the formation of the nanoparticles during the physical condensation process. The electrochemical properties of as-prepared Sn–M alloy nanoparticles are systematically investigated as anodes of Li-ion batteries. Among them, Sn–Fe nanoparticles electrode exhibits high Coulomb efficiency (about 71.2%) in the initial charge/discharge (257.9 mA h g −1 /366.6 mA h g −1 ) and optimal cycle stability (a specific reversible capacity of 240 mA h g −1 maintained after 20 cycles) compared with others. Large differences in the electrochemical behaviors indicate that the chemical composition and microstructure of the nanoparticles determine the lithium-ion storage properties and the long-term cyclic stability during the charge/discharge process. - Graphical abstract: The growth mechanism and electrochemical performance of Sn-based alloy nanoparticles. - Highlights: • Thermodynamic analyses of oxides on Sn-M nanoparticles surface. • The relationship between chemical components and electrochemical responses. • Sn-Fe nanoparticles show excellent electrode performance.
Energy Technology Data Exchange (ETDEWEB)
Gao, Song [Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Ministry of Education), School of Materials Science and Engineering, Dalian University of Technology, Dalian 116024 (China); Huang, Hao, E-mail: huanghao@dlut.edu.cn [Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Ministry of Education), School of Materials Science and Engineering, Dalian University of Technology, Dalian 116024 (China); Wu, Aimin; Yu, Jieyi; Gao, Jian; Dong, Xinglong; Liu, Chunjing [Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Ministry of Education), School of Materials Science and Engineering, Dalian University of Technology, Dalian 116024 (China); Cao, Guozhong, E-mail: gzcao@u.washington.edu [Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Ministry of Education), School of Materials Science and Engineering, Dalian University of Technology, Dalian 116024 (China); Department of Materials Science and Engineering, University of Washington, Seattle, WA 98195 (United States)
2016-10-15
A direct current arc-discharge method was applied to prepare the Sn–M (M=Fe, Al, Ni) bi-alloy nanoparticles. Thermodynamic is introduced to analyze the energy circumstances for the formation of the nanoparticles during the physical condensation process. The electrochemical properties of as-prepared Sn–M alloy nanoparticles are systematically investigated as anodes of Li-ion batteries. Among them, Sn–Fe nanoparticles electrode exhibits high Coulomb efficiency (about 71.2%) in the initial charge/discharge (257.9 mA h g{sup −1}/366.6 mA h g{sup −1}) and optimal cycle stability (a specific reversible capacity of 240 mA h g{sup −1} maintained after 20 cycles) compared with others. Large differences in the electrochemical behaviors indicate that the chemical composition and microstructure of the nanoparticles determine the lithium-ion storage properties and the long-term cyclic stability during the charge/discharge process. - Graphical abstract: The growth mechanism and electrochemical performance of Sn-based alloy nanoparticles. - Highlights: • Thermodynamic analyses of oxides on Sn-M nanoparticles surface. • The relationship between chemical components and electrochemical responses. • Sn-Fe nanoparticles show excellent electrode performance.
Pit nucleation on as-cast aluminiuim alloy AW-5083 in 0.01M NaCl
Directory of Open Access Journals (Sweden)
Dolić N.
2011-01-01
Full Text Available The use of aluminium alloys in a wide range of technical applications is related mostly to the two facts: they facilitate weight saving of final products (if compared to the steel and they are prone to spontaneous passivity due to the coherent surface oxide layer which impedes further reaction of aluminium with the environment. Among the commercial Al alloys, EN AW-5083 alloy is a representative non-heat treatable Al-Mg based alloy which possesses many interesting characteristics as a structural material, such as low price, moderately high strength, high formability in conjunction with superplasticity and good corrosion resistance in marine atmospheres. Aiming to enhance the knowledge of possible interactions of studied alloy EN AW-5083 in as-cast condition with chloride media, electrochemical measurements were used to follow the pitting behaviour in 0.01 M NaCl. The results of tests have shown that susceptibility of alloy to pitting corrosion is strongly influenced by the microstructural constituents of the alloy in as-cast condition.
48 CFR 252.217-7009 - Default.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...
40 CFR 265.252 - Waste analysis.
2010-07-01
... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...
48 CFR 252.236-7000 - Modification proposals-price breakdown.
2010-10-01
...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...
48 CFR 252.217-7002 - Offering property for exchange.
2010-10-01
... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...
46 CFR 252.31 - Wages of officers and crews.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...
Teratogenic effect of Californium-252 irradiation in rats
International Nuclear Information System (INIS)
Satow, Yukio; Lee, Juing-Yi; Hori, Hiroshi; Okuda, Hiroe; Tsuchimoto, Shigeo; Sawada, Shozo; Yokoro, Kenjiro
1989-01-01
The teratogenicity of Californium-252 (Cf-252) irradiation which generates approximately 70% 2.3 MeV fast neutron and 30% gamma rays was evaluated. A single whole body exposure of Cf-252 at various doses was given to pregnant rats on day 8 or 9 of pregnancy, followed by microscopic autopsy of the fetuses at the terminal stage of pregnancy to search for external and internal malformations. For comparison, pregnant rats were irradiated with various doses of Cobalt-60 (Co-60) standard gamma rays at the same dose rate (1 rad/min.). The doses were 20-120 rad of Cf-252 and 80-220 rad of Co-60. Using frequency of radiation induced malformations observed on day 8 of pregnancy as an index, relative biological effectiveness (RBE) of 2.3-2.7 was obtained from the straight line obtained by modifying by the least squares method the frequency curves of malformed fetuses in total implants and in surviving fetuses. The types of malformations induced by Cf-252 and Co-60 irradiation were alike. Using fetal LD 50 as an index, 2.4 was obtained as RBE when irradiated on day 8 of pregnancy and 3.1 as that when irradiated on day 9. The results showed that Cf-252 had stronger a teratogenic effect than Co-60 gamma rays. (author)
Generation of the V4.2m5 and AMPX and MPACT 51 and 252-Group Libraries with ENDF/B-VII.0 and VII.1
Energy Technology Data Exchange (ETDEWEB)
Kim, Kang Seog [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States). Consortium for Advanced Simulation of LWRs (CASL)
2016-12-12
The evaluated nuclear data file (ENDF)/B-7.0 v4.1m3 MPACT 47-group library has been used as a main library for the Consortium for Advanced Simulation of Light Water Reactors (CASL) neutronics simulator in simulating pressurized water reactor (PWR) problems. Recent analysis for the high void boiling water reactor (BWR) fuels and burnt fuels indicates that the 47-group library introduces relatively large reactivity bias. Since the 47- group structure does not match with the SCALE 6.2 252-group boundaries, the CASL Virtual Environment for Reactor Applications Core Simulator (VERA-CS) MPACT library must be maintained independently, which causes quality assurance concerns. In order to address this issue, a new 51-group structure has been proposed based on the MPACT 47- g and SCALE 252-g structures. In addition, the new CASL library will include a 19-group structure for gamma production and interaction cross section data based on the SCALE 19- group structure. New AMPX and MPACT 51-group libraries have been developed with the ENDF/B-7.0 and 7.1 evaluated nuclear data. The 19-group gamma data also have been generated for future use, but they are only available on the AMPX 51-g library. In addition, ENDF/B-7.0 and 7.1 MPACT 252-g libraries have been generated for verification purposes. Various benchmark calculations have been performed to verify and validate the newly developed libraries.
Generation of the V4.2m5 and AMPX and MPACT 51 and 252-Group Libraries with ENDF/B-VII.0 and VII.1
International Nuclear Information System (INIS)
Kim, Kang Seog
2016-01-01
The evaluated nuclear data file (ENDF)/B-7.0 v4.1m3 MPACT 47-group library has been used as a main library for the Consortium for Advanced Simulation of Light Water Reactors (CASL) neutronics simulator in simulating pressurized water reactor (PWR) problems. Recent analysis for the high void boiling water reactor (BWR) fuels and burnt fuels indicates that the 47-group library introduces relatively large reactivity bias. Since the 47- group structure does not match with the SCALE 6.2 252-group boundaries, the CASL Virtual Environment for Reactor Applications Core Simulator (VERA-CS) MPACT library must be maintained independently, which causes quality assurance concerns. In order to address this issue, a new 51-group structure has been proposed based on the MPACT 47- g and SCALE 252-g structures. In addition, the new CASL library will include a 19-group structure for gamma production and interaction cross section data based on the SCALE 19- group structure. New AMPX and MPACT 51-group libraries have been developed with the ENDF/B-7.0 and 7.1 evaluated nuclear data. The 19-group gamma data also have been generated for future use, but they are only available on the AMPX 51-g library. In addition, ENDF/B-7.0 and 7.1 MPACT 252-g libraries have been generated for verification purposes. Various benchmark calculations have been performed to verify and validate the newly developed libraries.
48 CFR 252.237-7011 - Preparation history.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...
48 CFR 252.217-7016 - Plant protection.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...
48 CFR 252.227-7000 - Non-estoppel.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...
Characteristics of laser clad α-Ti/TiC+(Ti,W)C1-x/Ti2SC+TiS composite coatings on TA2 titanium alloy
Zhai, Yong-Jie; Liu, Xiu-Bo; Qiao, Shi-Jie; Wang, Ming-Di; Lu, Xiao-Long; Wang, Yong-Guang; Chen, Yao; Ying, Li-Xia
2017-03-01
TiC reinforced Ti matrix composite coating with Ti2SC/TiS lubricant phases in-situ synthesized were prepared on TA2 titanium alloy by laser cladding with different powder mixtures: 40%Ti-19.5%TiC-40.5%WS2, 40%Ti-25.2%TiC-34.8%WS2, 40%Ti-29.4%TiC-30.6%WS2 (wt%). The phase compositions, microstructure, microhardness and tribological behaviors and wear mechanisms of coatings were investigated systematically. Results indicate that the main phase compositions of three coatings are all continuous matrix α-Ti, reinforced phases of (Ti,W)C1-x and TiC, lubricant phases of Ti2SC and TiS. The microhardness of the three different coatings are 927.1 HV0.5, 1007.5 HV0.5 and 1052.3 HV0.5, respectively. Compared with the TA2 titanium alloy (approximately 180 HV0.5), the microhardness of coatings have been improved dramatically. The coefficients of friction and the wear rates of those coatings are 0.41 and 30.98×10-5 mm3 N-1 m-1, 0.30 and 18.92×10-5 mm3 N-1 m-1, 0.34 and 15.98×10-5 mm3 N-1 m-1, respectively. Comparatively speaking, the coating fabricated with the powder mixtures of 40%Ti-25.2%TiC-34.8%WS2 presents superior friction reduction and anti-wear properties and the main wear mechanisms of that are slight plastic deformation and adhesive wear.
48 CFR 252.217-7001 - Surge option.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...
48 CFR 252.225-7025 - Restriction on acquisition of forgings.
2010-10-01
... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...
48 CFR 252.225-7031 - Secondary Arab boycott of Israel.
2010-10-01
... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...
24 CFR 92.252 - Qualification as affordable housing: Rental housing.
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...
48 CFR 252.235-7011 - Final scientific or technical report.
2010-10-01
... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...
Effect of mechanical alloying on FeCrC reinforced Ni alloys
Energy Technology Data Exchange (ETDEWEB)
Yilmaz, S. Osman [Univ. of Namik Kemal, Tekirdag (Turkey); Teker, Tanju [Adiyaman Univ. (Turkey). Dept. of Metallurgical and Materials Engineering; Demir, Fatih [Batman Univ. (Turkey)
2016-05-01
Mechanical alloying (MA) is a powder metallurgy processing technique involving cold welding, fracturing and rewelding of powder particles in a high-energy ball mill. In the present study, the intermetallic matrix composites (IMCs) of Ni-Al reinforced by M{sub 7}C{sub 3} were produced by powder metallurgical routes via solid state reaction of Ni, Al and M{sub 7}C{sub 3} particulates by mechanical alloying processes. Ni, Al and M{sub 7}C{sub 3} powders having 100 μm were mixed, mechanical alloyed and the compacts were combusted in a furnace. The mechanically alloyed (MAed) powders were investigated by X-ray diffraction (XRD), microhardness measurement, optic microscopy (OM), scanning electron microscopy (SEM) and energy dispersive spectrometry (EDS). The presence of the carbides depressed the formation of unwanted NiAl intermetallic phases. The mechanical alloyed M{sub 7}C{sub 3} particles were unstable and decomposed partially within the matrix during alloying and sintering, and the morphology of the composites changed with the dissolution ratio of M{sub 7}C{sub 3} and sintering temperature.
Californium-252 interstitial implants in carcinoma of the tongue
International Nuclear Information System (INIS)
Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.
1985-01-01
A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy
Microstructures, Corrosion and Tensile Properties of Ti-Al-Zr (PT-7M) Alloy
International Nuclear Information System (INIS)
Kim, Tae Hoon; Kang, Chang Sun; Baek, Jong Hyuk; Choi, Byoung Kwon; Jeong, Yong Hwan
2006-01-01
The primary circuit with the primary coolant of SMART (System integrated Modular Advanced ReacTor) is much different from that of commercial PWRs, i.e., an ammonia is used as a pH raising agent. To be used and have long term sustainability from this coarser environment, the titanium alloys should be proved they are good to hydrogen embrittlement. Thus, excellent mechanical properties and hydriding resistance is required for the safe operation during the reactor lifetime. The effects of hydrogen on the microstructure, mechanical properties and corrosion behavior of the Ti- Al-Zr (so-called PT-7M) alloy were studied
48 CFR 252.235-7002 - Animal welfare.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...
48 CFR 252.229-7001 - Tax relief.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...
Gao, Song; Huang, Hao; Wu, Aimin; Yu, Jieyi; Gao, Jian; Dong, Xinglong; Liu, Chunjing; Cao, Guozhong
2016-10-01
A direct current arc-discharge method was applied to prepare the Sn-M (M=Fe, Al, Ni) bi-alloy nanoparticles. Thermodynamic is introduced to analyze the energy circumstances for the formation of the nanoparticles during the physical condensation process. The electrochemical properties of as-prepared Sn-M alloy nanoparticles are systematically investigated as anodes of Li-ion batteries. Among them, Sn-Fe nanoparticles electrode exhibits high Coulomb efficiency (about 71.2%) in the initial charge/discharge (257.9 mA h g-1/366.6 mA h g-1) and optimal cycle stability (a specific reversible capacity of 240 mA h g-1 maintained after 20 cycles) compared with others. Large differences in the electrochemical behaviors indicate that the chemical composition and microstructure of the nanoparticles determine the lithium-ion storage properties and the long-term cyclic stability during the charge/discharge process.
Ahmed, Mohammad Shamsuddin; Park, Dongchul; Jeon, Seungwon
2016-03-01
A rare combination of graphene (G)-supported palladium and manganese in mixed-oxides binary alloyed catalysts (BACs) have been synthesized with the addition of Pd and Mn metals in various ratios (G/PdmMn1-mOx) through a facile wet-chemical method and employed as an efficient anode catalyst for ethanol oxidation reaction (EOR) in alkaline fuel cells. The as prepared G/PdmMn1-mOx BACs have been characterized by several instrumental techniques; the transmission electron microscopy images show that the ultrafine alloyed nanoparticles (NPs) are excellently monodispersed onto the G. The Pd and Mn in G/PdmMn1-mOx BACs have been alloyed homogeneously, and Mn presents in mixed-oxidized form that resulted by X-ray diffraction. The electrochemical performances, kinetics and stability of these catalysts toward EOR have been evaluated using cyclic voltammetry in 1 M KOH electrolyte. Among all G/PdmMn1-mOx BACs, the G/Pd0.5Mn0.5Ox catalyst has shown much superior mass activity and incredible stability than that of pure Pd catalysts (G/Pd1Mn0Ox, Pd/C and Pt/C). The well dispersion, ultrafine size of NPs and higher degree of alloying are the key factor for enhanced and stable EOR electrocatalysis on G/Pd0.5Mn0.5Ox.
International Nuclear Information System (INIS)
1975-01-01
This meeting constituted the third phase of a project initiated by the Dosimetry Section of the IAEA in 1973. The first step, early in 1973, consisted of the development of a programme for the loan of Cf-252 sources to the Member States in support of education, training and some limited research. To date, 14 institutions in 13 Member States have participated in this loan programme. In August last year, the Agency published an instructional syllabus and laboratory manual authored by Professors Eric J. Hall and Harald H. Rossi of Columbia University (Californium-252 in Teaching and Research, Technical Reports Series No. 159). The appearance of this publication, including guidance on the design and construction of a storage and use facility, was the second phase of this programme aimed at providing some support to potential users in the fields of radiation biology and dosimetry. The objective of the programme's third phase - the convening of an Educational Seminar - was to provide a forum to bring together participants in the Agency's loan programme and experts in various scientific fields. Specifically, the Seminar consisted of a series of expert presentations in spectrometry, activation and prompt gamma analyses, on-stream analysis, dosimetry, health physics, radiology and radiotherapy. (author)
Twin relationships of 5M modulated martensite in Ni-Mn-Ga alloy
International Nuclear Information System (INIS)
Li Zongbin; Zhang Yudong; Esling, Claude; Zhao Xiang; Zuo Liang
2011-01-01
Highlights: → We determine orientation relationships of 5M modulated martensite in NiMnGa alloy. → Accurate EBSD mapping is performed using monoclinic superstructure. → Four distinct variants mutually twin-related to each other are revealed. → Three twinning types and full twinning elements are identified. → Twin interfaces do coincide with respective twinning planes. - Abstract: For Ni-Mn-Ga ferromagnetic shape memory alloys, the characteristic features of modulated martensite (including the number/shape of constituent variants, the inter-variant orientation relationship and the geometrical distribution of variant interfaces) determine the attainability of the shape memory effect. In the present work, a comprehensive microstructural and crystallographic investigation has been conducted on a bulk polycrystalline Ni 50 Mn 28 Ga 22 alloy. As a first attempt, the orientation measurements by electron backscatter diffraction (EBSD) - using the precise information on the commensurate 5M modulated monoclinic superstructure (instead of the conventionally simplified non-modulated tetragonal structure) - were successfully performed to identify the crystallographic orientations on an individual basis. Consequently, the morphology of modulated martensite, the orientation relationships between adjacent variants and the characters of twin interfaces were unambiguously determined. With the thus-obtained full-featured image on the configuration of martensitic variants, the possibility of microstructural modification by proper mechanical 'training' was further discussed. This new effort makes it feasible to explore the crystallographic/microstructural correlations in modulated martensite with high statistical reliability, which in turn provides useful guidance for optimizing the microstructure and shape memory performance.
Grindability of dental magnetic alloys.
Hayashi, Eisei; Kikuchi, Masafumi; Okuno, Osamu; Kimura, Kohei
2005-06-01
In this study, the grindability of cast magnetic alloys (Fe-Pt-Nb magnetic alloy and magnetic stainless steel) was evaluated and compared with that of conventional dental casting alloys (Ag-Pd-Au alloy, Type 4 gold alloy, and cobalt-chromium alloy). Grindability was evaluated in terms of grinding rate (i.e., volume of metal removed per minute) and grinding ratio (i.e., volume ratio of metal removed compared to wheel material lost). Solution treated Fe-Pt-Nb magnetic alloy had a significantly higher grinding rate than the aged one at a grinding speed of 750-1500 m x min(-1). At 500 m x min(-1), there were no significant differences in grinding rate between solution treated and aged Fe-Pt-Nb magnetic alloys. At a lower speed of 500 m x min(-1) or 750 m x min(-1), it was found that the grinding rates of aged Fe-Pt-Nb magnetic alloy and stainless steel were higher than those of conventional casting alloys.
Hydrogen induced dis-proportionation studies on Zr-Co-M (M=Ni, Fe, Ti) ternary alloys
International Nuclear Information System (INIS)
Jat, Ram Avtar; Pati, Subhasis; Parida, S.C.; Agarwal, Renu; Mukerjee, S.K.; Sastry, P.U.; Jayakrishnan, V.B.
2016-01-01
The intermetallic compound ZrCo is considered as a suitable material for storage, supply and recovery of hydrogen isotopes in International Thermonuclear Experimental Reactor (ITER). However, upon repeated hydriding-dehydriding cycles, the hydrogen storage capacity of ZrCo decreases, which is attributed to the disproportionate reaction ZrCo + H 2 ↔ ZrH 2 + ZrCo 2 . The reduction of hydrogen storage capacity of ZrCo is not desirable for its use in tritium facilities. In our previous studies, attempts were made to improve the durability of ZrCo against dis-proportionation by including a third element. The present study is aimed to investigate the hydrogen induced dis-proportionation of Zr-Co-M (M=Ni, Fe and Ti) ternary alloys under hydrogen delivery conditions
Survey of potential markets for devices using Californium-252
International Nuclear Information System (INIS)
Permar, P.H.
1975-01-01
Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US
48 CFR 252.222-7002 - Compliance with local labor laws (overseas).
2010-10-01
... labor laws (overseas). 252.222-7002 Section 252.222-7002 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7002 Compliance with local labor laws (overseas). As prescribed in 222.7201(a), use the following clause: Compliance with Local Labor Laws (Overseas) (JUN 1997...
24 CFR 252.6 - Method of payment of mortgage insurance premiums.
2010-04-01
... insurance premiums. 252.6 Section 252.6 Housing and Urban Development Regulations Relating to Housing and..., AND BOARD AND CARE HOMES § 252.6 Method of payment of mortgage insurance premiums. The provisions of..., DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT...
24 CFR 236.252 - First, second, and third mortgage insurance premiums.
2010-04-01
... insurance premiums. 236.252 Section 236.252 Housing and Urban Development Regulations Relating to Housing... insurance premiums. All of the provisions of § 207.252 of this chapter governing the first, second, and third mortgage insurance premiums shall apply to mortgages insured under this subpart, except: (a) Where...
Application of californium-252 neutron sources for analytical chemistry
International Nuclear Information System (INIS)
Ishii, Daido
1976-01-01
The researches made for the application of Cf-252 neutron sources to analytical chemistry during the period from 1970 to 1974 including partly 1975 are reviewed. The first part is the introduction to the above. The second part deals with general review of symposia, publications and the like. Attention is directed to ERDA publishing the periodical ''Californium-252 Progress'' and to a study group of Cf-252 utilization held by Japanese Radioisotope Association in 1974. The third part deals with its application for radio activation analysis. The automated absolute activation analysis (AAAA) of Savannha River is briefly explained. The joint experiment of Savannha River operation office with New Brunswick laboratory is mentioned. Cf-252 radiation source was used for the non-destructive analysis of elements in river water. East neutrons of Cf-252 were used for the quantitative analysis of lead in paints. Many applications for industrial control processes have been reported. Attention is drawn to the application of Cf-252 neutron sources for the field search of neutral resources. For example, a logging sonde for searching uranium resources was developed. the fourth part deals with the application of the analysis with gamma ray by capturing neutrons. For example, a bore hole sonde and the process control analysis of sulfur in fuel utilized capture gamma ray. The prompt gamma ray by capturing neutrons may be used for the nondestructive analysis of enrivonment. (Iwakiri, K.)
Ternary-fragmentation-driving potential energies of 252Cf
Karthikraj, C.; Ren, Zhongzhou
2017-12-01
Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.
Mechanical and wear properties of pre-alloyed molybdenum P/M steels with nickel addition
Directory of Open Access Journals (Sweden)
Yamanoglu R.
2012-01-01
Full Text Available The aim of this study is to understand the effect of nickel addition on mechanical and wear properties of molybdenum and copper alloyed P/M steel. Specimens with three different nickel contents were pressed under 400 MPa and sintered at 1120ºC for 30 minutes then rapidly cooled. Microstructures and mechanical properties (bending strength, hardness and wear properties of the sintered specimens were investigated in detail. Metallographical investigations showed that the microstructures of consolidated specimens consist of tempered martensite, bainite, retained austenite and pores. It is also reported that the amount of pores varies depending on the nickel concentration of the alloys. Hardness of the alloys increases with increasing nickel content. Specimens containing 2% nickel showed minimum pore quantity and maximum wear resistance. The wear mechanism changed from abrasive wear at low nickel content to adhesive wear at higher nickel content.
Ab Initio Molecular Dynamics Studies of Pb m Sb n ( m + n ≤ 9) Alloy Clusters
Song, Bingyi; Xu, Baoqiang; Yang, Bin; Jiang, Wenlong; Chen, Xiumin; Xu, Na; Liu, Dachun; Dai, Yongnian
2017-10-01
Structure, stability, and dynamics of Pb m Sb n ( m + n ≤ 9) clusters were investigated using ab initio molecular dynamics. Size dependence of binding energies, the second-order energy difference of clusters, dissociation energy, HOMO-LUMO gaps, Mayer bond order, and the diffusion coefficient of Pb m Sb n clusters were discussed. Results suggest that Pb3Sb2, Pb4Sb2, and Pb5Sb4 ( n = 2 or 4) clusters have higher stability than other clusters, which is consistent with previous findings. In case of Pb-Sb alloy, the dynamics results show that Pb4Sb2 (Pb-22.71 wt pct Sb) can exist in gas phase at 1073 K (800 °C), which reasonably explains the azeotropic phenomenon, and the calculated values are in agreement with the experimental results (Pb-22 wt pct Sb).
Energy Technology Data Exchange (ETDEWEB)
Zhu, Xiaoxia; Zhou, Xuan; Yu, Shuaishuai; Wei, Congcong; Xu, Jing; Wang, Yan, E-mail: mse_wangy@ujn.edu.cn
2017-05-15
The effects of annealing treatment on the microstructure, thermal stability, and magnetic properties of the mechanical alloyed FeSiBAlNiM (M=Co, Cu, Ag) amorphous high entropy alloys (HEAs) have been investigated in this project. The simple crystallization products in FeSiBAlNi amorphous HEAs with Co and Ag addition reveal the high phase stability during heating process. At high annealing treatment, the crystallized HEAs possess the good semi-hard magnetic property. It can conclude that crystallization products containing proper FeSi-rich and FeB-rich phases are beneficial to improve the magnetic property. Annealing near the exothermic peak temperature presents the best enhancing effect on the semi-hard magnetic property of FeSiBAlNiCo. It performs both large saturated magnetization and remanence ratio of 13.0 emu/g and near 45%, which exhibit 465% and 105% enhancement compared with as-milled state, respectively. - Highlights: • Co, Cu, Ag additions affect crystallization behavior of FeSiBAlNi amorphous HEAs. • Crystallization products in FeSiBAlNi Co/Ag reveal high phase stability. • Proper FeSi-rich and FeB-rich phases are beneficial to improve magnetic property. • Annealing treatment improves semi-hard magnetic property compared to as-milled state. • Annealing near exothermic peak temperature shows best enhancing effect on magnetism.
Graphite moderated 252Cf source
International Nuclear Information System (INIS)
Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.
2014-08-01
The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)
7 CFR 766.252 - Unauthorized assistance resulting from submission of false information.
2010-01-01
... false information. 766.252 Section 766.252 Agriculture Regulations of the Department of Agriculture... Unauthorized Assistance § 766.252 Unauthorized assistance resulting from submission of false information. A... behalf, submits information to the Agency that the borrower knows to be false. ...
Prompt neutron spectrum of the spontaneous fission of californium-252
International Nuclear Information System (INIS)
Zamyatnin, Yu.S.; Kroshkin, N.I.; Korostylev, V.A.; Nefedov, V.N.; Ryazanov, D.K.; Starostov, B.I.; Semenov, A.F.
1976-01-01
The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252 Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252 Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252 Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references
System control for the modulated 252Cf source ''Shuffler''
International Nuclear Information System (INIS)
Stephens, M.M.
1975-06-01
The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)
Laboratory-scale shielded cell for 252Cf
International Nuclear Information System (INIS)
Anderl, R.A.; Cargo, C.H.
1979-01-01
A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms
A survey of uses and users of 252Cf
International Nuclear Information System (INIS)
Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.
1989-01-01
Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL
46 CFR 252.23 - Financial and other reporting requirements.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Financial and other reporting requirements. 252.23... SERVICES Operation § 252.23 Financial and other reporting requirements. (a) Voyage report. The operator... total loss covered by a policy of insurance. (d) Financial statements. The operator shall submit, in...
Cymer, Florian; Thomann, Marco; Wegele, Harald; Avenal, Cecile; Schlothauer, Tilman; Gygax, Daniel; Beck, Hermann
2017-11-01
Oxidation of monoclonal therapeutic antibodies (mAbs) can affect binding to Fc-receptors and potentially influence pharmacokinetics or effector functions like e.g. antibody dependent cellular phagocytosis (ADCP). Recently, it has been demonstrated that binding to FcγRIIa (H131) is affected by methionine oxidation of the Fc-portion but it is currently unknown which methionine is responsible for decreased binding. We separated an oxidized IgG1 monoclonal antibody based on the oxidation state of methionine 252 and analyzed fractionated material in receptor binding experiments as well as in functional (cell-based) assays. Although the unfractionated mixture demonstrated weaker interaction/activation of the receptor, differently oxidized isolated subspecies can lead both to stronger as well as weaker binding and activation of the histidine variant of FcγRIIa. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Solidification of eutectic system alloys in space (M-19)
Ohno, Atsumi
1993-01-01
It is well known that in the liquid state eutectic alloys are theoretically homogeneous under 1 g conditions. However, the homogeneous solidified structure of this alloy is not obtained because thermal convection and non-equilibrium solidification occur. The present investigators have clarified the solidification mechanisms of the eutectic system alloys under 1 g conditions by using the in situ observation method; in particular, the primary crystals of the eutectic system alloys never nucleated in the liquid, but instead did so on the mold wall, and the crystals separated from the mold wall by fluid motion caused by thermal convection. They also found that the equiaxed eutectic grains (eutectic cells) are formed on the primary crystals. In this case, the leading phase of the eutectic must agree with the phase of the primary crystals. In space, no thermal convection occurs so that primary crystals should not move from the mold wall and should not appear inside the solidified structure. Therefore no equiaxed eutectic grains will be formed under microgravity conditions. Past space experiments concerning eutectic alloys were classified into two types of experiments: one with respect to the solidification mechanisms of the eutectic alloys and the other to the unidirectional solidification of this alloy. The former type of experiment has the problem that the solidified structures between microgravity and 1 g conditions show little difference. This is why the flight samples were prepared by the ordinary cast techniques on Earth. Therefore it is impossible to ascertain whether or not the nucleation and growth of primary crystals in the melt occur and if primary crystals influence the formation of the equiaxed eutectic grains. In this experiment, hypo- and hyper-eutectic aluminum copper alloys which are near eutectic point are used. The chemical compositions of the samples are Al-32.4mass%Cu (Hypo-eutectic) and Al-33.5mass%Cu (hyper-eutectic). Long rods for the samples are
48 CFR 252.204-7001 - Commercial and Government Entity (CAGE) code reporting.
2010-10-01
... Entity (CAGE) code reporting. 252.204-7001 Section 252.204-7001 Federal Acquisition Regulations System... Entity (CAGE) Code Reporting (AUG 1999) (a) The offeror is requested to enter its CAGE code on its offer... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.204-7001 Commercial and Government Entity...
48 CFR 252.222-7005 - Prohibition on use of nonimmigrant aliens-Guam.
2010-10-01
... nonimmigrant aliens-Guam. 252.222-7005 Section 252.222-7005 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7005 Prohibition on use of nonimmigrant aliens—Guam. As prescribed in 222.7302, use the following clause: Prohibition on Use of Nonimmigrant Aliens—Guam (SEP 1999...
24 CFR 207.252e - Method of payment of mortgage insurance premiums.
2010-04-01
... insurance premiums. 207.252e Section 207.252e Housing and Urban Development Regulations Relating to Housing... Premiums § 207.252e Method of payment of mortgage insurance premiums. In the cases that the Commissioner... mortgagees, that mortgage insurance premiums be remitted electronically. [63 FR 1303, Jan. 8, 1998] ...
Montalvão, Diogo; Alçada, Francisca Sena; Braz Fernandes, Francisco Manuel; de Vilaverde-Correia, Sancho
2014-01-01
The purpose of this study is to understand how the M-Wire alloy conditions the mechanical flexibility of endodontic rotary files at body temperature.Two different rotary instruments, a Profile GT 20/.06 and a Profile GT Series X 20/.06, were selected due to their geometrical similarity and their different constituent alloy. GT series X files are made from M-Wire, a Ni-Ti alloy allegedly having higher flexibility at body temperature. Both files were analysed by X-Ray Diffraction and Differential Scanning Calorimetry to investigate phase transformations and the effects of working temperature on these different alloys. Mechanical behaviour was assessed by means of static bending and torsional Finite Element simulations, taking into account the nonlinear superelastic behaviour of Ni-Ti materials. It was found that GT files present austenitic phase at body temperature, whereas GT series X present R-phase at temperatures under 40 °C with a potential for larger flexibility. For the same load conditions, simulations showed that the slight geometrical differences between the two files do not introduce great disagreement in the instruments' mechanical response. It was confirmed that M-Wire increases the instrument's flexibility, mainly due to the presence of R-phase at body temperature.
International Nuclear Information System (INIS)
Wogman, N.A.
1976-12-01
Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables
Californium-252 Program Equipment Evaluation
Energy Technology Data Exchange (ETDEWEB)
Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2017-12-01
To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.
Energy Technology Data Exchange (ETDEWEB)
Wang, Siyan; Ding, Jie; Ming, Hongliang; Zhang, Zhiming; Wang, Jianqiu, E-mail: wangjianqiu@imr.ac.cn
2015-02-15
The interface region of welded A508–Alloy 52 M is characterized by scanning probe microscope (SPM) techniques, scanning electron microscopy (SEM)/energy dispersive spectroscopy (EDS), transmission electron microscopy (TEM)/Energy Dispersive Spectroscopy (EDS) and scanning vibrate electrode technique (SVET). The regions along the welded A508–Alloy 52 M interface can be categorized into two types according to their different microstructures. In the type-I interface region, A508 and Alloy 52 M are separated by the fusion boundary, while in the type-II interface region, A508 and Alloy 52 M are separated by a martensite zone. A508, martensite zone and grain boundaries in Alloy 52 M are ferromagnetic while the Alloy 52 M matrix is paramagnetic. The Volta potentials measured by scanning Kelvin probe force microscopy (SKPFM) of A508, martensite zone and Alloy 52 M follow the order: V{sub 52} {sub M} > V{sub A508} > V{sub martensite}. The corrosion behavior of A508–Alloy 52 M interface region is galvanic corrosion, in which Alloy 52 M is cathode while A508 is anode. The martensite dissolves faster than Alloy 52 M, but slower than A508 in the test solution. - Highlights: • The A508–Alloy 52 M interface regions can be categorized into two types. • The chromium depleted region is observed along the Alloy 52 M grain boundary. • The Alloy 52 M grain boundaries which are close to the interface are ferromagnetic. • Martensite zone has lower Volta potential but higher corrosion resistance than A508.
International Nuclear Information System (INIS)
Fu, Zhiqiang; Chen, Weiping; Fang, Sicong; Zhang, Dayue; Xiao, Huaqiang; Zhu, Dezhi
2013-01-01
Highlights: ► CoNiFeCrAl 0.6 Ti 0.4 high entropy alloy has been synthesized via MA and SPS. ► Deformation twinning possibly occurred during MA or SPS. ► This alloy exhibits excellent mechanical properties. ► The fracture mechanism of this alloy is intergranular fracture and plastic fracture. -- Abstract: Inequi-atomic CoNiFeCrAl 0.6 Ti 0.4 high entropy alloy has been designed and fabricated by mechanical alloying (MA) and spark plasma sintering (SPS). Alloying behavior, microstructure, phase evolution and mechanical properties of CoNiFeCrAl 0.6 Ti 0.4 alloy were investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscope (TEM), as well as by an Instron testing system. During MA, a supersaturated solid solution consisting of a FCC phase and a metastable BCC phase was formed. Two FCC phases (named FCC1 and FCC2) and a new BCC phase were observed after SPS. During SPS, the metastable BCC phase transformed into the FCC2 phase and the new BCC phase. Meanwhile, the FCC1 phase was the initial FCC phase which was formed during MA. Moreover, nanoscale twins obviously presented only in partial FCC1 phase after SPS. Deformation twinning may be occurred during MA or SPS. The sintered alloy with a high relative density of 98.83% exhibits excellent comprehensive mechanical properties. The yield stress, compressive strength, compression ratio and Vickers hardness of the alloy are 2.08, 2.52 GPa, 11.5% and 573 H V , respectively. The fracture mechanism of CoNiFeCrAl 0.6 Ti 0.4 high entropy alloy is mainly performed at intergranular fracture and plastic fracture mode
25m2 target-aligned heliostat with closed-loop control
CSIR Research Space (South Africa)
Roos, TH
2007-09-01
Full Text Available system making use of a solar tracker has been developed and tested on a 1.252m target-aligned miniheliostat. A tracking accuracy of 3.3 milliradians was obtained. A good focal spot has been obtained with the 252m target-aligned research heliostat....
48 CFR 252.227-7012 - Patent license and release contract.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Patent license and release contract. 252.227-7012 Section 252.227-7012 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...
Yang, A. L.; Song, H. P.; Liang, D. C.; Wei, H. Y.; Liu, X. L.; Jin, P.; Qin, X. B.; Yang, S. Y.; Zhu, Q. S.; Wang, Z. G.
2010-04-01
Temperature-dependent photoluminescence characteristics of non-polar m-plane ZnO and ZnMgO alloy films grown by metal organic chemical vapor deposition have been studied. The enhancement in emission intensity caused by localized excitons in m-plane ZnMgO alloy films was directly observed and it can be further improved after annealing in nitrogen. The concentration of Zn vacancies in the films was increased by alloying with Mg, which was detected by positron annihilation spectroscopy. This result is very important to directly explain why undoped Zn1-xMgxO thin films can show p-type conduction by controlling Mg content, as discussed by Li et al. [Appl. Phys. Lett. 91, 232115 (2007)].
International Nuclear Information System (INIS)
Nam, Nguyen Dang; Thang, Vo Quoc; Hoai, Nguyen To; Hien, Pham Van
2016-01-01
Highlights: • Yttrium 3-(4-nitrophenyl)-2-propenoate has been studied as an effective corrosion inhibitor for copper. • A high inhibition performance is attributed to the forming protective inhibiting deposits. • Yttrium 3-(4-nitrophenyl)-2-propenoate mitigates corrosion by promoting random distribution of minor anodes. - Abstract: Yttrium 3-(4-nitrophenyl)-2-propenoate has been studied as an effective corrosion inhibitor for copper alloy in 0.1 M chloride solution. The results show that the surface of copper alloy coupons exposed to solutions containing 0.45 mM yttrium 3-(4-nitrophenyl)-2-propenoate had no signs of corrosion attack due to protective film formation, whereas the surface of copper alloy coupons exposed to non-inhibitor and lower concentrations of yttrium 3-(4-nitrophenyl)-2-propenoate containing solutions were severely corroded. A high inhibition performance is attributed to the forming protective inhibiting deposits that slow down the electrochemical corrosion reactions and mitigate corrosion by promoting random distribution of minor anodes.
Graphite moderated {sup 252}Cf source
Energy Technology Data Exchange (ETDEWEB)
Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)
2014-08-15
The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)
Hot compressive deformation behavior of the as-quenched A357 aluminum alloy
International Nuclear Information System (INIS)
Yang, X.W.; Lai, Z.H.; Zhu, J.C.; Liu, Y.; He, D.
2012-01-01
Highlights: ► We create a thermal history curve which was applied to carry out compression tests. ► We make an analysis of deformation performance for as-quenched A357 alloy. ► We create a constitutive equation which has good accuracy. - Abstract: The objective of the present work was to establish an accurate thermal-stress mathematical model of the quenching operation for A357 (Al–7Si–0.6Mg) alloy and to investigate the deformation behavior of this alloy. Isothermal compression tests of as-quenched A357 alloy were performed in the temperature range of 350–500 °C and at the strain rate range of 0.001–1 s −1 . Experimental results show that the flow stress of as-quenched A357 alloy decreases with the increase of temperature and the decrease of strain rate. Based on the hyperbolic sine equation, a constitutive equation is a relation between 0.2 pct yield stress and deformation conditions (strain rate and deformation temperature) was established. The corresponding hot deformation activation energy (Q) for as-quenched A357 alloy is 252.095 kJ/mol. Under the different small strains (≤0.01), the constitutive equation parameters of as-quenched A357 alloy were calculated. Values of flow stress calculated by constitutive equation were in a very good agreement with experimental results. Therefore, it can be used as an accurate thermal-stress model to solve the problems of quench distortion of parts.
Application of mechanical alloying to synthesis of intermetallic phases based alloys
International Nuclear Information System (INIS)
Dymek, S.
2001-01-01
Mechanical alloying is the process of synthesis of powder materials during milling in high energetic mills, usually ball mills. The central event in mechanical alloying is the ball-powder-ball collision. Powder particles are trapped between the colliding balls during milling and undergo deformation and/or fracture. Fractured parts are cold welded. The continued fracture and cold welding results in a uniform size and chemical composition of powder particles. The main applications of mechanical alloying are: processing of ODS alloys, syntheses of intermetallic phases, synthesis of nonequilibrium structures (amorphous alloys, extended solid solutions, nanocrystalline, quasi crystals) and magnetic materials. The present paper deals with application of mechanical alloying to synthesis Ni A l base intermetallic phases as well as phases from the Nb-Al binary system. The alloy were processed from elemental powders. The course of milling was monitored by scanning electron microscopy and X-ray diffraction. After milling, the collected powders were sieved by 45 μm grid and hot pressed (Nb alloys and NiAl) or hot extruded (NiAl). The resulting material was fully dense and exhibited fine grain (< 1 μm) and uniform distribution of oxide dispersoid. The consolidated material was compression and creep tested. The mechanical properties of mechanically alloys were superior to properties of their cast counterparts both in the room and elevated temperatures. Higher strength of mechanically alloyed materials results from their fine grains and from the presence of dispersoid. At elevated temperatures, the Nb-Al alloys have higher compression strength than NiAl-based alloys processed at the same conditions. The minimum creep rates of mechanically alloyed Nb alloys are an order of magnitude lower than analogously processed NiAl-base alloys. (author)
Fabrication of californium-252 sources in the United Kingdom
International Nuclear Information System (INIS)
Ainsworth, A.; Brady, M.W.; Thornett, W.H.
1975-01-01
The advent of californium-252 in weighable quantities and at a reasonable price has caused some rethinking among neutron source suppliers. To explore this market the Radiochemical Center Ltd. has purchased 2 mg of californium-252, and subdivided this into a wide range of sources. To take advantage of its high specific neutron emission, a small double welded stainless steel capsule 7.8mm diameter x 10mm high was chosen for stock sources and this entailed the use of a microdispensing technique which had to be specially developed. The apparatus and procedure for subdividing milligram amounts of californium-252 are described. Some details of our experience in processing these one milligram shipments are given. 100 sources with activities from 200 microgram to 0.01 microgram have been produced. Losses have been small. Measurement of neutron spectra gamma spectra and dose rates from encapsulated sources has confirmed published data. Though it is early days, little industrial interest in californium-252 sources has been detected, most of the sources have so far been required for research into activation analysis and two examples of this are given. (U.S.)
Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields
International Nuclear Information System (INIS)
Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik
2001-01-01
Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated
Energy Technology Data Exchange (ETDEWEB)
Sonmez, S. [Hakkari University, Dept. of Biomedical Eng., 30000 Hakkari (Turkey); Aksakal, B., E-mail: baksakal@yildiz.edu.tr [Yildiz Technical University, Chemical Metallurgy Faculty, Dept. of Metall and Mater Eng., Istanbul (Turkey); Dikici, B. [Yuzuncu Yil University, Dept. of Mechanical Eng., 65080 Van (Turkey)
2014-05-01
Graphical abstract: The corrosion resistance of magnesium alloys is the primary concern in biomedical applications. Micron and nano-scale hydroxyapatite (HA) was coated successfully on MA8M magnesium alloy substrates by using a sol–gel deposition. In this study, the effects of coating thicknesses and HA powder particle sizes on the adhesion strength and corrosion behavior were investigated. Potentiodynamic polarization tests were performed in a Ringer solution. The coatings before and after corrosion tests were characterized by adhesion tests, scanning electron microscopy (SEM) and X-ray diffraction (XRD) analysis. The micro-scale-HA coated Mg substrates were more corrosion resistant than the nano-scale-HA coatings. The anodic activity of the micro-scale-HA coatings increased with increased coating thickness and the corrosion resistance of Mg substrates decreased. Corrosion susceptibilities of the nano-scale-HA coated samples were affected inversely. The coated film provided good barrier characteristics and achieved good corrosion protection for Mg substrates when compared to substrates without coatings. For micro-scale-HA coatings, anodic and cathodic activities were more intense for thicker films. When HA coatings are compared to nano-scale HA coatings, the micro-scale-HA coatings produced better current density values. Overall, as shown in Fig. 1, the best corrosion behavior of the Mg alloys was achieved using micro-scale HA powders at 30 μm coating thickness. - Highlights: • Nano and micro-scale-HA coatings provided good anti-corrosion performance compared to the uncoated ones. • The micro-scale-HA coated Mg substrates were more corrosion resistant than the nano-scale-HA coatings. • The best corrosion behavior was achieved for the micro-scale HA powders at 30 μm coating thickness. • Anodic activity decrease and cathodic activity increase with increasing film thickness. - Abstract: To improve the corrosion resistance of MA8M magnesium alloy, sol
Production, Distribution, and Applications of Californium-252 Neutron Sources
International Nuclear Information System (INIS)
Balo, P.A.; Knauer, J.B.; Martin, R.C.
1999-01-01
The radioisotope 252 Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10 11 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252 Cf to commercial reencapsulators domestically and internationally. Sealed 252 Cf sources are also available for loan to agencies and subcontractors of the U.S. government and to universities for educational, research, and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252 Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments, and irradiation of rice to induce genetic mutations
Li, C. H.; Busch, G.; Creter, C.
1976-01-01
The Metals Melting Skylab Experiment consisted of selectively melting, in sequence, three rotating discs made of aluminum alloy, stainless steel, and tantalum alloy. For comparison, three other discs of the same three materials were similarly melted or welded on the ground. The power source of the melting was an electron beam unit. Results are presented which support the concept that the major difference between ground base and Skylab samples (i.e., large elongated grains in ground base samples versus nearly equiaxed and equal sized grains in Skylab samples) can be explained on the basis of constitutional supercooling, and not on the basis of surface phenomena. Microstructural observations on the weld samples and present explanations for some of these observations are examined. In particular, ripples and their implications to weld solidification were studied. Evidence of pronounced copper segregation in the Skylab A1 weld samples, and the tantalum samples studied, indicates a weld microhardness (and hence strength) that is uniformly higher than the ground base results, which is in agreement with previous predictions. Photographs are shown of the microstructure of the various alloys.
Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)
International Nuclear Information System (INIS)
Budtz-Joergensen, C.; Knitter, H.H.
1986-01-01
The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)
Radiography using californium-252 neutron sources
International Nuclear Information System (INIS)
Ray, J.W.
1975-01-01
The current status in the technology of neutron radiography using californium-252 neutron sources is summarized. Major emphasis is on thermal neutron radiography since it has the widest potential applicability at the present time. Attention is given to four major factors which affect the quality and useability of thermal neutron radiography: source neutron thermalization, neutron beam extraction geometry, neutron collimator dimensions, and neutron imaging methods. Each of these factors has a major effect on the quality of the radiographs which are obtained from a californium source neutron radiography system and the exposure times required to obtain the radiographs; radiograph quality and exposure time in turn affect the practicality of neutron radiography for specific nondestructive inspection applications. A brief discussion of fast neutron radiography using californium-252 neutron sources is also included. (U.S.)
Radiation ulcers in patients with cancer of the torgue after 252Cf therapy
International Nuclear Information System (INIS)
Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.
1984-01-01
Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf
Grain refining mechanism of Al-containing Mg alloys with the addition of Mn-Al alloys
International Nuclear Information System (INIS)
Qin, Gaowu W.; Ren Yuping; Huang Wei; Li Song; Pei Wenli
2010-01-01
Graphical abstract: Display Omitted Research highlights: The ε-AlMn phase acts as the heterogeneous nucleus of α-Mg phase during the solidification of the AZ31 Mg alloy, not the γ-Al 8 Mn 5 phase. The grain refinement effect is very clear with the addition of only 0.5 wt% Mn-28Al alloy (pure ε-AlMn). The grain refinement does not deteriorate up to the holding time of 60 min at 740 o C. - Abstract: The effect of manganese on grain refinement of Al-containing AZ31 Mg alloy has been investigated by designing a series of Mn-Al alloys composed of either pure ε-AlMn, γ 2 -Al 8 Mn 5 or both of them using optical microscopy and X-ray diffraction. It is experimentally clarified that the grain refinement of the AZ31 Mg alloy is due to the existence of the ε-AlMn phase in the Mn-Al alloys, not the γ 2 -Al 8 Mn 5 phase. The grain size of AZ31 Mg alloy is about 91 μm without any addition of Mn-Al alloys, but remarkably decreases to ∼55 μm with the addition of either Mn-34 wt% Al or Mn-28 wt% Al. With a minor addition of 0.5 wt% Mn-28Al alloy, the grain size of AZ31 alloy decreases to ∼53 μm, and the Mn-28Al alloy can be active as grain refiner for holding time up to 60 min for the melt AZ31 alloy at 750 o C.
2010-04-01
... TREASURY LIQUORS BEER Removal of Brewer's Yeast and Other Articles § 25.252 Records. (a) Production. The brewer shall keep records of the production of malt syrup, wort, and other articles which are removed... of brewer's yeast, malt and other articles from the brewery. The record shall include the quantity...
Air oxidation of Zircaloy-4, M5 (registered) and ZIRLOTM cladding alloys at high temperatures
International Nuclear Information System (INIS)
Steinbrueck, M.; Boettcher, M.
2011-01-01
The paper presents the results of isothermal and transient oxidation experiments of the advanced cladding alloys M5 (registered) and ZIRLO TM in comparison to Zircaloy-4 in air at temperatures from 973 to 1853 K. Generally, oxidation in air leads to a strong degradation of the cladding material. The main mechanism of this process is the formation of zirconium nitride and its re-oxidation. From the point of view of safety, the barrier effect of the fuel cladding is lost much earlier than during accident transients with a steam atmosphere only. Comparison of the three alloys investigated reveals a qualitatively similar, but quantitatively varying oxidation behavior in air. The mainly parabolic oxidation kinetics, where applicable, is comparable for the three alloys. Strong differences of up to 500% in oxidation rates were observed after transition to linear kinetics at temperatures below 1300 K. The paper presents kinetic rate constants as well as critical times and oxide scale thicknesses at the point of transition from parabolic to linear kinetics.
Effect of ternary alloying elements on the shape memory behavior of Ti-Ta alloys
International Nuclear Information System (INIS)
Buenconsejo, Pio John S.; Kim, Hee Young; Miyazaki, Shuichi
2009-01-01
The effect of ternary alloying elements (X = V, Cr, Fe, Zr, Hf, Mo, Sn, Al) on the shape memory behavior of Ti-30Ta-X alloys was investigated. All the alloying elements decreased the martensitic transformation temperatures. The decrease in the martensitic transformation start (M s ) temperature due to alloying was affected by the atomic size and number of valence electrons of the alloying element. A larger number of valence electrons and a smaller atomic radius of an alloying element decreased the M s more strongly. The effect of the alloying elements on suppressing the aging effect on the shape memory behavior was also investigated. It was found that the additions of Sn and Al to Ti-Ta were effective in suppressing the effect of aging on the shape memory behavior, since they strongly suppress the formation of ω phase during aging treatment. For this reason the Ti-30Ta-1Al and Ti-30Ta-1Sn alloys exhibited a stable high-temperature shape memory effect during thermal cycling.
Neutron shielding for a 252 Cf source
International Nuclear Information System (INIS)
Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente
2006-01-01
To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)
48 CFR 252.225-7044 - Balance of Payments Program-Construction Material.
2010-10-01
... Program-Construction Material. 252.225-7044 Section 252.225-7044 Federal Acquisition Regulations System...—Construction Material. As prescribed in 225.7503(a), use the following clause: Balance of Payments Program—Construction Material (JAN 2009) (a) Definitions. As used in this clause— Commercially available off-the-shelf...
Grain refining mechanism of Al-containing Mg alloys with the addition of Mn-Al alloys
Energy Technology Data Exchange (ETDEWEB)
Qin, Gaowu W., E-mail: qingw@smm.neu.edu.c [Key Laboratory for Anisotropy and Texture of Materials (Ministry of Education), Northeastern University, Wenhu Road 3-11, Heping District, Shenyang 110004, Liaoning Province (China); Ren Yuping; Huang Wei; Li Song; Pei Wenli [Key Laboratory for Anisotropy and Texture of Materials (Ministry of Education), Northeastern University, Wenhu Road 3-11, Heping District, Shenyang 110004, Liaoning Province (China)
2010-10-08
Graphical abstract: Display Omitted Research highlights: The {epsilon}-AlMn phase acts as the heterogeneous nucleus of {alpha}-Mg phase during the solidification of the AZ31 Mg alloy, not the {gamma}-Al{sub 8}Mn{sub 5} phase. The grain refinement effect is very clear with the addition of only 0.5 wt% Mn-28Al alloy (pure {epsilon}-AlMn). The grain refinement does not deteriorate up to the holding time of 60 min at 740 {sup o}C. - Abstract: The effect of manganese on grain refinement of Al-containing AZ31 Mg alloy has been investigated by designing a series of Mn-Al alloys composed of either pure {epsilon}-AlMn, {gamma}{sub 2}-Al{sub 8}Mn{sub 5} or both of them using optical microscopy and X-ray diffraction. It is experimentally clarified that the grain refinement of the AZ31 Mg alloy is due to the existence of the {epsilon}-AlMn phase in the Mn-Al alloys, not the {gamma}{sub 2}-Al{sub 8}Mn{sub 5} phase. The grain size of AZ31 Mg alloy is about 91 {mu}m without any addition of Mn-Al alloys, but remarkably decreases to {approx}55 {mu}m with the addition of either Mn-34 wt% Al or Mn-28 wt% Al. With a minor addition of 0.5 wt% Mn-28Al alloy, the grain size of AZ31 alloy decreases to {approx}53 {mu}m, and the Mn-28Al alloy can be active as grain refiner for holding time up to 60 min for the melt AZ31 alloy at 750 {sup o}C.
Martirez, John Mark P; Carter, Emily A
2016-02-23
The Haber-Bosch process for NH3 synthesis is arguably one of the greatest inventions of the 20th century, with a massive footprint in agriculture and, historically, warfare. Current catalysts for this reaction use Fe for N2 activation, conducted at high temperatures and pressures to improve conversion rate and efficiency. A recent finding shows that plasmonic metal nanoparticles can either generate highly reactive electrons and holes or induce resonant surface excitations through plasmonic decay, which catalyze dissociation and redox reactions under mild conditions. It is therefore appealing to consider AuM (M = Fe, Co, Ni, and Mo) alloys to combine the strongly plasmonic nature of Au and the catalytic nature of M metals toward N2 dissociation, which together might facilitate ammonia production. To this end, through density functional theory, we (i) explore the feasibility of forming these surface alloys, (ii) find a pathway that may stabilize/deactivate surface M substituents during fabrication, and (iii) define a complementary route to reactivate them under operational conditions. Finally, we evaluate their reactivity toward N2, as well as their ability to support a pathway for N2 dissociation with a low thermodynamic barrier. We find that AuFe possesses similar appealing qualities, including relative stability with respect to phase separation, reversibility of Fe oxidation and reduction, and reactivity toward N2. While AuMo achieves the best affinity toward N2, its strong propensity toward oxidation could greatly limit its use.
Directory of Open Access Journals (Sweden)
Hui Huang
2016-07-01
Full Text Available This study investigated the structural stability and electrochemical properties of alloying additives M (M = Mn, V, Ti, Mo, or Ni at the γ-Fe(111/Cr2N(0001 interface by the first-principles method. Results indicated that V and Ti were easily segregated at the γ-Fe(111/Cr2N(0001 interface and enhanced interfacial adhesive strength. By contrast, Ni and Mo were difficult to segregate at the γ-Fe(111/Cr2N(0001 interface. Moreover, the results of the work function demonstrated that alloying additives Mn reduced local electrochemical corrosion behavior of the γ-Fe(111/Cr2N(0001 interface by cutting down Volta potential difference (VPD between clean γ-Fe(111 and Cr2N(0001, while alloying additives V, Ti, Mo, and Ni at the γ-Fe(111/Cr2N(0001 interface magnified VPD between clean γ-Fe(111 and Cr2N(0001, which were low-potential sites that usually serve as local attack initiation points.
38 CFR 3.252 - Annual income; pension; Mexican border period and later war periods.
2010-07-01
...; Mexican border period and later war periods. 3.252 Section 3.252 Pensions, Bonuses, and Veterans' Relief... Dependency, Income and Estate § 3.252 Annual income; pension; Mexican border period and later war periods. (a) Annual income limitations; old-law pension. Where the right to old-law pension is payable under section...
24 CFR 207.252c - Premiums-mortgages insured pursuant to section 238(c) of the Act.
2010-04-01
.... All of the provisions of §§ 207.252 and 207.252a governing mortgage insurance premiums shall apply to... insurance premiums due on such mortgages in accordance with §§ 207.252 and 207.252a shall be calculated on... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Premiums-mortgages insured pursuant...
International Nuclear Information System (INIS)
Rautenberg, M.; Poquillon, D.; Pilvin, P.; Grosjean, C.; Cloué, J.M.; Feaugas, X.
2014-01-01
Zirconium alloys are widely used in the nuclear industry. Several components, such as cladding or guide tubes, undergo strong mechanical loading during and after their use inside the pressurized water reactors. The current requirements on higher fuel performances lead to the developing on new Zr based alloys exhibiting better mechanical properties. In this framework, creep behaviors of recrystallized Zircaloy-4 and M5™, have been investigated and then compared. In order to give a better understanding of the thermal creep anisotropy of Zr-based alloys, multi-axial creep tests have been carried out at 673 K. Using a specific device, creep conditions have been set using different values of β = σ zz /σ θθ , σ zz and σ θθ being respectively the axial and hoop creep stresses. Both axial and hoop strains are measured during each test which is carried out until stationary creep is stabilized. The steady-state strain rates are then used to build isocreep curves. Considering the isocreep curves, the M5™ alloy shows a largely improved creep resistance compared to the recrystallized Zircaloy-4, especially for tubes under high hoop loadings (0 < β < 1). The isocreep curves are then compared with simulations performed using two different mechanical models. Model 1 uses a von Mises yield criterion, the model 2 is based on a Hill yield criterion. For both models, a coefficient derived from Norton law is used to assess the stress dependence
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. C M K Nair. Articles written in Bulletin of Materials Science. Volume 24 Issue 2 April 2001 pp 249-252 Crystal Growth. Thermal behaviour of strontium tartrate single crystals grown in gel · M H Rahimkutty K Rajendra Babu K Sreedharan Pillai M R Sudarsana Kumar C M K Nair.
50 CFR 14.252 - What definitions do I need to know?
2010-10-01
... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What definitions do I need to know? 14.252... PLANTS IMPORTATION, EXPORTATION, AND TRANSPORTATION OF WILDLIFE Captive Wildlife Safety Act § 14.252 What... which any individual other than an authorized keeper or caregiver may potentially touch or otherwise...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. M R Sudarsana Kumar. Articles written in Bulletin of Materials Science. Volume 24 Issue 2 April 2001 pp 249-252 Crystal Growth. Thermal behaviour of strontium tartrate single crystals grown in gel · M H Rahimkutty K Rajendra Babu K Sreedharan Pillai M R Sudarsana Kumar ...
International Nuclear Information System (INIS)
Heubner, Ulrich; Kloewer, Jutta; Alves, Helena; Behrens, Rainer; Schindler, Claudius; Wahl, Volker; Wolf, Martin
2012-01-01
This book contains the following eight topics: 1. Nickel alloys and high-alloy special stainless steels - Material overview and metallurgical principles (U. Heubner); 2. Corrosion resistance of nickel alloys and high-alloy special stainless steels (U. Heubner); 3. Welding of nickel alloys and high-alloy special stainless steels (T. Hoffmann, M. Wolf); 4. High-temperature materials for industrial plant construction (J. Kloewer); 5. Nickel alloys and high-alloy special stainless steels as hot roll clad composites-a cost-effective alternative (C. Schindler); 6. Selected examples of the use of nickel alloys and high-alloy special stainless steels in chemical plants (H. Alves); 7. The use of nickel alloys and stainless steels in environmental engineering (V. Wahl); 8: Nickel alloys and high-alloy special stainless steels for the oil and gas industry (R. Behrens).
The status of low dose rate and future of high dose rate Cf-252 brachytherapy
International Nuclear Information System (INIS)
Rivard, M.J.; Wierzbicki, J.G.; Van den Heuvel, F.; Chuba, P.J.; Fontanesi, J.
1997-12-01
This work describes the current status of the US low dose rate (LDR) Cf-252 brachytherapy program. The efforts undertaken towards development of a high dose rate (HDR) remotely after loaded Cf-252 source, which can accommodate 1 mg or greater Cf-252, are also described. This HDR effort is a collaboration between Oak Ridge National Laboratory (ORNL), commercial remote after loader manufactures, the Gershenson Radiation Oncology Center (ROC), and Wayne State University. To achieve this goal, several advances in isotope chemistry and source preparation at ORNL must be achieved to yield a specific material source loading of greater than or equal 1 mg Cf-252 per mm3. Development work with both radioactive and non-radioactive stand-ins for Cf-252 have indicated the feasibility of fabricating such sources. As a result, the decreased catheter diameter and computer controlled source placement will permit additional sites (e.g. brain, breast, prostate, lung, parotid, etc.) to be treated effectively with Cf-252 sources. Additional work at the Radiochemical Engineering and Development Center (REDC) remains in source fabrication, after loader modification, and safe design. The current LDR Cf-252 Treatment Suite at the ROC is shielded and licensed to hold up to 1 mg of Cf-252. This was designed to maintain cumulative personnel exposure, both external to the room and in direct isotope handling, at less than 20 microSv/hr. However, cumulative exposure may be greatly decreased if a Cf-252 HDR unit is employed which would eliminate direct isotope handling and decrease treatment times from tilde 3 hours to an expected range of 3 to 15 minutes. Such a Cf-252 HDR source will also demonstrate improved dose distributions over current LDR treatments due to the ability to step the point-like source throughout the target volume and weight the dwell time accordingly
Effect of alloying elements on the shape memory properties of ductile Cu-Al-Mn alloys
International Nuclear Information System (INIS)
Sutou, Y.; Kainuma, R.; Ishida, K.
1999-01-01
The effect of alloying elements on the M s temperature, ductility and the shape memory properties of Cu-Al-Mn ductile shape memory (SM) alloys was investigated by differential scanning calorimetry, cold-rolling and tensile test techniques. It was found that the addition of Au, Si and Zn to the Cu 73 -Al 17 -Mn 10 alloy stabilized the martensite (6M) phase increasing the M s temperature, while the addition of Ag, Co, Cr, Fe, Ni, Sn and Ti decreased the stability of the martensite phase, decreasing the M s temperature. The SM properties were improved by the addition of Co, Ni, Cr and Ti. (orig.)
48 CFR 252.244-7000 - Subcontracts for Commercial Items and Commercial Components (DoD Contracts).
2010-10-01
... under this contract: (a) 252.225-7009 Restriction on Acquisition of Certain Articles Containing... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Subcontracts for Commercial Items and Commercial Components (DoD Contracts). 252.244-7000 Section 252.244-7000 Federal...
Argon-arc welding of heat resisting aluminium alloys
International Nuclear Information System (INIS)
Ryazantsev, V.I.; Fedoseev, V.A.
1997-01-01
Welding of aluminium heat resisting alloys of the Al-Cu-Mg system is studied. The hot-shortness of heat-resistant alloys M40, 1150 and 1151 are at the level of aluminium alloys 1201 and by 2-3 times lower as compared to the aluminium alloy AMg6. The M40, 1150 and 1151 alloys have unquestionable advantages against other know aluminium alloys only at temperatures of welded structures operation, beginning with 150-2000 deg C and especially at 250 deg C
International Nuclear Information System (INIS)
Rhie, K.; Lim, W.Y.; Lee, S.H.; Yu, S.C.
1997-01-01
Studies of effective permeability, core loss and saturation magnetostriction of Fe 83-x Zr 7 B 10 M x (M=Ni, Nb) alloys revealed that the domain width is smallest around x=0.10. We measured the resistivity and low field Hall coefficients of these alloys and found that the maxima of resistivity and Hall coefficients occurred roughly at the same concentrations. Larger surface area of smaller domains is considered the reason. copyright 1997 American Institute of Physics
Effect of Al alloying on the martensitic temperature in Ti-Ta shape memory alloys
Energy Technology Data Exchange (ETDEWEB)
Ferrari, Alberto; Rogal, Jutta; Drautz, Ralf [Interdisciplinary Centre for Advanced Materials Simulation, Ruhr-Universitaet Bochum (Germany)
2017-07-01
Ti-Ta-based alloys are promising candidates as high temperature shape memory alloys (HTSMAs) for actuators and superelastic applications. The shape memory mechanism involves a martensitic transformation between the low-temperature α'' phase (orthorhombic) and the high-temperature β phase (body-centered cubic). In order to prevent the degradation of the shape memory effect, Ti-Ta needs to be alloyed with further elements. However, this often reduces the martensitic temperature M{sub s}, which is usually strongly composition dependent. The aim of this work is to analyze how the addition of a third element to Ti-Ta alloys affects M{sub s} by means of electronic structure calculations. In particular, it will be investigated how alloying Al to Ti-Ta alters the relative stability of the α'' and β phases. This understanding will help to identify new alloy compositions featuring both a stable shape memory effect and elevated transformation temperatures.
Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources
Energy Technology Data Exchange (ETDEWEB)
Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-04-01
A new, stronger 252Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing 252Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger 252Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our 252Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.
Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy
Energy Technology Data Exchange (ETDEWEB)
Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)
1984-01-01
Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.
International Nuclear Information System (INIS)
Granados, J.; Rodriguez, F.J.; Arganis, C.
1999-01-01
The Inconel 600 is used in diverse components of BWR and PWR type reactors, where diverse cases of intergranular stress corrosion have been presented. It has been reported susceptibility to the corrosion of this alloy, in presence of thiosulfates, which come from the degradation of the ion exchange resins of water treatments that use the reactors. The objective of this work is to study the influence of metallurgical condition in the corrosion velocity of Inconel 600 commercial alloy, in a 0.1 M thiosulfates solution. (Author)
Zhu, Chengzhou; Guo, Shaojun; Dong, Shaojun
2012-05-02
A facile and general method has been developed to synthesize well-defined PdPt and PdAu alloy nanowires, which exhibit significantly enhanced activity towards small molecules, such as ethanol, methanol, and glucose electro-oxidation in an alkaline medium. Considering the important role of one-dimensional alloy nanowires in electrocatalytic systems, the present Pd-based alloy nanostructures could offer a promising new class of advanced electrocatalysts for direct alcohol fuel cells and electrochemical sensors. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
48 CFR 252.245-7000 - Government-furnished mapping, charting, and geodesy property.
2010-10-01
... mapping, charting, and geodesy property. 252.245-7000 Section 252.245-7000 Federal Acquisition Regulations..., charting, and geodesy property. As prescribed in 245.107-70, use the following clause: Government-Furnished Mapping, Charting, and Geodesy Property (DEC 1991) (a) Definition—Mapping, charting, and geodesy (MC&G...
48 CFR 53.236-2 - Architect-engineer services (SF's 252 and 330).
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Architect-engineer... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.236-2 Architect-engineer...-engineer and related services: (a) SF 252 (Rev. 10/83), Architect-Engineer Contract. SF 252 is prescribed...
Radionuclide 252Cf neutron source
International Nuclear Information System (INIS)
Kolevatov, Yu.I.; Trykov, L.A.
1979-01-01
Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV
He, Xiaojing; Li, Meng; Wang, Huizhen; Zhang, Xiangyu; Tang, Bin
2015-05-01
Cu-Cr alloyed layers with different Cu and Cr contents on pure titanium were obtained by means of plasma surface alloying technology. The microstructure, chemical composition and phase composition of Cu-Cr alloyed layers were analyzed by scanning electron microscopy (SEM), energy dispersive spectrometer (EDS) and X-ray diffraction (XRD), respectively. The experimental results demonstrate that the alloyed layers are bonded strongly to pure titanium substrate and consist of unbound Ti, CuTi, Cu3Ti, CuTi3 and Cr2Ti. The thickness of Cu5Cr5 and Cu7Cr3 alloyed layer are about 18 μm and 28 μm, respectively. The antibacterial properties against gram-negative Escherichia coli (E.coli, ATCC10536) and gram-positive Staphylococcus aureus (S. aureus, ATCC6538) of untreated pure titanium and Cu-Cr alloyed specimen were investigated by live/dead fluorescence staining method. The study shows that Cu-Cr alloyed layers exhibit excellent antibacterial activities against both E.coli and S.aureus within 24 h, which may be attributed to the formation of Cu-containing phases.
Preparation of a high strength Al–Cu–Mg alloy by mechanical alloying and press-forming
International Nuclear Information System (INIS)
Tang Huaguo; Cheng Zhiqiang; Liu Jianwei; Ma Xianfeng
2012-01-01
Highlights: ► A high strength aluminum alloy of Al–2 wt.%Mg–2 wt.%Cu has been prepared by mechanical alloying and press-forming. ► The alloy only consists of solid solution α-Al. ► The grains size of α-Al was about 300 nm–5 μm. ► The solid solution strengthening and the grain refinement strengthening are the main reasons for such a high strength. - Abstract: A high strength aluminum alloy, with the ratio of 96 wt.%Al–2 wt.%Mg–2 wt.%Cu, has been prepared by mechanical alloying and press-forming. The alloy exhibited a high tensile strength of 780 MPa and a high microhardness of 180 HV. X-ray diffraction characterizations confirmed that the alloy only consists of a solid solution α-Al. Microstructure characterizations revealed that the grain size of α-Al was about 300 nm–5 μm. The solid solution strengthening and the grain refinement strengthening were considered to be the reason for such a high strength.
Preparation of a high strength Al-Cu-Mg alloy by mechanical alloying and press-forming
Energy Technology Data Exchange (ETDEWEB)
Tang Huaguo [State Key Laboratory of Rare Earth Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Cheng Zhiqiang [College of Resources and Environment, Jilin Agricultural University, Changchun 130118 (China); Liu Jianwei [State Key Laboratory of Rare Earth Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Ma Xianfeng, E-mail: xfma@ciac.jl.cn [State Key Laboratory of Rare Earth Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)
2012-07-30
Highlights: Black-Right-Pointing-Pointer A high strength aluminum alloy of Al-2 wt.%Mg-2 wt.%Cu has been prepared by mechanical alloying and press-forming. Black-Right-Pointing-Pointer The alloy only consists of solid solution {alpha}-Al. Black-Right-Pointing-Pointer The grains size of {alpha}-Al was about 300 nm-5 {mu}m. Black-Right-Pointing-Pointer The solid solution strengthening and the grain refinement strengthening are the main reasons for such a high strength. - Abstract: A high strength aluminum alloy, with the ratio of 96 wt.%Al-2 wt.%Mg-2 wt.%Cu, has been prepared by mechanical alloying and press-forming. The alloy exhibited a high tensile strength of 780 MPa and a high microhardness of 180 HV. X-ray diffraction characterizations confirmed that the alloy only consists of a solid solution {alpha}-Al. Microstructure characterizations revealed that the grain size of {alpha}-Al was about 300 nm-5 {mu}m. The solid solution strengthening and the grain refinement strengthening were considered to be the reason for such a high strength.
Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas
International Nuclear Information System (INIS)
Maruyama, J.; Beach, J.L.; Nagell, J.R. van
1984-01-01
Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de
A pneumatic transfer system for special form 252Cf
International Nuclear Information System (INIS)
Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.
1996-09-01
A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole
Neutron shielding for a {sup 252} Cf source
Energy Technology Data Exchange (ETDEWEB)
Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail: fermineutron@yahoo.com
2006-07-01
To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)
Trivedi, Shefali; Ravi Kumar, D.; Aravindan, S.
2016-10-01
Phosphorus in steel is known to increase strength and hardness and decrease ductility. Higher phosphorus content (more than 0.05%), however, promotes brittle behavior due to segregation of Fe3P along the grain boundaries which makes further mechanical working of these alloys difficult. In this work, thin sheets of Fe-P alloys (with phosphorus in range of 0.1-0.35%) have been developed through processing by powder metallurgy followed by hot rolling and cold rolling. The effect of phosphorus content and annealing parameters (temperature and time) on microstructure, mechanical properties, formability in biaxial stretching and fracture behavior of the cold rolled and annealed sheets has been studied. A comparison has also been made between the properties of the sheets made through P/M route and the conventional cast route with similar phosphorus content. It has been shown that thin sheets of Fe-P alloys with phosphorous up to 0.35% possessing a good combination of strength and formability can be produced through rolling of billets of these alloys made through powder metallurgy technique without the problem of segregation.
International Nuclear Information System (INIS)
Jayaraj, J.; Ningshen, S.; Mallika, C.; Kamachi Mudali, U.
2016-01-01
Aqueous reprocessing of plutonium-rich mixed oxide fuels require fluoride as a catalyst in boiling nitric acid for an effective dissolution of the spent fuel. The corrosion behavior of the candidate dissolver materials zircaloy-4 (Zr-4) and commercial pure titanium (CP-Ti grade 2) in boiling 11.5 M HNO 3 + 0.05 M NaF has been established. High corrosion rates were obtained for Zr- 4 and CP-Ti in nitric acid containing fluoride ions. Complexing the fluoride ions either with Al(NO 3 ) 3 or ZrO(NO 3 ) 2 aided in decreasing the corrosion rates of Zr-4 and CP-Ti. High corrosion resistance is claimed as one of the principal property of the amorphous alloy when compared to the crystalline alloy. Thus Ni 60 Nb 40 and Ni 60 Nb 30 Ta 10 amorphous ribbons were prepared and exposed in boiling 11.5 M HNO 3 and 11.5 M HNO 3 + 0.05 M NaF. In nitric acid these alloys did not show any sign of corrosion attack. XPS analysis confirmed that the passivity was due to the formation passive films of thickness ≈3 nm enriched with Nb 2 O 5 and of ≈1.5 nm enriched with both Nb 2 O 5 and Ta 2 O 5 on the respective surfaces of the ribbons. In boiling 11.5 M HNO 3 + 0.05 M NaF, severe corrosion attack was observed on Ni 60 Nb 40 ribbon, due to the instability of the oxide/metal interface. The Ni 60 Nb 30 Ta 10 amorphous ribbon exhibited corrosion resistance of at least an order of magnitude higher than that for Ni 60 Nb 40 ribbon
Guan, Ren-guo; Cipriano, Aaron F; Zhao, Zhan-yong; Lock, Jaclyn; Tie, Di; Zhao, Tong; Cui, Tong; Liu, Huinan
2013-10-01
A new biodegradable magnesium-zinc-strontium (Mg-Zn-Sr) alloy was developed and studied for medical implant applications. This first study investigated the alloy processing (casting, rolling, and heat treatment), microstructures, mechanical properties, and degradation properties in simulated body fluid (SBF). Aging treatment of the ZSr41 alloy at 175 °C for 8h improved the mechanical properties when compared to those of the as-cast alloy. Specifically, the aged ZSr41 alloy had an ultimate tensile strength of 270 MPa, Vickers hardness of 71.5 HV, and elongation at failure of 12.8%. The mechanical properties of the ZSr41 alloy were superior as compared with those of pure magnesium and met the requirements for load-bearing medical implants. Furthermore, the immersion of the ZSr41 alloy in SBF showed a degradation mode that progressed cyclically, alternating between pitting and localized corrosion. The steady-state average degradation rate of the aged ZSr41 alloy in SBF was 0.96 g/(m(2)·hr), while the pH of SBF immersion solution increased. The corrosion current density of the ZSr41 alloy in SBF solution was 0.41 mA/mm(2), which was much lower than 1.67 mA/mm(2) for pure Mg under the same conditions. In summary, compared to pure Mg, the mechanical properties of the new ZSr41 alloy improved while the degradation rate decreased due to the addition of Zn and Sr alloying elements and specific processing conditions. The superior mechanical properties and corrosion resistance of the new ZSr41 alloy make it a promising alloy for next-generation implant applications. Copyright © 2013 Elsevier B.V. All rights reserved.
24 CFR 252.2 - GNMA right to assignment.
2010-04-01
... COINSURANCE OF MORTGAGES COVERING NURSING HOMES, INTERMEDIATE CARE FACILITIES, AND BOARD AND CARE HOMES § 252... section, in order to allow an appropriate endorsement and necessary changes in the Commissioner's records...
A new type-B cask design for transporting 252Cf
International Nuclear Information System (INIS)
Simmons, C.M.
2000-01-01
A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask
Determination of the average number of neutrons per fission event for californium-252
International Nuclear Information System (INIS)
Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.
1982-01-01
By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)
Effect of cold work and processing orientation on the SCC behavior of Alloy 600
International Nuclear Information System (INIS)
Moshier, W.C.; Brown, C.M.
1999-01-01
Cold work accelerates SCC growth rates in Alloy 600. However, the variation in crack growth rates generated from cold worker material has been significant, and the effect has been difficult to quantify. A study was performed in hydrogenated water adjusted to pH 10.2 to systematically evaluate the effect of cold work on Alloy 600 as a function of temperature, amount of cold work, stress intensity factor, and processing orientation. Cold work was introduced into the material by either tensile prestraining or cold rolling plate product. Crack growth rates were determined between 252 and 360 C, stress intensity factors between 21 and 55 MPa√m, and yield strengths between 201 and 827 MPa. The material with the highest yield strength was cold rolled and tested in the longitudinal-transverse (LT) and short-transverse (ST) orientations. Crack growth rates increased with increasing temperature, stress intensity factor, and yield strength. Furthermore, crack growth rates were a strong function of the processing orientation in the cold rolled plate, with growth rates being approximately an order of magnitude greater in the ST orientation compared to the LT orientation. Crack growth rates in the LT orientation were measured between 0.003 and 1.95 x 10 -9 m/s and between 0.066 and 6.3 x 10 -9 m/s in the ST orientation. Activation energies were slightly greater in the ST orientation, ranging from 154 to 191 kcal/mole, compared to activation energies between 126 and 157 kJ/mole in the LT orientation. The results of this study demonstrate that although cold work can be used to accelerate SCC, the orientation of crack growth can significantly affect the results, and must be taken into account when analyzing data from cold worked material
Undergraduate experiments using the neutron radiation from californium-252
International Nuclear Information System (INIS)
Rossel, J.; Golecki, I.
1976-01-01
Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)
The stress-corrosion cracking behavior of high-strength aluminum powder metallurgy alloys
Pickens, J. R.; Christodoulou, L.
1987-01-01
The susceptibility to stress-corrosion cracking (SCC) of rapidly solidified (RS) aluminum powder metallurgy (P/M) alloys 7090 and 7091, mechanically alloyed aluminum P/M alloy IN* 9052, and ingot metallurgy (I/M) alloys of similar compositions was compared using bolt-loaded double cantilever beam specimens. In addition, the effects of aging, grain size, grain boundary segregation, pre-exposure embrittlement, and loading mode on the SCC of 7091 were independently assessed. Finally, the data generated were used to elucidate the mechanisms of SCC in the three P/M alloys. The IN 9052 had the lowest SCC susceptibility of all alloys tested in the peak-strength condition, although no SCC was observed in the two RS alloys in the overaged condition. The susceptibility of the RS alloys was greater in the underaged than the peak-aged temper. We detected no significant differences in susceptibility of 7091 with grain sizes varying from 2 to 300 μm. Most of the crack advance during SCC of 7091 was by hydrogen embrittlement (HE). Furthermore, both RS alloys were found to be susceptible to preexposure embrittlement—also indicative of HE. The P/M alloys were less susceptible to SCC than the I/M alloys in all but one test.
Phenotype abnormality: 252 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available lant flowering stage in environment of short day length regimen in environment of short day length regimen h... 252 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u758i delayed whole p
48 CFR 252.225-7016 - Restriction on acquisition of ball and roller bearings.
2010-10-01
... of ball and roller bearings. 252.225-7016 Section 252.225-7016 Federal Acquisition Regulations System... and roller bearings. As prescribed in 225.7009-5, use the following clause: Restriction on Acquisition of Ball and Roller Bearings (MAR 2006) (a) Definitions. As used in this clause' (1) Bearing...
48 CFR 252.227-7027 - Deferred ordering of technical data or computer software.
2010-10-01
... technical data or computer software. 252.227-7027 Section 252.227-7027 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(b), use the following clause: Deferred Ordering of Technical Data or Computer Software (APR 1988) In addition to technical data or computer software...
48 CFR 252.227-7026 - Deferred delivery of technical data or computer software.
2010-10-01
... technical data or computer software. 252.227-7026 Section 252.227-7026 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(a), use the following clause: Deferred Delivery of Technical Data or Computer Software (APR 1988) The Government shall have the right to require, at...
International Nuclear Information System (INIS)
Junqueira, Astrogildo de Carvalho
1999-01-01
The electric field gradient (efg) at the Nb site in the intermetallic compounds Nb 3 M (M = Al, Si, Ge, Sn) and at the T site in the intermetallic compounds T 3 Al (T = Ti, Zr, Hf, V, Nb, Ta) was measured by Perturbed Angular Correlation (PAC) method using the well known gamma-gamma cascade of 133-482 keV in 181 Ta from the β - decay of 181 Hf. The compounds were prepared by arc melting the constituent elements under argon atmosphere along with radioactive 181 Hf substituting approximately 0.1 atomic percent of Nb and T elements. The PAC measurements were carried out at 295 K for all compounds and the efg was obtained for each alloy. The results for the efg in the T 3 Al compounds showed a strong correlation with the number of conduction electrons, while for the Nbs M compounds the efg behavior is influenced mainly by the p electrons of the M elements. The so-called universal correlation between the electronic and lattice contribution for the efg in metals was not verified in this work for all studied compounds. Measurements of the quadrupole frequency in the range of 100 to 1210 K for the Nb 3 Al compound showed a linear behaviour with the temperature. Superconducting properties of this alloys may probably be related with this observed behaviour. The efg results are compared to those reported for other binary alloys and discussed with the help of ab-initio methods. (author)
Advanced processing of high temperature P/M copper alloy for aerospace applications
International Nuclear Information System (INIS)
Raman, R.V.; Rele, S.V.; Lasley, C.C.; Krotz, P.D.
1991-01-01
Copper Alloy 1035 is a rapidly solidified Cu-Cr-Zr alloy developed by Pratt and Whitney, which exhibits good elevated temperature strength and thermal conductivity. RSR Alloy 1035 powder has been consolidated utilizing the patented Ceracon Process. The Ceracon Process is a quasi-isostatic, hot consolidation technique which utilizes a proprietary particulate material as a pressure transmitting medium in place of a gas media as used in HIPping. Measured mechanical properties to 1200 F are compared to materials consolidated via vacuum plasma spraying (VPS), or VPS + HIPping processes. Advantages and disadvantages of these processing techniques are compared. Porosity and microstructural features are also evaluated
International Nuclear Information System (INIS)
Lamaze, G.P.; Schima, F.J.; Eisenhauer, C.M.; Spiegel, V.
1988-01-01
Because of the similarity in energy dependence of the /sup 103/Rh(n,n') differential cross section to the kerma muscle response function for neutrons, rhodium may be useful as a neutron kerma monitor. In support of its use as a neutron monitor, the spectrum-averaged cross section σ-bar has been measured for a /sup 252/Cf fission neutron spectrum. Pairs of thin rhodium samples were irradiated on opposite sides of a thinly encapsulated /sup 252/Cf neutron source. The neutron emission rate of the /sup 252/Cf source was determined by the manganous sulfate (MnSO/sub 4/) bath technique. In this method, the californium source emission rate is determined by comparison to the known emission rate of NBS-I, a standard radium-beryllium neutron source. The neutron fluence incident on the rhodium samples is determined from the californium source strength, average sample-to-source distance, and the duration of the irradiation. Corrections are made for neutron scattering saturation of activity, and attenuation of the X rays by the sample during counting. The X rays were detected with an intrinsic germanium detector designed specifically for low-energy X-ray detection. The activity was not determined by absolute counting so that the final results depend on the value of P/sub Κx/, to total Κ X-ray emission probability. The results of five separate irradiations yield a value of σ-bar . P/sub Κx/ = 62.3 +- 1.9 mb. Using the most recently published value of P/sub Κx/ gives a value of σ-bar = 739 +- 22 mb. A discussion of systematic uncertainties is given
48 CFR 252.247-7017 - Erroneous shipments.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Erroneous shipments. 252... SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of..., articles of personal property inadvertently packed with goods of other than the rightful owner. (2) Ensure...
Effects of Al-Mn-Ti-P-Cu master alloy on microstructure and properties of Al-25Si alloy
Directory of Open Access Journals (Sweden)
Xu Chunxiang
2013-09-01
Full Text Available To obtain a higher microstructural refining efficiency, and improve the properties and processing ability of hypereutectic Al-25Si alloy, a new environmentally friendly Al-20.6Mn-12Ti-0.9P-6.1Cu (by wt.% master alloy was fabricated; and its modification and strengthening mechanisms on the Al-25Si alloy were studied. The mechanical properties of the unmodified, modified and heat treated alloys were investigated. Results show that the optimal addition amount of the Al-20.6Mn-12Ti-0.9P-6.1Cu master alloy is 4wt.%. In this case, primary Si and eutectic Si as well as メ-Al phase were clearly refined, and this refining effect shows an excellent long residual action as it can be heat-retained for at least 5 h. After being T6 heat treated, the morphology of primary and eutectic Si in the Al-25Si alloys with the addition of 4wt.% Al-20.6Mn-12Ti-0.9P-6.1Cu alloy changes into particles and short rods. The average grain size of the primary and eutectic Si decreases from 250 レm (unmodified to 13.83 レm and 35 レm (unmodified to 7 レm; the メ-Al becomes obviously finer and the distribution of Si phases tends to be uniform and dispersed. Meanwhile, the tensile properties are improved obviously; the tensile strengths at room temperature and 300 ìC reach 241 MPa and 127 MPa, increased by 153.7% and 67.1%, respectively. In addition, the tensile fracture mechanism changes from brittle fracture for the alloy without modification to ductile fracture after modification. Modifying the morphology of Si phase and strengthening the matrix can effectively block the initiation and propagation of cracks, thus improving the strength of the hypereutectic Al-25Si alloy.
48 CFR 252.229-7004 - Status of contractors as a direct contractor (Spain).
2010-10-01
... direct contractor (Spain). 252.229-7004 Section 252.229-7004 Federal Acquisition Regulations System... contractor (Spain). As prescribed in 229.402-70(d), use the following clause: Status of Contractor as a Director Contractor (Spain) (JUN 1997) (a) “Direct Contractor,” as used in this clause, means an individual...
International Nuclear Information System (INIS)
Guan, Ren-guo; Cipriano, Aaron F.; Zhao, Zhan-yong; Lock, Jaclyn; Tie, Di; Zhao, Tong; Cui, Tong; Liu, Huinan
2013-01-01
A new biodegradable magnesium–zinc–strontium (Mg–Zn–Sr) alloy was developed and studied for medical implant applications. This first study investigated the alloy processing (casting, rolling, and heat treatment), microstructures, mechanical properties, and degradation properties in simulated body fluid (SBF). Aging treatment of the ZSr41 alloy at 175 °C for 8 h improved the mechanical properties when compared to those of the as-cast alloy. Specifically, the aged ZSr41 alloy had an ultimate tensile strength of 270 MPa, Vickers hardness of 71.5 HV, and elongation at failure of 12.8%. The mechanical properties of the ZSr41 alloy were superior as compared with those of pure magnesium and met the requirements for load-bearing medical implants. Furthermore, the immersion of the ZSr41 alloy in SBF showed a degradation mode that progressed cyclically, alternating between pitting and localized corrosion. The steady-state average degradation rate of the aged ZSr41 alloy in SBF was 0.96 g/(m 2 ·hr), while the pH of SBF immersion solution increased. The corrosion current density of the ZSr41 alloy in SBF solution was 0.41 mA/mm 2 , which was much lower than 1.67 mA/mm 2 for pure Mg under the same conditions. In summary, compared to pure Mg, the mechanical properties of the new ZSr41 alloy improved while the degradation rate decreased due to the addition of Zn and Sr alloying elements and specific processing conditions. The superior mechanical properties and corrosion resistance of the new ZSr41 alloy make it a promising alloy for next-generation implant applications. - Highlights: • Developed a new biodegradable magnesium–zinc–strontium (Mg–Zn–Sr) alloy for medical implant applications • Reported Mg–Zn–Sr alloy processing and microstructure characterization • Improved mechanical properties of Mg alloy after aging treatment • Improved degradation properties of Mg alloy in simulated body fluid
United modification of Al-24Si alloy by Al-P and Al-Ti-C master alloys
Institute of Scientific and Technical Information of China (English)
韩延峰; 刘相法; 王海梅; 王振卿; 边秀房; 张均艳
2003-01-01
The modification effect of a new type of Al-P master alloy on Al-24Si alloys was investigated. It is foundthat excellent modification effect can be obtained by the addition of this new type of A1-P master alloy into Al-24Simelt and the average primary Si grain size is decreased below 47 μm from original 225 μm. It is also found that theTiC particles in the melt coming from Al8Ti2C can improve the modification effect of the Al-P master alloy. Whenthe content of TiC particles in the Al-24Si melt is 0.03 %, the improvement reaches the maximum and keeps steadywith increasing content of TiC particles. Modification effect occurs at 50 min after the addition of the Al-P master al-loy and TiC particles, and keeps stable with prolonging holding time.
International Nuclear Information System (INIS)
Garcia C, M.A.; Fernandez V, S.M.; Vargas G, J.R.
2007-01-01
Metallic powders of Pt, Co and Nickel were processed by mechanical alloyed and electrocatalysts were synthesized for the oxygen reduction reaction, applicable in fuel cells. The structural and morphological characterization was carried out using X-ray Diffraction, scanning electron microscopy and transmission electron microscopy. It was found that the alloyed powders formed agglomerates that consist of crystalline particles of nano metric size. Its were obtained polarization curves by the Electrode of Rotational Disk technique in a solution of H 2 SO 4 0.5 M, used as electrolyte, to evaluate the electrocatalytic activity of mechanically alloyed powders. Tafel graphics were built to determine the kinetic parameters of each electro catalyst. The PtCoNi alloy exhibited the biggest electrocatalytic activity, with the smallest over potential for the oxygen reduction reaction. (Author)
Long-term effects of an intracavitary treatment with californium-252 on normal tissue
International Nuclear Information System (INIS)
Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.
1976-01-01
About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252 Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252 Cf and 7000 rad from 226 Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252 Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252 Cf and 5000 rad from 226 Ra
Directory of Open Access Journals (Sweden)
Dongmei Li
2017-08-01
Full Text Available Cu-Ni-Si alloys are widely used due to their good electrical conductivities in combination with high strength and hardness. In the present work, minor-alloying with M = (Cr, Fe, Mo, Zr was conducted for the objective of further improving their hardness while maintaining their conductivity level. A cluster-plus-glue-atom model was introduced to design the compositions of M-alloyed Cu-Ni-Si alloys, in which an ideal composition formula [(Ni,Si,M-Cu12]Cu3 (molar proportion was proposed. To guarantee the complete precipitation of solute elements in fine δ-Ni2Si precipitates, the atomic ratio of (Ni,M/Si was set as 2/1. Thus the designed alloy series of Cu93.75(Ni/Zr3.75Si2.08(Cr/Fe/Mo0.42 (at% were arc-melted into ingots under argon atmosphere, and solid-solutioned at 950 °C for 1 h plus water quenching and then aged at 450 °C for different hours. The experimental results showed that these designed alloys exhibit high hardness (HV > 1.7 GPa and good electrical conductivities (≥ 35% IACS. Specifically, the quinary Cu93.75Ni3.54Si2.08(Cr/Fe0.42Zr0.21 alloys (Cu-3.32Ni-0.93Si-0.37(Cr/Fe−0.30Zr wt% possess both a high hardness with HV = 2.5–2.7 GPa, comparable to the high-strength KLFA85 alloy (Cu-3.2Ni-0.7Si-1.1Zn wt%, HV = 2.548 GPa, and a good electrical conductivity (35–36% IACS.
48 CFR 252.237-7017 - Individual laundry.
2010-10-01
... clause: Individual Laundry (DEC 1991) (a) The Contractor shall provide laundry service under this... services. (c) Charges for individual laundry will be on a per unit bundle or a piece-rate basis. The... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Individual laundry. 252...
Electron beam and laser surface alloying of Al-Si base alloys
International Nuclear Information System (INIS)
Vanhille, P.; Tosto, S.; Pelletier, J.M.; Issa, A.; Vannes, A.B.; Criqui, B.
1992-01-01
Surface alloying on aluminium-base alloys is achieved either by using an electron beam or a laser beam, in order to improve the mechanical properties of the near-surface region. A predeposit of nickel is first realized by plasma spraying. Melting of both the coating and part of the substrate produces a surface alloy with a fine, dendritic microstructure with a high hardness. Enhancement of this property requires an increase in the nickel content. Various problems occur during the formation of nickel-rich surface layers: incomplete homogenization owing to a progressive increase of the liquidus temperature, cracks owing to the brittleness of this hard suface alloy, formation of a plasma when experiments are carried out in a gaseous environment (laser surface alloying). Nevertheless, various kinds of surface layers may be achieved; for example very hard surface alloys (HV 0.2 =900), with a thickness of about 500-600 μm, or very thick surface alloys (e>2 mm), with a fairly good hardness (greater than 350 HV 0.2 ). Thus, it is possible to obtain a large variety of new materials by using high energy beams on aluminium substrates. (orig.)
Electron dominated thermoelectric response in MNiSn (M: Ti, Zr, Hf) half-Heusler alloys
Gandi, Appala
2016-05-09
We solve the transport equations of the electrons and phonons to understand the thermoelectric behaviour of the technologically important half-Heusler alloys MNiSn (M: Ti, Zr, Hf). Doping is simulated within the rigid band approximation. We clarify the origin of the electron dominated thermoelectric response and determine the carrier concentrations with maximal figures of merit. The phonon mean free path is studied to calculate the grain size below which grain refinement methods can enforce ballistic heat conduction to enhance the figure of merit. © The Owner Societies 2016.
Electron dominated thermoelectric response in MNiSn (M: Ti, Zr, Hf) half-Heusler alloys
Gandi, Appala; Schwingenschlö gl, Udo
2016-01-01
We solve the transport equations of the electrons and phonons to understand the thermoelectric behaviour of the technologically important half-Heusler alloys MNiSn (M: Ti, Zr, Hf). Doping is simulated within the rigid band approximation. We clarify the origin of the electron dominated thermoelectric response and determine the carrier concentrations with maximal figures of merit. The phonon mean free path is studied to calculate the grain size below which grain refinement methods can enforce ballistic heat conduction to enhance the figure of merit. © The Owner Societies 2016.
High-alloy steels and nickel alloys for construction of industrial plants. Pt. 2
International Nuclear Information System (INIS)
2007-01-01
Vol. 2 of the 8. Dresden Corrosion Protection Seminar comprises eight papers, most of which are in the form of PowerPoint presentations: High-temperature materials and their applications in chemical engineering (J. Kloever); Alloy 602 CA in metal dusting conditions; Material requirements in future power plants (H. Schneider); Status report on material qualification for the 700 C technology in coal power plants (R. Mohrmann); Materials for nuclear fusion (M. Paju); The degradation mechanism relaxation cracking as exemplified by the alloys 800 H and 617 (H.C. van Wortel); Specific requirements on the design of a pressurised manifold of Alloy 800 H in refineries, a case study (I. Rommerskirchen et al.); Materials for electro-surfacing for corrosion protection in conditions of high-temperature corrosion (M.Spiegel) [de
Californium Cf-252 for pelvic radiotherapy
Energy Technology Data Exchange (ETDEWEB)
Maruyama, Y; Feola, J M; Tai, D; Wilson, L C; Van Nagell, J R; Yoneda, J
1978-01-01
Clinical data about therapy concerning tumors of the female gynecological cancers of the cervix, vagina and uterus are reviewed. Dosimetric, laboratory and radiobiological research data form the basis for an approach to such tumors using Cf-252 as a form of boost brachytherapy. Extreme personnel hazards are a real and important consideration and indicate that maximal containment and isolation procedures should be exercised in its use.
Contieri, R. J.; Lopes, E. S. N.; Taquire de La Cruz, M.; Costa, A. M.; Afonso, C. R. M.; Caram, R.
2011-10-01
The performance of Ti alloys can be considerably enhanced by combining Ti and other elements, causing an eutectic transformation and thereby producing composites in situ from the liquid phase. This paper reports on the processing and characterization of a directionally solidified Ti-Fe eutectic alloy. Directional solidification at different growth rates was carried out in a setup that employs a water-cooled copper crucible combined with a voltaic electric arc moving through the sample. The results obtained show that a regular fiber-like eutectic structure was produced and the interphase spacing was found to be a function of the growth rate. Mechanical properties were measured using compression, microindentation and nanoindentation tests to determine the Vickers hardness, compressive strength and elastic modulus. Directionally solidified eutectic samples presented high values of compressive strength in the range of 1844-3000 MPa and ductility between 21.6 and 25.2%.
48 CFR 252.225-7045 - Balance of Payments Program-Construction Material Under Trade Agreements.
2010-10-01
.... Designated country means— (1) A World Trade Organization Government Procurement Agreement (WTO GPA) country... another country, has been substantially transformed in a Free Trade Agreement country into a new and... Program-Construction Material Under Trade Agreements. 252.225-7045 Section 252.225-7045 Federal...
46 CFR 252.40 - Payment of subsidy.
2010-10-01
... Payment and Billing Procedures § 252.40 Payment of subsidy. (a) Submission of voucher. At the close of each calendar month, the subsidized operator may submit a voucher, and include for payment in such... submit an initial voucher and include for payment in such voucher a percentage of the ODS payable for the...
48 CFR 252.227-7005 - License term.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term. 252.227-7005..., DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And... referred to in the “License Grant” clause of this contract and any and all patents hereafter issued on...
48 CFR 252.225-7023 - Preference for products or services from Iraq or Afghanistan.
2010-10-01
... services from Iraq or Afghanistan. 252.225-7023 Section 252.225-7023 Federal Acquisition Regulations System... from Iraq or Afghanistan. As prescribed in 225.7703-5(a), use the following provision: Requirement for Products or Services from Iraq or Afghanistan (APR 2010) (a) Definitions. Product from Iraq or Afghanistan...
Effect of diluted alloying elements on mechanical properties of iron
International Nuclear Information System (INIS)
Hassan, A.A.S.
1996-01-01
Iron and its alloys have extensive applications. The effect of solute additions on mechanical properties of iron was investigated to check the efficiency of solute atoms on strength and surface e life. Additions in the range of 0.1 wt.% and 0.3 wt.% of alloying elements of Cu,Ni and Si were used. Samples of grains size ranged from 6-40 m which have been prepared by annealing followed by furnace cooling. The recrystallization temperature increases with alloying addition (475 degree C for Fe-0.3 wt. % C alloy compared to 375 degree C for pure iron). Si and Cu additions inhibit grain growth of iron whereas Ni addition enhances it.Addition of Si or Ni to iron induced softening below room temperature whereas addition of Cu caused hardening. The work hardening parameters decreased due to alloying additions. The strength coefficient K was 290 M N/m2 for Fe-03 wt % Ni compared to 340 M N/m2 for pure iron. The work hardening exponent n is 0.12 for fe-0.3 wt. Cu alloy compared to 0.17 for pure iron. All the investigated alloys fulfilled the Hall-Petch relation at liquid Nitrogen and at room temperature. Alloying addition which caused softening addition which caused hardening increased the Half-Petch parameters. Ni addition favors ductility of iron whereas Cu addition reduces it. Alloying additions generally lead to brittle fracture and decrease the crack resistance of iron. 9 tabs., 55 figs., 103 refs
48 CFR 252.225-7020 - Trade Agreements Certificate.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade Agreements... of Provisions And Clauses 252.225-7020 Trade Agreements Certificate. As prescribed in 225.1101(5), use the following provision: Trade Agreements Certificate (JAN 2005) (a) Definitions. Designated...
Electrochemical corrosion behavior of AZ91D alloy in ethylene glycol
International Nuclear Information System (INIS)
Fekry, A.M.; Fatayerji, M.Z.
2009-01-01
The effect of concentration on the corrosion behavior of Mg-based alloy AZ91D was investigated in ethylene glycol-water solutions using electrochemical techniques i.e. potentiodynamic polarization, electrochemical impedance measurements (EIS) and surface examination via scanning electron microscope (SEM) technique. This can provide a basis for developing new coolants for magnesium alloy engine blocks. Corrosion behavior of AZ91D alloy by coolant is important in the automotive industry. It was found that the corrosion rate of AZ91D alloy decreased with increasing concentration of ethylene glycol. For AZ91D alloy in chloride >0.05 M or fluoride 0.05 M for fluoride containing ethylene glycol solution, some inhibition effect has been observed. The corrosion of AZ91D alloy in the blank can be effectively inhibited by addition of 0.05 mM paracetamol that reacts with AZ91D alloy and forms a protective film on the surface at this concentration as confirmed by surface examination.
International Nuclear Information System (INIS)
Lee, Jae Hun
1993-02-01
In order to compare the effect of senitization on the intergranular stress corrosion cracking(IGSCC) between Alloy 600 and Alloy 690, these alloys have been sensitized for 1 to 100 hours at 700 .deg. C. The degree of sensitization(DOS) has evaluated by the ratio of Ir(the maximum current density at anodic scan) to Ia(the maximum current density at reverse scan) in the modified double loop EPR(electrochemical potentiokinetic reactivation) test in 0.01M H 2 SO 4 + 0.0001M KSCN at 25 .deg. C and at scan rate of 0.5mV/sec. The susceptibility to IGSCC has been measured in 0.01M Na 2 S 4 O 6 solution using CERT(constant extension rate tester) at strain rate of 1.0 x 10 -6 S -1 . With increasing sensitization time the DOS of Alloy 600 increases to the maximum value at 5 hours and decreases gradually due to the replenishment of Cr to the Cr-depleted grain boundaries. For Alloy 600 samples except those sensitized for less than 1 hour, the DOS measured by the modified EPR test parallel to susceptibility to IGSCC revealed by the ratio of strain to failure (εf, Na 2 S 4 O 6 /εf, Air). It appears that the susceptibility to IGSCC is closely associated with the depth in Cr-depleted concentration profile across grain boundary. For the sensitized Alloy 690 samples exhibited extremely low value of Ir/Ia less than 0.074% and also were immune to IGSCC. The good resistance of Alloy 690 to IGSCC is considered to be attributed to the higher Cr concentration to avoid serious Cr-depletion problems adjacent to grain boundary
International Nuclear Information System (INIS)
Zaborowski, H.L.
1976-10-01
The project 252 Cf-D 2 O is articulated upon the utilization of a 200μg nominal 252 Cf spontaneous neutron fission source, used bare and under D 2 O spherical moderators, giving leakage neutron spectra experimentally known and/or calculated. This project has for objective the applications of those sources to Health Physics, in dosimetry (calibration of ''rad'' and ''rem-meters'') and in spectrometry, associated with the experimental system of measurements made by the generalization of the BONNER Spheres, known as ''the Multisphere System''. This communication describes the normalization method used and the results obtained leading to the adoption of a reference matrix called ''the Log-Normal Multisphere Matrix'' (LN-MM) giving the energies response functions of the generalized system for all the spheres diameters between 40 and 400 millimeters and for all the energies between 0.4eV and 15MeV [fr
48 CFR 252.225-7024 - Requirement for products or services from Iraq or Afghanistan.
2010-10-01
... or services from Iraq or Afghanistan. 252.225-7024 Section 252.225-7024 Federal Acquisition... products or services from Iraq or Afghanistan. As prescribed in 225.7703-5(b), use the following clause: Requirement for Products or Services From Iraq or Afghanistan (SEP 2008) (a) Definitions. As used in this...
48 CFR 252.235-7001 - Indemnification under 10 U.S.C. 2354-cost reimbursement.
2010-10-01
....S.C. 2354-cost reimbursement. 252.235-7001 Section 252.235-7001 Federal Acquisition Regulations.... 2354—cost reimbursement. As prescribed in 235.070-3, use the following clause: Indemnification Under 10 U.S.C. 2354—Cost Reimbursement (DEC 1991) (a) This clause provides for indemnification under 10 U.S...
30 CFR 250.252 - What environmental monitoring information must accompany the DPP or DOCD?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What environmental monitoring information must accompany the DPP or DOCD? 250.252 Section 250.252 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... incidental take of marine mammals as may be necessary under the MMPA. (c) Flower Garden Banks National Marine...
De-Lubrication Behavior Of Novel EBS Based Admixed Lubricant In Aluminum P/M Alloy
Directory of Open Access Journals (Sweden)
Oh M.C.
2015-06-01
Full Text Available The objective of the present research is to develop a novel lubricant for Al-Cu-Mg P/M alloy and to address the effects of the lubricant and compaction pressure on sintered properties. A lubricant mixture consisting of Ethylene Bis Stearamide, Zn-Stearate, and fatty acid was newly developed in this study, and the de-lubrication behavior was compared with that of other commercial lubricants, such as Ethylene Bis Stearamide, Zn-Stearate, and Al-Stearate. Density and transverse rupture strength of sintered materials with each lubricant were examined, respectively. The microstructural analysis was conducted using optical microscope.
Potentiodynamic polarization study of the corrosion behavior of palladium-silver dental alloys.
Sun, Desheng; Brantley, William A; Frankel, Gerald S; Heshmati, Reza H; Johnston, William M
2018-04-01
Although palladium-silver alloys have been marketed for over 3 decades for metal-ceramic restorations, understanding of the corrosion behavior of current alloys is incomplete; this understanding is critical for evaluating biocompatibility and clinical performance. The purpose of this in vitro study was to characterize the corrosion behavior of 3 representative Pd-Ag alloys in simulated body fluid and oral environments and to compare them with a high-noble Au-Pd alloy. The study obtained values of important electrochemical corrosion parameters, with clinical relevance, for the rational selection of casting alloys. The room temperature in vitro corrosion characteristics of the 3 Pd-Ag alloys and the high-noble Au-Pd alloy were evaluated in 0.9% NaCl, 0.09% NaCl, and Fusayama solutions. After simulated porcelain firing heat treatment, 5 specimens of each alloy were immersed in the electrolytes for 24 hours. For each specimen, the open-circuit potential (OCP) was first recorded, and linear polarization was then performed from -20 mV to +20 mV (versus OCP) at a rate of 0.125 mV/s. Cyclic polarization was subsequently performed on 3 specimens of each alloy from -300 mV to +1000 mV and back to -300 mV (versus OCP) at a scanning rate of 1 mV/s. The differences in OCP and corrosion resistance parameters (zero-current potential and polarization resistance) among alloys and electrolyte combinations were compared with the 2-factor ANOVA (maximum-likelihood method) with post hoc Tukey adjustments (α=.05). The 24-hour OCPs and polarization resistance values of the 3 Pd-Ag alloys and the Au-Pd alloy were not significantly different (P=.233 and P=.211, respectively) for the same electrolyte, but significant differences were found for corrosion test results in different electrolytes (Palloy and electrolyte (P=.249 and P=.713, respectively). The 3 Pd-Ag silver alloys appeared to be resistant to chloride ion corrosion, and passivation and de-alloying were identified for these
50 CFR 216.252 - Permissible methods of taking.
2010-10-01
... ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking Marine Mammals Incidental to Conducting Precision Strike Weapon Missions in the Gulf of Mexico § 216.252 Permissible methods of taking. (a) Under Letters of Authorization issued pursuant to...
International Nuclear Information System (INIS)
Kaszuwara, W.
2004-01-01
Shape memory alloys (SMA), when deformed, have the ability of returning, in certain circumstances, to their initial shape. Deformations related to this phenomenon are for polycrystals 1-8% and up to 15% for monocrystals. The deformation energy is in the range of 10 6 - 10 7 J/m 3 . The deformation is caused by martensitic transformation in the material. Shape memory alloys exhibit one directional or two directional shape memory effect as well as pseudoelastic effect. Shape change is activated by temperature change, which limits working frequency of SMA to 10 2 Hz. Other group of alloys exhibit magnetic shape memory effect. In these alloys martensitic transformation is triggered by magnetic field, thus their working frequency can be higher. Composites containing shape memory alloys can also be used as shape memory materials (applied in vibration damping devices). Another group of composite materials is called heterostructures, in which SMA alloys are incorporated in a form of thin layers The heterostructures can be used as microactuators in microelectromechanical systems (MEMS). Basic SMA comprise: Ni-Ti, Cu (Cu-Zn,Cu-Al, Cu-Sn) and Fe (Fe-Mn, Fe-Cr-Ni) alloys. Shape memory alloys find applications in such areas: automatics, safety and medical devices and many domestic appliances. Currently the most important appears to be research on magnetic shape memory materials and high temperature SMA. Vital from application point of view are composite materials especially those containing several intelligent materials. (author)
Stress-corrosion behavior of aluminum-lithium alloys in aqueous environments
Pizzo, P. P.; Galvin, R. P.; Nelson, H. G.
1983-01-01
The stress corrosion susceptibility of two powder metallurgy (P/M) alloys, Al-Li-Cu and Al-Li-Cu-Mg two mechanically attrited (M/A) alloys, Al-Li-Cu and Al-Li-Mg; and two wrought, ingot alloys, X-2020 and AA7475, are compared. Time-dependent fracture in an aqueous sodium chloride environment under alternate immersion condition was found to vary significantly between alloys. The stress corrosion behavior of the two powder metallurgy processed alloys was studied in detail under conditions of crack initiation, static crack growth, and fatigue crack growth. A variety of stress corrosion tests were performed including smooth surface, time-to-failure tests; potentiostatic tests on smooth surfaces exposed to constant applied strain rates; and fracture mechanics-type tests under static and cyclic loads. Both alloys show surface pitting and subsequent intergranular corrosion. Pitting is more severe in the magnesium-bearing alloy and is associated with stringer particles strung along the extrusion direction as a result of P/M processing.
Coupling between bulk ordering and surface segregation: from alloy surfaces to surface alloys
International Nuclear Information System (INIS)
Gallis, Coralie
1997-01-01
-The knowledge of the alloy surfaces is of prime interest to understand their catalytic properties. On the one hand, the determination of the stability of the surface alloys depends very strongly on the behaviours of the A c B 1-c alloy surfaces. On the other hand, the knowledge of the kinetics of the formation-dissolution of surface alloys can allow to understand the equilibrium segregation isotherm. We have then studied the relation between the equilibrium surface segregation in an alloy A c B 1-c and the kinetics of dissolution of a few metallic layers of A/B and the inverse deposit. We have used an energetic model derived from the electronic structure (T.I.B.M.) allowing us to study the surface segregation both in the disordered state and in the ordered one. The kinetics of dissolution were studied using the kinetic version of this model (K.T.I.B.M.) consistent with the equilibrium model. To illustrate our study, we have chosen the Cu-Pd system, a model for the formation of surface alloys and for which a great number of studies, both experimental and theoretical, are in progress. We then have shown for the (111) surface of this system that the surface alloys obtained during the dissolution are related to the alloy surfaces observed for the equilibrium segregation. The Cu-Pd system is characteristic of systems which have a weak segregation energy. Then, we have performed an equivalent study for a system with a strong segregation energy. Our choice was directly put on the Pt-Sn system. The surface behaviour, both in equilibrium and during the kinetics of dissolution, is very different from the Cu-Pd case. In particular, we have found pure 2-D surface alloys. Finally, a quenched molecular dynamics study has allowed us to determine the relative stability of various possible surface superstructures. (author) [fr
Rotary Friction Welding of Weight Heavy Alloy with Wrought AlMg3 Alloy for Subcaliber Ammunition
Olgierd Janusz Goroch; Zbigniew Gulbinowicz
2017-01-01
The results of studies concerning friction welding of Weight Heavy Alloy (WHA) with AlMg3 alloy are presented. The friction welding of density 17,5 Mg/m3 with aluminum alloy showed that it is possible to reach the joints with the strength exceeding the yield strength of wrought AlMg3 alloy. This strength looks to be promising from point of view of condition which have to be fulfilled in case of armor subcaliber ammunition, where WHA rods play the role Kinetic Energy Penetrators and aluminum i...
International Nuclear Information System (INIS)
Ban, Sadayuki
1989-01-01
To assess the biological effects of neutrons, a man-made spontaneously fissioning isotope, Cf-252, is useful as an experimental model to obtain basic biological data on mixed radiation of gamma-rays and neutrons. The paper describes the lethal effect of Cf-252 radiation on human skin fibroblasts, its lethal and mutagenic effect on HeLa MR cells, and the micronuclei inducing effect on human peripheral lymphocytes. Dose-survival responses of three fibroblast cell strains exposed to Cf-252 radiation are measured. Individual difference is larger than the experimental fluctuation. D 10 values of each strain are obtained from the linear model and linear-quadratic model. Though the dose rate of X-ray is higher than that of Cf-252 radiations, the mean value of RBE(n+γ) is simply obtained as 1.86+0.31 (RBE:relative biological effectiveness). RBE(n) of Cf-252 neutrons to high-dose-rate X-rays is 2.29. After X-ray irradiation, the survival curve of HeLa MR cells gives an extrapolation number of 3.6. It is 1.3 after Cf-252 irradiation. At 50% survival, RBE(n+γ) and RBE(n) are 2.05 and 2.6, respectively. At 10% survival they are 2.05 and 2.6. The mutation frequencies after X-ray irradiation showed a significant non-linear increase with dose. Those after Cf-252 irradiation increase linearly with dose. (N.K.)
Effect of alloying elements on martensitic transformation in the binary NiAl(β) phase alloys
International Nuclear Information System (INIS)
Kainuma, R.; Ohtani, H.; Ishida, K.
1996-01-01
The characteristics of the B2(β) to L1 0 (β') martensitic transformation in NiAl base alloys containing a small amount of third elements have been investigated by differential scanning calorimetry (DSC), X-ray diffraction (XRD), and transmission electron microscopy (TEM). It is found that in addition to the normal L1 0 (3R) martensite, the 7R martensite is also present in the ternary alloys containing Ti, Mo, Ag, Ta, or Zr. While the addition of third elements X (X: Ti, V, Cr, Mn, Fe, Zr, Nb, Mo, Ta, W, and Si) to the binary Ni 64 Al 36 alloy stabilizes the parent β phase, thereby lowering the M s temperature, addition of third elements such as Co, Cu, or Ag destabilizes the β phase, increasing the M s temperature. The occurrence of the 7R martensite structure is attributed to solid solution hardening arising from the difference in atomic size between Ni and Al and the third elements added. The variation in M s temperature with third element additions is primarily ascribed to the difference in lattice stabilities of the bcc and fcc phases of the alloying elements
Proposed Californium-252 User Facility for Neutron Science at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
Martin, R.C.; Laxson, R.R.; Knauer, J.B.
1996-01-01
The Radiochemical Engineering Development Center (REDC) at ORNL has petitioned to establish a Californium-252 User Facility for Neutron Science for academic, industrial, and governmental researchers. The REDC Californium Facility (CF) stores the national inventory of sealed 252 Cf neutron source for university and research loans. Within the CF, the 252 Cf storage pool and two uncontaminated hot cells currently in service for the Californium Program will form the physical basis for the User Facility. Relevant applications include dosimetry and experiments for neutron tumor therapy; fast and thermal neutron activation analysis of materials; experimental configurations for prompt gamma neutron activation analysis; neutron shielding and material damage studies; and hardness testing of radiation detectors, cameras, and electronics. A formal User Facility simplifies working arrangements and agreements between US DOE facilities, academia, and commercial interests
Nanoindentation of Electropolished FeCrAl Alloy Welds
Energy Technology Data Exchange (ETDEWEB)
Weaver, Jordan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Aydogan, Eda [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Mara, Nathan Allan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Maloy, Stuart Andrew [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-02-13
The present report summarizes Berkovich nanoindentation modulus and hardness measurements on two candidate FeCrAl alloys (C35M and C37M) on as-received (AR) and welded samples. In addition, spherical nanoindentation stress-strain measurements were performed on individual grains to provide further information and demonstrate the applicability of these protocols to mechanically characterizing welds in FeCrAl alloys. The indentation results are compared against the reported tensile properties for these alloys to provide relationships between nanoindentation and tensile tests and insight into weldsoftening for these FeCrAl alloys. Hardness measurements revealed weld-softening for both alloys in good agreement with tensile test results. C35M showed a larger reduction in hardness at the weld center from the AR material compared to C37M; this is also consistent with tensile tests. In general, nanohardness was shown to be a good predictor of tensile yield strength and ultimate tensile stress for FeCrAl alloys. Spherical nanoindentation measurements revealed that the fusion zone (FZ) + heat affected zone (HAZ) has a very low defect density typical of well-annealed metals as indicated by the frequent pop-in events. Spherical nanoindentation yield strength, Berkovich hardness, and tensile yield strength measurements on the welded material all show that the C37M welded material has a higher strength than C35M welded material. From the comparison of nanoindentation and tensile tests, EBSD microstructure analysis, and information on the processing history, it can be deduced that the primary driver for weld-softening is a change in the defect structure at the grain-scale between the AR and welded material. These measurements serve as baseline data for utilizing nanoindentation for studying the effects of radiation damage on these alloys.
Energy Technology Data Exchange (ETDEWEB)
Miura, E [Tohoku University, Sendai (Japan); Yoshimi, K; Hanada, S [Tohoku Univ., Sendai (Japan). Research Inst. for Iron, Steel and Other Metals
1997-02-01
This paper describes an influence of additional elements on the high temperature deformation behavior of Nb-base solid solution alloys. Highly concentrated solid solution single crystals of Nb-Ta and Nb-Mo alloys were prepared. Compression test and strain rate sudden change test were conducted in the vacuum at temperatures ranging from 77 to 1773 K, to determine the strain rate sensitivity index. Yield stress of the Nb-Ta alloy was similar to that of Nb alloy at temperatures over 0.3{times}T{sub M}, where T{sub M} is fusing point of Nb. While, the yield stress increased with increasing the impurity oxygen concentration at temperatures below 0.3{times}T{sub M}. The yield stress became much higher than that of Nb alloy. The strain rate sensitivity index showed positive values in the whole temperature range. On the other hand, the yield stress of Nb-Mo alloy was higher than that of Nb alloy in the whole temperature range, and increased with increasing the Mo concentration. The strain rate sensitivity index showed negative values at the temperature range from 0.3{times}T{sub M} to 0.4{times}T{sub M}. It was found that serration occurred often for Nb-40Mo alloys. 1 ref., 4 figs., 1 tab.
Determination of disintegration half-life of 252Cf
International Nuclear Information System (INIS)
Chen Keliang; Liu Guoxing; Wang Sufang; Zheng Jiwen
1991-01-01
The follow-up measurements have been made by using a Si(Au) detector with small solid angle geometry for α disintegration of 252 Cf. The measured half-life of disintegration is 2.638 ± 0.009 year. This value is in accordance with other previous results
48 CFR 252.225-7041 - Correspondence in English.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Correspondence in English... of Provisions And Clauses 252.225-7041 Correspondence in English. As prescribed in 225.1103(2), use the following clause: Correspondence in English (JUN 1997) The Contractor shall ensure that all...
48 CFR 252.229-7002 - Customs exemptions (Germany).
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Customs exemptions... of Provisions And Clauses 252.229-7002 Customs exemptions (Germany). As prescribed in 229.402-70(b), use the following clause: Customs Exemptions (Germany) (JUN 1997) Imported products required for the...
48 CFR 252.237-7005 - Performance and delivery.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance and delivery... of Provisions And Clauses 252.237-7005 Performance and delivery. As prescribed in 237.7003(b), use the following clause: Performance and Delivery (DEC 1991) (a) The Contractor shall furnish the...
Decorporation of 241Am and 252Cf by Ca-DTPA from rat, Syrian and Chinese hamster
International Nuclear Information System (INIS)
Seidel, A.
1977-01-01
Retention and mobilization by Ca-DTPA of 241 Am and 252 Cf from rats, Syrian and Chinese hamsters are compared. Previous observations of a much longer residence time of actinides in hamsters liver than in rat liver are confirmed. Identical dose-effect functions were obtained for skeleton of rats and Syrian hamsters whereas 252 Cf removal from Chinese hamster skeleton was lower. The mobilization of 241 Am was lower than that of 252 Cf. With regard to species differences, qualitatively similar results were obtained for 241 Am as for 252 Cf. The results will be discussed with regard to the reduction by DTPA treatment of radiation risk in animal species with different biological half times of actinides in their livers. In this connection, attention will be paid to the usefulness of long-term DTPA treatment
Reactor production of 252Cf and transcurium isotopes
International Nuclear Information System (INIS)
Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.
1990-01-01
Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs
Electrochemical corrosion behavior of AZ91D alloy in ethylene glycol
Energy Technology Data Exchange (ETDEWEB)
Fekry, A.M. [Chemistry Department, Faculty of Science, Cairo University, Giza 12613 (Egypt)], E-mail: hham4@hotmail.com; Fatayerji, M.Z. [Chemistry Department, Faculty of Science, Cairo University, Giza 12613 (Egypt)
2009-11-01
The effect of concentration on the corrosion behavior of Mg-based alloy AZ91D was investigated in ethylene glycol-water solutions using electrochemical techniques i.e. potentiodynamic polarization, electrochemical impedance measurements (EIS) and surface examination via scanning electron microscope (SEM) technique. This can provide a basis for developing new coolants for magnesium alloy engine blocks. Corrosion behavior of AZ91D alloy by coolant is important in the automotive industry. It was found that the corrosion rate of AZ91D alloy decreased with increasing concentration of ethylene glycol. For AZ91D alloy in chloride >0.05 M or fluoride <0.05 M containing 30% ethylene glycol solution, they are more corrosive than the blank (30% ethylene glycol-70% water). However, at concentrations <0.05 for chloride or >0.05 M for fluoride containing ethylene glycol solution, some inhibition effect has been observed. The corrosion of AZ91D alloy in the blank can be effectively inhibited by addition of 0.05 mM paracetamol that reacts with AZ91D alloy and forms a protective film on the surface at this concentration as confirmed by surface examination.
Corrosion behaviour of Al-Fe-Ti-V medium entropy alloy
Bodunrin, M. O.; Obadele, B. A.; Chown, L. H.; Olubambi, P. A.
2017-12-01
Alloys containing up to four multi-principal elements in equiatomic ratios are referred to as medium entropy alloys (MEA). These alloys have attracted the interest of many researchers due to the superior mechanical properties it offers over the traditional alloys. The design approach of MEA often results to simple solid solution with either body centered cubic; face centered cubic structures or both. As the consideration for introducing the alloys into several engineering application increases, there have been efforts to study the corrosion behaviour of these alloys. Previous reports have shown that some of these alloys are more susceptible to corrosion when compared with traditional alloys due to lack of protective passive film. In this research, we have developed AlFeTiV medium entropy alloys containing two elements (Ti and Al) that readily passivate when exposed to corrosive solutions. The alloys were produced in vacuum arc furnace purged with high purity argon. Open circuit potential and potentiodynamic polarisation tests were used to evaluate the corrosion behaviour of the as-cast AlFeTiV alloy in 3.5 wt% NaCl and 1 M H2SO4. The corrosion performance of the alloy was compared with Ti-6Al-4V alloy tested under similar conditions. The results show that unlike in Ti-6Al-4V alloy, the open circuit potential of the AlFeTiV alloy move towards the negative values in both 3.5 wt% NaCl and 1 M H2SO4 solutions indicating that self-activation occurred rapidly on immersion. Anodic polarisation of the alloys showed that AlFeTiV alloy exhibited a narrow range of passivity in both solutions. In addition, the alloys exhibited lower Ecorr and higher Icorr when compared with traditional Ti-6Al-4V alloy. The traditional Ti-6Al-4V alloy showed superior corrosion resistant to the AlFeTiV alloy in both 3.5 wt.% NaCl and 1 M H2SO4 solutions.
Grain refinement of an AZ63B magnesium alloy by an Al-1C master alloy
Energy Technology Data Exchange (ETDEWEB)
Yichuan Pan; Xiangfa Liu; Hua Yang [The Key Lab. of Liquid Structure and Heredity of Materials, Shandong Univ., Jinan (China)
2005-12-01
In order to develop a refiner of Mg-Al alloys, an Al-1C (in wt.%) master alloy was synthesized using a casting method. The microstructure and grain-refining performance of the Al-1C master alloy were investigated using X-ray diffraction (XRD), electron probe microanalysis (EPMA) and a grain-refining test. The microstructure of the Al-1C master alloy is composed of {alpha}-Al solid solution, Al{sub 4}C{sub 3} particles, and graphite phases. After grain refinement of AZ63B alloy by the Al-1C master alloy, the mean grain size reached a limit when 2 wt.% Al-C master alloy was added at 800 C and held for 20 min in the melt before casting. The minimum mean grain size is approximately 48 {mu}m at the one-half radius of the ingot and is about 17% of that of the unrefined alloy. The Al-1C master alloy results in better grain refinement than C{sub 2}Cl{sub 6} and MgCO{sub 3} carbon-containing refiners. (orig.)
International Nuclear Information System (INIS)
Olmedo, A.M.; Bordon, R.
2007-01-01
In this work, the oxide films grown on Alloy 800 and Alloy 600 in lithiated (pH 25 C d egrees = 10.2-10.4) water at high temperature, with and without hydrogen overpressure (HO) and an initial oxygen dissolved in the water have been studied. The oxide films were grown at different temperatures (220-350 C degrees) and exposure times with HO, and at 315 C degrees without HO in static autoclaves. Some results are also reported for oxide layers grown on Alloy 800 coupons exposed in a high temperature loop during extended exposure times. The average oxide thickness was determined using descaling procedures. The morphology and composition of the oxide films were analyzed with scanning electron microscopy (SEM), EDS and X-ray diffraction (XRD). For both Alloys, at 350 C degrees with HO, the oxide layers were clearly composed of a double layer: an inner one of very small crystallites and an outer layer formed by bigger crystals scattered over the inner one. The analysis by X-ray diffraction indicated the presence of spinel structures like magnetite (Fe 3 O 4 ) and ferrites and/or nickel chromites. In this case the average oxide thickness was around 0.12 to 0.15 μm for both Alloys. Similar values were found at lower temperatures. The morphology of the oxide layer was similar at lower temperatures for Alloy 800, but a different morphology consisting of platelets or needles was found for Alloy 600. The oxide morphology found at 315 C degrees, without HO and with initial dissolved oxygen in the water, was also very different between both Alloys. The oxide film grown on Alloy 600 with an initial dissolved oxygen in the water, showed clusters of platelets forming structures like flowers that were dispersed on an rather homogeneous layer consisting of smaller platelets or needles. The average oxide film grown in this case was around 0.25 μm for Alloy 600 and 0.18 μm for Alloy 800. (author) [es
Effect of heat treatment on transformation behavior of Ti-Ni-V shape memory alloy
International Nuclear Information System (INIS)
He Zhirong; Liu Manqian
2011-01-01
Highlights: → New shape memory alloy (SMA) - Ti-50.8Ni-0.5V SMA. → The evolution laws of transformation types of annealed Ti-50.8Ni-0.5V SMA. → The evolution laws of transformation types of aged Ti-50.8Ni-0.5V SMA. → The effect laws of annealing on transformation temperature and hysteresis of the alloy. → The effect laws of aging on transformation temperature and hysterises of the alloy. - Abstract: Effects of annealing and aging processes on the transformation behaviors of Ti-50.8Ni-0.5V (atomic fraction, %) shape memory alloy were investigated by means of differential scanning calorimetry (DSC). The A → R/R → A (A - parent phase, R - R phase) type one-stage reversible transformation occurs in 350-400 deg. C annealed alloy, the A → R → M/M → R → A (M - martensite) type two-stage transformation occurs in 450-500 deg. C annealed alloy, the A → R → M/M → A type transformation occurs in 550 deg. C annealed alloy, and A → M/M → A type transformation occurs in the alloy annealed at above 600 deg. C upon cooling/heating. The transformation type of 300 deg. C aged alloy is A → R/R → A, and that of 500 deg. C aged alloy is A → R → M/M → A, while that of 400 deg. C aged alloy changes from A → R/R → A to A → R → M/M → R → A with increasing aging time. The effects of annealing and aging processes on R and M transformation temperatures and temperature hysteresis are given. The influence of annealing and aging temperature on transformation behaviors is stronger than that of annealing and aging time.
Bonessio, N; Pereira, E S J; Lomiento, G; Arias, A; Bahia, M G A; Buono, V T L; Peters, O A
2015-05-01
To validate torsional analysis, based on finite elements, of WaveOne instruments against in vitro tests and to model the effects of different nickel-titanium (NiTi) materials. WaveOne reciprocating instruments (Small, Primary and Large, n = 8 each, M-Wire) were tested under torsion according to standard ISO 3630-1. Torsional profiles including torque and angle at fracture were determined. Test conditions were reproduced through Finite Element Analysis (FEA) simulations based on micro-CT scans at 10-μm resolution; results were compared to experimental data using analysis of variance and two-sided one sample t-tests. The same simulation was performed on virtual instruments with identical geometry and load condition, based on M-Wire or conventional NiTi alloy. Torsional profiles from FEA simulations were in significant agreement with the in vitro results. Therefore, the models developed in this study were accurate and able to provide reliable simulation of the torsional performance. Stock NiTi files under torsional tests had up to 44.9%, 44.9% and 44.1% less flexibility than virtual M-Wire files at small deflections for Small, Primary and Large instruments, respectively. As deflection levels increased, the differences in flexibility between the two sets of simulated instruments decreased until fracture. Stock NiTi instruments had a torsional fracture resistance up to 10.3%, 8.0% and 7.4% lower than the M-Wire instruments, for the Small, Primary and Large file, respectively. M-Wire instruments benefitted primarily through higher material flexibility while still at low deflection levels, compared with conventional NiTi alloy. At fracture, the instruments did not take complete advantage of the enhanced fractural resistance of the M-Wire material, which determines only limited improvements of the torsional performance. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.
Characteristics of polyethylene-moderated 252Cf neutron sources
International Nuclear Information System (INIS)
Alejnikov, V.E.; Beskrovnaya, L.G.; Florko, B.V.
2000-01-01
Polyethylene-moderated 252 Cf neutron sources were designed to produce neutron reference fields' spectra that simulate the spectra observed in the workplaces within nuclear reactors and accelerators. The paper describes the neutron sources and fields. Neutron spectra were calculated by Monte Carlo method and compared with experimental data
48 CFR 252.229-7005 - Tax exemptions (Spain).
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax exemptions (Spain... of Provisions And Clauses 252.229-7005 Tax exemptions (Spain). As prescribed in 229.402-70(e), use the following clause: Tax Exemptions (Spain) (JUN 1997) (a) The Contractor represents that the...
Fragility and structure of Al-Cu alloy melts
International Nuclear Information System (INIS)
Lv Xiaoqian; Bian Xiufang; Mao Tan; Li Zhenkuan; Guo Jing; Zhao Yan
2007-01-01
The dynamic viscosity measurements are performed for Al-Cu alloy melts with different compositions using an oscillating-cup viscometer. The results show that the viscosities of Al-Cu alloy melts increase with the copper content increasing, and also have a correlation with the correlation radius of clusters, which is measured by the high-temperature X-ray diffractometer. It has also been found that the fragilities of superheated melts (M) of hypereutectic Al-Cu alloys increase with the copper content increasing. There exists a relationship between the fragility and the structure in Al-Cu alloy melts. The value of the M reflects the variation of activation energy for viscous flow
Ferromagnetic bulk glassy alloys
International Nuclear Information System (INIS)
Inoue, Akihisa; Makino, Akihiro; Mizushima, Takao
2000-01-01
This paper deals with the review on the formation, thermal stability and magnetic properties of the Fe-based bulk glassy alloys in as-cast bulk and melt-spun ribbon forms. A large supercooled liquid region over 50 K before crystallization was obtained in Fe-(Al, Ga)-(P, C, B, Si), Fe-(Cr, Mo, Nb)-(Al, Ga)-(P, C, B) and (Fe, Co, Ni)-Zr-M-B (M=Ti, Hf, V, Nb, Ta, Cr, Mo and W) systems and bulk glassy alloys were produced in a thickness range below 2 mm for the Fe-(Al, Ga)-(P, C, B, Si) system and 6 mm for the Fe-Co-(Zr, Nb, Ta)-(Mo, W)-B system by copper-mold casting. The ring-shaped glassy Fe-(Al, Ga)-(P, C, B, Si) alloys exhibit much better soft magnetic properties as compared with the ring-shaped alloy made from the melt-spun ribbon because of the formation of the unique domain structure. The good combination of high glass-forming ability and good soft magnetic properties indicates the possibility of future development as a new bulk glassy magnetic material
Electrochemical hydrogen storage alloys and batteries fabricated from Mg containing base alloys
Ovshinsky, Stanford R.; Fetcenko, Michael A.
1996-01-01
An electrochemical hydrogen storage material comprising: (Base Alloy).sub.a M.sub.b where, Base Alloy is an alloy of Mg and Ni in a ratio of from about 1:2 to about 2:1, preferably 1:1; M represents at least one modifier element chosen from the group consisting of Co, Mn, Al, Fe, Cu, Mo, W, Cr, V, Ti, Zr, Sn, Th, Si, Zn, Li, Cd, Na, Pb, La, Mm, and Ca; b is greater than 0.5, preferably 2.5, atomic percent and less than 30 atomic percent; and a+b=100 atomic percent. Preferably, the at least one modifier is chosen from the group consisting of Co, Mn, Al, Fe, and Cu and the total mass of the at least one modifier element is less than 25 atomic percent of the final composition. Most preferably, the total mass of said at least one modifier element is less than 20 atomic percent of the final composition.
Rotary Friction Welding of Weight Heavy Alloy with Wrought AlMg3 Alloy for Subcaliber Ammunition
Directory of Open Access Journals (Sweden)
Olgierd Janusz Goroch
2017-12-01
Full Text Available The results of studies concerning friction welding of Weight Heavy Alloy (WHA with AlMg3 alloy are presented. The friction welding of density 17,5 Mg/m3 with aluminum alloy showed that it is possible to reach the joints with the strength exceeding the yield strength of wrought AlMg3 alloy. This strength looks to be promising from point of view of condition which have to be fulfilled in case of armor subcaliber ammunition, where WHA rods play the role Kinetic Energy Penetrators and aluminum is used for projectile ballistic cup.
48 CFR 252.225-7026 - Acquisition Restricted to Products or Services from Iraq or Afghanistan.
2010-10-01
... Products or Services from Iraq or Afghanistan. 252.225-7026 Section 252.225-7026 Federal Acquisition... to Products or Services from Iraq or Afghanistan. As prescribed in 225.7703-5(c), use the following clause: Acquisition Restricted to Products or Services From Iraq or Afghanistan (APR 2010) (a...
48 CFR 252.225-7036 - Buy American Act-Free Trade Agreements-Balance of Payments Program.
2010-10-01
... Trade Agreements-Balance of Payments Program. 252.225-7036 Section 252.225-7036 Federal Acquisition... Trade Agreements—Balance of Payments Program. As prescribed in 225.1101(11)(i), use the following clause: Buy American Act—Free Trade Agreements—Balance of Payments Program (JUL 2009) (a) Definitions. As used...
Electrical Resistance Alloys and Low-Expansion Alloys
DEFF Research Database (Denmark)
Kjer, Torben
1996-01-01
The article gives an overview of electrical resistance alloys and alloys with low thermal expansion. The electrical resistance alloys comprise resistance alloys, heating alloys and thermostat alloys. The low expansion alloys comprise alloys with very low expansion coefficients, alloys with very low...... thermoelastic coefficients and age hardenable low expansion alloys....
Corrosion behavior of electrodeposited Co-Fe alloys in aerated solutions
Energy Technology Data Exchange (ETDEWEB)
Chansena, A. [Research Unit on Corrosion, College of Data Storage Innovation, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand); Sutthiruangwong, S., E-mail: sutha.su@kmitl.ac.th [Department of Chemistry, Faculty of Science, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand); Research Unit on Corrosion, College of Data Storage Innovation, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand)
2017-05-01
Co-Fe alloy is an important component for reader-writer in hard disk drive. The surface of the alloy is exposed to the environment both in gas phase and in liquid phase during manufacturing process. The study of corrosion behavior of Co-Fe alloys can provide useful fundamental data for reader-writer production planning especially when corrosion becomes a major problem. The corrosion study of electrodeposited Co-Fe alloys from cyclic galvanodynamic polarization was performed using potentiodynamic polarization technique. The composition of electrodeposited Co-Fe alloys was determined by X-ray fluorescence spectrometry. The patterns from X-ray diffractometer showed that the crystal structure of electrodeposited Co-Fe alloys was body-centered cubic. A vibrating sample magnetometer was used for magnetic measurements. The saturation magnetization (M{sub s}) was increased and the intrinsic coercivity (H{sub ci}) was decreased with increasing Fe content. The corrosion rate study was performed in aerated deionized water and aerated acidic solutions at pH 3, 4 and 5. The corrosion rate diagram for Co-Fe alloys was constructed. It was found that the corrosion rate of Co-Fe alloys was increased with increasing Fe content in both aerated deionized water and aerated acidic solutions. In aerated pH 3 solution, the Co-Fe alloy containing 78.8% Fe showed the highest corrosion rate of 7.7 mm yr{sup −1} with the highest M{sub s} of 32.0 A m{sup 2} kg{sup −1}. The corrosion rate of the alloy with 23.8% Fe was at 1.1 mm yr{sup −1} with M{sub s} of 1.2 A m{sup 2} kg{sup −1}. In aerated deionized water, the alloy with the highest Fe content of 78.5% still showed the highest corrosion rate of 0.0059 mm yr{sup −1} while the alloy with the lowest Fe content of 20.4% gave the lowest corrosion rate of 0.0045 mm yr{sup −1}. - Highlights: • The aeration during corrosion measurement simulates reader-writer head production environment. • The corrosion rate diagram for Co-Fe alloys
48 CFR 252.237-7007 - Termination for default.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Termination for default... of Provisions And Clauses 252.237-7007 Termination for default. As prescribed in 237.7003(b), use the following clause: Termination for Default (DEC 1991) (a) This clause supplements and is in addition to the...
Stable carbides in transition metal alloys
International Nuclear Information System (INIS)
Piotrkowski, R.
1991-01-01
In the present work different techniques were employed for the identification of stable carbides in two sets of transition metal alloys of wide technological application: a set of three high alloy M2 type steels in which W and/or Mo were total or partially replaced by Nb, and a Zr-2.5 Nb alloy. The M2 steel is a high speed steel worldwide used and the Zr-2.5 Nb alloy is the base material for the pressure tubes in the CANDU type nuclear reactors. The stability of carbide was studied in the frame of Goldschmidt's theory of interstitial alloys. The identification of stable carbides in steels was performed by determining their metallic composition with an energy analyzer attached to the scanning electron microscope (SEM). By these means typical carbides of the M2 steel, MC and M 6 C, were found. Moreover, the spatial and size distribution of carbide particles were determined after different heat treatments, and both microstructure and microhardness were correlated with the appearance of the secondary hardening phenomenon. In the Zr-Nb alloy a study of the α and β phases present after different heat treatments was performed with optical and SEM metallographic techniques, with the guide of Abriata and Bolcich phase diagram. The α-β interphase boundaries were characterized as short circuits for diffusion with radiotracer techniques and applying Fisher-Bondy-Martin model. The precipitation of carbides was promoted by heat treatments that produced first the C diffusion into the samples at high temperatures (β phase), and then the precipitation of carbide particles at lower temperature (α phase or (α+β)) two phase field. The precipitated carbides were identified as (Zr, Nb)C 1-x with SEM, electron microprobe and X-ray diffraction techniques. (Author) [es
Grindability of cast Ti-Cu alloys.
Kikuchi, Masafumi; Takada, Yukyo; Kiyosue, Seigo; Yoda, Masanobu; Woldu, Margaret; Cai, Zhuo; Okuno, Osamu; Okabe, Toru
2003-07-01
The purpose of the present study was to evaluate the grindability of a series of cast Ti-Cu alloys in order to develop a titanium alloy with better grindability than commercially pure titanium (CP Ti), which is considered to be one of the most difficult metals to machine. Experimental Ti-Cu alloys (0.5, 1.0, 2.0, 5.0, and 10.0 mass% Cu) were made in an argon-arc melting furnace. Each alloy was cast into a magnesia mold using a centrifugal casting machine. Cast alloy slabs (3.5 mm x 8.5 mm x 30.5 mm), from which the hardened surface layer (250 microm) was removed, were ground using a SiC abrasive wheel on an electric handpiece at four circumferential speeds (500, 750, 1000, or 1250 m/min) at 0.98 N (100 gf). Grindability was evaluated by measuring the amount of metal volume removed after grinding for 1min. Data were compared to those for CP Ti and Ti-6Al-4V. For all speeds, Ti-10% Cu alloy exhibited the highest grindability. For the Ti-Cu alloys with a Cu content of 2% or less, the highest grindability corresponded to an intermediate speed. It was observed that the grindability increased with an increase in the Cu concentration compared to CP Ti, particularly for the 5 or 10% Cu alloys at a circumferential speed of 1000 m/min or above. By alloying with copper, the cast titanium exhibited better grindability at high speed. The continuous precipitation of Ti(2)Cu among the alpha-matrix grains made this material less ductile and facilitated more effective grinding because small broken segments more readily formed.
Stress-corrosion behavior of aluminum-lithium alloys in aqueous salt environments
Pizzo, P. P.; Galvin, R. P.; Nelson, H. G.
1984-01-01
The stress corrosion susceptibility of two powder metallurgy (P/M) alloys, Al-Li-Cu and Al-Li-Cu-Mg; two mechanically attrited (M/A) alloys, Al-Li-Cu and Al-Li-Mg; and two wrought, ingot alloys, X-2020 and AA7475, are compared. Time-dependent fracture in an aqueous sodium chloride environment under alternate immersion condition was found to vary significantly between alloys. The stress corrosion behavior of the two powder metallurgy processed alloys was studied in detail under conditions of crack initiation, static crack growth, and fatigue crack growth. A variety of stress corrosion tests were performed including smooth surface, time-to-failure tests; potentiostatic tests on smooth surfaces exposed to constant applied strain rates; and fracture mechanics-type tests under static and cyclic loads. Both alloys show surface pitting and subsequent intergranular corrosion. Pitting is more severe in the magnesium-bearing alloy and is associated with stringer particles strung along the extrusion direction as a result of P/M processing.
Shielding experiments in different materials with 252Cf neutron spectra
International Nuclear Information System (INIS)
Sathian, Deepa; Marathe, P.K.; Pal, Rupali; Jayalakshmi, V.; Chourasiya, G.; Mayya, Y.S.
2008-01-01
Adequate shielding for neutron sources can be determined using analytical method or by actually measuring the attenuation for the target configuration. This paper describes the measurement of Half Value Thickness (HVT), Tenth Value Thickness (TVT), Σ values for four different shielding materials, using a standard 252 Cf neutron source and comparing with the values calculated using an empirical relationship. BF 3 based REM-counter is used for measurement of neutron dose equivalent, against different thickness of the shielding material. The experimental HVT and S values are in good agreement with the calculated values. From this study, it is concluded that, among the four materials studied, high density polyethylene (HDPE) is best suitable for the shielding of a 252 Cf neutron source. (author)
Energy and angular distributions of neutrons from 252Cf spontaneous fission
International Nuclear Information System (INIS)
Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.
1982-01-01
Some results from a first series of measurements of energy and angular distributions of neutrons from 252 Cf spontaneous fission using a spectrometer with high neutron detection efficiency, i.e. a 4π neutron time-of-flight spectrometer, were already presented. Subsequently, a second series of measurements was performed using a more sophisticated technique. For this second series, we used a more intense 252 Cf layer (25,000 spontaneous fissions per second). The angular resolution was improved by a factor of 2-3 by combining the hexahedral counter modules, placed at the same angle with respect to the direction of motion of the fragments, in new panoramic counters. The neutron counters were calibrated against the average 252 Cf neutron spectrum at several positions of the axis of the fragment detector with respect to the neutron counters. In the spectrum measurements and calibration work, the scattered neutron background was not determined theoretically, as in the first series of measurements, but experimentally using four extra scintillation counters with scatter cones; the counters were set up at 60 deg., 80 deg., 100 deg., and 120 deg. to the direction of separation of the fragments
Time domain measurements for fast metal assemblies with /sup 252/Cf
Energy Technology Data Exchange (ETDEWEB)
Mihalczo, J T
1975-06-01
Time correlation measurements between the pulses from an ionization counter containing a /sup 252/Cf neutron source, which provided the initiators of fission chains in a neutron multiplying assembly and from sensors that detected particles from the fission chains are reviewed for fast uranium or plutonium metal assemblies. Comparisons are made between the correlated count rate from a /sup 252/Cf measurement and that from both one and two-detector Rossi-..cap alpha.. measurements. The assemblies studied were (1) unmoderated and polyethylene-moderated uranium (93 wt percent /sup 235/U) cylinders with masses from 12 to 160 kg; prompt neutron decay constants from 3 to 10/sup 3/ to 10/sup 8/ sec/sup -1/ and (2) unmoderated plutonium spheres and parts of spheres with plutonium masses from 2.2 to 16 kg with /sup 240/Pu contents of 4.5 to 20.1 at. percent. Measurements with a delayed critical uranium metal sphere determined the effective delayed neutron fraction and served as the basis for verification of the theory of the /sup 252/Cf measurement method in the time domain within a few per cent. (auth)
Microstructure and mechanical properties of Cu-Ni-Si alloys
International Nuclear Information System (INIS)
Monzen, Ryoichi; Watanabe, Chihiro
2008-01-01
The microstructure and mechanical properties of 0.1 wt.% Mg-added and Mg-free Cu-2.0 wt.% Ni-0.5 wt.% Si alloys aged at 400 deg. C have been examined. The addition of Mg promotes the formation of disk-shaped Ni 2 Si precipitates. The Cu-Ni-Si-Mg alloy exhibits higher strength and resistance to stress relaxation than the Cu-Ni-Si alloy. The higher strength or stress relaxation resistance is attributable to the reduction in inter-precipitate spacing by the Mg addition or the drag effect of Mg atoms on dislocation motion. The Cu-Ni-Si alloy with a large grain size of 150 μm shows higher stress relaxation resistance than the alloy with a small grain size of 10 μm because of a lower density of mobile dislocations in the former alloy
Microstructure and mechanical properties of Cu-Ni-Si alloys
Energy Technology Data Exchange (ETDEWEB)
Monzen, Ryoichi [Division of Innovative Technology and Science, Graduate School of Natural Science and Technology, Kanzawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)], E-mail: monzen@t.kanazawa-u.ac.jp; Watanabe, Chihiro [Division of Innovative Technology and Science, Graduate School of Natural Science and Technology, Kanzawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)
2008-06-15
The microstructure and mechanical properties of 0.1 wt.% Mg-added and Mg-free Cu-2.0 wt.% Ni-0.5 wt.% Si alloys aged at 400 deg. C have been examined. The addition of Mg promotes the formation of disk-shaped Ni{sub 2}Si precipitates. The Cu-Ni-Si-Mg alloy exhibits higher strength and resistance to stress relaxation than the Cu-Ni-Si alloy. The higher strength or stress relaxation resistance is attributable to the reduction in inter-precipitate spacing by the Mg addition or the drag effect of Mg atoms on dislocation motion. The Cu-Ni-Si alloy with a large grain size of 150 {mu}m shows higher stress relaxation resistance than the alloy with a small grain size of 10 {mu}m because of a lower density of mobile dislocations in the former alloy.
Implementation of 252Cf-source-driven power spectrum density measurement system
International Nuclear Information System (INIS)
Ren Yong; Wei Biao; Feng Peng; Li Jiansheng; Ye Cenming
2012-01-01
The principle of 252 Cf-source-driven power spectrum density measurement method is introduced. A measurement system and platform is realized accordingly, which is a combination of hardware and software, for measuring nuclear parameters. The detection method of neutron pulses based on an ultra-high-speed data acquisition card (three channels, 1 GHz sampling rate, 1 ns synchronization) is described, and the data processing process and the power spectrum density algorithm on PC are designed. This 252 Cf-source-driven power spectrum density measurement system can effectively obtain the nuclear tag parameters of nuclear random processes, such as correlation function and power spectrum density. (authors)
Study of the pyrophoric characteristics of uranium-iron alloys
International Nuclear Information System (INIS)
Duplessis, X.
2000-01-01
The objective of the study is to understand the pyrophoric characteristics of uranium-iron alloys. In order to carry out this research we have elected to use uranium-iron alloy powder with granules of 200 μm and 1000 μm diameter with 4%, 10.8% and 14% iron content. The experiments were performed on small samples of few milligrams and on larger quantities of few hundred grams. The main conclusions obtained are the followings: -The reaction start at 453 K (180 deg. C) and the ignition at 543 K (270 deg. C) - The influence of the specific area seems more important than the iron concentration in the alloys - When the alloy ignites, the fire spreads quickly and the alloy rapidly consumes. (author)
Fracture toughness evaluation of select advanced replacement alloys for LWR core internals
Energy Technology Data Exchange (ETDEWEB)
Tan, Lizhen [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Chen, Xiang [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2017-08-01
ferritic alloys showing slight decreases (Grade 92) or significant decreases (14YWT) in fracture toughness at elevated temperatures, the fracture toughness of the austenitic stainless steels and Ni-base superalloys were not strongly dependent upon the test temperatures. The fracture toughness of the alloys at the LWR-relevant temperatures was estimated by averaging the toughness values within 250– 350°C, which suggested the fracture toughness of the alloys in a descending order as 316L (752±98 MPa√m), 310 (513±66 MPa√m), 718A (313±43 MPa√m), 690 (267±48 MPa√m), 725 (218±55 MPa√m), X750 (145±16 MPa√m), Grade 92 (112±12 MPa√m), and 14YWT (63±3 MPa√m). Tearing modulus of the alloys was analyzed in the meantime, which were not strongly dependent upon the test temperatures. The high-strength alloys 718A, 725, X750, and 14YWT had the lowest tearing modulus, ranging from ~45 to ~7. Alloy 690 exhibited the highest tearing modulus on the order of 450, followed by 316L and 310 on the order of 260. Grade 92 had a noticeably lower tearing modulus on the order of 70.
Synthesis and Characterization of Nano-Hydroxyapatite/mPEG-b-PCL Composite Coating on Nitinol Alloy
Mohamadreza Etminanfar; Jafar Khalil-Allafi; Kiyumars Jalili
2017-01-01
In this study the bioactivity of hydroxyapatite/poly(ε-caprolactone)–poly(ethylene glycol) bilayer coatings on Nitinol superelastic alloy was investigated. The surface of Nitinol alloy was activated by a thermo-chemical treatment and hydroxyapatite coating was electrodeposited on the alloy, followed by applying the polymer coating. The surface morphology of coatings was studied using FE-SEM and SEM. The data revealed that the hydroxyapatite coating is composed of one-dimensional nano sized fl...
Neutron emission during acceleration of 252Cf fission fragments
International Nuclear Information System (INIS)
Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.
1991-01-01
We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs
Alloy development for cladding and duct applications
International Nuclear Information System (INIS)
Straalsund, J.L.; Johnson, G.D.
1981-01-01
Three general classes of materials under development for cladding and ducts are listed. Solid solution strengthened, or austenitic, alloys are Type 316 stainless steel and D9. Precipitation hardened (also austenitic) alloys consist of D21, D66 and D68. These alloys are similar to such commercial alloys as M-813, Inconel 706, Inconel 718 and Nimonic PE-16. The third general class of alloys is composed of ferritic alloys, with current emphasis being placed on HT-9, a tempered martensitic alloy, and D67, a delta-ferritic steel. The program is comprised of three parallel paths. The current reference, or first generation alloy, is 20% cold worked Type 316 stainless steel. Second generation alloys for near-term applications include D9 and HT-9. Third generation materials consist of the precipitation strengthened steels and ferritic alloys, and are being considered for implementation at a later time than the first and second generation alloys. The development of second and third generation materials was initiated in 1974 with the selection of 35 alloys. This program has proceeded to today where there are six advanced alloys being evaluated. These alloys are the developmental alloys D9, D21, D57, D66 and D68, together with the commerical alloy, HT-9. The status of development of these alloys is summarized
PROCESS OF DISSOLVING ZIRCONIUM ALLOYS
Shor, R.S.; Vogler, S.
1958-01-21
A process is described for dissolving binary zirconium-uranium alloys where the uranium content is about 2%. In prior dissolution procedures for these alloys, an oxidizing agent was added to prevent the precipitation of uranium tetrafluoride. In the present method complete dissolution is accomplished without the use of the oxidizing agent by using only the stoichiometric amount or slight excess of HF required by the zirconium. The concentration of the acid may range from 2M to 10M and the dissolution is advatageously carried out at a temperature of 80 deg C.
The Implications of the Excited Rotation of Comet 252P/2000 G1 (LINEAR)
Li, Jian-Yang; Samarasinha, Nalin H.; Kelley, Michael S. P.; Farnocchia, Davide; Mutchler, Max J.; Ren, Yanqiong; Lu, Xiaoping; Tholen, David J.; Lister, Tim; Micheli, Marco
2018-01-01
Jupiter Family comet (JFC) 252P/LINEAR had a close encounter to Earth on 2016 March 21. We imaged the comet with the Hubble Space Telescope Wide Field Camera 3 UVIS channel through the V- and r’-band filters spanning ~8 hours on 2016 April 4. The pixel scale of 2.7 km/pixel allowed us to study the structure of the cometary coma at scales of a few kilometers to a few hundred kilometers from the nucleus, a characteristic that is unique to our data. The dust coma of 252P showed a strong, well defined, narrow and nearly linear feature in the sunward direction, and its projected position angle moved about the nucleus for ~60 deg in 8 hours, consistent with an apparent periodicity of ~7.24 hours. On the other hand, the lightcurve measured in both V- and r’-band images from a 13 km radius aperture, after corrected for color term, showed a variability of >0.14 mag that is consistent with an apparent periodicity of ~5.4 hours or its multiples. We suggest that the two different periodicities derived from coma morphology and the lightcurve is a strong indication that the nucleus of 252P is in a non-principal axis (NPA) rotation, joining two other confirmed NPA rotators (1P/Halley and 103P/Hartley 2) and comets that are potentially in NPA rotational states (e.g., 2P/Encke). However, this apparition has been unusual for 252P. In the past three perihelion passages since discovery, the comet was very weakly active compared to other JFCs. Meteor evidence also exists that it probably has been very weakly active for a few hundred years. But in our data, we saw a very active comet in this 2016 apparition with an active fraction of 40% to >100%, representing an increase of 100x with respect to its recent past. Based on our observations, 252P has a small nucleus with a radius of ~0.3 km, which suggests that its rotational state could be relatively easily changed by torques caused by outgassing. Since the very weak outgassing in the past is not likely to change the rotational state
2010-10-01
... Trade Agreements-Balance of Payments Program Certificate. 252.225-7035 Section 252.225-7035 Federal... Trade Agreements—Balance of Payments Program Certificate. As prescribed in 225.1101(10), use the following provision: Buy American Act—Free Trade Agreements—Balance of Payments Program Certificate (DEC...
Intergranular tellurium cracking of nickel-based alloys in molten Li, Be, Th, U/F salt mixture
Ignatiev, Victor; Surenkov, Alexander; Gnidoy, Ivan; Kulakov, Alexander; Uglov, Vadim; Vasiliev, Alexander; Presniakov, Mikhail
2013-09-01
In Russia, R&D on Molten Salt Reactor (MSR) are concentrated now on fast/intermediate spectrum concepts which were recognized as long term alternative to solid fueled fast reactors due to their attractive features: strong negative feedback coefficients, easy in-service inspection, and simplified fuel cycle. For high-temperature MSR corrosion of the metallic container alloy in primary circuit is the primary concern. Key problem receiving current attention include surface fissures in Ni-based alloys probably arising from fission product tellurium attack. This paper summarizes results of corrosion tests conducted recently to study effect of oxidation state in selected fuel salt on tellurium attack and to develop means of controlling tellurium cracking in the special Ni-based alloys recently developed for molten salt actinide recycler and tranforming (MOSART) system. Tellurium corrosion of Ni-based alloys was tested at temperatures up to 750 °C in stressed and unloaded conditions in molten LiF-BeF2 salt mixture fueled by about 20 mol% of ThF4 and 2 mol% of UF4 at different [U(IV)]/[U(III)] ratios: 0.7, 4, 20, 100 and 500. Following Ni-based alloys (in mass%): HN80М-VI (Mo—12, Cr—7.6, Nb—1.5), HN80МТY (Mo—13, Cr—6.8, Al—1.1, Ti—0.9), HN80МТW (Mo—9.4, Cr—7.0, Ti—1.7, W—5.5) and ЕМ-721 (W—25.2, Cr—5.7, Ti—0.17) were used for the study in the corrosion facility. If the redox state the fuel salt is characterized by uranium ratio [U(IV)]/[U(III)] uranium intermetallic compounds and alloys with nickel and molybdenum. This leads to spontaneous behavior of alloy formation processes on the specimens' surface and further diffusion of uranium deep into the metallic phase. As consequence of this films of intermetallic compounds and alloys of nickel, molybdenum, tungsten with uranium are formed on the alloys specimens' surface, and intergranular corrosion does not take place. In the fuel salt with [U(IV)]/[U(III)] = 4-20 the potentials of uranium
Microstructure and mechanical properties of Ti-Zr-Cr biomedical alloys.
Wang, Pan; Feng, Yan; Liu, Fengchao; Wu, Lihong; Guan, Shaokang
2015-06-01
The Ti-15Zr-xCr (0≤x≤10, wt.%) alloys were investigated to develop new biomedical materials. It was found that the phase constitutions and mechanical properties strongly depended on the Cr content. The Ti-15Zr alloy was comprised of α' phase and a small fraction of β phase was detected with adding 1wt.% Cr. With addition of 5wt.% or more, the β phase was completely retained. In addition, the ω phase was detected in the Ti-15Zr-5Cr alloy and Ti-15Zr-7Cr alloy which exhibited the highest compressive Young's modulus and the lowest ductility. On the other hand, all the Ti-15Zr-xCr alloys without ω phase exhibited high microhardness, high yield strength and superior ductility. Furthermore, the elastic energy of Ti-15Zr-10Cr alloy (5.89MJ/m(3)) with only β phase and that of Ti-15Zr-3Cr alloy (4.04MJ/m(3)) with α' phase and small fraction of β phase was higher than the elastic energy of c.p. Ti (1.25MJ/m(3)). This study demonstrated that Ti-15Zr-3Cr alloy and Ti-15Zr-10Cr alloy with superior mechanical properties are potential materials for biomedical applications. Copyright © 2015. Published by Elsevier B.V.
NAA using Cf-252 after preconcentration
International Nuclear Information System (INIS)
Panyo, O.; Moebius, S.; Keller, C.
1988-01-01
Neutron activation analysis (NAA) with thermal neutron using Cf-252 sources was applied to elemental analysis of elements in water samples. A high-resolution Ge(Li) detector was employed for gamma-radiation detection. Both suspended particulate matter and liquid fraction were investigated after filtration. Preconcentration method by co-precipitation using iron (III) hydroxide and oxine were chosen for use. Elements which were considered to be able to detect in the present study are Al, As, Cl, K, Mg, Mn, Na, Sr, Ti, U, V and Zn
Microstructure and erosive wear behaviors of Ti6Al4V alloy treated by plasma Ni alloying
Energy Technology Data Exchange (ETDEWEB)
Wang, Z.X.; Wu, H.R.; Shan, X.L.; Lin, N.M.; He, Z.Y., E-mail: tyuthzy@126.com; Liu, X.P.
2016-12-01
Graphical abstract: The Ni modified layers were prepared on the surface of Ti6Al4V substrate by the plasma surface alloying technique. The surface and cross-section morphology, element concentration and phase composition were investigated by thermal field emission scanning electron microscopy (SEM), and glow discharge optical emission spectroscopy (GDOES), X-ray diffraction (XRD), respectively. The cross-section nano-scale hardness of Ni modified layer was measured by nano indenter. The results showed that Ni modified layers exhibited triple layers structure and continuous gradient distribution of the concentration. From the surface to the matrix, they were 2 μm Ni deposition layer, 8 μm Ni-rich alloying layer including the phases of Ni{sub 3}Ti, NiTi, Ti{sub 2}Ni, AlNi{sub 3} and 24 μm Ni-poor alloying layer forming the solid solution of nickel. With increasing of the thickness of Ni modified layer, the microhardness increased first, reached the climax, then gradient decreased. The erosion tests were performed on the surface of the untreated and treated Ti6Al4V sample using MSE (Micro-slurry-jet Erosion) method. The experiment results showed that the wear rate of every layer showed different value, and the Ni-rich alloying layer was the lowest. The strengthening mechanism of Ni modified layer was also discussed. - Highlights: • The Ni modified layers were prepared by the plasma surface alloying technique. • Triple layers structure was prepared. • Using Micro-slurry-jet Erosion method. • The erosion rate of Ni modified layer experienced the process of descending first and then ascending. • Improvement of erosion resistance performance of Ni-rich alloying layer was prominent. The wear mechanism of Ni modified layer showed micro-cutting wearing. - Abstract: The Ni modified layers were prepared on the surface of Ti6Al4V substrate by the plasma surface alloying technique. The surface and cross-section morphology, element concentration and phase composition
Energy Technology Data Exchange (ETDEWEB)
Lou, Jia; Gabbitas, Brian, E-mail: briang@waikato.ac.nz; Yang, Fei; Raynova, Stella; Lu, Huiyang
2016-07-25
A trace amount of LaB{sub 6} powder was added to P/M Ti and Ti–6Al–4V alloy to improve mechanical properties and refine the microstructure. After sintering, TiB whiskers and La{sub 2}O{sub 3} dispersoids had formed in the microstructure. In a CP Ti alloy, the generation of secondary phases leads to a much refined microstructure, but the alignment of TiB whiskers led to a variation in mechanical properties. Open die forging (ODF) or powder compact extrusion (PCE) was carried out on sintered Ti–6Al–4V alloy to further improve the mechanical properties. This caused severe deformation and re-alignment of the TiB whiskers. Comparing the properties of hot worked Ti–6Al–4V alloy and Ti–6Al–4V alloy with boron additions, an addition of LaB{sub 6} leads to slightly lower strength but gives significant better ductility. - Highlights: • LaB{sub 6} powder was added to sintered and hot worked Ti and Ti–6Al–4V alloy. • TiB whiskers and La{sub 2}O{sub 3} dispersoids formed in the microstructure. • Different alignments of TiB{sub w} led to a variation in mechanical properties. • Hot working caused severe deformation and re-alignment of TiB{sub w}. • An addition of LaB{sub 6} is better than pure boron additions.
Energy Technology Data Exchange (ETDEWEB)
Davila R, I
1991-06-15
A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)
Grindability of dental cast Ti-Ag and Ti-Cu alloys.
Kikuchi, Masafumi; Takahashi, Masatoshi; Okabe, Toru; Okuno, Osamu
2003-06-01
Experimental Ti-Ag alloys (5, 10, and 20 mass% Ag) and Ti-Cu alloys (2, 5, and 10 mass% Cu) were cast into magnesia molds using a dental casting machine, and their grindability was investigated. At the lowest grinding speed (500 m min(-1)), there were no statistical differences among the grindability values of the titanium and titanium alloys. The grindability of the alloys increased as the grinding speed increased. At the highest grinding speed (1500 m x min(-1)), the grindability of the 20% Ag, 5% Cu, and 10% Cu alloys was significantly higher than that of titanium. It was found that alloying with silver or copper improved the grindability of titanium, particularly at a high speed. It appeared that the decrease in elongation caused by the precipitation of small amounts of intermetallic compounds primarily contributed to the favorable grindability of the experimental alloys.
Determination of kinetics parameters using stochastic methods in a 252Cf system
International Nuclear Information System (INIS)
Difilippo, F.C.
1988-01-01
Safety analysis and control system design of nuclear systems require the knowledge of neutron kinetics related parameters like effective delayed neutron fraction, neutron lifetime, time between neutron generations and subcriticality margins. Many methods, deterministic and stochastic, are being used, some since the beginning of nuclear power, to measure these important parameters. The method based on the use of the 252 Cf neutron source has been under intense study at the Oak Ridge National Laboratory, both experimentally and theoretically, during the last years. The increasing demand for this isotope in industrial and medical applications and new designs of advanced high flux reactors to produce it make the isotope available as neutron source (only few micrograms are necessary). A thin layer of 252 Cf is deposited in one of the electrodes of a fission chamber which produces pulses each time the 252 Cf disintegrates via α or spontaneous fission decay; the smaller pulses associated with the α decay can be easily discriminated with the important result that we known the time when v/sub c/ neutrons are injected into the system (number of neutrons per fission of 252 Cf). Thus, a small (few cm 3 ) and nonintrusive device can be used as a random pulsed neutron source with known natural properties that do no depend on biases associated with more complex interrogating devices like accelerators. This paper presents a general formalism that relates the kinetics parameters with stochastic descriptors that naturally appear because of the random nature of the production and transport of neutrons
Solidified structure of Al-Pb-Cu alloys
International Nuclear Information System (INIS)
Ikeda, Tetsuyuki; Nishi, Seiki; Kumeuchi, Hiroyuki; Tatsuta, Yoshinori.
1986-01-01
Al-Pb-Cu alloys were cast into bars or plates in different two metal mold casting processes in order to suppress gravity segregation of Pb and to achieve homogeneous dispersion of Pb phase in the alloys. Solidified structures were analyzed by a video-pattern-analyzer. Plate castings 15 to 20 mm in thickness of Al-Pb-1 % Cu alloy containing Pb up to 5 % in which Pb phase particles up to 10 μm disperse are achieved through water cooled metal mold casting. The plates up to 5 mm in thickness containing Pb as much as 8 to 10 % cast in this process have dispersed Pb particles up to 5 μm in diameter in the surface layer. Al-8 % Pb-1 % Cu alloy bars 40 mm in diameter and 180 mm in height in which gravity segregation of Pb is prevented can be cast by movable and water sprayed metal mold casting at casting temperature 920 deg C and mold moving speed 1.0 mm/s. Pb phase particles 10 μm in mean size are dispersed in the bars. (author)
A YOUNG ECLIPSING BINARY AND ITS LUMINOUS NEIGHBORS IN THE EMBEDDED STAR CLUSTER Sh 2-252E
Energy Technology Data Exchange (ETDEWEB)
Lester, Kathryn V.; Gies, Douglas R.; Guo, Zhao, E-mail: lester@chara.gsu.edu, E-mail: gies@chara.gsu.edu, E-mail: guo@chara.gsu.edu [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 5060, Atlanta, GA 30302-5060 (United States)
2016-12-01
We present a photometric and light curve analysis of an eccentric eclipsing binary in the K2 Campaign 0 field, which resides in Sh 2-252E, a young star cluster embedded in an H ii region. We describe a spectroscopic investigation of the three brightest stars in the crowded aperture to identify which is the binary system. We find that none of these stars are components of the eclipsing binary system, which must be one of the fainter nearby stars. These bright cluster members all have remarkable spectra: Sh 2-252a (EPIC 202062176) is a B0.5 V star with razor sharp absorption lines, Sh 2-252b is a Herbig A0 star with disk-like emission lines, and Sh 2-252c is a pre-main-sequence star with very red color.
Silicon Alloying On Aluminium Based Alloy Surface
International Nuclear Information System (INIS)
Suryanto
2002-01-01
Silicon alloying on surface of aluminium based alloy was carried out using electron beam. This is performed in order to enhance tribological properties of the alloy. Silicon is considered most important alloying element in aluminium alloy, particularly for tribological components. Prior to silicon alloying. aluminium substrate were painted with binder and silicon powder and dried in a furnace. Silicon alloying were carried out in a vacuum chamber. The Silicon alloyed materials were assessed using some techniques. The results show that silicon alloying formed a composite metal-non metal system in which silicon particles are dispersed in the alloyed layer. Silicon content in the alloyed layer is about 40% while in other place is only 10.5 %. The hardness of layer changes significantly. The wear properties of the alloying alloys increase. Silicon surface alloying also reduced the coefficient of friction for sliding against a hardened steel counter face, which could otherwise be higher because of the strong adhesion of aluminium to steel. The hardness of the silicon surface alloyed material dropped when it underwent a heating cycle similar to the ion coating process. Hence, silicon alloying is not a suitable choice for use as an intermediate layer for duplex treatment
Analysis of geological material and especially ores by means of a 252Cf source
International Nuclear Information System (INIS)
Barrandon, J.N.; Borderie, B.; Melky, S.; Halfon, J.; Marce, A.
1976-01-01
Tests were made on the possibilities for analysis by 252 Cf activation in the earth sciences and mining research. The results obtained show that while 252 Cf activation can only resolve certain very specific geochemical research problems, it does allow the exact and rapid determination of numerous elements whose ores are of great economic importance such as fluorine, titanium, vanadium, manganese, copper, antimony, barium, and tungsten. The utilization of activation analysis methods in the earth sciences is not a recent phenomenon. It has generally been limited to the analysis of traces in relatively small volumes by means of irradiation in nuclear reactors. Traditional neutron sources were little used and were not very applicable. The development of 252 Cf isotopic sources emitting more intense neutron fluxes make it possible to consider carrying out more sensitive determinations without making use of a nuclear reactor. In addition, this technique can be adapted for in situ analysis in mines and mine borings. Our work which is centered upon the possibilities of instrumental laboratory analyses of geological materials through 252 Cf activation is oriented in two principal directions: the study of the experimental sensitivities of the various elements in different rocks with the usual compositions; and the study of the possibilities for routine ore analyses
Improved Mo-Re VPS Alloys for High-Temperature Uses
Hickman, Robert; Martin, James; McKechnie, Timothy; O'Dell, John Scott
2011-01-01
Dispersion-strengthened molybdenum- rhenium alloys for vacuum plasma spraying (VPS) fabrication of high-temperature-resistant components are undergoing development. In comparison with otherwise equivalent non-dispersion-strengthened Mo-Re alloys, these alloys have improved high-temperature properties. Examples of VPS-fabricated high-temperature-resistant components for which these alloys are expected to be suitable include parts of aircraft and spacecraft engines, furnaces, and nuclear power plants; wear coatings; sputtering targets; x-ray targets; heat pipes in which liquid metals are used as working fluids; and heat exchangers in general. These alloys could also be useful as coating materials in some biomedical applications. The alloys consist of 60 weight percent Mo with 40 weight percent Re made from (1) blends of elemental Mo and Re powders or (2) Re-coated Mo particles that have been subjected to a proprietary powder-alloying-and-spheroidization process. For most of the dispersion- strengthening experiments performed thus far in this development effort, 0.4 volume percent of transition-metal ceramic dispersoids were mixed into the feedstock powders. For one experiment, the proportion of dispersoid was 1 volume percent. In each case, the dispersoid consisted of either ZrN particles having sizes <45 m, ZrO2 particles having sizes of about 1 m, HfO2 particles having sizes <45 m, or HfN particles having sizes <1 m. These materials were chosen for evaluation on the basis of previously published thermodynamic stability data. For comparison, Mo-Re feedstock powders without dispersoids were also prepared.
8 CFR 252.5 - Special procedures for deserters from Spanish or Greek ships of war.
2010-01-01
... Spanish or Greek ships of war. 252.5 Section 252.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY... Greek ships of war. (a) General. Under E.O. 11267 of January 19, 1966 (31 FR 807) and 28 CFR 0.109, and... a ship of war of that government, while in any port of the United States, and on proof by the...
2010-10-01
... subcontractor advance payments-DoD pilot mentor-protege program. 252.232-7005 Section 252.232-7005 Federal... subcontractor advance payments—DoD pilot mentor-protege program. As prescribed in 232.412-70(c), use the following clause: Reimbursement of Subcontractor Advance Payments—DoD Pilot Mentor-Protege Program (SEP 2001...
International Nuclear Information System (INIS)
Maruyama, Y.; van Nagell, J.R.; Yoneda, J.; Donaldson, E.; Gallion, H.; Higgins, R.; Powell, D.; Turner, C.; Kryscio, R.
1988-01-01
A fast-neutron-emitting radioisotope, 252 Cf, is being tested in clinical trials of neutron brachytherapy for cervical cancer. The efficacy for histological eradication of bulky stage IB cervical tumors (mean diameter, approximately 6 cm) using combined radiation and surgery was studied in 65 patients treated with 137 Cs or 252 Cf before surgery during 1983-1986. Forty-four patients were treated with 137 Cs and 21 were treated with 252 Cf at equivalent doses of radiation. Fifteen of the 44 specimens (34%) were positive after 137Cs therapy. Only one of the 21 specimens was positive after 252 Cf therapy (P = .025), and that patient was treated in a delayed schedule 21 days after the start of external-beam irradiation rather than early in the course. 252 Cf therapy required a much lower radiation dose and shorter treatment time. The study compared tumor destruction of an identically staged human cervical tumor in situ by direct histological means, using 252 Cf neutron therapy or conventional photon therapy at an identical and equivalent dose adjusted by a relative biological effectiveness of 6.0 for 252 Cf
Investigating the Acid Failure of Aluminium Alloy in 2 M Hydrochloric Acid Using Vernonia amygdalina
Directory of Open Access Journals (Sweden)
Olugbenga A. Omotosho
2012-04-01
Full Text Available The acid failure of aluminium alloy in 2 M hydrochloric acid solution in the presence of Vernonia amygdalina extract was investigated using gasometric technique. Aluminium alloy coupons of dimension 4 cm by 1 cm were immersed in test solutions of free acid and also those containing extract volumes of 2, 3, 4 and 5 cm3 at ambient temperature for 30 minutes. The volumes of hydrogen gas evolved as a result of the rate of reaction were recorded and analyzed. Analysis revealed that maximum inhibitor efficiency which corresponds to the lowest corrosion rate was obtained at optimum inhibitor volumes of 5 cm3, with reduction in the corrosion rate observed to follow in order of increasing extract volumes. Adsorption study revealed that Temkin isotherm best described the metal surface interaction with the extract phytochemicals, with 12 minutes becoming the best exposure time for the phytochemicals to adsorb to the metal surface at all volumes. Statistical modelling of the corrosion rate yielded an important relationship suitable for estimating corrosion rate values once volumes of the extract is known. Microstructural studies, showed an indirect relationship between crack growth rates and extract volumes, while consistency of the irregular intermetallic phases increases with increasing extract volumes.
Internal chlorination of Ni-Cr alloys
Energy Technology Data Exchange (ETDEWEB)
Berztiss, D.; Hennesen, K.; Grabke, H.J. [Max-Planck-Institut fuer Eisenforschung GmbH, Duesseldorf (Germany)
1998-12-31
In contrast to internal oxidation, sulfidation and carburization, very little information is available regarding internal chlorination, especially diffusion of chlorine in metallic alloys. This paper describes results of experiments on Ni-Cr alloys (<10 wt% Cr) exposed in an atmosphere containing radioactive HCl. The diffusion of chlorine in the alloy can be determined by measurement of residual {beta}-activity from the sample surface. Successively thin layers (0.5-10 {mu}m) of the alloy were removed by lapping and the surface activity was measured to obtain a depth profile. Both single and polycrystalline materials were tested. Through this work it should be determined if there is in fact solubility and diffusion of chlorine in Ni-based alloys as some authors have proposed or if the ingress of chlorine is mainly a grain boundary phenomenon. (orig.)
International Nuclear Information System (INIS)
Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik
2001-01-01
dose equivalent, the instrument was used to measure the dose rate in four separate neutron fields at the NNRC: un-moderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and the WEP neutron howitzer with the 252 Cf at its center. For each of these sources, dose equivalent measurements were performed at source-detector centerline distances ranging from 50 to 200 cm. The reading of the neutron probe in μSv/h was recorded at each position. The Eisenhauer, Schwartz, and Johnson (ESJ) method was used to adjust the measured dose rates for room-returned and air-scattered neutrons. A calibration factor for the instrument is then calculated by dividing the room and air-scatter corrected or 'true' dose rate at 1 m from the source by the theoretical dose at 1 m. Theoretical doses at 1 m in this work were calculated using the MCNP code. Complete modeling of the 252 Cf source geometry and materials as well as any associated source moderators was performed. Fluxes were calculated at 1 m from the sources and converted to ambient dose equivalent using dose conversion coefficients. The errors in the computed ambient dose equivalents range from 1.2% for the un-moderated 252 Cf source to 3.2% for the WEP neutron howitzer calculations. The calibration factors for the ambient dose equivalent readings obtained by dividing the air-scatter and room-return corrected dose rates by the theoretical dose rates are shown in Table I. The agreement is good and perhaps better than it should be since the Air-Scatter values used in the ESJ fit were for the count rate responses of a 25.4-cm-diam detector and not the dose rate response. More measurements with the LB 6411 neutron probe and more detailed analyses of the response data are planned. (authors)
Wear Behavior and Microstructure of Mg-Sn Alloy Processed by Equal Channel Angular Extrusion.
Chen, Jung-Hsuan; Shen, Yen-Chen; Chao, Chuen-Guang; Liu, Tzeng-Feng
2017-11-16
Mg-5wt.% Sn alloy is often used in portable electronic devices and automobiles. In this study, mechanical properties of Mg-5wt.% Sn alloy processed by Equal Channel Angular Extrusion (ECAE) were characterized. More precisely, its hardness and wear behavior were measured using Vickers hardness test and a pin-on-disc wear test. The microstructures of ECAE-processed Mg-Sn alloys were investigated by scanning electron microscope and X-ray diffraction. ECAE process refined the grain sizes of the Mg-Sn alloy from 117.6 μm (as-cast) to 88.0 μm (one pass), 49.5 μm (two passes) and 24.4 μm (four passes), respectively. Meanwhile, the hardness of the alloy improved significantly. The maximum wear resistance achieved in the present work was around 73.77 m/mm³, which was obtained from the Mg-Sn alloy treated with a one-pass ECAE process with a grain size of 88.0 μm. The wear resistance improvement was caused by the grain size refinement and the precipitate of the second phase, Mg₂Sn against the oxidation of the processed alloy. The as-cast Mg-Sn alloy with the larger grain size, i.e., 117.6 μm, underwent wear mechanisms, mainly adhesive wear and abrasive wear. In ECAE-processed Mg-Sn alloy, high internal energy occurred due to the high dislocation density and the stress field produced by the plastic deformation, which led to an increased oxidation rate of the processed alloy during sliding. Therefore, the oxidative wear and a three-body abrasive wear in which the oxide debris acted as the three-body abrasive components became the dominant factors in the wear behavior, and as a result, reduced the wear resistance in the multi-pass ECAE-processed alloy.
Aluminum alloy excellent in neutron absorbing performance
International Nuclear Information System (INIS)
Iida, Tetsuya; Tamamura, Tadao; Morimoto, Hiroyuki; Ouchi, Ken-ichiro.
1987-01-01
Purpose: To obtain structural materials made of aluminum alloys having favorable neutron absorbing performance and excellent in the performance as structural materials such as processability and strength. Constitution: Powder of Gd 2 O 3 as a gadolinium compound or metal gadolinium is uniformly mixed with the powder of aluminum or aluminum alloy. The amount of the gadolinium compound added is set to 0.1 - 30 % by weight. No sufficient neutron absorbing performance can be obtained if it is less than 0.1 % by weight, whereas the processability and mechanical property of the alloy are degraded if it exceeds 30 % by weight. Further, the grain size is set to less about 50 μm. Further, since the neutron absorbing performance varies greatly if the aluminum powder size exceeds 100 μm, the diameter is set to less than about 100 μm. These mixtures are molded in a hot press. This enables to obtain aimed structural materials. (Takahashi, M.)
Directory of Open Access Journals (Sweden)
Bao Lin
2014-10-01
Full Text Available Nano-textured porous metal materials present unique surface properties due to their enhanced surface energy with potential applications in sensing, molecular separation and catalysis. In this paper, commercial alloy foils, including brass (Cu85Zn15 and Cu70Zn30 and white gold (Au50Ag50 foils have been chemically de-alloyed to form nano-porous thin films. The impact of the initial alloy micro-structure and number of phases, as well as chemical de-alloying (DA parameters, including etchant concentration, time and solution temperature on the final nano-porous thin film morphology and properties were investigated by electron microscopy (EM. Furthermore, the penetration depth of the pores across the alloys were evaluated through the preparation of cross sections by focus ion beam (FIB milling. It is demonstrated that ordered pores ranging between 100 nm and 600 nm in diameter and 2–5 μm in depth can be successfully formed for the range of materials tested. The microstructure of the foils were obtained by electron back-scattered diffraction (EBSD and linked to development of pits across the material thickness and surface during DA. The role of selective etching of both noble and sacrificial metal phases of the alloy were discussed in light of the competitive surface etching across the range of microstructures and materials tested.
48 CFR 252.234-7002 - Earned Value Management System.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Earned Value Management... of Provisions And Clauses 252.234-7002 Earned Value Management System. As prescribed in 234.203(2), use the following clause: Earned Value Management System (APR 2008) (a) In the performance of this...
48 CFR 252.227-7007 - License term-running royalty.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term-running... of Provisions And Clauses 252.227-7007 License term—running royalty. As prescribed at 227.7009-4(b), insert the following clause in patent releases, license agreements, and assignments: License Term—Running...
High-Strength Low-Alloy (HSLA) Mg-Zn-Ca Alloys with Excellent Biodegradation Performance
Hofstetter, J.; Becker, M.; Martinelli, E.; Weinberg, A. M.; Mingler, B.; Kilian, H.; Pogatscher, S.; Uggowitzer, P. J.; Löffler, J. F.
2014-04-01
This article deals with the development of fine-grained high-strength low-alloy (HSLA) magnesium alloys intended for use as biodegradable implant material. The alloys contain solely low amounts of Zn and Ca as alloying elements. We illustrate the development path starting from the high-Zn-containing ZX50 (MgZn5Ca0.25) alloy with conventional purity, to an ultrahigh-purity ZX50 modification, and further to the ultrahigh-purity Zn-lean alloy ZX10 (MgZn1Ca0.3). It is shown that alloys with high Zn-content are prone to biocorrosion in various environments, most probably because of the presence of the intermetallic phase Mg6Zn3Ca2. A reduction of the Zn content results in (Mg,Zn)2Ca phase formation. This phase is less noble than the Mg-matrix and therefore, in contrast to Mg6Zn3Ca2, does not act as cathodic site. A fine-grained microstructure is achieved by the controlled formation of fine and homogeneously distributed (Mg,Zn)2Ca precipitates, which influence dynamic recrystallization and grain growth during hot forming. Such design scheme is comparable to that of HSLA steels, where low amounts of alloying elements are intended to produce a very fine dispersion of particles to increase the material's strength by refining the grain size. Consequently our new, ultrapure ZX10 alloy exhibits high strength (yield strength R p = 240 MPa, ultimate tensile strength R m = 255 MPa) and simultaneously high ductility (elongation to fracture A = 27%), as well as low mechanical anisotropy. Because of the anodic nature of the (Mg,Zn)2Ca particles used in the HSLA concept, the in vivo degradation in a rat femur implantation study is very slow and homogeneous without clinically observable hydrogen evolution, making the ZX10 alloy a promising material for biodegradable implants.
Macrophage proinflammatory response to the titanium alloy equipment in dental implantation.
Chen, X; Li, H S; Yin, Y; Feng, Y; Tan, X W
2015-08-07
Titanium alloy and stainless steel (SS) had been widely used as dental implant materials because of their affinity with epithelial tissue and connective tissue, and good physical, chemical, biological, mechanical properties and processability. We compared the effects of titanium alloy and SS on macrophage cytokine expression as well as their biocompatibility. Mouse macrophage RAW264.7 cells were cultured on titanium alloy and SS surfaces. Cells were counted by scanning electron microscopy. A nitride oxide kit was used to detect released nitric oxide by macrophages on the different materials. An enzyme linked immunosorbent assay was used to detect monocyte chemoattractant protein-1 levels. Scanning electron microscopy revealed fewer macrophages on the surface of titanium alloy (48.2 ± 6.4 x 10(3) cells/cm(2)) than on SS (135 ± 7.3 x 10(3) cells/cm(2)). The nitric oxide content stimulated by titanium alloy was 22.5 mM, which was lower than that stimulated by SS (26.8 mM), but the difference was not statistically significant (P = 0.07). The level of monocyte chemoattractant protein-1 released was significantly higher in the SS group (OD value = 0.128) than in the titanium alloy group (OD value = 0.081) (P = 0.024). The transforming growth factor-b1 mRNA expression levels in macrophages after stimulation by titanium alloy for 12 and 36 h were significantly higher than that after stimulation by SS (P = 0.31 and 0.25, respectively). Macrophages participate in the inflammatory response by regulating cytokines such as nitric oxide, monocyte chemoattractant protein-1, and transforming growth factor-b1. There were fewer macrophages and lower inflammation on the titanium alloy surface than on the SS surface. Titanium alloy materials exhibited better biological compatibility than did SS.
Microstructure and properties of Mg-Al binary alloys
Directory of Open Access Journals (Sweden)
ZHENG Wei-chao
2006-11-01
Full Text Available The effects of different amounts of added Al, ranging from 1 % to 9 %, on the microstructure and properties of Mg-Al binary alloys were investigated. The results showed that when the amount of added Al is less than 5%, the grain size of the Mg-Al binary alloys decreases dramatically from 3 097 μm to 151 μm with increasing addition of Al. Further addition of Al up to 9% makes the grain size decrease slowly to 111 μm. The α-Mg dendrite arms are also refined. Increasing the amount of added Al decreases the hot cracking susceptibility of the Mg-Al binary alloys remarkably, and enhances the micro-hardness of the α-Mg matrix.
International Nuclear Information System (INIS)
Ji Gang; Guo Yong; Luo Yisheng; Zhang Wenzhong
2001-01-01
Objective: To provide useful parameters for neutron radiotherapy, the author presents results of a Monte Carlo simulation study investigating the dosimetric characteristics of linear 252 Cf fission neutron sources. Methods: A 252 Cf fission source and tissue equivalent phantom were modeled. The dose of neutron and gamma radiations were calculated using Monte Carlo Code. Results: The dose of neutron and gamma at several positions for 252 Cf in the phantom made of equivalent materials to water, blood, muscle, skin, bone and lung were calculated. Conclusion: The results by Monte Carlo methods were compared with the data by measurement and references. According to the calculation, the method using water phantom to simulate local tissues such as muscle, blood and skin is reasonable for the calculation and measurements of dose distribution for 252 Cf
Evaluation of mass distribution data from 252Cf spontaneous fission
International Nuclear Information System (INIS)
Liu Tingjin
2003-01-01
The mass distribution data of 252 Cf spontaneous fission were evaluated based on 7 sets of available experimental data. The measured data were corrected for the standards and γ intensity used by using the new evaluated ones. The errors were made necessary adjusting. The evaluated experimental data were fitted with spline function without any restriction and with symmetric restriction. These two sets of fit data were recommended as reference data of the mass distribution of 252 Cf spontaneous fission. The errors of the recommended data were considerably reduced comparing with the measured ones. The light and heavy peaks are not completely symmetric. Also there are fine structures on the right side of the light peak at A=109-111 and left side of the heavy peak at A=137-139. These should be paid attention and studied further. (author)
Effective source size as related to 252Cf neutron radiography
International Nuclear Information System (INIS)
Wada, Nobuo; Enomoto, Shigemasa; Tachikawa, Noboru; Nojiri, Toshiaki.
1977-01-01
The effective source size in 252 Cf thermal neutron radiography, relating to its geometrical unsharpness in image formation, is experimentally studied. A neutron radiographic system consists of a 160 μg 252 Cf neutron source, water moderator and divergent cadmium lined collimator. Thermal neutron image detection is performed with using a LiF scintillator and a high speed X-ray film to employ direct exposure method. The modulation transfer function, used for describing image quality, is derived from radiographic image corresponding to a cadmium plate with sharp edge. The modulation transfer function for the system is expressed by the product of the function for both geometrical and inherent unsharpness, and allows isolation of geometrical unsharpness as related to the effective size of the thermal neutron source. It is found to be 80 -- 90% of the collimator inlet diameter. (auth.)
Energy Technology Data Exchange (ETDEWEB)
Suerme, Yavuz, E-mail: ysurme@nigde.edu.t [Department of Chemistry, Faculty of Science and Art, Nigde University, 51200 Nigde (Turkey); Guerten, A. Ali [Department of Chemistry, Faculty of Science and Art, Osmaniye Korkut Ata University, 80000 Osmaniye (Turkey); Bayol, Emel; Ersoy, Ersay [Department of Chemistry, Faculty of Science and Art, Nigde University, 51200 Nigde (Turkey)
2009-10-19
Copper-tin alloy films were galvanostatically electrodeposited on the mild steel (MS) by combining the different amount of Cu and Sn electrolytes at a constant temperature (55 deg. C) and pH (3.5). Alloy films were characterized by using the energy dispersive X-ray analysis (EDX), scanning electron microscopy (SEM), X-ray diffraction (XRD) and micrographing techniques. Corrosion behaviours were evaluated with electrochemical impedance spectrometry (EIS) and electrochemical polarization measurements. Time gradient of electrolysis process was adjusted to obtain same thickness of investigated alloys on MS. The systematic corrosion investigation of various Cu{sub x}-Sn{sub 100-x} (x = 0-100) alloy depositions on MS substrate were carried out in 0.1 M sulphuric acid medium. Results indicate that the corrosion resistance of the alloy coatings depended on the alloy composition, and the corrosion resistance increased at Cu-Sn alloy deposits in proportion to Sn ratio.
Effects of chemical composition on the corrosion of dental alloys.
Galo, Rodrigo; Ribeiro, Ricardo Faria; Rodrigues, Renata Cristina Silveira; Rocha, Luís Augusto; de Mattos, Maria da Glória Chiarello
2012-01-01
The aim of this study was to determine the effect of the oral environment on the corrosion of dental alloys with different compositions, using electrochemical methods. The corrosion rates were obtained from the current-potential curves and electrochemical impedance spectroscopy (EIS). The effect of artificial saliva on the corrosion of dental alloys was dependent on alloy composition. Dissolution of the ions occurred in all tested dental alloys and the results were strongly dependent on the general alloy composition. Regarding the alloys containing nickel, the Ni-Cr and Ni-Cr-Ti alloys released 0.62 mg/L of Ni on average, while the Co-Cr dental alloy released ions between 0.01 and 0.03 mg/L of Co and Cr, respectively.The open-circuit potential stabilized at a higher level with lower deviation (standard deviation: Ni-Cr-6Ti = 32 mV/SCE and Co-Cr = 54 mV/SCE). The potenciodynamic curves of the dental alloys showed that the Ni-based dental alloy with >70 wt% of Ni had a similar curve and the Co-Cr dental alloy showed a low current density and hence a high resistance to corrosion compared with the Ni-based dental alloys. Some changes in microstructure were observed and this fact influenced the corrosion behavior for the alloys. The lower corrosion resistance also led to greater release of nickel ions to the medium. The quantity of Co ions released from the Co-Cr-Mo alloy was relatively small in the solutions. In addition, the quantity of Cr ions released into the artificial saliva from the Co-Cr alloy was lower than Cr release from the Ni-based dental alloys.
48 CFR 252.227-7006 - License grant-running royalty.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License grant-running... of Provisions And Clauses 252.227-7006 License grant—running royalty. As prescribed at 227.7009-4(a...—Running Royalty (AUG 1984) (a) The Contractor hereby grants to the Government, as represented by the...
48 CFR 252.227-7033 - Rights in shop drawings.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in shop drawings... of Provisions And Clauses 252.227-7033 Rights in shop drawings. As prescribed in 227.7107-(1)(c), use the following clause: Rights in Shop Drawings (APR 1966) (a) Shop drawings for construction means...
Stress corrosion cracking of nickel alloys in bicarbonate and chloride solutions
International Nuclear Information System (INIS)
Ares, A. E.; Carranza, R. M.; Giordano, C. M.; Zadorozne, N. S.; Rebak, R.B.
2013-01-01
Alloy 22 is one of the candidates for the manufacture of high level radioactive waste containers. These containers provide services in natural environments characterized by multi-ionics solutions, it is estimated they could suffer three types of deterioration: general corrosion, localized corrosion (crevice corrosion) and stress corrosion cracking (SCC). It has been confirmed that the presence of bicarbonate at temperatures above 60°C and applied potentials around +400 mVSCE are necessary in order to produce cracking, . This susceptibility may be associated to the instability of the passive film formed and to the formation of an anodic current peak in the polarization curves in these media. Until now, it is unclear the role played by each alloying element (Ni, Cr or Mo) in the SCC susceptibility of Alloy 22 in these media The aim of this work is to evaluate the SCC susceptibility of nickel-based alloys in media containing bicarbonate and chloride ions, at high temperature. Slow Strain Rate Testing (SSRT) was conducted to samples of different alloys: 22 (Ni-Cr-Mo), 600 (Ni-Cr-Fe), 800H (Ni-Fe-Cr) y 201 (99.5% Ni).This tests were conducted in 1.1 mol/L NaHCO 3 +1.5 mol/L NaCl a 90°C and different applied potentials (+200mVSCE,+300 mVSCE, +400 mVSCE). These results were complemented with those obtained in a previous work, where we studied the anodic electrochemical behavior of nickel base alloys under the same conditions. It was found that alloy 22 showed a current peak in a potential range between +200 mVSCE and +300 mVSCE when immersed in bicarbonate ions containing solutions. This peak was attributed to the presence of chromium in the alloys. The SSRT showed that only alloy 22 has a clear indication of stress corrosion cracking. The current results suggested that the presence of an anodic peak in the polarization curves was not a sufficient condition for cracking. (author)
The structure-property relationships of powder processed Fe-Al-Si alloys
Energy Technology Data Exchange (ETDEWEB)
Prichard, Paul D. [Iowa State Univ., Ames, IA (United States)
1998-02-23
Iron-aluminum alloys have been extensively evaluated as semi-continuous product such as sheet and bar, but have not been evaluated by net shape P/M processing techniques such as metal injection molding. The alloy compositions of iron-aluminum alloys have been optimized for room temperature ductility, but have limited high temperature strength. Hot extruded powder alloys in the Fe-Al-Si system have developed impressive mechanical properties, but the effects of sintering on mechanical properties have not been explored. This investigation evaluated three powder processed Fe-Al-Si alloys: Fe-15Al, Fe-15Al-2.8Si, Fe-15Al-5Si (atomic %). The powder alloys were produced with a high pressure gas atomization (HPGA) process to obtain a high fraction of metal injection molding (MIM) quality powder (D84 < 32 μm). The powders were consolidated either by P/M hot extrusion or by vacuum sintering. The extruded materials were near full density with grain sizes ranging from 30 to 50 μm. The vacuum sintering conditions produced samples with density ranging from 87% to 99% of theoretical density, with an average grain size ranging from 26 μm to 104 μm. Mechanical property testing was conducted on both extruded and sintered material using a small punch test. Tensile tests were conducted on extruded bar for comparison with the punch test data. Punch tests were conducted from 25 to 550 C to determine the yield strength, and fracture energy for each alloy as a function of processing condition. The ductile to brittle transition temperature (DBTT) was observed to increase with an increasing silicon content. The Fe-15Al-2.8Si alloy was selected for more extensive testing due to the combination of high temperature strength and low temperature toughness due to the two phase α + DO3 structure. This investigation provided a framework for understanding the effects of silicon in powder processing and mechanical property behavior of Fe-Al-Si alloys.
Thermal stability and glass-forming ability of amorphous Nd-Al-TM (TM=Fe, Co, Ni or Cu) alloys
International Nuclear Information System (INIS)
Inoue, A.; Zhang Tao
1997-01-01
Bulk amorphous alloys were prepared for Nd 70 Al 10 TM 20 and Nd 60 Al 10 TM 30 (TM=Fe or Co) alloys by copper mold casting. The maximum sample thickness for glass formation reaches 15 mm for the Nd-Al-Fe alloys and 5 mm for the Nd-Al-Co alloys. A significant difference in the phase transition upon heating is recognized between the Fe- and Co-containing alloys. No glass transition before crystallization is observed for the Nd-Al-Fe alloys, but the Nd-Al-Co alloys exhibit the glass transition. The ΔT x (=T x -T g ) and T g /T m are 40-55 K and 0.65-0.67, respectively, for the latter alloys. The absence of supercooled liquid for the former alloys is different from those for all bulk amorphous alloys reported up to date. The T x /T m and ΔT m (=T m -T x ) are 0.85-0.89 and 88-137 K, respectively, for the Nd-Al-Fe alloys and, hence, the large glass-forming ability is presumably due to the high T x /T m and small ΔT m values. (orig.)
Directory of Open Access Journals (Sweden)
Jung-Fa Tsai
2017-07-01
Full Text Available This case–control study aimed to assess the interactive effect between polymorphisms of lymphotoxin (LT α +252 and habitual substance use on risk of hepatocellular carcinoma (HCC. We enrolled 150 pairs of sex- and age-matched HCC patients and unrelated healthy controls. LTα genotypes were detected with polymerase-chain reaction and restrictive fragment length polymorphisms. Information about habits of substance use was obtained through personal interview. Multivariate analysis indicated that LTα +252 G/G genotypes [odds ratio (OR = 3.36], Hepatitis B surface antigen (OR = 16.68, antibodies to hepatitis C virus (OR = 34.88 and having at least two habits of substance use (OR = 2.50 were independent risk factors for HCC. There were additive interactions among LTα +252 G/G genotype, chronic viral hepatitis, and habit of each substance use. In conclusion: There are independent and additive interactions between LTα +252 G/G genotype, chronic viral hepatitis, and habits of substance use on risk of HCC.
Activation analyses for different fusion structural alloys
International Nuclear Information System (INIS)
Attaya, H.; Smith, D.
1991-01-01
The leading candidate structural materials, viz., the vanadium alloys, the nickel or the manganese stabilized austenitic steels, and the ferritic steels, are analysed in terms of their induced activation in the TPSS fusion power reactor. The TPSS reactor has 1950 MW fusion power and inboard and outboard average neutron wall loading of 3.75 and 5.35 MW/m 2 respectively. The results shows that, after one year of continuous operation, the vanadium alloys have the least radioactivity at reactor shutdown. The maximum difference between the induced radioactivity in the vanadium alloys and in the other iron-based alloys occurs at about 10 years after reactor shutdown. At this time, the total reactor radioactivity, using the vanadium alloys, is about two orders of magnitude less than the total reactor radioactivity utilizing any other alloy. The difference is even larger in the first wall, the FW-vanadium activation is 3 orders of magnitude less than other alloys' FW activation. 2 refs., 7 figs
Radiation stability of chromium low alloys
International Nuclear Information System (INIS)
Chakin, V.P.; Kazakov, V.A.
1990-01-01
Radiation effect on the behaviour of mechanical properties and structure of chromium low alloys such as VKh-2K, KhP-3, VKhM in the wide range of temperatures and neutron fluences is studied. Radiation stability of the alloys is shown to be limited by low-temperature radiation embrittlement (LTRE), caused by radiation hardening as a result of formation of radiation-induced defects such as dislocation loops and vacancy voids in the structure. The methods for prevention LTRE of chromium alloys are suggested. 8 refs.; 8 figs
48 CFR 252.228-7001 - Ground and flight risk.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Ground and flight risk... of Provisions And Clauses 252.228-7001 Ground and flight risk. As prescribed in 228.370(b), use the following clause: Ground and Flight Risk (JUN 2010) (a) Definitions. As used in this clause— (1) Aircraft...
48 CFR 252.227-7020 - Rights in special works.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in special works... of Provisions And Clauses 252.227-7020 Rights in special works. As prescribed in 227.7105-3, 227.7106(a) or 227.7205(a), use the following clause: Rights in Special Works (JUN 1995) (a) Applicability...
International Nuclear Information System (INIS)
Chen, Jian; Wang, Jianqiu; Han, Enhou; Dong, Junhua; Ke, Wei
2007-01-01
The corrosion behavior of an AZ91 magnesium alloy in 0.1 M sodium sulfate solution at the corrosion potential (E corr ) was investigated using electrochemical impedance spectroscopy (EIS), environmental scanning electron microscopy (ESEM), energy dispersive X-ray spectroscopy (EDS), and X-ray photoelectron spectroscopy (XPS). The results showed that when the immersion time was less than 18th, general corrosion occurred on the surface and the main corrosion products were hydroxides and sulfates. The film coverage effect was the main mechanism for the corrosion process of AZ91 alloy. At this stage, the matrix had a better corrosion resistance. With the increasing immersion time, pitting occurred on the surface. At this stage, the corrosion process was controlled by three surface state variables: the area fraction θ 1 of the region controlled by the formation of Mg(OH) 2 , the area fraction θ 2 of the region controlled by the precipitation of MgAl 2 (SO 4 ) 4 .2H 2 O, and the metastable Mg + concentration C m
Acoustic properties of TiNiMoFe base alloys
International Nuclear Information System (INIS)
Gyunter, V.Eh.; Chernyshev, V.I.; Chekalkin, T.L.
2000-01-01
The regularity of changing the acoustic properties of the TiNi base alloys in dependence on the alloy composition and impact temperature is studied. It is shown that the oscillations of the TiNiMoFe base alloys within the temperature range of the B2 phase existence and possible appearance of the martensite under the load differ from the traditional materials oscillations. After excitation of spontaneous oscillations within the range of M f ≤ T ≤ M d there exists the area of long-term and low-amplitude low-frequency acoustic oscillations. It is established that free low-frequency oscillations of the TH-10 alloy sample are characterized by the low damping level in the given temperature range [ru
International Nuclear Information System (INIS)
Saikawa, Seiji; Nakai, Kiyoshi; Sugiura, Yasuo; Kamio, Akihiko.
1995-01-01
Mechanical properties and microstructures of various Al-Li-Mg alloy castings containing small amount of Zr and/or Ti were investigated. The δ(AlLi) phase was observed to crystallize in the dendrite-cell gaps as well as on the grain boundaries. Microsegregation of Mg also occurred in the solidified castings. The β(Al 3 Zr) or Al-Zr-Ti compounds crystallize during solidification and remain even after solid solution treatment at 803 K for 36 ks. The grain sizes of Al-2.5%Li-2%Mg alloy castings become finer by the addition of 0.15%Zr and 0.12%Ti compared with each addition of 0.15%Zr or 0.12%Ti. The age hardening is accelerated by the addition of 0.15%Zr. In an Al-2.5%Li-2%Mg-0.15%Zr-0.12%Ti alloy casting poured into a metallic mold and aged at 453 K for 36 ks, ultimate tensile strength, Young's modulus and density were 417 MPa, 80 GPa and was 2.52 g/cm 3 , respectively. Its specific strength and modulus are higher by 50.3 and 13.9% than those of the conventional AC4C-T6 casting. (author)
Superplastic Deformation of TC6 Alloy
Directory of Open Access Journals (Sweden)
DING Ling
2016-12-01
Full Text Available The superplastic tensile tests of TC6 alloy were conducted in the temperature range of 800-900℃ by using the maximum m value superplasticity deformation (Max m SPD method and the constant strain rate deformation method at the strain rate range of 0.0001-0.1 s-1. The stress-strain curve of the tensile tests was obtained and the microstructure near the fracture were analyzed by metallographic microscope. The result shows that the superplasticity of TC6 alloy is excellent, and the elongation increases first and then decreases with the increase of strain rate or temperature. When the temperature is 850℃ and strain rate is 0.001 s-1 at constant stain rate tensile tests, the elongation reaches up to 993%. However, the elongation using Max m SPD method at 850℃ is 1353%. It is shown that the material can achieve better superplasticity by using Max m SPD tensile compared to constant stain rate tensile under the same temperature. The superplastic deformation of TC6 alloy can enhance the dynamic recrystallization behavior significantly, the dynamic recrystallization behavior is promoted when strain rate and temperature are increased.
Zr/ZrC modified layer formed on AISI 440B stainless steel by plasma Zr-alloying
Shen, H. H.; Liu, L.; Liu, X. Z.; Guo, Q.; Meng, T. X.; Wang, Z. X.; Yang, H. J.; Liu, X. P.
2016-12-01
The surface Zr/ZrC gradient alloying layer was prepared by double glow plasma surface alloying technique to increase the surface hardness and wear resistance of AISI 440B stainless steel. The microstructure of the Zr/ZrC alloying layer formed at different alloying temperatures and times as well as its formation mechanism were discussed by using scanning electron microscopy, glow discharge optical emission spectrum, X-ray diffraction and X-ray photoelectron spectroscopy. The adhesive strength, hardness and tribological property of the Zr/ZrC alloying layer were also evaluated in the paper. The alloying surface consists of the Zr-top layer and ZrC-subsurface layer which adheres strongly to the AISI 440B steel substrate. The thickness of the Zr/ZrC alloying layer increases gradually from 16 μm to 23 μm with alloying temperature elevated from 900 °C to 1000 °C. With alloying time from 0.5 h to 4 h, the alloyed depth increases from 3 μm to 30 μm, and the ZrC-rich alloyed thickness vs time is basically parabola at temperature of 1000 °C. Both the hardness and wear resistance of the Zr/ZrC alloying layer obviously increase compared with untreated AISI 440B steel.
The electrochemical properties of melt-spun Al-Si-Cu alloys
International Nuclear Information System (INIS)
Zhang Linping; Wang Fei; Liang Pu; Song Xianlei; Hu Qing; Sun Zhanbo; Song Xiaoping; Yang Sen; Wang Liqun
2011-01-01
Highlights: → Non-equilibrium Al 75-X Si 25 Cu X alloys exhibit high lithiation storages. → The lithiation mechanism is different from melt-spun Al-Si-Mn system. → The structural evolution is mitigated in the non-equilibrium alloys. → Volume variation is alleviated due to the co-existence of Al 2 Cu, α-Si and α-Al. - Abstract: Melt spinning was used to prepare Al 75-X Si 25 Cu X (X = 1, 4, 7, 10 mol%) alloy anode materials for lithium-ion batteries. A metastable supersaturated solid solution of Si and Cu in fcc-Al, α-Si and Al 2 Cu co-existed in the alloys. Nano-scaled α-Al grains, as the matrix, formed in the as-quenched ribbons. The Al 74 Si 25 Cu 1 and Al 71 Si 25 Cu 4 anodes exhibited initial discharge specific capacities of 1539 mAh g -1 , 1324 mAh g -1 and reversible capacities above 472 mAh g -1 , 508 mAh g -1 at the 20th cycle, respectively. The specific capacities reduced as the increase of the Cu content. AlLi intermetallic compound was detected in the lithiated alloys. It is concluded that the lithiation mechanism of the Al-Si-based alloys can be affected by the third component. The structural evolution and volume variation can be mitigated due to the formation of non-equilibrium state and the co-existence of nano-scaled α-Al, α-Si, and Al 2 Cu for the present alloys.
Electroplating technologies of alloys
International Nuclear Information System (INIS)
Kim, Joung Soo; Kim, Seung Ho; Jeong, Hyun Kyu; Hwnag, Sung Sik; Seo, Yong Chil; Kim, Dong Jin; Seo, Moo Hong
2001-12-01
In localization of electrosleeving technique, there are some problems like the following articles. Firstly, Patents published by OHT have claimed Ni-P, Ni-B alloy plating and Mo, Mn Cr, W, Co as a pinning agent. Secondly, alloy platings have many restrictions. There are some method to get alloy plating in spite of the various restrictions. If current density increase above limiting current density in one of the metals, both of the metals discharge at the same time. The addition of surface active agent(sufactant) in the plating solution is one of the methods to get alloy plating. Alloy plating using pulse current easily controls chemical composition and structure of deposit. Ni-Fe alloy plating is known to exhibit anomalous type of plating behavior in which deposition of the less noble metal is favoured. Presence of hypophohphite ion can control the iron codeposition by changing the deposition mechanism. Hypophohphite suppresses the deposition of Fe and also promotes Ni. Composite plating will be considered to improve the strength at the high temperature. Addition of particle size of 10δ400μm makes residual stress compressive in plate layer and suppress the grain growth rate at the high temperature. Addition of particle makes suface roughness high and fracture stress low at high temperature. But, selection of the kinds of particle and control of additives amount overcome the problems above
Monte Carlo simulation using MCNP4B for an optimal shielding design of a 252 Cf source
International Nuclear Information System (INIS)
Silva, Ademir X. da; Crispim, Verginia R.
2001-01-01
This study aim to investigate an optimum shielding design against neutrons and gamma-rays from a source of 252 Cf, using Monte Carlo simulation. The shielding materials studied were: borated polyethylene, borated-lead polyethylene and stainless steel. The Monte Carlo code MCNP, version 4B, was used to design shielding for 252 Cf based neutron irradiator systems. By normalizing the dose equivalent rate values presented to the neutron production rate of the source, the resulting calculations are independents of the intensity of actual 252 Cf source. The results shown what the total dose equivalent rates were reduced significantly by the shielding system optimization. (author)
Directory of Open Access Journals (Sweden)
Dudzik Krzysztof
2016-09-01
Full Text Available Friction welding associated with mixing the weld material (FSW - Friction Stir Welding is an alternative to MIG and TIG welding techniques for Al-alloys. This paper presents experimental results obtained from static tension tests on specimens made of AW-7020M and AW-7020 alloys and their joints welded by using FSW method carried out on flat specimens, according to Polish standards : PN-EN ISO 4136:2011 and PN-EN ISO 6892-1:2010. Results of corrosion resistance tests are also presented. The tests were performed by using the electrochemical impedance spectroscopy (EIS. EIS measurement was conducted with the use of three-electrode system in a substitute sea water environment (3,5% NaCl - water solution. The impedance tests were carried out under corrosion potential. Voltage signal amplitude was equal to 10mV, and its frequency range - 100 kHz ÷ 0,1 Hz. Atlas 0531 EU&IA potentiostat was used for the tests. For the tested object an equivalent model was selected in the form of a substitute electric circuit. Results of the impedance spectroscopy tests are presented in the form of parameters which characterize corrosion process, as well as on Nyquist’s graphs together with the best-fit theoretical curve.
Fatigue behavior of alloy 600 in sodium chloride solution at room temperature
International Nuclear Information System (INIS)
Ho, J.-T.; Yu, G.-P.
2004-01-01
Fatigue crack growth (FCG) rates of mill annealed Alloy 600 in NaCI solution were studied by a fracture mechanics test method. Compact tension (CT) specimens were tested under load control with a sinusoidal wave form, in accordance with ASTM specification E647-83, to investigate the effects of environment, load frequency (f), load ratio (R=Pmin/Pmax). The FCG rates of Alloy 600, R=0.1, f=1Hz, were quite similar in air, distilled water, and NaCI (0.6 M, 0.1 M, and 0.001 M) solution at room temperature. Environmental enhancement effect on the FCG rate of Alloy 600 was not significant in NaCI solution. Variations of the load frequency (0.03Hz-3Hz) did not influence the FCG rates of Alloy 600 significantly in air and 0.1 M NaCI solution. The FCG rates of Alloy 600 in air and 0.1 M NaCI solution increased with increasing the load ratio. Compared with the corrosion effects, test results showed that the mechanical effects dominated on the FCG rates of Alloy 600 in chloride solution at room temperature. The SEM fractographs showed that significant striations and transgranular fracture modes were observed on tested specimens. (author)
48 CFR 252.225-7008 - Restriction on Acquisition of Specialty Metals.
2010-10-01
... CLAUSES Text of Provisions And Clauses 252.225-7008 Restriction on Acquisition of Specialty Metals. As... more of the following limits: Manganese, 1.65 percent; silicon, 0.60 percent; or copper, 0.60 percent...
Influence of microstructure on the accelerated corrosion in Zr-Nb alloys
International Nuclear Information System (INIS)
Muller, S; Lanzani, L
2012-01-01
The influence of microstructure on the accelerated corrosion of Zr-1%Nb and Zr-2.5%Nb (CANDU's pressure tube material) has been studied. The behavior of Zircaloy-4 was also studied in order to compare the Zr-Nb alloys with an alloy that does not have niobium as an alloying element. The corrosion tests were carried out in LiOH 0.1M at 340 o C, in LiOH 1M at the same temperature and in steam at 400 o C. The results showed that the behavior of Zr-Nb alloys in steam at 400 o C is similar to that of Zircaloy-4 in this medium. However, Zr-Nb alloys are more sensitive than Zircaloy-4 to the presence of LiOH. The results suggest that the niobium concentration in the matrix is the parameter that defines the oxidation rate in Zr-Nb alloys, while the presence of second phases in these alloys (β--Zr/β-Nb/Zr-Nb-Fe) could be related with the growth of non-protective oxides in LiOH solutions. In LiOH 1M, the corrosion resistance of Zr-Nb alloys is similar to that of Zircaloy-4, except for the Zr-1Nb martensitic material which showed a sharp increase in the oxidation rate in this medium (author)
Cf-252 based neutron radiography using real-time image processing system
International Nuclear Information System (INIS)
Mochiki, Koh-ichi; Koiso, Manabu; Yamaji, Akihiro; Iwata, Hideki; Kihara, Yoshitaka; Sano, Shigeru; Murata, Yutaka
2001-01-01
For compact Cf-252 based neutron radiography, a real-time image processing system by particle counting technique has been developed. The electronic imaging system consists of a supersensitive imaging camera, a real-time corrector, a real-time binary converter, a real-time calculator for centroid, a display monitor and a computer. Three types of accumulated NR image; ordinary, binary and centroid images, can be observed during a measurement. Accumulated NR images were taken by the centroid mode, the binary mode and ordinary mode using of Cf-252 neutron source and those images were compared. The centroid mode presented the sharpest image and its statistical characteristics followed the Poisson distribution, while the ordinary mode showed the smoothest image as the averaging effect by particle bright spots with distributed brightness was most dominant. (author)
Energy Technology Data Exchange (ETDEWEB)
Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.
1976-01-01
About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.
Porous Nb-Ti based alloy produced from plasma spheroidized powder
Li, Qijun; Zhang, Lin; Wei, Dongbin; Ren, Shubin; Qu, Xuanhui
2017-01-01
Spherical Nb-Ti based alloy powder was prepared by the combination of plasma spheroidization and mechanical alloying. Phase constituents, microstructure and surface state of the powder, and pore characteristics of the resulting porous alloy were investigated. The results show that the undissolved W and V in the mechanically alloyed powder is fully alloyed after spheroidization, and single β phase is achieved. Particle size of the spheroidized powder is in the range of 20–110 μm. With the decr...
Manigandan, K.; Srivatsan, T. S.; Tammana, Deepthi; Poorgangi, Behrang; Vasudevan, Vijay K.
2014-05-01
The focus of this technical manuscript is a record of the specific role of microstructure and test specimen orientation on cyclic stress response, cyclic strain resistance, and cyclic stress versus strain response, deformation and fracture behavior of alloy steel 300 M. The cyclic strain amplitude-controlled fatigue properties of this ultra-high strength alloy steel revealed a linear trend for the variation of log elastic strain amplitude with log reversals-to-failure, and log plastic strain amplitude with log reversals-to-failure for both longitudinal and transverse orientations. Test specimens of the longitudinal orientation showed only a marginal improvement over the transverse orientation at equivalent values of plastic strain amplitude. Cyclic stress response revealed a combination of initial hardening for the first few cycles followed by gradual softening for a large portion of fatigue life before culminating in rapid softening prior to catastrophic failure by fracture. Fracture characteristics of test specimens of this alloy steel were different at both the macroscopic and fine microscopic levels over the entire range of cyclic strain amplitudes examined. Both macroscopic and fine microscopic observations revealed fracture to be a combination of both brittle and ductile mechanisms. The underlying mechanisms governing stress response, deformation characteristics, fatigue life, and final fracture behavior are presented and discussed in light of the competing and mutually interactive influences of test specimen orientation, intrinsic microstructural effects, deformation characteristics of the microstructural constituents, cyclic strain amplitude, and response stress.
2010-10-01
...-basic steel, aluminum, brass, bronze, or copper mill products. 252.216-7000 Section 252.216-7000 Federal... adjustment—basic steel, aluminum, brass, bronze, or copper mill products. As prescribed in 216.203-4-70(a... Mill Products (JUL 1997) (a) Definitions. As used in this clause— Established price means a price which...
Medical applications of californium-252
International Nuclear Information System (INIS)
Oliver, G.D. Jr.
1975-01-01
Primarily, californium-252 sources have been utilized in medicine for the treatment of neoplastic lesions. For five years, a coordinated effort between several cancer research institutions and national laboratories has developed the necessary physics, radiobiology, and engineering skills to establish an evaluation program for californium. Several more years of combined effort are required before it is known whether californium therapy is as good as or better than conventional therapy with sources like radium. Recently, development of diagnostic applications of californium in medicine has received attention. Studies comparing neutron decay activation analysis versus prompt capture gamma ray analysis are in progress. A hopeful application of prompt analysis with reasonable quantities (200 μg) of californium is the elemental analysis of bone in the human body. (U.S.)
The microstructures of ordered alloys
International Nuclear Information System (INIS)
Sarma, G.M.K.; Ranganathan, S.
1977-01-01
The phenomenon of ordering in substitutional alloys confers special properties on them by introducing various types of structures and structural defects. Some of the important structural defects (translational and rotational antiphase boundaries, dissociated antiphase boundaries and superdislocations) and their observation by various microscopical methods, with particular emphasis on the applications of the electron microscope are described with illustrations drawn from the studies on nickel-molybdenum and nickel-tungsten alloys. (M.G.B.)
International Nuclear Information System (INIS)
Yasuoka, Shigekazu; Magari, Yoshifumi; Murata, Tetsuyuki; Tanaka, Tadayoshi; Ishida, Jun; Nakamura, Hiroshi; Nohma, Toshiyuki; Kihara, Masaru; Baba, Yoshitaka; Teraoka, Hirohito
2006-01-01
New R-Mg-Ni (R: rare earths) superlattice alloys with higher-capacity and higher-durability than the conventional Mm-Ni alloys with CaCu 5 structure have been developed. The oxidation resistibility of the superlattice alloys has been improved by optimizing the alloy composition by such as substituting aluminum for nickel and optimizing the magnesium content in order to prolong the battery life. High-capacity nickel-metal hydride batteries for the retail market, the Ni-MH2500/900 series (AA size type 2500mAh, AAA size type 900mAh), have been developed and commercialized by using an improved superlattice alloy for negative electrode material. alized by using an improved superlattice alloy for negative electrode material. (author)
48 CFR 252.242-7004 - Material management and accounting system.
2010-10-01
... CLAUSES Text of Provisions And Clauses 252.242-7004 Material management and accounting system. As prescribed in 242.7204, use the following caluse: Material Management and Accounting System (JUL 2009) (a) Definitions. As used in this clause— (1) Material management and accounting system (MMAS) means the Contractor...
Strength and ductility of Ni3Al alloyed with boron and substitutional elements
International Nuclear Information System (INIS)
Ishikawa, K.; Aoki, K.; Masumoto, T.
1995-01-01
The effect of simultaneous alloying of boron (B) and the substitutional elements M on mechanical properties of Ni 3 Al was investigated by the tensile test at room temperature. The yield strength of Ni 3 Al+B increases by alloying with M except for Fe and Ga. In particular, it increases by alloying with Hf, Nb, W, Ta, Pd and Si. The fracture strength of Ni 3 Al+B increases by alloying with Pd, Ga, Si and Hf, but decreases with the other elements. Elongation of Ni 3 Al+B increases by alloying with Ga, Fe and Pd, but decreases with other elements. Hf and Pd is the effective element for the increase of the yield strength and the fracture strength of Ni 3 Al+B, respectively. Alloying with Hf leads to the increases of the yield strength and the fracture strength of Ni 3 Al+B, but to the lowering of elongation. On the other hand, alloying with Pd improves all mechanical properties, i.e. the yield strength, the fracture strength and elongation. On the contrary, alloying with Ti, V and Co leads to the lowering of mechanical properties of Ni 3 Al+B. The reason why ductility of Ni 3 Al+B is reduced by alloying with some elements M is discussed
Laser surface alloying of aluminium-transition metal alloys
International Nuclear Information System (INIS)
Almeida, A.; Vilar, R.
1998-01-01
Laser surface alloying has been used as a tool to produce hard and corrosion resistant Al-transition metal (TM) alloys. Cr and Mo are particularly interesting alloying elements to produce stable high-strength alloys because they present low diffusion coefficients and solid solubility in Al. To produce Al-TM surface alloys a two-step laser process was developed: firstly, the material is alloyed using low scanning speed and secondly, the microstructure is modified by a refinement step. This process was used in the production of Al-Cr, Al-Mo and Al-Mo and Al-Nb surface alloys by alloying Cr, Mo or Nb powder into an Al and 7175 Al alloy substrate using a CO 2 laser . This paper presents a review of the work that has been developed at Instituto Superior Tecnico on laser alloying of Al-TM alloy, over the last years. (Author) 16 refs
Emissivity measurements on aeronautical alloys
International Nuclear Information System (INIS)
Campo, L. del; Perez-Saez, R.B.; Gonzalez-Fernandez, L.; Esquisabel, X.; Fernandez, I.; Gonzalez-Martin, P.; Tello, M.J.
2010-01-01
The emissivity of three Ni and Co based aeronautical alloys is analyzed in this paper. These alloys are employed in high temperature environments whenever good corrosion resistance, high temperature resistance and high strength are essential. Thus, apart from the aeronautical industry, these alloys are also used in other technological applications, as for example, aerospace, nuclear reactors, and tooling. The results in this paper extend the emissivity data for these alloys available in the literature. Emissivity dependence on the radiation wavelength (2-22 μm), sample temperature (200-650 o C) and emission angle (0-85 o ) has been investigated. In addition, the effect of surface finish and oxidation has also been taken into consideration. The data in this paper have several applications, as temperature measurement of a target by pyrometry, low observability of airplanes and thermal radiation heat transfer simulation in airplane nozzles or furnaces.
Emissivity measurements on aeronautical alloys
Energy Technology Data Exchange (ETDEWEB)
Campo, L. del, E-mail: leire.del-campo@cnrs-orleans.f [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Perez-Saez, R.B., E-mail: raul.perez@ehu.e [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Instituto de Sintesis y Estudio de Materiales, Universidad del Pais Vasco, Apdo. 644, 48080 Bilbao (Spain); Gonzalez-Fernandez, L. [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Esquisabel, X.; Fernandez, I. [Industria de Turbo Propulsores, S.A., Planta de Zamudio, Edificio 300, 48170 Zamudio, Bizkaia (Spain); Gonzalez-Martin, P. [Industria de Turbo Propulsores, S.A., Parque empresarial San Fernando, Avda. Castilla 2, 28830 San Fernando de Henares, Madrid (Spain); Tello, M.J. [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Instituto de Sintesis y Estudio de Materiales, Universidad del Pais Vasco, Apdo. 644, 48080 Bilbao (Spain)
2010-01-21
The emissivity of three Ni and Co based aeronautical alloys is analyzed in this paper. These alloys are employed in high temperature environments whenever good corrosion resistance, high temperature resistance and high strength are essential. Thus, apart from the aeronautical industry, these alloys are also used in other technological applications, as for example, aerospace, nuclear reactors, and tooling. The results in this paper extend the emissivity data for these alloys available in the literature. Emissivity dependence on the radiation wavelength (2-22 {mu}m), sample temperature (200-650 {sup o}C) and emission angle (0-85{sup o}) has been investigated. In addition, the effect of surface finish and oxidation has also been taken into consideration. The data in this paper have several applications, as temperature measurement of a target by pyrometry, low observability of airplanes and thermal radiation heat transfer simulation in airplane nozzles or furnaces.
International Nuclear Information System (INIS)
Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu; Wang Dong
2011-01-01
Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ( 252 Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with 252 Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7–12 Gy per insertion per week, with a total dose of 29–45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16–38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44–56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of 252 Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.
The electrochemical properties of melt-spun Al-Si-Cu alloys
Energy Technology Data Exchange (ETDEWEB)
Zhang Linping; Wang Fei; Liang Pu; Song Xianlei; Hu Qing [MOE Key Laboratory for Non-equilibrium Synthesis and Modulation of Condensed Matter, State Key Laboratory for Mechanical Behavior of Materials, Xi' an Jiaotong University, Xi' an 710049 (China); Sun Zhanbo, E-mail: szb@mail.xjtu.edu.cn [MOE Key Laboratory for Non-equilibrium Synthesis and Modulation of Condensed Matter, State Key Laboratory for Mechanical Behavior of Materials, Xi' an Jiaotong University, Xi' an 710049 (China); Song Xiaoping; Yang Sen; Wang Liqun [MOE Key Laboratory for Non-equilibrium Synthesis and Modulation of Condensed Matter, State Key Laboratory for Mechanical Behavior of Materials, Xi' an Jiaotong University, Xi' an 710049 (China)
2011-10-03
Highlights: {yields} Non-equilibrium Al{sub 75-X}Si{sub 25}Cu{sub X} alloys exhibit high lithiation storages. {yields} The lithiation mechanism is different from melt-spun Al-Si-Mn system. {yields} The structural evolution is mitigated in the non-equilibrium alloys. {yields} Volume variation is alleviated due to the co-existence of Al{sub 2}Cu, {alpha}-Si and {alpha}-Al. - Abstract: Melt spinning was used to prepare Al{sub 75-X}Si{sub 25}Cu{sub X} (X = 1, 4, 7, 10 mol%) alloy anode materials for lithium-ion batteries. A metastable supersaturated solid solution of Si and Cu in fcc-Al, {alpha}-Si and Al{sub 2}Cu co-existed in the alloys. Nano-scaled {alpha}-Al grains, as the matrix, formed in the as-quenched ribbons. The Al{sub 74}Si{sub 25}Cu{sub 1} and Al{sub 71}Si{sub 25}Cu{sub 4} anodes exhibited initial discharge specific capacities of 1539 mAh g{sup -1}, 1324 mAh g{sup -1} and reversible capacities above 472 mAh g{sup -1}, 508 mAh g{sup -1} at the 20th cycle, respectively. The specific capacities reduced as the increase of the Cu content. AlLi intermetallic compound was detected in the lithiated alloys. It is concluded that the lithiation mechanism of the Al-Si-based alloys can be affected by the third component. The structural evolution and volume variation can be mitigated due to the formation of non-equilibrium state and the co-existence of nano-scaled {alpha}-Al, {alpha}-Si, and Al{sub 2}Cu for the present alloys.
The characteristics of corrosion, radiation degradation and dissolution of titanium alloys
International Nuclear Information System (INIS)
Sung, K. W.; Na, J. W.; Choi, B. S.; Lee, D. J.; Chang, M. H.
2001-12-01
In order to establish the technical bases of water chemistry design requirement related titanium alloys, we investigated the characteristics of corrosion, activation, radiation degradation, radiation hydrogen embrittlement of titanium alloys and dissolution of titanium dioxide. Titanium alloys generally have high corrosion resistance. Corrosion product release from PT-7M and PT-3V titanium alloy surface for 18 months of operation is negligible, and the corrosion penetration for about 30 years is about 1 μm, while the corrosion rates is not higher than one third of that of austenitic steel. Titanium only converts into Sc-46 with 85 day halflife after neutron irradiation, and its radioactivity is not higher than one thousandth of that produced from nickel. Therefore, under the condition without any neutron irradiation, the radiation damage of titanium alloys would have no problem. Titanium dioxide, that protects the metals from the corrosion, has retrograde solubility in neutral solutions. It does not form any complexes with ligands such as ammonia, but Ti(IV) gets more stable by complexing with water molecules. In conclusion, it is estimated that titanium alloys such as PT-7M would be applicable to steam generator materials
International Nuclear Information System (INIS)
Murali, M.S.; Nair, A.G.C.; Gujar, R.B.; Jain, A.; Tomar, B.S.; Godbole, S.V.; Reddy, A.V.R.; Manchanda, V.K.
2008-07-01
The present report gives a description of the methodology for the separation of 248 Cm(III) from decayed 252 Cf (III) waste solution. The waste solution was first assayed for 252 Cf content by neutron counting using a neutron well coincidence counter. The sample was subjected to the chemical separation of 248 Cm (III) from 252 Cf (III) following anion and cation exchange chromatography. The alpha spectrum of the separated curium fraction showed peaks due to 246 Cm and 248 Cm while the corresponding alpha spectrum of californium fraction showed 249,250,251,252 Cf. The gamma ray abundances of 249 Cf were determined with respect to its gamma rays of 387 keV and the data agreed well with that in literature. Separated Cm(III) was further characterized by recording its time resolved fluorescence spectrum (TRFS) in aqueous medium. (author)
Grain refinement of AZ91D magnesium alloy by a new Mg–50%Al4C3 master alloy
International Nuclear Information System (INIS)
Liu, Shengfa; Chen, Yang; Han, Hui
2015-01-01
A novel and simple method for preparing Mg–50%Al 4 C 3 (hereafter in wt.%) master alloy has been developed by powder in-situ synthesis process under argon atmosphere. X-ray diffraction (XRD), scanning electron microscope (SEM) and energy dispersive X-ray spectroscopy (EDS) results show the existence of Al 4 C 3 particles in this master alloy. After adding 1.8% Mg–50%Al 4 C 3 master alloy, the average grain size of α-Mg decreased from 360 μm to 154 μm. Based on the DTA test results and calculation of the planar disregistry between Al 4 C 3 and α-Mg, Al 4 C 3 particles located in the central regions of magnesium grains can act as the heterogeneous nucleus of primary α-Mg phase
Measurement and Analysis of Density of Molten Ni-W Alloys
Institute of Scientific and Technical Information of China (English)
FANG Liang; XIAO Feng; TAO Zainan; MuKai Kusuhiro
2005-01-01
The density of molten Ni-W alloys was measured with a modified pycnometric method. It is found that the density of the molten Ni- W alloys decreases with temperature rising, but increases with the increase of tungsten concentration in the alloys. The molar volume of molten Ni- W binary alloys increases with the increase of temperature and tungsten concentration. The partial molar volume of tungsten in liquid Ni- W binary alloy has been calculated approximately as ( - 1.59+ 5.64 × 10-3 T) × 10-6m3 ·mol-1.
Room temperature creep in metals and alloys
Energy Technology Data Exchange (ETDEWEB)
Deibler, Lisa Anne [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States). Materials Characterization and Performance
2014-09-01
Time dependent deformation in the form of creep and stress relaxation is not often considered a factor when designing structural alloy parts for use at room temperature. However, creep and stress relaxation do occur at room temperature (0.09-0.21 Tm for alloys in this report) in structural alloys. This report will summarize the available literature on room temperature creep, present creep data collected on various structural alloys, and finally compare the acquired data to equations used in the literature to model creep behavior. Based on evidence from the literature and fitting of various equations, the mechanism which causes room temperature creep is found to include dislocation generation as well as exhaustion.
International Nuclear Information System (INIS)
Hatch, C.E.
1995-05-01
This document is the Functional Design Criteria for Project W-252. Project W-252 provides the scope to provide BAT/AKART (best available technology...) to 200 Liquid Effluent Phase II streams (B-Plant). This revision (Rev. 2) incorporates a major descoping of the project. The descoping was done to reflect a combination of budget cutting measures allowed by a less stringent regulatory posture toward the Phase II streams
Apparao, K. Ch; Birru, Anil Kumar
2018-01-01
A novel Al-3.5FeNb-1.5C master alloy with uniform microstructure was prepared using a melt reaction process for this study. In the master alloy, basic intermetallic particles such as NbAl3, NbC act as heterogeneous nucleation substrates during the solidification of aluminium. The grain refining performance of the novel master alloy on Al-Si9.8-Cu3.4 alloy has also been investigated. It is observed that the addition of 0.1 wt.% of Al-3.5FeNb-1.5C master alloy can induce very effective grain refinement of the Al-Si9.8-Cu3.4 alloy. The average grain size of α-Al is reduced to 22.90 μm from about 61.22 μm and most importantly, the inoculation of Al-Si9.8-Cu3.4 alloy with FeNb-C is not characterised by any visible poisoning effect, which is the drawback of using commercial Al-Ti-B master alloys on aluminium cast alloys. Therefore, the mechanical properties of the Al-Si9.8-Cu3.4 alloy have been improved obviously by the addition of the 0.1 wt.% of Al-3.5FeNb-1.5C master alloy, including the yield strength and elongation.
Long range ordered alloys modified by addition of niobium and cerium
International Nuclear Information System (INIS)
Liu, C.T.
1987-01-01
A long range ordered alloy composition is described consisting essentially of iron, nickel, cobalt, vanadium and a ductility enhancing metal, having the nominal composition (Fe, Ni,Co)/sub 3/(V,M) where M is the ductility enhancing metal selected from the group Ti, Zr, Hf and mixtures thereof. Effective amounts of creep property enhance elements selected from the group cerium, niobium and mixtures thereof sufficient to enhance creep properties in the resulting alloy without adversely affecting the fabrication of the alloy
Testing of ENDF/B cross section data in the Californium-252 neutron benchmark field
International Nuclear Information System (INIS)
Mannhart, W.
1979-01-01
The fission neutron field of 252 Cf presently represents one of the most well-known neutron benchmark fields. For 13 neutron reactions which are of importance in reactor metrology, measurements of spectrum-averaged cross sections, [sigma], performed in this neutron field were compared with calculated average cross sections. This comparison allows one to draw conclusions as to the quality of different sigma(E) data taken from ENDF/B-IV, from ENDF/B-V, and from recent experiments and used in the calculation of average cross sections. The comparison includes an uncertainty analysis regarding the different uncertainty contributions of [sigma], of sigma(E), and of the spectral distribution of 252 Cf fission neutrons. Additionally, in a few examples, sensitivity studies were carried out. The sensitivity of the spectrum-averaged cross sections to individual characteristics of the sigma(E) data, such as normalization factors or shifts in the energy scale, was investigated. Similarly, the sensitivity of [sigma] to the spectral distribution of 252 Cf was determined. 4 figures, 2 tables
Yasuoka, Shigekazu; Magari, Yoshifumi; Murata, Tetsuyuki; Tanaka, Tadayoshi; Ishida, Jun; Nakamura, Hiroshi; Nohma, Toshiyuki; Kihara, Masaru; Baba, Yoshitaka; Teraoka, Hirohito
New R-Mg-Ni (R: rare earths) superlattice alloys with higher-capacity and higher-durability than the conventional Mm-Ni alloys with CaCu 5 structure have been developed. The oxidation resistibility of the superlattice alloys has been improved by optimizing the alloy composition by such as substituting aluminum for nickel and optimizing the magnesium content in order to prolong the battery life. High-capacity nickel-metal hydride batteries for the retail market, the Ni-MH2500/900 series (AA size type 2500 mAh, AAA size type 900 mAh), have been developed and commercialized by using an improved superlattice alloy for negative electrode material.
Effect of strontium on the texture and mechanical properties of extruded Mg–1%Mn alloys
International Nuclear Information System (INIS)
Borkar, Hemant; Hoseini, Majid; Pekguleryuz, Mihriban
2012-01-01
Highlights: ► Mg–1%Mn and Mg–1%Mn–(0.3–2)Sr alloys were extruded at elevated temperature. ► Strontium additions refine extruded microstructure of M1 alloys. ► Sr additions weaken the basal texture of extruded M1, improve the ductility and reduce the yield asymmetry. ► Texture weakening with increasing strontium additions is the result of particle stimulated nucleation (PSN). - Abstract: Magnesium–manganese, M1, alloy is preferred for extrusion applications due to its extrudability. It is mainly used as a sacrificial anode or as a creep resistant alloy at elevated temperatures in the nuclear industry. Since Mn does not provide a significant strengthening effect, the alloy is not considered for structural applications. The basal texture which forms after extrusion orients the basal planes parallel to the extrusion direction causing anisotropy in mechanical properties. This basal texture, as well as the low strength of the alloy are the main challenges in its widespread applications. In this study, the effect of Sr addition on the texture and mechanical properties of M1 alloy was studied. M1–Sr alloys showed weakened texture by developing random texture components during extrusion. The texture randomisation is attributed to particle stimulated nucleation (PSN) around Mg–Sr intermetallics during recrystallisation. M1–Sr compositions are found to show improved strength and ductility as well as reduced yield asymmetry.
48 CFR 252.228-7000 - Reimbursement for war-hazard losses.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reimbursement for war... CLAUSES Text of Provisions And Clauses 252.228-7000 Reimbursement for war-hazard losses. As prescribed in 228.370(a), use the following clause: Reimbursement for War-Hazard Losses (DEC 1991) (a) Costs for...
Magnetic properties of the binary Nickel/Bismuth alloy
Energy Technology Data Exchange (ETDEWEB)
Keskin, Mustafa; Şarlı, Numan, E-mail: numansarli82@gmail.com
2017-09-01
Highlights: • We model and investigate the magnetic properties of the Ni/Bi alloy within the EFT. • Magnetizations of the Ni/Bi alloy are observed as Bi1 > Bi2 > Ni/Bi > Ni at T < Tc. • Magnetization of the Bi1 is dominant and Ni is at least dominant T < Tc. • Total magnetization of the Ni/Bi alloy is close to those of Ni at T < Tc. • Hysteresis curves are overlap at T < 0.1 and they behave separately at T > 0.1. - Abstract: Magnetic properties of the binary Nickel/Bismuth alloy (Ni/Bi) are investigated within the effective field theory. The Ni/Bi alloy has been modeled that the rhombohedral Bi lattice is surrounded by the hexagonal Ni lattice. According to lattice locations, Bi atoms have two different magnetic properties. Bi1 atoms are in the center of the hexagonal Ni atoms (Ni/Bi1 single layer) and Bi2 atoms are between two Ni/Bi1 bilayers. The Ni, Bi1, Bi2 and Ni/Bi undergo a second-order phase transition from the ferromagnetic phase to paramagnetic phase at Tc = 1.14. The magnetizations of the Ni/Bi alloy are observed as Bi1 > Bi2 > Ni/Bi > Ni at T < Tc; hence the magnetization of the Bi1 is dominant and Ni is at least dominant. However, the total magnetization of the Ni/Bi alloy is close to magnetization of the Ni at T < Tc. The corcivities of the Ni, Bi1, Bi2 and Ni/Bi alloy are the same with each others, but the remanence magnetizations are different. Our theoretical results of M(T) and M(H) of the Ni/Bi alloy are in quantitatively good agreement with the some experimental results of binary Nickel/Bismuth systems.
J. E. Martínez-Suárez; L. Camblor; S. Salva; W. A. de Jongh
2005-01-01
Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor.Two hundred fifty two patients with diagnosis of lumba...
Microstructural characterization of Y{sub 2}O{sub 3} ODS-Fe-Cr model alloys
Energy Technology Data Exchange (ETDEWEB)
Castro, V. de [Department of Materials, University of Oxford, Oxford OX1 3PH (United Kingdom)], E-mail: vanessa.decastro@materials.ox.ac.uk; Leguey, T.; Munoz, A.; Monge, M.A.; Pareja, R. [Departamento de Fisica, Universidad Carlos III de Madrid, 28911 Leganes (Spain); Marquis, E.A.; Lozano-Perez, S.; Jenkins, M.L. [Department of Materials, University of Oxford, Oxford OX1 3PH (United Kingdom)
2009-04-30
Two Fe-12 wt% Cr alloys, one containing 0.4 wt% Y{sub 2}O{sub 3} and the other Y{sub 2}O{sub 3}-free, have been produced by mechanical alloying followed by hot isostatic pressing. These oxide dispersion strengthened and reference alloys were characterized both in the as-HIPed state and after tempering by transmission electron microscopy and atom-probe tomography. The as-HIPed alloys exhibited the characteristic microstructure of lath martensite and contained a high density of dislocations. Small voids with sizes <10 nm were also observed. Both alloys also contained M{sub 3}C and M{sub 23}C{sub 6} carbides (M = Cr, Fe) probably as a result of C ingress during milling. After tempering at 1023 K for 4 h the microstructures had partially recovered. In the recovered regions, martensite laths were replaced by equiaxed grains in which M{sub 23}C{sub 6} carbides decorated the grain boundaries. In the ODS alloy nanoparticles containing Y were commonly observed within grains, although they were also present at grain boundaries and adjacent to large carbides.
Microstructural characterization of Y2O3 ODS-Fe-Cr model alloys
International Nuclear Information System (INIS)
Castro, V. de; Leguey, T.; Munoz, A.; Monge, M.A.; Pareja, R.; Marquis, E.A.; Lozano-Perez, S.; Jenkins, M.L.
2009-01-01
Two Fe-12 wt% Cr alloys, one containing 0.4 wt% Y 2 O 3 and the other Y 2 O 3 -free, have been produced by mechanical alloying followed by hot isostatic pressing. These oxide dispersion strengthened and reference alloys were characterized both in the as-HIPed state and after tempering by transmission electron microscopy and atom-probe tomography. The as-HIPed alloys exhibited the characteristic microstructure of lath martensite and contained a high density of dislocations. Small voids with sizes 3 C and M 23 C 6 carbides (M = Cr, Fe) probably as a result of C ingress during milling. After tempering at 1023 K for 4 h the microstructures had partially recovered. In the recovered regions, martensite laths were replaced by equiaxed grains in which M 23 C 6 carbides decorated the grain boundaries. In the ODS alloy nanoparticles containing Y were commonly observed within grains, although they were also present at grain boundaries and adjacent to large carbides.
International Nuclear Information System (INIS)
Bakhsheshi-Rad, H.R.; Idris, M.H.; Abdul-Kadir, M.R.; Ourdjini, A.; Medraj, M.; Daroonparvar, M.; Hamzah, E.
2014-01-01
Highlights: • Quaternary alloy show better mechanical and corrosion properties than binary alloy. • Mg–2Ca–0.5Mn–2Zn alloy showed suitable mechanical properties for bone application. • The improved corrosion resistance with addition of Mn and Zn into the Mg–Ca alloy. • Formation of protective surface film Mn-containing magnesium on quaternary alloy. • Secondary phases have strong effect on micro-galvanic corrosion of Mg alloys. - Abstract: Binary Mg–xCa alloys and the quaternary Mg–Ca–Mn–xZn were studied to investigate their bio-corrosion and mechanical properties. The surface morphology of specimens was characterized by X-ray diffraction (XRD), Fourier-transformed infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). The results of mechanical properties show that the yield strength (YS), ultimate tensile strength (UTS) and elongation of quaternary alloy increased significantly with the addition of zinc (Zn) up to 4 wt.%. However, further addition of Zn content beyond 4 wt.% did not improve yield strength and ultimate tensile strength. In contrast, increasing calcium (Ca) content has a deleterious effect on binary Mg–Ca alloys. Compression tests of the magnesium (Mg) alloys revealed that the compression strength of quaternary alloy was higher than that of binary alloy. However, binary Mg–Ca alloy showed higher reduction in compression strength after immersion in simulated body fluid. The bio-corrosion behaviour of the binary and quaternary Mg alloys were investigated using immersion tests and electrochemical tests. Electrochemical tests shows that the corrosion potential (E corr ) of binary Mg–2Ca significantly shifted toward nobeler direction from −1996.8 to −1616.6 mV SCE with the addition of 0.5 wt.% manganese (Mn) and 2 wt.% Zn content. However, further addition of Zn to 7 wt.% into quaternary alloy has the reverse effect. Immersion tests show that the quaternary
Chloride removal from plutonium alloy
International Nuclear Information System (INIS)
Holcomb, H.P.
1983-01-01
SRP is evaluating a program to recover plutonium from a metallic alloy that will contain chloride salt impurities. Removal of chloride to sufficiently low levels to prevent damaging corrosion to canyon equipment is feasible as a head-end step following dissolution. Silver nitrate and mercurous nitrate were each successfully used in laboratory tests to remove chloride from simulated alloy dissolver solution containing plutonium. Levels less than 10 ppM chloride were achieved in the supernates over the precipitated and centrifuged insoluble salts. Also, less than 0.05% loss of plutonium in the +3, +4, or +6 oxidation states was incurred via precipitate carrying. These results provide impetus for further study and development of a plant-scale process to recover plutonium from metal alloy at SRP
Fabrication and Characterization of novel W80Ni10Nb10 alloy produced by mechanical alloying
Saxena, R.; Patra, A.; Karak, S. K.; Pattanaik, A.; Mishra, S. C.
2016-02-01
Nanostructured tungsten (W) based alloy with nominal composition of W80Ni10Nb10 (in wt. %) was synthesized by mechanical alloying of elemental powders of tungsten (W), nickel (Ni), niobium (Nb) in a high energy planetary ball-mill for 20 h using chrome steel as grinding media and toluene as process control agent followed by compaction at 500 MPa pressure for 5 mins and sintering at 1500°C for 2 h in Ar atmosphere. The phase evolution and the microstructure of the milled powder and consolidated product were investigated by X-ray diffraction (XRD), Scanning electron microscopy (SEM) and Transmission electron microscopy (TEM). The crystallite size of W in W80Ni10Nb10 powder was reduced from 100 μm at 0 h to 45.6 nm at 10 h and 34.1 nm at 20 h of milling whereas lattice strain increases to 35% at 20 h of milling. The dislocation density shows sharp increase up to 5 h of milling and the rate of increase drops beyond 5 to 20 h of milling. The lattice parameter of tungsten in W80Ni10Nb10 expanded upto 0.04% at 10 h of milling and contracted upto 0.02% at 20 h of milling. The SEM micrograph revealed the presence of spherical and elongated particles in W80Ni10Nb10 powders at 20 h of milling. The particle size decreases from 100 μm to 2 μm with an increase in the milling time from 0 to 20 hours. The crystallite size of W in milled W80Ni10Nb10 alloy as evident from bright field TEM image was in well agreement with the measured crystallite size from XRD. Structure of W in 20 h milled W80Ni10Nb10 alloy was identified by indexing of selected area diffraction (SAD) pattern. Formation of NbNi intermetallic was evident from XRD pattern and SEM micrograph of sintered alloy. Maximum sinterability of 90.8% was achieved in 20 h milled sintered alloy. Hardness and wear study was also conducted to investigate the mechanical behaviour of the sintered product. Hardness of W80Ni10Nb10 alloy reduces with increasing load whereas wear rate increases with increasing load. The evaluated
LCF behavior of Zr-4 alloy at elevated temperature
International Nuclear Information System (INIS)
Ye Yuming; Cai Lixun
2006-01-01
A series of strain fatigue tests were carried out on small bugle-like slice-specimens of Zr-4 alloy at room temperature and 400 degree C. According to Elastic and Plastic Finite Element Analysis and assumption of local damage equivalence, a strain conversion equation was given to transform the transverse strain of the specimen to the axial strain. Based on the test results of the alloy and the strain conversion equation, fatigue life estimation equations of Zr-4alloy, or M-C (Manson-Coffin) models, were obtained. The results showed that, Zr-4 alloy had obvious cyclic hardening character during high amplitude strain at different temperatures, but showed reverse character during low amplitude strain. Elevated temperature lowered seriously the fatigue life of Zr-4 alloys, ann as the increasing of amplitude strain, temperature effect impaired gradually. Analysis showed that the prediction life by using M-C model based on the traditional strain conversion equation was quite conservative when axial strain amplitude was less than 5000 micro-strain. (authors)
Magnetic properties of centrifugally prepared melt-spun Nd-Fe-B alloys and their powders
International Nuclear Information System (INIS)
Andreev, S.V.; Kudrevatykh, N.V.; Kozlov, A.I.; Markin, P.E.; Pushkarskiy, V.I.
1998-01-01
Magnetic hysteresis properties and microstructure peculiarities of melt spun Nd-Fe-B alloys (ribbons) prepared by melt quenching on to the internal surface of an iron spinning wheel at the tangential speeds in the range 5-20 m/sec are reported. The alloy composition was Nd-36% wt. B-1.2% wt. and Fe-reminder. It was found that the coercivity of ribbons does not practically depend on the wheel speed in the applied range (1430 kA/m at 5 m/sec and 1750 kA/m at 20 m/sec), whereas the grain size of the basic phase (2-14-1) steadily decreases when the speed rises, starting from 2-3 μm for 5 m sec alloy down to the 200-300 nm for 20 m/sec alloy. All ribbons have normal convex demagnetization curves, even those prepared at low wheel speeds (without peculiar step near H∝0, which usually exists on such curves for traditionally prepared underquenched melt-spun Nd-Fe-B alloys). Grinding the ribbons subjected to hydrogen and annealing treatments causes the coercivity drop. However, this operations increase the powder alignment ability and, as a result, the energy product for fully dense magnet from such powder rises to 160-180 kJ/m 3 . (orig.)
International Nuclear Information System (INIS)
Oliveira, Mara Cristina Lopes de
2009-01-01
HDDR process has attracted great interest for producing polymer- bonded rare earth based magnets. It presents commercial advantages when compared with conventional sintered magnets owing to easy and low cost manufacturing. With the development of anisotropic powders using praseodymium, the expectations about this process grow e also the need for studying new compositions and alloy additions. In this work the magnetic properties of polymer-bonded magnets prepared with PrFeB magnetic alloys using HDDR process have been studied. Pr 14 Fe bal Co 16 B 6 Nb 0,1 was used as the reference alloy Phosphorus, copper, aluminium, gallium and gadolinium additions have been performed to increase the magnetic properties of the reference alloy. The microstructural characterization of the magnets has been carried out through optical microscopy and SEM. The complex microstructure influences the electrochemical behavior of the magnetic alloys. The literature about this subject is scarce. Thus, the corrosion resistance of the different alloys prepared during this work was evaluated using electrochemical impedance spectroscopy and potentiodynamic polarization curves. A correlation between the microstructural features and the electrochemical behavior of the alloys has been established. The results showed that phosphorus and aluminium additions up to 1.0wt% had a beneficial effect on the magnetic properties and corrosion resistance of the alloys. Copper additions, on the other hand, strongly diminished the magnetic properties of the reference alloy. (author)
48 CFR 252.227-7019 - Validation of asserted restrictions-Computer software.
2010-10-01
..., creates or implies privity of contract between the Government and the Contractor's subcontractors or... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7019 Validation of asserted restrictions..., unless otherwise specifically indicated, the term “Contractor” means the Contractor and its...
Zr/ZrC modified layer formed on AISI 440B stainless steel by plasma Zr-alloying
Energy Technology Data Exchange (ETDEWEB)
Shen, H.H.; Liu, L.; Liu, X.Z.; Guo, Q.; Meng, T.X.; Wang, Z.X.; Yang, H.J.; Liu, X.P., E-mail: liuxiaoping@tyut.edu.cn
2016-12-01
Highlights: • A Zr/ZrC modified layer was formed on AISI 440B stainless steel using plasma surface Zr-alloying. • The thickness of the modified layer increases with alloying temperature and time. • Formation mechanism of the modified layer is dependent on the mutual diffusion of Zr and substrate elements. • The modified surface shows an improved wear resistance. - Abstract: The surface Zr/ZrC gradient alloying layer was prepared by double glow plasma surface alloying technique to increase the surface hardness and wear resistance of AISI 440B stainless steel. The microstructure of the Zr/ZrC alloying layer formed at different alloying temperatures and times as well as its formation mechanism were discussed by using scanning electron microscopy, glow discharge optical emission spectrum, X-ray diffraction and X-ray photoelectron spectroscopy. The adhesive strength, hardness and tribological property of the Zr/ZrC alloying layer were also evaluated in the paper. The alloying surface consists of the Zr-top layer and ZrC-subsurface layer which adheres strongly to the AISI 440B steel substrate. The thickness of the Zr/ZrC alloying layer increases gradually from 16 μm to 23 μm with alloying temperature elevated from 900 °C to 1000 °C. With alloying time from 0.5 h to 4 h, the alloyed depth increases from 3 μm to 30 μm, and the ZrC-rich alloyed thickness vs time is basically parabola at temperature of 1000 °C. Both the hardness and wear resistance of the Zr/ZrC alloying layer obviously increase compared with untreated AISI 440B steel.
Clinicopathological study of 252 jaw bone periapical lesions from a private pathology laboratory.
Lin, Hung-Pin; Chen, Hsin-Ming; Yu, Chuan-Hang; Kuo, Ru-Cheng; Kuo, Ying-Shiung; Wang, Yi-Ping
2010-11-01
Periapical lesions are common sequelae of pulp diseases. This retrospective study evaluated the clinical and histopathological features of periapical lesions sent to a private pathology laboratory by dentists in private clinics. Two hundred and fifty-two consecutive cases of periapical lesions were collected from September 2005 to October 2009. Clinical data and histopathological features of these periapical lesions were reviewed and analyzed. The 252 periapical lesions consisted of 128 periapical granulomas, 117 periapical cysts, and seven periapical scars. These 252 lesions were taken from 252 patients (92 men and 160 women; mean age = 43.6 years; range, 9-81 years). Of the 252 periapical lesions, 186 were found in the maxilla and 66 in the mandible. The most common site for periapical lesions was the maxillary anterior region (134 cases, including 73 granulomas, 54 cysts and 7 scars), and the most frequently involved tooth was the maxillary lateral incisor (64 cases, including 29 granulomas, 31 cysts and 4 scars). Of the 117 periapical cysts, 116 were lined by stratified squamous epithelium and one by mucoepidermoid epithelium. Hyaline bodies were discovered in the lining epithelium of four periapical cysts. Odontogenic epithelial rest, cholesterol cleft, foamy histiocytes, hemosiderin-laden macrophages, dystrophic calcification, foreign bodies, and bacterial clumps were found in five, three, nine, two, 28, 10 and one periapical granulomas, respectively, as well as in six, 11, eight, seven, 19, nine and eight periapical cysts, respectively. Granulomas and cysts were the two most common periapical lesions. Periapical lesions occurred more frequently in female patients and in those in their fourth to fifth decades. The most commonly affected site for periapical lesions was the maxillary anterior region, and the most frequently involved tooth was the maxillary lateral incisor. Copyright © 2010 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All
Cf-252 neutron brachytherapy: an advance for bulky localized cancer therapy
International Nuclear Information System (INIS)
Maruyama, Y.
1984-01-01
The physical and radiobiogical basis as well as the rationale for neutron brachytherapy, using Cf-252, in human cancer therapy is reviewed. Cf-252 brachytherapy represents an economical and effective form of neutron radiotherapy that is readily and safely applied clinically. It can be used anywhere in the world without unusual personnel, equipment or facilities, or prohibitive expenses or maintenance costs. Used on bulky head and neck, thoracic, abdominal, pelvic, brain and appendage cancers, it overcomes hypoxic radioresistance and produces remarkable rates of tumor clearance. It is easily combined with photon radiotherapy and in proper schedules and doses, it can control advanced but still localized regional cancers to produce tumor cure. It will clear the local manifestations of recurrent or metastatic tumors or advanced stages of primary tumors and therefore in conjunction with other adjuvant therapies offers much more effective tumor control and palliation than present conventional therapy. (Auth.)
International Nuclear Information System (INIS)
Kandavel, T.K.; Chandramouli, R.; Karthikeyan, P.
2012-01-01
Highlights: ► Corrosion of low alloy P/M steels under HCl acid pickling environment has been studied. ► Influence of density, strain and alloying elements on the rate of corrosion of the steels has been investigated. ► Residual porosity has significant effect on acid corrosion. ► Addition of the alloying elements Cu, Mo and Ti reduces the corrosion rate significantly. ► Carbide forming elements Mo and Ti improve further the resistance of the steels to aqueous corrosion. -- Abstract: Low alloy steels produced through powder metallurgy route of sintering followed by forging are promising candidate materials for high strength small components. Porosity in such steels poses a real challenge during acid pickling treatment, which is one of the processing steps during manufacturing. The present research work attempts to investigate the mechanism underlying the acid corrosion behaviour of some sintered low alloy steels under induced acid pickling conditions. Sintered-forged low alloy steel samples containing molybdenum (Mo), copper (Cu) and titanium (Ti) were subjected to aqueous corrosion attack by immersing the samples in 18% HCl (Hydrochloric acid) solution for 25 h. Sample weight loss and Fe (Iron) loss were estimated for the corroded samples. The morphology of the corroded surfaces was studied through metallography and scanning electron microscopy. Higher porosity alloys underwent enhanced corrosion rates. Both corrosion rate and iron loss are found to decrease linearly with reduction in porosity in all cases of the alloys. The alloying elements Mo, Ti and Cu, when added in combination, have played a complementary role in the reduction of corrosion rate by almost one order of magnitude compared to unalloyed steel. Presence of carbides of the carbide forming elements Mo and Ti played a positive role on the corrosion behaviour of the low alloy steels.
Neutron irradiation effect on thermomechanical properties of shape memory alloys
International Nuclear Information System (INIS)
Abramov, V.Ya.; Ionajtis, R.R.; Kotov, V.V.; Loguntsev, E.N.; Ushakov, V.P.
1996-01-01
Alloys of Ti-Ni, Ti-Ni-Pd, Fe-Mn-Si, Mn-Cu-Cr, Mn-Cu, Cu-Al-Mn, Cu-Al-Ni systems are investigated after irradiation in IVV-2M reactor at various temperatures with neutron fluence of 10 19 - 10 20 cm -2 . The degradation of shape memory effect in titanium nickelide base alloys is revealed after irradiation. Mn-Cu and Mn-Cu-Cr alloys show the best results. Trends in shape memory alloy behaviour depending on irradiation temperature are found. A consideration is given to the possibility of using these alloys for components of power reactor control and protection systems [ru
Hydroxyapatite coating by biomimetic method on titanium alloy ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 28; Issue 6. Hydroxyapatite coating by biomimetic method on titanium alloy using concentrated SBF. S Bharati M K Sinha ... Optical microscopic and SEM observations revealed the deposition of Ca–P layer on the titanium alloy by both the methods. Thickness of coating ...
Structure and grindability of cast Ti-5Cr-xFe alloys
International Nuclear Information System (INIS)
Hsu, H.-C.; Pan, C.-H.; Wu, S.-C.; Ho, W.-F.
2009-01-01
The purpose of this study was to investigate the structure, microhardness and grindability of Ti-5Cr and a series of ternary Ti-5Cr-xFe alloys with 0.1, 0.5, 1, 3 and 5 wt.% Fe, respectively. This study evaluated the phase and structure of Ti-5Cr and Ti-5Cr-xFe alloys, using an X-ray diffraction (XRD) for phase analysis and optical microscope for microstructure of the etched alloys. In addition, grindability was evaluated by measuring the amount of metal volume removed after grinding for 1 min at each of the four rotational speeds of the wheel (500, 750, 1000 or 1200 m/min), with the goal of developing a titanium alloy with better machinability than commercially pure titanium (c.p. Ti). The results showed that the structure of Ti-5Cr-xFe alloys is sensitive to the Fe content. With Fe contents higher than 0.5 wt.%, the equi-axed β phase is entirely retained, while ω phase was found in the Ti-5Cr, Ti-5Cr-0.1Fe, Ti-5Cr-0.5Fe and Ti-5Cr-1Fe alloys. The largest quantity of ω phase and highest microhardness were found in Ti-5Cr-0.5Fe and Ti-5Cr-1Fe alloys. The grinding rates of the Ti-5Cr and Ti-5Cr-xFe alloys showed a similar tendency to the microhardness. The Ti-5Cr, Ti-5Cr-0.1Fe, Ti-5Cr-0.5Fe and Ti-5Cr-1Fe alloys exhibited the best grindability, especially at 500, 750 and 1000 m/min. Furthermore, the grindability of the tested metals increased in proportion to grinding speed up to 1000 m/min, with a decrease after 1200 m/min. This study concluded that Fe may be used to harden titanium and improve the grindability
Rosalbino, F; Delsante, S; Borzone, G; Scavino, G
2012-05-01
Titanium alloys exhibit excellent corrosion resistance in most aqueous media due to the formation of a stable oxide film, and some of these alloys (particularly Ti-6Al-7Nb) have been chosen for surgical and odontological implants for their resistance and biocompatibility. Treatment with fluorides (F(-)) is known to be the main method for preventing plaque formation and dental caries. Toothpastes, mouthwashes, and prophylactic gels can contain from 200 to 20,000 ppm F(-) and can affect the corrosion behaviour of titanium alloy devices present in the oral cavity. In this work, the electrochemical corrosion behaviour of Ti-1M alloys (M = Ag, Au, Pd, Pt) was assessed in artificial saliva of pH = 3.0 containing 910 ppm F(-) (0.05 M NaF) through open circuit potential, E(OC), and electrochemical impedance spectroscopy (EIS) measurements. The corrosion behaviour of the Ti-6Al-7Nb commercial alloy was also evaluated for comparison. E (OC) measurements show an active behaviour for all the titanium alloys in fluoridated acidified saliva due to the presence of significant concentrations of HF and HF(2) (-) species that dissolve the spontaneous air-formed oxide film giving rise to surface activation. However, an increase in stability of the passive oxide layer and consequently a decrease in surface activation is observed for the Ti-1M alloys. This behaviour is confirmed by EIS measurements. In fact, the Ti-6Al-7Nb alloy exhibits lower impedance values as compared with Ti-1M alloys, the highest values being measured for the Ti-1Au alloy. The experimental results show that the corrosion resistance of the studied Ti-1M alloys is similar to or better than that of Ti-6Al-7Nb alloy currently used as biomaterial, suggesting their potential for dental applications.
Energy Technology Data Exchange (ETDEWEB)
Shanglian, Bao; Jinquan, Liu [Beijing Univ., BJ (China); Batenkov, O I; Blinov, M V; Smirnov, S N [V.G. Khlopin Radium Institute, ST. Petersburg (Russian Federation)
1994-09-01
The {sup 252}Cf spontaneous prompt fission neutron spectrum at 0 degree and 180 degree relative to the motion direction of corresponding fission fragments was measured. High angular resolution for fragment measurements and high energy resolution for neutron measurements were obtained using multi-parameter TOF spectrometer. The results showed that there is a symmetric distribution of `forward` and `backward` for low energy in C.M.S. neutrons, which was an evidence of nonequilibrium neutrons existed in fission process.
Development of Al-Mg-Li alloys for fusion reactor
International Nuclear Information System (INIS)
Shoji, Yoshifusa; Yoshida, Hideo; Uno, Teruo; Baba, Yoshio; Kamada, Koji.
1985-01-01
Aluminum-magnesium-lithium alloys featuring low residual induced radioactivity and high electrical resistivity have been developed for fusion reactor structural materials. The addition of lithium in aluminum and Al-Mg alloys markedly increases electrical resistivity and tensile strength of them. However the elongation of Al-Mg-Li alloys containing more than 2 mass% lithium are less than 10 %. The Al-4--5 mass%Mg-1 mass%Li alloys are optimum for fusion reactor materials, and exhibit high resistivity (86 nΩm: 20 %IACS), medium strength (300 MPa) and good formability (22 % elongation). The variation of electrical resistivity of Al-Li and Al-Mg-Li alloys in solid solution can be approximated by the Matthiessen's rule. (author)
Development and testing ov danadium alloys for fusion applications
Energy Technology Data Exchange (ETDEWEB)
Chung, H.M.; Loomis, B.A.; Smith, D.L.
1996-10-01
V base alloys have advantages for fusion reactor first-wall and blanket structure. To screen candidate alloys and optimize a V-base alloy, physical and mechanical properties of V-Ti, V-Cr-Ti, and V-Ti- Si alloys were studied before and after irradiation in Li environment in fast fission reactors. V-4Cr-4Ti containing 500-1000 wppM Si and <1000 wppM O+N+C was investigated as the most promising alloy, and more testing is being done. Major results of the work are presented in this paper. The reference V-4Cr-4Ti had the most attractive combination of the mechanical and physical properties that are prerequisite for first-wall and blanket structures: good thermal creep, good tensile strength/ductility, high impact energy, excellent resistance to swelling, and very low ductile-brittle transition temperature before and after irradiation. The alloy was highly resistant to irradiation-induced embrittlement in Li at 420-600 C, and the effects of dynamically charged He on swelling and mechanical properties were insignificant. However, several important issues remain unresolved: welding, low-temperature irradiation, He effect at high dose and high He concentration, irradiation creep, and irradiation performance in air or He. Initial results of investigation of some of these issues are also given.
Upgrade Fe-50%Ni alloys for open-loop DC current sensor: Design and alloy-potential characteristics
International Nuclear Information System (INIS)
Waeckerle, Thierry; Fraisse, Herve; Furnemont, Quentin; Bloch, Frederic
2006-01-01
This paper deals with the DC current sensor with open loop and high accuracy, and describes the relationship between the latter and the core-material magnetic properties in the case of Fe-50%Ni alloys. It is pointed out that air-gap precision, nonlinearity B-H and hysteresis are the main sources of accuracy; the influences of mechanical stress and temperature on coercive field are quantified and have to be taken into account in the design of the sensor. It is shown by dedicated choice of grades and annealing that Fe-50%Ni alloys may vary their coercive field from 4-6 A/m down to 1.5-4 A/m depending on the final annealing treatment used
48 CFR 252.227-7021 - Rights in data-existing works.
2010-10-01
... of Provisions And Clauses 252.227-7021 Rights in data—existing works. As prescribed at 227.7105-2(a), use the following clause: Rights in Data—Existing Works (MAR 1979) (a) The term works as used herein... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in data-existing...
Ternary alloying study of MoSi2
International Nuclear Information System (INIS)
Yi, D.; Li, C.; Akselsen, O.M.; Ulvensoen, J.H.
1998-01-01
Ternary alloying of MoSi 2 with adding a series of transition elements was investigated by X-ray diffraction (XRD), scanning electron microscopy, transmission electron microscopy (TEM), and energy dispersive spectroscopy (EDS). Iron, Co, Ni, Cr, V, Ti, and Nb were chosen as alloying elements according to the AB 2 structure map or the atomic size factor. The studied MoSi 2 base alloys were prepared by the arc melting process from high-purity metals. The EDS analysis showed that Fe, Co, and Ni have no solid solubility in as-cast MoSi 2 , while Cr, V, Ti, and Nb exhibit limited solid solubilities, which were determined to be 1.4 ± 0.7, 1.4 ± 0.4, 0.4 ± 0.1, and 0.8 ± 0.1. Microstructural characterization indicated that Mo-Si-M VIII (M VIII = Fe, Co, Ni) and Mo-Si-Cr alloys have a two-phase as-cast microstructure, i.e., MoSi 2 matrix and the second-phase FeSi 2 , CoSi, NiSi 2 , and CrSi 2 , respectively. In as-cast Mo-Si-V, Mo-Si-Ti, and Mo-Si-Nb alloys, besides MoSi 2 and C40 phases, the third phases were observed, which have been identified to be (Mo, V) 5 Si 3 , TiSi 2 , and (Mo, Nb) 5 Si 3
Energy Technology Data Exchange (ETDEWEB)
Lu, L. [State Key Laboratory for Advanced Metals and Materials, University of Science and Technology Beijing, Xueyuan Road 30, Haidian District, Beijing 100083 (China); Hou, L.G., E-mail: lghou@skl.ustb.edu.cn [State Key Laboratory for Advanced Metals and Materials, University of Science and Technology Beijing, Xueyuan Road 30, Haidian District, Beijing 100083 (China); Zhang, J.X.; Wang, H.B.; Cui, H.; Huang, J.F. [State Key Laboratory for Advanced Metals and Materials, University of Science and Technology Beijing, Xueyuan Road 30, Haidian District, Beijing 100083 (China); Zhang, Y.A. [State Key Laboratory of Non-Ferrous Metals and Process, General Research Institute for Non-Ferrous Metals, Beijing 100088 (China); Zhang, J.S. [State Key Laboratory for Advanced Metals and Materials, University of Science and Technology Beijing, Xueyuan Road 30, Haidian District, Beijing 100083 (China)
2016-07-15
The microstructures and properties of spray formed (SF) high-speed steels (HSSs) with or without niobium (Nb) addition were studied. Particular emphasis was placed on the effect of Nb on the solidification microstructures, decomposition of M{sub 2}C carbides, thermal stability and mechanical properties. The results show that spray forming can refine the cell size of eutectic carbides due to the rapid cooling effect during atomization. With Nb addition, further refinement of the eutectic carbides and primary austenite grains are obtained. Moreover, the Nb addition can accelerate the decomposition of M{sub 2}C carbides and increase the thermal stability of high-speed steel, and also can improve the hardness and bending strength with slightly decrease the impact toughness. The high-speed steel made by spray forming and Nb alloying can give a better tool performance compared with powder metallurgy M3:2 and commercial AISI M2 high-speed steels. - Highlights: • Spray forming can effectively refine the microstructure of M3:2 steel. • Niobium accelerates the decomposition of M{sub 2}C carbides. • Niobium increases the hardness and bending strength of spray formed M3:2 steel. • Spray-formed niobium-containing M3:2 steel has the best tool performance.
Compatibility of heat resistant alloys with boron carbide, (4)
International Nuclear Information System (INIS)
Baba, Sinichi; Saruta, Toru; Ooka, Kiichi; Tanaka, Isao; Aoyama, Isao
1985-07-01
This paper relates to the compatibility test of control rod sheath (Hastelloy XR alloy) and neutron absorber (boronated graphite) for the VHTR, which has been researched and developed by JAERI. The irradiation was conducted by using the OGL-1 irradiation facility in the JMTR in order to study reaction behaviour between Hastelloy XR alloy and boronated graphite as well as to determine a reaction barrier performance of refractory metal foils Nb, Mo, W and Re. Irradiation conditions were as follows. Neutron dose : 4.05 x 10 22 m -2 (E 18 m -2 (E > 0.16 pJ, 1 Mev). Helium coolant : Average temperature 855 0 C, Pressure 2.94 MPa, Total impurity concentration 400 kBq/m 3 . Irradiation time : 5.0 Ms (1390 hours). Post-irradiation examinations i.e. visual inspection, dimensional inspection, weight measurement, metallography, hardness test, morphological observations by SEM and analysis of element distributions by EPMA were carried out. In the result, reaction products of Hastelloy XR alloy were observed in the ellipsoidal form locally. These results were same as those of the out-of-pile tests. Obvious irradiation effects were not detectable but a little accelarated increase in reaction depth of Hastelloy XR alloy by heat effect of specimens was observed. The refractory metal foils had a good performance of reaction barrier between Hastelloy XR alloy and boronated graphite. Furthermore, movement of Ni, Fe and Cr in the reaction area of Hastelloy XR alloy, difference in the reaction depth of B and C, irradiation effects on diffusion coefficient, lithium production and heat effect are discussed. (author)
Microstructure and corrosion behavior of laser processed NiTi alloy.
Marattukalam, Jithin J; Singh, Amit Kumar; Datta, Susmit; Das, Mitun; Balla, Vamsi Krishna; Bontha, Srikanth; Kalpathy, Sreeram K
2015-12-01
Laser Engineered Net Shaping (LENS™), a commercially available additive manufacturing technology, has been used to fabricate dense equiatomic NiTi alloy components. The primary aim of this work is to study the effect of laser power and scan speed on microstructure, phase constituents, hardness and corrosion behavior of laser processed NiTi alloy. The results showed retention of large amount of high-temperature austenite phase at room temperature due to high cooling rates associated with laser processing. The high amount of austenite in these samples increased the hardness. The grain size and corrosion resistance were found to increase with laser power. The surface energy of NiTi alloy, calculated using contact angles, decreased from 61 mN/m to 56 mN/m with increase in laser energy density from 20 J/mm(2) to 80 J/mm(2). The decrease in surface energy shifted the corrosion potentials to nobler direction and decreased the corrosion current. Under present experimental conditions the laser power found to have strong influence on microstructure, phase constituents and corrosion resistance of NiTi alloy. Copyright © 2015 Elsevier B.V. All rights reserved.
Theory of Anion-Substituted Nitrogen-Bearing III-V Alloys
1998-07-20
was found by Zunger group). When more than 4% arsenic is incorporated into GaN in an ordered array, the band gap closes . Calculations of the...arsenic is incorporated into GaN in an ordered array, the band gap closes . Calculations of the properties of random alloys predict smaller bowing...BEARING lll-V ALLOYS Prepared by: M. A. Berding, Senior Research Physicist M. van Schilfgaarde, Senior Research Physicist A. Sher, Associate Director
An insight into the passivation of cupronickel alloys in chloride ...
Indian Academy of Sciences (India)
Unknown
surface of the alloy C was seen under scanning electron microscope at different magnifications. ... oxygen evolution for alloy C. The reverse scan revealed an inverted anodic peak at. 458 mV followed .... Scanning electron microscope picture.
Koo, Hyunmin; Mojib, Nazia; Huang, Jonathan P.; Donahoe, Rona J.; Bej, Asim K.
2014-01-01
In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.
Koo, Hyunmin
2014-07-10
In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.
On the corrosion testing of weldments of high alloyed CrNiMo-stainless steels and NiCrMo-alloys
International Nuclear Information System (INIS)
Riedel, G.; Voigt, C.; Werner, H.
1997-01-01
Weldments of high-alloyed CrNiMo stainless steels and NiCrMo alloys can be more susceptible to localized corrosion than the solution annealed basic material owing to segregations and precipitations in the heat affected zone, the high temperature zone and/or in the weld. To investigate these differences the FeCl 3 -test (10% FeCl 3 . 6aq), the test ''green death'' (11.5% H 2 SO 4 , 1.2% HCl, 1% CuCl 2 , 1% FeCl 3 ) as well as chronopotentiostatic tests in artificial sea water or in 3% NaCl-solution are used. In particular for testing the highest alloyed materials a CaCl 2 -test was developed (4.5 M CaCl 2 , chronopotentiostatic test in duration of 8 to 10 hours at + 200 mV (SCE)), which can be carried out to a temperature of 115 C at atmospheric pressure. The aggressivity increases in the range FeCl 3 -test, ''green death''-test, CaCl 2 -test. Matching and graduated over-alloyed weldments (TIG, heat input of 7 and 15.5 kJ/cm) of materials 1.4529, 1.4562, 2.4856, 2.4819 (german materials No.) are comparingly examined in various tests, of materials 1.4406, 1.4539, 1.4439 and 1.4563 (german materials No.) only matching weldments in the FeCl 3 -test. In strongly oxidizing media only a highly over-alloyed performed weldment (filler material 2.4607, german material No.) produces the best corrosion behaviour, measured as the critical temperatures of localized corrosion. Measurements of critical current densities of passivation can be used for investigations of corrosion behaviour of weldments, too. Critical current densities of passivation are showing a tendency to inverse proportion to the critical temperatures of localized corrosion. Suitable electrolytes are among others 0.2 M H 2 SO 4 + 1 M NaCl + 10 -3 % KSCN, N 2 -bubbled, 25 to 60 C and xM H 2 SO 4 + 4 M NaCl + 10 -3 % KSCN (x = 0.05 to 1), 25 C, in contact with air. An influence of heat input at the welding is indicated in the test of localized corrosion, but it is only small. It is sometimes more clearly shown at
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. M Sujatha. Articles written in Bulletin of Materials Science. Volume 23 Issue 1 February 2000 pp 39-45 Metallic Materials. Role of diffusional coherency strain theory in the discontinuous precipitation in Mg–Al alloy · K T Kashyap C Ramachandra M Sujatha B Chatterji.
Energy Technology Data Exchange (ETDEWEB)
Blawert, C., E-mail: carsten.blawert@gkss.d [GKSS Forschungszentrum Geesthacht GmbH, Max-Planck-Str. 1, 21502 Geesthacht (Germany); Fechner, D.; Hoeche, D.; Heitmann, V.; Dietzel, W.; Kainer, K.U. [GKSS Forschungszentrum Geesthacht GmbH, Max-Planck-Str. 1, 21502 Geesthacht (Germany); Zivanovic, P.; Scharf, C.; Ditze, A.; Groebner, J.; Schmid-Fetzer, R. [TU Clausthal, Institut fuer Metallurgie, Robert-Koch-Str. 42, 38678 Clausthal-Zellerfeld (Germany)
2010-07-15
The development of secondary magnesium alloys requires a completely different concept compared with standard alloys which obtain their corrosion resistance by reducing the levels of impurities below certain alloy and process depending limits. The present approach suitable for Mg-Al based cast and wrought alloys uses a new concept replacing the {beta}-phase by {tau}-phase, which is able to incorporate more impurities while being electro-chemically less detrimental to the matrix. The overall experimental effort correlating composition, microstructure and corrosion resistance was reduced by using thermodynamic calculations to optimise the alloy composition. The outcome is a new, more impurity tolerant alloy class with a composition between the standard AZ and ZC systems having sufficient ductility and corrosion properties comparable to the high purity standard alloys.
Laser polishing of additive manufactured Ti alloys
Ma, C. P.; Guan, Y. C.; Zhou, W.
2017-06-01
Laser-based additive manufacturing has attracted much attention as a promising 3D printing method for metallic components in recent years. However, surface roughness of additive manufactured components has been considered as a challenge to achieve high performance. In this work, we demonstrate the capability of fiber laser in polishing rough surface of additive manufactured Ti-based alloys as Ti-6Al-4V and TC11. Both as-received surface and laser-polished surfaces as well as cross-section subsurfaces were analyzed carefully by White-Light Interference, Confocal Microscope, Focus Ion Beam, Scanning Electron Microscopy, Energy Dispersive Spectrometer, and X-ray Diffraction. Results revealed that as-received Ti-based alloys with surface roughness more than 5 μm could be reduce to less than 1 μm through laser polishing process. Moreover, microstructure, microhardness and wear resistance of laser-polished zone was investigated in order to examine the thermal effect of laser polishing processing on the substrate of additive manufactured Ti alloys. This proof-of-concept process has the potential to effectively improve the surface roughness of additive manufactured metallic alloy by local polishing method without damage to the substrate.
Alloying principles for magnesium base heat resisting alloys
International Nuclear Information System (INIS)
Drits, M.E.; Rokhlin, L.L.; Oreshkina, A.A.; Nikitina, N.I.
1982-01-01
Some binary systems of magnesium-base alloys in which solid solutions are formed, are considered for prospecting heat resistant alloys. It is shown that elements having essential solubility in solid magnesium strongly decreasing with temperature should be used for alloying maqnesium base alloys with high strength properties at increased temperatures. The strengthening phases in these alloys should comprise essential quantity of magnesium and be rather refractory
Alloy Microstructure Dictates Corrosion Modes in THA Modular Junctions.
Pourzal, Robin; Hall, Deborah J; Ehrich, Jonas; McCarthy, Stephanie M; Mathew, Mathew T; Jacobs, Joshua J; Urban, Robert M
2017-12-01
Adverse local tissue reactions (ALTRs) triggered by corrosion products from modular taper junctions are a known cause of premature THA failure. CoCrMo devices are of particular concern because cobalt ions and chromium-orthophosphates were shown to be linked to ALTRs, even in metal-on-polyethylene THAs. The most common categories of CoCrMo alloy are cast and wrought alloy, which exhibit fundamental microstructural differences in terms of grain size and hard phases. The impact of implant alloy microstructure on the occurring modes of corrosion and subsequent metal ion release is not well understood. The purpose of this study was to determine whether (1) the microstructure of cast CoCrMo alloy varies broadly between manufacturers and can dictate specific corrosion modes; and whether (2) the microstructure of wrought CoCrMo alloy is more consistent between manufacturers and has low implications on the alloy's corrosion behavior. The alloy microstructure of four femoral-stem and three femoral-head designs from four manufacturers was metallographically and electrochemically characterized. Three stem designs were made from cast alloy; all three head designs and one stem design were made from wrought alloy. Alloy samples were sectioned from retrieved components and then polished and etched to visualize grain structure and hard phases such as carbides (eg, M 23 C 6 ) or intermetallic phases (eg, σ phase). Potentiodynamic polarization (PDP) tests were conducted to determine the corrosion potential (E corr ), corrosion current density (I corr ), and pitting potential (E pit ) for each alloy. Four devices were tested within each group, and each measurement was repeated three times to ensure repeatable results. Differences in PDP metrics between manufacturers and between alloys with different hard phase contents were compared using one-way analysis of variance and independent-sample t-tests. Microstructural features such as twin boundaries and slip bands as well as corrosion
X-ray determination of static displacements of atoms in alloyed Ni3Al
International Nuclear Information System (INIS)
Morinaga, M.; Sone, K.; Kamimura, T.; Ohtaka, K.; Yukawa, N.
1988-01-01
Single crystals of Ni 3 (Al, M) were grown by the Bridgman method, where M is Ti, V, Cr, Mn, Fe, Nb, Mo and Ta. The composition was controlled to be about Ni 75 Al 20 M 5 so that the alloying element, M, substitutes mainly for Al. With these crystals conventional X-ray structural analysis was performed. The measured static displacements of atoms from the average lattice points depended largely on the alloying elements and varied in the range 0.00-0.13 A for Ni atoms and 0.09-0.18 A for Al atoms. It was found that these atomic displacements correlated well with the atomic radius of the alloying element, M. For example, when the atomic radius of M is larger than that of Al, the static displacements are large for the atoms in the Al sublattice but small for the atoms in the Ni sublattice. By contrast, when the atomic radius of M is smaller than that of Al, the displacements are more enhanced in the Ni sublattice than in the Al sublattice. Thus, there is an interesting correlation between the atomic displacements in both the Al and Ni sublattices in the presence of alloying elements. This seems to be one of the characteristics of alloyed compounds with several sublattices. (orig.)
48 CFR 252.219-7004 - Small business subcontracting plan (test program).
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7004 Small business subcontracting plan (test program). As prescribed in 219.708(b)(1)(B), use the following clause: Small Business...
International Nuclear Information System (INIS)
Wang Yuexing; Yang Yifang; Lu Yongjie; Zhang Jianguo; Xing Hongchuan
2011-01-01
Objective: To investigate the specific activity of '2 4 Na per unit neutron fluence, A B/Φ ,in blood produced for Chinese reference man irradiated by 252 Cf neutron source,and to analyze the effects of scattering neutrons from ground,wall,and ceiling in irradiation site on it.Methods: A 252 Cf neutron source of 3×10 8 n/s and the anthropomorphic phantom were used for experiments. The phantom was made from 4 mm thick of outer covering by perspex and the liquid tissue-equivalent substitute in it. The data of phantom dimensions fit into Chinese reference man.The weight ratios of H, N, O and C in substitute equal from source to long axis of phantom were 1.1, 2.1, 3.1 and 4.1 m, respectively. Both the neutron source and the position of xiphisternum of the phantom were 1.6 m above the floor. Results: The average specific activity of 24 Na per unit neutron fluence was related to the irradiation-distances, d, and its maximum value, A B/ΦM , deduced by experimental data was about 1.85×10 -7 Bq·cm 2 ·g -1 . Conclusions: The A B/ΦM corresponds to that of phantom irradiated by plane-parallel beams, and the value is about more 3% than that by BOMAB phantom reported in literature. It has shown that floor-(wall-)scattered neutrons in irradiation site have significant contribution to the specific activity of 24 Na, but they contributed relatively little to the induced neutron doses. Consequently,using the specific activity of 24 Na for assessing accidental neutron doses received by an individual, the contribution of scattered neutrons in accident site will lead dose to be overestimated, and need to be correct. (authors)
Effects of lipopolysaccharides on the corrosion behavior of Ni-Cr and Co-Cr alloys.
Yu, Weiqiang; Qian, Chao; Weng, Weimin; Zhang, Songmei
2016-08-01
Lipopolysaccharides (LPS) are constituents of gingival crevicular fluid and may affect the base metal alloys used in metal ceramic crowns. The role of LPS in base metal alloys is currently unknown. The purpose of this in vitro study was to evaluate the effects of gram-negative bacterial LPS on the electrochemical behavior of Ni-Cr and Co-Cr alloys. Alloy specimens were divided into 4 groups according to Escherichia coli LPS concentration (0, 0.15, 15, and 150 μg/mL) in acidic saliva (pH 5). Open circuit potential (OCP) and potentiodynamic polarization behavior were examined using a computer-controlled potentiostat. Metal ions released from the 2 alloys were measured by immersion in LPS-free solution and 150 μg/mL LPS solution and analyzed by inductively coupled plasma atomic emission spectrometry (ICP-AES). Data were evaluated using 1-way ANOVA (α=.05). Compared with control groups, medium LPS concentration (15 μg/mL) accelerated Ni-Cr alloy corrosion (Palloy corrosion (Pcorrosion current density, and polarization resistance parameters. After immersion in high LPS concentrations (150 μg/mL), a slight increase in Ni ion release (P >.05) was observed for the Ni-Cr alloy, while a more significant Co ion release (Palloy. LPS negatively affected the electrochemical behavior of both the Ni-Cr and Co-Cr alloys. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.
The application of n-γ discrimination in 252Cf spontaneous neutron TOF spectra measurement
International Nuclear Information System (INIS)
Zhou Haojun; Zhang Yi; Li Jiansheng; Jin Yu; Wang Jie; Li Chunyuan
2004-01-01
The BC501 scintillator is used as a fast neutron detector. The effect that the pulse rise time method was used to discriminate γ from 252 Cf spontaneous neutron TOF spectra is studied in the experiment. A pulse rise time separation spectra of γ and 252 Cf spontaneous neuron upon 1 MeV is obtained, the n-γ separation function reaches to 4.6. When the result of pulse rise time separation coincides with the time-of-flight spectra in which the neutron energy is upon 0.5 MeV, 0.8 MeV and 1.0 MeV, comparing with the anticoincidence, γ was eliminated 99.90% at least. (authors)
Energy Technology Data Exchange (ETDEWEB)
Hans Thieme, Cornelis Leo (Westborough, MA); Thompson, Elliott D. (Coventry, RI); Fritzemeier, Leslie G. (Acton, MA); Cameron, Robert D. (Franklin, MA); Siegal, Edward J. (Malden, MA)
2002-01-01
An alloy that contains at least two metals and can be used as a substrate for a superconductor is disclosed. The alloy can contain an oxide former. The alloy can have a biaxial or cube texture. The substrate can be used in a multilayer superconductor, which can further include one or more buffer layers disposed between the substrate and the superconductor material. The alloys can be made a by process that involves first rolling the alloy then annealing the alloy. A relatively large volume percentage of the alloy can be formed of grains having a biaxial or cube texture.
Energy Technology Data Exchange (ETDEWEB)
Bruemmer, Stephen M.; Toloczko, Mychailo B.; Olszta, Matthew J.
2012-03-01
The objective of this program is to evaluate the primary water stress corrosion cracking (PWSCC) susceptibility of high chromium alloy 690 and its weld metals, establish quantitative measurements of crack-growth rates and determine relationships among cracking susceptibility, environmental conditions and metallurgical characteristics. Stress-corrosion, crack-growth rates have been determined for 12 alloy 690 specimens, 11 alloy 152/52/52M weld metal specimens, 4 alloy 52M/182 overlay specimens and 2 alloy 52M/82 inlay specimens in simulated PWR primary water environments. The alloy 690 test materials included three different heats of extruded control-rod-drive mechanism (CRDM) tubing with variations in the initial material condition and degree of cold work for one heat. Two cold-rolled (CR) alloy 690 plate heats were also obtained and evaluated enabling comparisons to the CR CRDM materials. Weld metal, overlay and inlay specimens were machined from industry mock ups to provide plant-representative materials for testing. Specimens have been tested for one alloy 152 weld, two alloy 52 welds and three alloy 52M welds. The overlay and inlay specimens were prepared to propagate stress-corrosion cracks from the alloy 182 or 82 material into the more resistant alloy 52M. In all cases, crack extension was monitored in situ by direct current potential drop (DCPD) with length resolution of about +1 µm making it possible to measure extremely low growth rates approaching 5x10-10 mm/s. Most SCC tests were performed at 325-360°C with hydrogen concentrations from 11-29 cc/kg; however, environmental conditions were modified during a few experiments to evaluate the influence of temperature, water chemistry or electrochemical potential on propagation rates. In addition, low-temperature (~50°C) cracking behavior was examined for selected alloy 690 and weld metal specimens. Extensive characterizations have been performed on material microstructures and stress-corrosion cracks by
Study of fatigue crack propagation in magnesium alloys
International Nuclear Information System (INIS)
Yarema, S.Ya.; Zinyuk, O.D.; Ostash, O.P.; Kudryashov, V.G.; Elkin, F.M.
1981-01-01
Fatigue crack propagation in standard (MA2-1, MA8) and super light (MA21, MA18) alloys has been investigated in the whole range of load amplitude changes-from threshold to critical; the materials have been compared by cyclic crack resistance, fractographic analysis has been made. It is shown that MA2-1 alloy crack resistance is slightly lower than the resistance of the other three alloys. MA8 and MA21 alloys having similar mechanical properties almost do not differ in cyclic crack resistance as well. MA18 alloy has the highest resistance to fatigue crack propagation in the whole range of Ksub(max) changes. The presented results on cyclic crack resistance of MA21 and MA18 alloys agree with the data on statistic fracture toughness. The fractures have been also investigated using a scanning electron microscope. Fracture microrelieves of MA8 and MA21 alloys are very similar. At low crack propagation rates (v - 7 m/cycle) it develops through grains, in MA2-1 alloy fracture intergrain fracture areas can be observed. In MA8 and MA21 alloy fractures groove covered areas can be seen alonside with areas of slipping plane laminatron; their specific weight increases with #betta# decrease. Lower crack propagation rates and higher values of threshold stress intensity factors for MA8 and MA21 alloys than for MA2-1 alloy are caused by the absence of intergrain fracture
Frequency spectrum analysis of 252Cf neutron source based on LabVIEW
International Nuclear Information System (INIS)
Mi Deling; Li Pengcheng
2011-01-01
The frequency spectrum analysis of 252 Cf Neutron source is an extremely important method in nuclear stochastic signal processing. Focused on the special '0' and '1' structure of neutron pulse series, this paper proposes a fast-correlation algorithm to improve the computational rate of the spectrum analysis system. And the multi-core processor technology is employed as well as multi-threaded programming techniques of LabVIEW to construct frequency spectrum analysis system of 252 Cf neutron source based on LabVIEW. It not only obtains the auto-correlation and cross correlation results, but also auto-power spectrum,cross-power spectrum and ratio of spectral density. The results show that: analysis tools based on LabVIEW improve the fast auto-correlation and cross correlation code operating efficiency about by 25% to 35%, also verify the feasibility of using LabVIEW for spectrum analysis. (authors)
A new facility for non-destructive assay using a 252Cf source
International Nuclear Information System (INIS)
Stevanato, L.; Caldogno, M.; Dima, R.; Fabris, D.; Hao, Xin; Lunardon, M.; Moretto, S.; Nebbia, G.; Pesente, S.; Pino, F.; Sajo-Bohus, L.; Viesti, G.
2013-01-01
A new laboratory facility for non-destructive analysis (NDA) using a time-tagged 252 Cf source is presented. The system is designed to analyze samples having maximum size of about 20×25 cm 2 , the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. - Highlights: ► Tagged 252 Cf source setup. ► Material recognition and sample imaging with measurements of gamma ray and neutron transmission. ► Material identification via energy dependent neutron and gamma ray transmission measurements. ► Identification of layered material. ► Effects due to the sample thickness on the above identification techniques
2010-10-01
... and value added tax on fuel (passenger vehicles) (United Kingdom). 252.229-7009 Section 252.229-7009... Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom). As prescribed in 229.402-70(i), use the following clause: Relief from Customs Duty and Value Added Tax on Fuel...
Study of the shielding for spontaneous fission sources of Californium-252
International Nuclear Information System (INIS)
Davila R, I.
1991-06-01
A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)
Gu, X N; Li, X L; Zhou, W R; Cheng, Y; Zheng, Y F
2010-06-01
Rapidly solidified (RS) Mg–3Ca alloy ribbons were prepared by the melt-spinning technique at different wheel rotating speeds (15 m s(-1), 30 m s(-1) and 45 m s(-1) with the as-cast Mg–3Ca alloy ingot as a raw material. The RS45 Mg–3Ca alloy ribbon showed a much more fine grain size feature (approximately 200–500 nm) in comparison to the coarse grain size (50–100 μm)of the original as-cast Mg–3Ca alloy ingot. The corrosion electrochemical tests in simulated body fluid indicated that the corrosion rate of the as-cast Mg–3Ca alloy was strongly reduced by the RS procedure and tended to be further decreased with increasing wheel rotating speeds(1.43 mm yr(-1) for RS15, 0.94 mm yr(-1) for RS30 and 0.36 mm yr(-1) for RS45). The RS Mg–3Ca alloy ribbons showed more uniform corrosion morphology compared with the as-cast Mg–3Ca alloy after polarization. The cytotoxicity evaluation revealed that the three experimental as-spun Mg–3Ca alloy ribbon extracts did not induce toxicity to the L-929 cells,whereas the as-cast Mg–3Ca alloy ingot extract did. The L-929 cells showed more improved adhesion on the surfaces of the three as-spun Mg–3Ca alloy ribbons than that of the as-cast Mg–3Ca alloy ingot.
International Nuclear Information System (INIS)
Gu, X N; Zhou, W R; Zheng, Y F; Li, X L; Cheng, Y
2010-01-01
Rapidly solidified (RS) Mg-3Ca alloy ribbons were prepared by the melt-spinning technique at different wheel rotating speeds (15 m s -1 , 30 m s -1 and 45 m s -1 ) with the as-cast Mg-3Ca alloy ingot as a raw material. The RS45 Mg-3Ca alloy ribbon showed a much more fine grain size feature (approximately 200-500 nm) in comparison to the coarse grain size (50-100 μm) of the original as-cast Mg-3Ca alloy ingot. The corrosion electrochemical tests in simulated body fluid indicated that the corrosion rate of the as-cast Mg-3Ca alloy was strongly reduced by the RS procedure and tended to be further decreased with increasing wheel rotating speeds (1.43 mm yr -1 for RS15, 0.94 mm yr -1 for RS30 and 0.36 mm yr -1 for RS45). The RS Mg-3Ca alloy ribbons showed more uniform corrosion morphology compared with the as-cast Mg-3Ca alloy after polarization. The cytotoxicity evaluation revealed that the three experimental as-spun Mg-3Ca alloy ribbon extracts did not induce toxicity to the L-929 cells, whereas the as-cast Mg-3Ca alloy ingot extract did. The L-929 cells showed more improved adhesion on the surfaces of the three as-spun Mg-3Ca alloy ribbons than that of the as-cast Mg-3Ca alloy ingot.
48 CFR 252.239-7016 - Telecommunications security equipment, devices, techniques, and services.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Telecommunications... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.239-7016 Telecommunications... clause: Telecommunications Security Equipment, Devices, Techniques, and Services (DEC 1991) (a...
A review of chromium, molybdenum, and tungsten alloys
International Nuclear Information System (INIS)
Klopp, W.D.
1975-01-01
The mechanical properties of chromium, molybdenum, and tungsten alloys are reviewed, with particular emphasis on high-temperature strength and low-temperature ductility. Precipitate strengthening is highly effective at 0.4-0.8 Tsub(m) in these metals, with HfC being most effective in tungsten and molybdenum, and Ta(B,C) most effective in chromium. Low-temperature ductility can be improved by alloying to promote rhenium ductilizing or solution softening. The low-temperature mechanical properties of these alloys appear related to electronic interactions rather than to the usual metallurgical considerations. (Auth.)
International Nuclear Information System (INIS)
Yalcin, Battal G.
2015-01-01
The semi-local Becke–Johnson (BJ) exchange-correlation potential and its modified form proposed by Tran and Blaha have attracted a lot of interest recently because of the surprisingly accurate band gaps they can deliver for many semiconductors and insulators (e.g., sp semiconductors, noble-gas solids, and transition-metal oxides). The structural and electronic properties of ternary alloys BBi 1−x N x (0≤x≤1) in zinc-blende phase have been reported in this study. The results of the studied binary compounds (BN and BBi) and ternary alloys BBi 1−x N x structures are presented by means of density functional theory. The exchange and correlation effects are taken into account by using the generalized gradient approximation (GGA) functional of Wu and Cohen (WC) which is an improved form of the most popular Perdew–Burke–Ernzerhof (PBE). For electronic properties the modified Becke–Johnson (mBJ) potential, which is more accurate than standard semi-local LDA and PBE calculations, has been chosen. Geometric optimization has been implemented before the volume optimization calculations for all the studied alloys structure. The obtained equilibrium lattice constants of the studied binary compounds are in coincidence with experimental works. And, the variation of the lattice parameter of ternary alloys BBi 1−x N x almost perfectly matches with Vegard's law. The spin–orbit interaction (SOI) has been also considered for structural and electronic calculations and the results are compared to those of non-SOI calculations
Liu, H L; Walker, P M
2012-01-01
Total Routhian surface calculations have been performed to investigate rapidly rotating transfermium nuclei, the heaviest nuclei accessible by detailed spectroscopy experiments. The observed fast alignment in $^{252}$No and slow alignment in $^{254}$No are well reproduced by the calculations incorporating high-order deformations. The different rotational behaviors of $^{252}$No and $^{254}$No can be understood for the first time in terms of $\\beta_6$ deformation that decreases the energies of the $\
The influence of yttrium (Y) on the corrosion of Mg-Y binary alloys
International Nuclear Information System (INIS)
Liu Ming; Schmutz, Patrik; Uggowitzer, Peter J.; Song Guangling; Atrens, Andrej
2010-01-01
Research highlights: → The Y-intermetallic can accelerate corrosion and Y can increase the protectiveness of the surface layer. → In 0.1 M NaCl, the corrosion rate of Mg-Y alloys increased with increasing Y due to the Y intermetallic. → In 0.1 M NaCl, there was filiform corrosion. → In 0.1 M Na 2 SO 4 , the corrosion rate of Mg-Y alloys decreased with increasing Y in the range 3-7%Y. → Hydrogen evolution was observed from particular parts of the alloy surface. - Abstract: Corrosion of Mg-Y alloys was studied using electrochemical evaluations, immersion tests and direct observations. There were two important effects. In 0.1 M NaCl, the corrosion rate increased with increasing Y content due to increasing amounts of the Y-containing intermetallic. In 0.1 M Na 2 SO 4 , the corrosion rate decreased with increasing Y content above 3%, attributed to a more protective surface film, despite the intermetallic. The corrosion rate evaluated by electrochemical impedance spectroscopy was somewhat smaller than that evaluated from H evolution as expected from the Mg corrosion mechanism. A mechanism is proposed for filiform corrosion. Direct in situ corrosion observations revealed that a predominant feature was hydrogen evolution from particular parts of the alloy surface.
Titanium by design: TRIP titanium alloy
Tran, Jamie
elements in titanium to model the effect of alloying elements on the Ms temperature in titanium. Available atomic volume data and collaborative first principles quantum mechanical calculations are combined to model the composition dependence of the transformation molar volume change. Composition analysis of the beta phase from the LEAP and Bolling-Richman experimental measurement of the M ssigma temperature defining mechanical transformation stability of the beta phase in Ti5111 provided a calibration of transformation models. Using the near-alpha Ti5111 alloy as a reference alloy, the feasibility was assessed for application of transformation toughening to maintain the high toughness of Ti5111 at the higher 120ksi (827MPa) yield strength of Ti-6Al-4V. Combined with models of solution and grain refinement strengthening, a modification of the Ti5111 composition was designed meeting the transformation stability requirement while increasing the calculated transformation volume change by 10% for efficient toughening. A design prototype was created and mechanically tested resulting in a room temperature yield strength of >120ksi and M ssigma(ut) at room temperature confirming strength and transformation stability predictions.
Design of a setup for {sup 252}Cf neutron source for storage and analysis purpose
Energy Technology Data Exchange (ETDEWEB)
Hei, Daqian [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Zhuang, Haocheng [Xi’an Middle School of Shanxi Province, Xi’an 710000 (China); Jia, Wenbao, E-mail: jiawenbao@163.com [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China); Cheng, Can; Jiang, Zhou; Wang, Hongtao [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Chen, Da [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China)
2016-11-01
{sup 252}Cf is a reliable isotopic neutron source and widely used in the prompt gamma ray neutron activation analysis (PGNAA) technique. A cylindrical barrel made by polymethyl methacrylate contained with the boric acid solution was designed for storage and application of a 5 μg {sup 252}Cf neutron source. The size of the setup was optimized with Monte Carlo code. The experiments were performed and the results showed the doses were reduced with the setup and less than the allowable limit. The intensity and collimating radius of the neutron beam could also be adjusted through different collimator.
INAA using 252Cf neutron source at University of Pune
International Nuclear Information System (INIS)
Rajurkar, N.S.
2006-01-01
The review presents the work done over last two decades on Instrumental Neutron Activation Analysis (INAA) by our research group at University of Pune using 252 Cf spontaneous fission neutron source. The technique has been applied in different fields viz. numismatics, industry, agriculture, ayurveda, environmental and health sciences and diffusion studies. A brief discussion of the work is presented in this article. (author)
Refinement and fracture mechanisms of as-cast QT700-6 alloy by alloying method
Directory of Open Access Journals (Sweden)
Min-qiang Gao
2017-01-01
Full Text Available The as-cast QT700-6 alloy was synthesized with addition of a certain amount of copper, nickel, niobium and stannum elements by alloying method in a medium frequency induction furnace, aiming at improving its strength and toughness. Microstructures of the as-cast QT700-6 alloy were observed using a scanning-electron microscope (SEM and the mechanical properties were investigated using a universal tensile test machine. Results indicate that the ratio of pearlite/ferrite is about 9:1 and the graphite size is less than 40 μm in diameter in the as-cast QT700-6 alloy. The predominant refinement mechanism is attributed to the formation of niobium carbides, which increases the heterogeneous nucleus and hinders the growth of graphite. Meanwhile, niobium carbides also exist around the grain boundaries, which improve the strength of the ductile iron. The tensile strength and elongation of the as-cast QT700-6 alloy reach over 700 MPa and 6%, respectively, when the addition amount of niobium is 0.8%. The addition of copper and nickel elements contributed to the decrease of eutectoid transformation temperature, resulting in the decrease of pearlite lamellar spacing (about 248 nm, which is also beneficial to enhancing the tensile strength. The main fracture mechanism is cleavage fracture with the appearance of a small amount of dimples.
48 CFR 252.228-7006 - Compliance with Spanish laws and insurance.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Compliance with Spanish... CLAUSES Text of Provisions And Clauses 252.228-7006 Compliance with Spanish laws and insurance. As prescribed at 228.370(e), use the following clause: Compliance with Spanish Laws and Insurance (DEC 1998) (a...
48 CFR 252.229-7006 - Value added tax exclusion (United Kingdom).
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Value added tax exclusion... CLAUSES Text of Provisions And Clauses 252.229-7006 Value added tax exclusion (United Kingdom). As prescribed in 229.402-70(f), use the following clause: Value Added Tax Exclusion (United Kingdom) (JUN 1997...
Physical and biological dosimetries of Cf-252 radiation
International Nuclear Information System (INIS)
Yamashita, Hisao; Wada, Tadashi; Dokiya, Takushi; Hashimoto, Shozo
1986-01-01
Recently Cf-252 sources containing 300 μg have become available in a size identical to 1 Ci of Cs-137 and with the use of remotely controlled afterloading apparatus, safe therapy with little exposure to the therapist is now possible. Radiation leakage from the Cf-252 apparatus and from the treatment room was measured with REM-meter and it was possible to reduce the leakage from the treatment room to less than 1 mrem/h (gamma rays) and 0.5 mrem/h (neutrons). Measurement of fast neutrons was made with a twin chamber composed of a tissue equivalent ionization chamber and a carbon ionization chamber. The neutron dose in air and the absorbed dose in tissue equivalent water tank were measured, which showed that in air, neutrons were 70% and photons were 30% of dose. In water, greater distances from the source, neutrons attenuate and gamma rays increase in dose. The results of studies on the skin reaction of mice and sperm cleavage delay time of sea urchins indicated that the RBE ranges from 1.5 to 3.0 using the high dose rate system. Neutrons are remarkably affected by a time factor. With the use of high dose rate sources, the dose rate has become higher, but the overall time has been extended through dose fractionation and it was considered advisable to employ an RBE of 3-4 in these studies. (Auth.)
Inconel type resistive alloys based on ultrahigh purity nickel
International Nuclear Information System (INIS)
Matsarin, K.A.; Matsarin, S.K.
2000-01-01
The new nickel high-ohm alloys (ρ = 1.2-1.4 μOhm · m), containing the W, Al, Mo alloying elements in the quantity, not exceeding their solubility in a solid solution, are developed on the basis of the Inconel-type standard alloy. The optical composition of the alloy was determined by the results of the alloy was determined by the results of the electric resistance measurement and technological effectiveness indices (relative to the pressure and workable metal yield). The following optimal component concentrations were established: 14-17 %Cr; 10-12 %Fe; 0.5-1.0 %Cu; 1.0-1.5 %Mn; 0.1-0.2 %C; 0.4-0.6 %Si; 0.5-3.0 %W; 5-16 %Mo; 0.5-2.0 %Al; the remainder - Ni. The new alloys are recommended as materials for resistive elements of direct-glow cathode nodes of low capacity electron tubes [ru
Fukuhara, Mikio; Sugawara, Kazuyuki
2014-01-01
Charging/discharging behaviors of de-alloyed and anodic oxidized Ti-Ni-Si amorphous alloy ribbons were measured as a function of current between 10 pA and 100 mA, using galvanostatic charge/discharging method. In sharp contrast to conventional electric double layer capacitor (EDLC), discharging behaviors for voltage under constant currents of 1, 10 and 100 mA after 1.8 ks charging at 100 mA show parabolic decrease, demonstrating direct electric storage without solvents. The supercapacitors, devices that store electric charge on their amorphous TiO2-x surfaces that contain many 70-nm sized cavities, show the Ragone plot which locates at lower energy density region near the 2nd cells, and RC constant of 800 s (at 1 mHz), which is 157,000 times larger than that (5 ms) in EDLC.
Characterization and corrosion behaviour of CoNi alloys obtained by mechanical alloying
International Nuclear Information System (INIS)
Olvera, S.; Sánchez-Marcos, J.; Palomares, F.J.; Salas, E.; Arce, E.M.; Herrasti, P.
2014-01-01
CoNi alloys including Co 30 Ni 70 , Co 50 Ni 50 and Co 70 Ni 30 were prepared via mechanical alloying using Co and Ni powders. The crystallinity and short-range order were studied using X-ray diffraction and X-ray absorption spectroscopy. The results show that the milling process increases the number of vacancies, especially around the Co atoms, while the milling time decreases the crystalline size and enhances the crystallinity. X-ray photoelectron spectroscopy was used to characterise the chemical composition of the samples surface. The magnetic properties were analysed using zero-field cooling, field cooling and a magnetic hysteresis loops. The magnetic saturation moment is approximately 1.05 μ B /atom; this value decreases with the mechanical alloying time, and it is proportional to the cobalt concentration. The polarization and impedance curves in different media (NaCl, H 2 SO 4 and NaOH) showed similar corrosion resistance values. The corrosion resistance increased in the order NaCl, H 2 SO 4 and NaOH. A good passivation layer was formed in NaOH due to the cobalt and nickel oxides on the particle surfaces. - Highlights: • Ni x Co 100-x alloys were synthesized by mechanical alloying • Milling time decrease size and enhances crystallinity. • Oxygen is not present in a significant percentage in bulk but is detected on the surface. • Magnetic saturation moment is 1.05 mB/atom and decrease with mechanical allowing time • Corrosion resistance is higher in NaOH than in NaCl or HCl solutions
Characterization and properties of sintered WC–Co and WC–Ni–Fe hard metal alloys
International Nuclear Information System (INIS)
Chang, Shih-Hsien; Chen, Song-Ling
2014-01-01
Highlights: • WC–Ni–Fe alloy sintered at 1400 °C had the highest hardness (HRA 85.3 ± 0.5). • The optimal WC–Ni–Fe sintered alloy possessed the highest TRS value (2524.5 ± 1.0 MPa). • The fracture toughness of the sintered WC–Ni–Fe alloys is mainly provided by the Ni–Fe binders. • WC–Ni–Fe sintered alloy possessed the highest fracture toughness of K IC (15.1 MPa m 1/2 ). • The WC–Ni–Fe sintered alloy had the much better corrosion resistance in 0.15 M HCl solution. -- Abstract: The aim of this study is to explore two different tungsten carbide binders (Co and Ni–Fe) and then impose various sintering temperature treatments. Experimental results show that the optimal sintering temperatures for WC–Co and WC–Ni–Fe hard metal alloys are 1350 °C and 1400 °C for 1 h, respectively. Meanwhile, the WC–Co and WC–Ni–Fe alloys undergo a well liquid-phase sintering and, thus, exhibit excellent mechanical properties. In addition, the sintered WC–Co and WC–Ni–Fe alloys show that when the relative density reached 99.76% and 99.68%, the hardness was enhanced to HRA 84.4 ± 0.5 and 85.3 ± 0.5, and the TRS increased to 2471.2 ± 1.0 and 2524.5 ± 1.0 MPa, respectively. Moreover, the corrosion test results show that the WC–Ni–Fe alloy sintered at 1400 °C had the lowest corrosion current (I corr ) of 1.11 × 10 −5 A cm −2 and the highest polarization resistance (R p ) of 2464.61 Ω cm 2 in 0.15 M HCl solution. Simultaneously, the fracture toughness of K IC increased to 15.1 MPa m 1/2 . Compared with sintered WC–Co alloys, the sintered WC–Ni–Fe hard metal alloys possessed much better corrosion resistance and mechanical properties
International Nuclear Information System (INIS)
Vieira, A.C.; Pinto, A.M.; Rocha, L.A.; Mischler, S.
2011-01-01
Research highlights: → Influence of the size distribution of Al-Cu phases on the electrochemical behaviour of well defined alloys under controlled mass transport conditions (RDE). → Oxygen reduction occurs only the Al 2 Cu phases. → Thinner Al-Cu grains the oxygen reduction current deviates at high rotation rates from the Levich behaviour. - Abstract: The electrochemical behaviour of age-hardened Al-Si-Cu-Mg alloys was investigated in a 0.05 M NaCl solution under controlled mass transport conditions using a rotating disk electrode. This work aimed at getting better understanding of the effect of the alloy microstructure, in particular the size distribution of Al 2 Cu phase, on the corrosion behaviour of the alloy. Three different size distributions of the Al 2 Cu phase were obtained through appropriate heat treatments. The cathodic reduction of oxygen was found to occur mainly on the Al 2 Cu phases acting as preferential cathodes. Small sized Al 2 Cu phases were found to promote at high rotation rates a transition from a 4 electron to a 2 electron dominated oxygen reduction mechanisms.
A 252Cf based nondestructive assay system for fissile material
International Nuclear Information System (INIS)
Menlove, H.O.; Crane, T.W.
1978-01-01
A modulated 252 Cf source assay system 'Shuffler' based on fast-or-thermal-neutron interrogation combined with delayed-neutron counting has been developed for the assay of fissile material. The 252 Cf neutron source is repetitively transferred from the interrogation position to a shielded position while the delayed neutrons are counted in a high efficiency 3 He neutron well-counter. For samples containing plutonium, this well-counter is also used in the passive coincidence mode to assay the effective 240 Pu content. The design of an optimized neutron tailoring assembly for fast-neutron interrogation using a Monte Carlo Neutron Computer Code is described. The Shuffler system has been applied to the assay of fuel pellets, inventory samples, irradiated fuel and plutonium mixed-oxide fuel. The system can assay samples with fissile contents from a few milligrams up to several kilograms using thermal-neutron interrogation for the low mass samples and fast-neutron interrogation for the high mass samples. Samples containing 235 U- 238 U, or 233 U-Th, or UO 2 -PuO 2 fuel mixtures have been assayed with the Shuffler system. (Auth.)
Rtishchev, V. V.
1995-11-01
Using computer programs some foreign firms have developed new deformable and castable high-temperature nickel-base alloys such as IN, Rene, Mar-M, Udimet, TRW, TM, TMS, TUT, with equiaxial, columnar, and single-crystal structures for manufacturing functional and nozzle blades and other parts of the hot duct of transport and stationary gas-turbine installations (GTI). Similar investigations have been carried out in Russia. This paper presents examples of the use of the PSCPCSP computer software for a quantitative analysis of structural und phase characteristics and properties of industrial alloys with change (within the grade range) in the concentrations of the alloying elements for optimizing the composition of the alloys and regimes of their heat treatment.
Energy Technology Data Exchange (ETDEWEB)
Gu, X N; Zhou, W R; Zheng, Y F [State Key Laboratory for Turbulence and Complex System and Department of Advanced Materials and Nanotechnology, College of Engineering, Peking University, Beijing 100871 (China); Li, X L [Center for Biomedical Materials and Engineering, Harbin Engineering University, Harbin 150001 (China); Cheng, Y, E-mail: yfzheng@pku.edu.c [Center for Biomedical Materials and Tissue Engineering, Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China)
2010-06-01
Rapidly solidified (RS) Mg-3Ca alloy ribbons were prepared by the melt-spinning technique at different wheel rotating speeds (15 m s{sup -1}, 30 m s{sup -1} and 45 m s{sup -1}) with the as-cast Mg-3Ca alloy ingot as a raw material. The RS45 Mg-3Ca alloy ribbon showed a much more fine grain size feature (approximately 200-500 nm) in comparison to the coarse grain size (50-100 {mu}m) of the original as-cast Mg-3Ca alloy ingot. The corrosion electrochemical tests in simulated body fluid indicated that the corrosion rate of the as-cast Mg-3Ca alloy was strongly reduced by the RS procedure and tended to be further decreased with increasing wheel rotating speeds (1.43 mm yr{sup -1} for RS15, 0.94 mm yr{sup -1} for RS30 and 0.36 mm yr{sup -1} for RS45). The RS Mg-3Ca alloy ribbons showed more uniform corrosion morphology compared with the as-cast Mg-3Ca alloy after polarization. The cytotoxicity evaluation revealed that the three experimental as-spun Mg-3Ca alloy ribbon extracts did not induce toxicity to the L-929 cells, whereas the as-cast Mg-3Ca alloy ingot extract did. The L-929 cells showed more improved adhesion on the surfaces of the three as-spun Mg-3Ca alloy ribbons than that of the as-cast Mg-3Ca alloy ingot.
Effect of heat treatment on the microstructure and properties of Ni based soft magnetic alloy.
Li, Chunhong; Ruan, Hui; Chen, Dengming; Li, Kejian; Guo, Donglin; Shao, Bin
2018-04-20
A Ni-based alloy was heat treated by changing the temperature and ambient atmosphere of the heat treatment. Morphology, crystal structure, and physical performance of the Ni-based alloy were characterized via SEM, XRD, TEM, and PPMS. Results show that due to the heat treatment process, the grain growth of the Ni-based alloy and the removal of impurities and defects are promoted. Both the orientation and stress caused by rolling are reduced. The permeability and saturation magnetization of the alloy are improved. The hysteresis loss and coercivity are decreased. Higher heat treatment temperature leads to increased improvement of permeability and saturation magnetization. Heat treatment in hydrogen is more conducive to the removal of impurities. At the same temperature, the magnetic performance of the heat-treated alloy in hydrogen is better than that of an alloy with heat treatment in vacuum. The Ni-based alloy shows an excellent magnetic performance on 1,373 K heat treatment in hydrogen atmosphere. In this process, the µ m , B s , P u , and H c of the obtained alloy are 427 mHm -1 , 509 mT, 0.866 Jm -3 , and 0.514 Am -1 , respectively. At the same time, the resistivity of alloy decreases and its thermal conductivity increases in response to heat treatment. © 2018 Wiley Periodicals, Inc.
Nanodispersed boriding of titanium alloy
International Nuclear Information System (INIS)
Kostyuk, K.O.; Kostyuk, V.O.
2015-01-01
The problem of improving the operational reliability of machines is becoming increasingly important due to the increased mechanical, thermal and other loads on the details. There are many surface hardening methods for machines parts which breakdown begins with surface corruption. The most promising methods are chemical-thermal treatment. The aim of this work is to study the impact of boriding on the structure and properties of titanium alloy. Materials and Methods: The material of this study is VT3-1 titanium alloy. The boriding were conducted using nanodispersed powder blend based on boric substances. It is established that boriding of paste compounds allows obtaining the surface hardness within 30 - 29 GPa and with declining to 27- 26 GPa in layer to the transition zone (with total thickness up to 110 μm) owing to changes of the layer phase composition where T 2 B, TiB, TiB 2 titanium borides are formed. The increasing of chemical-thermal treatment time from 15 minutes to 2 hours leads to thickening of the borated layer (30 - 110 μm) and transition zone (30 - 190 μm). Due to usage of nanodispersed boric powder, the boriding duration is decreasing in 2 - 3 times. This allows saving time and electric energy. The developed optimal mode of boriding the VT3-1 titanium alloy allows obtaining the required operational characteristics and to combine the saturation of the surface layer with atomic boron and hardening
Validation of IRDFF in 252Cf Standard and IRDF-2002 Reference Neutron Fields
Directory of Open Access Journals (Sweden)
Simakov Stanislav
2016-01-01
Full Text Available The results of validation of the latest release of International Reactor Dosimetry and Fusion File, IRDFF-1.03, in the standard 252Cf(s.f. and reference 235U(nth,f neutron benchmark fields are presented. The spectrum-averaged cross sections were shown to confirm IRDFF-1.03 in the 252Cf standard spontaneous fission spectrum; that was not the case for the current recommended spectra for 235U(nth,f. IRDFF was also validated in the spectra of the research reactor facilities ISNF, Sigma-Sigma and YAYOI, which are available in the IRDF-2002 collection. The ISNF facility was re-simulated to remove unphysical oscillations in the spectrum. IRDFF-1.03 was shown to reproduce reasonably well the spectrum-averaged data measured in these fields except for the case of YAYOI.
Prompt neutron energy spectrum for the spontaneous fission of Cf-252
International Nuclear Information System (INIS)
Blinov, M.V.; Boykov, G.S.; Vitenko, V.A.
1985-06-01
The prompt neutron spectrum for the spontaneous fission of Cf-252 has been measured in 0.01-10 MeV region by the time-of-flight technique using a fast ionization chamber with U-235 layers as the neutron detector. Numerical data for the spectrum are presented, with an error file. (author)
Welding of a powder metallurgy uranium alloy
International Nuclear Information System (INIS)
Holbert, R.K.; Doughty, M.W.; Alexander-Morrison, G.M.
1989-01-01
The interest at the Oak Ridge Y-12 Plant in powder metallurgy (P/M) uranium parts is due to the potential cost savings in the fabrication of the material, to achieving a more homogeneous product, and to the reduction of uranium scrap. The joining of P/M uranium-6 wt-% niobium (U-6Nb) alloys by the electron beam (EB) welding process results in weld porosity. Varying the EB welding parameters did not eliminate the porosity. Reducing the oxygen and nitrogen content in this P/M uranium material did minimize the weld porosity, but this step made the techniques of producing the material more difficult. Therefore, joining wrought and P/M U-6Nb rods with the inertia welding technique is considered. Since no gases will be evolved with the solid-state welding process and the weld area will be compacted, porosity should not be a problem in the inertia welding of uranium alloys. The welds that are evaluated are wrought-to-wrought, wrought-to-P/M, and P/M-to-P/M U-6Nb samples
Directory of Open Access Journals (Sweden)
Yuqing Qiao
2013-01-01
Full Text Available Structure and electrochemical characteristics of La0.96Ce0.04Mg0.15Al0.05Ni2.8 hydrogen storage alloy have been investigated. X-ray diffraction analyses reveal that the La0.96Ce0.04Mg0.15Al0.05Ni2.8 hydrogen storage alloy consisted of a (La, MgNi3 phase with the rhombohedral PuNi3-type structure and a LaNi5 phase with the hexagonal CaCu5-type structure. TEM shows that the alloy is multicrystal with a lattice space 0.187 nm. EDS analyse shows that the content of Mg is 3.48% (atom which coincide well with the designed composition of the electrode alloy. Electrochemical investigations show that the maximum discharge capacity of the alloy electrode is 325 mAh g−1. The alloy electrode has higher discharge capacity within the discharge current density span from 60 mA g−1 to 300 mA g−1. Electrochemical impedance spectroscopy measurements indicate that the charge transfer resistance RT on the alloy electrode surface and the calculated exchange current density I0 are 0.135 Ω and 1298 mA g−1, respectively; the better eletrochemical reaction kinetic of the alloy electrode may be responsible for the better high-rate dischargeability.
The electrochemistry of chromium, chromium-boron and chromium-phosphorus alloys
International Nuclear Information System (INIS)
Moffat, T.P.; Ruf, R.R.; Latanision, R.M.
1987-01-01
It is fairly well established that chromium-metalloid interactions represent the key to understanding the remarkable corrosion behavior of TM-Cr-M glasses; (Fe, Ni, Co,...)-Cr-(P, Si, C, S). The character and kinetics of passive film growth on the glasses are being studied ni order to assess the role of the film former, chromium, and the metalloids in the passivation process. A series of thin film microcrystalline chromium, Cr-B and Cr-P binary alloys have been fabricated by physical vapor deposition techniques. Vacuum melted conventionally processed chromium has also been studied. Examination of these materials in lM H/sub 2/SO/sub 4/ and lM HCl by voltammetry, potentiostatic and impedance techniques yields the following conclusion: 1. Pure chromium with a grain size varying from < 400 A to 0.5 mm exhibits no well defined differences in electrochemical behavior in lM H/sub 2/SO/sub 4/. 2. The tremendous corrosion resistance of Cr-B alloys has been confirmed. 3. The beneficial effects observed for boron alloyed with chromium may be considered surprising in view of the neutral/negative influence of alloying boron with iron, i.e. Fe/sub 80/B/sub 20/. 4. The interaction of the electrochemistry of the metalloid constituent with that of the transition base element determines the corrosion behavior. 5. Preliminary work with Cr-P alloys indicates that certain compositions exhibit promising properties - certain films were found to be intact after two days of immersion in concentrated HCl. Further work is in progress
Laser Cladding of γ-TiAl Intermetallic Alloy on Titanium Alloy Substrates
Maliutina, Iuliia Nikolaevna; Si-Mohand, Hocine; Piolet, Romain; Missemer, Florent; Popelyukh, Albert Igorevich; Belousova, Natalya Sergeevna; Bertrand, Philippe
2016-01-01
The enhancement of titanium and titanium alloy's tribological properties is of major interest in many applications such as the aerospace and automotive industry. Therefore, the current research paper investigates the laser cladding of Ti48Al2Cr2Nb powder onto Ti6242 titanium alloy substrates. The work was carried out in two steps. First, the optimal deposition parameters were defined using the so-called "combined parameters," i.e., the specific energy E specific and powder density G. Thus, the results show that those combined parameters have a significant influence on the geometry, microstructure, and microhardness of titanium aluminide-formed tracks. Then, the formation of dense, homogeneous, and defect-free coatings based on optimal parameters has been investigated. Optical and scanning electron microscopy techniques as well as energy-dispersive spectroscopy and X-ray diffraction analyses have shown that a duplex structure consisting of γ-TiAl and α 2-Ti3Al phases was obtained in the coatings during laser cladding. Moreover, it was shown that produced coatings exhibit higher values of microhardness (477 ± 9 Hv0.3) and wear resistance (average friction coefficient is 0.31 and volume of worn material is 5 mm3 after 400 m) compared to those obtained with bare titanium alloy substrates (353 Hv0.3, average friction coefficient is 0.57 and a volume of worn material after 400 m is 35 mm3).
48 CFR 252.227-7037 - Validation of restrictive markings on technical data.
2010-10-01
.... However, this clause neither creates nor implies privity of contract between the Government and... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7037 Validation of restrictive markings on... following clause: Validation of Restrictive Markings on Technical Data (SEP 1999) (a) Definitions. The terms...
Properties of mechanically alloyed Mg-Ni-Ti ternary hydrogen storage alloys for Ni-MH batteries
Ruggeri, Stéphane; Roué, Lionel; Huot, Jacques; Schulz, Robert; Aymard, Luc; Tarascon, Jean-Marie
MgNiTi x, Mg 1- xTi xNi and MgNi 1- xTi x (with x varying from 0 to 0.5) alloys have been prepared by high energy ball milling and tested as hydrogen storage electrodes. The initial discharge capacities of the Mg-Ni-Ti ternary alloys are inferior to the MgNi electrode capacity. However, an exception is observed with MgNi 0.95Ti 0.05, which has an initial discharge capacity of 575 mAh/g compared to 522 mAh/g for the MgNi electrode. The Mg-Ni-Ti ternary alloys show improved cycle life compared to Mg-Ni binary alloys with the same Mg/Ni atomic ratio. The best cycle life is observed with Mg 0.5Ti 0.5Ni electrode which retains 75% of initial capacity after 10 cycles in comparison to 39% for MgNi electrodes, in addition to improved high-rate dischargeability (HRD). According to the XPS analysis, the cycle life improvement of the Mg 0.5Ti 0.5Ni electrode can be related to the formation of TiO 2 which limits Mg(OH) 2 formation. The anodic polarization curve of Mg 0.5Ti 0.5Ni electrode shows that the current related to the active/passive transition is much less important and that the passive region is more extended than for the MgNi electrode but the corrosion of the electrode is still significant. This suggests that the cycle life improvement would be also associated with a decrease of the particle pulverization upon cycling.
Magnetic susceptibilities of liquid Cr-Au, Mn-Au and Fe-Au alloys
Energy Technology Data Exchange (ETDEWEB)
Ohno, S.; Shimakura, H. [Niigata University of Pharmacy and Applied Life Sciences, Higashijima, Akiha-ku, Niigata 956-8603 (Japan); Tahara, S. [Faculty of Science, University of the Ryukyus, Nishihara-cho, Okinawa 903-0213 (Japan); Okada, T. [Niigata College of Technology, Kamishin’eicho, Nishi-ku, Niigata 950-2076 (Japan)
2015-08-17
The magnetic susceptibility of liquid Cr-Au, Mn-Au, Fe-Au and Cu-Au alloys was investigated as a function of temperature and composition. Liquid Cr{sub 1-c}Au{sub c} with 0.5 ≤ c and Mn{sub 1-c}Au{sub c} with 0.3≤c obeyed the Curie-Weiss law with regard to their dependence of χ on temperature. The magnetic susceptibilities of liquid Fe-Au alloys also exhibited Curie-Weiss behavior with a reasonable value for the effective number of Bohr magneton. On the Au-rich side, the composition dependence of χ for liquid TM-Au (TM=Cr, Mn, Fe) alloys increased rapidly with increasing TM content, respectively. Additionally, the composition dependences of χ for liquid Cr-Au, Mn-Au, and Fe-Au alloys had maxima at compositions of 50 at% Cr, 70 at% Mn, and 85 at% Fe, respectively. We compared the composition dependences of χ{sub 3d} due to 3d electrons for liquid binary TM-M (M=Au, Al, Si, Sb), and investigated the relationship between χ{sub 3d} and E{sub F} in liquid binary TM-M alloys at a composition of 50 at% TM.
Electrochemical polymerization of pyrrole over AZ31 Mg alloy for biomedical applications
International Nuclear Information System (INIS)
Srinivasan, A.; Ranjani, P.; Rajendran, N.
2013-01-01
Highlights: ► Polymerization of pyrrole over AZ31 Mg was carried out using cyclic voltammetry. ► Pyrrole concentration was optimized to accomplish the adherent and uniform coating. ► Effect of monomer concentration on the surface morphology was discussed. ► Corrosion resistance of AZ31 Mg in SBF was studied as a function of Py concentration. ► PPy coated AZ31 Mg alloy exhibited enhanced corrosion resistance at 0.25 M of Py. -- Abstract: Electrochemical polymerization of pyrrole (Py) from aqueous salicylate solution over AZ31 Mg alloy was carried out using cyclic voltammetry (CV). The effect of monomer concentration on the surface and electrochemical corrosion in simulated body fluid (SBF) were analysed. Attenuated total reflection-infrared (ATR-IR) spectra showed the characteristic ring stretching peaks for polypyrrole (PPy). Scanning electron microscopy (SEM) and atomic force microscopy (AFM) studies exhibited typical cauliflower morphology with rough surface for PPy coated AZ31 Mg alloy. Open circuit potential measurement and potentiodynamic polarization studies revealed that the coating prepared using 0.25 M of Py had positive shift of about 120 mV in corrosion potential and lower corrosion current density (0.03 mA/cm 2 ) compared to other concentrations and uncoated AZ31 Mg alloy (0.25 mA/cm 2 ). Electrochemical impedance spectroscopic (EIS) studies of uncoated and PPy coated Mg alloy in SBF revealed three-time constants behaviour with about one order of increment in impedance value for 0.25 M of Py
Investigation on mechanical alloying process for v-cr-ti alloys
International Nuclear Information System (INIS)
Stanciulescu, M.; Carlan, P.; Mihalache, M.; Bucsa, G.; Abrudeanu, M.; Galateanu, A.
2015-01-01
Mechanical alloying (MA) is an efficient approach for fabricating oxide-dispersion alloys and structural materials including vanadium alloys for fusion and fission application. Dissolution behaviour of the alloying elements is a key issue for optimizing the mechanical alloying process in fabricating vanadium alloys. This paper studies the MA process of V-4wt.%Cr-4wt.%Ti alloy. The outcomes of the MA powders in a planetary ball mill are reported in terms of powder particle size and morphology evolution and elemental composition. The impact of spark-plasma sintering process on the mechanically alloyed powder is analysed. An optimal set of sintering parameters, including the maximum temperature, the dwell time and the heating rate are determined. (authors)
Energy Technology Data Exchange (ETDEWEB)
Hu, Guo-rong, E-mail: hgrhsj@263.net; Liu, Ji-jun; Du, Ke; Peng, Zhong-dong; Cao, Yan-bing; Wang, Wei-gang; Duan, Jian-guo
2014-08-01
To separate ferrum from chromium in the leaching sulfate solution of ferrochrome alloy, the oxalic acid was employed to precipitate the ferrum as the form of FeC{sub 2}O{sub 4} and Cr was left in the solution. In this route, small amount of nickel, cobalt and manganese exited in ferrochrome alloy were also precipitated simultaneously together with ferrous oxalate. Analysis from ICP shows that the molar percent of Fe in oxalic precipitate is 97.9% and the main doped elements are Ni (1.1%) and Mn (0.4%).The mixed metal oxalate Fe{sub (1−x)}M{sub x}C{sub 2}O{sub 4} was used as a raw material to prepare doped LiFePO{sub 4} cathode material of lithium ion batteries. The obtained LiFe{sub (1−x)}M{sub x}PO{sub 4}/C was a single olivine-type phase with higher crystallinity and presents the well-distributed fine particles. It shows an outstanding electrochemical performance with a discharge capacity of 162 mAh/g at the rate of 0.1 C, 136 mAh/g at 1 C and 103 mAh/g at 5 C. When cycled at 1 C for 50 times, the capacity retention is 98.2%.
International Nuclear Information System (INIS)
Zhao, Dianyun; Fan, Dawei; Wang, Jinping; Xu, Caixia
2015-01-01
A hierarchical nanoporous PtCu alloy was fabricated by two-step dealloying of a PtCuAl precursor alloy followed by annealing. The new alloy possesses interconnected hierarchical network architecture with bimodal distributions of ligaments and pores. It exhibits high electrochemical activity towards the oxidation of ascorbic acid (AA), dopamine (DA), and uric acid (UA) at working potentials of 0.32, 0.47 and 0.61 V (vs. a mercury sulfate reference electrode), respectively. The new alloy was placed on a glassy carbon electrode and then displayed a wide linear response to AA, DA, and UA in the concentration ranges from 25 to 800 μM, 4 to 20 μM, and 10 to 70 μM, respectively. The lower detection limits are 17.5 μM, 2.8 µM and 5.7 μM at an S/N ratio of 3. (author)
Electrode characteristics of the (Mm)Ni 5-based hydrogen storage alloys
Energy Technology Data Exchange (ETDEWEB)
Han, Dong Soo; Choi, Seung Jun; Chang, Min Ho; Choi, Jeon; Park, Choong Nyun [Chonnam National University, Kwangju (Korea, Republic of)
1995-06-01
The MmNi-based alloy electrode was studied for use a negative electrode in Ni-MH battery. Alloys with MmNi{sub 5}-{sub x} M{sub x}(M=Co,Al,Mn) composition were synthesized, and their electrode characteristics of activation rate, temperature dependence, electrode capacity and cycle life were investigated. With increasing Al content and decreasing Mn content in the alloys, the discharge capacity increased while the cycle life decreased. As x in MmNi{sub 5}-{sub x} M{sub x} increased from 1.5 to 2.0, decreasing the Ni content, the discharge capacity, the low temperature property and the rate capability decreased. However its cycle life was improved. Increasing Co content resulted in a prolonged cycle life and decrease of high rate discharge capacity. It can be concluded that the most promising alloy in view of discharge capacity and cycle life is MmNi{sub 3}.5 Co{sub 0}.7 Al{sub 0}.5 Mn{sub 0}.3. (author). 9 refs., 9 figs., 1 tab.
Laser surface alloying of aluminium-transition metal alloys
Directory of Open Access Journals (Sweden)
Almeida, A.
1998-04-01
Full Text Available Laser surface alloying has been used as a tool to produce hard and corrosion resistant Al-transition metal (TM alloys. Cr and Mo are particularly interesting alloying elements to produce stable highstrength alloys because they present low diffusion coefficients and solid solubility in Al. To produce Al-TM surface alloys a two-step laser process was developed: firstly, the material is alloyed using low scanning speed and secondly, the microstructure is modified by a refinement step. This process was used in the production of Al-Cr, Al-Mo and Al-Nb surface alloys by alloying Cr, Mo or Nb powder into an Al and 7175 Al alloy substrate using a CO2 laser. This paper presents a review of the work that has been developed at Instituto Superior Tecnico on laser alloying of Al-TM alloys, over the last years.
En el presente trabajo se estudia la aleación superficial mediante láser de aluminio con metales de transición. El cromo y el molibdeno son particularmente interesantes porque producen aleaciones de alta resistencia y por el bajo coeficiente de difusión y solución sólida en aluminio. Para producir estas aleaciones se ha seguido un procedimiento desarrollado en dos partes. En primer lugar, el material se alea usando una baja velocidad de procesado y en segundo lugar la estructura se modifica mediante un refinamiento posterior. Este procedimiento se ha empleado en la producción de aleaciones Al-Cr, Al-Mo y Al-Nb mediante aleación con láser de CO2 de polvos de Cr, Mo o Nb en aluminio y la aleación 7175. Este trabajo es una revisión del desarrollado en el Instituto Superior Técnico de Lisboa en los últimos años.
Approaches for the generation of a covariance matrix for the Cf-252 fission-neutron spectrum
International Nuclear Information System (INIS)
Mannhart, W.
1983-01-01
After a brief retrospective glance is cast at the situation, the evaluation of the Cf-252 neutron spectrum with a complete covariance matrix based on the results of integral experiments is proposed. The different steps already taken in such an evaluation and work in progress are reviewed. It is shown that special attention should be given to the normalization of the neutron spectrum which must be reflected in the covariance matrix. The result of the least-squares adjustment procedure applied can easily be combined with the results of direct spectrum measurements and should be regarded as the first step in a new evaluation of the Cf-252 fission-neutron spectrum. (author)
International Nuclear Information System (INIS)
Markelov, V.A.; Novikov, V.V.; Kon'kov, V.F.; Tselishchev, A.V.; Dologov, A.B.; Zmitko, M.; Maserik, V.; Kocik, J.
2008-01-01
As structural materials for VVER 1000 fuel rod claddings and FA components use is made of zirconium alloys E110 (Zr 1Nb) and E635 (Zr 1.2Sn 1Nb 0.35Fe) that meet the design parameters of operation. Nonetheless, the work is in progress to perfect those alloys to reach higher corrosion and shape change resistance. At VNIINM updated E110M and E635M alloys have been developed on E110 and E635 bases. To assess the corrosion behaviour of the updated alloys in comparison to the base alloys their cladding samples were tested in RVS 3 loop of LWR 15 reactor (NRI, Rez) in PWR water chemistry with coolant surface and volume boiling. The data are presented on the influence effected by in pile irradiation for up to 324 days on oxide coat thickness and microstructure of fuel claddings produced from the four tested alloys. It has been revealed that E110 alloy its updated version E110M and E635M alloy compared to E635 have higher corrosion resistances. The paper discusses th+e results on the in pile corrosion of cladding samples from the alloys under study in comparison to the results acquired for similar samples tested in LWR 15 inactive channel and under autoclave conditions. Using methods of TEM, EDX analyses of extraction replicas dislocation structure and phase composition changes were studied in samples of all four alloy claddings LWR 15 reactor irradiated to the material damage dose of 1.5 dpa. The interrelation is discussed between irradiation effected strengthening and corrosion of fuel claddings made of E110 and E635 type zirconium alloys and the evolution of their structure and phase states
Preparation technology of 103Pd-110Agm composite alloy membranes
International Nuclear Information System (INIS)
Liu Zhuo; Chen Daming; Jin Xiaohai; Li Zhongyong; Guo Feihu; Qin Hongbin
2012-01-01
The preparation of 103 Pd- 110 Ag m alloy membranes was the basis for the production of 103 Pd- 125 I composite sources. Taking 103 Pd and 110 Ag m as trace elements, the method of non-electrolytical plating was chosen to prepare the alloy membrane. A γ-detector and electron microscope (SEM) were used for quantitative and qualitative analysis, respectively. The pre-treatment of the support before the preparation of Palladium-silver composite membranes was discussed in detail. It was found that when the concentration of PdCl 2 was between 0.5 and 2.0 mmol/L the result was good. The effects of various factors were investigated, including the proportion of Pd and Ag, the concentrations of the total metal, ammonium hydroxide hydrazine and ethylenediaminetetraacetic acid, temperature, the time, and the rotation speed. By improving the reaction conditions the alloy membrane with metallic luster was obtained. Besides, the presence of Pd and Ag was observed in the alloy membranes by qualitative analysis. (authors)
International Nuclear Information System (INIS)
Yamashita, H.; Hashimoto, S.; Wada, M.; Dokiya, T.
1986-01-01
Cf-252 fast neutron therapy with high intensity Cf-252 sources was tested for the treatment of advanced gynaecological cancers using a remotely controlled afterloading machine designed by the author and manufactured by Toshiba. Using high intensity sources and short treatment times in a special treatment room, personnel or environment exposure to radiation was at a safe level, i.e. almost nil. During 1978-1983 18 stage III cases of cancer of the uterine cervix were treated with complete response in 78% and 44% 5 year survivals. The types of acute and delayed effects of Cf-252 were the same as Co-60 or Cs-137 but the rectum was found sensitive in this system of brachytherapy. A dose of 1,000-1,500 cGy/6-10 F in 10-22 days of Cf-252 radiation was tolerated and produced tumor cure
Self-positioned thin Pb-alloy base electrode Josephson junction
International Nuclear Information System (INIS)
Kuroda, K.; Sato, K.
1986-01-01
A self-positioned thin (SPOT) Pb-alloy base electrode Josephson junction is developed. In this junction, a 50-nm thick Pb-alloy base electrode is restricted within the junction region on an Nb underlayer using a self-alignment technique. The grain size reduction and the base electrode area restriction greatly improve thermal cycling stability, where the thermal cycling tests of 4000 proposed junctions (5 x 5 μm 2 ) showed no failures after 4000 cycles. In addition, the elimination of insulator layer stress on the Pb-alloy base electrode rectifies the problem of size effect on current density. The Nb underlayers also serve to isolate the Pb-alloy base electrodes from the resistors
Directory of Open Access Journals (Sweden)
Bünyamin Alım
2018-04-01
Full Text Available K shell X-ray fluorescence cross-sections (σKα, σKβ and σK, and K shell fluorescence yields (ωK of Ti, Ni both in pure metals and in different alloy compositions (TixNi1-x; x = 0.3, 0.4, 0.5, 0.6, 0.7 were measured by using energy dispersive X-ray fluorescence (EDXRF technique. The samples were excited by 22.69 keV X-rays from a 10 mCi Cd-109 radioactive point source and K X rays emitted by samples were counted by a high resolution Si(Li solid-state detector coupled to a 4 K multichannel analyzer (MCA. The alloying effects on the X-ray fluorescence (XRF parameters of Ti-Ni shape memory alloys (SMAs were investigated. It is clearly observed that alloying effect causes to change in K shell XRF parameter values in Ti-Ni based SMAs for different compositions of x. Also, the present investigation makes it possible to perform reliable interpretation of experimental σKα, σKβ and ωK values for Ti and Ni in SMAs and can also provide quantitative information about the changes of K shell X-ray fluorescence cross sections and fluorescence yields of these metals with alloy composition. Keywords: Alloying effect, XRF, K X-ray fluorescence cross-section, K shell fluorescence yield, Shape memory alloy
Directory of Open Access Journals (Sweden)
Kenneth Kanayo ALANEME
2015-05-01
Full Text Available The corrosion behaviour of Al-Mg-Si alloy based composites reinforced with groundnut shell ash (GSA and silicon carbide (SiC was investigated. The aim is to assess the corrosion properties of Al-Mg-Si alloy based hybrid reinforced composites developed using different mix ratios of GSA (a cheaply processed agro waste derivative which served as partial replacement for SiC and SiC as reinforcing materials. GSA and SiC mixed in weight ratios 0:1, 1:3, 1:1, 3:1, and 1:0 were utilized to prepare 6 and 10 wt% of the reinforcing phase with Al‐Mg‐Si alloy as matrix using two‐step stir casting method. Mass loss and corrosion rate measurement was used to study the corrosion behaviour of the produced composites in 3.5% NaCl and 0.3M H2SO4 solutions. The results show that the Al-Mg-Si alloy based composites containing 6 and 10 wt% GSA and SiC in varied weight ratios were resistant to corrosion in 3.5% NaCl solution. The composites were however more susceptible to corrosion in 0.3M H2SO4 solution (in comparison with the 3.5% NaCl solution. It was noted that the Al-Mg-Si/6 wt% GSA-SiC hybrid composite grades containing GSA and SiC in weight ratio 1:3 and 3:1 respectively exhibited superior corrosion resistance in the 0.3M H2SO4 solution compared to other composites produced for this series. In the case of the Al-Mg-Si/10 wt% GSA-SiC hybrid composite grades, the corrosion resistance was relatively superior for the composites containing a greater weight ratio of GSA (75% and 100% in 0.3M H2SO4 solution.
Search for fully compensated ferrimagnet in Co substituted Mn2VGa alloy
International Nuclear Information System (INIS)
Deka, Bhargab; Singh, R.K.; Srinivasan, A.
2015-01-01
Crystallographic and magnetic properties of bulk (Mn 1−x Co x ) 2 VGa alloys with 0≤x≤0.50 are reported in this work. All the alloys exhibit stable L2 1 structure. Unit cell volume of this series of alloys decreased from 207.5 Å 3 to 195.1 Å 3 as x was increased from 0 to 0.50. All the alloys shows ferrimagnetic behavior with Curie temperature decreasing from 763 K to 367 K with increase in x. Saturation magnetization (M s ) measured for the alloys with x=0, 0.25 and 0.50 are 1.84 μ B /f.u., 0.85 μ B /f.u. and 0.30 μ B /f.u., respectively, as compared to the values of 2.00 μ B /f.u., 1.00 μ B /f.u. and 0 μ B /f.u., predicted by the Slater–Pauling (S–P) rule. While explaining the deviations in the M s from the values predicted by the S–P rule, a fully compensated ferrimagnet is expected in an alloy with total number of valance electrons of 24.1. - Highlights: • (Mn 1−x Co x ) 2 VGa alloys with highly ordered L2 1 structure has been obtained • With Co substitution, magnetization of (Mn 1-x Co x ) 2 VGa alloys reduces to 0.3= B /f.u. • Fully compensated ferrimagnet is expected in the alloy with 24.1 valance electrons
Structure and grindability of dental Ti-Cr alloys
International Nuclear Information System (INIS)
Hsu, H.-C.; Wu, S.-C.; Chiang, T.-Y.; Ho, W.-F.
2009-01-01
The purpose of this study was to investigate the structure and microhardness of a series of binary Ti-Cr alloys with Cr contents up to 30 wt%. In addition, the grindability was also evaluated using an electric dental handpiece with SiC wheels, with the goal of developing a titanium alloy with better mechanical properties and machinability than commercially pure titanium (c.p. Ti), a metal generally considered to be difficult to machine. This study evaluated the phase and structure of Ti-Cr alloys, using an X-ray diffraction (XRD) for phase analysis and optical microscope for microstructure of the etched alloys. Grindability was evaluated by measuring the amount of metal volume removed after grinding for 1 min. Results indicated that the structure of Ti-Cr alloys is sensitive to the Cr content. The cast c.p. Ti has a hexagonal α phase. With 5 wt% Cr, metastable β phase starts to be retained. With Cr contents higher than 10 wt%, the equi-axed β phase is almost entirely retained. In addition, athermal ω phase was found in the Ti-5Cr and Ti-10Cr alloys. The largest quantity of ω phase and highest microhardness were found in Ti-10Cr alloy. The grinding rate of the Ti-Cr alloys showed a similar tendency to the microhardness. The Ti-10Cr alloy exhibited the best grindability, especially at 1000 m/min, which presumably due to the brittle nature of the alloy containing the ω phase in the β matrix.
Machinability of zinc-aluminum alloy5; zamzk5; alloy produced by powder metallurgy
International Nuclear Information System (INIS)
Adnan, I.O.; Momani, M.A.A.
2007-01-01
Powder metallurgy process (P/M) is repeatedly reported as a near-net or net-shape manufacturing process with the ability of producing parts of complicated or intricate shapes with high required dimensional accuracy and high surface quality. However, some finishing and machining operations are sometimes necessary and must be done to meet dimensional tolerances or accommodate design features that can be achieved during compaction such as transverse holes, undercuts and threads. Therefore, it is necessary to study the machinability of P/M products. ZAMAK5 alloy is widely used in engineering applications in the automobile industry, particularly in the manufacturing of bushes and recently self -lubricated bearings which are manufactured by the P/M process. Therefore it is anticipated that studying the machinability of this alloy as produced by the powder metallurgy process is worthwhile investigating. In this paper, the machinability of ZAMAK5, alloy produced by powder metallurgy, under different cutting conditions of speed, depth of cut and feed rate is carried out. Surface roughness was used as a criterion for assessing machinability at the different conditions. It was found that specimens compacted at 475 MPa and having 1% addition of zinc stearates as a binder and lubricant gave better surface quality than those produced at 550 MPa compacting pressure,whereas at 1.5% addition of zinc stearates produced worse surface quality (i.e. Higher surface roughness than in case of 475 MPa compacting pressure). On the whole, the results of the experimental work revealed that the surface roughness at the different cutting conditions remained within the accepted level in industry, less than 2 microns. (author)
From Porous to Dense Nanostructured β-Ti alloys through High-Pressure Torsion.
Afonso, Conrado R M; Amigó, Angelica; Stolyarov, Vladimir; Gunderov, Dmitri; Amigó, Vicente
2017-10-19
β-Ti alloys have low elastic modulus, good specific strength and high corrosion resistance for biomaterial applications. Noble elements, such as Nb, Ta and Mo, are used to obtain β-Ti due to their chemical biocompatibility. However, due to their refractory nature, β-Ti requires specific processing routes. Powder metallurgy (P/M) allows for the development of new β-Ti alloys with decreasing costs, but dealing with high-elemental-content alloys can lead to a lack of diffusion and grain growth. One method to refine the structure and improve mechanical properties is a severe plastic deformation technique through high-pressure torsion (HPT). The aim of this work was to evaluate the conversion of P/M porous β-Ti-35Nb-10Ta-xFe alloys to dense nanostructures through high-pressure torsion in one deformation step and the influence of the structure variation on the properties and microstructure. TEM analysis and ASTAR crystallographic mapping was utilized to characterize the nanostructures, and the properties of P/M β Ti-35Nb-10Ta-xFe alloys processed by HPT were compared. The initial microstructure consisted mainly by the β-Ti phase with some α-Ti phase at the grain boundaries. The HPT process refined the microstructure from 50 µm (P/M) down to nanostructured grains of approximately 50 nm.
Magnetic hysteresis properties of melt-spun Nd-Fe-B alloys prepared by centrifugal method
International Nuclear Information System (INIS)
Andreev, S.V.; Kudrevatykh, N.V.; Pushkarsky, V.I.; Markin, P.E.; Zaikov, N.K.; Tarasov, E.N.
1998-01-01
Magnetic hysteresis properties and microstructure peculiarities of melt spun Nd-Fe-B alloys (ribbons) prepared by melt quenching onto the internal surface of an iron spinning wheel at tangential speeds in the range 5-20 m/s are reported. The alloy composition was Nd-36% wt, B-1.2% wt. and Fe-remainder. It was found that the coercivity of ribbons does not practically depend on the wheel speed in applied range (18 kOe at 5 m/s and 22 kOe at 20 m/s), whereas the grain size of the basic phase (2-14-1) ste[ily decreases when the speed rises, starting from 2-3 μm for 5 m/s alloy down to the 200-300 nm for 20 m/s alloy. All ribbons have normal convex demagnetization curves, even those prepared at low wheel speeds (without peculiar step near H∝0, which usually exists on such curves for tr[itionally prepared underquenched melt-spun Nd-Fe-B alloys). Grinding the ribbon in a vibration mill causes the coercivity drop to 7 kOe after 120 min of treatment. However, this operation increases the powder alignment ability and, as a result, the energy product for a fully dense magnet from anisotropic powder prepared from some ribbons rises to 20-23 MGOe. (orig.)
48 CFR 252.219-7003 - Small business subcontracting plan (DoD contracts).
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7003 Small business subcontracting plan (DoD contracts). As prescribed in 219.708(b)(1)(A), use the following clause: Small Business...
Characteristics of mechanical alloying of Zn-Al-based alloys
International Nuclear Information System (INIS)
Zhu, Y.H.; Hong Kong Polytechnic; Perez Hernandez, A.; Lee, W.B.
2001-01-01
Three pure elemental powder mixtures of Zn-22%Al-18%Cu, Zn-5%Al-11%Cu, and Zn-27%Al-3%Cu (in wt.%) were mechanically alloyed by steel-ball milling processing. The mechanical alloying characteristics were investigated using X-ray diffraction, scanning electron microscopy, and transmission electron microscopy techniques. It was explored that mechanical alloying started with the formation of phases from pure elemental powders, and this was followed by mechanical milling-induced phase transformation. During mechanical alloying, phases stable at the higher temperatures formed at the near room temperature of milling. Nano-structure Zn-Al-based alloys were produced by mechanical alloying. (orig.)
Vacancy enhancement of diffusion after quenching and during irradiation in silver-zinc alloys
International Nuclear Information System (INIS)
Schuele, W.
1980-01-01
Quenching and annealing experiments were performed on silver-zinc alloys with 8.14 and 30 at %Zn. From the changes of the electrical resistivity due to an increase of the degree of short-range order, the activation energy of self-diffusion was determined to be Qsub(SD) = 1.60 and Qsub(SD) = 1.38 eV for both alloys, respectively. For the migration energy of vacancies, a value Esub(V)sup(M) = 0.64 eV was found for the alloy with 8.14 at %Zn. Evidence is given that the vacancy migration energy Esub(V)sup(M) of the alloys with 30 at %Zn is smaller than 0.60 eV in agreement with data given by Berry and Orehotsky. The results of measurements of radiation-enhanced diffusion obtained by a Russian and a French group, are reinterpreted. It follows that the increase of the degree of order during irradiation is obtained only be vacancy enhancement of diffusion and that the migration activation energy of self-interstitials is Esub(I)sup(M) approximately 0.46 eV and Esub(I)sup(M) approximately 0.41 eV for the alloys with 8.14 and 30 at %Zn, respectively. (author)
Development of neutron induced prompt γ-ray spectroscopy system using 252Cf
International Nuclear Information System (INIS)
Park, Yong-Joon; Song, Byung-Chul; Jee, Kwang-Yong
2003-01-01
For the design and set-up of neutron induced prompt γ-ray spectroscopy system using 252 Cf neutron source, the effects of shielding and moderator materials have been examined. The 252 Cf source being used for TLD badge calibration in Korea Atomic Energy Research Institute was utilized for this preliminary experiment. The γ-ray background and prompt γ-ray spectrum of the sample containing Cl were measured using HPGe (GMX 69% relative efficiency) located at the inside of the system connected to notebook PC at the outside of the system (about 20 meter distance). The background activities of neutron and γ-rays were measured with neutron survey meter as well as γ-ray survey meters, respectively and the system was designed to minimize the activities. Prompt γ-ray spectrum was measured using γ-γ coincident system for reduce the background and the continuum spectrum. The optimum system was designed and set up using the experimental data obtained
Determining {sup 252}Cf source strength by absolute passive neutron correlation counting
Energy Technology Data Exchange (ETDEWEB)
Croft, S. [Oak Ridge National Laboratory, Oak Ridge, TN 37831-6166 (United States); Henzlova, D., E-mail: henzlova@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)
2013-06-21
Physically small, lightly encapsulated, radionuclide sources containing {sup 252}Cf are widely used for a vast variety of industrial, medical, educational and research applications requiring a convenient source of neutrons. For many quantitative applications, such as detector efficiency calibrations, the absolute strength of the neutron emission is needed. In this work we show how, by using a neutron multiplicity counter the neutron emission rate can be obtained with high accuracy. This provides an independent and alternative way to create reference sources in-house for laboratories such as ours engaged in international safeguards metrology. The method makes use of the unique and well known properties of the {sup 252}Cf spontaneous fission system and applies advanced neutron correlation counting methods. We lay out the foundation of the method and demonstrate it experimentally. We show that accuracy comparable to the best methods currently used by national bodies to certify neutron source strengths is possible.
Ye, Jia; Gao, Yong
2012-01-01
Rotary instruments made of a new nickel-titanium (NiTi) alloy (M-Wire) have shown improved cyclic fatigue resistance and mechanical properties compared with those made of conventional superelastic NiTi wires. The objective of this study was to characterize microstructural changes of M-Wire throughout the cyclic fatigue process under controlled strain amplitude. The average fatigue life was calculated from 30 M-Wire samples that were subjected to a strain-controlled (≈ 4%) rotating bend fatigue test at room temperature and rotational speed of 300 rpm. Microstructural evolution of M-Wire has been investigated by different metallurgical characterization techniques, including differential scanning calorimetry, Vickers microhardness, and transmission electron microscopy at 4 different stages (as-received state, 30%, 60%, and 90% of average fatigue life). During rotating bend fatigue test, no statistically significant difference (P > .05) was found on austenite finish temperatures between as-received M-Wire and fatigued samples. However, significant differences (P Wire are expected to have higher strength and wear resistance than similar instruments made of conventional superelastic NiTi wires because of its unique nano-crystalline martensitic microstructure. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Characterization and corrosion behaviour of CoNi alloys obtained by mechanical alloying
Energy Technology Data Exchange (ETDEWEB)
Olvera, S. [Instituto Politécnico Nacional, ESIQIE, Departamento de Ingeniería en Metalurgia y Materiales, México, D. F. (Mexico); Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Química-Física Aplicada, 28049 Madrid (Spain); Sánchez-Marcos, J. [Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Química-Física Aplicada, 28049 Madrid (Spain); Palomares, F.J. [Instituto de Ciencia de Materiales de Madrid, ICMM-CSIC, Cantoblanco, 28049 Madrid (Spain); Salas, E. [Spline Spanish CRG Beamline at the European Synchrotron Radiation Facilities, ESRF, BP 220-38043, Grenoble Cedex (France); Arce, E.M. [Instituto Politécnico Nacional, ESIQIE, Departamento de Ingeniería en Metalurgia y Materiales, México, D. F. (Mexico); Herrasti, P., E-mail: pilar.herrasti@uam.es [Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Química-Física Aplicada, 28049 Madrid (Spain)
2014-07-01
CoNi alloys including Co{sub 30}Ni{sub 70}, Co{sub 50}Ni{sub 50} and Co{sub 70}Ni{sub 30} were prepared via mechanical alloying using Co and Ni powders. The crystallinity and short-range order were studied using X-ray diffraction and X-ray absorption spectroscopy. The results show that the milling process increases the number of vacancies, especially around the Co atoms, while the milling time decreases the crystalline size and enhances the crystallinity. X-ray photoelectron spectroscopy was used to characterise the chemical composition of the samples surface. The magnetic properties were analysed using zero-field cooling, field cooling and a magnetic hysteresis loops. The magnetic saturation moment is approximately 1.05 μ{sub B}/atom; this value decreases with the mechanical alloying time, and it is proportional to the cobalt concentration. The polarization and impedance curves in different media (NaCl, H{sub 2}SO{sub 4} and NaOH) showed similar corrosion resistance values. The corrosion resistance increased in the order NaCl, H{sub 2}SO{sub 4} and NaOH. A good passivation layer was formed in NaOH due to the cobalt and nickel oxides on the particle surfaces. - Highlights: • Ni{sub x}Co{sub 100-x} alloys were synthesized by mechanical alloying • Milling time decrease size and enhances crystallinity. • Oxygen is not present in a significant percentage in bulk but is detected on the surface. • Magnetic saturation moment is 1.05 mB/atom and decrease with mechanical allowing time • Corrosion resistance is higher in NaOH than in NaCl or HCl solutions.
The development of zirconium alloy and its manufacturing
International Nuclear Information System (INIS)
Yuan Gaihuan; Yue Qiang
2015-01-01
Nuclear power which acts as one of low-carbon energy resources is the most realistic in large-scale application. It is also the preferred choice for many countries to develop energy resources and optimize its structure. Zirconium alloy is a key structural material for nuclear power plant fuel assemblies and cladding tubes of zirconium alloy are often referred as the first safeguard to nuclear power safety. With the development of nuclear power, three kinds of zirconium alloys Zr-Sn, Zr-Nb, Zr-Sn-Nb and with the representative products of Zr-4, M5, Zirlo respectively are developed and widely applied. Because of its severe operating environment and influence to nuclear safety, the requirements to zirconium alloys for physical and chemical properties, nuclear capability, tolerance and surface quality are very strict. The in-depth research and its manufacture capability become one of the main barriers for many countries who are developing the nuclear energy. In recent years, a stated-owned company, State Nuclear Bao Ti Zirconium Industry Company ('SNZ' for short) as well as National R and D Center for Nuclear Grade Zirconium material, is founded to meet the requirement of the rapid development of China's nuclear power industry. SNZ is dedicated for the fabrication and the research of nuclear grade zirconium products. After the successful completion of technology transfer of manufacturing for production chain and fully grasped of the manufacturing technology for the nuclear grade zirconium sponge through zirconium alloy tube, rod and strip products. National R and D Center for Nuclear Grade Zirconium material is cooperating with universities, nuclear energy research and design institutes and the owners of nuclear power plant to develop new zirconium alloy of self-owned brand. Through the selection of components, in-process testing and product inspection, four kinds of new zirconium alloys owns better performance than currently commercialized M5, Zirlo etc
Brachytherapy of carcinoma of vulva with 252Cf
International Nuclear Information System (INIS)
Spikalovas, V.; Sinkevicius, V.; Drulia, E.; Kurtinaitis, J.
1996-01-01
Thirty patients with carcinoma of vulva were treated with interstitial neutron radiotherapy with 252 Cf. Age of patients was from 32 to 83 years. Stage I was in I patient, stage II - in 12, stage III was in 10 patients. The diagnosis of vulvar cancer was made for the first time in 11 cases, 19 patients had recurrences after the initial treatment. Most of these patients also received external irradiation for cancer of vulva and bilateral inguinal sites with a single fraction dose of 2 Gy to a total dose 30-50 Gy. Enlarged inguinal lymph nodes were irradiated additionally to 60 Gy with reduced field of irradiation. When radiotherapy was used repeatedly interstitial brachytherapy comprised the major part of irradiation dose or the therapy was used alone delivering 35-55 iGy. We used 252 Cf sources with increased activity at the ends 20-30 mm long. A number of inserted sources varied from 2 to 10, irradiation dose rate from 20.3 to 236.7 cGy/h, time of irradiation from 10.2 to 12. hours, RBE from 4.6 to 6.33. Special template device made it possible to implant sources in strictly pre-set geometry. Analysis of survival of patients showed that 2 years survival was 66%, 3 years - 60%, and 5 years survival was 49%. In two cases necrotic epithelitis developed with following radiation ulcer which were cured in 3-4 months. Clinical data showed great effectiveness of interstitial neutron therapy having in mind that 19 patients were treated for recurrences of vulvar cancer after previuos treatment
Zhang, Yang-Huan; Li, Bao-Wei; Ren, Hui-Ping; Li, Xia; Qi, Yan; Zhao, Dong-Liang
2011-01-18
Mg₂Ni-type Mg₂Ni 1-x Co x (x = 0, 0.1, 0.2, 0.3, 0.4) alloys were fabricated by melt spinning technique. The structures of the as-spun alloys were characterized by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The hydrogen absorption and desorption kinetics of the alloys were measured by an automatically controlled Sieverts apparatus. The electrochemical hydrogen storage kinetics of the as-spun alloys was tested by an automatic galvanostatic system. The results show that the as-spun (x = 0.1) alloy exhibits a typical nanocrystalline structure, while the as-spun (x = 0.4) alloy displays a nanocrystalline and amorphous structure, confirming that the substitution of Co for Ni notably intensifies the glass forming ability of the Mg₂Ni-type alloy. The melt spinning treatment notably improves the hydriding and dehydriding kinetics as well as the high rate discharge ability (HRD) of the alloys. With an increase in the spinning rate from 0 (as-cast is defined as spinning rate of 0 m/s) to 30 m/s, the hydrogen absorption saturation ratio () of the (x = 0.4) alloy increases from 77.1 to 93.5%, the hydrogen desorption ratio () from 54.5 to 70.2%, the hydrogen diffusion coefficient (D) from 0.75 × 10 - 11 to 3.88 × 10 - 11 cm²/s and the limiting current density I L from 150.9 to 887.4 mA/g.
Corrosion of iron-base alloys by lithium
International Nuclear Information System (INIS)
Selle, J.E.
1976-01-01
A review of corrosion mechanisms operating in lithium-iron-base alloy systems is presented along with data obtained with thermal-convection loops of niobium-stabilized 2 1 / 4 percent Cr-1 percent Mo steel and types 304L and 321 stainless steels. A corrosion rate of 2.3 μm/year (0.09 mil/year) was obtained on the 2 1 / 4 percent Cr-1 percent Mo steel at 600 0 C. Considerably more mass transport of alloying constituents and a maximum corrosion rate of about 14 μm/year (0.55 mil/year) was obtained with the austenitic stainless steels. Results of metallography, x-ray fluorescence analysis, scanning electron microscopy, and weight-change data are presented and discussed
Copper alloys for high heat flux structure applications
International Nuclear Information System (INIS)
Zinkle, S.J.; Fabritsiev, S.A.
1994-01-01
The mechanical and physical properties of copper alloys are reviewed and compared with the requirements for high heat flux structural applications in fusion reactors. High heat flux structural materials must possess a combination of high thermal conductivity and high mechanical strength. The three most promising copper alloys at the present time are oxide dispersion-strengthened copper (Cu-Al 2 O 3 ) and two precipitation-hardened copper alloys (Cu-Cr-Zr and Cu-Ni-Be). These three alloys are capable of room temperature yield strengths >400 MPa and thermal conductivities up to 350 W/m-K. All of these alloys require extensive cold working to achieve their optimum strength. Precipitation-hardened copper alloys such Cu-Cr-Zr are susceptible to softening due to precipitate overaging and recrystallization during brazing, whereas the dislocation structure in Cu-Al 2 O 3 remains stabilized during typical high temperature brazing cycles. All three alloys exhibit good resistance to irradiation-induced softening and void swelling at temperatures below 300 degrees C. The precipitation-strengthened allows typically soften during neutron irradiation at temperatures above about 300 degrees C and therefore should only be considered for applications operating at temperatures 2 O 3 ) is considered to be the best candidate for high heat flux structural applications
Gd{sub 90}Co{sub 2.5}Fe{sub 7.5} alloy displaying enhanced magnetocaloric properties
Energy Technology Data Exchange (ETDEWEB)
Provenzano, V., E-mail: virgil12@nist.gov [Materials Science and Engineering Division, NIST, Gaithersburg, MD 20899-8552 (United States); Shull, R.D., E-mail: robert.shull@nist.gov [Materials Science and Engineering Division, NIST, Gaithersburg, MD 20899-8552 (United States); Kletetschka, G., E-mail: kletetschka@gmail.com [Faculty of Science, Charles University, Prague 12843 (Czech Republic); Institute of Geology, Academy of Science of the Czech Republic, v.v.i., Prague 16500 (Czech Republic); Stutzman, P.E., E-mail: paul.stutzman@nist.gov [Materials and Structural Systems Division, NIST, Gaithersburg, MD 20899-861 (United States)
2015-02-15
Highlights: • The Gd{sub 90}Co{sub 2.5}Fe{sub 7.5} alloy displays superior magnetocaloric properties than Gd. • Alloy’s superior properties at relatively low field values: 400, 800 kA/m (0.5, 1 T). • We proposed two possible mechanisms for the Gd-based alloy enhanced properties. • We indicated a pathway for further improving the alloy magnetocaloric properties. - Abstract: We report on the discovery of a new Gd{sub 90}Co{sub 2.5}Fe{sub 7.5} alloy exhibiting superior magnetocaloric properties compared to those of gadolinium. We present magnetically-derived entropy change, ΔS{sub M}, computed from magnetic data, and thermally-derived temperature change, ΔT{sub ad}, obtained from direct thermal measurements together with their respective MCE peaks for the alloy and gadolinium. The MCE peaks of the alloy are taller and broader than the corresponding MCE peaks of gadolinium. Correspondingly, the refrigeration capacity (RC) values of the alloy computed from magnetic and thermal MCEs for field changes, ΔH, of 400 kA/m (0.5 T) and 800 kA/m (1 T) are about 20% larger than those of gadolinium. Two possible mechanisms are proposed to account for the improved magnetocaloric properties of gadolinium alloyed with small amounts of Co and Fe, thereby pointing out a different methodology to use in the search for improved low field magnetic refrigerants.
{sup 5}He ternary fission yields of {sup 252}Cf and {sup 235}U(n,f)
Energy Technology Data Exchange (ETDEWEB)
Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Ramayya, A. V. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Hamilton, J. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Beyer, C. J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Kormicki, J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Zhang, X. Q. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Rodin, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Formichev, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Kliman, J. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Krupa, L. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation)] (and others)
2000-04-01
The relative {sup 4}He and {sup 5}He ternary fission yields were determined from a careful analysis of the energy distribution of {alpha} spectra from a new measurement with a {sup 252}Cf source and from published data on {sup 252}Cf and {sup 235}U(n,f). The kinetic energies of the {sup 5}He and {sup 4}He ternary particles were found to be approximately 11 and 16 MeV, respectively. {sup 5}He particles contribute 10-20 % to the total alpha yield with the remainder originating from {sup 4}He accompanied fission. (c) 2000 The American Physical Society.
Energy Technology Data Exchange (ETDEWEB)
Patel, Bhairav [Department of Mechanical Engineering, University College London, Torrington Place, London WC1E 7JE (United Kingdom); Favaro, Gregory [CSM Instruments SA, Rue de la Gare 4, Galileo Center, CH-2034 Peseux (Switzerland); Inam, Fawad [Advanced Composite Training and Development Centre and School of Mechanical and Aeronautical Engineering, Glyndwr University, Mold Road, Wrexham LL11 2AW (United Kingdom); School of Engineering and Materials Science and Nanoforce Technology Ltd, Queen Mary University of London, London E1 4NS (United Kingdom); Reece, Michael J. [School of Engineering and Materials Science and Nanoforce Technology Ltd, Queen Mary University of London, London E1 4NS (United Kingdom); Angadji, Arash [Orthopaedic Research UK, Furlong House, 10a Chandos Street, London W1G 9DQ (United Kingdom); Bonfield, William [Department of Materials Science and Metallurgy, University of Cambridge, Pembroke Street, Cambridge CB2 3QZ (United Kingdom); Huang, Jie [Department of Mechanical Engineering, University College London, Torrington Place, London WC1E 7JE (United Kingdom); Edirisinghe, Mohan, E-mail: m.edirisinghe@ucl.ac.uk [Department of Mechanical Engineering, University College London, Torrington Place, London WC1E 7JE (United Kingdom)
2012-07-01
The average longevity of hip replacement devices is approximately 10-15 years, which generally depends on many factors. But for younger generation patients this would mean that revisions may be required at some stage in order to maintain functional activity. Therefore, research is required to increase the longevity to around 25-30 years; a target that was initially set by John Charnley. The main issues related to metal-on-metal (MoM) hip replacement devices are the high wear rates when malpositioned and the release of metallic ions into the blood stream and surrounding tissues. Work is required to reduce the wear rates and limit the amount of metallic ions being leached out of the current MoM materials, to be able to produce an ideal hip replacement material. The most commonly used MoM material is the cobalt-based alloys, more specifically ASTM F75, due to their excellent wear and corrosion resistance. They are either fabricated using the cast or wrought method, however powder processing of these alloys has been shown to improve the properties. One powder processing technique used is spark plasma sintering, which utilises electric current Joule heating to produce high heating rates to sinter powders to form an alloy. Two conventionally manufactured alloys (ASTM F75 and ASTM F1537) and a spark plasma sintered (SPS) alloy were evaluated for their microstructure, hardness, tribological performance and the release of metallic content. The SPS alloy with oxides and not carbides in its microstructure had the higher hardness, which resulted in the lowest wear and friction coefficient, with lower amounts of chromium and molybdenum detected from the wear debris compared to the ASTM F75 and ASTM F1537. In addition the wear debris size and size distribution of the SPS alloy generated were considerably small, indicating a material that exhibits excellent performance and more favourable compared to the current conventional cobalt based alloys used in orthopaedics. - Highlights
The fast neutron emission spectrum of 252-Cf
International Nuclear Information System (INIS)
Bensch, F.
1979-07-01
The aim of this work was a new measurement of the neutron emission spectrum of 252-Cf neutron standard sources as the IAEA is offering to users. The main feature was the application of gas-filled proton-recoil spectrometers and no TOF technique. The special interest of this document was in the temperature parameter of the Maxwellian distribution and in its relative deviations. In this connection, special measurements with high energy resolution were carried out in a search for fine structure neutron groups, which have been observed in some TOF measurements, but could not be reproduced during this measurement
Microstructures and Electrochemical Behavior of Ti-Mo Alloys for Biomaterials
Directory of Open Access Journals (Sweden)
Back-Sub Sung
2015-01-01
Full Text Available The Ti alloy with 7 wt% Mo revealed a microstructure that contained only the orthorhombic α′′ phase of a fine acicular martensitic structure. The corrosion resistance of the Ti-Mo alloys increased as the Mo content increased. Based on the results obtained from the polarization curve and electrochemical impedance, the Ti-Mo alloys were shown to be corrosion resistant because of the passive films formed on their surfaces. No ion release was detected in SBF (simulated body fluid solution, while Ti ions were released in 0.1% lactic acid ranging from 0.05 to 0.12 μg/mL for the Ti-Mo alloys. In vitro tests showed that MC3T3-E1 cell proliferation on Ti-7 wt% Mo alloy was rather active compared to other Ti-Mo alloys and commercial-grade pure Ti.
Bonding tungsten, W–Cu-alloy and copper with amorphous Fe–W alloy transition
Energy Technology Data Exchange (ETDEWEB)
Wang, Song, E-mail: wangsongrain@163.com [Laboratory of Special Ceramics and Powder Metallurgy, University of Science and Technology Beijing, Beijing 100083 (China); Laboratory of Advanced Materials, Tsinghua University, Beijing 100084 (China); Ling, Yunhan, E-mail: yhling@mail.tsinghua.edu.cn [Laboratory of Advanced Materials, Tsinghua University, Beijing 100084 (China); Zhao, Pei [Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100039 (China); Zang, Nanzhi [Laboratory of Advanced Materials, Tsinghua University, Beijing 100084 (China); Wang, Jianjun [Laboratory of Special Ceramics and Powder Metallurgy, University of Science and Technology Beijing, Beijing 100083 (China); Guo, Shibin [Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100039 (China); Zhang, Jun [Laboratory of Advanced Materials, Tsinghua University, Beijing 100084 (China); Xu, Guiying [Laboratory of Special Ceramics and Powder Metallurgy, University of Science and Technology Beijing, Beijing 100083 (China)
2013-05-15
W/Cu graded materials are the leading candidate materials used as the plasma facing components in a fusion reactor. However, tungsten and copper can hardly be jointed together due to their great differences in physical properties such as coefficient of thermal expansion and melting point, and the lack of solid solubility between them. To overcome those difficulties, a new amorphous Fe–W alloy transitional coating and vacuum hot pressing (VHP) method were proposed and introduced in this paper. The morphology, composition and structure of the amorphous Fe–W alloy coating and the sintering interface of the specimens were analyzed by scanning electron microscopy (SEM), energy dispersive spectrometer (EDS) and X-ray diffraction (XRD). The thermal shock resistance of the bonded composite was also tested. The results demonstrated that amorphous structure underwent change from amorphous to nano grains during joining process, and the joined W/Cu composite can endued plasma thermal shock resistance with energy density more than 5.33 MW/m{sup 2}. It provides a new feasible technical to join refractory tungsten to immiscible copper with amorphous Fe–W alloy coating.
High-power laser and arc welding of thorium-doped iridium alloys
International Nuclear Information System (INIS)
David, S.A.; Liu, C.T.
1980-05-01
The arc and laser weldabilities of two Ir-0.3% W alloys containing 60 and 200 wt ppM Th have been investigated. The Ir-.03% W alloy containing 200 wt ppM Th is severely prone to hot cracking during gas tungsten-arc welding. Weld metal cracking results from the combined effects of heat-affected zone liquation cracking and solidification cracking. Scanning electron microscopic analysis of the fractured surface revealed patches of low-melting eutectic. The cracking is influenced to a great extent by the fusion zone microstructure and thorium content. The alloy has been welded with a continuous-wave high-power CO 2 laser system with beam power ranging from 5 to 10 kW and welding speeds of 8 to 25 mm/s. Successful laser welds without hot cracking have been obtained in this particular alloy. This is attributable to the highly concentrated heat source available in the laser beam and the refinement in fusion zone microstructure obtained during laser welding. Efforts to refine the fusion zone structure during gas tungsten-arc welding of Ir-0.3 % W alloy containing 60 wt ppM Th were partially successful. Here transverse arc oscillation during gas tungsten-arc welding refines the fusion zone structure to a certain extent. However, microstructural analysis of this alloy's laser welds indicates further refinement in the fusion zone microstructure than in that from the gas tungsten-arc process using arc oscillations. The fusion zone structure of the laser weld is a strong function of welding speed
Creep behavior of plasma carburized Ti-6Al-4V alloy
International Nuclear Information System (INIS)
Oliveira, Veronica Mara Cortez Alves de; Barboza, Miguel Justino Ribeiro; Silva, Mariane Capellari Leite da; Pinto, Catia Gisele; Suzuki, Paulo Atsushi; Machado, Joao Paulo B.
2010-01-01
This paper aims to evaluate the effect of plasma carburizing on the Ti-6Al-4V alloy submitted to creep tests. The results showed that the alloy Ti-6Al-4V had a hardness of 334 ± 18 HV. After treatment thermochemical by plasma, was observed the formation of a layer of average thickness of 1,5 μm and hardness of 809 ± 79 HV due to the presence of TiC phase identified by X-ray diffraction. The treatment increased the values of average roughness of 1,28 to 2,02 μm. The creep properties of carburized specimens were improved in comparison with those of the uncarburized Ti-6Al-4V alloy. (author)
Barnwal, Ajay Kumar; Mondal, D. P.; Kumar, Rajeev; Prasanth, N.; Dasgupta, R.
2018-03-01
Cu-Zn-Al foams of varying porosity fractions using mechanical alloyed powder have been made through powder metallurgy route. Here, NH4 (HCO3) was used as a space holder. Mechanically alloyed Cu-Zn-Al is made using a planetary ball mill taking the ratio of Cu/Zn/Al = 70:25:5 (by weight ratio). The ball/powder ratios were varied in the four ranges 10:1, 15:1, 20:1, and 25:1. Green compacts of milled powder and space holder samples were sintered at three stages at three different temperatures 350, 550, and 850 °C for 1 h at each stage. The crystalline size and particle size as a function of ball/powder ratios were examined. The compressive deformation responses of foams are varied with relative density and the ball/powder ratio. The plateau stress and energy absorption of these foams increase with an increase in relative density but decreases with increase in ball/powder ratio, even though crystalline size decreases. This has further been explained on the basis of particle morphology as a function of ball/powder ratio.
Microstructure of Fe-Cr-C hardfacing alloys with additions of Nb, Ti and, B
International Nuclear Information System (INIS)
Berns, H.; Fischer, A.
1987-01-01
The abrasive wear of machine parts and tools used in the mining, earth moving, and transporting of mineral materials can be lowered by filler wire welding of hardfacing alloys. In this paper, the microstructures of Fe-Cr-C and Fe-Cr-C-Nb/Ti hardfacing alloys and deposits and those of newly developed Fe-Cr-C-B and Fe-Ti-Cr-C-B ones are described. They show up to 85 vol.% of primarily solidified coarse hard phases; i.e., Carbides of MC-, M/sub 7/C/sub 3/-, M/sub 3/C-type and Borides of MB/sub 2/-, M/sub 3/B/sub 2/-, M/sub 2/B-, M/sub 3/B-, M/sub 23/B/sub 6/-type, which are embedded in a hard eutectic. This itself consists of eutectic hard phases and a martensitic or austenitic metal matrix. The newly developed Fe-Cr-C-B alloys reach hardness values of up to 1200 HV and are harder than all purchased ones. The primary solidification of the MB/sub 2/-type phase of titanium requires such high amounts of titanium and boron that these alloys are not practical for manufacture as commercial filler wires
Dosimetric evaluation of 252Cf beam for use in radiobiology studies at Hiroshima University
International Nuclear Information System (INIS)
Hoshi, M.; Takeoka, S.; Tsujimura, T.; Kuroda, T.; Kawami, M.; Sawada, S.
1988-01-01
This report provides reliable tissue kerma in free air data by characterising the 252 Cf irradiating system and by comparing three dosimetry methods, paired chambers (ICRU 1977, 1978), Fricke and thermoluminescence dosemeter. (author)
Electron-beam welding of thorium-doped iridium alloy sheets
International Nuclear Information System (INIS)
David, S.A.; Liu, C.T.; Hudson, J.D.
1979-04-01
Modified iridium alloys containing 100 ppM Th were found to be very susceptible to hot-cracking during gas tungsten-arc and electron-beam welding. However, the electron-beam welding process showed greater promise of success in welding these alloys, in particular Ir--0.3% W doped with 200 ppM Th and 50 ppM Al. The weldability of this particular alloy was extremely sensitive to the welding parameters, such as beam focus condition and welding speed, and the resulting fusion zone structure. At low speed successful electron-beam welds were made over a narrow range of beam focus conditions. However, at high speeds successful welds can be made over an extended range of focus conditions. The fusion zone grain structure is a strong function of welding speed and focus condition, as well. In the welds that showed hot-cracking, a region of positive segregation of thorium was identified at the fusion boundary. This highly thorium-segregated region seems to act as a potential source for the nucleation of a liquation crack, which later grows as a centerline crack
Comparative assessment of filler wires for argon-arc welding of refractory alloys
International Nuclear Information System (INIS)
Sorokin, L.I.; Bagdasarov, Yu.S.; Tupikin, V.I.
1993-01-01
It is recommended to use wires of similar composition as filler material during argon-arc welding of heat resisting alloys, and Sv-08Kh20N57M8V8T3R wire - for welding of dispersion hardening alloys. Sv-06Kh15N60M15, Sv-KhN64KBMYuVF or Kh11N60M23 wires should be used as filler materials to decrease tendency of welded joints to cracking during welding and heat treatment
2010-10-01
... 47 Telecommunication 3 2010-10-01 2010-10-01 false Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act. 51.807 Section 51.807 Telecommunication FEDERAL... Implementation of Section 252 of the Act § 51.807 Arbitration and mediation of agreements by the Commission...
Characterization of the uranium--2 weight percent molybdenum alloy
International Nuclear Information System (INIS)
Hemperly, V.C.
1976-01-01
The uranium-2 wt percent molybdenum alloy was prepared, processed, and age hardened to meet a minimum 930-MPa yield strength (0.2 percent) with a minimum of 10 percent elongation. These mechanical properties were obtained with a carbon level up to 300 ppM in the alloy. The tensile-test ductility is lowered by the humidity of the laboratory atmosphere
A study on the microstructural characteristics of rapidly solidified Al-Fe alloys(I)
International Nuclear Information System (INIS)
Kim, D.H.; Lee, H.I.
1991-01-01
Solidification microstructures and phases in rapidly solidified Al-5, 10wt% Fe alloys have been investigated by TEM bright field and dark field imaging techniques and electron and x-ray diffraction techniques. Rapid solidification of Al-5, 10wt%Fe alloys produces various metastable and stable phases, such as Al m Fe, Al 6 Fe and Al 13 Fe 4 . In addition to these phases, clusters of randomly oriented few nm scale particles exist in the form of fine cellular network with α-Al or primary spherical particles. Solidification microstructures of the rapidly solidified Al-5, 10wt%Fe alloys consist of various combination of primary phases such as Al 13 Fe 4 , Al m Fe and cluster of nm scale particles, and cellular/dendritic structures such as fine cellular network structure of nm scale particle clusters and α-Al and cellular structure of Al m Fe and α-Al, depending upon alloy compositions and local cooling rates. (Author)
High thermal shock resistance of the hot rolled and swaged bulk W–ZrC alloys
Energy Technology Data Exchange (ETDEWEB)
Xie, Z.M.; Liu, R.; Miao, S.; Yang, X.D. [Key Laboratory of Materials Physics, Institute of Solid State Physics, Hefei Science Center, Chinese Academy of Sciences, Hefei 230031 (China); University of Science and Technology of China, Hefei 230026 (China); Zhang, T., E-mail: zhangtao@issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Hefei Science Center, Chinese Academy of Sciences, Hefei 230031 (China); University of Science and Technology of China, Hefei 230026 (China); Fang, Q.F.; Wang, X.P. [Key Laboratory of Materials Physics, Institute of Solid State Physics, Hefei Science Center, Chinese Academy of Sciences, Hefei 230031 (China); University of Science and Technology of China, Hefei 230026 (China); Liu, C.S., E-mail: csliu@issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Hefei Science Center, Chinese Academy of Sciences, Hefei 230031 (China); University of Science and Technology of China, Hefei 230026 (China); Lian, Y.Y. [Southwestern Institute of Physics, Chengdu (China); Liu, X., E-mail: xliu@swip.ac.cn [Southwestern Institute of Physics, Chengdu (China); Luo, G.N. [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China)
2016-02-15
The thermal shock (single shot) resistance and mechanical properties of the W–0.5wt% ZrC (WZC) alloys manufactured by ordinary sintering followed by swaging or rolling process were investigated. No cracks or surface melting were detected on the surface of the rolled WZC alloy plates after thermal shock at a power density of 0.66 GW/m{sup 2} for 5 ms, while primary intergranular cracks appear on the surface of the swaged WZC samples after thermal shock at a power density of 0.44 GW/m{sup 2} for 5 ms. Three point bending tests indicate that the rolled WZC alloy has a flexural strength of ∼2.4 GPa and a total strain of 1.8% at room temperature, which are 100% and 260% higher than those of the swaged WZC, respectively. The fracture energy density of the rolled WZC alloy is 3.23 × 10{sup 7} J/m{sup 3}, about 10 times higher than that of the swaged WZC (2.9 × 10{sup 6} J/m{sup 3}). The high thermal shock resistance of the rolled WZC alloys can be ascribed to their extraordinary ductility and plasticity. - Graphical abstract: (Left panel) surface morphology observed by optical microscope after a single pulse for 5 ms with various absorbed power densities at RT on the rolled WZC. (Right panel) curves of flexural stress versus strain at RT (a) and the calculated fracture energy (b) for the swaged WZC and rolled WZC alloys. - Highlights: • No cracks or surface melting were detected on the rolled WZC alloy samples after thermal shock at 0.66 GW/m{sup 2} for 5 ms. • Hot rolled WZC alloy plates exhibit a flexural strength of 2.4 GPa and a strain of 1.8% at RT. • The fracture energy of the rolled WZC alloy is 3.23 × 10{sup 7} J/m{sup 3} at RT, about 10 times higher than that of the swaged WZC. • A detailed analysis of the relationships between the mechanical properties and the thermal shock resistance is given.
Thermo-mechanical processing (TMP) of Ti-48Al-2Nb-2Cr based alloys
International Nuclear Information System (INIS)
Fuchs, G.E.
1995-02-01
The effects of heat treatment and deformation processing on the microstructures and properties of γ-TiAl based alloys produced by ingot metallurgy (I/M) and powder metallurgy (P/M) techniques were examined. The alloy selected for this work is the second generation γ-TiAl based alloy -- Ti-48Al-2Nb-2Cr (at %). Homogenization of I/M samples was performed at a variety of temperatures, followed by hot working by isothermal forging. P/M samples were prepared from gas atomized powders, consolidated by both HIP and extrusion and some of the HIPed material was then hot worked by isothermal forging. The effects of processing, heat treatment and hot working on the microstructures and properties will be discussed
Enhancement of magnetic properties of Co2MnSi Heusler alloy prepared by mechanical alloying method
International Nuclear Information System (INIS)
Rabie, Naeemeh; Gordani, Gholam Reza; Ghasemi, Ali
2017-01-01
Highlights: • Ferromagnetic Heusler alloys of Co 2 MnSi were synthesized at low temperature. • There is an at least 30% reduction in the phase formation temperature. • Saturation magnetization of alloy was increased significantly after annealing. - Abstract: Ferromagnetic Heusler alloys of Co 2 MnSi were synthesized by mechanical alloying method at low temperature. The effect of milling time and annealing process on structural and magnetic properties of ferromagnetic alloy samples were studied by X-ray diffraction, scanning electron microscopy and vibration sample magnetometer methods, respectively. Structural characteristics such as crystallite size, phase percentage, and lattice parameter determined using the Rietveld method. The values of these parameters were obtained 362.9 nm, 5.699 Å and 98.7%, respectively for annealed sample. Magnetization studies show that the Co2MnSi phase is formed at 15 h of milling and is optimized after 20 h of milling. VSM results showed that saturation magnetization (M s ) of milled samples reduces from 112 to 75 (emu/g) with increasing milling time and then increased gradually to 95 emu/g. The effect of post-annealing on the structural and magnetic properties of milled samples was also investigated. The saturation magnetization of annealed sample (120 emu/g) is higher than the optimum milled sample (95 emu/g) due to increasing preferential ordered L2 1 structure.
Corrosion and impedance studies on magnesium alloy in oxalate solution
International Nuclear Information System (INIS)
Fekry, A.M.; Tammam, Riham H.
2011-01-01
Highlights: → Corrosion behavior of AZ91E alloy was investigated in 0.1 M Na 2 C 2 O 4 containing different additives as Br - , Cl - or Silicate. → The corrosion rate of 0.1 M oxalate solution containing silicate ion is lower than the blank (0.1 M Na 2 C 2 O 4 ). This was confirmed by scanning electron microscope (SEM) observations. → For the other added ions Br - or Cl - , the corrosion rate is higher than the blank. - Abstract: Corrosion behavior of AZ91E alloy was investigated in oxalate solution using potentiodynamic polarization and electrochemical impedance measurements (EIS). The effect of oxalate concentration was studied, where the corrosion rate increases with increasing oxalate concentration. The effect of added ions (Br - , Cl - or SiO 3 2- ) on the electrochemical behavior of magnesium alloy in 0.1 M Na 2 C 2 O 4 solution at 298 K, was investigated. It was found that the corrosion rate of 0.1 M oxalate solution containing silicate ion is lower than the blank (0.1 M Na 2 C 2 O 4 ). This was confirmed by scanning electron microscope (SEM) observations. However, for the other added ions Br - or Cl - , the corrosion rate is higher than the blank.
Crevice Corrosion on Ni-Cr-Mo Alloys
International Nuclear Information System (INIS)
P. Jakupi; D. Zagidulin; J.J. Noel; D.W. Shoesmith
2006-01-01
Ni-Cr-Mo alloys were developed for their exceptional corrosion resistance in a variety of extreme corrosive environments. An alloy from this series, Alloy-22, has been selected as the reference material for the fabrication of nuclear waste containers in the proposed Yucca Mountain repository located in Nevada (US). A possible localized corrosion process under the anticipated conditions at this location is crevice corrosion. therefore, it is necessary to assess how this process may, or may not, propagate if the use of this alloy is to be justified. Consequently, the primary objective is the development of a crevice corrosion damage function that can be used to assess the evolution of material penetration rates. They have been using various electrochemical methods such as potentiostatic, galvanostatic and galvanic coupling techniques. Corrosion damage patterns have been investigated using surface analysis techniques such as scanning electron microscopy (SEM) and optical microscopy. All crevice corrosion experiments were performed at 120 C in 5M NaCl solution. Initiating crevice corrosion on these alloys has proven to be difficult; therefore, they have forced it to occur under either potentiostatic or galvanostatic conditions
Tungsten-zirconium carbide-rhenium alloys with extraordinary thermal stability
Energy Technology Data Exchange (ETDEWEB)
Yang, X.D. [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China); Xie, Z.M.; Miao, S. [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China); University of Science and Technology of China, Hefei 230026 (China); Liu, R.; Jiang, W.B. [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China); Zhang, T., E-mail: zhangtao@issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China); Wang, X.P., E-mail: xpwang@issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China); Fang, Q.F. [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China); University of Science and Technology of China, Hefei 230026 (China); Liu, C.S., E-mail: csliu@issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China); Luo, G.N. [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Liu, X. [Southwest Institute of Plasma Physics, Chengdu (China)
2016-05-15
The low recrystallization temperature (1200 °C) of pure W is a serious limitation for application as facing plasma materials in fusion reactor. In this paper, W-0.5wt.%ZrC-1wt.%Re (WZR) alloy with recrystallization temperature up to 1800 °C was prepared by mechanical milling and spark plasma sintering. The grain size of WZR alloy is about 2.6 μm, smaller than that of pure W (4.4 μm), which keeps unchanged until the annealing temperature increases to 1800 °C. Tensile tests indicate that the WZR alloys exhibit excellent comprehensive properties: the ductile to brittle transition temperature of WZR is in the range from 400 °C to 500 °C, about 200 °C lower than that of pure W prepared by the same process; the total elongation (TE) of WZR at 600 °C is above 30%, which is about 2 times that of pure W (at 700 °C). Meanwhile its tensile strength keeps ∼450 MPa before and after 1800 °C annealing as well as its TE increases after annealing. WZR alloy exhibits higher hardness (489HV) than that of pure W (453HV) at room temperature. Microstructure analysis indicates that the strengthening of nano-sized ZrC particles dispersion and Re solid solution improve tensile properties and thermal stability of WZR alloy.
Lattice thermal transport in group II-alloyed PbTe
Xia, Yi; Hodges, James M.; Kanatzidis, Mercouri G.; Chan, Maria K. Y.
2018-04-01
PbTe, one of the most promising thermoelectric materials, has recently demonstrated a thermoelectric figure of merit (ZT) of above 2.0 when alloyed with group II elements. The improvements are due mainly to significant reduction of lattice thermal conductivity (κl), which was in turn attributed to nanoparticle precipitates. However, a fundamental understanding of various phonon scattering mechanisms within the bulk alloy is still lacking. In this work, we apply the newly-developed density-functional-theory-based compressive sensing lattice dynamics approach to model lattice heat transport in PbTe, MTe, and Pb0.94M0.06Te (M = Mg, Ca, Sr, and Ba) and compare our results with experimental measurements, with focus on the strain effect and mass disorder scattering. We find that (1) CaTe, SrTe, and BaTe in the rock-salt structure exhibit much higher κl than PbTe, while MgTe in the same structure shows anomalously low κl; (2) lattice heat transport of PbTe is extremely sensitive to static strain induced by alloying atoms in solid solution form; (3) mass disorder scattering plays a major role in reducing κl for Mg/Ca/Sr-alloyed PbTe through strongly suppressing the lifetimes of intermediate- and high-frequency phonons, while for Ba-alloyed PbTe, precipitated nanoparticles are also important.
Life cycle assessment of metal alloys for structural applications
Malovrh Rebec, K.; Markoli, B.; Leskovar, B.
2018-03-01
The study compared environmental footprints of two types of Al-alloys: well-known 5083 aluminium alloy with magnesium and traces of manganese and chromium in its composition. This material is highly resistant to seawater corrosion and the influence of industrial chemicals. Furthermore, it retains exceptional strength after welding. The comparisons were made to an innovative alloy where the aluminium based matrix is reinforced by metastable quasicrystals (QC), thus avoiding magnesium in its composition. Furthermore, we checked other aluminium ingots’ footprints and compared European average and Germany country specific production data. Environmental footprints were assessed via cradle to gate life cycle assessment. Our findings normalized to 1 m2 plate suggest, that newly proposed alloy could save around 50 % in value of parameters abiotic resources depletion of fossil fuels, acidification, eutrophication, global warming potential and photochemical ozone creation potential if we compare Qc5 to 6 mm 5083 alloy plate. Only abiotic resources depletion of elements and ozone depletion parameters increase for Qc5 compared to 6 mm 5083 alloy plate.
International Nuclear Information System (INIS)
Kohno, Hiroyuki; Tatsunami, Shinobu; Hiroi, Tomoko; Kouyama, Hiroshi; Taniguchi, Masashi; Yago, Nagasumi; Nakamura, Iwao
1995-01-01
Bisbenzylisoquinoline alkaloids of Stephania cepharantha have been used for various clinical purposes and recently reevaluated as stimulators of interleukin secretion in tissues. We analyzed molecular stuctures of bisbenzylisoquinoline alkaloids by determining their molecular weights using the 252 Cf-plasma desorption mass spectrometry (PDMS). The spectra were accumulated for 500 000 fission events. The acceleration voltage used here was 15 kV. Samples were analyzed using nitrocellulose-coated sample targets. Of the 5 alkaloids studied here, cepharanthine gave a main peak of molecular weight of 606.1 for the theoretical molecular weight of 606.7. The other minor peaks were considered to be demethylated fragment ions. 252 Cf-PDMS should be quite useful in studying structure, metabolism and pharmacokinetics of various drugs with extremely low coefficients of variation. (author)
Optimization of in situ prompt gamma-ray analysis using a HPGe-252Cf probe
International Nuclear Information System (INIS)
Chien Chung; Jiunnhsing Chao
1991-01-01
Application of in situ measurements by the neutron-induced prompt gamma-ray activation analysis (PGAA) technique to geochemical analysis and mineral survey have been investigated. An in situ survey of water pollutants by PGAA techniques was first proposed in the authors' previous study, where a 2.7-μg 252 Cf neutron source used in connection with a gamma-ray detecting system to determine water pollutants was described. In this paper the authors describe a modified detection probe designed and constructed to look for the optimum conditions of various-intensity 252 Cf neutron sources in measurement of some elements in lake water. Detecting efficiencies at high-energy regions and detection limits for elements commonly found in polluted lakes were evaluated and predicted to investigate the potential application of the probe for in situ measurements
Power spectral density measurements with 252Cf for a light water moderated research reactor
International Nuclear Information System (INIS)
King, W.T.; Mihalczo, J.T.
1979-01-01
A method of determining the reactivity of far subcritical systems from neutron noise power spectral density measurements with 252 Cf has previously been tested in fast reactor critical assemblies: a mockup of the Fast Flux Test Facility reactor and a uranium metal sphere. Calculations indicated that this measurement was feasible for a pressurized water reactor (PWR). In order to evaluate the ability to perform these measurements with moderated reactors which have long prompt neutron lifetimes, measurements were performed with a small plate-type research reactor whose neutron lifetime (57 microseconds) was about a factor of three longer than that of a PWR and approx. 50% longer than that of a boiling water reactor. The results of the first measurements of power spectral densities with 252 Cf for a water moderated reactor are presented
Electrodeposition of white copper-tin alloys from alkaline cyanide solutions
International Nuclear Information System (INIS)
Purwadaria, H.S.; Zainal Arifin Ahmad
2007-01-01
Electrodeposition of white copper-tin alloys (including with mir alloys) has been done onto planar mild steel substrates from alkaline cyanide solutions at 65 degree C. The chemical composition of the coating is influenced by plating bath composition and current density. White mir alloy can be produced from the test solution containing 10 g/l CuCN 2 ,45 g/l Na 2 SnO 3 , 25 g/l NaCN, and 12 g/l NaOH at current density about 5 mA/cm?2. The local compositions of the coating cross section were analyzed using EDX installed in a FESEM operated at an accelerating voltage of 20 kV. The phases formed during co-deposition process were identified using XRD at 25 mA current and 35 kV voltage. (Author)
Effect of alloying on elastic properties of ZrN based transition metal nitride alloys
Kanoun, Mohammed; Goumri-Said, Souraya
2014-01-01
We report the effect of composition and metal sublattice substitutional element on the structural, elastic and electronic properties of ternary transition metal nitrides Zr1-xMxN with M=Al, Ti, Hf, V, Nb, W and Mo. The analysis of the elastic constants, bulk modulus, shear modulus, Young's modulus, and Poisson's ratio provides insights regarding the mechanical behavior of Zr1-xMxN. We predict that ternary alloys are more ductile compared to their parent binary compounds. The revealed trend in the mechanical behavior might help for experimentalists on the ability of tuning the mechanical properties during the alloying process by varying the concentration of the transition metal. © 2014 Elsevier B.V.
Effect of alloying on elastic properties of ZrN based transition metal nitride alloys
Kanoun, Mohammed
2014-09-01
We report the effect of composition and metal sublattice substitutional element on the structural, elastic and electronic properties of ternary transition metal nitrides Zr1-xMxN with M=Al, Ti, Hf, V, Nb, W and Mo. The analysis of the elastic constants, bulk modulus, shear modulus, Young\\'s modulus, and Poisson\\'s ratio provides insights regarding the mechanical behavior of Zr1-xMxN. We predict that ternary alloys are more ductile compared to their parent binary compounds. The revealed trend in the mechanical behavior might help for experimentalists on the ability of tuning the mechanical properties during the alloying process by varying the concentration of the transition metal. © 2014 Elsevier B.V.
Microstructural study and wear behavior of ductile iron surface alloyed by Inconel 617
International Nuclear Information System (INIS)
Arabi Jeshvaghani, R.; Jaberzadeh, M.; Zohdi, H.; Shamanian, M.
2014-01-01
Highlights: • The Ni-base alloy was deposited on the surface of ductile iron by TIG welding process. • Microstructure of alloyed layer consisted of carbides embedded in Ni-rich dendrite. • Hardness and wear resistance of coated sample greatly improved. • The formation of oxide layer and delamination were dominant mechanisms of wear. - Abstract: In this research, microstructure and wear behavior of Ni-based alloy is discussed in detail. Using tungsten inert gas welding process, coating of nearly 1–2 mm thickness was deposited on ductile iron. Optical and scanning electron microscopy, as well as X-ray diffraction analysis and electron probe microanalysis were used to characterize the microstructure of the surface alloyed layer. Micro-hardness and wear resistance of the alloyed layer was also studied. Results showed that the microstructure of the alloyed layer consisted of M 23 C 6 carbides embedded in Ni-rich solid solution dendrites. The partial melted zone (PMZ) had eutectic ledeburit plus martensite microstructure, while the heat affected zone (HAZ) had only a martensite structure. It was also noticed that hardness and wear resistance of the alloyed layer was considerably higher than that of the substrate. Improvement of wear resistance is attributed to the solution strengthening effect of alloying elements and also the presence of hard carbides such as M 23 C 6 . Based on worn surface analysis, the dominant wear mechanisms of alloyed layer were found to be oxidation and delamination
Watanabe, I; Baba, N; Watanabe, E; Atsuta, M; Okabe, T
2004-01-01
This study investigated the effect of heat treatment on the machinability of heat-treated cast gold alloy with age-hardenability at intraoral temperature using a handpiece engine with SiC wheels and an air-turbine handpiece with carbide burs and diamond points. Cast gold alloy specimens underwent various heat treatments [As-cast (AC); Solution treatment (ST); High-temperature aging (HA), Intraoral aging (IA)] before machinability testing. The machinability test was conducted at a constant machining force of 0.784N. The three circumferential speeds used for the handpiece engine were 500, 1,000 and 1,500 m/min. The machinability index (M-index) was determined as the amount of metal removed by machining (volume loss, mm(3)). The results were analyzed by ANOVA and Scheffé's test. When an air-turbine handpiece was used, there was no difference in the M-index of the gold alloy among the heat treatments. The air-turbine carbide burs showed significantly (pmachinability of the gold alloy using the air-turbine handpiece. The heat treatments had a small effect on the M-index of the gold alloy machined with a SiC wheel for a handpiece engine.
Investigation of Ti-Fe-Co bulk alloys with high strength and enhanced ductility
International Nuclear Information System (INIS)
Louzguine-Luzgin, Dmitri V.; Louzguina-Luzgina, Larissa V.; Kato, Hidemi; Inoue, Akihisa
2005-01-01
High-strength Ti-Fe-Co alloys were produced in the shape of arc-melted ingots with the dimensions of about 20-25mm in diameter and 7-10mm in height. The structure of the Ti-Fe-Co alloys (at Fe/Co ratio >1) studied by X-ray diffractometry and scanning electron microscopy consisted of an ordered Pm3-bar m Ti(FeCo) compound and a disordered body-centered cubic Im3-bar m β-Ti solid solution. The optimization of the Ti-Fe-Co alloy composition is performed from the viewpoint of both high strength and ductility. The strongest Ti-Fe-Co alloys have a hypereutectic structure and exhibit a high strength of about 2000MPa and a plastic deformation of 15%. The high strength and ductility values can be achieved without using the injection mould casting or rapid solidification procedure. The deformation behavior and the fractography of Ti-Fe-Co alloys are studied in detail
Directory of Open Access Journals (Sweden)
Hui-Ping Ren
2011-01-01
Full Text Available Mg2Ni-type Mg2Ni1−xCox (x = 0, 0.1, 0.2, 0.3, 0.4 alloys were fabricated by melt spinning technique. The structures of the as-spun alloys were characterized by X-ray diffraction (XRD and transmission electron microscopy (TEM. The hydrogen absorption and desorption kinetics of the alloys were measured by an automatically controlled Sieverts apparatus. The electrochemical hydrogen storage kinetics of the as-spun alloys was tested by an automatic galvanostatic system. The results show that the as-spun (x = 0.1 alloy exhibits a typical nanocrystalline structure, while the as-spun (x = 0.4 alloy displays a nanocrystalline and amorphous structure, confirming that the substitution of Co for Ni notably intensifies the glass forming ability of the Mg2Ni-type alloy. The melt spinning treatment notably improves the hydriding and dehydriding kinetics as well as the high rate discharge ability (HRD of the alloys. With an increase in the spinning rate from 0 (as-cast is defined as spinning rate of 0 m/s to 30 m/s, the hydrogen absorption saturation ratio ( of the (x = 0.4 alloy increases from 77.1 to 93.5%, the hydrogen desorption ratio ( from 54.5 to 70.2%, the hydrogen diffusion coefficient (D from 0.75 × 10−11 to 3.88 × 10−11 cm2/s and the limiting current density IL from 150.9 to 887.4 mA/g.
International Nuclear Information System (INIS)
Landolt, R.R.; Hem, S.L.
1983-01-01
A commercial antacid suspension containing aluminum hydroxide and magnesium hydroxide products was used as a model sample to study the use of a californium-252 thermal neutron activation as a method for quantifying aluminum content as well as for the simultaneous assay of aluminum and magnesium. A 3.5-micrograms californium-252 source was used for the activation, and the induced aluminum-28 and magnesium-27 activity was simultaneously measured by sodium iodide crystal gamma-ray spectrometry using dual single-channel analyzers and scalers. The antacid suspension was contained in a chamber designed with the unique capability of serving as the container for counting the induced radioactivity in addition to being the irradiation chamber itself. This pilot study demonstrated that use of more intense californium-252 sources, which are commonly available, would provide a method that is competitive with the ethylenediaminetetraacetic acid titration method in precision and in other aspects as well
Understanding the magnetic anisotropy in Fe-Si amorphous alloys
Energy Technology Data Exchange (ETDEWEB)
Diaz, J.; Hamdan, N.M.; Jalil, P.; Hussain, Z.; Valvidares, S.M.; Alameda, J.M.
2002-08-01
The origin of the magnetic anisotropy in a very disordered Fe-Si alloy has been investigated. The alloy containing 40 percent at. Si was prepared in the form of a thin film in a DC magnetron sputtering chamber. Structural disorder was obtained from Extended X-ray Absorption Fine Structure spectroscopy. The uniformity and lack of inhomogeneities at a microscopic level was checked by measuring their transverse magnetic susceptibility and hysteresis loops. The orbital component of the magnetic moment was measured by X-ray Magnetic Circular Dichroism spectroscopy. The orbital moment was extraordinary high, 0.4mB. Such a high value contrasted with the relatively small uniaxial anisotropy energy of the thin film (2kJ/m3). This suggests that the cause of the magnetic anisotropy in this alloy was a small degree of correlation in the orientation of the local orbital moments along a preferential direction.
Understanding the magnetic anisotropy in Fe-Si amorphous alloys
International Nuclear Information System (INIS)
Diaz, J.; Hamdan, N.M.; Jalil, P.; Hussain, Z.; Valvidares, S.M.; Alameda, J.M.
2002-01-01
The origin of the magnetic anisotropy in a very disordered Fe-Si alloy has been investigated. The alloy containing 40 percent at. Si was prepared in the form of a thin film in a DC magnetron sputtering chamber. Structural disorder was obtained from Extended X-ray Absorption Fine Structure spectroscopy. The uniformity and lack of inhomogeneities at a microscopic level was checked by measuring their transverse magnetic susceptibility and hysteresis loops. The orbital component of the magnetic moment was measured by X-ray Magnetic Circular Dichroism spectroscopy. The orbital moment was extraordinary high, 0.4mB. Such a high value contrasted with the relatively small uniaxial anisotropy energy of the thin film (2kJ/m3). This suggests that the cause of the magnetic anisotropy in this alloy was a small degree of correlation in the orientation of the local orbital moments along a preferential direction
Multi-step wrought processing of TiAl-based alloys
International Nuclear Information System (INIS)
Fuchs, G.E.
1997-04-01
Wrought processing will likely be needed for fabrication of a variety of TiAl-based alloy structural components. Laboratory and development work has usually relied on one-step forging to produce test material. Attempts to scale-up TiAl-based alloy processing has indicated that multi-step wrought processing is necessary. The purpose of this study was to examine potential multi-step processing routes, such as two-step isothermal forging and extrusion + isothermal forging. The effects of processing (I/M versus P/M), intermediate recrystallization heat treatments and processing route on the tensile and creep properties of Ti-48Al-2Nb-2Cr alloys were examined. The results of the testing were then compared to samples from the same heats of materials processed by one-step routes. Finally, by evaluating the effect of processing on microstructure and properties, optimized and potentially lower cost processing routes could be identified
A comparative study, of 1 M and 8 M KOH electrolyte concentrations, used in Ni-MH batteries
International Nuclear Information System (INIS)
Khaldi, C.; Mathlouthi, H.; Lamloumi, J.
2009-01-01
One may wonder if we really should use a very high concentration of KOH electrolyte in Ni-MH batteries, to keep the thermodynamic and kinetic properties of the alloy, while this solution is very aggressive to the used alloys. In this work we present a comparative study, using different techniques of two concentrations, 1 M and 8 M KOH electrolytes. The maximum capacity values are 295 mAh g -1 and 237 mAh g -1 , the loss in capacity, after 23 cycles, are of 10% and 58%, the polarization after the activation are 110 mV and 360 mV and the thickness of the corrosion layer, on the electrode surface, are 7 nm and 42 nm, for the 1 M and 8 M KOH electrolytes, respectively. These results showed that replacing the solution 8 M with 1 M improves the performance of Ni-MH batteries and leads to better results
Energy Technology Data Exchange (ETDEWEB)
Li, Yuan; Tao, Yang; Ke, Dandan; Ma, Yufei [Hebei Key Laboratory of Applied Chemistry, School of Environmental and Chemical Engineering, Yanshan University, Qinhuangdao 066004 (China); Han, Shumin, E-mail: hanshm@ysu.edu.cn [Hebei Key Laboratory of Applied Chemistry, School of Environmental and Chemical Engineering, Yanshan University, Qinhuangdao 066004 (China); State Key Laboratory of Metastable Materials Science and Technology, Yanshan University, Qinhuangdao 066004 (China)
2015-12-01
Graphical abstract: - Highlights: • The Co–Ni composite coating was prepared by electroplating. • The alloy treated at 10 mA/cm{sup 2} has superior kinetic performances. • The Co–Ni layer accelerates the charge transfer rate on the surface of the alloy. - Abstract: Electroplating Co–Ni treatment was applied to the surface of the La{sub 0.75}Mg{sub 0.25}Ni{sub 3.48} alloy electrodes in order to improve the electrochemical and kinetic performances. The Scanning electron microscope-Energy dispersive spectroscopy and X-ray diffraction results showed that the electrodes were plated with a homogeneous Co–Ni alloy film. The alloy coating significantly improved the high rate dischargeability of the alloy electrode, and the HRD value increased to 57.5% at discharge current density 1875 mA/g after the Co–Ni-coating. The exchange current density I{sub 0}, the limiting current density I{sub L} and the oxidation peak current also increased for the coated alloy. The improvement of overall electrode performances was attributed to an enhancement in electro-catalytic activity and conductivity at the alloy surface, owing to the precipitation of the Co–Ni layer.
Strain-controlled low cycle fatigue properties of a rare-earth containing ME20 magnesium alloy
Energy Technology Data Exchange (ETDEWEB)
Mirza, F.A., E-mail: f4mirza@ryerson.ca [Department of Mechanical and Industrial Engineering, Ryerson University, 350 Victoria Street, Toronto, Ontario M5B 2K3 (Canada); Wang, K.; Bhole, S.D.; Friedman, J.; Chen, D.L. [Department of Mechanical and Industrial Engineering, Ryerson University, 350 Victoria Street, Toronto, Ontario M5B 2K3 (Canada); Ni, D.R.; Xiao, B.L. [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China); Ma, Z.Y., E-mail: zyma@imr.ac.cn [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China)
2016-04-20
The present study was aimed to evaluate the strain-controlled cyclic deformation characteristics and low cycle fatigue (LCF) life of a low (~0.3 wt%) Ce-containing ME20-H112 magnesium alloy. The alloy contained equiaxed grains with ellipsoidal particles containing Mg and Ce (Mg{sub 12}Ce), and exhibited a relatively weak basal texture. Unlike the high rare earth (RE)-containing magnesium alloy, the ME20M-H112 alloy exhibited asymmetrical hysteresis loops somewhat similar to the RE-free extruded Mg alloys due to the presence of twinning-detwinning activities during cyclic deformation. While cyclic stabilization was barely achieved even at the lower strain amplitudes, cyclic softening was the predominant characteristics at most strain amplitudes. The ME20M-H112 alloy showed basically an equivalent fatigue life to that of the RE-free extruded Mg alloys, which could be described by the Coffin-Manson law and Basquin's equation. Fatigue crack was observed to initiate from the near-surface imperfections, and in contrast to the typical fatigue striations, the present alloy showed some shallow dimples along with some fractions of quasi-cleavage features in the crack propagation area.
Das, Suman; Swain, Diptikanta; Araujo, Rafael B; Shi, Songxin; Ahuja, Rajeev; Row, Tayur N Guru; Bhattacharyya, Aninda J
2018-02-02
We discuss here a unique flexible non-carbonaceous layered host, namely, metal titanium niobates (M-Ti-niobate, M: Al 3+ , Pb 2+ , Sb 3+ , Ba 2+ , Mg 2+ ), which can synergistically store both lithium ions and sodium ions via a simultaneous intercalation and alloying mechanisms. M-Ti-niobate is formed by ion exchange of the K + ions, which are specifically located inside galleries between the layers formed by edge and corner sharing TiO 6 and NbO 6 octahedral units in the sol-gel synthesized potassium titanium niobate (KTiNbO 5 ). Drastic volume changes (approximately 300-400 %) typically associated with an alloying mechanism of storage are completely tackled chemically by the unique chemical composition and structure of the M-Ti-niobates. The free space between the adjustable Ti/Nb octahedral layers easily accommodates the volume changes. Due to the presence of an optimum amount of multivalent alloying metal ions (50-75 % of total K + ) in the M-Ti-niobate, an efficient alloying reaction takes place directly with ions and completely eliminates any form of mechanical degradation of the electroactive particles. The M-Ti-niobate can be cycled over a wide voltage range (as low as 0.01 V) and displays remarkably stable Li + and Na + ion cyclability (>2 Li + /Na + per formula unit) for widely varying current densities over few hundreds to thousands of successive cycles. The simultaneous intercalation and alloying storage mechanisms is also studied within the density functional theory (DFT) framework. DFT expectedly shows a very small variation in the volume of Al-titanium niobate following lithium alloying. Moreover, the theoretical investigations also conclusively support the occurrence of the alloying process of Li ions with the Al ions along with the intercalation process during discharge. The M-Ti-niobates studied here demonstrate a paradigm shift in chemical design of electrodes and will pave the way for the development of a multitude of improved electrodes
The experimental search for new predicted binary-alloy structures
Erb, K. C.; Richey, Lauren; Lang, Candace; Campbell, Branton; Hart, Gus
2010-10-01
Predicting new ordered phases in metallic alloys is a productive line of inquiry because configurational ordering in an alloy can dramatically alter their useful material properties. One is able to infer the existence of an ordered phase in an alloy using first-principles calculated formation enthalpies.ootnotetextG. L. W. Hart, ``Where are Nature's missing structures?,'' Nature Materials 6 941-945 2007 Using this approach, we have been able to identify stable (i.e. lowest energy) orderings in a variety of binary metallic alloys. Many of these phases have been observed experimentally in the past, though others have not. In pursuit of several of the missing structures, we have characterized potential orderings in PtCd, PtPd and PtMo alloys using synchrotron x-ray powder diffraction and symmetry-analysis tools.ootnotetextB. J. Campbell, H. T. Stokes, D. E. Tanner, and D. M. Hatch, ``ISODISPLACE: a web-based tool for exploring structural distortions,'' J. Appl. Cryst. 39, 607-614 (2006)
Energy Technology Data Exchange (ETDEWEB)
Naeem, Haider T. [School of Materials Engineering, Universiti Malaysia Perlis, Taman Muhibbah, 02600 Jejawi, Perlis (Malaysia); College of Engineering, Al-Muthanna University, South Baghdad (Iraq); Mohammad, Kahtan S.; Hussin, Kamarudin; Tan, T. Qing; Idris, M. Sobri [School of Materials Engineering, Universiti Malaysia Perlis, Taman Muhibbah, 02600 Jejawi, Perlis (Malaysia)
2015-05-15
In order to understand the importance of the retrogression and re-aging as a heat treatment for improving microstructural and mechanical properties of the Al-Zn-Mg-Cu powder metallurgy alloys, Al-Zn-Mg-Cu-Fe-Cr alloys were fabricated from the elemental powders. Green compacts are compressed under compaction pressure about 370 MPa. The sintering process carried out for the samples of aluminum alloys at temperature was 650°C under argon atmosphere for two hours. The sintered compacts were subjected into homogenizing condition at 470°C for 1.5 hours and then aged at 120°C for 24 hours (T6 temper) after that it carried out the retrogressed at 180°C for 30 min., and then re-aged at 120°C for 24 hours (RRA). Observations microstructures were examined using optical, scanning electron microscopy coupled with energy dispersive spectroscopy and X-ray diffraction. Density and porosity content was conducted for the samples of alloys. The result showing that the highest Vickers hardness exhibited for an Al-Zn-Mg-Cu alloy after underwent the retrogression and reaging treatment. Increasing in hardness was because of the precipitation hardening through precipitate the (Mg Zn) and (Mg{sub 2}Zn{sub 11}) phases during matrix of aluminum-alloy.
International Nuclear Information System (INIS)
Naeem, Haider T.; Mohammad, Kahtan S.; Hussin, Kamarudin; Tan, T. Qing; Idris, M. Sobri
2015-01-01
In order to understand the importance of the retrogression and re-aging as a heat treatment for improving microstructural and mechanical properties of the Al-Zn-Mg-Cu powder metallurgy alloys, Al-Zn-Mg-Cu-Fe-Cr alloys were fabricated from the elemental powders. Green compacts are compressed under compaction pressure about 370 MPa. The sintering process carried out for the samples of aluminum alloys at temperature was 650°C under argon atmosphere for two hours. The sintered compacts were subjected into homogenizing condition at 470°C for 1.5 hours and then aged at 120°C for 24 hours (T6 temper) after that it carried out the retrogressed at 180°C for 30 min., and then re-aged at 120°C for 24 hours (RRA). Observations microstructures were examined using optical, scanning electron microscopy coupled with energy dispersive spectroscopy and X-ray diffraction. Density and porosity content was conducted for the samples of alloys. The result showing that the highest Vickers hardness exhibited for an Al-Zn-Mg-Cu alloy after underwent the retrogression and reaging treatment. Increasing in hardness was because of the precipitation hardening through precipitate the (Mg Zn) and (Mg 2 Zn 11 ) phases during matrix of aluminum-alloy
Amperometric Morphine Detection Using Pt-Co Alloy Nanowire Array-modified Electrode
International Nuclear Information System (INIS)
Tao, Manlan; Xu, Feng; Li, Yueting; Xu, Quanqing; Chang, Yanbing; Yang, Yunhui; Wu, Zaisheng
2010-01-01
Pt-Co alloy nanowire array was directly synthesized by electrochemical deposition with polycarbonate template at -1.0V and subsequent chemical etching of the template. The use of Pt-Co alloy nanowire array-modified electrode (Pt- Co NAE) for the determination of morphine (MO) is described. The morphology of the Pt-Co alloy nanowire array has been investigated by scanning electron microscopy (SEM) and energy disperse X-ray spectroscopy (EDS) analysis), respectively. The resulting Pt-Co NAE offered a linear amperometric response for morphine ranging from 2.35 x 10 -5 to 2.39 x 10 -3 M with a detection limit of 7.83 x 10 -6 M at optimum conditions. This sensor displayed high sensitivity and long-term stability
International Nuclear Information System (INIS)
Maruyama, Y.; Wierzbicki, J.; Feola, J.M.
1993-01-01
Data for the 30 day bone marrow syndrome (BM-50) and the 6-10 day gastrointestinal (GI-50) syndrome for a one and two fraction schedule and acute and low dose rate irradiation using pure and mixed Cf-252 and photon radiation are presented. The radiation of Cf-252 is a mixture of neutrons and gamma rays. Balb/c mice of both sexes were total body irradiated with acute Co-60, low dose rate Cs-137 and Cf-252 using a 1 x and 2 x schedule. For low linear energy transfer radiations of Co-60 or Cs-137 there was expected to be an increase in the dose to produce the gastrointestinal and bone marrow syndromes with minimal change for Cf-252 neutrons. The proportion of photons in the Cf-252 radiation field were further altered by mixing Cs-137 with the Cf-252 sources and mice were total body irradiated with different proportions of photons to determine the effect on the radiation syndromes. The effects of mixing Cf-252 neutrons with different proportions of photons on the syndromes was determined. There was increase in BM-50 and GI-50 doses with fractionated or low dose rate photon irradiations and the dose modifying factors were 1.3-1.4 for the GI syndrome and 1.2 for the bone marrow syndrome. For Cf-252 there was minimal fractionation effect for the GI-50 syndrome, which increased by 1.1 for x 1 vs. x 2 fractions; for the BM-50 syndrome it rose by a 1.1 factor. For LDR Cs-137 the dose for the GI-50 syndrome rose 2.2-fold. For mixed neutron-photon radiation of 0%, 15%, 35%, and 65% η/γ mixtures, the dose to produce the BM-50 and GI-50 endpoints dropped sharply from 0 to 35% neutrons and remained flat thereafter. For major tissues such as the bone marrow and GI tract, Cf-252 behaved as high linear energy transfer for mixtures of neutrons and gamma rays when the radiations were delivered simultaneously at the low dose rates studied. 35 refs., 3 figs., 2 tabs
Group Representation of the Prompt Fission Neutron Spectrum of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Croft, S.; Miller, K. A. [Safeguards Science and Technology Group (N-1), Nuclear Nonproliferation Division, Los Alamos National Laboratory, Los Alamos(United States)
2011-12-15
We review the spectral representation used for the prompt fission neutron spectrum of 252Cf in the International Organization for Standardization document ISO 8529-1. We find corrections to Table A.2, the discrete group structure form, of this report are needed. We describe the approach to generating replacement values and provide a new tabulation.
A half-century of changes in zirconium alloys
International Nuclear Information System (INIS)
Mardon, J.P.; Barberis, P.; Hoffmann, P.B.
2008-01-01
This article presents the history of zirconium alloys for PWR and BWR technologies. For more than 20 years zirconium alloys have evolved to cope with demands of the reactor operators concerning the burn-up extension and new safety margins. The poor properties of Zircaloy-1 concerning corrosion have led researchers to add elements like iron by developing Zircaloy-3A and Zircaloy-3C, and resulting in Zircaloy-4 with tin addition (from 1.30% to 1.50%). Zircaloy-4 is now outdated for PWR and new zirconium alloys with niobium are used (M5, ZIRLO...) they present a better resistance to corrosion, to hydridation, to creep and they are less prone to dimensional changes under irradiation. (A.C.)
Energy Technology Data Exchange (ETDEWEB)
Huang, Hongxia, E-mail: hhxhunan@yahoo.com.cn [College of Chemistry and Bioengineering, Guilin University of Technology, Guilin (China); Huang, Kelong [College of Chemistry and Chemical Engineering, Central South University (China)
2012-05-15
The influence of surface treatment by solutions of NH{sub 4}F, LiF and LiF containing KBH{sub 4} on the structure and electrochemical properties of the M1Ni{sub 3.5}Co{sub 0.6}Mn{sub 0.4}Al{sub 0.5} hydrogen storage alloy (in which M1 denotes mischmetal) is investigated. The fluorination treatment improves the electrochemical performances of the M1Ni{sub 3.5}Co{sub 0.6}Mn{sub 0.4}Al{sub 0.5} alloy. The maximum discharge capacity (C{sub max}) increases from 314.8 to 325.7 (NH{sub 4}F), 326.5 (LiF) and 316.4 mAh g{sup -1} (LiF+KBH{sub 4}). After 60 cycles, the capacity retention rate increases from 83.5 to 84.8% (NH{sub 4}F), 89.5% (LiF) and 93.9% (LiF+KBH{sub 4}). The results of the linear polarization and anodic polarization reveal that the exchange current density (I{sub 0}) and the limiting current density (I{sub L}) increase after fluorination treatment, indicating an improvement of the kinetics of the hydrogen absorption/desorption. (author)
Fast LIBS Identification of Aluminum Alloys
Directory of Open Access Journals (Sweden)
Tawfik W.
2007-04-01
Full Text Available Laser-induced breakdown spectroscopy (LIBS has been applied to analysis aluminum alloy targets. The plasma is generated by focusing a 300 mJ pulsed Nd: YAG laser on the target in air at atmospheric pressure. Such plasma emission spectrum was collected using a one-meter length wide band fused-silica optical fiber connected to a portable Echelle spectrometer with intensified CCD camera. Spectroscopic analysis of plasma evolution of laser produced plasmas has been characterized in terms of their spectra, electron density and electron temperature assuming the LTE and optically thin plasma conditions. The LIBS spectrum was optimized for high S/N ratio especially for trace elements. The electron temperature and density were determined using the emission intensity and stark broadening, respectively, of selected aluminum spectral lines. The values of these parameters were found to change with the aluminum alloy matrix, i.e. they could be used as a fingerprint character to distinguish between different aluminum alloy matrices using only one major element (aluminum without needing to analysis the rest of elements in the matrix. Moreover, It was found that the values of T e and N e decrease with increasing the trace elements concentrations in the aluminum alloy samples. The obtained results indicate that it is possible to improve the exploitation of LIBS in the remote on-line industrial monitoring application, by following up only the values of T e and N e for aluminum in aluminum alloys as a marker for the correct alloying using an optical fiber probe.
Chemical compatibility between cladding alloys and advanced fuels
International Nuclear Information System (INIS)
Fee, D.C.; Johnson, C.E.
1975-05-01
The National Advanced Fuels Program requires chemical, mechanical, and thermophysical properties data for cladding alloys. The compatibility behavior of cladding alloys with advanced fuels is critically reviewed. in carbide fuel pins, the principal compatibility problem is cladding carburization, diffusion of carbon into the cladding matrix accompanied by carbide precipitation. Carburization changes the mechanical properties of the cladding alloy. The extent of carburization increases in sodium (versus gas) bonded fuels. The depth of carburization increases with increasing sesquicarbide (M 2 C 3 ) content of the fuel. In nitride fuel pins, the principal compatibility problem is cladding nitriding, diffusion of nitrogen into the cladding matrix accompanied by nitride precipitation. Nitriding changes the mechanical properties of the cladding alloy. In both carbide and nitride fuel pins, fission products do not migrate appreciably to the cladding and do not appear to contribute to cladding attack. 77 references. (U.S.)
Kannan, M Bobby; Raman, R K Singh
2008-05-01
The successful applications of magnesium-based alloys as degradable orthopaedic implants are mainly inhibited due to their high degradation rates in physiological environment and consequent loss in the mechanical integrity. This study examines the degradation behaviour and the mechanical integrity of calcium-containing magnesium alloys using electrochemical techniques and slow strain rate test (SSRT) method, respectively, in modified-simulated body fluid (m-SBF). Potentiodynamic polarisation and electrochemical impedance spectroscopy (EIS) results showed that calcium addition enhances the general and pitting corrosion resistances of magnesium alloys significantly. The corrosion current was significantly lower in AZ91Ca alloy than that in AZ91 alloy. Furthermore, AZ91Ca alloy exhibited a five-fold increase in the surface film resistance than AZ91 alloy. The SSRT results showed that the ultimate tensile strength and elongation to fracture of AZ91Ca alloy in m-SBF decreased only marginally (approximately 15% and 20%, respectively) in comparison with these properties in air. The fracture morphologies of the failed samples are discussed in the paper. The in vitro study suggests that calcium-containing magnesium alloys to be a promising candidate for their applications in degradable orthopaedic implants, and it is worthwhile to further investigate the in vivo corrosion behaviour of these alloys.
Spin wave propagation detected over 100 μm in half-metallic Heusler alloy Co2MnSi
Stückler, Tobias; Liu, Chuanpu; Yu, Haiming; Heimbach, Florian; Chen, Jilei; Hu, Junfeng; Tu, Sa; Alam, Md. Shah; Zhang, Jianyu; Zhang, Youguang; Farrell, Ian L.; Emeny, Chrissy; Granville, Simon; Liao, Zhi-Min; Yu, Dapeng; Zhao, Weisheng
2018-03-01
The field of magnon spintronics offers a charge current free way of information transportation by using spin waves (SWs). Compared to forward volume spin waves for example, Damon-Eshbach (DE) SWs need a relatively weak external magnetic field which is suitable for small spintronic devices. In this work we study DE SWs in Co2MnSi, a half-metallic Heusler alloy with significant potential for magnonics. Thin films have been produced by pulsed laser deposition. Integrated coplanar waveguide (CPW) antennas with different distances between emitter and detection antenna have been prepared on a Co2MnSi film. We used a vector network analyzer to measure spin wave reflection and transmission. We observe spin wave propagation up to 100 μm, a new record for half-metallic Heusler thin films.
Hot temperature corrosion of a zircon-1%niobium alloy
International Nuclear Information System (INIS)
Muller, Sebastian; Lanzani, Liliana
2010-01-01
The reaction of the Zr-1%Niobium alloy to corrosion is studied in this work, which is used as fuel elements sheath material in Russian VVER reactors. For comparative purposes, the conventional alloys Zircaloy-4 y Zr-2.5%Nb have been tested as well. Autoclave tests were carried out in water and in solutions of LiOH with concentrations of 0-1 to 1M at 343 o C and in water vapor at 400 o C (following ASTM G2/G2M-06). The gain in weight/unit of area of the autoclaved samples was determined in order to evaluate the corrosion, and metallographics were performed to characterize the oxides and hydrides that formed. The results show that for tests of 16 hours, a minimum concentration of 0.65M LiOH is needed to accelerate corrosion in Zr-1%Nb and Zr-2.5%Nb, while acceleration occurs in Zircaloy-4 at a concentration of 0.45M. In solutions of LiOH 1M the hydrogen 'uptake' in Zr-1Nb and Zr-2,5Nb is considerably lower in Zircaloy-4. The lesser amount of β-Zr phase present in the Zr-1Nb alloy produces thinner and more compact oxides, with better visual characteristics than for those formed in Zr-2.5Nb
Non-equilibrium synthesis of alloys using lasers
International Nuclear Information System (INIS)
Mazumder, J.; Choi, J.; Ribaudo, C.; Wang, A.; Kar, A.
1993-01-01
This paper discusses microstructure and properties of alloys, produced by laser alloying and cladding technique, for various applications. These include Fe-Cr-W-C alloys for wear resistance, Ni-Cr-Al-Hf alloys for high temperature oxidation resistance and Mg-Al alloys for corrosion resistance. Also a mathematical model will be presented for the prediction of the composition of the metastable phases produced by laser synthesis. Microstructure was characterized using various electron optical techniques such as Transmission Electron Microscopy (TEM), Scanning Electron Microscopy (SEM), Auger Electron Spectroscopy (AES) and Energy Dispersive X-Ray Analysis (EDAX). Wear properties were characterized by a line contact Block on Cylinder method. High temperature oxidation properties were characterized by using Perkin-Elmer Thermo-Gravimetric Analyzer (TGA) where dynamic weight change were monitored at 1,200 C. Corrosion properties were evaluated by a potentio-dynamic method using a computer controlled Potentiostat manufactured by EG ampersand G. A non-equilibrium M 6 C type carbide was found to be responsible for the improved wear resistance. Increased solid-solubility of Hf was found to be a major factor in improving the high temperature oxidation resistance of the Ni-Cr-Al-Hf alloys. Micro-Crystalline phases were observed in Mg-Al alloys. The rapid solidification was modeled using heat transfer in the liquid pool and the solid substrate and mass transfer in the liquid pool. Non-equilibrium partition coefficient was introduced through the boundary condition at the liquid-solid interface. A good correlation was observed between the prediction and the experimental data. 54 refs