WorldWideScience

Sample records for alimento vivo artemia

  1. Alimento vivo como alternativa en la dieta de larvas y juveniles de Pterophyllum scalare (Lichtenstein, 1823)

    OpenAIRE

    J. Luna-Figueroa; Z. T. de J. Vargas; T. J. Figueroa

    2010-01-01

    La nutrición en los estadios iniciales de los peces constituye uno de los principales problemas de cultivo, debido a que es la etapa en la que se presenta la mayor mortalidad. En el presente estudio se evaluó, como alternativa en la alimentación de larvas y juveniles de Pterophyllum scalare, el efecto de tres alimentos vivos (Moina wierzejski, Artemia franciscana y Panagrellus redivivus) y un alimento comercial (Aquarian Tropical Flakes) sobre la tasa específica de crecimiento (TEC) y la sobr...

  2. Alimento vivo como alternativa en la dieta de larvas y juveniles de Pterophyllum scalare (Lichtenstein, 1823

    Directory of Open Access Journals (Sweden)

    J. Luna-Figueroa

    2010-01-01

    Full Text Available La nutrición en los estadios iniciales de los peces constituye uno de los principales problemas de cultivo, debido a que es la etapa en la que se presenta la mayor mortalidad. En el presente estudio se evaluó, como alternativa en la alimentación de larvas y juveniles de Pterophyllum scalare, el efecto de tres alimentos vivos (Moina wierzejski, Artemia franciscana y Panagrellus redivivus y un alimento comercial (Aquarian Tropical Flakes sobre la tasa específica de crecimiento (TEC y la sobrevivencia. La TEC de larvas resultó más alta con nauplios de A. franciscana (17.57 ± 0.39a% peso corporal ganado mg/ día, seguida de M. wierzejski (16.63 ± 0.41b, P. redivivus (14.25 ± 0.42c y del alimento comercial (13.20 ± 0.42d (P<0.05. En los juveniles, la TEC fue mayor con M. wierzejski (6.28 ± 0.21a% peso corporal ganado mg/día, seguida de A. franciscana (6.04 ± 0.23b, P. redivivus (4.86 ± 0.23c y del alimento comercial (4.39 ± 0.23d (P<0.05. La sobrevivencia de las larvas fue 80.00 ± 10.00a% con A. franciscana y M. wierzejski, mayor 25 y 40.62% con respecto a P. redivivus (60.00 ± 10.00b% y al alimento comercial (45.00 ± 10.00b% (P<0.05. En los juveniles, la sobrevivencia del 100% no difirió con ningún alimento. Finalmente, los nauplios de Artemia en la etapa larval y la Moina en juveniles estimularon favorablemente la TEC y la sobrevivencia de P. scalare.

  3. Substituição de alimento vivo por alimento inerte na larvicultura intensiva do tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus) = Replacement of live food for inert food on larviculture of tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus)

    OpenAIRE

    Danieli Cuzini Lombardi; Levy de Carvalho Gomes

    2008-01-01

    Com este trabalho objetivou-se avaliar a substituição de náuplios de Artemia salina por alimentos inertes durante a larvicultura do tambacu. Na primeira fase, com duração de 12 dias, as larvas foram alimentadas com: náuplio de Artemia salina, cyclop-eeze e ovo de Artemia salina. Na segunda fase, com duração de dez dias, foram utilizadas larvas alimentadas com náuplios de Artemia salina provenientes da primeira fase e testados os mesmos três alimentos. A qualidade da água manteve-se em condiçõ...

  4. Substituição de alimento vivo por alimento inerte na larvicultura intensiva do tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus) - DOI: 10.4025/actascianimsci.v30i4.3835 Replacement of live food for inert food on larviculture of tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus) - DOI: 10.4025/actascianimsci.v30i4.3835

    OpenAIRE

    Levy de Carvalho Gomes; Danieli Cuzini Lombardi

    2009-01-01

    Com este trabalho objetivou-se avaliar a substituição de náuplios de Artemia salina por alimentos inertes durante a larvicultura do tambacu. Na primeira fase, com duração de 12 dias, as larvas foram alimentadas com: náuplio de Artemia salina, cyclop-eeze e ovo de Artemia salina. Na segunda fase, com duração de dez dias, foram utilizadas larvas alimentadas com náuplios de Artemia salina provenientes da primeira fase e testados os mesmos três alimentos. A qualidade da água manteve-se em condiçõ...

  5. Substituição de alimento vivo por alimento inerte na larvicultura intensiva do tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus = Replacement of live food for inert food on larviculture of tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Danieli Cuzini Lombardi

    2008-10-01

    Full Text Available Com este trabalho objetivou-se avaliar a substituição de náuplios de Artemia salina por alimentos inertes durante a larvicultura do tambacu. Na primeira fase, com duração de 12 dias, as larvas foram alimentadas com: náuplio de Artemia salina, cyclop-eeze e ovo de Artemia salina. Na segunda fase, com duração de dez dias, foram utilizadas larvas alimentadas com náuplios de Artemia salina provenientes da primeira fase e testados os mesmos três alimentos. A qualidade da água manteve-se em condições adequadas para alarvicultura nas duas fases. As larvas da primeira fase alimentadas com náuplios de Artemia salina obtiveram os melhores resultados em crescimento, sobrevivência e desempenho produtivo. Na segunda fase, o crescimento, a sobrevivência e o desempenho produtivo das larvas alimentadas com náuplios de Artemia salina e ovo de Artemia salina foram semelhantes. Nas duas fases, o custo com alimento foi mais baixo nas larvas alimentadas com náuplios de Artemia salina. Os resultados obtidos mostram que nas duas fases de larvicultura testadas a oferta de náuplios de Artemia salina é a melhor estratégia alimentar por proporcionar boa sobrevivência, crescimento e bom desempenho produtivo, além de menor custo.The aim of this work was to evaluate the replacement of Artemia salina nauplii by inert food during larviculture of tambacu. On the first phase with duration of 12 days, the larvae were fed with one of the following foods: Artemia salina nauplii, cyclop-eeze or Artemia salina egg. On the second phase, with 10 days of duration, larvae fed with Artemia salina nauplii were utilized in the first experiment and the same food treatments were tested. Water quality was adequate forlarvae rearing in both phases. The larvae from the first phase that fed with Artemia salina nauplii presented better growth, survival rate and yield. On the second phase, the growth, survival and yield of larvae fed with Artemia salina nauplii and eggs were

  6. Substituição de alimento vivo por alimento inerte na larvicultura intensiva do tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus - DOI: 10.4025/actascianimsci.v30i4.3835 Replacement of live food for inert food on larviculture of tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus - DOI: 10.4025/actascianimsci.v30i4.3835

    Directory of Open Access Journals (Sweden)

    Levy de Carvalho Gomes

    2009-03-01

    Full Text Available Com este trabalho objetivou-se avaliar a substituição de náuplios de Artemia salina por alimentos inertes durante a larvicultura do tambacu. Na primeira fase, com duração de 12 dias, as larvas foram alimentadas com: náuplio de Artemia salina, cyclop-eeze e ovo de Artemia salina. Na segunda fase, com duração de dez dias, foram utilizadas larvas alimentadas com náuplios de Artemia salina provenientes da primeira fase e testados os mesmos três alimentos. A qualidade da água manteve-se em condições adequadas para a larvicultura nas duas fases. As larvas da primeira fase alimentadas com náuplios de Artemia salina obtiveram os melhores resultados em crescimento, sobrevivência e desempenho produtivo. Na segunda fase, o crescimento, a sobrevivência e o desempenho produtivo das larvas alimentadas com náuplios de Artemia salina e ovo de Artemia salina foram semelhantes. Nas duas fases, o custo com alimento foi mais baixo nas larvas alimentadas com náuplios de Artemia salina. Os resultados obtidos mostram que nas duas fases de larvicultura testadas a oferta de náuplios de Artemia salina é a melhor estratégia alimentar por proporcionar boa sobrevivência, crescimento e bom desempenho produtivo, além de menor custo.The aim of this work was to evaluate the replacement of Artemia salina nauplii by inert food during larviculture of tambacu. On the first phase with duration of 12 days, the larvae were fed with one of the following foods: Artemia salina nauplii, cyclop-eeze or Artemia salina egg. On the second phase, with 10 days of duration, larvae fed with Artemia salina nauplii were utilized in the first experiment and the same food treatments were tested. Water quality was adequate for larvae rearing in both phases. The larvae from the first phase that fed with Artemia salina nauplii presented better growth, survival rate and yield. On the second phase, the growth, survival and yield of larvae fed with Artemia salina nauplii and eggs

  7. Characterization of the virulence of Harveyi clade vibrios isolated from a shrimp hatchery in vitro and in vivo, in a brine shrimp (Artemia franciscana) model system

    OpenAIRE

    Vanmaele, S.; Defoirdt, T; Cleenwerck, I; Vos, P; P. Bossier

    2015-01-01

    Vibrios belonging to the Harveyi clade are important pathogens of a large number of marine animals in the aquaculture industry. In this study, six isolates (H1 to H6) were obtained from a shrimp hatchery in Rio Grande do Norte (Natal-Area, Brazil), which had been confronted with disease outbreaks in 2009. The aim was to characterize the virulence of these isolates, both in vitro (virulence factor production) and in vivo (virulence towards gnotobiotic brine shrimp, Artemia franciscana, larvae)...

  8. DIGESTIBILIDADE IN VITRO E IN VIVO DE PROTEÍNAS DE ALIMENTOS: ESTUDO COMPARATIVO

    OpenAIRE

    C. V. PIRES; M. G. A. OLIVEIRA; Rosa, J. C.; G. A. D. R. CRUZ; F. Q. MENDES; N. M. B. Costa

    2008-01-01

    O presente trabalho teve como objetivos determinar a digestibilidade in vivo, ajustar equações para a determinação da digestibilidade in vitro por meio de diferentes métodos e verificar qual método desenvolvido para a digestibilidade in vitro apresenta maior correlação com a digestibilidade in vivo. Foram utilizadas as seguintes fontes de proteína: carne de rã sem os...

  9. DIGESTIBILIDADE IN VITRO E IN VIVO DE PROTEÍNAS DE ALIMENTOS: ESTUDO COMPARATIVO

    Directory of Open Access Journals (Sweden)

    C. V. PIRES

    2008-10-01

    Full Text Available

    O presente trabalho teve como objetivos determinar a digestibilidade in vivo, ajustar equações para a determinação da digestibilidade in vitro por meio de diferentes métodos e verificar qual método desenvolvido para a digestibilidade in vitro apresenta maior correlação com a digestibilidade in vivo. Foram utilizadas as seguintes fontes de proteína: carne de rã sem osso, carne de rã com osso, carne de rã mecanicamente separada (CMS, carne bovina, ovo em pó, caseína, trigo, milho, soja convencional, soja isenta de inibidor de tripsina Kunitz e de lipoxigenases (soja KTI-LOX-, proteína texturizada de soja (PTS e feijão. Para o cálculo da digestibilidade in vitro foram utilizados os valores de pH obtidos em 10 min (método 1 e 20 min (Método 2 após a adição da solução de enzimas e o do pH estático (método 3, o qual mede o volume de NaOH adicionado, necessário para manter em 8,0 o valor de pH da solução de proteínas após a adição da solução enzimática. No método da queda de pH, as melhores equações foram obtidas com os valores de pH obtidos após 10 min da solução de enzimas. Dessas equações, as que tiveram maiores valores de R2 foram confeccionadas sem a presença de caseína. No método do pH estático as equações que permitiram melhor correlação entre volumes de NaOH com digestibilidade foram aquelas nas quais se usavam todas as fontes de proteína e aquela em que não estava presente a caseína. O uso de técnicas in vitro para a determinação da digestibilidade protéica traz uma série de benefícios, pois requer menos tempo, é mais barato e requisita de menos mão-de-obra e espaço físico.

  10. Alimentos irradiados

    OpenAIRE

    Sendra, E.; Capellas, M.; Guamis, B.

    2001-01-01

    Not available

    La industria alimentaria y las administraciones públicas realizan grandes esfuerzos para mejorar el mantenimiento de las condiciones higiénicas y evitar la contaminación de alimentos. Pese a estos esfuerzos siguen produciéndose un gran numero de procesos patológicos relacionados con los alimentos. Las buenas prácticas higiénicas pueden reducir el nivel de contaminación, pero algunos microorganismos patógenos resulta imposible eliminarlos, especialmente de aque...

  11. Alimentos irradiados

    Directory of Open Access Journals (Sweden)

    Sendra, E.

    2001-01-01

    Full Text Available Not available

    La industria alimentaria y las administraciones públicas realizan grandes esfuerzos para mejorar el mantenimiento de las condiciones higiénicas y evitar la contaminación de alimentos. Pese a estos esfuerzos siguen produciéndose un gran numero de procesos patológicos relacionados con los alimentos. Las buenas prácticas higiénicas pueden reducir el nivel de contaminación, pero algunos microorganismos patógenos resulta imposible eliminarlos, especialmente de aquellos alimentos que se comercializan crudos y con procesado mínimo. La irradiación se presenta como un método de descontaminación posible para este grupo de alimentos, especialmente válido como método de descontaminación final. Dosis de irradiación inferiores a 10 kGy (dependiendo del alimento y condiciones son efectivas para eliminar posibles patógenos no esporulados, inactivar parásitos, tratar especias, condimentos y otros ingredientes secos, fruta fresca y productos de cuarta gama (vegetales frescos, limpios y envasados, listos para consumo. Respecto a la seguridad de los alimentos irradiados, está plenamente demostrado que no provoca la aparición de compuestos especiales y provoca una ligera reducción en el contenido de algunas vitaminas, que es equiparable a la producida por otros tratamientos tecnológicos. Se ha visto también que microorganismos que han sido sometidos a radiaciones y han sobrevivido a ellas se muestran más sensibles a las condiciones ambientales de estrés que aquellos que nunca han sido irradiados. Pese a que los organismos internacionales FAO y OMS presentan la irradiación como un método seguro, eficaz, limpio con el medio ambiente y energéticamente eficiente, los consumidores siguen estando desinformados y mostrándose reticentes a su utilización. En la actualidad se están llevando a cabo muchos sondeos, de los que se deriva que una correcta in formación al consumidor es el único método válido para conseguir la

  12. Potencial toxicológico frente Artemia Salina em plantas condimentares comercializadas no município de Campina Grande-PB

    Directory of Open Access Journals (Sweden)

    Emmanuel Moreira Pereira

    2015-03-01

    Full Text Available O conhecimento do potencial toxicológico das plantas é um fator primordial para estipular o limite consumível. Objetivou-se nesse trabalho avaliar o potencial toxicológico de plantas condimentares frente Artemia salina, expostas às concentrações dos extratos das plantas erva-doce (Pimpinella anisum L., pimenta malagueta (Capsicum frutescens, endro (Anethum graveolens L. e alecrim (Rosmarinus officinalis L.. O trabalho foi desenvolvido no Laboratório de Engenharia de Alimentos - LEA pertencente ao Centro de Tecnologia e Recursos Naturais da Universidade Federal de Campina Grande-PB. A erva doce apresentou uma baixa toxicidade, atingindo uma DL50 de 428ppm do extrato. Já a pimenta malagueta exibiu um comportamento similar, atingindo o seu potencial toxicológico máximo na terceira diluição com DL50 716,1ppm. Para o endro, observou-se uma baixa taxa de mortalidade, consequentemente foi considerada não toxica, apresentando a DL50, com 2.624,5ppm. O alecrim apresentou baixos percentuais de mortalidade em náuplios de Artemia, sendo a DL50 com 3.720,6ppm, sendo considerado não toxico. No entanto necessita-se de estudos mais aprofundados para caracterizar a composição química das plantas estudadas e um teste in vivo para as que apresentaram baixa toxicidade.

  13. Motion control of a population of Artemias

    Directory of Open Access Journals (Sweden)

    L. Fortuna

    2010-06-01

    Full Text Available In this work, the collective behavior of Artemia Salina is studied both experimentally and theoretically. Several experiments have been designed to investigate the Artemia motion under different environment conditions. From the results of such experiments, a strategy to control the direction of motion of an Artemia population, by exploiting their sensitivity to light, has been derived and then implemented.

  14. Complexity in a population of Artemia

    International Nuclear Information System (INIS)

    Highlights: → Experiments on collective motion of populations of animals (Artemia salina). → Design of low-cost experimental setup for complex systems. → Control of collective motion of populations of Artemia. → Models of collective motion of populations of Artemia. - Abstract: Artemia salina belongs to a genus of very primordial crustaceans, whose behavior is not widely investigated in literature. Their collective behavior is studied in this paper both experimentally and theoretically. Different experiments have been designed to control the direction of motion of an Artemia population by exploiting their sensitivity to light and to measure the response of the population to light at different wavelengths. Mathematical models have been also derived, explaining the mechanisms underlying Artemia flocking formation when a light spot is applied to the system. The results obtained allow to develop new strategies for distributed control of agents and to test them in a simple and low cost experimental setup.

  15. Complexity in a population of Artemia

    Energy Technology Data Exchange (ETDEWEB)

    Ali, A.A., E-mail: abduladem1@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Fortuna, L., E-mail: lfortuna@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Frasca, M., E-mail: mfrasca@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Rashid, M.T., E-mail: mofid76@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Xibilia, M.G., E-mail: mxibilia@ingegneria.unime.i [DiSIA, Faculty of Engineering, University of Messina (Italy)

    2011-04-15

    Highlights: Experiments on collective motion of populations of animals (Artemia salina). Design of low-cost experimental setup for complex systems. Control of collective motion of populations of Artemia. Models of collective motion of populations of Artemia. - Abstract: Artemia salina belongs to a genus of very primordial crustaceans, whose behavior is not widely investigated in literature. Their collective behavior is studied in this paper both experimentally and theoretically. Different experiments have been designed to control the direction of motion of an Artemia population by exploiting their sensitivity to light and to measure the response of the population to light at different wavelengths. Mathematical models have been also derived, explaining the mechanisms underlying Artemia flocking formation when a light spot is applied to the system. The results obtained allow to develop new strategies for distributed control of agents and to test them in a simple and low cost experimental setup.

  16. El consumidor ante los alimentos de nueva generacion: alimentos funcionales y alimentos transgenicos

    OpenAIRE

    Sanchez, Mercedes; Barrena Figueroa, Ramo

    2004-01-01

    El mercado alimentario esta siendo sometido a profunos cambios en los paises desarollados tanto desde el punto vista de la oferta como de la demanda. El principal objectivo de este trabajo se centra en el analisis del proceso de aceptacion por parte de los consumidores de dos categorias de alimentos basadas en la aplicacion de buevas teenologias en la industria agroalimentaria: los alimentos transgenicos o geneticamente modificados y los nuevos alimentos functionales de diseno. La principal f...

  17. Quorum Sensing-Disrupting Brominated Furanones Protect the Gnotobiotic Brine Shrimp Artemia franciscana from Pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus Isolates†

    OpenAIRE

    Defoirdt, Tom; Crab, Roselien; Wood, Thomas K.; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

    2006-01-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests.

  18. Quorum Sensing-Disrupting Brominated Furanones Protect the Gnotobiotic Brine Shrimp Artemia franciscana from Pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus Isolates†

    Science.gov (United States)

    Defoirdt, Tom; Crab, Roselien; Wood, Thomas K.; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

    2006-01-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests. PMID:16957276

  19. Marine Lactobacillus pentosus H16 protects Artemia franciscana from Vibrio alginolyticus pathogenic effects.

    Science.gov (United States)

    Garcés, M E; Sequeiros, C; Olivera, N L

    2015-02-10

    Vibrio alginolyticus is an opportunistic pathogen which may affect different aquatic organisms. The aim of this study was to assess the probiotic properties and the protective mode of action of Lactobacillus pentosus H16 against V. alginolyticus 03/8525, through in vitro and in vivo studies using Artemia franciscana (hereafter Artemia). This strain showed antimicrobial activity against V. alginolyticus 03/8525 and Aeromonas salmonicida subsp. salmonicida ATCC33658 possibly related to lactobacilli organic acid production. It was able to survive at high rainbow trout bile concentrations and showed high selective adhesion to rainbow trout mucus (1.2×10(5)±8.0×10(3) cells cm(-2)). H16 outcompeted V. alginolyticus 03/8525 and A. salmonicida subsp. salmonicida ATCC33658, greatly reducing their adherence to rainbow trout mucus (64.8 and 74.1%, respectively). Moreover, H16 produced a cell-bound biosurfactant which caused an important decrease in the surface tension. H16 also protected Artemia nauplii against mortality when it was administered previous to V. alginolyticus 03/8525 inoculation. Furthermore, H16 bioencapsulated in Artemia, suggesting that it is possible to use live carriers in its administration. We conclude that the ability of L. pentosus H16 to selectively adhere to mucosal surfaces and produce cell-bound biosurfactants, displacing pathogenic strains, in addition to its antimicrobial activity, confer H16 competitive advantages against pathogens as demonstrated in in vivo challenge experiments. Thus, L. pentosus H16, a marine bacterium from the intestinal tract of hake, is an interesting probiotic for Artemia culture and also has the potential to prevent vibriosis in other aquaculture activities such as larvae culture and fish farming. PMID:25667335

  20. Comparison of the Artemia salina and Artemia fransiscana bioassays for toxicity of Indian medicinal plants

    Institute of Scientific and Technical Information of China (English)

    Thangapandi Veni; Thambusamy Pushpanathan

    2014-01-01

    Objective:To evaluate leaves extract of Azima tetracantha and Gmelina asiatica for lethality to brine shrimp larvae (Artemia salina and Artemia fransiscana). Methods: The plant materials were extracted based on polarity gradients of petroleum ether, benzene, chloroform, acetone, ethanol and methanol. The extracts were investigated for their cytotoxic potential. Results: In the brine shrimp lethality assay of all extracts, exception of acetone, ethanol and petroleum ether extracts Gmelina asiatica displayed 100%mortality at 1 000 μg/mL by Artemia salina and Artemia fransiscana. Chloroform extract was the most potent and presented the highest percentage of mortality with the lowest LC50 values by both assay too. Conclusions:The results of the present study suggest the presence of photochemical possessing cytotoxic agents.

  1. Nonhatching Decapsulated Artemia Cysts As a Replacement to Artemia Nauplii in Juvenile and Adult Zebrafish Culture.

    Science.gov (United States)

    Tye, Marc; Rider, Dana; Duffy, Elizabeth A; Seubert, Adam; Lothert, Brogen; Schimmenti, Lisa A

    2015-12-01

    Feeding Artemia nauplii as the main nutrition source for zebrafish is a common practice for many research facilities. Culturing live feed can be time-consuming and requires additional equipment to be purchased, maintained, and cleaned. Nonhatching decapsulated Artemia cysts (decaps) are a commercially available product that can be fed directly to fish. Several other ornamental fish species have been successfully cultured using decaps. Replacing Artemia nauplii with decaps could reduce the overall time and costs associated with the operation of a zebrafish facility. The objective of this study was to determine if decaps could be a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture. Wild-type zebrafish were fed one of three dietary treatments: decaps only, nauplii only, or a standard consisting of nauplii plus a commercially prepared pellet food. Survival, growth (length and weight), and embryo production were analyzed between the treatments. Fish receiving the decap diet demonstrated a significantly higher growth and embryo production when compared to the fish receiving the nauplii-only diet. When comparing the decap fish to the standard fish, no significant difference was found in mean survival, mean weight at 90 days postfertilization, or mean embryo production. It was determined that nonhatching decapsulated Artemia cysts can be used as a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture. PMID:25495227

  2. Toxic Assessment of Triclosan and Triclocarban on Artemia salina.

    Science.gov (United States)

    Xu, Xiaolu; Lu, Yin; Zhang, Deyong; Wang, Yinyin; Zhou, Xianshan; Xu, Huiying; Mei, Yu

    2015-12-01

    In this study, we investigated the possible acute toxic and genotoxic effects of triclosan (TCS) and triclocarban (TCC) on Artemia salina. Genotoxicity was evaluated using single-cell gel electrophoresis and apoptotic frequency assays (Annexin V-FITC/PI assay). Acute toxicity test results showed that TCC (LC50-24 h = 17.8 µg/L) was more toxic than TCS (LC50-24 h = 171.1 µg/L). Significant increases in both genotoxic biomarkers were observed at 24 h after initial exposure, indicating that these two chemicals are potentially dangerous for this aquatic biological model. Although further studies are required, a comparison of data both in vitro and in vivo allowed us to suggest possible mechanisms of action for TCS and TCC in this sentinel organism. PMID:26310128

  3. Toxicity Effect of Silver Nanoparticles in Brine Shrimp Artemia

    OpenAIRE

    Chinnasamy Arulvasu; Samou Michael Jennifer; Durai Prabhu; Devakumar Chandhirasekar

    2014-01-01

    The present study revealed the toxic effect of silver nanoparticles (AgNPs) in Artemia nauplii and evaluated the mortality rate, hatching percentage, and genotoxic effect in Artemia nauplii/cysts. The AgNPs were commercially purchased and characterized using field emission scanning electron microscope with energy dispersive X-ray spectroscopy. Nanoparticles were spherical in nature and with size range of 30–40 nm. Artemia cysts were collected from salt pan, processed, and hatched in sea water...

  4. Feeding adult of Artemia salina (Crustacea-Branchiopoda on the dinoflagellate Gyrodinium corsicum (Gymnodiniales and the Chryptophyta Rhodomonas baltica

    Directory of Open Access Journals (Sweden)

    Rauquírio André Albuquerque Marinho da Costa

    2005-07-01

    Full Text Available Experiments were carried out on feeding performance and survival rates of adult Artemia salina exposed to no axenic strains of the dinoflagellate Gyrodinium corsicum and of the Chryptophyta Rhodomonas baltica. Filtration rates on R. baltica and G. corsicum varied from 3.35 to 7.14 ml.artemia-1.h-1 and from 2.97 to 15.86 ml.artemia-1.h-1, respectively. The ingestion rates observed for A. salina did not indicate any digestive dysfunction or physiological impairment for organisms fed on G. corsicum and their functional response were similar to those observed for other organisms like copepod fed on different food concentrations. Mortality rates oscillated from 2.5% to 100% when A. salina was fed on R. baltica or G. corsicum, respectively. Highest mortality rates observed for organisms fed on G. corsicum indicated that this dinoflagellate presented a hazard effect on A. salina that was not possible to confirm if it was related to toxin production or to nutritive inadequacy of this dinoflagellate as food for organisms of this species.Experimentos foram desenvolvidos para estudar as taxas de alimentação e de sobrevivência de Artemia salina alimentada com cepas não tóxicas do dinoflagelado Gyrodinium corsicum e da Chryptophyta Rhodomonas baltica. As taxas de filtração sobre R. baltica e G. corsicum variaram entre 3,35 e 7,14 ml.artemia-1.h-1 e 2,97 e 15,86 ml.artemia-1.h-, respectivamente. As taxas de ingestão observadas para A. salina não indicaram disfunção digestiva ou prejuízo fisiológico nos organismos alimentados com G. corsicum, sendo a resposta funcional destes organismos similar a observada em copépodos alimentados com diferentes concentrações de alimento. As taxas de mortalidade de A. salina oscilaram entre 2,5 e 100% quando alimentada com R. baltica e G. corsicum, respectivamente. As maiores taxas de mortalidade observadas para os organismos alimentados com G. corsicum indicam que este dinoflagelado apresenta algum efeito

  5. Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates

    OpenAIRE

    Defoirdt, T; Crab, R.; Wood, T. K.; Sorgeloos, P.; Verstraete, W; P. Bossier

    2006-01-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests.

  6. Prospects of Artemia culture in the coastal zone

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.

    The importance of the brine shrimp Artemia as live feed in shrimp hatcheries has been pointed out. The paper deals with the resource potential and status of cyst production in India. There is a need for setting up a Pilot Project for Artemia cyst...

  7. Essential oils of Nigella sativa protects Artemia from the pathogenic effect of Vibrio parahaemolyticus Dahv2.

    Science.gov (United States)

    Manju, Sivalingam; Malaikozhundan, Balasubramanian; Withyachumnarnkul, Boonsirm; Vaseeharan, Baskaralingam

    2016-05-01

    The anti-Vibrio activity of essential oils (EOs) of nine medicinal plants was tested against 28 Vibrio spp. isolated from diseased Fenneropenaeus indicus. EO of Nigella sativa exhibited anti-Vibrio activity against all Vibrio spp. and greater inhibition was noted for the isolate V2 which was identified as Vibrio parahaemolyticus Dahv2. Further, EO of N. sativa effectively inhibited V. parahaemolyticus Dahv2 with an inhibition zone of 23.9mm at 101.2μgml(-1). Moreover, EO of N. sativa revealed anti-biofilm activity at 101.2μgml(-1) against V. parahaemolyticus Dahv2 and inhibited the growth of V. parahaemolyticus Dahv2 at 100μgml(-1).In vivo experimental infection studies showed that the survival of Artemia spp. infected with V. parahaemolyticus Dahv2 at 1×10(3)cfuml(-1) was only 40%. However, the survival of Artemia spp. was significantly increased after challenge with 100μgml(-1) of EO of N. sativa. EO of N. sativa showed higher anti-oxidant potential and total phenol content than other EOs tested. The anti-oxidant activity of EO of N. sativa was highly correlated to their total phenolic contents (r=0.836, P<0.05). This observation suggests that EO of N. sativa protected the Artemia spp. after experimental infection of V. parahaemolyticus Dahv2. PMID:26945773

  8. Use of the genus Artemia in ecotoxicity testing

    International Nuclear Information System (INIS)

    Information related to varied uses of several species of the genus Artemia (commonly known as brine shrimp), is dispersed among literature from several scientific areas, such as Ecology, Physiology, Ecotoxicology, Aquaculture and Genetics. The present paper reviews information related to Artemia that may be considered relevant for ecotoxicity testing. Integration of different areas of scientific knowledge concerning biology, life cycle and environmental needs of Artemia is of crucial importance when considering the interpretation of results drawn from tests involving this genus. Furthermore, this paper provides suggestions to overcome problems related to toxicity assessment with the use of Artemia as test organism in bioassays, under the scope of estuarine, marine and hypersaline environments. Aspects related to variability in results, adoptable toxicity end-points, culture conditions, characteristics of species and strains, influence of geographical origins over physiological features and responses to exposure to chemical agents are considered. - The physiology, reproductive processes and general use of Artemia in modern ecotoxicological testing are reviewed

  9. Use of the genus Artemia in ecotoxicity testing

    Energy Technology Data Exchange (ETDEWEB)

    Nunes, Bruno S. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal) and Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal)]. E-mail: bruno@ufp.pt; Carvalho, Felix D. [REQUIMTE, Departamento de Toxicologia da Faculdade de Farmacia da Universidade do Porto, Rua Anibal Cunha, 164, 4050-047 Porto (Portugal); Guilhermino, Lucia M. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal); Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal); Van Stappen, Gilbert [Laboratory of Aquaculture and Artemia Reference Centre, Ghent University, Rozier 44, B-9000 Ghent (Belgium)

    2006-11-15

    Information related to varied uses of several species of the genus Artemia (commonly known as brine shrimp), is dispersed among literature from several scientific areas, such as Ecology, Physiology, Ecotoxicology, Aquaculture and Genetics. The present paper reviews information related to Artemia that may be considered relevant for ecotoxicity testing. Integration of different areas of scientific knowledge concerning biology, life cycle and environmental needs of Artemia is of crucial importance when considering the interpretation of results drawn from tests involving this genus. Furthermore, this paper provides suggestions to overcome problems related to toxicity assessment with the use of Artemia as test organism in bioassays, under the scope of estuarine, marine and hypersaline environments. Aspects related to variability in results, adoptable toxicity end-points, culture conditions, characteristics of species and strains, influence of geographical origins over physiological features and responses to exposure to chemical agents are considered. - The physiology, reproductive processes and general use of Artemia in modern ecotoxicological testing are reviewed.

  10. Use of brine shrimp, Artemia spp., in larval crustacean nutrition: a review

    OpenAIRE

    Sorgeloos, P.; Coutteau, P.; Dhert, Ph.; Merchie, G.; Lavens, P.

    1998-01-01

    Because of convenience in production and their suitable biochemical composition, brine shrimp Artemia spp. nauplii have been adopted as a standard diet in the commercial larviculture of several crustacean species. The nutritional value of Artemia, however, is not constant, but varies both geographically and temporally. During the past decade both the causes of Artemia nutritional variability and methods to improve poor-quality Artemia have been identified. Enriching Artemia spp. with emulsifi...

  11. VIDA ÚTIL DE LOS ALIMENTOS

    OpenAIRE

    María Luisa Carrillo Inungaray; Abigail Reyes Munguía

    2013-01-01

    En un mundo de consumismo, en el que la duración de las cosas puede haber pasado a un segundo plano, conocer el tiempo que durarán los alimentos ha cobrado gran importancia. Esto puede explicarse por el interés de los consumidores por el cuidado de su salud, lo que los lleva a tomar precauciones para minimizar riesgos de contraer enfermedades por el consumo de alimentos contaminados, o de alimentos procesados. La elaboración de alimentos con procesamiento mínimo requiere de un conocimiento de...

  12. Reacciones adversas a los alimentos

    OpenAIRE

    Lastra Gómez, V.I.; Salas Medina, Pablo

    2013-01-01

    Introducción: Las respuestas anómalas tras la ingestión de alimentos es un hecho ampliamente conocido y frecuente. Se pueden producir diferente tipo de reacciones, entre las cuales destacan la alergia alimentaria y la intolerancia alimentaria. Objetivos: Elaborar un protocolo de actuación que permita realizar un proceso estandarizado a la hora de desarrollar un diagnostico precoz y plantear un plan de cuidado apropiado y específico para cada usuario. Material y métodos: Para operacionalizar l...

  13. Larvicidal activity of some marine macrophytes against Artemia salina

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    and Microdictyon pseudohapteron, seagrasses (Halophila ovalis and Syringodium isoetifolium and lichens (Umbilicaria arpina) were tested for larvicidal activity using Artemia salina nauplii. The LC50 values for the PE-fraction of M. pseudohapteron and A. muscoides...

  14. Strong environmental tolerance of Artemia under very high pressure

    International Nuclear Information System (INIS)

    It was shown by the present authors group that a tardigrade in its tun-state can survive after exposed to 7.5 GPa for 13 hours. We have extended this experiment to other tiny animals searching for lives under extreme conditions of high hydrostatic pressure. Artemia, a kind of planktons, in its dried egg-state have strong environmental tolerance. Dozens of Artemia eggs were sealed in a small Teflon capsule together with a liquid pressure medium, and exposed to the high hydrostatic pressure of 7.5 GPa. After the pressure was released, they were soaked in seawater to observe hatching rate. It was proved that 80-90% of the Artemia eggs were alive and hatched into Nauplii after exposed to the maximum pressure of 7.5 GPa for up to 48 hours. Comparing with Tardigrades, Artemia are four-times stronger against high pressure.

  15. Artemia in aquatic toxicology: a review

    OpenAIRE

    Persoone, G.; Wells, P.G.

    1987-01-01

    Due to commercial availability of dried cysts from which live test material can be hatched at will, Artemia is used extensively in research and applied toxicology.Despite the extensive literature on dose-effect relationships of chemicals on brine shrimp, it was not until 1980 that an experimental protocol was developed for a simple acute toxicity test with Artemia nauplii, meeting the prerequisites for standardization.The reliability and accuracy of this short-term test were determined during...

  16. Specific anion effects in Artemia salina.

    Science.gov (United States)

    Lo Nostro, Pierandrea; Ninham, Barry W; Carretti, Emiliano; Dei, Luigi; Baglioni, Piero

    2015-09-01

    The specific anion effect on the vitality of Artemia salina was investigated by measuring the Lethal Time LT50 of the crustaceans in the presence of different sodium salts solutions at room temperature and at the same ionic strength as natural seawater. Fluoride, thiocyanate and perchlorate are the most toxic agents, while chloride, bromide and sulfate are well tolerated. The rates of oxygen consumption of brine shrimps were recorded in mixed NaCl+NaF or NaCl+NaSCN solutions as a function of time. The results are discussed in terms of the Hofmeister series, and suggest that, besides the biochemical processes that involve F(-), SCN(-) and ClO4(-), the different physico-chemical properties of the strong kosmotropic and chaotropic anions may contribute in determining their strong toxicity for A. salina. PMID:25978674

  17. VIDA ÚTIL DE LOS ALIMENTOS

    Directory of Open Access Journals (Sweden)

    María Luisa Carrillo Inungaray

    2013-02-01

    Full Text Available En un mundo de consumismo, en el que la duración de las cosas puede haber pasado a un segundo plano, conocer el tiempo que durarán los alimentos ha cobrado gran importancia. Esto puede explicarse por el interés de los consumidores por el cuidado de su salud, lo que los lleva a tomar precauciones para minimizar riesgos de contraer enfermedades por el consumo de alimentos contaminados, o de alimentos procesados. La elaboración de alimentos con procesamiento mínimo requiere de un conocimiento de las complejas reacciones que se llevan a cabo en el alimento, ya que si la combinación de factores de conservación que se aplican en el alimento no son en la cantidad y la intensidad adecuadas, puede ocurrir una mayor velocidad de deterioro de los mismos. La información que aquí se presenta, pretende servir de apoyo al personal de la industria alimentaria, a estudiantes y profesores del área de los alimentos, que requieran de información básica acerca de cómo lograr la estabilidad de los alimentos, así como los factores que participan en su descomposición. Los conceptos que se presentan permitirán comprender los factores relacionados con la descomposición de los alimentos y la influencia en su estabilidad. Asimismo, se mostrará cómo aplicar e interpretar pruebas para prolongar la vida útil de los alimentos, lo que contribuirá a la mejora de la calidad y a la consecuente disminución del riesgo de adquirir enfermedades transmitidas por ellos.

  18. Alimentos transgénicos

    OpenAIRE

    García Olmedo, Francisco

    2009-01-01

    En los últimos años se han producido aumentos en la producción de alimentos por habitante en todas las áreas geográficas, con excepción del Sahel. De acuerdo con la FAO, el número de personas con hambre estricta pasó de 935 millones en 1970 a 730 millones en 1990, a pesar de que en esas regiones casi se duplicó la población. Aun así, el hambre supone una de las mayores lacras actuales de la humanidad. Algunos factores esenciales de la producción agrícola, tales como la energía, el agua ...

  19. Empaque de alimentos en atmosferas modificadas

    OpenAIRE

    Restrepo Molina, Diego Alonso

    2003-01-01

    Resumen: Las técnicas usadas para reducir el oxígeno alrededor del alimento son conocidas como Modified Atmosphere Packaging (MAP) e incluyen el empacado en atmosfera controlada y el “verdadero” empacado en atmosfera modificada. Teniendo en cuenta que la refrigeración es considerada, en el ámbito de los alimentos, como uno de los métodos de conservación de mayor impacto, ya que retarda el deterioro de los alimentos almacenados por periodos importantes de tiempo, la combinación de la disminuci...

  20. Variant subunit specificity in the quaternary structure of Artemia hemoglobin.

    Science.gov (United States)

    Vandenberg, Cassandra J; Matthews, Charles M; Trotman, Clive N A

    2002-08-01

    The brine shrimp Artemia has three extracellular hemoglobins (Hbs) that are developmentally expressed and exhibit distinct oxygen-binding characteristics (Heip, Moens, and Kondo 1978; Heip et al. 1978 ). These Hbs are composed of two polymers, each of which comprises nine covalently linked globin domains. Although the cDNA sequences of two nine-domain globins from Artemia have been published, there is evidence for the existence of further expressed globin genes (Manning, Trotman, and Tate 1990 ). In the present study extensive analysis at the cDNA and genomic levels was performed in order to determine the globin gene copy number in Artemia. Sequence and Southern analysis suggest that four Hb polymers (T1, T2, C1, and C2) are expressed in Artemia. In addition, there is also at least one globin pseudogene. Protein sequencing of the native Hbs revealed that there are limitations on which two polymers can associate. The composition of the Hbs has been determined to be: Hb I, C1C2; Hb II, C1T2; and Hb III, T1T2. These pairings allow the levels of the three Artemia Hbs to be regulated independently by polymer expression alone, therefore explaining the previously inconsistent developmental and hypoxia-induced expression patterns. PMID:12140240

  1. Effects of Artemia enriched with unsaturated fatty acids and vitamin C on growth, survival and resistance Salmo trutta caspius larvae

    OpenAIRE

    Javaheri baboli, Mehran

    2006-01-01

    This experiment was conducted to investigate the effect of using n-3 HUFA and Vitamin C enriched Artemia urmiana Nauplii Five difference treament were tested: for Caspian salmon (Salmo trutta caspius) larvae compare with artificial food in five treatment: (1) Artificial food, (2) Newly hatched Artemia (3) n-3 HUFA enriched Artemia (4) n-3 HUFA + 10% Ascorbyl Palmitate enriched Artemia (5) n-3 HUFA+20% Ascorbyl palmitate enriched Artemia during 15 days then all treatment were fe...

  2. Field culture of American strain of Artemia in India

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Pilot scale culture of Artemia was carried out in a 0.22 ha condenser unit of salt pans. Pond was fertilized with inorganic salts. The nauplii of San Francisco Bay, USA strain were inoculated. Within a period of 5 months a production of 20.6 kg dry...

  3. Mutagenicidade e antimutagenicidade dos principais corantes para alimentos

    Directory of Open Access Journals (Sweden)

    ANTUNES Lusânia Maria Greggi

    2000-01-01

    Full Text Available Muitos compostos presentes nos alimentos, tanto naturalmente, como adicionados ou produzidos durante o processamento, já foram testados quanto à mutagenicidade ou antimutagenicidade em diferentes sistemas experimentais. O grande número de corantes para alimentos, naturais ou sintéticos, tem levado os pesquisadores a avaliar a mutagenicidade e/ou antimutagenicidade desses compostos. Alguns corantes sintéticos apresentaram potencial mutagênico e seu uso foi proibido em alguns países. Muitos corantes naturais testados apresentaram potencial antimutagênico em pelo menos um sistema-teste, entretanto, isto não quer dizer que os corantes naturais são inócuos. O corante natural curcumina, por exemplo, apresentou potencial antimutagênico nos testes in vivo e foi mutagênico nos testes in vitro. Este paradoxo ressalta a importância de uma avaliação criteriosa e ampla na avaliação da possível atividade mutagênica e/ou antimutagênica dos corantes.

  4. Mutagenicidade e antimutagenicidade dos principais corantes para alimentos

    Directory of Open Access Journals (Sweden)

    Lusânia Maria Greggi ANTUNES

    2000-08-01

    Full Text Available Muitos compostos presentes nos alimentos, tanto naturalmente, como adicionados ou produzidos durante o processamento, já foram testados quanto à mutagenicidade ou antimutagenicidade em diferentes sistemas experimentais. O grande número de corantes para alimentos, naturais ou sintéticos, tem levado os pesquisadores a avaliar a mutagenicidade e/ou antimutagenicidade desses compostos. Alguns corantes sintéticos apresentaram potencial mutagênico e seu uso foi proibido em alguns países. Muitos corantes naturais testados apresentaram potencial antimutagênico em pelo menos um sistema-teste, entretanto, isto não quer dizer que os corantes naturais são inócuos. O corante natural curcumina, por exemplo, apresentou potencial antimutagênico nos testes in vivo e foi mutagênico nos testes in vitro. Este paradoxo ressalta a importância de uma avaliação criteriosa e ampla na avaliação da possível atividade mutagênica e/ou antimutagênica dos corantes.

  5. The Brine Shrimp Artemia: Adapted to Critical Life Conditions

    Science.gov (United States)

    Gajardo, Gonzalo M.; Beardmore, John A.

    2012-01-01

    The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological) to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry-out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst) capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to “perceive” forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity) when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity) that are able to maintain the population under suitable conditions. At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism). The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress response of

  6. Origin and Genetic Diversity of Diploid Parthenogenetic Artemia in Eurasia

    Science.gov (United States)

    Maccari, Marta; Amat, Francisco; Gómez, Africa

    2013-01-01

    There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia). Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca) are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages. PMID:24376692

  7. INTERNATIONAL STUDY ON ARTEMIA XXII: NUTRITION IN AQUATIC TOXICOLOGY--DIET QUALITY OF GEOGRAPHICAL STRAINS OF THE BRINE SHRIMP, ARTEMIA

    Science.gov (United States)

    A reference and four geographical strains of brine shrimp (Artemia spp.) nauplii were evaluated as diets for the larvae of a marine fish, the Atlantic silverside (Menidia menidia). The survival of fish fed the various strains was significantly different and ranged from 82 to 57 p...

  8. Higiene de los alimentos (Keeping Food Safe)

    Centers for Disease Control (CDC) Podcasts

    2009-05-27

    Este podcast de Kidtastics de los CDC habla de lo que pueden hacer los niños y sus padres para conservar los alimentos en buen estado y evitar enfermedades.  Created: 5/27/2009 by National Center for Zoonotic, Vector-Borne, and Enteric Diseases (NCZVED).   Date Released: 5/27/2009.

  9. Alimentos balanceados para perros en Costa Rica

    Directory of Open Access Journals (Sweden)

    Ruth Vargas

    2001-01-01

    Full Text Available Diagnóstico de la comercialización de alimentos balanceados para perros en Costa Rica. Para ampliar los reportes oficiales de la comercialización de alimentos para perros se creó una base de datos que incluyó cantidad, costo, empaque y formulación durante el período 1998 a agosto del 2000. De 1995 a 1998 y de 1996 a 1999 la producción nacional incrementó un 90,4% y la importación un 42,56% respectivamente, ocupando los alimentos nacionales un 72% del tonelaje y un 70% del valor en dólares americanos. No fue posible determinar cuál es el empaque más comercializado, pero si que los alimentos extrusados son los que ocupan el primer lugar y que los alimentos recomendados para cachorros y adultos son los que más se comercializan. La ausencia de datos en las declaraciones sugiere la necesidad de incrementar el control en las mismas en caso de requerirse un estudio de mercado, ya que contrariamente a esta situación el mayor número de garantías inscritas corresponden separadamente para las fases de cachorros y adultos. Merece también atención que las garantías indican mayores porcentajes de proteína cruda que los recomendados por la AAFCO y que al menos 36 fórmulas son recomendadas para estados sanitarios específicos (p.e. para perros con problemas de alergias, cálculos renales, pérdidas de pelo, etc. sin que oficialmente se encuentre registrada ninguna fórmula medicada

  10. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  11. INTERNATIONAL STUDY ON 'ARTEMIA': 21. INVESTIGATIONS INTO WHY SOME STRAINS OF 'ARTEMIA' ARE BETTER FOOD SOURCES THAN OTHERS. FURTHER NUTRITIONAL WORK WITH LARVAE OF THE MUD CRAB, 'RHITHROPANOPEUS HARRISII'

    Science.gov (United States)

    In a series of studies conducted by members of the International Study on Artemia, differences in nutritional quality were documented between geographical strains of the brine shrimp Artemia. Concomitant with, and possibly related to nutritional effectiveness are differences in b...

  12. The brine shrimp Artemia: adapted to critical life conditions

    Directory of Open Access Journals (Sweden)

    Gonzalo M Gajardo

    2012-06-01

    Full Text Available The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to perceive forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity that are able to maintain the population under suitable conditions.At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism. The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress

  13. Involvement of cyclin K posttranscriptional regulation in the formation of Artemia diapause cysts.

    Directory of Open Access Journals (Sweden)

    Yang Zhao

    Full Text Available BACKGROUND: Artemia eggs tend to develop ovoviviparously to yield nauplius larvae in good rearing conditions; while under adverse situations, they tend to develop oviparously and encysted diapause embryos are formed instead. However, the intrinsic mechanisms regulating this process are not well understood. PRINCIPAL FINDING: This study has characterized the function of cyclin K, a regulatory subunit of the positive transcription elongation factor b (P-TEFb in the two different developmental pathways of Artemia. In the diapause-destined embryo, Western blots showed that the cyclin K protein was down-regulated as the embryo entered dormancy and reverted to relatively high levels of expression once development resumed, consistent with the fluctuations in phosphorylation of position 2 serines (Ser2 in the C-terminal domain (CTD of the largest subunit (Rpb1 of RNA polymerase II (RNAP II. Interestingly, the cyclin K transcript levels remained constant during this process. In vitro translation data indicated that the template activity of cyclin K mRNA stored in the postdiapause cyst was repressed. In addition, in vivo knockdown of cyclin K in developing embryos by RNA interference eliminated phosphorylation of the CTD Ser2 of RNAP II and induced apoptosis by inhibiting the extracellular signal-regulated kinase (ERK survival signaling pathway. CONCLUSIONS/SIGNIFICANCE: Taken together, these findings reveal a role for cyclin K in regulating RNAP II activity during diapause embryo development, which involves the post-transcriptional regulation of cyclin K. In addition, a further role was identified for cyclin K in regulating the control of cell survival during embryogenesis through ERK signaling pathways.

  14. ANALYTICAL VARIATION IN THE DETERMINATION OF THE FATTY ACID COMPOSITION OF STANDARD PREPARATIONS OF BRINE SHRIMP ARTEMIA: AN INTERLABORATORY EXERCISE

    Science.gov (United States)

    An international interlaboratory exercise was conducted to investigate the variability associated with the preparation and analysis of samples and the reporting of fatty acid composition data for tvo samples of Artemia supplied to the laboratories by the Artemia Reference Center ...

  15. EFECTO DEL ENRIQUECIMIENTO DE Artemia FRANCISCANA CON DIFERENTES PROPORCIONES DE ω-3 DHA/EPA SOBRE EL CRECIMIENTO DE JUVENILES DE PEZ BLANCO Menidia estor.

    OpenAIRE

    Hernández Téllez, Ana Rosa

    2012-01-01

    La inclusión de los ácidos grasos ω-3 DHA y EPA en el alimento, es un factor importante para lograr mejor supervivencia y crecimiento en la mayoría de los peces cultivados. Dentro del desarrollo tecnológico para el cultivo del pez blanco de Pátzcuaro Menidia estor, se desconoce el requerimiento de ácidos grasos ω-3 DHA/EPA, y el efecto que éstos tienen en el crecimiento y supervivencia de juveniles en cautiverio. En esta especie como en otras, el alimento vivo (nauplio de Artem...

  16. Bioencapsulation of Two Different Vibrio Species in Nauplii of the Brine Shrimp (Artemia franciscana)

    OpenAIRE

    Gomez-Gil, Bruno; Herrera-Vega, Maria A.; Abreu-Grobois, F. Alberto; Roque, Ana

    1998-01-01

    Two groups of nauplii from the brine shrimp (Artemia franciscana) were enriched with different bacteria, and the dynamics of bacterial uptake by the nauplii were observed. This study showed that the efficiency of Artemia nauplii in bioencapsulating bacteria strongly depends on the type of bacteria used, time of exposure, and status (live or dead) of the bacteria.

  17. Characterization of polymorphic microsatellite markers in the brine shrimp Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Green, Andy J.; Figuerola, Jordi;

    2009-01-01

    The brine shrimp Artemia is a complex genus containing sexual species and parthenogenetic lineages. Artemia franciscana is native to America and its cysts (diapausing eggs) are used worldwide as a food source in aquaculture. As a consequence, this anostracan has become an invasive species in many...

  18. Comparison live adult Artemia and squid meat on the growth of Penaeid shrimp Metapenaeus dobsoni (Miers)

    Digital Repository Service at National Institute of Oceanography (India)

    Nair, S.R.S.; Achuthankutty, C.T.; Royan, J.P.

    An experiment lasting 14 weeks was conducted to compare the efficiency of live adult Artemia with fresh squid meat on growth of penaeid shrimp Metapenaeus dobsoni. The shrimps were found actively feeding on live Artemia and grew 84% more than those...

  19. Probióticos e alimentos lácteos fermentados - uma revisão

    OpenAIRE

    Luana Katzuke Wendling; Simone Weschenfer

    2013-01-01

    O objetivo deste trabalho foi realizar uma revisão sobre os probióticos e os benefícios a eles atribuídos, associando sua presença em alimentos lácteos fermentados, mais especificamente nos leites fermentados. Os alimentos funcionais são aqueles que fornecem uma nutrição básica e satisfatoriamente geram benefícios à saúde e neles se enquadram os probióticos, que são micro-organismos vivos que conferem benefícios a saúde humana. Os probióticos são amplamente empregados na indústria de laticíni...

  20. Group 1 LEA proteins contribute to the desiccation and freeze tolerance of Artemia franciscana embryos during diapause.

    Science.gov (United States)

    Toxopeus, Jantina; Warner, Alden H; MacRae, Thomas H

    2014-11-01

    Water loss either by desiccation or freezing causes multiple forms of cellular damage. The encysted embryos (cysts) of the crustacean Artemia franciscana have several molecular mechanisms to enable anhydrobiosis-life without water-during diapause. To better understand how cysts survive reduced hydration, group 1 late embryogenesis abundant (LEA) proteins, hydrophilic unstructured proteins that accumulate in the stress-tolerant cysts of A. franciscana, were knocked down using RNA interference (RNAi). Embryos lacking group 1 LEA proteins showed significantly lower survival than control embryos after desiccation and freezing, or freezing alone, demonstrating a role for group 1 LEA proteins in A. franciscana tolerance of low water conditions. In contrast, regardless of group 1 LEA protein presence, cysts responded similarly to hydrogen peroxide (H2O2) exposure, indicating little to no function for these proteins in diapause termination. This is the first in vivo study of group 1 LEA proteins in an animal and it contributes to the fundamental understanding of these proteins. Knowing how LEA proteins protect A. franciscana cysts from desiccation and freezing may have applied significance in aquaculture, where Artemia is an important feed source, and in the cryopreservation of cells for therapeutic applications. PMID:24846336

  1. Radiation Damage to Artemia Cysts:Effects of Water Vapor.

    Science.gov (United States)

    Snipes, W C; Gordy, W

    1963-10-25

    Water vapor altered the form and greatly increased the rate of decay of the electron-spin resonance pattern of long-lived free radicals obtained upon gamma irradiation of Artemia salina cysts ( brine shrimp eggs). These results, combined with data on radiation survival, indicate that the water vapor protects the cysts from radiation damage, or heals the damage. They also indicate that water protects the cysts from the effect of oxygen by neutralizing the radiation-induced free radicals before they can interact with oxygen to produce irreversible damage. PMID:17748168

  2. Alimentos funcionales y biotecnología

    OpenAIRE

    Andrés Illanes

    2015-01-01

    Título en ingles: Functional  foods and biotechnologyEl estilo de vida contemporáneo provoca un fuerte impacto en los hábitos alimentarios, con un consumo creciente de alimentos procesados y comidas rápidas cuyos efectos adversos sobre la salud son claramente perceptibles. La comida en el mundo occidental está asociada al placer, de modo que el compromiso entre la gratificación y la salud es un dilema en nuestra sociedad. Los problemas de salud asociados a hábitos alimentarios: diabetes, cánc...

  3. Embryogenesis, hatching and larval development of Artemia during orbital spaceflight

    Science.gov (United States)

    Spooner, B. S.; Debell, L.; Armbrust, L.; Guikema, J. A.; Metcalf, J.; Paulsen, A.

    1994-08-01

    Developmental biology studies, using gastrula-arrested cysts of the brine shrimp Artemia franciscana, were conducted during two flights of the space shuttle Atlantis (missions STS-37 and STS-43) in 1991. Dehydrated cysts were activated, on orbit, by addition of salt water to the cysts, and then development was terminated by the addition of fixative. Development took place in 5 ml syringes, connected by tubing to activation syringes, containing salt water, and termination syringes, containing fixative. Comparison of space results with simultaneous ground control experiments showed that equivalent percentages of naupliar larvae hatched in the syringes (40%). Thus, reactivation of development, completion of embryogenesis, emergence and hatching took place, during spaceflight, without recognizable alteration in numbers of larvae produced. Post-hatching larval development was studied in experiments where development was terminated, by intrduction of fixative, 2 days, 4 days, and 8 days after reinitiation of development. During spaceflight, successive larval instars or stages, interrupted by molts, occurred, generating brine shrimp at appropriate larval instars. Naupliar larvae possessed the single naupliar eye, and development of the lateral pair of adult eyes also took place in space. Transmission electron microscopy revealed extensive differentiation, including skeletal muscle and gut endoderm, as well as the eye tissues. These studies demonstrate the potential value of Artemia for developmental biology studies during spaceflight, and show that extensive degress of development can take place in this microgravity environment.

  4. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  5. Growth and survival of Hippocampus erectus (Perry, 1810 juveniles fed on Artemia with different HUFA levels

    Directory of Open Access Journals (Sweden)

    Nicolás Vite-Garcia

    2014-03-01

    Full Text Available Survival during first months after birth is one of the bottlenecks for consolidating the seahorse farming industry. In this work, Artemia metanauplii enriched with two highly unsaturated fatty acids (HUFA rich commercial emulsions with different docosahexaenoic acid (DHA levels (63% and 14% of total lipids, a vegetable oil with no DHA, and non-enriched Artemia as control, were used to feed 5-day-old juvenile Hippocampus erectus for 60 days. Enriched Artemia had similar levels of DHA (13% and 9%, despite great differences of DHA in the emulsions, with traces of DHA in non-enriched and vegetable oil enriched Artemia. More than 20% of DHA was found in 24 h starved juveniles fed both DHA-enriched treatments, similar to values in newly born juveniles, but those fed vegetable oil enriched Artemia or non-enriched Artemia had 5% of DHA. Total lipid and protein levels were similar in juveniles from the four treatments. The n-3/n-6 ratio was almost four-fold higher in seahorses fed DHA-enriched treatments compared to juveniles fed the non-enriched treatments. Survival of seahorses only partially reflected the DHA levels: it was lower in the vegetable oil treatment, similar in the seahorses fed Artemia with higher DHA and in the control treatment, and higher in seahorses fed the HUFA-enriched Artemia with lower DHA levels, although growth was similar in the two DHA-enriched Artemia treatments. Juvenile H. erectus seahorses perform better when they have at least 20% of DHA in their tissues, and these levels can be attained with no more than 14% of DHA in emulsions, eliminating the need for more expensive emulsions with higher DHA levels.

  6. Comparación biométrica del lóbulo frontal en poblaciones americanas de Artemia (Anostraca, Artemiidae Biometric comparision of the frontal knob in american populations of Artemia (Anostraca, Artemiidae

    Directory of Open Access Journals (Sweden)

    PATRICIO R DE LOS RIOS

    2000-03-01

    Full Text Available Se compararon el diámetro del lóbulo frontal y su relación con la longitud corporal, en poblaciones de Artemia franciscana (Chile y Estados Unidos, A. persimilis (Argentina y Artemia sp. (Chile, cultivadas en laboratorio bajo condiciones controladas. Se encontraron diferencias significativas en ambos parámetros entre las poblaciones de A. franciscana y Artemia sp., de Salina El Convento (Chile y entre A. persimilis y Artemia sp. de Torres del Paine (Chile. Se discuten en el presente trabajo los factores geográficos, ecológicos y genéticos que determinaron la especiación de Artemia en Chile y Argentina, y como ésta se manifiesta en distintos patrones morfométricosThe frontal knob diameter and its relationship with the total body lenght among populations of Artemia franciscana (Chile and U.S.A, A. persimilis (Argentina, and Artemia sp. (Chile, were asessed. All populations were cultured under laboratory conditions. Significant differences in both parameters between A. franciscana and Artemia sp. from Salina el Convento (Chile, and between A. persimilis and Artemia sp. from Amarga Lagoon (Chile were recorded.Geographical, ecological and genetic aspects which affected the speciation of Artemia populations in Chile and Argentina, and their expression in morphometric characters are discussed

  7. Diffusive properties of water in Artemia cysts as determined from quasi-elastic neutron scattering spectra. [Artemia shrimp

    Energy Technology Data Exchange (ETDEWEB)

    Trantham, E.C.; Rorschach, H.E.; Clegg, J.S.; Hazlewood, C.F.; Nicklow, R.M.; Wakabayashi, N.

    1984-05-01

    Results have been obtained on the quasi-elastic spectra of neutrons scattered from pure water, 20% agarose gel (hydration four grams H/sub 2/O per gram of dry solid) and cysts of the brine shrimp Artemia for hydrations between 0.10 and 1.2 grams H/sub 2/O per gram of dry solids. The spectra were interpreted using a two-component model that included contributions from the covalently bonded protons and the hydration water, and a mobile water fraction. The mobile fraction was described by a jump-diffusion correlation function for the translation motion and a simple diffusive orientational correlation function. The results for the line widths ..gamma..(Q/sup 2/) for pure water were in good agreement with previous measurements. The agarose results were consistent with NMR measurements that show a slightly reduced translational diffusion for the mobile water fraction. The Artemia results show that the translational diffusion coefficient of the mobile water fraction was greatly reduced from that of pure water. The line width was determined mainly by the rotational motion, which was also substantially reduced from the pure water value as determined from dielectric relaxation studies. The translational and rotational diffusion parameters were consistent with the NMR measurements of diffusion and relaxation. Values for the hydration fraction and the mean square thermal displacement as determined from the Q-dependence of line areas were also obtained.

  8. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O. T. TÜZÜN, E. GÜRKAN, S. DOĞANCA, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  9. Production dynamics of Brine Shrimp (Artemia franciscana) in the San Francisco Bay National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Abundance, stage structure and population dynamics of brine shrimp Artemia franciscana in pond M4 of the San Francisco Bay National Wildlife Refuge were documented...

  10. Listeria monocytogenes em alimentos prontos para consumo

    OpenAIRE

    Castro, José Luís Draper Mineiro Romano de

    2011-01-01

    Dissertação de Mestrado Integrado em Medicina Veterinária Nota introdutória - Bactéria matou 13 em 22 meses Um surto de Listeriose que se regista na região de Setúbal e Almada há 22 meses, desde Janeiro de 2009, já afectou, pelo menos, 24 pessoas, 13 das quais morreram. O CM apurou que uma grávida perdeu o filho na 32ª semana de gestação após comer alimentos infectados com a bactéria Listeria. As vítimas mortais foram idosos e pessoas imunodeprimidas (com o sistema imunit...

  11. Iodo em alimentos consumidos em Portugal

    OpenAIRE

    Coelho, Inês; Delgado, Inês; Costa, Sofia; Castanheira, Isabel; Calhau, Maria Antónia

    2015-01-01

    O iodo é um elemento vestigial essencial na dieta humana e animal, com uma importância nutricional bem estabelecida. É indispensável para a síntese das hormonas da tiroide, tiroxina e triiodotirosina, cujo principal papel está relacionado com o crescimento e desenvolvimento dos órgãos, em particular do cérebro. A fonte natural de iodo são os alimentos. Contudo, de acordo com a OMS um terço da população mundial sofre de algum tipo de carência de iodo. A deficiência crônica de iodo pode levar a...

  12. Evaluation of mono- and mixed diets as food for intensive Artemia culture

    OpenAIRE

    Lavens, P.; De Meulemeester, A.; Sorgeloos, P.

    1987-01-01

    In order to alleviate the problems encountered when using live algae or rice bran as Artemia food in intensive culturing, different alternative types of brine shrimp diets have been evaluated. Using a high-density flow-through recirculation culture system, a Single Cell Protein yeast and mixed diets, consisting of this yeast and micronized waste products from agricultural corps, were selected as suitable Artemia feeds.Production yields after 2 weeks culturing varied from 2 to 5 kg live weight...

  13. Potentials of converting microalgae into brine shrimp Artemia

    OpenAIRE

    Sorgeloos, P

    1985-01-01

    High densities of brine shrimp Artemia can be cultured in flow-through systems using the effluent of microalgae cultures as a combined source of culture medium and food. It has been proven at the "St. Croix Artificial Upwelling Mariculture Project" that in comparison with the fast growing clam Tapes japonica, brine shrimp assure a much more efficient conversion of plant into animal biomass. It appears from the given examples that microalgae conversion into brine shrimp Artemia offers efficien...

  14. Nutritional Content of Artemia sp. Fed with Chaetoceros calcitrans and Skeletonema costatum

    Directory of Open Access Journals (Sweden)

    VIVI ENDAR HERAWATI

    2014-12-01

    Full Text Available Artemia sp. is a natural food with high protein content, especially amino acid. Nowadays, Indonesia still relies on import for its supply. Hence, the utilization of local Artemia sp. as an alternative to the imported product is recommended as it contains more protein and less expensive. The advantages of local Artemia sp. is its better crystal quality as it is still fresh. It also provides better income for salt farmers because waste water from salt farm can be used to culture Artemia sp.. This research is aimed at determining the quality of locally-produced Artemia sp., by evaluation of its essential amino acid and fatty acid profiles after treatments. Our results indicated that Artemia sp. cysts with good quality were produced after 8 hours and Artemia sp. reaches a hatching rate of 1,320,000 cysts (95% after 27 hours. We also found an indication that the best feed concentration was a mix of 60% Chaetoceros calcitrans with 40% Skeletonema costatum. Fatty acid profile analyses showed that the highest SAFA (12.86% and PUFA (29.91% were gained after feeding with Chaetoceros calcitrans, whereas the highest HUFA (4.93% was gained after feeding with Skeletonemacostatum. Essential amino acid profile analyses revealed the highest content of amino acid (18912.62 ppm was after feeding with a combination of Chaetoceros calcitrans and Skeletonema costatum. Finally, the proper water quality during research was at 25-30 oC of temperature, 30-31 ppt of salinity, pH 7.8-8.9, and DO was at 3.0-4.4 mg/L.

  15. Alimentos funcionales y biotecnología

    Directory of Open Access Journals (Sweden)

    Andrés Illanes

    2015-05-01

    Full Text Available Título en ingles: Functional  foods and biotechnologyEl estilo de vida contemporáneo provoca un fuerte impacto en los hábitos alimentarios, con un consumo creciente de alimentos procesados y comidas rápidas cuyos efectos adversos sobre la salud son claramente perceptibles. La comida en el mundo occidental está asociada al placer, de modo que el compromiso entre la gratificación y la salud es un dilema en nuestra sociedad. Los problemas de salud asociados a hábitos alimentarios: diabetes, cáncer, fallas cardíacas, alergias y obesidad,  afectan por igual a adultos y niños y tienen un profundo impacto en países en vías de desarrollo donde los efectos nocivos resultan más evidentes que en países desarrollados debido a las limitaciones económicas (Ezzati et al., 2005.

  16. Stress tolerance during diapause and quiescence of the brine shrimp, Artemia.

    Science.gov (United States)

    MacRae, Thomas H

    2016-01-01

    Oviparously developing embryos of the brine shrimp, Artemia, arrest at gastrulation and are released from females as cysts before entering diapause, a state of dormancy and stress tolerance. Diapause is terminated by an external signal, and growth resumes if conditions are permissible. However, if circumstances are unfavorable, cysts enter quiescence, a dormant stage that continues as long as adverse conditions persist. Artemia embryos in diapause and quiescence are remarkably resistant to environmental and physiological stressors, withstanding desiccation, cold, heat, oxidation, ultraviolet radiation, and years of anoxia at ambient temperature when fully hydrated. Cysts have adapted to stress in several ways; they are surrounded by a rigid cell wall impermeable to most chemical compounds and which functions as a shield against ultraviolet radiation. Artemia cysts contain large amounts of trehalose, a non-reducing sugar thought to preserve membranes and proteins during desiccation by replacing water molecules and/or contributing to vitrification. Late embryogenesis abundant proteins similar to those in seeds and other anhydrobiotic organisms are found in cysts, and they safeguard cell organelles and proteins during desiccation. Artemia cysts contain abundant amounts of p26, a small heat shock protein, and artemin, a ferritin homologue, both ATP-independent molecular chaperones important in stress tolerance. The evidence provided in this review supports the conclusion that it is the interplay of these protective elements that make Artemia one of the most stress tolerant of all metazoan organisms. PMID:26334984

  17. Artemia parthenogenetica (Branchiopoda: Anostraca) from the Large Aral Sea: Abundance, distribution, population structure and cyst production

    Science.gov (United States)

    Arashkevich, Elena G.; Sapozhnikov, P. V.; Soloviov, K. A.; Kudyshkin, T. V.; Zavialov, P. O.

    2009-03-01

    The brine shrimp Artemia parthenogenetica appeared in the Large Aral Sea (Central Asia) in 1998 when mineralization reached 63 ppt. Data on Artemia abundance and biomass, along with temperature and salinity measurements were collected in the western basin during 2002-2006, primarily in the autumn. During the study period, population density grew progressively, both in terms of number, from 250 to 1260 individuals per m 3, and in terms of biomass, from 0.3 to 1.3 g per m 3. In 2005, the population density and spatial distribution in the different parts of the sea (western and eastern basins and strait) was assessed. The horizontal distribution of the Artemia population was uniform in the deep central part of the western basin, although the distribution was quite patchy in the shallow coastal zone. Depth habitat of Artemia was restricted to the upper 20-25 m of depth, as the oxygen depletion and formation of anoxic layer prevented distribution of Artemia to the deeper waters. In autumn, all females reproduced oviparously, with an average clutch size of 30-35 eggs per female. The number of eggs in a clutch was positively correlated with female body length ( r2 = 0.36-0.44).

  18. Brine shrimp Artemia in coastal saltworks: inexpensive source of food for vertically integrated aquaculture

    OpenAIRE

    Sorgeloos, P.

    1983-01-01

    Proper Artemia introduction and management should lead not only to optimal salt production outputs but at the same time provide opportunities for the exploitation of valuable by-products, i.e. Artemia cysts and adult biomass as cheap sources of high quality food for intensive fish or crustacean farming.

  19. Global biodiversity and geographical distribution of diapausing aquatic invertebrates: the case of the cosmopolitan brine shrimp, Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Pacios, Fernando

    2010-01-01

    The genus Artemia comprises passively dispersed anostracan species with a distribution all around the world, except in Antarctica. We used both published and personal data to assess and update existing knowledge on the diversity and distribution of Artemia, in particular compiling also genetic an...

  20. Purification and characterization of a carboxymethyl cellulase from Artemia salina.

    Science.gov (United States)

    Zin, Hyun Woo; Park, Kwang-Hyun; Choi, Tae Jin

    2014-01-01

    Brine shrimp (Artemia salina) belong to a group of crustaceans that feed on microalgae and require a cellulase enzyme that can be used in ethanol production from marine algae. Protein with potential cellulase activity was purified and the activity analyzed under different conditions. After initial identification of cellulase activity by CMC cellulase, surface sterilization and PCR using 16s rRNA primers was conducted to confirm that the cellulase activity was not produced from contaminating bacteria. The enzyme was purified by ammonium sulfate fractionation, gel filtration, and ion exchange chromatography. After the final purification, a 70-fold increase in specific enzyme activity was observed. SDS-PAGE results revealed that the cellulase enzyme had a molecular mass of 96 kDa. Temperature, pH, and salinity values were found to be optimal at 55 °C, pH 8.0, and 600 mM NaCl, respectively. Specifically, the enzyme showed a fivefold increase in enzyme activity in seawater compared to 600 mM NaCl in phosphate buffer. Further analysis of the purified enzyme by molecular spectrometry showed no match to known cellulases, indicating this enzyme could be a novel halophilic cellulase that can be used for the production of bioethanol from marine macroalgae. PMID:24291747

  1. Phaeobacter inhibens as Probiotic Bacteria in Non-Axenic Artemia and Algae Cultures

    DEFF Research Database (Denmark)

    Grotkjær, Torben; D'Alvise, Paul; Bentzon-Tilia, Mikkel;

    2015-01-01

    Bacterial diseases are a major constraint in aquaculture, especially in larviculture. Antibiotics that can control pathogens should be avoided due to risk of antibiotic resistance. We have shown in axenic systems of live larval feed that marine Roseobacter clade bacteria can antagonize fish...... (Phaeobacter inhibens) were studied in an Artemia and a Dunaliella tertiolecta challenge setup, and a controlled microbiota of four bacteria isolated from aquaculture was added. P. inhibens grew well in Artemia and D. tertiolecta cultures, also with a background microbiota. V. anguillarum was decreased...... demonstrates that probiotic bacteria can be introduced at the stage of live feed and have a pathogen reducing effect in both an Artemia and a D. tertiolecta challenge setup. This can potentially limit the subsequent use of antibiotics for control of pathogenic bacteria....

  2. Alimentos funcionales y nutrición óptima: ¿Cerca o lejos?

    Directory of Open Access Journals (Sweden)

    Manuela Belén Silveira Rodríguez

    2003-01-01

    Full Text Available El concepto de alimento funcional, aún no consensuado científicamente, surge en el seno de la Nutrición Óptima, encaminada a modificar aspectos genéticos y fisiológicos y a la prevención y tratamiento de enfermedades, más allá de la mera cobertura de las necesidades de nutrientes. Bajo la perspectiva de la Unión Europea, pueden ser tanto alimentos naturales como procesados industrialmente. Los alimentos funcionales más relevantes y sobre los que recae la más sólida evidencia científica son los probióticos, microorganismos vivos representados fundamentalmente por los derivados lácteos fermentados. Los prebióticos, como los fructanos tipo inulina, son el sustrato trófico de los probióticos y potenciales selectores de la flora colónica. La asociación de un prebiótico y un probiótico se denomina simbiótico. Se conocen innumerables sustancias con actividad funcional: fibra soluble e insoluble, fitosteroles, fitoestrógenos, ácidos grasos monoinsaturados y poliinsaturados, derivados fenólicos, vitaminas y otros fitoquímicos. Los alimentos funcionales ejercen su actividad en múltiples sistemas, especialmente el gastrointestinal, cardiovascular e inmunológico. Se comportan como potenciadores del desarrollo y la diferenciación, moduladores del metabolismo de nutrientes, la expresión génica, el estrés oxidativo y la esfera psíquica. La construcción de alegaciones sanitarias dirigidas al consumidor debe cimentarse en el conocimiento científico y la regulación legal. Es preciso encontrar biomarcadores eficientes del efecto biológico, analizar las posibles interacciones y realizar estudios válidos en humanos. El objetivo prioritario, sin embargo, debe ser la dieta en su conjunto. Emerge así el futuro reto de una dieta funcional.

  3. [Artemia sp. (Crustacea, Anostracea) as intermediate host of Eurycestus avoceti Clark, 1954 (Cestoda, Cyclophyllidea) (author's transl)].

    Science.gov (United States)

    Gabrion, C; MacDonald, G

    1980-01-01

    Examination of Artemia sp. (Crustacé, Anostracé) for natural infection by cysticercoids of Flamingolepis liguloides, Cestode of the Flamingo (Phoenicopterus ruber) shows the presence of three other cysticercoids of cestode parasites of the Flamingo in the hemocoele of the Branchiopode. A fourth one is reported as the cysticercoid of Eurycestus avoceti, Clark, 1954, which parasitizes the Avocet (Recurvirostra avosetta). The systematic position of this Cestode is always unknown. This report shows the importance of Artemia in the life cycle of Cestodes of Anseriforms and Charadriiforms birds in saline lagoons. PMID:7406422

  4. Bacteria contribute to Artemia nutrition in algae-limited conditions: A laboratory study

    OpenAIRE

    Toi, H.T.; P. Boeckx; Sorgeloos, P.; Bossier, P; Van Stappen, G.

    2013-01-01

    We investigated the effect of the stimulation of bacterial growth on Artemia performance in combination with a standard and with a low algal feeding regime. In both regimes, organic carbon (supplied as sucrose or soluble potato starch) and 15N labeled inorganic nitrogen (supplied as NaNO3) were used to stimulate bacterial growth in the Artemia cultures at C/N ratio 10 and 50. After a culture period of 15 days, significantly improved biomass production was obtained in all treatments with the l...

  5. Evaluation of the bioactivities of some Myanmar medicinal plants using brine shrimp (Artemia salina) toxicity test

    International Nuclear Information System (INIS)

    For a variety of toxic substances, brine shrimp larvae (Artemia salina) are usually used as a simple bioassay method and it is also applied for natural product research. The brine shrimp larvae (nauplii) are obtained by natural hatching method from Artemia cysts. By using the larvae, the results from these experiments lead to the lethal dose, LD50 values of extracts of selected medicinal plants. Activities of a broad range of plant extracts are manifested as toxicity to the brine shrimp. Screening results with six plant extracts are compared with pure caffeine. This method is rapid, reliable, inexpensive and convenient. (author)

  6. Radiation-pathological examinations of Artemia Salina L. after exposure to heavy nuclei of cosmic radiation

    International Nuclear Information System (INIS)

    The radiation damage incurring in the development of Artemia salina (L) are investigated for the case when the eggs of this salt crab are not by a heavy nucleus of cosmic radiation. These are atom nuclei heavier than helium which possess relatively high energy. The investigations belong to the series of biostack experiments in which very intensively explored standard objects, embedded in water-soluble plastics (PVH), are exposed to space conditions. Artemia salina (L.) proved esp. suitable because of its extraordinary resistance against chemical and physical damaging factors. (orig./AJ)

  7. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2008-01-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading to...... their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South...

  8. Intracellular water in Artemia cysts (brine shrimp): Investigations by deuterium and oxygen-17 nuclear magnetic resonance

    OpenAIRE

    Kasturi, S. R.; Seitz, P. K.; Chang, D. C.; Hazlewood, C. F.

    1990-01-01

    The dormant cysts of Artemia undergo cycles of hydration-dehydration without losing viability. Therefore, Artemia cysts serve as an excellent intact cellular system for studying the dynamics of water-protein interactions as a function of hydration. Deuterium spin-lattice (T1) and spin-spin (T2) relaxation times of water in cysts hydrated with D2O have been measured for hydrations between 1.5 and 0.1 g of D2O per gram of dry solids. When the relaxation rates (I/T1, I/T2) of 2H and 17O are plot...

  9. ALIMENTOS TRANSGÉNICOS Y ALERGENICIDAD Transgenic foods and allergenicity

    OpenAIRE

    Orlando Acosta Losada; Carlos Arturo Guerrero Fonseca

    2007-01-01

    La utilización de la tecnología transgénica en la modificación de las fuentes alimentarias ha permitido desarrollar alimentos menos caros y más saludables. Esta tecnología tiene la potencialidad de reducir el uso de plaguicidas químicos, incrementar la productividad y proteger el hábitat de los humanos y de otras especies. No obstante, los alimentos genéticamente modificados (GM) han dado origen a preocupaciones públicas entre las organizaciones no gubernamentales (NGOs), los consumidores y l...

  10. Peligros biológicos e inocuidad de alimentos

    OpenAIRE

    Alfredo Rodríguez Matos; Emilio Guzmán Torres; Armando Escalona Rosabal; Mario Otero Fernández

    2005-01-01

    I.- Introducción Cuando un consumidor adquiere un alimento, descuenta que la inocuidad o seguridad del mismo está siempre presente, las expectativas y actitudes de los consumidores están dirigidas a exigir el derecho a la protección de la seguridad, la salud y la información básica sobre los alimentos que el mercado pone a su alcance. En opinión de Erro (2002), la inocuidad se transforma entonces en una “necesidad implícita” que obviamente se pretende satisfacer, pero la toma de conciencia de...

  11. Calidad integral de alimentos y ecología microbiana

    OpenAIRE

    Rodríguez, Héctor Ricardo

    2006-01-01

    En el presente artículo, se plantea analizar y reflexionar sobre algunos aspectos ligados a la calidad y a la seguridad alimentaria -inocuidad, resaltando la necesidad de fortalecer y difundir estos conceptos, tratando de contribuir con la cadena agroalimentaria argentina, en la intención de favorecer la producción de los alimentos que el consumidor demanda, tanto en el mercado doméstico, como en el internacional. El término seguridad alimentaria / seguridad de alimentos (“Food Safety”), será...

  12. Purification and characterization of phenoloxidase from brine shrimp Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Tingjun Fan; Zhao Jing; Xianyuan Fan; Miaomiao Yu; Guojian Jiang

    2011-01-01

    Phenoloxidase from Artemia sinica (AsPO) was purified by Superdex 200 gel-filtration and Q Sepharose fast flow ionexchange chromatography,and its properties were characterized biochemically and enzymatically by using L-dihydroxyphenylalanine (L-DOPA) as the specific substrate.Results showed that AsPO was isolated as a monomeric protein of 125.5 kDa in molecular mass.The optimal pH value and temperature are 7.0 and 50℃,respectively,for its PO activity.The AsPO had an apparent Km value of 4.2 mM on L-DOPA,and 10.9 mM on catechol,respectively.Oxidase inhibitor on PO activity showed that the AsPO was extremely sensitive to ascorbic acid,sodium sulfite,and citric acid; and was very sensitive to cysteine,benzoic acid,and l-phenyl-2-thiourea.Combined with its specific enzyme activity on L-DOPA and catechol,it can be concluded that AsPO is most probably a typical catechol-type O-diphenoloxidase.Its PO activity was also sensitive to metal ions and chelators,and 20 mM DETC-inhibited PO activity was obviously recovered by 15 mM Cu2+,indicating that AsPO is most probably a copper-containing metalloenzyme.All these data about specific substrate,sensitivity to oxidase inhibitor metal ions and chelators indicate that the AsPO has the properties of a catechol-type copper-containing Odiphenoloxidase that functions as a vital humoral factor in host defense via melaninization as in other Crustaceans.

  13. Survival of the probiotic bacteria Lactobacillus rhamnosus in seawater and its bioencapsulation in the brine shrimp Artemia

    Directory of Open Access Journals (Sweden)

    Claudia Ofelio

    2014-06-01

    The results obtained in the first test showed that the L. rhamnosus was able to survive in seawater during the whole experiment (30h, maintaining densities of 10e7 CFU/ml during the first 6h although decreasing progressively afterwards (10e3 CFU/ml at 30h. This allows adequate levels at sufficient time for Artemia to incorporate the probiotic. In fact, bioencapsulation test demonstrated that Artemia metanauplii were able to bioencapsulate the probiotic, reaching the highest concentration in Artemia after 30 min of bioencapsulation (10e4 CFU/Artemia. A slight further decrease (10e3 CFU/Artemia was observed after 24h. Interestingly, L. rhamnosus reduced in 1Log total Vibrionaceae bacteria in Artemia during the 3 first hours. Therefore, 3 hours was the time established for the bioencapsulation protocol and further studies are in progress to determine the ability of Artemia metanauplii to maintain bioencapsulated L. rhamnosus once transferred to rearing tanks. Also, the capability of the probiotic to inhibit potential pathogenic or opportunistic bacteria will be assessed.

  14. Assessment of cyst production potential of a natural population of brine shrimp Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Studies on a natural population of Artemia in the salterns of Jamnagar indicated that the population is parthenogenetic. These shrimps reach a maximum size of 9 mm. Number of cysts per brood varies from 10-32. Adults form about 68% of the total...

  15. SURVIVAL AND GROWTH OF A SHEEPSHEAD MINNOW LARVAE AND JUVENILES ON A DIET OF 'ARTEMIA' NAUPLII

    Science.gov (United States)

    Two geographic strains of brine shrimp (Artemia franciscana) nauplii were evaluated for nutritional quality as a food source for young sheepshead minnows (Cyprinodon variegatus). Although there was no mortality of fish fed either strain, fish reared on brine shrimp nauplii from S...

  16. SURVIVAL AND GROWTH OF SHEEPSHEAD MINNOW LARVAE AND JUVENILES ON A DIET OF 'ARTEMIA' NAUPLII

    Science.gov (United States)

    Two geographic strains of brine shrimp (Artemia franciscana) nauplii were evaluated for nutritional quality as a food source for young sheepshead minnows (Cyprinodon variegatus). Although there was no mortality of fish fed either strain, fish reared on brine shrimp nauplii from S...

  17. Morphometric characterization of thalassohaline Artemia franciscana populations from the Colombian Caribbean

    OpenAIRE

    Camargo, W.N.; Ely, J.S.; Sorgeloos, P.

    2003-01-01

    Aim: To establish possible interpopulation relationships among Colombian Artemia franciscana (Crustacea, Anostraca) populations.Location: Colombian Caribbean coast (Manaure, Galerazamba, Salina Cero and Tayrona) and a similar thalassohaline reference population from San Francisco Bay (SFB-USA). Methods: Morphometric characters of male and female cultured individuals of A. franciscana were measured. The populations were grouped according to: (1) population type (populations grouped according t...

  18. Phylogenetic Analysis of Brine Shrimp (Artemia) in China Using DNA Barcoding

    Institute of Scientific and Technical Information of China (English)

    Weiwei Wang; Jun Yu; Qibin Luo; Haiyan Guo; Peter Bossier; Gilbert Van Stappen; Patrick Sorgeloos; Naihong Xin; Qishi Sun; Songnian Hu

    2008-01-01

    DNA barcoding is a powerful approach for characterizing species of organisms,especially those with almost identical morphological features, thereby helping to to establish phylogenetic relationships and reveal evolutionary histories. In this study, we chose a 648-bp segment of the mitochondrial gene, cytochrome c oxidase subunit 1 (COI), as a standard barcode region to establish phylogenetic relationships among brine shrimp (Artemia) species from major habitats around the world and further focused on the biodiversity of Artemia species in China, especially in the Tibetan Plateau. Samples from five major salt lakes of the Tibetan Plateau located at altitudes over 4,000 m showed clear differences from other Artemia populations in China. We also observed two consistent amino acid changes, 153A/V and 183L/F, in the COI gene between the high and low altitude species in China.Moreover, indels in the COI sequence were identified in cyst and adult samples unique to the Co Qen population from the Tibetan Plateau, demonstrating the need for additional investigations of the mitochondrial genome among Tibetan Artemia populations.

  19. Potential utilization of Artemia franciscana eggs as food for Coleomegilla maculata

    Science.gov (United States)

    We tested the hypothesis that Artemia franciscana Kellogg (brine shrimp, Anostraca: Artemiidae) eggs are suitable factitious, i.e., alternative, food to support the life history of a predatory ladybird beetle, Coleomegilla maculata DeGeer (Coleoptera: Coccinellidae). Using progeny from a stock colo...

  20. Effect of artificial regulations of Artemia n-3 HUFA content on growth and survival of black seabream ( Sparus macrocephalus) larvae

    Science.gov (United States)

    Liu, Jing-Ke

    1998-06-01

    The requirement for dietary n-3 HUFA (highly unsaturated fatty acid) for growth and survival of black seabream ( Sparus macrocephalus) larvae was tested using Artemia with various levels of n-3 HUFA. Four treatments with Artemia differing in their n-3 HUFA were prepared by feeding them various oil emulsions. The results indicated that dietary n-3 HUFA significantly influences fish n-3 HUFA levels and are necessary for good growth and survival of black seabream larvae. The proper value of n-3 HUFA level and DHA, EPA level in Artemia should be 4.273% and 0.873% (wet weight) for good growth and survival in black seabream larvae respectively.

  1. Successful inoculation of Artemia and production of cysts in man-made salterns in the Philippines

    OpenAIRE

    de los Santos, C. Jr.; Sorgeloos, P.; Laviña, E.; Bernardino, A.

    1980-01-01

    The objective of the inoculation described in this paper was to test the feasibility of culturing Artemia in man-made earthen salterns and of producing adults and cysts for use in aquaculture projects in the Philippines. San Francisco Bay (California, USA) Artemia were inoculated in two concrete tanks and in four earthen ponds which are part of a small local salt factory. It was found that Artemia can be grown (with continuous production of nauplii and cysts) year-round in covered concrete ta...

  2. Feeding adult of Artemia salina (Crustacea-Branchiopoda) on the dinoflagellate Gyrodinium corsicum (Gymnodiniales) and the Chryptophyta Rhodomonas baltica

    OpenAIRE

    Rauquírio André Albuquerque Marinho da Costa; Maria Luise Koening; Luci Cajueiro Carneiro Pereira

    2005-01-01

    Experiments were carried out on feeding performance and survival rates of adult Artemia salina exposed to no axenic strains of the dinoflagellate Gyrodinium corsicum and of the Chryptophyta Rhodomonas baltica. Filtration rates on R. baltica and G. corsicum varied from 3.35 to 7.14 ml.artemia-1.h-1 and from 2.97 to 15.86 ml.artemia-1.h-1, respectively. The ingestion rates observed for A. salina did not indicate any digestive dysfunction or physiological impairment for organisms fed on G. corsi...

  3. Peligros biológicos e inocuidad de alimentos

    Directory of Open Access Journals (Sweden)

    Alfredo Rodríguez Matos

    2005-09-01

    Full Text Available I.- Introducción Cuando un consumidor adquiere un alimento, descuenta que la inocuidad o seguridad del mismo está siempre presente, las expectativas y actitudes de los consumidores están dirigidas a exigir el derecho a la protección de la seguridad, la salud y la información básica sobre los alimentos que el mercado pone a su alcance. En opinión de Erro (2002, la inocuidad se transforma entonces en una “necesidad implícita” que obviamente se pretende satisfacer, pero la toma de conciencia de esto se da, lamentablemente, cuando aquella dejó de estar presente. Remitiéndonos a lo expresado por el Codex Alimentarius (1997, indica que las enfermedades de transmisión alimentaria y los daños provocados por los alimentos son, en el mejor de los casos desagradables, y en el peor pueden ser fatales. El deterioro de los alimentos ocasiona pérdidas, es costoso y puede influir negativamente en el comercio y la confianza de los consumidores. Por consiguiente, es imprescindible un control eficaz de la higiene, a fin de evitar los daños ocasionados por los alimentos y por el deterioro de los mismos, para la salud y la economía. Todos, fabricantes, elaboradores, manipuladores y consumidores de alimentos, tienen la responsabilidad de asegurarse de que los alimentos sean inocuos y aptos para el consumo. La responsabilidad del control de los riesgos microbiológicos recae sobre los individuos que intervienen en todas las fases de la cadena alimentaria, desde la explotación agrícola o ganadera hasta el consumidor final. Visto desde esta óptica el análisis de riesgos debería aplicarse dentro de un contexto estratégico, organizativo y operacional reconocido. Si bien en el proceso pueden haber elementos comunes, en el establecimiento de un nivel apropiado de protección los enfoques de esos sectores pueden presentar las máximas diferencias (FAO 2003.

  4. Emulsiones múltiples: compuestos bioactivos y alimentos funcionales

    Directory of Open Access Journals (Sweden)

    Francisco Jiménez-Colmenero

    2013-10-01

    Full Text Available La continua aparición de evidencias científicas acerca del papel de la dieta y/o sus componentes en el bienestar y la salud, ha favorecido la aparición de los alimentos funcionales que en la actualidad constituyen uno de los principales impulsores del desarrollo de nuevos productos. La aplicación de emulsiones múltiples abre nuevas posibilidades en el diseño y desarrollo de alimentos funcionales. Tales sistemas pueden emplearse como producto intermedio (ingrediente alimentario dentro de las estrategias tecnológicas habitualmente empleadas en la optimización de la presencia de compuestos bioactivos en alimentos más saludables y funcionales. Este artículo presenta un breve análisis de los tipos, características y formación de emulsiones múltiples, posibilidad de localización de compuestos bioactivos, así como su potencial aplicación en el diseño y preparación de alimentos saludables y funcionales. Tales aplicaciones se manifiestan especialmente relevantes en relación con aspectos cuantitativos y cualitativos del material lipídico (reducción de grasa/calorías y optimización del perfíl de ácidos grasos, encapsulamiento de compuestos bioactivos fundamentalmente hidrofílicos y reducción de sodio. Esta estrategia ofrece interesantes posibilidades en relación con el enmascaramiento de sabores y mejora de las propiedades sensoriales de los alimentos.

  5. Depression of nuclear transcription and extension of mRNA half-life under anoxia in Artemia franciscana embryos.

    Science.gov (United States)

    van Breukelen, F; Maier, R; Hand, S C

    2000-04-01

    Transcriptional activity, as assessed by nuclear run-on assays, was constant during 10 h of normoxic development for embryos of the brine shrimp Artemia franciscana. Exposure of embryos to only 4 h of anoxia resulted in a 79.3+/-1 % decrease in levels of in-vivo-initiated transcripts, and transcription was depressed by 88. 2+/-0.7 % compared with normoxic controls after 24 h of anoxia (means +/- s.e.m., N=3). Initiation of transcription was fully restored after 1 h of normoxic recovery. Artificially lowering the intracellular pH of aerobic embryos to the value reflective of anoxia (pH 6.7) showed that acidification alone explained over half the transcriptional arrest. Initiation of transcription was not rescued by application of 80 % carbon monoxide under anoxia, which suggests that heme-based oxygen sensing is not involved in this global arrest. When these transcriptional data are combined with the finding that mRNA levels are unchanged for at least 6 h of anoxia, it is clear that the half-life of mRNA is extended at least 8.5-fold compared with that in aerobic embryos. In contrast to the activation of compensatory mechanisms to cope with anoxia that occurs in mammalian cells, A. franciscana embryos enter a metabolically depressed state in which gene expression and mRNA turnover are cellular costs apparently not compatible with survival and in which extended tolerance supercedes the requirement for continued metabolic function. PMID:10708633

  6. The genus Artemia Leach, 1819 (Crustacea: Branchiopoda: I. True and false taxonomical descriptions El género Artemia Leach, 1819 (Crustacea: Branchiopoda: I. Descripciones taxonómicas verdaderas y falsas

    Directory of Open Access Journals (Sweden)

    Alireza Asem

    2010-01-01

    Full Text Available The brine shrimp Artemia is important for aquaculture since it is bighly nutritious. It is also used widely in biological studies because it is easy to culture. The aim of the present study is to review the literature on the taxonomical nomenclature of Artemia. The present study indicates the existence of seven species: three living in the Americas, one in Europe, and three in Asia.El camarón de salmuera Artemia es importante para la acuicultura por su alta calidad nutricional y es muy utilizado para estudios biológicos por ser de fácil cultivo. El objetivo del presente estudio es revisar la literatura sobre la nomenclatura taxonómica de Artemia. Se determina la existencia de siete especies; tres de ellas viven en América, una en Europa y tres en Asia.

  7. Oxygen-binding characteristics of three extracellular haemoglobins of Artemia salina.

    Science.gov (United States)

    D'Hondt, J; Moens, L; Heip, J; D'Hondt, A; Kondo, M

    1978-06-01

    The oxygen-binding characteristics of the three extracellular haemoglobins of brine shrimp (Artemia salina) were studied in vitro by using highly purified preparations. Haemoglobin I is induced last in the development of brine shrimps when functional gills are formed. It has the lowest oxygen affinity (p(50) 5.34mmHg), an intermediate Bohr effect (ø -0.09 at 20 degrees C) above pH8 and a temperature-sensitivity (DeltaH -44.8 to -45.6kJ/mol at pH8-9) comparable with those observed with other invertebrate haemoglobins [Weber & Heidemann (1977) Comp. Biochem. Physiol. A57, 151-155]. Haemoglobin II, which is the first to be induced, soon after hatching of nauplius larvae, persists generally throughout the whole adult life. It has an intermediate oxygen affinity (p(50) 3.7mmHg), the highest Bohr effect (ø -0.21 at 20 degrees C) above pH8 and a similar temperature-sensitivity (DeltaH -46.0 to -54.8kJ/mol at pH8-9) as haemoglobin I. However, haemoglobin III, which is induced second several hours after the induction of haemoglobin II but disappearing from the haemolymph in the middle of adult life, has the highest oxygen affinity (p(50) 1.8mmHg), the lowest Bohr effect (ø -0.03 at 20 degrees C) above pH8.5 and a high resistance against temperature variation between 10 and 25 degrees C at pH8.5-9 (DeltaH -22.6 to -23.0kJ/mol). At pH7.5-8, haemoglobin III exhibits a similar temperature-sensitivity under 30 degrees C as do other haemoglobins. All three haemoglobins have a rather low co-operativity, with Hill coefficients (h 1.6-1.9 at pH8.5), which are dependent on both pH and temperature. The highest co-operativity was observed at 20 degrees C and pH9 for haemoglobins I and II, whereas it was at 27 degrees C and pH8.5 for haemoglobin III. Thus the oxygen-binding behaviour of haemoglobin III in vitro is significantly different from those of haemoglobins I and II and indicates possibly its specific physiological role in vivo in the adaptive process in the natural

  8. ALIMENTOS TRANSGÉNICOS Y ALERGENICIDAD Transgenic foods and allergenicity

    Directory of Open Access Journals (Sweden)

    Orlando Acosta Losada

    2007-12-01

    Full Text Available La utilización de la tecnología transgénica en la modificación de las fuentes alimentarias ha permitido desarrollar alimentos menos caros y más saludables. Esta tecnología tiene la potencialidad de reducir el uso de plaguicidas químicos, incrementar la productividad y proteger el hábitat de los humanos y de otras especies. No obstante, los alimentos genéticamente modificados (GM han dado origen a preocupaciones públicas entre las organizaciones no gubernamentales (NGOs, los consumidores y los medios con relación a su potencial toxicidad, alergenicidad y alteración de los nutrientes. Se presenta una revisión crítica de la literatura reciente sobre las respuestas inmunológicas adversas a las proteínas de los alimentos. Esta revisión incluye las características físicas y químicas de los alergenos, la heterogeneidad en la prevalencia de la alergia a los alimentos y los avances en la comprensión de los desordenes alérgicos producidos por alimentos. Se realiza una descripción del espectro clínico de las reacciones alérgicas inducidas por alimentos, las cuales son responsables de una variedad de síntomas que afectan la piel, el tracto respiratorio y el tracto gastrointestinal. Los métodos utilizados en las pruebas para evaluar la seguridad de los alimentos derivados de los cultivos GM se presentan y discuten. Se concluye que los riesgos alergénicos potenciales introducidos por los alimentos GM no son mayores que los presentados por los alimentos derivados de cultivos modificados genéticamente por los métodos convencionales.The use of transgenic technology to modify food sources has anticipated the possibility of developing less expensive and healthier food. This technology has the potential of reducing the use of chemical pesticides, increasing the productivity and protecting the environment in which human beings and other species live. However, genetically modified (GM foods have raised a public concern among

  9. Baker's yeast as a potential substitute for live algae in aquaculture diets: Artemia as a case study

    OpenAIRE

    Coutteau, P.; Lavens, P.; Sorgeloos, P.

    1990-01-01

    In this study baker's yeast was evaluated as a substitute for live Dunaliella tertiolecta algae in the culture of the brine shrimp Artemia . Consumption of fresh baker's yeast resulted in poor growth and survival of brine shrimp. However, the nutritional value of the yeast significantly improved after complete removal of the yeast cell wall by enzymatic treatment. Baker's yeast was also made digestible for Artemia by simple chemical treatment which did not reduce rigidity of the yeast cell. T...

  10. O prazer associado ao consumo de alimentos e factores influenciadores

    OpenAIRE

    Gomes, Filipe Gonçalo Ferreira

    2013-01-01

    Os indivíduos quando sujeitos a várias sensações transmitem respostas que surgem de reacções fisiológicas resultantes de certos estímulos, gerando a interpretação das propriedades intrínsecas aos alimentos, sendo a análise sensorial realizada em função dessas respostas individuais. As sensações são medidas por efeitos psicológicos, podendo dimensionar a intensidade, extensão, qualidade, duração, gosto ou desgosto em relação ao alimento avaliado, e os estímulos são medidos por processos físico...

  11. Sustentabilidade quanto às embalagens de alimentos no Brasil

    OpenAIRE

    Ana Paula Miguel Landim; Cristiany Oliveira Bernardo; Inayara Beatriz Araujo Martins; Michele Rodrigues Francisco; Monique Barreto Santos; Nathália Ramos de Melo

    2016-01-01

    Resumo A mudança de hábito e o aumento do consumismo nas últimas décadas levaram a inovações tecnológicas e consequentemente à maior produção de bens de consumo, o que gerou um aumento na produção de embalagens. As embalagens estão presentes em diversos setores, dentre eles destacam-se as indústrias de alimentos, nas quais as embalagens têm como principal função contribuir para conservação do alimento, além de vender o produto. Diferentes materiais são utilizados na fabricação de embalagens p...

  12. In vivo toxicity study of Lantana camara

    Institute of Scientific and Technical Information of China (English)

    Badakhshan Mahdi Pour; Sreenivasan Sasidharan

    2011-01-01

    Objective: To investigate the toxicity of methanol extract of various parts (Root, Stem, Leaf, Flower and Fruit) of Lantana camara(L. Camara) in Artemia salina. Methods: The methanol extracts of L. camara were tested for in vivo brine shrimp lethality assay. Results: All the tested extract exhibited very low toxicity on brine shrimp larva. The results showed that the root extract was the most toxic part of L. camara and may have potential as anticancer agent. Conclusions:Methanolic extract of L. camara is relatively safe on short-term exposure.

  13. Evolutionary Origin and Phylogeography of the Diploid Obligate Parthenogen Artemia parthenogenetica (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2010-01-01

    Background: Understanding the evolutionary origin and the phylogeographic patterns of asexual taxa can shed light on the origin and maintenance of sexual reproduction. We assessed the geographic origin, genetic diversity, and phylogeographic history of obligate parthenogen diploid Artemia...... the phylogenetic relationships of diploid A. parthenogenetica and its closest sexual relatives. Populations displayed an extremely low level of mitochondrial genetic diversity, with one widespread haplotype shared by over 79% of individuals analysed. Phylogenetic and phylogeographic analyses indicated......, and probably to the rest of its current geographic distribution. This contrasts with the restricted geographic distribution, strong genetic structure, and regional endemism of sexual Artemia lineages and other passively dispersed sexual continental aquatic invertebrates. We hypothesize that diploid...

  14. Poly-beta-hydroxybutyrate-accumulating bacteria protect gnotobiotic Artemia franciscana from pathogenic Vibrio campbellii.

    Science.gov (United States)

    Halet, Dirk; Defoirdt, Tom; Van Damme, Petra; Vervaeren, Han; Forrez, Ilse; Van de Wiele, Tom; Boon, Nico; Sorgeloos, Patrick; Bossier, Peter; Verstraete, Willy

    2007-06-01

    A poly-beta-hydroxybutyrate (PHB)-accumulating enrichment culture was obtained using activated sludge from a polyphosphate-accumulating reactor as inoculum. PHB accumulated by the enrichment culture significantly enhanced the survival of Artemia nauplii, infected with the virulent pathogen Vibrio campbellii LMG 21363. A strain was isolated from the enrichment culture, based on its ability to accumulate PHB, and 16S rRNA gene sequencing of the isolate revealed 99% sequence similarity to Brachymonas denitrificans AS-P1. The isolate, named PHB2, showed good PHB-accumulating activity (up to 32% of the cell dry weight). PHB accumulated by isolate PHB2 was able to protect Artemia completely from the V. campbellii strain. Our data indicate that PHB-accumulating bacteria, such as B. denitrificans PHB2, could be used as an an effective and economically interesting alternative strategy to control infections in aquaculture. PMID:17391334

  15. Effect of ultra-high pressure on small animals, tardigrades and Artemia

    Directory of Open Access Journals (Sweden)

    Fumihisa Ono

    2016-12-01

    Full Text Available This research shows that small animals, tardigrades (Milnesium tardigradum in tun (dehydrated state and Artemia salina cists (dried eggs can tolerate the very high hydrostatic pressure of 7.5 GPa. It was really surprising that living organisms can survive after exposure to such a high pressure. We extended these studies to the extremely high pressure of 20 GPa by using a Kawai-type octahedral anvil press. After exposure to this pressure for 30 min, the tardigrades were soaked in pure water and investigated under a microscope. Their bodies regained metabolic state and no serious injury could be seen. But they were not alive. A few of Artemia eggs went part of the way to hatching after soaked in sea water, but they never grew any further. Comparing with the case of blue-green alga, these animals are weaker under ultra-high pressure.

  16. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine.

    Science.gov (United States)

    Arcanjo, D D R; Albuquerque, A C M; Melo-Neto, B; Santana, L C L R; Medeiros, M G F; Citó, Amgl

    2012-08-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Justicia pectoralis and Equisetum sp.) against Artemia salina. Biological activity was evaluated for extracts at 1, 10, 100, and 1000 µg/mL in triplicate, and the mean lethal concentration values (LC50) were obtained by probit analysis. The species Acmella uliginosa showed the highest bioactivity, and its flower extract was more active than its leaf extract. PMID:22990821

  17. Vaccination of European sea bass fry through bioencapsulation of Artemia nauplii

    OpenAIRE

    Chair, M.; Gapasin, R.S.J.; Dehasque, M.; Sorgeloos, P.

    1994-01-01

    European sea bass (Dicentrarchus labrax) fry vaccinated orally by bioencapsulation in Artemia nauplii or by bath method exhibited better performance than control fish in terms of growth, food conversion and resistance to stress. The comparable survival between vaccinated and non-vaccinated animals suggests that vaccination methods are stressful. The present study shows that oral vaccination can be used to enhance growth in fish fry.

  18. Monitoring the Effect of Metal Ions on the Mobility of Artemia salina Nauplii

    OpenAIRE

    Varvara Kokkali; Ioannis Katramados; Newman, Jeffrey D.

    2011-01-01

    This study aims to measure the effect of toxic aqueous solutions of metals on the mobility of Artemia salina nauplii by using digital image processing. The instrument consists of a camera with a macro lens, a dark chamber, a light source and a laptop computer. Four nauplii were inserted into a macro cuvette, which contained copper, cadmium, iron and zinc ions at various concentrations. The nauplii were then filmed inside the dark chamber for two minutes and the video sequence was processed by...

  19. AKTIVITAS ANTIKANKER EKSTRAK ETANOL DAUN Rhizopora mucronata TERHADAP LARVA UDANG Artemia salina Leach DAN SEL RAJI

    OpenAIRE

    Hartiwi Diastuti; Warsinah; Purwati

    2009-01-01

    The mangrove plant have been long used the people for traditional medicine to cure various diseases, one of them to cancer therapy. Investigation the anticancer potent of R. mucronata has not been carried yet. This research was aimed to toxicity test of R. mucronta leaf extracts againts Artemia salina Leach, then cytotoxicity test of R. mucronata leave extracts againts Raji cancer cells. The extraction of R. mucronata leaf was peformed by maseration with ethanol. The ethanol extracts was part...

  20. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    OpenAIRE

    Geethaa, Sahgal; Thavamany, Priscilla Jayanthi; Chiew, Siah Poh; Thong, Ong Ming

    2013-01-01

    Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO) are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT]) to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the ...

  1. Sharp Phylogeographic Breaks and Patterns of Genealogical Concordance in the Brine Shrimp Artemia franciscana

    OpenAIRE

    Theodora Farmaki; Abatzopoulos, Theodore J.; Baxevanis, Athanasios D.; Stefania Maniatsi; Ilias Kappas

    2009-01-01

    Genealogical concordance is a critical overlay of all phylogenetic analyses, irrespective of taxonomic level. To assess such patterns of congruence we have compiled and derived sequence data for two mitochondrial (16S rRNA, COI) and two nuclear (ITS1, p26) markers in 14 American populations of the hypersaline branchiopod Artemia franciscana. Cladistic analysis revealed three reciprocally monophyletic mitochondrial clades. For nuclear DNA, incomplete lineage sorting was evident presumably as a...

  2. Elimination of negative effects of cadmium after addition ionizing radiation in Artemia franciscan

    International Nuclear Information System (INIS)

    Nuclear reactor failures present a risk of global contamination which can be affected by other environmental factors, such as chemical elements. The present study investigated the effect of low doses of gamma radiation in relation to the presence of low of Cd. We used an alternative biotest of 2nd generation - Artemia franciscan a. Interaction between irradiation and the action of cadmium chloride could result in a protective effect of ionizing radiation at some concentration of cadmium chloride. (authors)

  3. Genetic characterization of Artemia tibetiana (Crustacea: Anostraca)

    OpenAIRE

    Abatzopoulos, T.J.; Kappas, I.; Bossier, P.; Sorgeloos, P.; Beardmore, J. A.

    2002-01-01

    The brine shrimp Artemia consists of a number of bisexual species and a large number of parthenogenetic forms, which collectively, inhabit a wide range of hypersaline habitats. A recently described species (A. tibetiana) from a carbonate lake (Lagkor Co) in Tibet at an altitude of 4490 m has been tested with New World (A. franciscana USA, and A. franciscana feral population Vietnam) and Old World species (A. salina, A. urmiana, A. sinica) for cross fertility. These tests show complete inferti...

  4. Morphological changes about Artemia Salina by the effect of gamma radiation

    International Nuclear Information System (INIS)

    Direction Council of Europe require restriction of laboratory vertebrae in biological experiments. Once by possibilities is using biological test II. generation among which belongs to and test for Artemia salina. Still this time published test however value only lethality in dependence on dose, exposition and time survival. This work document possibility watch of expressive morphological changes, which consist in retardation development brine shrimps stage in dependence on dose gamma radiation 60Co. (authors)

  5. A small heat shock/α-crystallin protein from encysted Artemia embryos suppresses tubulin denaturation

    OpenAIRE

    Day, Rossalyn M.; Gupta, Jagdish S.; MacRae, Thomas H.

    2003-01-01

    Small heat shock/α-crystallin proteins function as molecular chaperones, protecting other proteins from irreversible denaturation by an energy-independent process. The brine shrimp, Artemia franciscana, produces a small heat shock/α-crystallin protein termed p26, found in embryos undergoing encystment, diapause, and metabolic arrest. These embryos withstand long-term anoxia and other stresses normally expected to cause death, a property likely dependent on molecular chaperone activity. The as...

  6. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay.

    Science.gov (United States)

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50  1000 µg/ml). Our subsequent studies of conifer heartwoods with strong activity confirm the assay's value for identifying new investigational leads for materials with insecticidal and fungicidal activity. PMID:27186474

  7. Oxygen bioavailability and haemoglobins in the brine shrimp Artemia franciscana

    OpenAIRE

    Wachter, B; Blust, R.; Decleir, W.

    1992-01-01

    Bioavailability of oxygen for the saline-water invertebrate Artemia franciscana was studied, since both oxygen concentration and oxygen diffusion rate change with salinity. Total haemoglobin concentration and the relative contribution of each of three haemoglobins was measured in specimens acclimated to different salinities and oxygen concentrations. Both haemoglobin concentration and contribution were influenced by salinity and the group observed (males, females with and females without eggs...

  8. Crecimiento y supervivencia de crías de pulpo (Octopus maya ): alimentados con dietas inertes bajo condiciones de laboratorio en Yucatán, México Growth and survival of larvals of octopus (Octopus maya ): fed with inert diets under conditions of laboratory in Yucatan, Mexico

    OpenAIRE

    Miguel Rodríguez-Serna; Claudia Carmona-Osalde

    2008-01-01

    Bajo un diseño experimental se probaron tres dietas con el objetivo de determinar el crecimiento y la supervivencia de las crías de Octopus maya (Voss y Solís 1966), utilizando dos tipos de alimento inerte (A2 = Balanceado, A3 = Surimi) y comparándolo con un alimento vivo (A1 = Artemia), bajo condiciones controladas. Los resultados mostraron diferencias significativas entre el alimento vivo y el alimento inerte. Se encontró un mejor crecimiento en peso ganado en las crías de pulpo alimentadas...

  9. La ciencia de los alimentos saludables: una panor??mica actual

    OpenAIRE

    Bello, J.

    2006-01-01

    En respuesta a una demanda surgida de la preocupaci??n social por relacionar su estado de salud con los alimentos que consume, la industria alimentaria comercializa unos productos alimenticios que califi ca de Saludables. Los planteamientos implicados en la elaboraci??n de tales categor??as de alimentos han conducido al desarrollo de una nueva rama de la Bromatolog??a, denominada Ciencia de los Alimentos Saludables, con unos objetivos esenciales que le proporcionan su naturaleza c...

  10. Automatic Estimation of Artemia Hatching Rate Using an Object Discrimination Method

    Directory of Open Access Journals (Sweden)

    Sung Kim

    2013-09-01

    Full Text Available Digital image processing is a process to analyze a large volume of information on digital images. In this study, Artemia hatching rate was measured by automatically classifying and counting cysts and larvae based on color imaging data from cyst hatching experiments using an image processing technique. The Artemia hatching rate estimation consists of a series of processes; a step to convert the scanned image data to a binary image data, a process to detect objects and to extract their shape information in the converted image data, an analysis step to choose an optimal discriminant function, and a step to recognize and classify the objects using the function. The function to classify Artemia cysts and larvae is optimally estimated based on the classification performance using the areas and the plan-form factors of the detected objects. The hatching rate using the image data obtained under the different experimental conditions was estimated in the range of 34-48%. It was shown that the maximum difference is about 19.7% and the average root-mean squared difference is about 10.9% as the difference between the results using an automatic counting (this study and a manual counting were compared. This technique can be applied to biological specimen analysis using similar imaging information.

  11. Assessment of toxic potential of Cerrado fruit seeds using Artemia salina bioassay

    Directory of Open Access Journals (Sweden)

    Raíza Cavalcante Fonseca

    2013-06-01

    Full Text Available Artemia salina bioassay was used to assess toxicity of seeds and kernels of Brazilian fruits from cerrado (central high plains region and other inner regions of the country. Water extracts of the kernels were filtered and added to Artemia cultures containing ten individuals per mL. Dose - response curves were constructed, and LD50 values were calculated. Pure potassium cyanide standard was used to draw a calibration curve for comparison to detect the presence of cyanide in the samples tested. Extracts of the seeds of araticum, mangaba, cagaita, jatobá, and tucumã were found toxic to Artemia salina, and some of the dose - response curves were very similar in shape to those obtained with pure potassium cyanide standards, while the samples of baru, cajá-manga, siriguela, trauma, and veludo showed no toxicity at all. The Guignard test, specific for cyanide detection, showed negative results in all toxic samples, suggesting the presence of other toxic compounds rather than cyanide. The comparison of araticum dose - response curve with those of other annonaceous fruits suggests the presence acetogenins as the main toxic compounds in the seeds. These results could be useful to prevent poisoning by industrial derivatives of the fruits studied.

  12. Laboratory generation of new parthenogenetic lineages supports contagious parthenogenesis in Artemia

    Directory of Open Access Journals (Sweden)

    Marta Maccari

    2014-06-01

    Full Text Available Contagious parthenogenesis—a process involving rare functional males produced by a parthenogenetic lineage which mate with coexisting sexual females resulting in fertile parthenogenetic offspring—is one of the most striking mechanisms responsible for the generation of new parthenogenetic lineages. Populations of the parthenogenetic diploid brine shrimp Artemia produce fully functional males in low proportions. The evolutionary role of these so-called Artemia rare males is, however, unknown. Here we investigate whether new parthenogenetic clones could be obtained in the laboratory by mating these rare males with sexual females. We assessed the survival and sex ratio of the hybrid ovoviviparous offspring from previous crosses between rare males and females from all Asiatic sexual species, carried out cross-mating experiments between F1 hybrid individuals to assess their fertility, and estimated the viability and the reproductive mode of the resulting F2 offspring. Molecular analysis confirmed the parentage of hybrid parthenogenetic F2. Our study documents the first laboratory synthesis of new parthenogenetic lineages in Artemia and supports a model for the contagious spread of parthenogenesis. Our results suggest recessive inheritance but further experiments are required to confirm the likelihood of the contagious parthenogenesis model.

  13. Actitud del consumidor frente a los alimentos genéticamente modificados

    OpenAIRE

    Viedma, Inmaculada; López Nicolás, José Manuel; Serrano Megías, Marta; Balanza Galindo, Serafín

    2014-01-01

    Uno de los grandes retos en materia de seguridad alimentaria con los que se enfrenta la sociedad del siglo XXI es la aparición de una gran variedad de nuevos alimentos entre los que se encuentran los alimentos genéticamente modificados. Sin embargo, el futuro de estos alimentos va a depender de cómo sean percibidos por los consumidores y de la aceptación de los mismos. En este trabajo se analiza el grado de conocimiento que el consumidor de la Región de Murcia tiene sobre los alimentos genéti...

  14. Caracterización de la conservación de alimentos en diferentes instalaciones.

    OpenAIRE

    Tamara Díaz Lorenzo; Marta Cardona Gálvez; Angel Caballero Torres; Pedro Morejon Martin; Yariela Sánchez Azahares

    2005-01-01

    La conservación es uno de los elementos que influyen en la calidad sanitaria de los alimentos a lo largo de la cadena alimentaria. Las enfermedades transmitidas por los alimentos se presentan con alta incidencia en nuestro país y constituyen un problema de salud y la conservación adecuada de los alimentos una de las medidas de prevención más importante para evitar su aparición, con el objetivo de caracterizar el comportamiento de la conservación de los alimentos en diferentes instalaciones de...

  15. Sustentabilidade quanto às embalagens de alimentos no Brasil

    Directory of Open Access Journals (Sweden)

    Ana Paula Miguel Landim

    2016-01-01

    Full Text Available Resumo A mudança de hábito e o aumento do consumismo nas últimas décadas levaram a inovações tecnológicas e consequentemente à maior produção de bens de consumo, o que gerou um aumento na produção de embalagens. As embalagens estão presentes em diversos setores, dentre eles destacam-se as indústrias de alimentos, nas quais as embalagens têm como principal função contribuir para conservação do alimento, além de vender o produto. Diferentes materiais são utilizados na fabricação de embalagens para alimentos, sendo eles os plásticos, metais, vidro e celulose. Cada material possui suas diferentes características para conservar o produto, dentre elas as principais são propriedade de barreira a gases, aroma, luz, água, microrganismos e resistência mecânica. No entanto, apesar das diversas vantagens de sua utilização, seu uso e descarte desordenado gera um grande volume de resíduos sólidos, que estão associados ao impacto ambiental. Em preocupação a essa situação têm-se buscado meios alternativos para reduzir tais impactos podendo destacar a reutilização e reciclagem das embalagens, bem como o desenvolvimento de polímeros verdes e materiais biodegradáveis.

  16. Los alimentos modificados. ??El omn??voro desculturalizado?

    OpenAIRE

    Contreras, Jes??s; Ribas, Joan

    2012-01-01

    Los avances cient??ficos y la innovaci??n tecnol??gica en el sector agroalimentario han dado lugar a una ruptura fundamental de las relaciones que los seres humanos hab??an mantenido f??sicamente con su medio. La 'industrializaci??n', percibida en gran medida como una 'artificializaci??n' de la alimentaci??n, ha dado lugar a la idea de que cada vez sabemos menos acerca de lo que comemos, a pesar de que nunca como hoy hab??amos tenido tantos conocimientos sobre los alimentos, las enfermedades...

  17. Estimaciones de demanda de alimentos utilizando un sistema LINQUAD

    OpenAIRE

    Fernández, Santiago Javier

    2007-01-01

    Para realizar análisis de política económica relacionados con el consumo de alimentos resulta de utilidad conocer la respuesta estimada que tendrán los consumidores frente a cambios en el ingreso y en el precio de estos bienes. De esta manera se podrá tener en cuenta el cambio estimado en la dieta de los consumidores como una consecuencia adicional de la política a implementar. Aunque existen muchos modelos para estimar sistemas de demanda, Agnew (1998) demostró que una manera de obtener func...

  18. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Directory of Open Access Journals (Sweden)

    Behnam Shekarchi

    2016-02-01

    Full Text Available Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME (3.5% v/v. Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P < 0.05. So, the results showed that Artemia urmiana adults individuals that fed with 2MEtreated yeasts had the highest growth and total length. These results were confirmed with growth measurement in adult individuals of Artemia. Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  19. Feeding of the brine shrimp Artemia on yeast: effect of mechanical disturbance, animal density, water quality and light intensity

    OpenAIRE

    Coutteau, P.; Sorgeloos, P.

    1989-01-01

    Details are given of experiments conducted to determine the effects of tank culture conditions on the feeding of Artemia. Mechanical disturbance, animal density and water quality were found to affect the feeding rate of Artemia. The importance of culture conditions in maintaining a rate of food consumption which does not limit the growth of the brine shrimp is stressed.

  20. Comparative study of the assay of Artemia salina L. and the estimate of the medium lethal dose (LD50 value) in mice, to determine oral acute toxicity of plant extracts.

    Science.gov (United States)

    Logarto Parra, A; Silva Yhebra, R; Guerra Sardiñas, I; Iglesias Buela, L

    2001-09-01

    Artemia salina L. (Artemiidae), the brine shrimp larva, is an invertebrate used in the alternative test to determine toxicity of chemical and natural products. In this study the Medium Lethal Concentrations (LC50 value) of 20 plant extracts, Aloe vera (L.) Burm. F. (Aloeaceae), Artemisia absinthium L. (Asteraceae); Citrus aurantium L. (Rutaceae); Cymbopogon citratus (DC. Ex Nees) Stapf (Poaceae); Datura stramonium L. (Solanaceae); Justicia pectoralis Jacq. (Acanthaceae); Musa x paradisiaca L. (Musaceae); Ocimum basilicum L.; O. gratissimum L.; O. tenuiflorum L. (Lamiaceae); Pimenta dioica (L.) Merr. (Myrtaceae); Piper auritum Kunth (Piperaceae); Plantago major L. (Plantaginaceae); Plectranthus amboinicus (Lour.) Spreng. (Lamiaceae); Ruta graveolens L. (Rutaceae); Senna alata (L.) Roxb. (Fabaceae); Stachytarpheta jamaicensis (L.) Vahl (Verbenaceae); and Thuja occidentalis L. (Cupressaceae), were determined using Artemia salina L. (Artemiidae), with the objective of relating the results to the LD50 values reported in mice (tested at three concentrations: 10, 100, and 1000 microg/mL, for each extract). We found good correlation between the in vivo and the in vitro tests (r = 0.85 p < 0.05), and this method is a useful tool for predicting oral acute toxicity in plant extracts. PMID:11695884

  1. The influence of different rotifer and Artemia enrichment diets on growth, survival and pigmentation in turbot (Scophthalmus maximus L.) larvae

    DEFF Research Database (Denmark)

    Støttrup, Josianne; Attramadal, Y.

    1992-01-01

    An experiment was carried out on turbot larvae fed three different rotifer enrichment diets: Dry Selco, Protein Selco and ICES low-HUFA (an enrichment emulsion containing low amounts of highly unsaturated fatty acids-HUFA). Seven tanks were set up for each diet. After the rotifer stage, approxima......An experiment was carried out on turbot larvae fed three different rotifer enrichment diets: Dry Selco, Protein Selco and ICES low-HUFA (an enrichment emulsion containing low amounts of highly unsaturated fatty acids-HUFA). Seven tanks were set up for each diet. After the rotifer stage......, approximately seven days after hatching, the larvae were fed newly-hatched Artemia salina nauplii (AT-1; Brazil strain). From day 10, enriched Great Salt Lake Artemia nauplii were introduced. Each set of seven tansk was further subdivided and the larvae fed Artemia nauplii enriched with one of four enrichment...

  2. CONHECIMENTO DE CONSUMIDORES IDOSOS SOBRE ROTULAGEM DE ALIMENTOS

    Directory of Open Access Journals (Sweden)

    Claudiane Nascimento

    2014-04-01

    Full Text Available Justificativa e Objetivo: A compreensão da rotulagem nutricional pode ser um meio eficaz para auxiliar os consumidores a fazerem escolhas alimentares saudáveis. Porém, a leitura dos rótulos precisa ser melhor avaliada para que se torne mais compreensível principalmente entre os idosos. O objetivo deste estudo é avaliar o conhecimento dos consumidores idosos a respeito dos rótulos de alimentos industrializados. Métodos: estudo transversal com 96 idosos frequentadores do programa de atividades do Parque Ararigbóia, de Porto Alegre/RS. Realizou-se a pesquisa através de um questionário estruturado. Foi realizada análise descritiva dos dados. Resultados: A maioria dos entrevistados costumava ler (86% as informações contidas nos rótulos dos produtos, principalmente a data de validade (88%, mas consideram as informações de difícil leitura (82% e não tinham o hábito de seguir as orientações presentes nos rótulos (64%. Conclusão: verifica-se a necessidade de promover ações educativas que permitam o entendimento das informações para que possa contribuir na escolha de uma alimentação adequada através da rotulagem de alimentos.

  3. Toxicity of Five Phenolic Compounds to Brine Shrimp Artemia sinica(Crustacea:Artemiidae)

    Institute of Scientific and Technical Information of China (English)

    Ali Shaukat; LIU Guangxing; LI Zhengyan; XU Donghui; HUANG Yousong; CHEN Hongju

    2014-01-01

    The acute toxicity of five phenolic compounds each to 15 d old Artemia sinica was determined in this study. The brine shrimp A. sinica was hatched from the encysted dry eggs (Bohai Bay Brand) produced by Dongying Ocean Artemia Co., Ltd., China at 27℃± 1℃in pre-filtered (through pores of 0.45 µm in diameter) and autoclaved seawater (salinity 31, pH 7.5-8.0) in a cilindroconical glass beaker (2000 mL in volume) under continuous illumination (provided by a side set 20 W fluorescent lamp) with slight aeration. Ten Artemia individuals from the same batch of the hatched were cultured in 10 mL toxicant solution prepared with seawater (salinity 31, pH 7.5-8.0) at room temperature (about 20℃) to determine 24 h, 48 h and 72 h medium lethal concentration (LC50) of 5 phenolic compounds each. It was found that the toxicity of n-heptylphenol was the highest followed by nonylphenol, t-butylphenol, 2,4-dichlorophenol and bisphenol A in order. The LC50 values of the 5 compounds were calculated with regression analysis. The real concentration (in µg L-1) of 5 phenolic compounds each in toxicant solutions was measured with GC/MS analysis. Significant loss of phenolic compounds caused by either adsorption or desorption was not found. The significant difference of LC50 values was found among the five compounds 3 exposure times each. The range between the highest no-observed-effect concentration (NOEC) and 100%death causing concentration of five phenolic compounds each was determined. The toxicity in term of 24 h LC50 value of n-HP was 9.10 times higher than that of BPA, 1.71 times higher than t-BP, 1.53 times higher than 2,4-DCP and 1.36 times higher than NP, respectively.

  4. May arsenic pollution contribute to limiting Artemia franciscana invasion in southern Spain?

    Science.gov (United States)

    Sánchez, Marta I; Petit, Cathleen; Martínez-Haro, Mónica; Taggart, Mark A; Green, Andy J

    2016-01-01

    Limited information exists regarding the complex interactions between biological invasions, pollution, and climate change. Most studies indicate that pollution tends to favor invasive species. Here, we provide evidence that arsenic (As) pollution may have a role in limiting the invasion of the exotic brine shrimp Artemia franciscana. We tested As toxicity in natural populations of Artemia parthenogenetica (a native taxon) and A. franciscana from localities in southern Spain with differing degrees of As contamination. Tests were conducted both under current mean temperature conditions (25 °C), and as per a future climate scenario (i.e., an increase in mean temperature of 4 °C). Acute toxicity was estimated on the basis of the median lethal concentration (at 24 h), and chronic toxicity was evaluated by measuring Artemia survival and growth under sublethal exposures (after 26 days). At 25 °C, native A. parthenogenetica from the highly polluted Odiel and Tinto estuary was much more resistant to acute As stress (LC50-24 h, 24.67 mg L(-1)) than A. franciscana (15.78 mg L(-1)) and A. parthenogenetica from unpolluted sites (12.04 mg L(-1))-suggesting that local adaptation to polluted conditions may occur. At 29 °C, resistance of A. parthenogenetica from Odiel decreased significantly, and there were no statistical differences in sensitivity between the three species/populations, suggesting that climate change may enhance the probability of invasion. Resistance increased with developmental stage from nauplii to adults, and was extremely high in cysts which still hatched at As concentrations of up to 6400 mg L(-1). Under sublethal chronic exposure A. franciscana performed better (survival and growth) than A. parthenogenetica, and both species experienced a faster growth when exposed to As, compared with unexposed (control) individuals, probably due to the hormesis. We discuss the ecological implications of our results. PMID:26925327

  5. Physical, biochemical and functional characterization of haemoglobin from three strains of Artemia.

    Science.gov (United States)

    Sugumar, Vasudevan; Munuswamy, Natesan

    2007-02-01

    The brine shrimp, Artemia, an inhabitant of coastal and inland salterns, encounter fluctuations in the salinity which in turn influences the oxygen availability of their habitat. Hence, experiments were performed to analyze variations in haemoglobin structure and patterns of three strains of Artemia from South India and also to reflect the effect of varying oxygen levels in their habitat. Haemoglobins were purified on a DEAE-Sephadex column and haemoglobin types were analyzed by comparing their relative mobility on a non-denaturing medium. Furthermore, their molecular masses were determined by gel filtration in Sepharose column and by dodecylsulfate polyacrylamide gel electrophoresis. Results clearly reveal the presence of three distinct extracellular haemoglobins Hb I, Hb II and Hb III in Tuticorin strain while the other strains displayed only trails or the complete absence of Hb III and Hb II. Estimated molecular masses of these haemoglobins are 235,000-250,000 Da. Denaturation of the reduced and alkylated haemoglobins revealed apparently one polypeptide chain with a molecular mass of 124,000 Da. Upon denaturing gel electrophoresis of native haemoglobin Hb II, it was found that the 124,000 Da, polypeptide was cleaved specifically into two unequally-sized fragments of 50,400 and 79,800 Da. With regard to oxygen affinity, Hb III has a very high affinity for oxygen, an almost negligible Bohr effect and a good physiological adaptation to temperature changes. By combining the three haemoglobins in different proportions Artemia strains must be able to withstand diverging environmental conditions. In particular, the absence of Hb III in Puthalam and its occurrence as a faint band in Thamaraikulam could be correlated to the oxygen levels of their habitats. PMID:17185017

  6. Non-lethal heat shock protects gnotobiotic Artemia franciscana larvae against virulent Vibrios

    OpenAIRE

    Yik Sung, Y.; Van Damme, E.J.M.; Sorgeloos, P.; Bossier, P

    2007-01-01

    Brine shrimp Artemia were exposed under gnotobiotic conditions to a non-lethal heat shock (NLHS) from 28 to 32, 37 and 40°C. Different recovery periods (2, 6, 12 and 24 h) and different heat-exposure times (15, 30, 45 and 60 min) were tested. After these NLHS, Artemia was subsequently challenged with Vibrio. Challenge tests were performed in stressed and unstressed nauplii at concentrations of 107 cells ml-1 of pathogenic bacteria, Vibrio campbellii and Vibrio proteolyticus. A NLHS with an op...

  7. Live preys in shrimp culture: nutritional and sanitary considerations on the use of Artemia in New Caledonia

    OpenAIRE

    Pham, Dominique; Wabete, Nelly; Maillez, Jean-rene; Broutoi, Francis; Chim, Liet

    2009-01-01

    In aquaculture, Artemia nauplii are commonly used as live prey; and represent 40 % of the total aquaculture feed demands in the early stages. However, the production of Brine shrimp is very unstable from one year to another and in the late 90’s, only 20 % of the world aquaculture need was covered. An insufficient offer leads to higher prices of the Artemia cysts and consequently, the price of shrimp juveniles from hatchery. In New Caledonia, marine aquaculture is mainly based on the blue s...

  8. Toxicidad de nauplios de Artemia franciscana a dos piretroides de uso comercial

    OpenAIRE

    Arencibia Carballo, G.; Tizol Correa, R. A.; Rodríguez, R. O.

    2010-01-01

    Se presentan los resultados de la determinación de la LC50 para 24 h de exposición mediante una prueba de toxicidad aguda en Artemia franciscana. Se caracterizó una cepa, la cual según los resultados se evaluó de primera calidad y se aplicaron criterios importantes para el empleo de sus nauplios en dichas pruebas. Se determinó la toxicidad de los insecticidas piretroides, cipermetrina y permetrina reportándose los valores de 4,72 y 26,7 μg/mL de CL50 para 24 h respectivame...

  9. Biomass production of Artemia in air-water-lift raceway system

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Vijayaraghavan, S.; Krishnakumari, L.

    is in great demand as a source of high quality food in fish and crustacean fanning (Persoone and Sorgeloos, 1982). Recent studies have proved that adult Artemia have higher nutritive value, contain 60% protein and rich in all essential amino and fatty acids... sources for Arternia and this can 164 ROYANetal be converted to nutritive animal protein. It was found that the shrimp Met)ipenaeus monoceros was able to,convert maximum of the food into body tissue "Vhen..fed aciult Artemiil inpelleted form (Sumi...

  10. The primary structure of elongation factor EF-1 alpha from the brine shrimp Artemia.

    OpenAIRE

    Hemert, F.J. van; Amons, R; Pluijms, W J; van Ormondt, H; Möller, W.

    1984-01-01

    cDNA as well as amino acid sequencing has revealed the complete primary structure of elongation factor EF-1 alpha from the brine shrimp Artemia. A comparison with the published sequences of bacterial EF-Tu, mitochondrial EF-Tu and chloroplastic EF-Tu shows that distinct areas of these polypeptide chains are conserved in evolution. The evolutionary distance between prokaryotic and eukaryotic types of EF-Tu is larger than among bacterial and organellar EF- Tus . A number of regions present in b...

  11. The brine shrimp ( Artemia parthenogenetica) as encapsulation organism for prophylactic chemotherapy of fish and prawn

    Science.gov (United States)

    Cao, Ji-Xiang; Bian, Bo-Zhong; Li, Ming-Ren

    1996-06-01

    Brine shrimp ( Artemia parthenogenetica) which had ingested three water-insoluble antibacterial drugs i.e. sulfadiazine(SD), oxytetracycline (OTC) and erythromycin estolate (ERY-Es) were fed to Tilapia and Mysis III of Penaeus orientalis K. The drug contents in the predators were then determined. After administration of drugs to Tilapia and Mysis III, through the bio-encapsulation of the brine shrimp, efficacious therapeutical concentration of OTC and ERY-Es (but not SD) in the predators could be reached and maintained for more than 8 hours.

  12. Quaternary structure of Artemia haemoglobin II: analysis of T and C polymer alignment and interpolymer interface

    Directory of Open Access Journals (Sweden)

    Rawle Vincent L

    2007-04-01

    Full Text Available Abstract Background The brine shrimp Artemia expresses four different types of haemoglobin subunits namely C1, C2, T1 and T2. Two of these four subunits dimerize in different combinations to produce the three isoforms of the heterodimeric Artemia haemoglobin: HbI (C1 and C2, HbII (C1 and T2 and HbIII (T1 and T2. Previous biochemical, biophysical and computational analyses demonstrate that the T and C polymers are rings of nine concatenated globin domains, which are covalently joined by interdomain linkers. Two such rings stacked coaxially give the functional molecule. This research aimed to construct a quaternary structural model of Artemia HbII that shows the interpolymer interface and domain-domain alignment, using the MS3D (mass spectrometry for three dimensional analysis approach. This involved introducing chemical crosslinks between the two polymers, cleaving with trypsin and analyzing the resulting products by mass spectrometry. This was followed by computational analysis of the mass spectrometry data using the program SearchXlinks to identify putatively crosslinked peptides. Results Six putative EGS (ethylene glycol bis [succinimidylsuccinate] crosslinked tryptic peptides were identified. All of them support a model in which the EF helices of all domains are in contact along the interpolymer surface, and Domain 1 of the T-polymer aligns with Domain 1 of the C-polymer. Any two adjacent interpolymer domain pairs contact through the early Helix H and early Helix A. The orientation of domains is different from the subunit proposed model proposed previously by this group. Crosslinking with GMBS (N- [γ-maleimidobutyryloxy]succinimide ester was also performed, and the results show good agreement with this model. Conclusion The interpolymer EF-contact allows the hydrophobic E and F helices to be buried in the interface and therefore allow the complex to solubilize readily to facilitate efficient oxygen transport. Furthermore the EF-contact is a

  13. Alimentos disfrazados. De la metáfora al fraude Alimentos disfrazados. De la metáfora al fraude

    Directory of Open Access Journals (Sweden)

    Rafael Díaz Maderuelo

    2006-10-01

    Full Text Available Every culinary elaboration supposes a transformation of meats. In several occasions the domestic or professional culinary ability has permitted to mislead foods to represent some aspects of reality. Since the rise of the World Food System of Industrial Production, the traditional proceedings of misleading foods have been moved from the kitchen to the alimentary industries and, frequently, the have been converted in technological ways of adulteration and food-fraud, until such point that —at present— expressions as “to know what we eat” are based only in the confidence that the consumer deposits in certain marks and labels.Toda elaboración culinaria supone una transformación de los alimentos. En ocasiones la habilidad técnica de cocineros, domésticos o profesionales, ha permitido disfrazarlos para representar ciertos aspectos de la realidad. Desde la implantación del sistema alimentario mundial de producción industrial, las formas de disfrazar los alimentos de han trasladado de la cocina a las industrias y, con frecuencia, se han convertido en técnicas de adulteración y fraude, hasta tal punto que en la actualidad expresiones como “saber lo que comemos” se basan solamente en la confianza que el consumidor deposita en ciertos legitimadores como las marcas y las etiquetas.

  14. Alimentos probióticos: expresión génica de Bifidobacterium animalis subps. lactis en leche fermentada

    OpenAIRE

    Fernández Fernández, David

    2014-01-01

    El término probiótico define aquellos microorganismos vivos que al ser ingeridos en cantidades adecuadas producen un efecto beneficioso sobre la salud del hospedador. Los probióticos se incluyen en alimentos, especialmente en productos lácteos fermentados, siendo el yogur el vehículo más utilizado y disponible el mercado. Para consumo humano las bacterias probióticas más habituales pertenecen a los géneros Lactobacillus y Bifidobacterium y en éste último la especie más habitual es Bifidobact...

  15. Evaluation of the toxicity of the methanolic extract of Caesalpinia Pyramidalis, subjected to gamma radiation, compared to saline artemias; Avaliacao da toxicidade do extrato metanolico de Caesalpinia Pyramidalis, submetido a radiacao gama, frente a artemias salinas

    Energy Technology Data Exchange (ETDEWEB)

    Pessoa, Juanna G.; Santos, Mariana L.O.; Costa, Michelle C.A.; Siqueira, Williams N.; Silva, Luanna R.S.; Cabral, Daniela L.V.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: marianasantos_ufpe@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil)

    2013-07-01

    The present study aimed to investigate the possible effect of irradiation of 60 Co in methanol extract of Caesalpinia pyramidalis (catingueira) with function of reducing the toxicity of the extract at concentrations of 1000, 500, 250 and 125 ppm irradiating them with doses of 5 kGy 7 kGy and 10 kGy, using lethality tests with saline Artemias.

  16. Alimentos e alimentação no Portugal Quinhentista

    OpenAIRE

    Fernandes, Isabel Maria

    2002-01-01

    Neste texto traça-se uma panorâmica sobre os alimentos e alimentação no Portugal Quinhentista, mas sem referência à doçaria. Analisa-se o território e o seu uso para fins alimentares e qual a base da alimentação no séc. XVI: cereais e seus derivados: farinha e pão; carne de criação, de caça e seus derivados; peixe e marisco; vegetais (legumes e leguminosas); cheiros; adubos e condimentos; temperos e fruta. Existe um capítulo dedicado aos fazedores e vendedores: da matéria-prima ao consumo, pa...

  17. Assessment of endemic microalgae as potential food for Artemia franciscana culture

    Directory of Open Access Journals (Sweden)

    Juan M Pacheco-Vega

    2015-03-01

    Full Text Available In this study, five microalgal strains were isolated from Bahía de La Paz, Baja California Sur, Mexico and identified as Grammatophora sp., Navícula sp., Rhabdonema sp., Schizochytrium sp., and Nitzschia sp., and their evaluation as potential food for Artemia franciscana. The isolated strains were cultured outdoors and harvested after four days. Chaetoceros muelleri was cultured under laboratory conditions and used as control. The protein, lipid, and carbohydrate composition and the fatty acid profiles of the strains were determined by gas chromatography. To assess the effect of microalgal strains on A. franciscana, decapsulated cysts were cultured at outdoor conditions in 15 L containers. The experiment was conducted for twelve days. Samples from the five different feeding treatments were taken at the beginning and end of the experiment to assess number, size, and weight of Artemia larvae. Treatment with Rhabdonema sp. showed larvae with a lower percentage of polyunsaturated fatty acids (PUFAs while Grammatophora sp. showed those with the greatest PUFA proportion, even more than those fed Chaetoceros muelleri (control. Larvae consuming Schizochytrium sp. had no docosahexanoic (DHA nor eicosapentaenoic (EPA fatty acid content. Growth and survival of A. franciscana did not show significant differences among feed treatments, except when it was fed Nitzschia sp., showing lower survival and dry weight. Treatment based on Schizochytrium sp. and Rhabdonema sp. had a greater A. franciscana size but reduced dry weight; additional tests including two or more algal species for every treatment should be carried out to determine the best yield.

  18. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Ana D’ors

    2014-08-01

    Full Text Available Objective: To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods: Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results: Biotoxin equivalent values obtained by immunodetection were (2.12±0.10, (8.60±1.30 and (4.32±1.67 pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions: These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  19. A gene catalogue for post-diapause development of an anhydrobiotic arthropod Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Yu Jun

    2009-01-01

    Full Text Available Abstract Background Diapause is a reversible state of developmental suspension and found among diverse taxa, from plants to animals, including marsupials and some other mammals. Although previous work has accumulated ample data, the molecular mechanism underlying diapause and reactivation from it remain elusive. Results Using Artemia franciscana, a model organism to study the development of post-diapause embryos in Arthropod, we sequenced random clones up to a total of 28,039 ESTs from four cDNA libraries made from dehydrated cysts and three time points after rehydration/reactivation, which were assembled into 8,018 unigene clusters. We identified 324 differentially-expressed genes (DEGs, P Conclusion We found that the first 5-hour period after rehydration is most important for embryonic reactivation of Artemia. As the total number of expressed genes increases significantly, the majority of DEGs were also identified in this period, including a group of water-deficient-induced genes. A group of genes with similar functions have been described in plant seeds; for instance, one of the novel LEA members shares ~70% amino-acid identity with an Arabidopsis EM (embryonic abundant protein, the closest animal relative to plant LEA families identified thus far. Our findings also suggested that not only nutrition, but also mRNAs are produced and stored during cyst formation to support rapid development after reactivation.

  20. Diffusive properties of water in Artemia cysts as determined from quasi-elastic neutron scattering spectra

    International Nuclear Information System (INIS)

    Results have been obtained on the quasi-elastic spectra of neutrons scattered from pure water, 20% agarose gel (hydration four grams H2O per gram of dry solid) and cysts of the brine shrimp Artemia for hydrations between 0.10 and 1.2 grams H2O per gram of dry solids. The spectra were interpreted using a two-component model that included contributions from the covalently bonded protons and the hydration water, and a mobile water fraction. The mobile fraction was described by a jump-diffusion correlation function for the translation motion and a simple diffusive orientational correlation function. The results for the line widths γ(Q2) for pure water were in good agreement with previous measurements. The agarose results were consistent with NMR measurements that show a slightly reduced translational diffusion for the mobile water fraction. The Artemia results show that the translational diffusion coefficient of the mobile water fraction was greatly reduced from that of pure water. The line width was determined mainly by the rotational motion, which was also substantially reduced from the pure water value as determined from dielectric relaxation studies. The translational and rotational diffusion parameters were consistent with the NMR measurements of diffusion and relaxation. Values for the hydration fraction and the mean square thermal displacement 2> as determined from the Q-dependence of line areas were also obtained

  1. Cloning and Expression Analysis of p26 Gene in Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Lijuan JIANG; Lin HOU; Xiangyang ZOU; Ruifeng ZHANG; Jiaqing WANG; Wenjing SUN; Xintao ZHAO; Jialu AN

    2007-01-01

    The protein p26 is a small heat shock protein that functions as a molecular chaperone to protect embryos by preventing irreversible protein damage during embryonic development. A 542 bp fragment of the p26 gene was cloned and sequenced. The fragment encoded 174 amino acid residues and the amino acid sequence contained the α-crystallin domain. Phylogenetic analysis showed that eight Artemia populations were divided into four major groups. Artemia sinica (YC) belonged to the East Asia bisexual group. Expression of the p26 gene at different developmental stages of A. sinica was quantified using real-time quantitative polymerase chain reaction followed by cloning and sequencing. The relationship between the quantity of p26 gene expression and embryonic development was analyzed. The results indicated that massive amounts of p26 were expressed during the development of A. sinica. At the developmental stage of 0 h, A. sinica expressed the highest level of p26. As development proceeded, expression levels of the p26 gene reduced significantly. There was a small quantity of p26 gene expression at the developmental stages of 16 h and 24 h. We concluded that p26 might be involved in protecting the embryo from physiological stress during embryonic development.

  2. Habitat diversity and adaptation to environmental stress in encysted embryos of the crustacean Artemia

    Indian Academy of Sciences (India)

    Joshua A Tanguay; Reno C Reyes; James S Clegg

    2004-12-01

    Encysted embryos (cysts) of the brine shrimp, Artemia, provide excellent opportunities for the study of biochemical and biophysical adaptation to extremes of environmental stress in animals. Among other virtues, this organism is found in a wide variety of hypersaline habitats, ranging from deserts, to tropics, to mountains. One adaptation implicated in the ecological success of Artemia is p26, a small heat shock protein that previous evidence indicates plays the role of a molecular chaperone in these embryos. We add to that evidence here. We summarize recently published work on thermal tolerance and stress protein levels in embryos from the San Francisco Bay (SFB) of California inoculated into experimental ponds in southern Vietnam where water temperatures are much higher. New results on the relative contents of three stress proteins (hsp70, artemin and p26) will be presented along with data on cysts of A. tibetiana collected from the high plateau of Tibet about 4.5 km above sea level. Unpublished results on the stress protein artemin are discussed briefly in the context of this paper, and its potential role as an RNA chaperone. Interestingly, we show that the substantial tolerance of A. franciscana embryos to ultraviolet (UV) light does not seem to result from intracellular biochemistry but, rather, from their surrounding thick shell, a biophysical adaptation of considerable importance since these embryos receive heavy doses of UV in nature.

  3. Peningkatan Kuantitas dan Kualitas Kista Artemia franciscana setelah Pemberian Silase Ikan

    Directory of Open Access Journals (Sweden)

    ENDAH BUDI SULISTYOWATI

    2007-11-01

    Full Text Available Artemia is one of live feed needed in aquaculture as fishes and crustacean. Commercially, Artemia usually sold in dry cysts which can kept for years. The aim of this research were to know increasing quantity and quality A. franciscana cysts after exposing various concentration of fish silage as artificial food and to know optimal concentration of fish silage that can increase quantity and quality A. franciscana cysts. This research was done in Laboratory of Live Feed BBPBAP Jepara Central Java. This research was conducted by 5 treatments. Treatments were grouped based on amount of concentration given, i.e: control (coconut cake with concentrate 10 g/m3, fish silage concentrate 10, 20, 30, and 40 g/m3. Parameter investigated were number of cysts produced by individual female A. franciscana, diameter of A. franciscana cysts, hatching percentage, and hatching rate of A. franciscana cysts. Data were analyzed using ANOVA and continued using Tukeys test at significant level 5%. The result of this research showed that exposing fish silage can increase quantity and quality A. franciscana cysts. They were increase number of cysts production by individual females, decrease cysts diameter, increase hatching percentage and hatching rate. Optimal concentration of fish silage on increase quantity and quality of A. franciscana cysts was 20 g/m3.

  4. Intentional introduction of Artemia sinica (Anostraca) in the high-altitude Tibetan lake Dangxiong Co: the new population and consequences for the environment and for humans

    Science.gov (United States)

    Jia, Qinxian; Anufriieva, Elena; Liu, Xifang; Kong, Fanjing; Shadrin, Nickolai

    2015-11-01

    The imbalance between supply and demand of Artemia cysts in China and around the world is increasing now. Salt lakes in Tibet may contribute to the solution of the problem. In Northern Tibet there are 26 saline lakes whose salinity and temperature may support Artemia survival at an altitude of 4 000-5 100 m. We found Artemia in 15 of these lakes. The saline lakes with Artemia populations mainly belong to the shallow basin lakes, and the majority of these lakes are small in area. The total area of lakes without Artemia is more than 1 000 km2. Lake Dangxiong Co (Co means lake in Tibet) was chosen for the intentional introduction of Artemia sinica. In 2004, 850 g of A. sinica cysts, originating from Qinghai, were introduced in the lake. Surveys in 2006-2014 showed that the average abundance of Artemia adults in the lake gradually increased from 20 ind./m3 in 2006 to 1950 ind./m3 in 2013. We assume that two subpopulations of A. sinica, separated by depth, may exist in the lake. The new Artemia population caused an increase in the number of species of phytoplankton and heterotrophic protozoa with a decrease of their total abundance. Water transparency also increased. Dominance in phytoplankton passed from cyanobacteria to diatoms. Changes occurred not only in the lake ecosystem; the number of water birds using the lakes also dramatically increased. Preliminary calculations showed that is it possible to harvest at least about 150 t cysts per year from the lake as well as 3.2 thousand tons of frozen or 350 t of dried biomass of adult Artemia.

  5. Actualización en legislación de alimentos para celíacos

    OpenAIRE

    Pellicer, K.; Huber, Bárbara; Benítez, F.; Bigeon, G.; Barbero, R.; Salum, L.; Copes, Julio

    2014-01-01

    Se realizó un análisis de la normativa sanitaria sobre alimentos para celíacos y su impacto en la población celíaca, mediante la investigación y comparación de las normativas sanitarias argentina e internacional sobre alimentos libres de gluten y el análisis de las consultas realizadas al listado oficial argentino de productos libres de gluten. La norma CODEX STAN 118/1979 y la normativa de la Comunidad Europea reconocen como alimentos “exentos de gluten” a los que contienen hasta 20 mg/kg y ...

  6. Estudio microbiológico de los alimentos elaborados en comedores colectivos de alto riesgo

    OpenAIRE

    Pérez-Silva García Mª del Carmen; Belmonte Cortés Susana; Martínez Corral Javier

    1998-01-01

    FUNDAMENTO: Valorar los resultados del análisis microbiológico de los alimentos preparados en comedores colectivos de alto riesgo, con el fin de conocer el grado de contaminación de los alimentos, analizar las causas de dicha contaminación y mejorar la situación sanitaria de estos establecimientos. MÉTODOS: Estudio observacional descriptivo con los datos obtenidos de la inspección sanitaria en 44 comedores colectivos de alto riesgo, que incluyó el análisis microbiológico de 90 alimentos, así ...

  7. EFEITOS DO PROCESSAMENTO INDUSTRIAL DE ALIMENTOS SOBRE A ESTABILIDADE DE VITAMINAS

    OpenAIRE

    L. F. M. CORREIA; A. S. FARAONI; H.M. PINHEIRO-SANT’ANA

    2008-01-01

    O processamento industrial de alimentos promove o prolongamento da sua vida útil, tornando-os mais atraentes ao paladar; entretanto, induz mudanças e interações entre os constituintes de alimentos. Assim, o processamento pode ter um impacto positivo (destruição de inibidores ou formação de complexos desejáveis entre os componentes dos alimentos e os íons metálicos) o...

  8. Caracterización de la conservación de alimentos en diferentes instalaciones.

    Directory of Open Access Journals (Sweden)

    Tamara Díaz Lorenzo

    2005-01-01

    Full Text Available La conservación es uno de los elementos que influyen en la calidad sanitaria de los alimentos a lo largo de la cadena alimentaria. Las enfermedades transmitidas por los alimentos se presentan con alta incidencia en nuestro país y constituyen un problema de salud y la conservación adecuada de los alimentos una de las medidas de prevención más importante para evitar su aparición, con el objetivo de caracterizar el comportamiento de la conservación de los alimentos en diferentes instalaciones de nuestro país(hogares, hospitales, círculos infantiles, hoteles realizamos un estudio descriptivo retrospectivo durante el período de enero a diciembre el 2004 a través de una encuesta confeccionada para el estudio de las siguientes variables: conservación, educación sanitaria, limpieza y desinfección, condiciones sanitarias básicas. La conservación de los alimentos perecederos se comportó de manera inadecuada en más de la mitad de los hogares no así en los hospitales ni en los Círculos infantiles estudiados donde en su totalidad era inadecuada. En los hoteles esta fue de manera adecuada en la tercera parte de ellos. Los alimentos no perecederos se conservaban correctamente en la totalidad de los hoteles, hogares, círculos infantiles y en la mitad de los hospitales. El programa de limpieza y desinfección de frutas y hortalizas se aplicaba sólo en la mitad de los hoteles. La educación sanitaria de los manipuladores de alimentos en estas instituciones en relación a los factores que son necesarios para la conservación de los alimentos fue insuficiente en su totalidad. La presencia de vectores y la protección de los alimentos contra estos fue una deficiencia altamente observada. Consideramos que se hace necesario dentro del programa de inocuidad de los alimentos constituir un equipo multidisciplinario que desde la asistencia primaria realice acciones para prevenir las enfermedades transmitidas por los alimentos producidas por

  9. Transición vítrea en alimentos congelados

    OpenAIRE

    Orrego Alzate, Carlos Eduardo

    2000-01-01

    En la congelación de alimentos la transición vitrea (TV) asociada con la fase crioconcentrada no congelada (FCNC) ha sido objeto de numerosos estudios en la última década, desde que Levine y Slade (1998) relacionaron la cinética de los polímeros con los procesos fisicoquímicos de los alimentos. Las pérdidas de calidad de los alimentos congelados, debido a reacciones enzimáticas o recristalización, pueden reducirse sustancialmente cuándo la FCNC está en estado vitreo. Es por ello útil conoc...

  10. Sudden weaning of angel fish pterophyllum scalare (Lichtenstein) (Pisces; Cichlidae) larvae from brine shrimp (Artemia sp) nauplii to formulated larval feed

    OpenAIRE

    Herath, Sandamali Sakunthala; Atapaththu, Kerthi Sri Senarathna

    2013-01-01

    This study investigated the effects of sudden weaning of angel fish larvae (Pteraphylum scalari) from Artemia nauplii to commercial larval feed. Four days post hatch (DPH) larvae were reared in four different weaning protocols (TR1-TR4) with triplicates in a complete randomize design. Larvae in TR1 and TR4 were exclusively fed Artemia nauplii and dry feed respectively. In TR2 and TR3, larvae were initially fed Artemia nauplii and suddenly wean to formulated feed on 14 DPH and 7 DPH respective...

  11. Avances en biotecnología de alimentos

    Directory of Open Access Journals (Sweden)

    Ramón, Daniel

    2014-08-01

    . De hecho, la biotecnología de los alimentos es la más antigua de todas las biotecnologías. Recientemente, las técnicas de ADN recombinante se han aplicado en la tecnología de alimentos creando los llamados alimentos modificados genéticamente o alimentos transgénicos. Ejemplos de este tipo de productos son unas patatas transgénicas que funcionan como una vacuna oral contra el cólera, unas levaduras vínicas transgénicas capaces de producir vino con aroma más afrutado o vacas u ovejas que producen leche con altos niveles de proteínas terapéuticas. En cualquier caso, la fecha de partida para el futuro de la biotecnología de los alimentos fue la publicación en 2001 del primer borrador del genoma humano: este descubrimiento abrió la puerta a la búsqueda de genes de nuestro genoma que se activan o desactivan en respuesta a la ingesta de nutrientes específicos. No solo eso, hoy en día también es posible determinar las diferencias genéticas entre individuos que producen diferentes respuestas nutricionales. Además cada día se publican en las bases de datos varios nuevos genomas de animales, plantas o microorganismos que son componentes habituales de nuestra dieta. Algunos casos sobresalientes son los genomas del arroz, la levadura del pan, la bacteria probiótica Bifidobacterium bifidum o patógenos responsables de la intoxicación alimentaria, como Escherichia coli. Estos datos proporcionan información sobre genes clave, con la que es posible diseñar estrategias de mejora por genética clásica o ingeniería clásica, delimitar los mecanismos de defensa para combatir la patogenicidad o definir nuevas funciones fisiológicas. Su aplicación a la alimentación y la nutrición está mucho más próxima de lo que muchos imaginan.

  12. Grado de conocimiento y actitudes de los consumidores espanoles hacia los alimentos modificados geneticamente

    OpenAIRE

    Noomene, Rouhia; Gil, Jose Maria

    2006-01-01

    Los alimentos transgenicos han sido objecto de un consuderabke debate en los ultimos anos, manteniendose posturas radicalmente opuestas. A pesar de que la aceptacion entre los productores es notable, los consumidores, sobre todo en Europa, se han mostrado tradicionalmente reacios a este tipo de productos. Una vez que se ha aprobado la regulacion sobre el etiquetado de estos alimentos y, por tanto, que el consumidor va a disponer de cierta informacion sobre la naturaleza de los productos que v...

  13. Alimentos funcionais no manejo da diabetes mellitus = Functional foods in the management of diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Zaparolli, Marília Rizzon

    2013-01-01

    Conclusão: O conhecimento de alimentos funcionais bem como seu consumo é pequeno por parte de pacientes diabéticos. Há a necessidade de uma maior intervenção por parte dos profissionais da Nutrição na orientação do consumo desses alimentos na dieta habitual dos diabéticos, visando promover um melhor controle da diabetes mellitus

  14. Estudio microbiológico de los alimentos elaborados en comedores colectivos de alto riesgo

    Directory of Open Access Journals (Sweden)

    Pérez-Silva García Mª del Carmen

    1998-01-01

    Full Text Available FUNDAMENTO: Valorar los resultados del análisis microbiológico de los alimentos preparados en comedores colectivos de alto riesgo, con el fin de conocer el grado de contaminación de los alimentos, analizar las causas de dicha contaminación y mejorar la situación sanitaria de estos establecimientos. MÉTODOS: Estudio observacional descriptivo con los datos obtenidos de la inspección sanitaria en 44 comedores colectivos de alto riesgo, que incluyó el análisis microbiológico de 90 alimentos, así como la inspección sanitaria de los establecimientos. RESULTADOS: En los colegios los microorganismos mesófilos fueron los contaminantes más frecuentes; en las guarderías y residencias de ancianos predominaron los indicadores de higiene deficiente en la manipulación de alimentos. Los microorganismos mesófilos se encontraron durante los meses fríos en mayor proporción que durante los meses cálidos. Los indicadores de higiene deficiente aparecieron generalmente en los alimentos preparados en establecimientos en los que se observaron deficiencias. Los microorganismos psicrótrofos no se encontraron en ninguno de los alimentos recogidos en guarderías y sí en colegios y residencias de ancianos. CONCLUSIONES: Este estudio indica qué problemas predominan en cada tipo de comedor colectivo de alto riesgo. Los mesófilos aparecen en los alimentos elaborados en cocinas de tamaño grande, los indicadores de higiene deficiente se encontraron asociados a una manipulación de alimentos por personal no profesional y a establecimientos con deficiencias, y los psicrótrofos se detectaron en aquellos establecimientos que guardan la comida sobrante. Se sugieren recomendaciones para la eliminación de los problemas detectados.

  15. La selección de los alimentos: una práctica compleja.

    OpenAIRE

    Luis Fernando Vélez; Beatriz Gracia

    2009-01-01

    Seleccionar los alimentos es una conducta compleja, determinada por aspectos estructurales que establecen la oferta y el acceso a los alimentos, fenómenos fisiológicos y elementos culturales que incluyen tradiciones, normas sociales y la presencia de los medios masivos de comunicación, entre otros. El individuo tiene intenciones de consumir productos alimenticios de acuerdo con su gusto por ciertos sabores y a las necesidades de algunos nutrientes. La preferencia por sabores, es en esencia ap...

  16. La Irradiación de alimentos: Lo que usted debe saber

    Science.gov (United States)

    La irradiaciÃÆ'ƒÂ³n de alimentos (la aplicaciÃÆ'Æ’ ³n de radiaciÃÆ'ƒÂ³n ionizante a los alimentos ...

  17. Cytotoxicity of antimalarial plant extracts from Kenyan biodiversity to the brine shrimp, Artemia salina L. (Artemiidae

    Directory of Open Access Journals (Sweden)

    Joseph Mwanzia Nguta

    2012-07-01

    Full Text Available Artemia salina (Artemiidae, the brine shrimp larva, is an invertebrate used in the alternative test to determine toxicity of chemicals and natural products. In this study the medium lethal concentration fifty (LC50 values of 45 antimalarial plant extracts and positive controls, cyclophosphamide and etoposide were determined using Artemia salina (Artemiidae. Out of the 45 organic extracts screened for activity against Artemia salina larvae, 23 (51% of the crude extracts demonstrated activity at or below 100 μg/mL, and were categorized as having strong cytotoxic activity, 18 (40% of the crude extracts had LC50 values between 100 μg/mL and 500 μg/mL, and were categorized as having moderate cytotoxicity, 2 (4.5% of the crude extracts had LC50 values between 500 μg/mL and 1000 μg/mL, and were considered to have weak cytotoxic activity, while 2 (4.5% of the crude extracts had LC50 values greater than 1000 μg/mL and were considered to be non toxic. Approximately 20% (9 of the aqueous extracts demonstrated activity at or below 100 g/mL and were considered to have strong cytotoxic activity, 40% (18 of the screened aqueous crude extracts had LC50 values between 100 μg/mL and 500 μg/mL and were considered to be moderately cytotoxic, 16% (7 of the crude extracts had LC50 values between 500 μg/mL and 1000 μg/mL and were considered to have weak cytotoxic activity while 24% (11 of the aqueous extracts had LC50 values greater than 1000μg/mL and were categorized as non toxic The positive controls, cyclophosphamide and etoposide exhibited strong cytotoxicity with LC50 values of 95 μg/mL and 6 μg/mL respectively in a 24 hour lethality study, validating their use as anticancer agents. In the current study, 95.5% of all the screened organic extracts and 76% of the investigated aqueous extracts demonstrated LC50 values <1000 g/mL, indicating that these plants could not make safe anti-malarial treatments. This calls for dose adjustment amongst the

  18. Consumo de alimentos fora do domicílio no Brasil Consumo de alimentos fuera del domicilio en Brasil Consumption of foods away from home in Brazil

    Directory of Open Access Journals (Sweden)

    Rosangela Alves Pereira

    2013-02-01

    Full Text Available OBJETIVO: Analisar características do consumo de alimentos fora do domicílio no Brasil. MÉTODOS: Foram analisados dados do Inquérito Nacional de Alimentação, conduzido com 34.003 indivíduos acima de dez anos de idade em 24% dos domicílios participantes da Pesquisa de Orçamentos Familiares em 2008-2009. O consumo de alimentos e bebidas foi coletado por meio de registros dos alimentos consumidos, tipo de preparação, quantidade, horário e fonte do alimento (dentro ou fora de casa. A frequência de indivíduos que consumiu alimentos fora do domicílio foi calculada segundo faixas de idade, sexo, faixas de renda, área de localização do domicílio, tamanho da família, presença de criança no domicílio e idade do chefe do domicílio no Brasil e em cada região brasileira. Para as análises, considerou-se o peso amostral específico do inquérito e incorporou-se o efeito do desenho amostral. RESULTADOS: O consumo de alimentos fora do domicílio no Brasil foi reportado por 40% dos entrevistados, variando de 13% entre os idosos da região Sul a 51% entre os adolescentes da região Sudeste. Esse percentual diminuiu com a idade e aumentou com a renda em todas as regiões brasileiras; foi maior entre os homens e na área urbana. Os grupos de alimentos com maior percentual de consumo fora de casa foram bebidas alcoólicas, salgadinhos fritos e assados, pizza, refrigerantes e sanduíches. CONCLUSÕES: A alimentação fora de casa apresenta predominância de alimentos de alto conteúdo energético e pobre conteúdo nutricional, indicando que o consumo de alimentos fora do domicílio deve ser considerado nas ações de saúde pública voltadas para a melhoria da alimentação dos brasileiros.OBJETIVO: Analizar características del consumo de alimentos fuera del domicilio. MÉTODOS: se analizaron datos de la Pesquisa Nacional de Alimentación, conducido con 34.003 individuos con edades mayores a diez años en 24% de los domicilios participantes

  19. Some observations on the growth and cyst production characteristics of the brine shrimp Artemia sp. (Gujarat strain) in pond culture and its potential for import substitution

    OpenAIRE

    Gopalakrishnan, P.; Krishna Raju, V.; Thaker, S R

    1989-01-01

    Experimental culture of the brine shrimp Artemia sp. (Gujarat strain) and production of cyst is discussed. The qualitative and quantitative aspects of the cyst and its economic potential for import substitution are highlighted.

  20. Mass selection for small-sized cysts in Artemia franciscana produced in Vinh Chau salt ponds, Vietnam

    OpenAIRE

    Van, N.T.H.; Van Hoa, N.; Bossier, P.; Sorgeloos, P; Van Stappen, G.

    2014-01-01

    Unidirectional mass truncation selection for small-sized cysts was carried out on brine shrimp (Artemia franciscana Kellogg 1906), Vinh Chau strain, Vietnam, through cyst sieving and then culturing the selected individuals (

  1. Growth, longevity, and reproduction capacity of the marine crustacean Mysidopsis bahia Molenock fed on brine shrimp Artemia produced in two salt farms in Kenya.

    OpenAIRE

    Rasowo, J.

    1986-01-01

    The standard culture test using the mysid Mysidopsis bahia (M.) juveniles as predators was used to determine the nutritional quality possessed by the first batch of brine shrimp Artemia cysts collected one month after innoculation of the brine shrimp in two salt farms north of Malindi Town, Kenya. Good growth and survival was observed in all the cases. There was no significant difference in survival and growth resulting from Artemia collected from the different ecological zones. Fatty acids p...

  2. The ARC-test: a standardized short-term routine toxicity test with Artemia nauplii: methodology and evaluation

    OpenAIRE

    Vanhaecke, P.; Persoone, G.

    1984-01-01

    Considering the need for reliable standardized routine toxicity tests for the marine environment, a short-term bioassay with Artemia nauplii has been developed for routine testing. The major reason for the selection of brine shrimp as test species is the continuous availability of Artemia under the form of dry cysts from which the larvae are hatched very easily. This unique advantage solves one of the major problems of aquatic ecotoxicological tests, namely stock recruitment and/or culturing;...

  3. Uji Sitotoksik Fraksi Etilasetat Daun Bangun-Bangun (Plectranthus amboinicus (Lour.) terhadap Larva Artemia salina Leach dengan Metode Brine Shrimp Lethality Test (BSLT)

    OpenAIRE

    Pardede, E. Roslina

    2016-01-01

    Background: Bangun-Bangun leaves (Plectranthus amboinicus (Lour.) Spreng is one of the plants that have the potential to be developed as a cancer chemopreventive agent. The Purpose: The aim of the study were to find out the cytotoxic effect of ethylacetate fraction bangun-bangun leaves (FEDBB) on Artemia salina Leach larvae. Methods: This experimental study using 800 Artemia salina Leach larvae were divided into one control group negative 1 and 5 positive control group concentration10 μ...

  4. Efecto del alimento sobre variables productivas de dos especies de Cladóceros bajo condiciones de laboratorio

    Directory of Open Access Journals (Sweden)

    Angélica Otero P.

    2013-10-01

    Full Text Available Objetivo. Evaluar los efectos de diferentes tipos de alimentos sobre la productividad de Diaphanosoma sp., y Alona sp bajo condiciones de laboratorio. Materiales y métodos. Juveniles de Diaphanosoma sp., y Alona sp., fueron sembrados en acuarios de 20 L a una densidad de 6 org L-1 y mantenidos con aireación constante y fotoperíodo 12:12 (luz : oscuridad. Se alimentaron con Saccharomyces cereviseae y Chlorella vulgaris a concentración de 4 x 105 Cel/ml cada uno, en tres combinaciones: 1. C. vulgaris, 2. S. cereviseae, 3. C. vulgaris + S. cereviseae en proporciones iguales; de cada tratamiento se realizaron 3 réplicas. Con el propósito de determinar la densidad poblacional, cada 3 días y durante un período de 27 días, y se midió la concentración de individuos por ml. Resultados. Se obtuvieron mejores resultados en el tratamientos de microalgas + levadura, con valores de TCE=0.1323±0.07 y 0.1598±0.04 días-1; R=0.010 ±0.004 y 0.019±0.01 org ml-1 día-1, TD=5.2±0.5 y 4.3±0.38 días para Diaphanosoma sp., y Alona sp., respectivamente, pero sin presentar diferencias significativas (p>0.05. Conclusiones. La dieta mixta de levadura y microalgas produjo mayor eficiencia productiva en las dos especies estudiadas, constituyendo una alternativa de fuente de alimento vivo para la acuicultura.

  5. Aspectos tecnológicos de alimentos funcionais contendo probióticos Technological aspects of functional foods containing probiotics

    Directory of Open Access Journals (Sweden)

    Maricê Nogueira de Oliveira

    2002-03-01

    Full Text Available Os alimentos funcionais constituem hoje prioridade de pesquisa em todo mundo com a finalidade de elucidar as propriedades e os efeitos que estes produtos podem apresentar na promoção da saúde. As bactérias probióticas são microrganismos vivos que, quando consumidos, exercem efeitos benéficos sobre o hospedeiro conferindo propriedades à microbiota endógena. Algumas propriedades benéficas atribuídas às culturas probióticas necessitam de estudos mais controlados para serem definitivamente esclarecidas. Neste artigo são enfocados os aspectos tecnológicos dos probióticos, os efeitos associados ao consumo de produtos contendo probióticos e as principais cepas empregadas. São apresentados resultados experimentais originais para ilustrar os aspectos tecnológicos da fabricação de alimentos contendo probióticos buscando descrever suas limitações e alternativas.Functional food science is being considered priority of research nowadays and studies are directed towards attempts to elucidate their proprieties and effects in promoting health. Probiotics are viable microbial dietary supplements that have beneficial effects over the health of the host by means of modulation of the intestinal microflora. Some beneficial properties attributed to probiotic microorganisms still need more controlled studies to be definitely established. This article deals with technology aspects related to probiotics, the effects associated with the consumption of food products containing these microorganisms and the main strains employed for that purpose. Experimental data are also presented in order to illustrate technological aspects of the manufacture of food products containing probiotics, intending to describe their limitations and alternatives.

  6. Intracellular localization of group 3 LEA proteins in embryos of Artemia franciscana.

    Science.gov (United States)

    Boswell, Leaf C; Hand, Steven C

    2014-12-01

    Late embryogenesis abundant (LEA) proteins are accumulated by anhydrobiotic organisms in response to desiccation and improve survivorship during water stress. In this study we provide the first direct evidence for the subcellular localizations of AfrLEA2 and AfrLEA3m (and its subforms) in anhydrobiotic embryos of Artemia franciscana. Immunohistochemistry shows AfrLEA2 to reside in the cytoplasm and nucleus, and the four AfrLEA3m proteins to be localized to the mitochondrion. Cellular locations are supported by Western blots of mitochondrial, nuclear and cytoplasmic fractions. The presence of LEA proteins in multiple subcellular compartments of A. franciscana embryos suggests the need to protect biological structures in many areas of a cell in order for an organism to survive desiccation stress, and may explain in part why a multitude of different LEA proteins are expressed by a single organism. PMID:25311474

  7. First secondary metabolites from Herissantia crispa L (Brizicky) and the toxicity activity against Artemia salina Leach

    International Nuclear Information System (INIS)

    The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-β-D-glucopyranoside, stigmasterol 3-O-β-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol), 3,5,7,3',4'-pentahydroxyflavone (quercetin), unpublished in the genus Herissantia, besides β-sitosterol, kaempferol 3-O-β-D-(6''-E-p-coumaroil) (tiliroside) glucopyranoside and kaempferol 3,7-di-O-α-L-ramnopyranoside (lespedin), described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, 1H and 13C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out. (author)

  8. Preliminary results of the Artemia salina experiments in biostack on LDEF

    International Nuclear Information System (INIS)

    The mosaic egg of the brine shrimp, Artemia salina, resting in blastula or gastrula state represents a system that during further development, proceeds without any further development to the larval stage, the free swimming nauplius. Therefore, injury to a single cell of the egg will be manifest in the larvae. In several experiments, it was shown that the passage of a single heavy ion through the shrimp egg damaged a cellular area large enough to disturb either embryogenesis or further development of the larvae, or the integrity of the adult individual. Emergence from the egg shell was heavily disturbed by the heavy ions as was hatching. Additional late effects, due to a hit by a heavy ion, are delayed of growth and of sexual maturity, and reduced fertility. Anomalies in the body and the extremities could be observed more frequently for the nauplii which had developed from eggs hit by heavy ions

  9. Genetic variation in parthenogenetic Artemia from the Shandong Peninsula, P.R.C.

    Science.gov (United States)

    King, Charles E.; Zhao, Yuqi; Liu, Xin; Li, Mingren

    1988-06-01

    Results are presented of a survey of isozyme frequencies in parthenogenetic Artimia from six salterns in the Shandong Peninsula, P.R.C. Three of the eleven enzymes we scored using polyacryamide gel electrophoresis proved to be useful for analysis of electromorph frequency variation. These enzymes are tetrazolium oxidase (TO), lactate dehydrogenase (LDH), and malate dehydrogenase (MDH). Each of these systems showed extensive isozyme variation both within and between salterns. In addition, we have examined the possibility that electromorph frequencies may vary as the result of natural selection for adaptation to specific salinity, or salinity-associated environmental conditions. An indication of clinal variation was found in two series of ponds differing in salinity, however more extensive data are needed before it is possible to conclude that these patterns are the result of natural selection. Finally, the use of isozyme analyses such as ours, for unraveling taxonomic problems in Artemia is discussed.

  10. IDENTIFIKASI DAN UJI AKTIVITAS ANTIKANKER EKSTRAK SPONS Ianthella basta TERHADAP LARVA Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Ni Wayan Sri Sukmarianti

    2013-05-01

    Full Text Available The main purpose of this research is to determine the toxicity of extracts sponge Ianthella basta against Artemia salina larvae and to identify the chemical compounds contained in those toxic isolates. The preliminary test of the anticancer activity has conducted by Brine Shrimp Letalithy (BST test. The results showed that the chloroform extract was the most toxic with LC50 value of 22,39 ppm. Futher, the cloroform extract was separated and purified by coloumn chromatography using eluent of solvent mixture of chloroform : ethyl acetate : n-hexane by 7 : 2 : 1 and 4 fractions were obtained. The most toxic fraction was the fraction C with LC50 value of 35,36 ppm. Based on the GC-MS results, the toxic isolate is allegedly containing chemicals compound of hexadecanoic methyl ester and hexadecanoic acid.

  11. Maladaptive Sex Ratio Adjustment in the Invasive Brine Shrimp Artemia franciscana.

    Science.gov (United States)

    Lievens, Eva J P; Henriques, Gil J B; Michalakis, Yannis; Lenormand, Thomas

    2016-06-01

    Sex allocation theory is often hailed as the most successful area of evolutionary theory due to its striking success as a predictor of empirical observations [1]. Most naturally occurring sex ratios can be explained by the principle of equal investment in the sexes [2-4] or by cases of "extraordinary" sex allocation [5]. Deviations from the expected sex ratio are often correlated with weak selection or low environmental predictability (e.g., [6, 7]); true cases of aberrant sex allocation are surprisingly rare [8]. Here, we present a case of long-lasting maladaptive sex allocation, which we discovered in invasive populations of the exclusively sexual brine shrimp Artemia franciscana. A. franciscana was introduced to Southern France roughly 500 generations ago [9]; since then, it has coexisted with the native asexual species Artemia parthenogenetica [10]. Although we expect A. franciscana to produce balanced offspring sex ratios, we regularly observed extremely male-biased sex ratios in invasive A. franciscana, which were significantly correlated to the proportion of asexuals in the overall population. We experimentally proved that both invasive- and native-range A. franciscana overproduced sons when exposed to excess females, without distinguishing between conspecific and asexual females. We conclude that A. franciscana adjust their offspring sex ratio in function of the adult sex ratio but are information limited in the presence of asexual females. Their facultative adjustment trait, which is presumably adaptive in their native range, has thus become maladaptive in the invasive range where asexuals occur. Despite this, it has persisted unchanged for hundreds of generations. PMID:27185556

  12. Intracellular water in Artemia cysts (brine shrimp): Investigations by deuterium and oxygen-17 nuclear magnetic resonance.

    Science.gov (United States)

    Kasturi, S R; Seitz, P K; Chang, D C; Hazlewood, C F

    1990-08-01

    The dormant cysts of Artemia undergo cycles of hydration-dehydration without losing viability. Therefore, Artemia cysts serve as an excellent intact cellular system for studying the dynamics of water-protein interactions as a function of hydration. Deuterium spin-lattice (T(1)) and spin-spin (T(2)) relaxation times of water in cysts hydrated with D(2)O have been measured for hydrations between 1.5 and 0.1 g of D(2)O per gram of dry solids. When the relaxation rates (I/T(1), I/T(2)) of (2)H and (17)O are plotted as a function of the reciprocal of hydration (1/H), an abrupt change in slope is observed near 0.6 g of D(2)O (or H(2) (17)O)/gram of dry solids, the hydration at which conventional metabolism is activated in this system. The results have been discussed in terms of the two-site and multisite exchange models for the water-protein interaction as well as protein dynamics models. The (2)H and (17)O relaxation rates as a function of hydration show striking similarities to those observed for anisotropic motion of water molecules in protein crystals.It is suggested here that although the simple two-site exchange model or n-site exchange model could be used to explain our data at high hydration levels, such models are not adequate at low hydration levels (<0.6 g H(2)O/g) where several complex interactions between water and proteins play a predominant role in the relaxation of water nuclei. We further suggest that the abrupt change in the slope of I/T(1) as a function of hydration in the vicinity of 0.6 g H(2)O/g is due to a change in water-protein interactions resulting from a variation in the dynamics of protein motion. PMID:19431762

  13. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Institute of Scientific and Technical Information of China (English)

    Ana Dors; Mara Carmen Bartolom; Sebastin Snchez-Fortn

    2014-01-01

    Objective:To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods:Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI)-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results:Biotoxin equivalent values obtained by immunodetection were (2.12±0.10), (8.60±1.30) and (4.32±1.67) pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions:These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  14. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Institute of Scientific and Technical Information of China (English)

    Behnam Shekarchi; Ali Nekuiefard; Ramin Manaffar

    2016-01-01

    Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME) (3.5% v/v). Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms) were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate) in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  15. Tendencia de los consumos de alimentos en Colombia

    Directory of Open Access Journals (Sweden)

    Kalmanovitz Salomón

    1980-12-01

    Full Text Available En un tipo de economía como la colombiana, caracterizada por salarios que tienen muy poca ligazón con la productividad social del trabajo, estos son por lo general muy bajos y una parte de ellos, que llega a ser más de la mitad, se dedica a la adquisición de alimentos. Mientras el salario mínimo en Colombia era en enero de 1979 de US$ 3.10 diarios, en Estados Unidos era de US$ 3.75 la hora, al tiempo que la jornada de trabajo acá era un 20% más larga (48 horas a la semana contra 40 , lo que representa una diferencia abismal de 12 veces. Las diferencias de productividad industrial en 1974 eran de sólo 4 veces en términos de valor agregado por trabajador o sea que un capitalista operando en el país estrujaba 3 veces más trabajo sobrante a cada obrero que el correspondiente a un empresario yanki.

  16. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    Directory of Open Access Journals (Sweden)

    J.M. Lima

    2009-03-01

    Full Text Available A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qualificados no extrato aquoso, com exceção de cumarinas. Em diclorometano, verificou se a presença de saponinas, derivados triterpênicos e esteróides. No teste de toxicidade sobre Artemia salina, os dados convergiram para frações de extrato aquoso de 5.117,2 ppm, indicando ser um extrato de baixa toxicidade.Sonchus oleraceus is a common weed in Brazil, also used as a medicinal plant. Phytochemical prospecting of this species was carried out in this work using extracts obtained in ethanol, water and dichloromethane. A toxicity study of the aqueous extract was also conducted, using the micro crustaceous Artemia salina. The aqueous extract presented sugar reducers, phenolic compounds, tannins, flavonoids and coumarins in its composition. The compounds found in the aqueous extract were also detected in the ethanol extract, except for the coumarins. Saponin, triterpenes and steroids were identified in the dichloromethane extract. The toxicity test on Artemia salina pointed to aqueous extract fractions of 5,117.2 ppm, indicative of low toxicity.

  17. Species-specific RFLP pattern in the Heat Shock Protein26 gene (Hsp26): a single-locus tool for species identification and experimental testing of habitat-induced isolation in the New World Artemia species.

    Science.gov (United States)

    Beristain, P; Gajardo, G; Bossier, P

    2010-01-01

    The brine shrimp Artemia (Crustacea, Branchiopoda), a paradigmatic inhabitant of hypersaline lakes, has molecular features to survive under stressful conditions, such as the p26 heat shock protein. We report the RFLP fingerprinting pattern (four restriction enzymes) of a 217 bp fragment of exon2 of the Hsp26 gene in six Artemia franciscana and four Artemia persimilis populations, the most genetically divergent Artemia species co-occurring in latitudinal extremes of Chile. The species-specific RFLP pattern observed is a simple and cost-effective single-locus tool for species delimitation and experimental testing the habitat-induced isolation barrier between them. PMID:21565017

  18. PONTOS DE VENDA DE ALIMENTOS: UMA ANÁLISE DO PERFIL DE COMPRA DOS CONSUMIDORES DE CARNE BOVINA E FLV

    OpenAIRE

    Moura, Thaís Lacava de; Silva, Andrea Lago da; Viana, Adriana Backx Noronha; Batalha, Mario Otavio

    2006-01-01

    As variáveis sócio-demográficas são um dos fatores que mais influenciam a escolha dos formatos de varejo do consumidor para a compra de alimentos. Ao analisar essas variáveis e a provável associação com a compra de alimentos, é possível desenhar um perfil dos consumidores que freqüentam os formatos de varejos de alimentos. O propósito deste artigo é identificar o perfil dos consumidores que freqüentam os diversos formatos de varejo de alimentos em 4 capitais brasileiras para a compra de carne...

  19. Effect of salinity on the uptake of cadmium by the brine shrimp Artemia fransiscana

    OpenAIRE

    Blust, R.; Kockelbergh, E.; Baillieul, M.

    1992-01-01

    The effect of salinity on cadmium uptake by the brine shrimp Artemia fransiscana was studied in chemically defined saltwater solutions. Shrimp were acclimated to different salinities and exposed to the metal in solutions of differing salinity and composition. Within each acclimation group, the cadmium uptake decreased with increasing salinity of exposure. Most of this variation was explained by changes in the activity of the free metal ion. Among the acclimation groups, uptake increased by in...

  20. Impact of enriching larval brine shrimp (Artemia sp.) with a supplement containing polyunsaturated fatty acids on their growth and mortality

    OpenAIRE

    Prusińska Maja; Kushniry Olga; Khudyi Oleksii; Khuda Lidiia; Kolman Ryszard

    2015-01-01

    The aim of the study was to determine the impact the commercial supplement S.presso (INVE Aquaculture, Belgium), a source of polyunsaturated fatty acids to enrich the proximate composition of brine shrimp (Artemia sp.), had on their growth and mortality. Four different enrichment protocols were investigated: the supplement was given in one or two doses at various time intervals. The results indicate that while S.presso increased nauplius mortality slightly, administering the appropriate dose ...

  1. Bird migratory flyways influence the phylogeography of the invasive brine shrimp Artemia franciscana in its native American range

    OpenAIRE

    Joaquín Muñoz; Francisco Amat; Green, Andy J.; Jordi Figuerola; Africa Gómez

    2013-01-01

    Since Darwin’s time, waterbirds have been considered an important vector for the dispersal of continental aquatic invertebrates. Bird movements have facilitated the worldwide invasion of the American brine shrimp Artemia franciscana, transporting cysts (diapausing eggs), and favouring rapid range expansions from introduction sites. Here we address the impact of bird migratory flyways on the population genetic structure and phylogeography of A. franciscana in its native range in the Americas. ...

  2. Bioencapsulation of the antibacterial drug sarafloxacin in nauplii of the brine shrimp Artemia franciscana

    OpenAIRE

    Dixon, B.A.; Van Poucke, S; Chair, M; Dehasque, M.; Nelis, H J; Sorgeloos, P.; De Leenheer, A P

    1995-01-01

    Nauplii of the brine shrimp Artemia franciscana were enriched with the antibacterial drug sarafloxacin hydrochloride to determine if levels effective against four pathogenetic strains of Vibrio spp. would accumulate in brine shrimp. Three vibrio strains were Vibrio anguillarum; the fourth was V. vulnificus. Concentrations of sarafloxacin ranging from 1 to 40% (weight: volume) were incorporated into the oil phase of Super Selco brine shrimp diets. Enriched nauplii and controls were sampled at ...

  3. Study of model systems to test the potential function of Artemia group 1 late embryogenesis abundant (LEA) proteins.

    Science.gov (United States)

    Warner, Alden H; Guo, Zhi-hao; Moshi, Sandra; Hudson, John W; Kozarova, Anna

    2016-01-01

    Embryos of the brine shrimp, Artemia franciscana, are genetically programmed to develop either ovoviparously or oviparously depending on environmental conditions. Shortly upon their release from the female, oviparous embryos enter diapause during which time they undergo major metabolic rate depression while simultaneously synthesize proteins that permit them to tolerate a wide range of stressful environmental events including prolonged periods of desiccation, freezing, and anoxia. Among the known stress-related proteins that accumulate in embryos entering diapause are the late embryogenesis abundant (LEA) proteins. This large group of intrinsically disordered proteins has been proposed to act as molecular shields or chaperones of macromolecules which are otherwise intolerant to harsh conditions associated with diapause. In this research, we used two model systems to study the potential function of the group 1 LEA proteins from Artemia. Expression of the Artemia group 1 gene (AfrLEA-1) in Escherichia coli inhibited growth in proportion to the number of 20-mer amino acid motifs expressed. As well, clones of E. coli, transformed with the AfrLEA-1 gene, expressed multiple bands of LEA proteins, either intrinsically or upon induction with isopropyl-β-thiogalactoside (IPTG), in a vector-specific manner. Expression of AfrLEA-1 in E. coli did not overcome the inhibitory effects of high concentrations of NaCl and KCl but modulated growth inhibition resulting from high concentrations of sorbitol in the growth medium. In contrast, expression of the AfrLEA-1 gene in Saccharomyces cerevisiae did not alter the growth kinetics or permit yeast to tolerate high concentrations of NaCl, KCl, or sorbitol. However, expression of AfrLEA-1 in yeast improved its tolerance to drying (desiccation) and freezing. Under our experimental conditions, both E. coli and S. cerevisiae appear to be potentially suitable hosts to study the function of Artemia group 1 LEA proteins under environmentally

  4. Design, operation, and potential of a culture system for the continuous production of Artemia nauplii

    OpenAIRE

    Lavens, P.; Sorgeloos, P

    1987-01-01

    A flow-through system is described for the controlled production of Artemia nauplii. High densities of adult brine shrimp are induced to ovoviviparity through diet manipulation, optimal culture water exchange, and high constant oxygen levels. The nauplii produced are separated from the culture tank effluents in a special recuperation filter system. The culture water is recirculated over a rotating biodisc, a cross-flow sieve, and a plate separator.The potential of this nauplii production syst...

  5. TRANSGÉNICOS, ALERTA NARANJA EN LOS ALIMENTOS

    Directory of Open Access Journals (Sweden)

    Camilo Alviar F.

    2005-01-01

    Full Text Available La ingeniería genética en el área de la agricultura, y más concretamente de la producción de alimentos, desde hace varias décadas está modificando la estructura genética de origen para dar lugar a las superplantas, a los supercultivos. La obtención de los transgénicos responde a intereses comerciales y mercantilistas y no a una respuesta para el campesino ni para el medio ambiente ni para el consumidor. Al consumidor se le está negando una información vital cuando no se le suministra información visible y medianamente comprobable para que tenga la posibilidad de elegir cómo alimentarse. Los organismos modificados genéticamente (OMG pueden representar peligros muy grandes para el planeta. Actualmente, los cultivos transgénicos han incrementado las áreas productivas en forma exponencial, y están prácticamente en todo el orbe. Y aunque las áreas de agricultura orgánica, limpia, y sostenible han aumentado enormemente con resultados positivos demostrados contundentemente, la proporción con respecto a los transgénicos coloca a la humanidad en serios riesgos. Para los recursos naturales no es menos crítica la situación, ya que se han podido demostrar categóricamente las consecuencias negativas con estudios serios y de varios años. El agua, el suelo, la biodiversidad como un todo está en peligro, pues los organismos alterados están provocando la extinción de plantas nativas, de plantas promisorias: el germoplasma silvestre está siendo atacado en forma frontal.

  6. Consumo de alimentos fora do domicílio no Brasil

    Directory of Open Access Journals (Sweden)

    Ilana Nogueira Bezerra

    2013-02-01

    Full Text Available OBJETIVO: Analisar características do consumo de alimentos fora do domicílio no Brasil. MÉTODOS: Foram analisados dados do Inquérito Nacional de Alimentação, conduzido com 34.003 indivíduos acima de dez anos de idade em 24% dos domicílios participantes da Pesquisa de Orçamentos Familiares em 2008-2009. O consumo de alimentos e bebidas foi coletado por meio de registros dos alimentos consumidos, tipo de preparação, quantidade, horário e fonte do alimento (dentro ou fora de casa. A frequência de indivíduos que consumiu alimentos fora do domicílio foi calculada segundo faixas de idade, sexo, faixas de renda, área de localização do domicílio, tamanho da família, presença de criança no domicílio e idade do chefe do domicílio no Brasil e em cada região brasileira. Para as análises, considerou-se o peso amostral específico do inquérito e incorporou-se o efeito do desenho amostral. RESULTADOS: O consumo de alimentos fora do domicílio no Brasil foi reportado por 40% dos entrevistados, variando de 13% entre os idosos da região Sul a 51% entre os adolescentes da região Sudeste. Esse percentual diminuiu com a idade e aumentou com a renda em todas as regiões brasileiras; foi maior entre os homens e na área urbana. Os grupos de alimentos com maior percentual de consumo fora de casa foram bebidas alcoólicas, salgadinhos fritos e assados, pizza, refrigerantes e sanduíches. CONCLUSÕES: A alimentação fora de casa apresenta predominância de alimentos de alto conteúdo energético e pobre conteúdo nutricional, indicando que o consumo de alimentos fora do domicílio deve ser considerado nas ações de saúde pública voltadas para a melhoria da alimentação dos brasileiros.

  7. 卤虫属分类研究进展%Progress on Researches of Taxonomy on Genus Artemia

    Institute of Scientific and Technical Information of China (English)

    张伟峰; 郝浩永; 陈莉

    2008-01-01

    卤虫(Anemia)属于节肢动物门(Phylum Arthropoda),甲壳纲(Class Crustacea),鳃足亚纲(SubclassBranchiopoda),无甲目(Order Anostraca),卤虫科(Family Artemidae).世界卤虫根据生殖方式可分为两性生殖卤虫和孤雌生殖卤虫两大类.利用生殖隔离实验将世界两性卤虫分为8个种:Anemiafranciscana Kellogg、Artemia persimilis Piccinelli et Prosdoeimi、Anemia rnonica Verrill、Anemia salina Linnaeus、Artemia urmianaGünther、Anemia tunisiana Bowen et Sterling、Anemia sinica Cai和Anemia tibetiana Abatzopouios,Zhang et Sorge-loos.其中,我国发现有A.sinica和A.tibetiana两种两性卤虫.孤雌生殖卤虫统称为Artemia parthenogenetica,并在其后加上产地的地名以示区别.

  8. Multiple γ-glutamylation: A novel type of post-translational modification in a diapausing Artemia cyst protein

    International Nuclear Information System (INIS)

    A highly hydrophilic, glutamate-rich protein was identified in the aqueous phenol extract from the cytosolic fraction of brine shrimp (Artemia franciscana) diapausing cysts and termed Artemia phenol soluble protein (PSP). Mass spectrometric analysis revealed the presence of many protein peaks around m/z 11,000, separated by 129 atomic mass units; this value corresponds to that of glutamate, which is strongly suggestive of heterogeneous polyglutamylation. Polyglutamylation has long been known as the functionally important post-translational modification of tubulins, which carry poly(L-glutamic acid) chains of heterogeneous length branching off from the main chain at the γ-carboxy groups of a few specific glutamate residues. In Artemia PSP, however, Edman degradation of enzymatic peptides revealed that at least 13, and presumably 16, glutamate residues were modified by the attachment of a single L-glutamate, representing a hitherto undescribed type of post-translational modification: namely, multiple γ-glutamylation or the addition of a large number of glutamate residues along the polypeptide chain. Although biological significance of PSP and its modification is yet to be established, suppression of in vitro thermal aggregation of lactate dehydrogenase by glutamylated PSP was observed.

  9. Multiple {gamma}-glutamylation: A novel type of post-translational modification in a diapausing Artemia cyst protein

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Mai [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Ikeda, Yuka [Institute of High Polymer Research, Faculty of Textile Science and Technology, Shinshu University, 3-15-1, Tokida, Ueda 386-8567 (Japan); Kanzawa, Hideaki [Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Sakamoto, Mika [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Goto, Mina [Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Tsunasawa, Susumu [Analytical and Measuring Instruments Division, Shimadzu Corporation, Nishinokyo Kuwabaracho 1, Nakagyo-Ku, Kyoto 604-8511 (Japan); Uchiumi, Toshio, E-mail: uchiumi@bio.sc.niigata-u.ac.jp [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Odani, Shoji [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan)

    2010-03-26

    A highly hydrophilic, glutamate-rich protein was identified in the aqueous phenol extract from the cytosolic fraction of brine shrimp (Artemia franciscana) diapausing cysts and termed Artemia phenol soluble protein (PSP). Mass spectrometric analysis revealed the presence of many protein peaks around m/z 11,000, separated by 129 atomic mass units; this value corresponds to that of glutamate, which is strongly suggestive of heterogeneous polyglutamylation. Polyglutamylation has long been known as the functionally important post-translational modification of tubulins, which carry poly(L-glutamic acid) chains of heterogeneous length branching off from the main chain at the {gamma}-carboxy groups of a few specific glutamate residues. In Artemia PSP, however, Edman degradation of enzymatic peptides revealed that at least 13, and presumably 16, glutamate residues were modified by the attachment of a single L-glutamate, representing a hitherto undescribed type of post-translational modification: namely, multiple {gamma}-glutamylation or the addition of a large number of glutamate residues along the polypeptide chain. Although biological significance of PSP and its modification is yet to be established, suppression of in vitro thermal aggregation of lactate dehydrogenase by glutamylated PSP was observed.

  10. Validação de fotografias de alimentos para estimativa do consumo alimentar

    Directory of Open Access Journals (Sweden)

    Rávila Graziany Machado de SOUZA

    2016-06-01

    Full Text Available RESUMO Objetivo Validar fotografias de um guia fotográfico de alimentos para estimativa do consumo alimentar. Métodos As fotografias de 12 alimentos (bolo simples, macarrão ao sugo, mamão formosa, melancia, repolho roxo ralado, quiabo refogado, churrasco em tiras, filé de frango grelhado, pudim de leite condensado, pizza, amendoim cru e queijo tipo minas, retratadas em três tamanhos de porções (pequena, média e grande, foram avaliadas por 90 indivíduos adultos. Foram também investigados o peso, a estatura e o sexo dos participantes. Para análise de concordância entre o tamanho da porção do alimento retratado nas fotos e o tamanho real do alimento, utilizou-se o teste Kappa. Os dados foram analisados no software Stata, considerando-se p 0,05. Conclusão As 12 fotografias apresentaram uma boa concordância com as porções dos alimentos e podem ser um instrumento útil para aumentar a acurácia dos relatos do consumo alimentar.

  11. Coadaptation: lessons from the brine shrimp Artemia, "the aquatic Drosophila" (Crustacea; Anostraca Coadaptación: lecciones desde el camarón de salmuera Artemia, "la Drosophila acuática" (Crustacea; Anostraca

    Directory of Open Access Journals (Sweden)

    GONZALO GAJARDO

    2001-03-01

    Full Text Available During the fifties Brncic and the Dobzhansky's school, using the fruit fly Drosophila as a test organism, introduced the term integration of the genotype, or genetic coadaptation, which has had great impact on thinking in today's evolutionary biology. In this work we use the brine shrimp Artemia - in many respects a sort of aquatic Drosophila- as a model organism to evaluate the relationship between population structure, potential for divergence and the degree of morphological and/or genetic change. These aspects, tightly linked with the organization of the genotype, are important to understanding how recombination and adaptive release of genetic and phenotypic variation affect the speciation process in Artemia. Analysis of genetic (allozyme, diploid and chromocentre numbers, morphological (Mahalanobis distances and reproductive data (cross-fertility tests available for populations of the bisexual, endemic species of the Americas, Artemia franciscana and A. persimilis, indicate that: (i A. franciscana and A. persimilis are morphologically distinct in correspondence with observed genetic differences (D Nei > 1; 2n = 42 and 44; 12.5 and 1.5 mean chromocentre numbers, respectively; (ii populations from Chile and other South American localities (mainly A. franciscana display high levels of genetic variability and a trend to develop large genetic distances between populations; (iii the plasticity of Artemia gene pool is associated, at least in part, with ecological heterogeneity. Hence an adaptive divergence mode is thought to best define the speciation process in Artemia; (iv the succesful production of laboratory hybrids in the allopatric Artemia populations studied in the Americas, a feature seen in other anostracods, could be explained by the fact that formerly allopatric populations have not achieved later sympatry, as required by the allopatric speciation paradigmEn los años cincuenta Brncic y la escuela de Dobzhansky introdujeron el t

  12. Alimentos funcionales y nutrición óptima: ¿Cerca o lejos?

    OpenAIRE

    Silveira Rodríguez Manuela Belén; Monereo Megías Susana; Molina Baena Begoña

    2003-01-01

    El concepto de alimento funcional, aún no consensuado científicamente, surge en el seno de la Nutrición Óptima, encaminada a modificar aspectos genéticos y fisiológicos y a la prevención y tratamiento de enfermedades, más allá de la mera cobertura de las necesidades de nutrientes. Bajo la perspectiva de la Unión Europea, pueden ser tanto alimentos naturales como procesados industrialmente. Los alimentos funcionales más relevantes y sobre los que recae la más sólida evidencia científica son lo...

  13. Comparison of bioassays using the anostracan crustaceans Artemia salina and Thamnocephalus platyurus for plant extract toxicity screening Comparação de bioensaios com os crustáceos Artemia salina e Thamnocephalus platyurus para abordagem de extratos de plantas com toxicidade

    OpenAIRE

    Pablo Mayorga; Karen R. Pérez; Sully M. Cruz; Armando Cáceres

    2010-01-01

    Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest) and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest), were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq.) Kunth ex ...

  14. Sustitución de alimento comercial por excretas en la dieta de conejos en crecimiento

    Directory of Open Access Journals (Sweden)

    S. P. Castillo-Rodríguez

    2007-01-01

    Full Text Available La presente investigación se llevó a cabo para evaluar el efecto de la sustitución de alimento comercial por una mezcla de excretas [gallinas, cerdos y vacas] sobre el crecimiento de conejos Nueva Zelanda. Se utilizaron 30 animales con un promedio de peso de 600 + 18.2 g, y edad de 35 días, los cuales se colocaron en jaulas individuales. Los tratamientos consistieron en la sustitución parcial del alimento comercial en niveles de 0, 15, 20, 25, 30 y 35%, con una mezcla de excretas (gallinaza, cerdaza y bovinaza. La prueba tuvo una duración de 42 días, el alimento y agua de bebida fueron ofrecidos ad libitum. Todos los días se pesó el alimento ofrecido y el rechazado; el peso de los animales se registró semanalmente. Las medias generales ± desviación estándar para ganancia de peso, consumo de alimento y digestibilidad aparente fueron 866 ± 129 g, 3.02 ± 0.35 kg y 64.0 ± 0.5%, respectivamente. La ganancia de peso, consumo de alimento y digestibilidad aparente fueron afectadas por el nivel de excretas en la ración (P 0.05, pero la digestibilidad aparente fue menor en los niveles de 30 y 35% de excretas. Se puede concluir que las excretas pueden ser usadas hasta en un 25% con resultados satisfactorios y sin efectos adversos sobre la ganancia de peso y la conversión alimenticia.

  15. DISPONIBILIDADE DE FERRO IN VITRO EM MISTURAS DE ALIMENTOS VEGETAIS

    Directory of Open Access Journals (Sweden)

    Eduardo Fraccarolli BURIOLA

    2010-09-01

    Full Text Available

    O objetivo deste estudo foi avaliar a disponibilidade de ferro em misturas contendo arroz, feijão, tomate e aveia, arroz, feijão, tomate e castanha-do-pará e, no caso do controle arroz, feijão e tomate. Foram avaliadas a mistura controle, com arroz e feijão 2:1 (p/p acrescidos de tomate (o equivalente a 5mg de ácido ascórbico, três misturas com todos os alimentos da mistura controle mais aveia nas proporções 25%, 50% e 75% (25AV, 50AV e 75AV, respectivamente e três misturas iguais ao controle mais castanha-do-pará com proporções de 5%, 10% e 20% (5CP, 10CP e 20CP, respectivamente. As misturas e o controle foram analisados quanto à dialisabilidade do ferro e à concentração de taninos, ácido fítico, ácido oxálico e vitamina C, sendo que o ferro dialisável não diferiu entre as misturas CP e AV. O controle apresentou a maior porcentagem de disponibilidade de ferro e, com adição de aveia ou castanha-do-pará, ocorreu diminuição da porcentagem de ferro dialisável. Quando o teor de ferro dialisável foi considerado, não ocorreu diferença entre o controle e as demais misturas, pois a concentração de ferro total foi maior para as misturas adicionadas de aveia ou castanha-do-pará. Portanto, a adição de aveia ou castanha-do-pará à mistura de arroz, feijão e tomate afeta de forma negativa a disponibilidade do ferro. Essa infl uência negativa pode ser devido ao teor de ácido fítico e oxálico, encontrados principalmente na aveia, e pelos taninos, presentes em quantidades similares na aveia e na castanha-do-pará.

  16. RESISTENCIA A ANTIBIOTICOS DE BACTERIAS AISLADAS DE BIOPELÍCULAS EN UNA PLANTA DE ALIMENTOS

    OpenAIRE

    María Vanegas L; Nancy Correa C; Ana Morales M; Aída Martínez L; Laura C Rúgeles G; Francy M Jiménez

    2009-01-01

    Objetivo. Evaluar la resistencia a antibióticos y la capacidad de formación de biopelículas de bacterias aisladas en una planta de producción de alimentos. Materiales y métodos. Se tomaron muestras de 3 zonas diferentes, en una planta procesadora de alimentos; en la lavadora de canastas, la mesa de producción y en la banda empacadora. Se aislaron e identificaron las bacterias presentes en cada una de las tres zonas y se determinó la capacidad formadora de biopelículas por ...

  17. Consumo de alimentos protetores e preditores do risco cardiovascular em adultos do estado de Pernambuco

    OpenAIRE

    Cláudia Porto Sabino Pinho; Alcides da Silva Diniz; Ilma Kruze Grande de Arruda; Pedro Israel Cabral de Lira; Poliana Coelho Cabral; Leopoldina Augusta Souza Siqueira; Malaquias Batista Filho

    2012-01-01

    OBJETIVO: Avaliar o consumo de alimentos protetores e preditores do risco cardiovascular e os fatores associados na população adulta do Estado de Pernambuco. MÉTODOS: Estudo transversal, de base populacional, envolvendo 1.820 adultos de 25 a 59 anos. Foram constituídos 3 grupos de alimentos: fontes em fibras (protetores), em carboidratos simples e em gorduras saturadas (risco para doenças cardiovasculares e ganho excessivo de peso). O consumo alimentar foi avaliado por um questionário de freq...

  18. Alimentos funcionais no manejo da diabetes mellitus = Functional foods in the management of diabetes mellitus

    OpenAIRE

    Zaparolli, Marília Rizzon

    2013-01-01

    Objetivo: Analisar o conhecimento e o consumo de alimentos funcionais que auxiliam no controle da Diabetes mellitus em pacientes de um hospital público de Curitiba – PR. Materiais e Métodos: Trata-se de um estudo transversal e quantitativo, realizado com pacientes diabéticos hospitalizados (Hospital de Clínicas/UFPR), no período de dezembro de 2011 a março de 2012. Para a coleta de dados foi utilizado um questionário, através do qual se obteve informações sobre o conhecimento de alimentos ...

  19. Aporte de vitaminas y minerales por grupo de alimentos en estudiantes universitarios chilenos

    OpenAIRE

    Samuel Durán Agüero; Susanne Reyes García; María Cristina Gaete

    2013-01-01

    Introducción: La etapa universitaria es un proceso en el cual las personas pasan por periodos prolongados de inactividad física y horarios irregulares de comidas, lo que conlleva al incremento en el consumo de alimentos procesados y de comida rápida. Objetivo: Fue determinar el aporte vitaminas y minerales por grupo de alimentos en la alimentación de estudiantes universitarios. Métodos: Se trabajó con una muestra de 654 estudiantes universitarios chilenos (18-24 años, 54% mujeres), a quienes ...

  20. Capacitación de productores y manipuladores de alimentos en seguridad alimentaria

    OpenAIRE

    Zeinsteger, Pedro A.; Yamul, Diego Karim; Dulout, Mariana; Mastrantonio Garrido, Guido Enrique

    2012-01-01

    Las enfermedades transmitidas por alimentos (ETA) implican un riesgo para la población susceptible debido a errores en la manipulación, almacenamiento o servicio. Las pérdidas ocasionadas, por fallas en los aspectos sanitarios durante la producción, se estiman en el mundo en el orden del 30%. Existe la necesidad de facilitar la incorporación de conocimientos teóricos y prácticos relacionados con la producción segura de alimentos en circuitos formales e informales de producción. Tradicionalmen...

  1. Ecodiseño de alimentos mediante análisis de ciclo de vida

    OpenAIRE

    Ramos Fernández, Saioa

    2015-01-01

    246 p. La creciente demanda de producción de alimentos debida al aumento de la población mundial, ejerce una gran presión sobre los ecosistemas y el medio ambiente del planeta. Los alimentos, a lo largo de su ciclo de vida utilizan una gran cantidad de recursos (suelo, agua, energía y materiales) y emiten muchas sustancias al medio (CO2, pesticidas, etc.) que tienen un impacto directo en el medio ambiente. Con el fin de evaluar el impacto ambiental asociado a la producción comercialización...

  2. Endolisinas fágicas: ¿Nuevos bioconservantes para alimentos?

    OpenAIRE

    García Suárez, María Pilar; Martínez Fernández, Beatriz; Rodríguez, Lorena; Rodríguez González, Ana

    2010-01-01

    La mejora de la calidad de la alimentación está intimamente relacionada con una mejora en la seguridad alimentaria y con la inocuidad de los alimentos entendida desde una perspectiva global. Los microorganismos, y en concreto las bacterias, son la principal causa de enfermedades causadas por el consumo de alimentos. Por ello, los métodos de control de la contaminación deben de ser eficaces a la vez que adecuados al tipo de productos que demanda el consumidor actual. Entre los distintos método...

  3. Optimum level of fish liver oil as enrichment for Artemia fed to the tiger tail seahorse Hippocampus comes for reproduction and juvenile survival

    Directory of Open Access Journals (Sweden)

    Mac Nhu Binh

    2012-09-01

    Full Text Available Reproductive performance of broodstocks and juvenile stress resistance of seahorseHippocampus comes afed Artemia enriched with varying fish liver oil (FLO were evaluated. Artemia wasenriched in seven media with 0%, 1%, 2%, 3%, 4%, 5% and 10% FLO supplemented with egg yolk,baker’s yeast and vitamins 12 h before feeding to seahorse broodstocks. In general, responseparameters increased at lower concentration of FLO, peaked at 5% and decreased at 10%; thus, forparabolic relationships, the quadratic regression was appropriate to estimate quantitative optimum level.Artemia enrichment with FLO increased considerably its saturated FA content in the form of myristic acidand the total HUFA content, particularly DHA and arachidonic acid. Feeding seahorse broodstock with FLOenriched Artemia resulted in: (1 significant increase in brood size both during the first and secondbrooding, (2 significant shortening of interbrooding period, and (3 significant extension of the time tototal mortality during the salinity shock test of juveniles. Quantitative estimates of mean optimum FLOlevel for the enrichment of Artemia fed to H. comes awas 6.3% (range 5.9–7.0% using each responseparameter fitted in a quadratic model.

  4. Evaluando la aceptación de alimentos en escolares: registro visual cualitativo frente a análisis de residuos de alimentos

    OpenAIRE

    Alejandra Rodríguez-Tadeo; Begoña Patiño Villena; María Jesus Periago Caston; Gaspar Ros Berrnezo; Eduardo González Martínez-Lacuesta

    2014-01-01

    Introducción: Los comedores escolares cuentan con normativa de gestión y supervisión de menús, sin embargo no se ha valorado si son consumidos en su totalidad. Objetivo: Valorar la aceptación de alimentos mediante pesado de restos y validación de una metodología visual para su estimación en comedores escolares de Murcia. Metodología: Participaron escolares de segundo y tercer ciclo de educación primaria, de 8-12 años. La estimación de restos se realizó mediante pesado de alimentos de 765 band...

  5. Impacts of harvesting on brine shrimp (Artemia franciscana) in Great Salt Lake, Utah, USA.

    Science.gov (United States)

    Sura, Shayna A; Belovsky, Gary E

    2016-03-01

    Selective harvesting can cause evolutionary responses in populations via shifts in phenotypic characteristics, especially those affecting life history. Brine shrimp (Artemia franciscana) cysts in Great Salt Lake (GSL), Utah, USA are commercially harvested with techniques that select against floating cysts. This selective pressure could cause evolutionary changes over time. Our objectives are to (1) determine if there is a genetic basis to cyst buoyancy, (2) determine if cyst buoyancy and nauplii mortality have changed over time, and (3) to examine GSL environmental conditions over time to distinguish whether selective harvesting pressure or a trend in environmental conditions caused changes in cyst buoyancy and nauplii mortality. Mating crosses between floating and sinking parental phenotypes with two food concentrations (low and high) indicated there is a genetic basis to cyst buoyancy. Using cysts harvested from 1991-2011, we found cyst buoyancy decreased and nauplii mortality increased over time. Data on water temperature, salinity, and chlorophyll a concentration in GSL from 1994 to 2011 indicated that although water temperature has increased over time and chlorophyll a concentration has decreased over time, the selective harvesting pressure against floating cysts is a better predictor of changes in cyst buoyancy and nauplii mortality over time than trends in environmental conditions. Harvesting of GSL A. franciscana cysts is causing evolutionary changes, which has implications for the sustainable management and harvesting of these cysts. Monitoring phenotypic characteristics and life-history traits of the population should be implemented and appropriate responses taken to reduce the impacts of the selective harvesting. PMID:27209783

  6. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    Directory of Open Access Journals (Sweden)

    Sahgal Geethaa

    2013-01-01

    Full Text Available Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT] to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC 50 for the solvents were 8.5% (DMSO, 6.4% (methanol, 3.4% (ethanol and 2.5% (Tween 20. The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  7. Experimental taphonomy of Artemia reveals the role of endogenous microbes in mediating decay and fossilization.

    Science.gov (United States)

    Butler, Aodhán D; Cunningham, John A; Budd, Graham E; Donoghue, Philip C J

    2015-06-01

    Exceptionally preserved fossils provide major insights into the evolutionary history of life. Microbial activity is thought to play a pivotal role in both the decay of organisms and the preservation of soft tissue in the fossil record, though this has been the subject of very little experimental investigation. To remedy this, we undertook an experimental study of the decay of the brine shrimp Artemia, examining the roles of autolysis, microbial activity, oxygen diffusion and reducing conditions. Our findings indicate that endogenous gut bacteria are the main factor controlling decay. Following gut wall rupture, but prior to cuticle failure, gut-derived microbes spread into the body cavity, consuming tissues and forming biofilms capable of mediating authigenic mineralization, that pseudomorph tissues and structures such as limbs and the haemocoel. These observations explain patterns observed in exceptionally preserved fossil arthropods. For example, guts are preserved relatively frequently, while preservation of other internal anatomy is rare. They also suggest that gut-derived microbes play a key role in the preservation of internal anatomy and that differential preservation between exceptional deposits might be because of factors that control autolysis and microbial activity. The findings also suggest that the evolution of a through gut and its bacterial microflora increased the potential for exceptional fossil preservation in bilaterians, providing one explanation for the extreme rarity of internal preservation in those animals that lack a through gut. PMID:25972468

  8. Valor nutricional de alimentos para suínos determinado na Universidade Federal de Lavras Nutritional value of feedstuffs for pigs determined at the University of Lavras

    OpenAIRE

    Zuleide Alves de Souza Santos; Rilke Tadeu Fonseca de Freitas; Elias Tadeu Fialho; Paulo Borges Rodrigues; José Augusto de Freitas Lima; Douglas de Carvalho Carellos; Patricia Azevedo Castelo Branco; Vinicius de Souza Cantarelli

    2005-01-01

    Foram conduzidos seis ensaios de metabolismo no Departamento de Zootecnia da Universidade Federal de Lavras (UFLA) no ano de 2002, com objetivo de avaliar a composição química e nutricional de 8 alimentos protéicos e 10 energéticos. Para o primeiro ensaio, foram selecionados animais de peso-vivo médio de 40,4 kg, sendo analisado o farelo de algodão, soja micronizada, farelo de soja, farelo de linhaça, farinha de pâncreas suíno, farinha de vísceras suína, milho comum, milheto em grão e moído, ...

  9. Investigations of the effects of cosmic rays on Artemia cysts and tobacco seeds: results of Exobloc II experiment, flown aboard Biocosmos 1887

    International Nuclear Information System (INIS)

    Artemia (Brine shrimp) cysts and tobacco seeds, dormant biological material devoid of metabolic activity, were flown aboard the Soviet Biocosmos 1887 in order to investigate the effects of cosmic rays. Artemia cysts and tobacco seeds were used in bulk or in monolayers sandwiched with track detectors. Biological and physical units were located outside and inside the spacecraft. Stacks included lead shielding in order to expose the objects to different doses of radiation. Total dosimetry was performed using thermoluminescent detectors. In spite of low levels of doses, the space flight resulted in a decrease in developmental capacity of Artemia cysts, and in a higher mutation rate in tobacco seeds. The more obvious responses occurred, in both cases, in biological objects exposed to the highest doses. These results are compared to those of previous space experiments. (author)

  10. Avaliação da bioatividade dos extratos de cúrcuma (Curcuma longa L., Zingiberaceae em Artemia salina e Biomphalaria glabrata Bioactivity evaluation of the turmeric (Curcuma longa L., Zingiberaceae extracts in Artemia salina and Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Carlos R. M. da Silva Filho

    2009-12-01

    Full Text Available A cúrcuma é o rizoma limpo, em boas condições, seco e moído da Curcuma longa L., uma planta herbácea da família Zingiberaceae. Visando novas alternativas para o controle da esquistossomose, os extratos de Curcuma longa L. foram testados para a avaliação da atividade moluscicida contra caramujos adultos da espécie Biomphalaria glabrata, e toxicidade (ensaio de letalidade com Artemia salina. A oleoresina e o óleo essencial de cúrcuma foram ativos contra Artemia salina (CL50 = 80,43 e CL50 = 319,82 μg/mL, respectivamente e também ativos contra os indivíduos adultos de Biomphalaria glabrata (CL50 = 58,3 e CL50 = 46,73 μg/mL, respectivamente. A partir dos resultados obtidos pôde ser concluído que ambos os extratos podem constituir uma alternativa no controle da população desses caramujos e na redução da esquistossomose.The turmeric is the clean rhizome at good conditions, dried and powdered of Curcuma longa L., an herbaceous plant of Zingiberaceae family. Aiming new alternatives for Schistosomiasis control, the Curcuma longa L. extracts were tested for molluscicidal activity evaluation against adult snails of Biomphalaria glabrata specie, and the toxicity (Brine Shrimp Lethality-BSL-bioassay. The oleoresin and the essential oil of turmeric were active against Artemia salina (CL50 = 80.43 and CL50 = 319.82 μg.mL-1, respectively and also active against the adult snails of Biomphalaria glabrata (CL50 = 58.3 and CL50 = 46.73 μg.mL-1, respectively. From the obtained results it was concluded that both extracts can constitute an alternative to population control of these snails and in the reduction of Schistosomiasis.

  11. Inducción de la muda de gallinas ponedoras mediante el uso de alimentos bajos en energía y proteína: efectos en la producción y en la calidad del huevo postmuda

    OpenAIRE

    Callejo Ramos, Antonio; Nicodemus Martin, Nuria; Buxade Carbo, Carlos

    2012-01-01

    La inducción de la muda en gallinas ponedoras mediante la supresión total del alimento sólido está prohibida en la UE por perjudicar el bienestar de la gallina y su sistema inmunitario. Por ello, es necesario estudiar alternativas (sin ayuno) que logren una adecuada pérdida de peso vivo para que la puesta cese rápidamente, su tract o reproductor se “rejuvenezca”, y la producción de huevos se reanude rápida y satisfactoriamente, con una mínima mo...

  12. Aplicação de nanotecnologia em embalagens de alimentos

    Directory of Open Access Journals (Sweden)

    Ana Carolina Sergio Almeida

    2015-12-01

    Full Text Available Resumo A nanotecnologia tem grande potencial de aplicação na indústria de alimentos. No desenvolvimento de embalagens, pode proporcionar diferentes alternativas, tais como o desenvolvimento de nanopartículas, nanodispersões, nanolaminados, e nanotubos, que, associados aos polímeros, podem fornecer diversas funções. Por exemplo, pela incorporação de nanopartículas com propriedades antimicrobianas; nanosensores capazes de detectar produtos químicos, agentes patogênicos e toxinas em alimentos; nanopartículas bioativas capazes de manter os compostos em condições ideais, até a sua migração para o produto alimentício e nanocompósitos, que melhorem as propriedades de flexibilidade, barreira a gases e umidade e quanto à absorção de irradiação UV dos materiais aos quais são incorporados, assim como a estabilidade frente à temperatura. Este artigo relata algumas aplicações da nanotecnologia em embalagens de alimentos, bem como questões sobre toxicidade e regulamentação relacionadas à possibilidade de migração das nanopartículas para os alimentos; razão pela qual o setor alimentício tem sido cauteloso com a utilização desses materiais.

  13. La construccion mas local de la seguridad de los alimentos: el caso de la Argentina

    OpenAIRE

    Sozzo, Gonzalo

    2013-01-01

    La cuestión de la seguridad alimentaria como inocuidad constituye un caso particular de construcción de una modalidad de gobierno de un riesgo global: el riesgo alimentario entendido como la probabilidad de sufrir una enfermedad o morir a causa de la ingesta de un alimento.

  14. High prevalence of cestodes in Artemia spp. throughout the annual cycle: relationship with abundance of avian final hosts

    Science.gov (United States)

    Sánchez, Marta I.; Nikolov, Pavel N.; GEorgieva, Darina D.; Georgiev, Boyko B.; Vasileva, Gergana P.; Pankov, Plamen; Paracuellos, Mariano; Lafferty, Kevin D.; Green, Andy J.

    2013-01-01

    Brine shrimp, Artemia spp., act as intermediate hosts for a range of cestode species that use waterbirds as their final hosts. These parasites can have marked influences on shrimp behavior and fecundity, generating the potential for cascading effects in hypersaline food webs. We present the first comprehensive study of the temporal dynamics of cestode parasites in natural populations of brine shrimp throughout the annual cycle. Over a 12-month period, clonal Artemia parthenogenetica were sampled in the Odiel marshes in Huelva, and the sexual Artemia salina was sampled in the Salinas de Cerrillos in Almería. Throughout the year, 4–45 % of A. parthenogenetica were infected with cestodes (mean species richness = 0.26), compared to 27–72 % of A. salina (mean species richness = 0.64). Ten cestode species were recorded. Male and female A. salina showed similar levels of parasitism. The most prevalent and abundant cestodes were those infecting the most abundant final hosts, especially the Greater Flamingo Phoenicopterus ruber. In particular, the flamingo parasite Flamingolepis liguloides had a prevalence of up to 43 % in A. parthenogenetica and 63.5 % in A. salina in a given month. Although there was strong seasonal variation in prevalence, abundance, and intensity of cestode infections, seasonal changes in bird counts were weak predictors of the dynamics of cestode infections. However, infection levels of Confluaria podicipina in A. parthenogenetica were positively correlated with the number of their black-necked grebe Podiceps nigricollis hosts. Similarly, infection levels of Anomotaenia tringae and Anomotaenia microphallos in A. salina were correlated with the number of shorebird hosts present the month before. Correlated seasonal transmission structured the cestode community, leading to more multiple infections than expected by chance.

  15. Identification of the glycerol kinase gene and its role in diapause embryo restart and early embryo development of Artemia sinica.

    Science.gov (United States)

    Cheng, Cheng; Yao, Feng; Chu, Bing; Li, Xuejie; Liu, Yan; Wu, Yang; Mei, Yanli; Wang, Peisheng; Hou, Lin; Zou, Xiangyang

    2014-03-01

    Glycerol kinase (GK) catalyzes the rate-limiting step in glycerol utilization by transferring a phosphate from ATP to glycerol, yielding glycerol 3-phosphate, which is an important intermediate for both energy metabolism and glycerolipid production. Artemia sinica has an unusual diapause process under stress conditions of high salinity, low temperature and lack of food. In the process, diapause embryos of A. sinica (brine shrimp) accumulate high concentrations of glycerol as a cryoprotectant to prevent low temperature damage to embryos. Upon embryo restart, glycerol is converted into glucose and other carbohydrates. Therefore, GK plays an important role in the diapause embryo restart process. However, the role of GK in diapause termination of embryo development in A. sinica remains unknown. In the present study, a 2096 bp full-length cDNA of gk from A. sinica (As-gk) was obtained, encoding putative 551 amino acids, 60.6 kDa protein. As a crucial enzyme in glycerol uptake and metabolism, GK has been conserved structurally and functionally during evolution. The expression pattern of As-gk was investigated by quantitative real-time PCR and Western blotting. Expression locations of As-gk were analyzed using in situ hybridization. As-gk was widely distributed in the early embryo and several main parts of Artemia after differentiation. The expression of As-GK was also induced by stresses such as cold exposure and high salinity. This initial research into the expression pattern and stress response of GK in Artemia provides a sound basis for further understanding of the function and regulation of genes in early embryonic development in A. sinica and the stress response. PMID:24365596

  16. The effects of feeding with synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia on skin mucus immune responses, stress resistance, intestinal microbiota and performance of angelfish (Pterophyllum scalare).

    Science.gov (United States)

    Azimirad, Mahmood; Meshkini, Saeed; Ahmadifard, Nasrollah; Hoseinifar, Seyed Hossein

    2016-07-01

    The aim of this study was to evaluate the effects of feeding on synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia franciscana on skin mucus immune responses, stress resistance, intestinal microbiota and growth performance of angelfish (Pterophyllum scalare). Three hundred and sixty fish with initial weight 3.2 ± 0.13 g were randomly divided into twelve aquaria (50 L) assigned to four groups in triplicates. Fish were fed for 7 weeks with dietary treatments, including treatment 1: feeding adult Artemia without enrichment (control group), treatment 2: feeding adult Artemia enriched with lyophilised probiotic P. acidilactici (700 mg L(-1)), 3: feeding adult Artemia enriched with prebiotic fructooligosaccharide (FOS) (100 mg L(-1)), group 4: feeding adult Artemia enriched with synbiotic (P. acidilactici (700 mg L(-1)) + FOS (100 mg L(-1))). Skin mucus immune responses (lysozyme activity, total Immunoglobulin and protease), stress resistance against environmental stress (acute decrease of temperature and increase salinity), intestinal microbiota as well as growth indices were measured at the end of feeding trial. Artemia enriched with synbiotic significantly improved growth performance compared to other treatments (P < 0.05). The highest weight gain and specific growth rate (SGR) was observed in synbiotic fed fish (P < 0.05). Compared to the other treatments, the population of lactic acid bacteria was significantly higher in the intestinal microbiota of fish fed synbiotic supplemented diet (P < 0.05). In the environmental stress challenge test, the maximum resistance to abrupt decrease of temperature (17 °C) or elevation of salinity (12 g per liter) was observed in the synbiotic treatment. Also, the total immunoglobulin and lysozyme activity level of skin mucus was significantly elevated in fish fed Artemia enriched with synbiotic (P < 0.05). These results revealed that feeding angelfish with synbiotic

  17. Temperature-dose relationships with aflatoxin M1 in milk on the brine shrimp (Artemia salina) larvae

    OpenAIRE

    Lejla Duraković; Mihaela Blažinkov; Andrea Skelin; Sanja Sikora; Frane Delaš; Mirna Mrkonjić-Fuka; Katarina Huić-Babić; Sulejman Redžepović

    2011-01-01

    Temperature-dose relationships with aflatoxin M1 (AFM1) were studied using the brine shrimp Artemia salina larvae as an biological indicator in the temperature range from 20 °C to 40 °C. Increase in the incubation temperature resulted in sensitivity increase by the brine shrimp to AFM1. Optimum sensitivity occured at 30 °C. Positive results were obtained at 0.18 μg AFM1 x L-1 of whole pasteurized milk with a mortality of over 15%. Greater than 90 % mortality occurred at dose levels of 0.9 μg ...

  18. Effect of low doses of ionizing radiation, azoxystrobin and selected heavy metals on the model organism of species Artemia franciscana

    International Nuclear Information System (INIS)

    The aim of our study was to observe the effect of low doses of ionizing radiation, azoxystrobin, zinc and chrome on the lethality of Artemia franciscana. Significant increase of the lethality was observed after 72 and 96 hours of exposure to azoxystrobin and chrome as well as to azoxystrobin, chrome and irradiation. On the other hand, we observed significant decrease of the lethality in the groups exposed to pesticide and chrome or pesticide and zinc in combination with ionizing radiation with the dose of 50 Gy at time interval of 96 hours in comparison to non-irradiated groups. (authors)

  19. Naked eye instant reversible sensing of Cu(2+) and its in situ imaging in live brine shrimp Artemia.

    Science.gov (United States)

    Nair, Ratish R; Raju, M; Patel, Neha P; Raval, Ishan H; Suresh, E; Haldar, Soumya; Chatterjee, Pabitra B

    2015-08-21

    A Cu(2+)-specific colorimetric reversible fluorescent receptor was designed and synthesized which showed a naked eye observable colour change from colourless to pink on addition of an aqueous buffer (pH 7.4) solution of 30 ppb Cu(2+). Short response time (≤5 s) and low detection limit (nearly 3 ppb) make suitable as a reliable "dip-in" open eye sensor for Cu(2+). Bio-imaging application in live brine shrimp Artemia enabled to detect Cu(2+) at as low as 10 ppb exposure. PMID:26145434

  20. Proteomic analysis of acute responses to copper sulfate stress in larvae of the brine shrimp,Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    周茜; 吴长功; 董波; 李富花; 刘凤岐; 相建海

    2010-01-01

    Proteomics was used to reveal the differential protein expression profiles of acute responses to copper sulfate exposure in larvae of Artemia sinica.Fourteen differentially displayed protein spots were detected and seven of them were identified.Three spots were up-expressed and identified:actin, heat shock protein 70,and chaperone subunit 1;three down-regulated proteins were identified:arginine kinase,elongation factor-2,and glycine-rich protein;and a newly expressed protein was identified as peroxiredoxin....

  1. Assessment of Cytotoxic Activity of Three Plants of Pigweed, Bermuda grass and Burdock via Artemia Salina Test

    OpenAIRE

    parisa sadighara; tahere aliesfahani; mahdie jafari; atousa ziaei; tahere farkhondeh

    2010-01-01

    Introduction: Pigweed is a weed which grows in the pastures of Iran. Local people use the plant leaves to cook traditional food. Bermuda grass with its rapid growth and distribution is regarded a real threat to prairies and it can lead to tremors syndrome in cattle and sheep. Burdock which also grows in many parts of Iran is used as a medicinal herb. In this study, the cytotoxicity potential of the three plants was assessed via Artemia Salina test. Methods: Pigweed, Bermuda grass and burdock ...

  2. Recreating the seawater mixture composition of HOCs in toxicity tests with Artemia franciscana by passive dosing

    Energy Technology Data Exchange (ETDEWEB)

    Rojo-Nieto, E., E-mail: elisa.rojo@uca.es [Andalusian Centre of Marine Science and Technology (CACYTMAR), Department of Environmental Technologies, University of Cadiz, 11510 Puerto Real (Spain); Smith, K.E.C. [Department of Environmental Science, Aarhus University, DK-4000 Roskilde (Denmark); Perales, J.A. [Andalusian Centre of Marine Science and Technology (CACYTMAR), Department of Environmental Technologies, University of Cadiz, 11510 Puerto Real (Spain); Mayer, P. [Department of Environmental Science, Aarhus University, DK-4000 Roskilde (Denmark)

    2012-09-15

    The toxicity testing of hydrophobic organic compounds (HOCs) in aquatic media is generally challenging, and this is even more problematic for mixtures. The hydrophobic properties of these compounds make them difficult to dissolve, and subsequently to maintain constant exposure concentrations. Evaporative and sorptive losses are highly compound-specific, which can alter not only total concentrations, but also the proportions between the compounds in the mixture. Therefore, the general aim of this study was to explore the potential of passive dosing for testing the toxicity of a PAH mixture that recreates the mixture composition found in seawater from a coastal area of Spain, the Bay of Algeciras. First, solvent spiking and passive dosing were compared for their suitability to determine the acute toxicity to Artemia franciscana nauplii of several PAHs at their respective solubility limits. Second, passive dosing was applied to recreate the seawater mixture composition of PAHs measured in a Spanish monitoring program, to test the toxicity of this mixture at different levels. HPLC analysis was used to confirm the reproducibility of the dissolved exposure concentrations for the individual PAHs and mixtures. This study shows that passive dosing has some important benefits in comparison with solvent spiking for testing HOCs in aquatic media. These include maintaining constant exposure concentrations, leading to higher reproducibility and a relative increase in toxicity. Passive dosing is also able to faithfully reproduce real mixtures of HOCs such as PAHs, in toxicity tests, reproducing both the levels and proportions of the different compounds. This provides a useful approach for studying the toxicity of environmental mixtures of HOCs, both with a view to investigating their toxicity but also for determining safety factors before such mixtures result in detrimental effects.

  3. Assessment of toxicity of Moringa oleifera flower extract to Biomphalaria glabrata, Schistosoma mansoni and Artemia salina.

    Science.gov (United States)

    Rocha-Filho, Cláudio A A; Albuquerque, Lidiane P; Silva, Luanna R S; Silva, Patrícia C B; Coelho, Luana C B B; Navarro, Daniela M A F; Albuquerque, Monica C P A; Melo, Ana Maria M A; Napoleão, Thiago H; Pontual, Emmanuel V; Paiva, Patrícia M G

    2015-08-01

    This study reports the effect of an aqueous extract from Moringa oleifera Lam. flowers on Biomphalaria glabrata embryos and adults and on Schistosoma mansoni adult worms. The extract contains tannins, saponins, flavones, flavonols, xanthones, and trypsin inhibitor activity. The toxicity of the extract on Artemia salina larvae was also investigated to determine the safety of its use for schistosomiasis control. After incubation for 24h, the flower extract significantly (p<0.05) delayed the development of B. glabrata embryos and promoted mortality of adult snails (LC50: 2.37±0.5mgmL(-1)). Furthermore, treatment with the extract disrupted the development of embryos generated by snails, with most of them remaining in the blastula stage while control embryos were already in the gastrula stage. Flower extract killed A. salina larvae with a LC50 value (0.2±0.015mgmL(-1)) lower than that determined for snails. A small reduction (17%) in molluscicidal activity was detected when flower extract (2.37mgmL(-1)) was exposed to tropical environmental conditions (UVI index ranging from 1 to 14, temperature from 25 to 30°C, and 65% relative humidity). Toxicity to A. salina was also reduced (LC50 value of 0.28±0.01mgmL(-1)). In conclusion, M. oleifera flower extract had deleterious effects on B. glabrata adults and embryos. However, unrestricted use to control schistosomiasis should be avoided due to the toxicity of this extract on A. salina. PMID:25867917

  4. Recreating the seawater mixture composition of HOCs in toxicity tests with Artemia franciscana by passive dosing

    International Nuclear Information System (INIS)

    The toxicity testing of hydrophobic organic compounds (HOCs) in aquatic media is generally challenging, and this is even more problematic for mixtures. The hydrophobic properties of these compounds make them difficult to dissolve, and subsequently to maintain constant exposure concentrations. Evaporative and sorptive losses are highly compound-specific, which can alter not only total concentrations, but also the proportions between the compounds in the mixture. Therefore, the general aim of this study was to explore the potential of passive dosing for testing the toxicity of a PAH mixture that recreates the mixture composition found in seawater from a coastal area of Spain, the Bay of Algeciras. First, solvent spiking and passive dosing were compared for their suitability to determine the acute toxicity to Artemia franciscana nauplii of several PAHs at their respective solubility limits. Second, passive dosing was applied to recreate the seawater mixture composition of PAHs measured in a Spanish monitoring program, to test the toxicity of this mixture at different levels. HPLC analysis was used to confirm the reproducibility of the dissolved exposure concentrations for the individual PAHs and mixtures. This study shows that passive dosing has some important benefits in comparison with solvent spiking for testing HOCs in aquatic media. These include maintaining constant exposure concentrations, leading to higher reproducibility and a relative increase in toxicity. Passive dosing is also able to faithfully reproduce real mixtures of HOCs such as PAHs, in toxicity tests, reproducing both the levels and proportions of the different compounds. This provides a useful approach for studying the toxicity of environmental mixtures of HOCs, both with a view to investigating their toxicity but also for determining safety factors before such mixtures result in detrimental effects.

  5. Nano-sized polystyrene affects feeding, behavior and physiology of brine shrimp Artemia franciscana larvae.

    Science.gov (United States)

    Bergami, Elisa; Bocci, Elena; Vannuccini, Maria Luisa; Monopoli, Marco; Salvati, Anna; Dawson, Kenneth A; Corsi, Ilaria

    2016-01-01

    Nano-sized polymers as polystyrene (PS) constitute one of the main challenges for marine ecosystems, since they can distribute along the whole water column affecting planktonic species and consequently disrupting the energy flow of marine ecosystems. Nowadays very little knowledge is available on the impact of nano-sized plastics on marine organisms. Therefore, the present study aims to evaluate the effects of 40nm anionic carboxylated (PS-COOH) and 50nm cationic amino (PS-NH2) polystyrene nanoparticles (PS NPs) on brine shrimp Artemia franciscana larvae. No signs of mortality were observed at 48h of exposure for both PS NPs at naplius stage but several sub-lethal effects were evident. PS-COOH (5-100μg/ml) resulted massively sequestered inside the gut lumen of larvae (48h) probably limiting food intake. Some of them were lately excreted as fecal pellets but not a full release was observed. Likewise, PS-NH2 (5-100µg/ml) accumulated in larvae (48h) but also adsorbed at the surface of sensorial antennules and appendages probably hampering larvae motility. In addition, larvae exposed to PS-NH2 undergo multiple molting events during 48h of exposure compared to controls. The activation of a defense mechanism based on a physiological process able to release toxic cationic NPs (PS-NH2) from the body can be hypothesized. The general observed accumulation of PS NPs within the gut during the 48h of exposure indicates a continuous bioavailability of nano-sized PS for planktonic species as well as a potential transfer along the trophic web. Therefore, nano-sized PS might be able to impair food uptake (feeding), behavior (motility) and physiology (multiple molting) of brine shrimp larvae with consequences not only at organism and population level but on the overall ecosystem based on the key role of zooplankton on marine food webs. PMID:26422775

  6. Liposomes with diverse compositions are protected during desiccation by LEA proteins from Artemia franciscana and trehalose.

    Science.gov (United States)

    Moore, Daniel S; Hansen, Richard; Hand, Steven C

    2016-01-01

    Intracellular accumulation of Late Embryogenesis Abundant (LEA) proteins and the disaccharide trehalose is associated with cellular desiccation tolerance in a number of animal species. Two LEA proteins from anhydrobiotic embryos of the brine shrimp Artemia franciscana were tested for the ability to protect liposomes of various compositions against desiccation-induced damage in the presence and absence of trehalose. Damage was assessed by carboxyfluorescein leakage after drying and rehydration. Further, using a cytoplasmic-localized (AfrLEA2) and a mitochondrial-targeted (AfrLEA3m) LEA protein allowed us to evaluate whether each may preferentially stabilize membranes of a particular lipid composition based on the protein's subcellular location. Both LEA proteins were able to offset damage during drying of liposomes that mimicked the lipid compositions of the inner mitochondrial membrane (with cardiolipin), outer mitochondrial membrane, and the inner leaflet of the plasma membrane. Thus liposome stabilization by AfrLEA3m or AfrLEA2 was not dependent on lipid composition, provided physiological amounts of bilayer and non-bilayer-forming lipids were present (liposomes with a non-biological composition of 100% phosphatidylcholine were not protected by either protein). Additive protection by LEA proteins plus trehalose was dependent on the lipid composition of the target membrane. Minimal additional damage occurred to liposomes stored at room temperature in the dried state for one week compared to liposomes rehydrated after 24h. Consistent with the ability to stabilize lipid bilayers, molecular modeling of the secondary structures for AfrLEA2 and AfrLEA3m revealed bands of charged amino acids similar to other amphipathic proteins that interact directly with membranes. PMID:26518519

  7. Biological screening of chitosan derivatives using Artemia spp. (brine shrimp test)

    International Nuclear Information System (INIS)

    The present study reported on the screening of six selected chitosan derivatives using the brine shrimp lethality bioassay. In addition, the irradiation effects towards the compounds at 25 kGy were also studied. Chitosan is a natural polysaccharide derived from chitin, extracted from the exoskeletons of crustaceans and insects as well as walls of some bacteria and fungi. Brine shrimp test is employed for the screening of toxicity of chitosan derivatives. Toxicity test was carried out by adding different concentrations of tested samples to approximately 5 to 15 Artemia salina larvae. Biological activity using the brine shrimp bioassay was recorded as LC50 i.e. lethal concentration that kills 50% of the larvae within 24 hours of contact with the samples. Compounds are considered toxic when the LC50 value is lower than 1 mg/ml by brine shrimp bioassay and practically non-toxic when the value is larger. Of the samples tested, none were toxic to the brine shrimp (LC50 > 1 mg/ml). The LC50 values of all chitosan derivatives tested, control and irradiated at 25 kGy were above 1 mg/ml thus all tested samples are considered non-toxic. This study demonstrated that irradiation at 25 kGy showed no significant effects towards the toxicity of the chitosan derivatives. After irradiation, only NO-CMC exhibited marked decrease in LC50 value, reduced by 3-fold from 34.96 mg/ml to 11.07 mg/ml while O-CMC (5.45 mg/ml to 5 mg/ml) showed no clear differences based on rough estimation. This study suggested that brine shrimp bioassay is a simple, reliable and convenient method that could provide useful clues of the relative toxic potential of the sample tested. (Author)

  8. Exactitud de las tablas de composición de alimentos en la determinación de nutrientes

    OpenAIRE

    R. Pérez Grana

    2013-01-01

    Las tablas de composición de alimentos constituyen una herramienta imprescindible para realizar una valoración nutricional de alimentos o de ingesta en las Fuerzas Armadas. Ofrecen una información semicuantitativa, más exacta para los macronutrientes o algunos elementos minerales mayoritarios (potasio, calcio y fósforo), y menos exacta para vitaminas y elementos minerales traza. Las diferencias entre las tablas de composición de alimentos y los análisis químicos son variables dependiendo de l...

  9. El mercado de los alimentos funcionales y los nuevos retos para la educación alimentaria - nutricional

    OpenAIRE

    Patricia Sedó Masís

    2002-01-01

    El estudio de los alimentos cobra cada día más importancia, dada la alta incidencia de enfermedades crónicas y cáncer, y el reconocimiento de que la dieta, como parte de un estilo de vida saludable, tiene un papel preponderante en la prevención y cura de enfermedades. Paralelo a la investigación de alimentos naturales, surgen nuevas corrientes en el procesamiento de alimentos, las cuales vienen a dar respuesta a las necesidades de los consumidores por adquirir productos procesados más "saluda...

  10. Competencias profesionales de un ingeniero en alimentos. Un estudio sobre su formación matemática

    OpenAIRE

    Muñoz, Hernán

    2004-01-01

    Esta presentación da cuenta de una investigación de tipo cualitativo que genera y sistematiza la información sobre las competencias profesionales y matemáticas de un Ingeniero en Alimentos. Las fuentes utilizadas fueron análisis bibliográfico sobre competencias profesionales, focus group realizados con ingenieros en alimentos de empresas y con académicos de universidades y entrevistas en profundidad realizadas a académicos de las universidades y a ingenieros en alimentos. Se integró y comparó...

  11. Estudio sobre el comportamiento de bacterias patógenas entéricas vehiculadas por alimentos

    OpenAIRE

    Fernández Escudero, Irene

    2015-01-01

    En Microbiología de los Alimentos destacan dos campos de interés: la protección de los consumidores frente a enfermedades transmitidas por alimentos y la prevención de alteraciones de los productos por estos agentes. La familia Enterobacteriaceae constituye uno de los principales ejemplos de bacterias vehiculadas por alimentos, de la que forman parte las especies Escherichia coli y Cronobacter sakazakii. La creación de modelos predictivos y el estudio de su comportamiento constituyen herramie...

  12. Caracterização de alergenos de frutos secos e o seu papel na alergia a alimentos vegetais

    OpenAIRE

    Pereira, Cátia Liliana Morais

    2013-01-01

    As alergias alimentares são um problema comum nos países ocidentais. Na última década, estas doenças têm aumentado significativamente e actualmente é estimado que afectem 2-8% da população. Nas alergias alimentares, a alergia a alimentos vegetais é a mais frequente na população adulta e a maioria dos alergenos de alimentos vegetais pertencem a famílias de proteínas com funções de defesa e armazenamento. Entre as alergias a alimentos vegetais, há um interesse especial na alergia a frutos se...

  13. Disponibilidad de alimentos básicos en Colombia 2000-2010: ¿producción nacional o importaciones?

    OpenAIRE

    López Hernández, Diego

    2012-01-01

    Como dimensión constitutiva de la seguridad alimentaria, la disponibilidad de alimentos plantea la inquietud sobre la manera de obtener el suministro de alimentos para el país. Frente a este aspecto, la agricultura juega un papel determinante, pues puede ser ésta la que principalmente produzca los alimentos o, desde otra estrategia, la que genere los recursos para importarlos, a través de la producción de otros bienes agrícolas. Este documento establece en qué medida el suministro de un grupo...

  14. Las regulaciones de alimentos y su eficacia para responder a las exigencias de calidad del consumidor argentino

    OpenAIRE

    Lacaze, María Victoria

    2008-01-01

    Desde finales del siglo XX, los mercados de alimentos están experimentando importantes cambios. La seguridad alimentaria se ha convertido, en consecuencia, en uno de los temas clave de discusión. Las poblaciones con excedentes alimentarios están interesadas y preocupadas por la alimentación, la nutrición y la inocuidad de los alimentos. Cobra importancia, en ese contexto, la calidad de los alimentos y los mecanismos regulatorios que proporcionan garantías al respecto. Las decisiones de consum...

  15. Fortification of industrialized foods with vitamins Fortificação de alimentos industrializados com vitaminas

    Directory of Open Access Journals (Sweden)

    Selma Coelho Liberato

    2006-04-01

    Full Text Available Vitamins are essential to life. Inadequate eating habits, high caloric intake and metabolic defects lead to micronutrient deficiencies, affecting more than two billion people worldwide. The increasing intake of industrialized foods, combined with low vitamin stability has led to the common practice of adding these nutrients to processed foods. This review discusses the terminology, availability, intake and risk of hypervitaminosis, due to the intake and nutritional importance of foods fortified with vitamins. The addition of nutrients should occur in foods that are effectively consumed by the target population and must meet the real needs of a significant segment of the population. In Brazil, a total of 166 products available in supermarkets are vitamin-enriched. A 10-year study involving children and adolescents in Germany showed that 90% of those surveyed used at least one fortified food. During this 10-year period, 472 fortified products were consumed. The enrichment of foods should be based on the needs of each country and, if possible, regional needs. For instance, in order to increase its intake, Vitamin D is added to foods in Denmark during the winter, mainly for the elderly. However, in Brazil, there is no evidence of the need to fortify food with this vitamin. A survey showed that of the 76 enriched dairy products, 37 contained vitamin D. Food-fortification is a very important strategy to solve nutritional deficiency problems, but it can also cause many health problems.Vitaminas são nutrientes essenciais à vida. Hábitos alimentares inadequados, alto consumo energético e falhas no metabolismo levam a deficiências de micronutrientes, que afetam mais de dois bilhões de pessoas mundialmente. O consumo, cada vez maior, de alimentos industrializados, somado à baixa estabilidade das vitaminas, têm induzido à prática de adição de nutrientes aos alimentos processados. Esta revisão discute terminologia, disponibilidade, ingestão e

  16. Desarrollo biológico e instalación del mírido depredador Nesidiocoris tenuis en el cultivo del tomate con quistes desencapsulados de Artemia sp. como alimento alternativo

    OpenAIRE

    ALONSO VALIENTE, MIQUEL

    2015-01-01

    [EN] Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) caused great damage in tomato crops during the first years after its introduction in 2006. After several years using insecticides, its integrated management was improved via the use of the predatory mirid Nesidiocoris tenuis Reuter (Hemiptera: Miridae). N. tenuis is currently used in southeastern Spanish greenhouses. This predator is reared by several companies using the eggs of the mill moth, Ephestia kuehniella (Zeller) ...

  17. Evaluando la aceptación de alimentos en escolares: registro visual cualitativo frente a análisis de residuos de alimentos

    Directory of Open Access Journals (Sweden)

    Alejandra Rodríguez-Tadeo

    2014-05-01

    Full Text Available Introducción: Los comedores escolares cuentan con normativa de gestión y supervisión de menús, sin embargo no se ha valorado si son consumidos en su totalidad. Objetivo: Valorar la aceptación de alimentos mediante pesado de restos y validación de una metodología visual para su estimación en comedores escolares de Murcia. Metodología: Participaron escolares de segundo y tercer ciclo de educación primaria, de 8-12 años. La estimación de restos se realizó mediante pesado de alimentos de 765 bandejas. La valoración visual (300 bandejas se realizó con escala categórica: 1 = 0-25%; 2 = 26-50%; 3 = 5175% y 4 = 76-100%, por dos dietistas y se valoró la fiabilidad con respecto al pesado de alimentos. La concordancia entre ambos métodos fue evaluada en dos muestras estratificadas por la presencia/ausencia de cocina en la escuela. Resultados: Los primeros platos con más restos fueron pasta, arroz y purés de verduras siendo mayor en aquellos colegios sin cocina en el centro (p < 0,05. También los segundos platos a base de legumbres, ave y pescado y ensaladas de guarnición. Las frutas y el total de restos son superiores en colegios sin cocina (p < 0,05. La concordancia entre evaluadoras fue alta en platos a base de carnes y en ensaladas, y considerable en legumbres, precocinados, tortilla de huevo, pasta, pescado y arroz. Conclusiones: Los restos son elevados y existieron diferencias en la aceptación de ciertos alimentos acorde al tipo de menú ofertado. La escala visual es una herramienta confiable para medir la aceptación de forma indirecta, pero necesita capacitación y entrenamiento del personal implicado.

  18. Effect of municipal waste water effluent upon the expression of Glutathione S-transferase isoenzymes of brine shrimp Artemia.

    Science.gov (United States)

    Grammou, Athina; Papadimitriou, Chrisa; Samaras, Peter; Vasara, Eleni; Papadopoulos, Athanasios I

    2011-06-01

    Multiple isoenzymes of the detoxification enzyme family Glutathione S-transferase are expressed in the brine shrimp Artemia. The number of the major ones detected in crude extract by means of chromatofocusing varied between three and four, depending on the age. Two isoenzymes, one alkaline and one neutral (with corresponding isoelectric points of 8.5 and 7.2) appear to be dominant in all three developmental stages studied, (24, 48, and 72 h after hatching). Culturing Artemia for 48 h after hatching, in artificial sea water prepared by municipal wastewater effluent resulted to significant alterations of the isoenzyme profile. In comparison to organisms cultured for the same period of time in artificial sea water prepared by filtered tap water, the expression of the alkaline isoenzyme decreased by 62% while that of the neutral isoenzyme increased by 58%. Furthermore, the enzyme activity of the major isoenzyme of the acidic area increased by more than two folds. It is worth mentioning that although the specific activity of the total enzyme in the whole body homogenate was elevated, no statistically significant alteration of the Km value was observed. These findings suggest that study of the isoenzyme profile of Glutathione S-transferase may offer high sensitivity in detecting environmental pollution and needs to be further investigated. PMID:21429555

  19. A note on the biogeographical origin of the brine shrimp Artemia urmiana Günther, 1899 from Urmia Lake, Iran.

    Science.gov (United States)

    Eimanifar, Amin; Asem, Alireza; Djamali, Morteza; Wink, Michael

    2016-01-01

    The brine shrimp Artemia urmiana, an abundant inhabitant of the hypersaline Urmia Lake in northwestern Iran, has recently been described from Lake Koyashskoe, also a shallow hypersaline lake that is located on the Black Sea coast of the Crimean Peninsula (Ukraine). This discovery has questioned the endemicity of A. urmiana in Urmia Lake and has also brought into question the biogeographical origin of this species. In the present study, we combined recent genetic divergence data (mtDNA-COI) with palaeoecological evidence to address the biogeographical origin of A. urmiana. Calibration of the molecular clock of the COI region was set by assigning the age of the micro-crustacean Daphnia pulex minimally at 145 Mya. The divergence age of A. urmiana in Urmia Lake dates back to 383,000 years, whereas Ukrainian Artemia reflects a very young populations that diverged about 196,000 years ago. Palaeoecological evidence suggests that the age of the major habitat of A. urmiana i.e. Urmia Lake goes back to the Tertiary Period while the Ukranian habitats of the species are very young, by virtue of geological features of the Holocene age. We conclude that the biogeographical origin of A. urmiana is outside of Europe and the current state of knowledge strongly suggests that Urmia Lake has been the major source of its expansion into its modern habitats in Europe. PMID:27394547

  20. Probing the phenomenon of trained immunity in invertebrates during a transgenerational study, using brine shrimp Artemia as a model system.

    Science.gov (United States)

    Norouzitallab, Parisa; Baruah, Kartik; Biswas, Priyanka; Vanrompay, Daisy; Bossier, Peter

    2016-01-01

    The invertebrate's innate immune system was reported to show some form of adaptive features, termed trained immunity. However, the memory characteristics of innate immune system and the mechanisms behind such phenomena remain unclear. Using the invertebrate model Artemia, we verified the possibility or impossibility of trained immunity, examining the presence or absence of enduring memory against homologous and heterologous antigens (Vibrio spp.) during a transgenerational study. We also determined the mechanisms behind such phenomenon. Our results showed the occurrence of memory and partial discrimination in Artemia's immune system, as manifested by increased resistance, for three successive generations, of the progenies of Vibrio-exposed ancestors towards a homologous bacterial strain, rather than to a heterologous strain. This increased resistance phenotype was associated with elevated levels of hsp70 and hmgb1 signaling molecules and alteration in the expression of key innate immunity-related genes. Our results also showed stochastic pattern in the acetylation and methylation levels of H4 and H3K4me3 histones, respectively, in the progenies whose ancestors were challenged. Overall results suggest that innate immune responses in invertebrates have the capacity to be trained, and epigenetic reprogramming of (selected) innate immune effectors is likely to have central place in the mechanisms leading to trained immunity. PMID:26876951

  1. Assessment of Cytotoxic Activity of Three Plants of Pigweed, Bermuda grass and Burdock via Artemia Salina Test

    Directory of Open Access Journals (Sweden)

    parisa sadighara

    2010-01-01

    Full Text Available Introduction: Pigweed is a weed which grows in the pastures of Iran. Local people use the plant leaves to cook traditional food. Bermuda grass with its rapid growth and distribution is regarded a real threat to prairies and it can lead to tremors syndrome in cattle and sheep. Burdock which also grows in many parts of Iran is used as a medicinal herb. In this study, the cytotoxicity potential of the three plants was assessed via Artemia Salina test. Methods: Pigweed, Bermuda grass and burdock were collected from Ghaemshahr in the North of Iran. The leaves were dried and the essence of the three plants was extracted. The larvaes were hatched from cysts of Artemia salina at 26˚C in filtered seawater. The plant extracts with different concentration (10,100 and 1000ppm were added to the solution larvaes. Results: The LC50 values (the concentration which needed to die half the larvaes were measured for pigweed, Bermuda grass and burdock at 1640, 990, and 840 ppm, respectively. Conclusion: The results indicate that compared to the two other species, there is more priority for burdock to be studied in further studies for identification and assessment of toxicity

  2. Incidencia de los atributos de calidad en las percepciones y elecciones de los consumidores de alimentos orgánicos

    OpenAIRE

    Rodríguez, Elsa Mirta M.; Lupín, Beatriz; Lacaze, María Victoria

    2006-01-01

    Este trabajo plantea como objetivo identificar potenciales consumidores de alimentos orgánicos a partir de sus percepciones de riesgos, y evaluar la incidencia de los atributos de calidad de estos productos en las decisiones de consumo.

  3. Culture of Artemia on rice bran: the conversion of a waste-product into highly nutritive animal protein

    OpenAIRE

    Sorgeloos, P.; Baeza-Mesa, M.; Bossuyt, E.; Bruggeman, E.; Dobbeleir, J.; Versichele, D.; Laviña, E.; Bernardino, A.

    1980-01-01

    The age-old problem of finding a cheap and suitable food for Artemia is finally solved with rice bran, in fact a waste-product which is available at a very low price in many countries all over the world.

  4. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine): the use of brine shrimp Artemia salina in a variably saline lagoon complex.

    NARCIS (Netherlands)

    Verkuil, Y.; Have, van der T.M.; Winden, van der J.; Chernichko, I.I.

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  5. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine) : The use of Brine Shrimp Artemia salina in a variably saline lagoon complex

    NARCIS (Netherlands)

    Verkuil, Y; Van der Have, TM; Van der Winden, J; Chernichko, [No Value

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  6. Representaciones sociales asociadas al consumo hedónico de alimentos en restaurantes

    Directory of Open Access Journals (Sweden)

    Claudia Mercedes Padrón Mercado

    2011-01-01

    Full Text Available Esta investigación tuvo como objetivo establecer las representaciones sociales asociadas al consumo hedónico de alimentos en restaurantes para personas de los estratos 2 al 6 en la ciudad de Bogotá ¿ Colombia. Se realizó un estudio descriptivo multidimensional basado en los resultados de una encuesta estructurada con preguntas abiertas y cerradas. Para el análisis de los datos se emplearon análisis lexicométricos y análisis Multivariados. Los resultados dan a conocer el núcleo central y sistema periférico de las representaciones sociales asociadas al consumo hedónico de alimentos, donde se observaron aspectos personales, sociales y culturales que permitieron realizar una segmentación psicográfica de acuerdo a las características de diferentes tipos de comensales encontrados.

  7. Alimentos transgénicos ¿Qué tan seguro es su consumo?

    OpenAIRE

    Fernández Suárez María del Rocío

    2011-01-01

    Los alimentos transgénicos están en la mesa de los consumidores de muchos países en el mundo desde hace ya casi quince años. A lo largo de todo este período, el debate en torno a la seguridad de los mismos no ha cesado. Por un lado, las compañías biotecnológicas productoras de organismos genéticamente modificados, apoyadas por un sector de la comunidad científica (a veces ligado directa o indirectamente a los intereses de las mismas compañías), afirman que los alimentos transgénicos son segu...

  8. Rendimiento reproductivo de hembras de Cryphiops caementarius (Crustacea: Palaemonidae mantenidas con alimento natural

    Directory of Open Access Journals (Sweden)

    Magali Bazán

    2011-07-01

    Full Text Available El objetivo del presente trabajo fue determinar el rendimiento reproductivo de hembras de C. caementarius mantenidas con alimento natural. Se empleó 24 hembras inmaduras (5,2 cm y 2,0 g, acondicionadas en ocho acuarios (45 L y alimentadas durante dos meses de acuerdo a cada tratamiento, con pota (Dosidicus sp., almeja (Semele solida, poliqueto (Pseudonereis sp. y con alimento balanceado. El rendimiento reproductivo de las hembras fue mejorado cuando se alimentó con poliqueto y pota, lográndose la maduración entre 16 y 18 días con alta fecundidad (2627 y 1377 huevos g-1 y fertilidad (2566 y 1364 larvas g-1, respectivamente.

  9. Crecimiento restringido por la balanza de pagos en países exportadores de alimentos

    Directory of Open Access Journals (Sweden)

    Pablo Ignacio Chena

    2008-01-01

    Full Text Available El presente trabajo analiza las posibilidades de los países exportadores de alimentos en América Latina de evitar la restricción externa y crecer de forma sostenida con las nuevas tendencias en los precios mundiales de los commodities agropecuarios. En este nuevo escenario, el artículo destaca la importancia de la elasticidad ingreso de la demanda interna de alimentos como freno a un modelo de crecimiento impulsado por las exportaciones de bienes de primera necesidad. Todo ello en un contexto en el cual la heterogeneidad estructural propia de las economías latinoamericanas disminuye la efectividad de los cambios en los precios relativos como instrumento para sortear la restricción externa en el largo plazo.

  10. Detrimental effect of CO2-driven seawater acidification on a crustacean brine shrimp, Artemia sinica.

    Science.gov (United States)

    Zheng, Chao-qun; Jeswin, Joseph; Shen, Kai-li; Lablche, Meghan; Wang, Ke-jian; Liu, Hai-peng

    2015-03-01

    The effects of the decline in ocean pH, termed as ocean acidification due to the elevated carbon dioxide in the atmosphere, on calcifying organisms such as marine crustacean are unclear. To understand the possible effects of ocean acidification on the physiological responses of a marine model crustacean brine shrimp, Artemia sinica, three groups of the cysts or animals were raised at different pH levels (8.2 as control; 7.8 and 7.6 as acidification stress according to the predictions for the end of this century and next century accordingly) for 24 h or two weeks, respectively, followed by examination of their hatching success, morphological appearance such as deformity and microstructure of animal body, growth (i.e. body length), survival rate, expression of selected genes (involved in development, immunity and cellular activity etc), and biological activity of several key enzymes (participated in antioxidant responses and physiological reactions etc). Our results clearly demonstrated that the cysts hatching rate, growth at late stage of acidification stress, and animal survival rate of brine shrimp were all reduced due to lower pH level (7.6 & 7.8) on comparison to the control group (pH 8.2), but no obvious change in deformity or microstructure of brine shrimp was present under these acidification stress by microscopy observation and section analysis. In addition, the animals subjected to a lower pH level of seawater underwent changes on their gene expressions, including Spätzle, MyD88, Notch, Gram-negative bacteria binding protein, prophenoloxidase, Apoptosis inhibitor 5, Trachealess, Caveolin-1 and Cyclin K. Meanwhile, several key enzyme activities, including superoxide dismutase, catalase, peroxidase, alkaline phosphatase and acid phosphatase, were also affected by acidified seawater stress. Taken together, our findings supports the idea that CO2-driven seawater acidification indeed has a detrimental effect, in case of hatching success, growth and survival, on

  11. Quiescence in Artemia franciscana embryos: reversible arrest of metabolism and gene expression at low oxygen levels.

    Science.gov (United States)

    Hand, S C

    1998-04-01

    Depression of the production and consumption of cellular energy appears to be a prerequisite for the survival of prolonged bouts of anoxia. A correlation exists between the degree of metabolic depression under anoxia and the duration of anoxia tolerance. In the case of brine shrimp (Artemia franciscana) embryos, oxygen deprivation induces a reversible quiescent state that can be tolerated for several years with substantial survivorship. A global arrest of cytoplasmic translation accompanies the transition into anoxia, and rates of protein synthesis in mitochondria from these embryos appears to be markedly reduced in response to anoxia. Previous evidence suggests that the acute acidification of intracellular pH (pHi) by over 1.0 unit during the transition into anoxia contributes to the depression of biosynthesis, but message limitation does not appear to play a role in the down-regulation in either cellular compartment. The ontogenetic increase in mRNA levels for a mitochondrial-encoded subunit of cytochrome c oxidase (COX I) and for nuclear-encoded actin is blocked by anoxia and aerobic acidosis (artificial quiescence imposed by intracellular acidification under aerobic conditions). Further, the levels of COX I and actin mRNA do not decline appreciably during 6 h bouts of quiescence, even though protein synthesis is acutely arrested across this same period. Thus, the constancy of mRNA levels during quiescence indicates that reduced protein synthesis is not caused by message limitation but, instead, is probably controlled at the translational level. This apparent stabilization of mRNA under anoxia is mirrored in an extension of protein half-life. The ubiquitin-dependent pathway for protein degradation is depressed under anoxia and aerobic acidosis, as judged by the acute drop in levels of ubiquitin-conjugated proteins. Mitochondrial protein synthesis is responsive to both acidification of pHi and removal of oxygen per se. Matrix pH declines in parallel with pHi, and

  12. Nova geração de embalagens alimentares pretende aumentar a vida útil dos alimentos

    OpenAIRE

    Sanches-Silva, Ana; Carvalho-Costa, Denise; Albuquerque, T.G.; Costa, H. S.

    2015-01-01

    O Instituto Nacional de Saúde Doutor Ricardo Jorge (Instituto Ricardo Jorge) tem em curso um projeto de investigação que visa desenvolver uma embalagem biodegradável para aumentar a vida útil dos alimentos. Com o acrónimo de “Rose4Pack”, os investigadores têm pela frente um importante desafio na área da nova geração de embalagens alimentares.

  13. Fatores de influência no comportamento de compra de alimentos por crianças

    Directory of Open Access Journals (Sweden)

    Alipio Ramos Veiga Neto

    2013-06-01

    Full Text Available A escolha alimentar nas sociedades contemporâneas passa, inevitavelmente, pelo comércio, pois o alimento constitui-se mercadoria que é consumida, assim como tantos outros bens e serviços. Atualmente muitas crianças já definem sozinhas suas escolhas alimentares, provocando a atenção tanto de empresas como de organizações preocupadas com sua nutrição. Utilizando o modelo BPM (Behavioral Perpective Model, criado por Foxall (2010, fundamentado na psicologia do consumidor e estruturado na tríplice contingência de Skinner, analisaram-se os fatores que influenciam crianças em seu comportamento de compra de alimentos. Tendo como sujeitos 175 alunos com idades compreendidas entre 10 e 12 anos, identificaram-se 35 variáveis que foram classificadas entre estímulos antecedentes (cenário ou histórico de aprendizado e consequentes (reforço utilitário ou informativo no comportamento de compra. Verificou-se que os estímulos reforçadores (consequentes têm maior grau de importância para a decisão de compra de alimentos desses sujeitos do que os estímulos antecedentes, sendo que as consequências utilitárias são mais influentes do que as informativas. Conclui-se que os atributos dos produtos, como sabor e qualidade, têm maior influência na decisão de compra do que os estímulos ambientais, como as promoções e publicidade dos alimentos.

  14. Efeito alelopático e toxicidade frente à Artemia salina Leach dos extatos do fruto de Euterpe edulis Martius Allelopathic effects and toxicity against Artemia salina Leach of extracts of the fruit of Euterpe edulis Martius

    Directory of Open Access Journals (Sweden)

    Cristina Peitz de Lima

    2011-06-01

    Full Text Available Alelopatia é um processo envolvendo metabólitos secundários produzidos por plantas que infl uenciam o crescimento e desenvolvimento de sistemas agrícolas. Devido à toxicidade dos herbicidas sintéticos para o meio ambiente e para a saúde humana tem-se aumentado o interesse na exploração da alelopatia como uma alternativa para o controle de plantas daninhas. O presente trabalho avaliou efeito dos extratos dos frutos de Euterpe edulis Martius sobre o desenvolvimento de cipselas e plântulas de Lactuca sativa Linné, foram determinados o índice de velocidade de germinação, o crescimento da radícula e do hipocótilo. Para a avaliação da toxicidade dos extratos foi realizado o ensaio de toxicidade frente ao microcrustáceo Artemia salina Leach determinando-se a CL50 e percentual de mortalidade. A fração remanescente demonstrou efeito alelopático, pois todas as concentrações alteraram os valores do índice de velocidade de germinação e as concentrações de 0,2 e 0,4 mg inibiram tanto o crescimento da radícula quanto o crescimento do hipocótilo. No ensaio de toxicidade todos os extratos apresentaram CL50 superior a 1000 ppm e 0% de mortalidade das artemias, indicando a não toxicidade dos extratos.Allelopathy is a process involving secondary metabolites produced by plants that influence growth and development of agricultural systems. Because of the toxicity of synthetic herbicides to the environment and human health, there has been increased interest in exploiting allelopathy as an alternative for weed control. This study evaluated the eff ect of extracts of Euterpe edulis Martius fruits on the development of cypselae and seedlings of Lactuca sativa Linné; the germination speed index, radicle and hypocotyl growth were determined. To evaluate the toxicity of the extracts the toxicity test against Artemia salina Leach was used, where the LC50 and mortality rate were determined. Th e remaining fraction showed allelopathic effect

  15. Eficiencia en la adquisición de alimentos en el sector público colombiano

    Directory of Open Access Journals (Sweden)

    Diego Alejandro Peralta Borray

    2015-12-01

    Full Text Available Dada la magnitud y el potencial del mercado de compras públicas dealimentos en Colombia y la tendencia que se ha venido dando en AméricaLatina en relación a la utilización de la contratación como mecanismo paraintervenir las entidades públicas y la economía, se hace imperiosa la necesidad de contar con herramientas que permitan medir la gestión de los administradores públicos al respecto. Este documento propone un indicador para la medición de la eficiencia en relación a la compra de alimentos de las entidades públicas, además, analiza si el uso de diferentes formas de contratación influye en sus niveles de eficiencia. También entrega elementos estadísticos razonables para determinar la mejor forma de abastecimiento de alimentos para los proyectos, programas y servicios estatales. La muestra evaluada corresponde a la observación de 139 referencias de alimentos crudos, comprados periódicamente por las entidades entre los años 2005 y 2009, y utilizados en su mayoría para la prestación de servicios de alimentación y/o su entrega directa a la población con una inversión promedio a 43 302 millones de pesos anuales.

  16. Alimentos Balanceados Para Animales A Partir De Residuos Orgánicos

    Directory of Open Access Journals (Sweden)

    Amelia Vidales Olivo

    2004-01-01

    Full Text Available En esta investigación se encontró un proceso idóneo para la elaboración de alimentos balanceados para animales domésticos y mascotas; cuyo contenido nutricional cumplió con las expectativas de los parámetros establecidos y regidos por la norma 499 de NRC (Comité sobre Nutrición Animal de la Academia Nacional de Ciencia de Estados Unidos – National Research Council, tomando en cuenta primordialmente que el proceso empleado no generara contaminación para el medio ambiente; sino todo lo contrario este alimento utilizó como materia prima los residuos orgánicos (esqueleto de pescado, cascarón de huevo, olote, tortilla, para balancear los constituyentes del producto elaborado. El proyecto de investigación fue realizado en el segundo semestre del 2000 al primer semestre del 2003, tiempo suficiente para probar la eficiencia del alimento elaborado para (pollos; observando el desarrollo de los animales y registrando cada día los cambios en peso presentados en ellos. También se comprobó la hipótesis del trabajo aportando resultados (ver tabla 4, beneficios y conclusiones

  17. TRATAMIENTO DE DATOS POR MEDIO DE LA COMPUTADORA, PARA LA PREPARACIÓN DE ALIMENTOS CONCENTRADOS.

    Directory of Open Access Journals (Sweden)

    Pizza Jorge

    2010-09-01

    Full Text Available La explotación industrial de animales para el consumo humano exige estudios de formulación analítica de los alimentos concentrados, especialmente en lo que concierne al requerimiento calórico del animal y a su peso metabólico. En toda formulación para alimentos concentrados, la estandarización de una fórmula cualquiera exige cálculos muy largos, basados únicamente en el método de ensayo y error, debido a que en cada tanteo es necesario efectuar un alto número de permutaciones de los porcentajes de la composición de las materias primas que intervienen en la constitución del concentrado. El presente trabajo constituye el primer intento realizado en este campo, mediante el uso racional de la computadora. Hemos elaborado un programa de cálculo CALICON en FORTRAN IV, el cual suministra la fórmula de un alimento concentrado dependiendo de la clase de animal que va a ser alimentado. Además, dentro de una misma formulación, el programa elabora simultáneamente una serie de fórmulas, las cuales suministran la misma energía metabolizable y que proporcionan una composición alimenticia semejante, todas dentro de los límites permisibles que el usuario podrá elegir, dependiendo de sus propios criterios y necesidades industriales.

  18. Sustitución de alimento concentrado, con morera fresca (Morus alba, en la dieta de vacas lecheras

    Directory of Open Access Journals (Sweden)

    Carlos Boschini

    2003-01-01

    Full Text Available Se experimentaron cuatro dietas balanceadas con sustitución de alimento concentrado por la inclusión de 0, 20, 40 y 60% de materia seca de hojas de morera de 84 días. El consumo de materia seca total fue de 3,12 a 3,24% con relación al peso vivo. No se apreciaron diferencias importantes (P≥0,05 en el consumo total de MS entre vacas dentro de un mismo tratamiento. En la dieta sin morera (0%, el forraje constituyó el 42% y en la dieta con 60% de morera constituyó el 86% de la materia seca. El consumo de morera fue cercano a 2% en la dieta con 60%. La tasa de sustitución fue de 677 g/animal- /día de materia seca de concentrado por cada kilogramo de materia seca de morera agregada a la dieta, más la sustitución de 323 g/animal/día del sorgo negro forrajero y de la soja en mezcla para los dietas que contienen esta última. El reemplazo de proteína fue de 576 g/animal/día del concentrado y 424 g/animal/día del sorgo negro forrajero y soja por cada kilogramo de proteína cruda de morera adicionada. Cada megacalor ía de energía digestible de morera agregada a la dieta sustituyó 0,675 mcal/animal/día de energía del concentrado y 0,325 mcal/animal/día de la mezcla sorgo negro forrajero y soja. Se encontraron diferencias (P0,05 entre el peso inicial y final de los animales y las variaciones de producción de leche diaria fueron de pequeña magnitud dentro de dietas.

  19. The potential role of As-sumo-1 in the embryonic diapause process and early embryo development of Artemia sinica.

    Directory of Open Access Journals (Sweden)

    Bing Chu

    Full Text Available During embryonic development of Artemia sinica, environmental stresses induce the embryo diapause phenomenon, required to resist apoptosis and regulate cell cycle activity. The small ubiquitin-related modifier-1 (SUMO, a reversible post-translational protein modifier, plays an important role in embryo development. SUMO regulates multiple cellular processes, including development and other biological processes. The molecular mechanism of diapause, diapause termination and the role of As-sumo-1 in this processes and in early embryo development of Artemia sinica still remains unknown. In this study, the complete cDNA sequences of the sumo-1 homolog, sumo ligase homolog, caspase-1 homolog and cyclin B homolog from Artemia sinica were cloned. The mRNA expression patterns of As-sumo-1, sumo ligase, caspase-1, cyclin B and the location of As-sumo-1 were investigated. SUMO-1, p53, Mdm2, Caspase-1, Cyclin B and Cyclin E proteins were analyzed during different developmental stages of the embryo of A. sinica. Small interfering RNA (siRNA was used to verify the function of sumo-1 in A. sinica. The full-length cDNA of As-sumo-1 was 476 bp, encoding a 92 amino acid protein. The As-caspases-1 cDNA was 966 bp, encoding a 245 amino-acid protein. The As-sumo ligase cDNA was 1556 bp encoding, a 343 amino acid protein, and the cyclin B cDNA was 739 bp, encoding a 133 amino acid protein. The expressions of As-sumo-1, As-caspase-1 and As-cyclin B were highest at the 10 h stage of embryonic development, and As-sumo ligase showed its highest expression at 0 h. The expression of As-SUMO-1 showed no tissue or organ specificity. Western blotting showed high expression of As-SUMO-1, p53, Mdm2, Caspase-1, Cyclin B and Cyclin E at the 10 h stage. The siRNA caused abnormal development of the embryo, with increased malformation and mortality. As-SUMO-1 is a crucial regulation and modification protein resumption of embryonic diapause and early embryo development of A. sinica.

  20. http://revistas.unicordoba.edu.co/revistamvz/mvz-182/v18n2a12.pdf

    OpenAIRE

    Rubén Valbuena V.; Beatriz Zapata-Berruecos; Angélica Otero-Paternina

    2013-01-01

    Objetivo. Evaluar el desempeño y sobrevivencia de larvas de capaz Pimelodus grosskopfii suministrando alimento vivo (Cladóceros, Copépodos y Artemia salina). Materiales y métodos. Larvas de capaz fueron ubicadas en recipientes plásticos con un volumen útil de 3 L, a una densidad de 10 larvas L-1, fueron alimentadas cuatro veces al día, durante 15 días con nauplios de Artemia recién eclosionadas, Cladóceros de los géneros Moina y Ceriodaphnia y Copépodos calanoides. Las larvas de capaz se pesa...

  1. Evaluación de la primera alimentación en larvas de capaz Pimelodus grosskopfii bajo condiciones de laboratorio

    OpenAIRE

    Valbuena V, Rubén; Zapata-Berruecos, Beatriz; Otero-Paternina, Angélica

    2015-01-01

    RESUMENObjetivo. Evaluar el desempeño y sobrevivencia de larvas de capaz Pimelodus grosskopfii suministrando alimento vivo (Cladóceros, Copépodos y Artemia salina). Materiales y métodos. Larvas de capaz fueron ubicadas en recipientes plásticos con un volumen útil de 3 L, a una densidad de 10 larvas L-1, fueron alimentadas cuatro veces al día, durante 15 días con nauplios de Artemia recién eclosionadas, Cladóceros de los géneros Moina y Ceriodaphnia y Copépodos calanoides. Las larvas de capaz ...

  2. Observações preliminares sobre a toxicidade do ϒBHC e do cloreto de mercúrio à Artemia salina Preliminary observations on the toxicity of ϒBHC and mercuric cloride on Artemia salina

    Directory of Open Access Journals (Sweden)

    Salvador Airton Gaeta

    1983-01-01

    Full Text Available São apresentados os resultados de bioensaios com larvas de Artemia salinacolocadas em misturas de γBHC e HgCl2, a fim de se compararem os efeitos das mesmas com aqueles obtidos quando essas duas substancias atuam isoladamente. A CL50 para o yBHC foi quase que o dobro do valor para o HgCl2. O efeito da primeira dose foi observado para aproximadamente 16% da população (CL16, enquanto que, para o γBHC, o foi em 2,3% da população (CL2,3. Assim, as doses subseqüentes foram mais efetivas para o HgCl2 que para o γBHC. A dose efetiva 50% (ED50 ê mais ou menos igual para o γBHC e para o γBHC + HgCl2, mas em doses altas o YBHC seria mais efetivo, enquanto que em doses baixas a mistura e que o seria.Results of bio-assays using Artemia salina larvae in γBHC-HgCl2 mixture are presented. The results obtained are compared with those obtained using the two chemicals separately. The LC50 for γBHC was almost double that for HgCl2. The effect due to the primary dose of HgCl2 was observed for approximately 16% of the population (LC2.3 while for γBHC the population percentage was 2.3 (LC2.3. As a consequence, subsequent doses were more effective for HgCl2 than for γBHC. The effective dose 50% (ED50 is about the same for γBHC and for γBHC + HgCl2 mixture, though in higher doses BHC would be more effective, while in smaller doses the mixture would predominate.

  3. Comparación entre dos métodos para medir el consumo de alimentos en un área rural costarricense

    Directory of Open Access Journals (Sweden)

    Anne Chinnock

    1999-12-01

    Full Text Available El objetivo del presente trabajo fue comparar, mediante dos métodos, el consumo de alimentos en un grupo de treinta familias de una zona rural costarricense. Los métodos comparados fueron el Consumo Aparente de Alimentos y el Registro con Pesos. Para el primero se realizaron tres entrevistas a cada familia los días cero, ocho y veintidós del estudio. El Registro con Pesos se aplicó durante un periodo de siete días (desde el día uno hasta el día siete. Los resultados señalaron que no hubo diferencias estadísticamente significativas entre ambos métodos para la mayoría de los alimentos y nutrientes. Sin embargo, el método de Consumo Aparente de Alimentos sobreestimó significativamente el consumo de 7 alimentos, incluyendo el arroz y el azúcar y algunos alimentos de producción casera. Debido a estas diferencias, el método de Consumo Aparente de Alimentos sobreestimó la cantidad promedia de energía, carbohidratos, calcio, fósforo y tiamina. Se concluye que el método de Consumo Aparente de Alimentos no debe ser utilizado para estimar el consumo de alimentos e ingesta de nutrientes a nivel de cada familia. Sin embargo, al mejorar la capacidad del método de Consumo Aparente de Alimentos para estimar cantidades consumidas de arroz, azúcar y alimentos de autoconsumo, puede utilizarse para estimar el consumo promedio de alimentos, energía y nutrientes de grupos de familias de características similares a las del presente estudio.

  4. Co-feeding of microalgae and bacteria may result in increased N assimilation in Artemia as compared to mono-diets, as demonstrated by a 15N isotope uptake laboratory study

    OpenAIRE

    Toi, H.T.; Boeckx, P.; Sorgeloos, P.; Bossier, P.; Van Stappen, G.

    2014-01-01

    This study investigated the effect of the co-feeding of bacteria and microalgae on nitrogen (N) assimilation in an Artemia franciscana gnotobiotic laboratory culture test. Two strains of bacteria were used, HT3 and HT6, isolated from previous Artemia laboratory cultures. These were fed in combination with microalga Dunaliella tertiolecta strains, either the high quality DT 19/6B or the low quality DT 19/27 strain. Each combination of algae and bacteria was offered in different proportions, i....

  5. Valor nutricional de alimentos para suínos determinado na Universidade Federal de Lavras Nutritional value of feedstuffs for pigs determined at the University of Lavras

    Directory of Open Access Journals (Sweden)

    Zuleide Alves de Souza Santos

    2005-02-01

    Full Text Available Foram conduzidos seis ensaios de metabolismo no Departamento de Zootecnia da Universidade Federal de Lavras (UFLA no ano de 2002, com objetivo de avaliar a composição química e nutricional de 8 alimentos protéicos e 10 energéticos. Para o primeiro ensaio, foram selecionados animais de peso-vivo médio de 40,4 kg, sendo analisado o farelo de algodão, soja micronizada, farelo de soja, farelo de linhaça, farinha de pâncreas suíno, farinha de vísceras suína, milho comum, milheto em grão e moído, resíduo de bolacha, óleo de canola, óleo de linhaça, óleo de soja, gordura de coco e gordura suína. Para o segundo ensaio, foram selecionados animais de 50,2 kg e foi analisado o farelo de amendoim e milho QPM. Um total de 72 suínos machos, castrados e mestiços (Landrace x Large White, foram utilizados nos ensaios, e a metodologia adotada foi a da coleta total de fezes e urina. Desta forma, cada alimento foi testado em três repetições. Os valores obtidos de coeficiente de digestibilidade da proteína bruta (CDPB, valores de energia digestível (ED e energia metabolizável (EM para os alimentos protéicos de origem vegetal foram 66,2%, 2480 kcal/kg, 2190 kcal/kg, para farelo de algodão; 77,73%, 2365 kcal/kg, 2289 kcal/kg, para o farelo de girassol; 72,3%, 2880 kcal/kg, 2580 kcal/kg para farelo de linhaça; 86,5%, 3430 kcal, 3360 kcal/kg para farelo de soja 46% proteína bruta; 86,8%, 4580 kcal/kg, 4350 kcal/kg para soja micronizada; 81,2%, 3292 kcal/kg, 3146 kcal/kg para o farelo de amendoim. Para os alimentos protéicos de origem animal foram 47,3%, 3470 kcal/kg, 3310 kcal/kg para farinha de pâncreas suína; 81,3%, 3660 kcal/kg, 3535 kcal/kg para farinha de vísceras suína. Para os alimentos energéticos de origem vegetal foram 84,4%, 3220 kcal/kg, 3185 kcal/kg para a farinha de bolacha; 85,3%, 3480 kcal, 3320 kcal/kg para o milho moído; 81,2%, 3308 kcal/kg; 3257 kcal/kg para o milho QPM; 86,2%, 3213 kcal/kg, 3048 kcal/kg para o

  6. Efecto de los comerciales de televisión en la escogencia y consumo de alimentos en los niños

    OpenAIRE

    Sonia Tucci

    2010-01-01

    Esta revisión examina los efectos de los comerciales televisados de alimentos en la preferencia y consumo de los mismos en niños, lo cual sin duda conlleva a alteraciones en su peso corporal. Es importante señalar que la gran mayoría de los alimentos promovidos en los comerciales de televisión son alimentos de bajo valor nutricional y calóricamente densos. Esto contrasta notablemente con los alimentos saludables promocionados por los gobiernos, organizaciones de salud, escuelas y padres. Los ...

  7. Concentração de fluoreto em arroz, feijão e alimentos infantis industrializados Fluoride concentrations in typical Brazilian foods and in infant foods

    OpenAIRE

    Renato C. V. Casarin; Daniel R M Fernandes; Ynara B O Lima-Arsati; Cury, Jaime A.

    2007-01-01

    OBJETIVO: Determinar a concentração de fluoreto na refeição brasileira típica (arroz e feijão) e em alimentos infantis industrializados e estimar suas contribuições para fluorose dental. MÉTODOS: Os alimentos foram adquiridos de supermercados das cidades de Piracicaba e Campinas, SP, Brasil. Os alimentos infantis industrializados foram comprados em 2001 e o arroz e feijão em 2003, e imediatamente analisados. Foram analisadas três marcas de arroz, três de feijão e 36 amostras de alimentos infa...

  8. Proteomic analysis of acute responses to copper sulfate stress in larvae of the brine shrimp, Artemia sinica

    Science.gov (United States)

    Zhou, Qian; Wu, Changgong; Dong, Bo; Li, Fuhua; Liu, Fengqi; Xiang, Jianhai

    2010-03-01

    Proteomics was used to reveal the differential protein expression profiles of acute responses to copper sulfate exposure in larvae of Artemia sinica. Fourteen differentially displayed protein spots were detected and seven of them were identified. Three spots were up-expressed and identified: actin, heat shock protein 70, and chaperone subunit 1; three down-regulated proteins were identified: arginine kinase, elongation factor-2, and glycine-rich protein; and a newly expressed protein was identified as peroxiredoxin. The study indicates the involvement of all the differentially expressed proteins in the early responses of protein expression, and in the survival of A. sinica in the presence of copper and other heavy metals; the findings improve understanding of the organism’s adaptive responses and resistance.

  9. Optimizing the co-feeding strategy of Persian sturgeon (Acipenser persicus larvae using Artemia nauplii and formulated diet

    Directory of Open Access Journals (Sweden)

    Naser Agh

    2013-07-01

    Full Text Available High mortality and labor costs are associated with first-feeding sturgeon culture, particularly during the period of dietary transition from live to formulated feed. Therefore we investigated the effects of various feeding treatments on the survival and growth of the Persian sturgeon (Acipenser persicus larvae during a 20-day culture period. Three replicate groups (250 fish/replicate of first-feeding larvae were fed according to four main feeding regimes: (1 live food (live nauplii of brine shrimp Artemia urmiana; (2 indirect transition (5 days live food followed by gradual transition to formulated diet; (3 direct transition (using different combinations of live and formulated diet from the start feeding onwards; (4 formulated feed (FD from the start feeding. Results indicated that growth and survival were higher in the indirect transition feeding regime than in other regimes. Based on our study, co-feeding of A. persicus should start five days after prior feeding with live food.

  10. Analysis of toxicity of Anacardium occidentale L. extract submitted to ionizing radiation on embryos of Biomphalaria glabrata and Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Hianna A.M.F.; Sa, Jose L.F.; Lima, Claudia S.A.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: hiannaamfs@gmail.com, E-mail: luismuma6@gmail.com, E-mail: claudia.salima@gmail.com, E-mail: amancioff@bol.com.br, E-mail: amdemelo@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Biofisica e Radiobiologia; Ribeiro, Luanna R.S.; Santos, Gustavo H.F.; Silva, Edvane B., E-mail: luannaribeiro_lua@hotmail.com, E-mail: santosghf@hotmail.com, E-mail: edvborges@yahoo.com.br [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Energia Nuclear. Grupo de Estudos em Radioprotecao e Radioecologia

    2013-07-01

    The use of gamma radiation as a sterilization method for herbs, herbal medicines and foods, shows positive results regarding the retention of such products, economy and safety of the method. However, it is known that this method of processing plant material can cause chemical changes in these products related to the type of material, its components and the dose received. Evaluated, in the present study, the action of gamma radiation as a modifier of toxicity extract of Anacardium occidentale Linn. To evaluate the toxicity of the extract irradiated at doses of 5.0, 7.5 and 10.0 kGy and concentrations of 250, 500 and 1000 mg/L was used bioassays with Artemia salina and Biomphalaria glabrata. For the test to A. salina, 520 specimens were used divided into groups of 10 larvae. For the bioassay with B. glabrata, 3900 specimens were used divided into groups of, approximately, 100 embryos. Larvae of A. salina and embryos were subjected to extracts irradiated and unirradiated for 24 hours. The bioassay with A. salina, showed a decrease, compared to extract unirradiated and irradiated at doses of 5.0 and 7.5 kGy, of extract irradiated with 10 kGy, where the mortality did not differ from the control group. In tests with embryos was observed an increase in the toxicity of the extract at a dose of 7.5 kGy and a decrease in the dose of 10.0 kGy. The radiation promoted changes in the toxicity of leaves extracts of Anacardium occidentale Linn. on embryos of Biomphalaria glabrata and Artemia salina. (author)

  11. Analysis of toxicity of Anacardium occidentale L. extract submitted to ionizing radiation on embryos of Biomphalaria glabrata and Artemia salina

    International Nuclear Information System (INIS)

    The use of gamma radiation as a sterilization method for herbs, herbal medicines and foods, shows positive results regarding the retention of such products, economy and safety of the method. However, it is known that this method of processing plant material can cause chemical changes in these products related to the type of material, its components and the dose received. Evaluated, in the present study, the action of gamma radiation as a modifier of toxicity extract of Anacardium occidentale Linn. To evaluate the toxicity of the extract irradiated at doses of 5.0, 7.5 and 10.0 kGy and concentrations of 250, 500 and 1000 mg/L was used bioassays with Artemia salina and Biomphalaria glabrata. For the test to A. salina, 520 specimens were used divided into groups of 10 larvae. For the bioassay with B. glabrata, 3900 specimens were used divided into groups of, approximately, 100 embryos. Larvae of A. salina and embryos were subjected to extracts irradiated and unirradiated for 24 hours. The bioassay with A. salina, showed a decrease, compared to extract unirradiated and irradiated at doses of 5.0 and 7.5 kGy, of extract irradiated with 10 kGy, where the mortality did not differ from the control group. In tests with embryos was observed an increase in the toxicity of the extract at a dose of 7.5 kGy and a decrease in the dose of 10.0 kGy. The radiation promoted changes in the toxicity of leaves extracts of Anacardium occidentale Linn. on embryos of Biomphalaria glabrata and Artemia salina. (author)

  12. El mercado de los alimentos funcionales y los nuevos retos para la educación alimentaria - nutricional

    Directory of Open Access Journals (Sweden)

    Patricia Sedó Masís

    2002-07-01

    Full Text Available El estudio de los alimentos cobra cada día más importancia, dada la alta incidencia de enfermedades crónicas y cáncer, y el reconocimiento de que la dieta, como parte de un estilo de vida saludable, tiene un papel preponderante en la prevención y cura de enfermedades. Paralelo a la investigación de alimentos naturales, surgen nuevas corrientes en el procesamiento de alimentos, las cuales vienen a dar respuesta a las necesidades de los consumidores por adquirir productos procesados más "saludables". El mercado de alimentos procesados con supuestas propiedades benéficas y la mayor información circulante, plantea nuevos retos a la educación nutricional. El objetivo de este trabajo es, partir de una revisión bibliográfica, describir algunas de las tendencias actuales del mercado de alimentos con características "funcionales", su Influencia en el comportamiento del consumidor, y los nuevos retos que significa esta situación para la educación alimentaria nutricional en Costa Rica.

  13. Transmissão Intergeracional: uma contribuição ao estudo do comportamento do consumidor de alimentos

    Directory of Open Access Journals (Sweden)

    Maria de Fátima Evangelista Mendonça Lima

    2010-02-01

    Full Text Available A escolha dos alimentos tem sido estudada por várias áreasdo conhecimento, entre elas destacando-se o Marketing, aEconomia, a Psicologia, a Nutrição, a Medicina, a Sociologiae a Antropologia. A área do Marketing e da Economiatrata da escolha de produtos, utilizando modelos na maioriaquantitativo-econométricos, ao contrário deste estudo, queutiliza a metodologia qualitativa, baseando-se na teoria daintergeracionalidade, por considerar a escolha, sobretudo ade alimentos, um fenômeno complexo. Para tanto, foram realizadasentrevistas semiestruturadas com dez mães residentesna cidade de Campo Grande/MS. A técnica utilizadapara o estudo dos dados é a análise de conteúdo. Os resultadosapontam que, além das restrições estruturais, existe apresença do fenômeno da intergeracionalidade como fatorimportante na escolha de alimentos. Sendo assim, pode-sedizer que no processo de escolha de alimentos está presentea herança simbólica recebida, principalmente da mãe, influenciandoas atuais escolhas dos indivíduos por alimentos.

  14. Síntese de 1,3,5-triazinas substituídas e avaliação da toxicidade frente a Artemia Salina leach Synthesis of substituted 1,3,5-triazines and toxicity evaluation against Artemia Salina leach

    Directory of Open Access Journals (Sweden)

    Márcia Ferreira Cavalcante

    2000-02-01

    Full Text Available The synthesis of ten symmetrically and unsymmetrically substituted 1,3,5-triazines by Phase Transfer Catalysis (PTC method is described. Their toxicities were determined against Artemia salina Leach. The LD50 values have also been obtained for these compounds.

  15. Alimentos kilométricos y gases de efecto invernadero: Análisis del transporte de las importaciones de alimentos en el Estado español (1995-2007)

    OpenAIRE

    Simón Fernández, Xavier; Copena Rodríguez, Damián; Pérez Neira, David; Delgado Cabeza, Manuel; Soler Montiel, Marta

    2014-01-01

    Este trabajo analiza la presión ambiental de las importaciones alimentarias en el Estado español durante el período 1995- 2007 a través de tres indicadores biofísicos: la cantidad de alimentos importados (t), las emisiones de CO2-eq y la distancia recorrida por los alimentos o “food miles” (km). El análisis se realiza según medios de transporte (aéreo, ferrocarril, carretera y marítimo) y por países para 10 grupos de productos de la división “alimentos y animales vivos” de la Clasificación Un...

  16. Tecnologías emergentes para la conservación de alimentos sin calor

    Directory of Open Access Journals (Sweden)

    Fernández Molina, Juan José

    2001-01-01

    Full Text Available Not available

    Se han investigado los principios básicos de tres tecnologías emergentes para pasteurizar y esterilizar alimentos sin empleo del calor Mediante numerosos estudios se ha comprobado la efectividad de los campos eléctricos pulsantes de alta intensidad (CEPAI, los pulsos de luz (PL y los campos magnéticos oscilantes (CMO en la destrucción de microorganismos y enzimas de sistemas alimentarios. En la inactivación microbiana por CEPA!, el blanco principal es la membrana celular que, al ser sometida a campos eléctricos de alta intensidad, se hace permeable formando huecos o poros cuyo tamaño se incrementa a medida que aumenta la intensidad del campo eléctrico o el tiempo de tratamiento o se reduce la resistencia iónica del medio de pulsación. Por otra parte, los PL inducen reacciones fotoquímicas y fototérmicas en los alimentos, causando la muerte de gran cantidad de microorganismos, especialmente en productos alimenticios envasados. Los CMO producen simulación o inhibición en el crecimiento y reproducción de los microorganismos, un simple pulso de intensidad de 5-10 teslas y frecuencias de 5-500 kHz es suficiente para reducir el número de microorganismos en un mínimo de 2 ciclos logarítmicos. Se ha comprobado que estas tecnologías alargan la vida de anaquel de diversos productos alimenticios y pueden ser consideradas como sustitutos parciales de los procesos convencionales de pasteurización y esterilización de alimentos por tratamientos térmicos.

  17. Interações entre Antiparasitários e Alimentos

    Directory of Open Access Journals (Sweden)

    Carina Duarte Venturini

    2014-01-01

    Full Text Available O uso, por vezes indiscriminado, de antiparasitários pode levar a consequências importantes na saúde do indivíduo, principalmente relacionadas a alterações no sistema gastrointestinal. As interações entre fármacos e nutrientes podem ocorrer quando um alimento ou nutriente altera a resposta esperada de um medicamento ou quando este interfere sobre o estado nutricional do indivíduo. Essa alteração da eficácia pode resultar em falha no tratamento ou até mesmo na toxicidade do fármaco. A fim de conhecer, identificar e prevenir interações indesejáveis entre antiparasitários e alimentos, o presente artigo de revisão aborda os principais fármacos e alimentos ou nutrientes envolvidos, bem como as consequências que tais interações podem acarretar ao indivíduo. O estado nutricional é de suma importância nas infecções parasitárias, pois é o determinante entre uma maior carga de parasitos ou a resistência total contra a infecção. De forma geral, indivíduos parasitados são inapetentes e emagrecidos, o que em crianças pode comprometer o desenvolvimento físico e intelectual. Portanto, o conhecimento e uma correta orientação médica, farmacêutica e nutricional levam a um tratamento bem sucedido.

  18. Congelación y liofilización de alimentos

    OpenAIRE

    Orrego Alzate, Carlos Eduardo

    2008-01-01

    Este libro resume algunos de los resultados de distintos proyectos de investigación y tesis dirigidos por el autor con el apoyo económico de la Gobernación de Caldas, Universidad Nacional de Colombia - Sede Manizales y Programa de las Naciones Unidas para el Desarrollo, PNUD. La liofilización es un segmento muy especializado de la industria. Se utiliza intensivamente en farmacia, en alimentos deshidratados, en producción de catalizadores y en nuevos materiales. Se dice que en América este ...

  19. Ocorrência de Vibrio vulnificus em alguns alimentos de origem marinha

    OpenAIRE

    Maria Luz Garcia Moreno; Mariza Landgraf

    1997-01-01

    Vibrio vulnificus é uma bactéria Gram-negativa que habita águas marinhas. É patogênica para o homem e a doença está associada ao consumo de frutos do mar, com aproximadamente 60% dos casos sendo fatais em pacientes imunocomprometidos. O objetivo desta pesquisa foi estudar a ocorrência de V. vulnificus em amostras de alguns alimentos de origem marinha. As amostras de ostras, mariscos e camarões foram coletadas nos períodos de abril-agosto de 1993, maio-setembro de 1994 e fevereiro de 1995. De ...

  20. Fluoruro en alimentos: contenidos, bioaccesibilidad y absorción por el epitelio intestinal.

    OpenAIRE

    ROCHA BARRASA, RENE

    2013-01-01

    El fluoruro se considera importante para la salud debido a su efecto beneficioso en la prevención de la caries dental y en el desarrollo óseo en la población infantil. Sin embargo, una ingesta excesiva produce determinadas patologías, como fluorosis dental y esquelética, incluso reducciones de las capacidades cognitivas en la población infantil. El objetivo de esta tesis doctoral es la evaluación de los contenidos de fluoruro en los alimentos, su bioaccesibilidad y su absorción por el epiteli...

  1. Salud dental: relación entre la caries dental y el consumo de alimentos

    OpenAIRE

    Ángel Miguel González Sanz; Blanca Aurora González Nieto; Esther González Nieto

    2013-01-01

    A pesar de que la reducción de la incidencia y prevalencia de la caries dental en muchos países se relaciona en gran medida con el uso sistemático del flúor en las pastas dentífricas y la mejora de la higiene dental, se debe tener presente la importancia de los hábitos alimentarios en la prevención primaria y secundaria de la caries dental. En este sentido, destacan los carbohidratos fermentables, determinadas características de los alimentos, la frecuencia de consumo, distintos tipos de alim...

  2. Descontaminación de micotoxinas emergentes mediante el procesado de alimentos

    OpenAIRE

    Roig Pérez, María

    2013-01-01

    Los hongos filamentosos de los géneros Aspergillus, Penicillium y Fusarium son responsables de producir metabolitos tóxicos denominados micotoxinas: sustancias contaminantes de alimentos y piensos que suponen un grave perjuicio para la salud humana y animal. El género micotoxigénico Fusarium es el más importante en las regiones de clima templado y países nórdicos. En los últimos años existe un interés creciente por las denominadas micotoxinas emergentes, particulamente la beauvericina (BEA),...

  3. Riesgos y preocupaciones sobre los alimentos transgénicos y la salud humana

    OpenAIRE

    Acosta, Orlando

    2011-01-01

    La tecnología transgénica en la agricultura se ha visto recientemente implicada en un intenso debate entre dos corrientes opuestas. Algunas organizaciones no gubernamentales (ONG) consideran esta tecnología como de alto riesgo para la salud, el ambiente y la economía de los países no desarrollados. Por el contrario, la comunidad científica ha respaldado públicamente esta tecnología asegurando que la clave para su aceptación es la educación. Aunque los alimentos genéticamente modificados (GM) ...

  4. Contaminación de alimentos marinos por cadmio en Lima, 2015

    OpenAIRE

    Gloria Marín Vallejos

    2015-01-01

    Los objetivos fueron determinar las concentraciones de cadmio en ocho especies de alimentos marinos y comparar con los valores máximos permitidos según la Comisión de la Unión Europea en su Reglamento (CE) Nº 1881/2006 y su modificatoria Reglamento (UE) N° 488/2014. La investigación fue de carácter descriptivo, trasversal. Las muestras fueron de 100 g de cada ejemplar de pescado en tres oportunidades; los ejemplares fueron: jurel (Trachurus picturatus murphyi), langostinos (Penaeus vannamei),...

  5. Aflatoxinas e ocratoxina A em alimentos e riscos para a saúde humana

    Directory of Open Access Journals (Sweden)

    Eloisa Dutra Caldas

    2002-06-01

    Full Text Available OBJETIVOS: A presença de micotoxinas em alimentos tem sido correlacionada a várias patologias humanas, e as autoridades de saúde no mundo todo têm implementado ações para diminuir a ingestão desses compostos pela dieta. Realizou-se pesquisa para analisar os níveis de aflatoxinas e ocratoxina A de alimentos para consumo e avaliar o potencial de risco da exposição humana a essas micotoxinas. MÉTODOS: Foram analisadas 366 amostras de alimentos consumidos no Distrito Federal, no período de julho de 1998 a dezembro de 2001, como amendoim e derivados, castanhas, milho, produtos de trigo e/ou aveia, arroz e feijão. As amostras foram processadas, e as micotoxinas extraídas, detectadas e quantificadas por fluorescência após separação em cromatografia camada delgada. RESULTADOS: Foram detectadas aflatoxinas em 19,6% das amostras, em amendoim cru e derivados, milho de pipoca, milho em grão e castanha-do-pará (>2 mig/kg. Amendoim e derivados apresentaram maior incidência de contaminação por aflatoxinas (34,7% com amostras contendo até 1.280 mig/kg de AFB1+AFG1 e 1.706 mig/kg de aflatoxinas totais. Das amostras positivas, AFB1 estava presente em 98,5%, AFB2 em 93%, AFG1 em 66,7% e AFG2 em 65,4%. A ocratoxina A não foi detectada (<25 mig/kg em nenhuma amostra analisada. CONCLUSÃO: Os níveis de contaminação encontrados em amendoim e derivados ultrapassaram os níveis máximos permitidos pela legislação brasileira, podendo significar fator de risco para a população que os consome regularmente. A conscientização dos produtores de alimentos e as ações de vigilância sanitária permanentes são essenciais para diminuir a exposição humana a esses compostos e prevenir doenças crônicas advindas dessa exposição.

  6. Aflatoxinas e ocratoxina A em alimentos e riscos para a saúde humana

    Directory of Open Access Journals (Sweden)

    Caldas Eloisa Dutra

    2002-01-01

    Full Text Available OBJETIVOS: A presença de micotoxinas em alimentos tem sido correlacionada a várias patologias humanas, e as autoridades de saúde no mundo todo têm implementado ações para diminuir a ingestão desses compostos pela dieta. Realizou-se pesquisa para analisar os níveis de aflatoxinas e ocratoxina A de alimentos para consumo e avaliar o potencial de risco da exposição humana a essas micotoxinas. MÉTODOS: Foram analisadas 366 amostras de alimentos consumidos no Distrito Federal, no período de julho de 1998 a dezembro de 2001, como amendoim e derivados, castanhas, milho, produtos de trigo e/ou aveia, arroz e feijão. As amostras foram processadas, e as micotoxinas extraídas, detectadas e quantificadas por fluorescência após separação em cromatografia camada delgada. RESULTADOS: Foram detectadas aflatoxinas em 19,6% das amostras, em amendoim cru e derivados, milho de pipoca, milho em grão e castanha-do-pará (>2 mig/kg. Amendoim e derivados apresentaram maior incidência de contaminação por aflatoxinas (34,7% com amostras contendo até 1.280 mig/kg de AFB1+AFG1 e 1.706 mig/kg de aflatoxinas totais. Das amostras positivas, AFB1 estava presente em 98,5%, AFB2 em 93%, AFG1 em 66,7% e AFG2 em 65,4%. A ocratoxina A não foi detectada (<25 mig/kg em nenhuma amostra analisada. CONCLUSÃO: Os níveis de contaminação encontrados em amendoim e derivados ultrapassaram os níveis máximos permitidos pela legislação brasileira, podendo significar fator de risco para a população que os consome regularmente. A conscientização dos produtores de alimentos e as ações de vigilância sanitária permanentes são essenciais para diminuir a exposição humana a esses compostos e prevenir doenças crônicas advindas dessa exposição.

  7. Consenso Cultural sobre Alimentos en Adolescentes Embarazadas de Guadalajara, México

    OpenAIRE

    Claudia C. Herrera-Suárez; Javier E. García-De Alba; Edgar M. Vásquez-Garibay; Enrique Romero-Velarde; Hiliana P. Romo-Huerta; Rogelio Troyo-Sanromán

    2008-01-01

    Objetivo Caracterizar la estructura semántica y el nivel de consenso cultural que manifiestan las adolescentes embarazadas que acuden a la consulta externa del Hospital Civil de Guadalajara Dr. Juan I Menchaca. Métodos Estudio cualitativo mediante entrevistas estructuradas con la técnica de listas libres. Muestreo propositivo no aleatorizado que incluyo a 54 adolescentes embarazadas de 12 a 19 años de edad. Resultados Los alimentos del desayuno y la cena obtuvieron un mayor grado de consenso ...

  8. Alimentación y OGM: los alimentos transgénicos

    OpenAIRE

    Delgado Cabañas, Sara

    2015-01-01

    El presente trabajo trata de introducir los aspectos básicos de un tema tan amplio y controvertido como es el de los alimentos transgénicos. Se empieza con una introducción para comprender como los avances de la biotecnología han dado lugar a la aparición de los organismos genéticamente modificados (OGM) y como las investigaciones han evolucionado desde ese momento hasta la actualidad. Se habla de los diferentes tipos de OGM y sus aplicaciones, de la transformación de las plantas transgénicas...

  9. Implicaciones jurídicas de los alimentos transgénicos en Colombia

    OpenAIRE

    Mario Ernesto García Martínez; Hugues Manuel Lacouture Daníes

    2003-01-01

    Las implicaciones juridicas de los alimentos transgénicos en Colombia demuestra que es necesario que se establezca un marco legal de Bioseguridad sólido. Es imperativo que la autoridad medioambiental, entendiendo por éstá no sólo el Ministerio del Medio Ambiente sino también, el Ministerio de Salud, el Ministerio de Agricultura, el lCA y ellNVlMA, desarrollen una política integral de Bioseguridad y Biotecnología, y como consecuencia de ello presenten cuanto antes un proye...

  10. Consumo de alimentos y calidad de la dieta en estudiantes universitarios: Proyecto uniHcos

    OpenAIRE

    Ortiz Moncada, Rocío; Norte Navarro, Aurora; E. Jiménez Mejías; M. Delgado; Valero, L.F.; J.M Cancela; Alguacil, J; MartÍn, V.

    2014-01-01

    Antecedentes/Objetivos: La etapa universitaria se caracteriza por cambios en estilos de vida y, la alimentación es uno de los de mayor variación, especialmente en los primeros cursos. El objetivo de este estudio es describir la frecuencia de consumo de alimentos y la calidad de la dieta de los universitarios españoles. Métodos: Estudio observacional, descriptivo, transversal, multicéntrico de estudiantes universitarios de primer año participantes en el proyecto uniHcos. Población de 1363 est...

  11. Mecanismos de transporte y toxicidad intestinal de especies de mercurio presentes en los alimentos

    OpenAIRE

    Vázquez San Antonio, Marta

    2014-01-01

    El mercurio es un metal tóxico ampliamente distribuido en el medioambiente. Las formas químicas mayoritarias en los alimentos son el mercurio mercúrico [Hg(II)] y el metilmercurio (CH3Hg). La principal vía de exposición para el ser humano la constituye la dieta, siendo los productos pesqueros los que mayor aporte de mercurio realizan. Teniendo en cuenta que la principal vía de exposición al mercurio es la oral, el tracto gastrointestinal se considera la puerta de entrada de este tóxico al org...

  12. Pastas de Rhodomonas salina (Cryptophyta) como alimento para Brachionus plicatilis (Rotifera)

    OpenAIRE

    Miguel Guevara; Leandro Bastardo; Roraysi Cortez; Bertha Arredondo-Vega; Lolymar Romero; Patricia Gómez

    2011-01-01

    Pastas de Rhodomonas salina, obtenidas mediante centrifugación y floculación con quitosano y preservadas con o sin vitamina C, a -20°C fueron evaluadas bioquímicamente y proporcionadas como alimento al rotífero Brachionus plicatilis. Las pastas microalgales: (1) centrifugada y con vitamina C (CV), (2) centrifugada y sin vitamina C (C), (3) floculada y con vitamina C (FV) y (4) floculada y sin adición de vitamina C (F); mantuvieron sus contenidos de proteínas y lípidos totales similares al cul...

  13. Tecnologías emergentes para la conservación de alimentos sin calor

    OpenAIRE

    Fernández Molina, Juan José; Gustavo V. Barbosa-Cánovas; Swanson, Barry G.

    2001-01-01

    Not available

    Se han investigado los principios básicos de tres tecnologías emergentes para pasteurizar y esterilizar alimentos sin empleo del calor Mediante numerosos estudios se ha comprobado la efectividad de los campos eléctricos pulsantes de alta intensidad (CEPAI), los pulsos de luz (PL) y los campos magnéticos oscilantes (CMO) en la destrucción de microorganismos y enzimas de sistemas alimentarios. En la inactivación microbiana por CEPA!, el blanco principal es la me...

  14. El mercado interno de alimentos orgánicos: perfil de los consumidores argentinos

    OpenAIRE

    Rodríguez, Elsa Mirta M.; Gentile, Natacha; Lupín, Beatriz; Garrido, Laura

    2002-01-01

    Desde el punto de vista del consumidor, la producción orgánica está estrechamente relacionada con tres aspectos fundamentales: medio ambiente, salud humana y bienestar animal. Los alimentos orgánicos, a través de los sistemas de certificación, garantizan a los consumidores que no se han utilizado agroquímicos sintéticos ni materiales transgénicos durante el proceso de producción y en el caso de los productos de origen animal, que se han respetado aspectos relacionados con el bienestar de los ...

  15. Experimentando con alimentos en educación infantil."La caja misteriosa de Minichef"

    OpenAIRE

    García Bernardo, Sara

    2015-01-01

    El trabajo de Fin de Grado que se presenta a continuación trata de destacar la importancia de la ciencia y la experimentación en Educación Infantil. Los niños desde que nacen son investigadores, observan y experimentan con los objetos que encuentran en su entorno más cercano. Partiendo de esta idea se ha llevado a cabo la planificación y puesta en práctica de un proyecto en un aula de infantil, cuyo objetivo ha sido que los niños conozcan algunas propiedades de los alimentos a través de la ex...

  16. SÍNTESIS DE INMUNORREACTIVOS PARA LA DETERMINACIÓN DE SULFONAMIDAS Y TETRACICLINAS EN ALIMENTOS

    OpenAIRE

    Pastor Navarro, Nuria

    2012-01-01

    La presencia de residuos de antibióticos en alimentos de origen animal es uno de los problemas más importantes y actuales en seguridad alimentaria. Los medicamentos son utilizados en la producción animal con fines terapéuticos y como promotores del crecimiento. El problema surge cuando residuos de estos antibióticos llegan al consumidor a través de la cadena alimentaria a niveles perjudiciales para su salud, ya que tienen efectos secundarios al destruir las bacterias comensales de nuestro int...

  17. Seguridad y riesgo de toxicidad de los alimentos: un debate actual

    OpenAIRE

    Mariné Font, Abel; Vidal Carou, M. Carmen

    2001-01-01

    Not available

    El progreso científico y tecnológico ha tenido muchas consecuencias beneficiosas para la humanidad pero también conlleva riesgos. Un ámbito en el que estos dos aspectos de la cuestión se manifiestan más claramente es el de la alimentación humana. Las posibilidades actuales de la industria alimentaria permiten la obtención de productos cada vez más adaptados a las necesidades y gustos del consumidor No obstante, existe una desconfianza frente a los alimentos tr...

  18. ANÁLISE DAS MUDANÇAS RECENTES NAS DESPESAS COM ALIMENTOS

    OpenAIRE

    Silveira, Rebecca Impelizieri; Bicalho, Ellenise Elsa Emidio; Lirio, Viviani Silva

    2008-01-01

    O objetivo deste estudo é analisar as mudanças na despesa alimentar das famílias brasileiras no período compreendido entre os anos de 1996 e 2003. Relacionou-se o consumo familiar ao preço e à despesa anual para os seguintes alimentos: aves e ovos, bebidas, carne bovina, carne suína, cereais em grãos, farinhas e derivados, frutas, lácteos, legumes e verduras. Na pesquisa, foram utilizados os microdados da Pesquisa de Orçamentos Familiares (POF) disponibilizados pelo IBGE, para os períodos sel...

  19. Interações entre Antiparasitários e Alimentos

    OpenAIRE

    Carina Duarte Venturini; Paula Engroff; Luísa Scheer Ely; Tiana Tasca; Geraldo Attilio De Carli

    2014-01-01

    O uso, por vezes indiscriminado, de antiparasitários pode levar a consequências importantes na saúde do indivíduo, principalmente relacionadas a alterações no sistema gastrointestinal. As interações entre fármacos e nutrientes podem ocorrer quando um alimento ou nutriente altera a resposta esperada de um medicamento ou quando este interfere sobre o estado nutricional do indivíduo. Essa alteração da eficácia pode resultar em falha no tratamento ou até mesmo na toxici...

  20. Bacteriófagos para el biocontrol de aminas biógenas en alimentos

    OpenAIRE

    Gómez Sordo, Carolina

    2015-01-01

    En el último siglo, la preocupación por la seguridad alimentaria ha adquirido especial importancia en los consumidores. En especial, la eliminación de productos o compuestos tóxicos de los alimentos es una prioridad para ellos. En los productos lácteos, y más concretamente en los quesos, se acumulan grandes cantidades de aminas biógenas, que son compuestos tóxicos producidos por la descarboxilación de aminoácidos, que pueden acumularse debido al metabolismo de ciertas cepas de bacterias del á...

  1. Comparison of bioassays using the anostracan crustaceans Artemia salina and Thamnocephalus platyurus for plant extract toxicity screening Comparação de bioensaios com os crustáceos Artemia salina e Thamnocephalus platyurus para abordagem de extratos de plantas com toxicidade

    Directory of Open Access Journals (Sweden)

    Pablo Mayorga

    2010-12-01

    Full Text Available Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest, were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq. Kunth ex Walp., Fabaceae, Neurolaena lobata (L. Cass., Asteraceae, Petiveria alliacea L., Phytolaccaceae, and Ocimum campechianum Mill., Lamiaceae. The five others: Curatella americana L., Dilleniaceae, Prunus barbata Koehne, Rosaceae, Quercus crispifolia Trel., Fagaceae, Rhizophora mangle L., Rhizophoraceae, and Smilax domingensis Willd., Smilacaceae, do not. All plants without anti-Artemia activity had no lethal effects in both assays with A. salina. For the plants with anti-Artemia activity the Artoxkit M was not sensitive to G. sepium and the conventional Artemia test was not sensitive to S. americanum, G. sepium and N. lobata. All the plant extracts, except for that of C. americana, had lethal effects on T. platyurus and the lethal median concentration (LC50 levels for this organism were in all cases substantially lower than those of the salt-water test species. This study revealed that T. platyurus is a promising test species worth further in depth investigation for toxicity screening of plant extracts with potential medicinal properties.Três bioensaios de letalidade com o crustáceo de água salgada Artemia salina Leach, Artemiidae, (teste convencional em microplaca de 96 poós Artoxkit microbiotest M e o crustáceo de água doce Thamnocephalus platyurus Packard, Thamnocephalidae (Thamnotoxkit microbiotest F, foram comparados utilizando extratos de dez espécies de plantas da Guatemala. Foi previamente observado que cinco delas possuem atividade anti-Artemia

  2. Effect of hydrogen ions and inorganic complexing on the uptake of copper by the brine shrimp Artemia franciscana

    OpenAIRE

    Blust, R.; Fontaine, A.; Decleir, W.

    1991-01-01

    The effect of hydrogen ions and inorganic complexing on copper uptake in the brine shrimp Artemia franciscana has been studied in chemically defined saltwater solutions. Uptake increases with decreasing hydrogen ion concentration and decreases with increasing carbonate complexation. A simple non-linear model that combines the effect of hydrogen ions on the transport of the metal across the solution-body interface and the effect of hydrogen ions and complexation on the speciation of the metal ...

  3. A case study to optimise and validate the brine shrimp Artemia franciscana immobilisation assay with silver nanoparticles: The role of harmonisation.

    Science.gov (United States)

    Kos, Monika; Kahru, Anne; Drobne, Damjana; Singh, Shashi; Kalčíková, Gabriela; Kühnel, Dana; Rohit, Rekulapelly; Gotvajn, Andreja Žgajnar; Jemec, Anita

    2016-06-01

    Brine shrimp Artemia sp. has been recognised as an important ecotoxicity and nanotoxicity test model organism for salt-rich aquatic environments, but currently there is still no harmonised testing protocol which would ensure the comparable results for hazard identification. In this paper we aimed to design the harmonised protocol for nanomaterial toxicity testing using Artemia franciscana and present a case study to validate the protocol with silver nanoparticles (AgNPs). We (i) revised the existing nanotoxicity test protocols with Artemia sp. (ii) optimised certain methodological steps based on the experiments with AgNPs and potassium dichromate (K2Cr2O7) as a soluble reference chemical and (iii) tested the optimised protocol in an international inter-laboratory exercise conducted within the EU FP7 NanoValid project. The intra- and inter-laboratory reproducibility of the proposed protocol with a soluble reference chemical K2Cr2O7 was good, which confirms the suitability of this assay for conventional chemicals. However, the variability of AgNPs toxicity results was very high showing again that nanomaterials are inherently challenging for toxicity studies, especially those which toxic effect is linked to shed metal ions. Among the identified sources for this variability were: the hatching conditions, the type of test plate incubation and the illumination regime. The latter induced variations assumingly due to the changes in bioavailable silver species concentrations. Up to our knowledge this is the first inter-laboratory comparison of the Artemia sp. toxicity study involving nanomaterials. Although the inter-laboratory exercise revealed poor repeatability of AgNPs toxicity results, this study provides valuable information regarding the importance of harmonisation of all steps in the test procedure. Also, the presented AgNPs toxicity case study may serve as a platform for further validation steps with other types of NMs. PMID:26895539

  4. Aplicación del bioensayo de Artemia salina en el análisis general de plantas medicinales brasileñas

    OpenAIRE

    Montanher, Ana Beatriz Pimentel; Pizzolatti, Moacir Geraldo; Brighente, Inês Maria Costa

    2002-01-01

    Extractos de once especies de la flora brasileña fueron estudiados para evaluar la actividad citotóxica por el test de Artemia salina. Las plantas seleccionadas fueron: Baccharis pseudotenuifolia, Baccharis ligustrina, Baccharis platypoda, Baccharis coridifolia, Polygala paniculata, Polygala sabulosa, Croton celtidifolius, Cyathea phalerata, Trichilia catigua, Eugenia uniflora y Schinus molle. Los resultados obtenidos para los extractos crudos de B. pseudotenuifolia, B. ligustrina, B. c...

  5. Produção de refeições e alterações nutricionais nos alimentos

    OpenAIRE

    Torres, Duarte

    2009-01-01

    Durante a produção de refeições, o conteúdo nutricional dos alimentos pode decrescer devido à alteraçãoou degradação química dos nutrientes, ou devido à solubilização e drenagem dos nutrientes dos alimentos para o meio de confecção. Por outro lado, o processamento altera a matriz do alimento original,promovendo o aumento da biodisponibilidade de alguns nutrientes e fitoquímicos. Uma correcta compreensão destes dois fenómenos contribuirá para uma melhor estimativa de ingestão de nutrientes e d...

  6. Evaluation of growth and survival rate of Artemia parthenogenetica feed with micro algae (Isochrysis galbana and Chlorella vulgaris and bakery yeast (Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Mehdi Dehghan

    2011-10-01

    Full Text Available This study was done to evaluate growth and survival rate of Maharloo lake artemia (ArtemiaParthenogenetica (Bowen & Sterling, 1978 which feed with two species of microalgae (IsochrysisGalbana and Chlorella vulgaris and bakery yeast (Saccharomyces cerevisiae with different nutritiousingredients for 15 days. We evaluated them in 3rd, 7th, 11th and 15thdays of cultivation period for 4 times. This experiment was done in completely randomized design with 4 treatments (3 treatments and 1 control and each treatment has 3 replicates. Artemia parthenogenetica nauplii were feed with three different types of food that includes Isochrysis galbana microalgae (T1, Chlorella vulgaris (T2 and Saccharomyces cerevisiae yeast (T4. Control had feed with blend of these three matters. After 15 days the highest survival rate was observed in control (84.00 and the lowest one was related to the T4 (59.58 which feed with Saccharomyces cerevisiae yeast (p<0.05. The highest growth rate was observed in T4, T3, followed by T1 and T2 respectively. Achievement results showed significantdifferences between control and other treatments (p<0.05. This study proved that treatments whichfeed with blend of two micro algae's species and bakery yeast have higher survival ability than theother treatments.

  7. Sudden weaning of angel fish pterophyllum scalare (Lichtenstein) (Pisces; Cichlidae) larvae from brine shrimp (Artemia sp) nauplii to formulated larval feed.

    Science.gov (United States)

    Herath, Sandamali Sakunthala; Atapaththu, Kerthi Sri Senarathna

    2013-12-01

    This study investigated the effects of sudden weaning of angel fish larvae (Pteraphylum scalari) from Artemia nauplii to commercial larval feed. Four days post hatch (DPH) larvae were reared in four different weaning protocols (TR1-TR4) with triplicates in a complete randomize design. Larvae in TR1 and TR4 were exclusively fed Artemia nauplii and dry feed respectively. In TR2 and TR3, larvae were initially fed Artemia nauplii and suddenly wean to formulated feed on 14 DPH and 7 DPH respectively. The experiment was lasted for 28 days. At the end of the experiment, final mean weight (FW), total length (FL), height (FH), Daily Weight Gain (DWG), Specific Growth Rate (SGR), survival and stress index were compared. Significantly highest (P < 0.05) FW, DWG and SGR were observed in TR1 and TR2 while former values of TR3 were not significantly different from TR1. Highest FL observed in TR1 and TR2 while FL of TR2 was statistically similar to that of TR3. The poorest growth was observed in larvae solely fed formulated feed. Survival and the stress index were independent from weaning methods. Although sudden weaning is possible on 7 DPH, larvae showed comparatively higher growth when switch off to formulate feed on 14 DPH. PMID:23626927

  8. Anticipation of Artemia sp. supply in the larviculture of the barber goby Elacatinus figaro (Gobiidae: Teleostei influenced growth, metamorphosis and alkaline protease activity

    Directory of Open Access Journals (Sweden)

    Maria Fernanda da Silva-Souza

    2015-09-01

    Full Text Available The barber goby Elacatinus figaro is considered endangered due to overexploitation by the ornamental industry. Farming marine ornamental fishes, especially the threatened ones, can be one of the measures to minimize the pressure on the natural stocks. Among the priority issues for their production is the determination of the most appropriate feeding management. The feeding protocol commonly used in the larviculture of barber goby, when the start of Artemia sp. offer occurred at the 18th DAH (days after hatching (treatment T18, was modified, by anticipating brine shrimp supply in 6 days (treatment T12. Alkaline proteases activity, growth and metamorphosis of larvae were evaluated in both protocols. Juveniles at T12 showed higher weight (0.04 ± 0.001 g and lower activity of total alkaline proteases (1.3 ± 0.2 mU mg-1 protein compared to T18 (0.02 ± 0.001 g; 2.8 ± 0.4 mU mg-1 protein, respectively. With anticipation of brine shrimp, the commencing and end of larval transformation was observed earlier (at 24 and 34 DAH, respectively in comparison to those with the supply of Artemia sp. at 18 DAH (27 and 41 DAH, respectively. Thus, the Artemia sp. anticipation was beneficial during the larviculture of the barber goby, considering that larvae reached metamorphosis earlier.

  9. Metodología de Proyecto para el perfeccionamiento de la atención de alimentos en conflicto.

    OpenAIRE

    Marta Cardona Gálvez; Tamara Díaz Lorenzo; Yariela Sánchez Azahares; Angel Caballero Torres; Pedro Morejón Martín

    2005-01-01

    La educación sanitaria ha estado siempre entre las principales actividades a realizar para garantizar la calidad sanitaria de los alimentos, aunque en la actualidad se reconoce la necesidad de perfeccionarla a través de la implementación de un Programa de Capacitación en Seguridad Alimentaria, dirigido a todas las personas involucradas en la cadena alimentaria. Teniendo en cuenta las desviaciones sanitarias que están experimentando los alimentos desde su producción hasta el consumo y la alta ...

  10. As leguminosas como alimentos funcionais: o caso das dislipidémias e das doenças cardiovasculares.

    OpenAIRE

    J. M. Martins; Bento, O.P.

    2007-01-01

    A dieta mediterrânica é rica em alimentos funcionais. As leguminosas, um dos alimentos-chave desta dieta, têm visto o seu papel na prevenção de dislipidémias, diabetes e cancro do cólon mencionado por muitos autores. O efeito do consumo de leguminosas na redução da colesterolémia deve-se a diferentes nutrientes e fitoquímicos, tais como: i) proteína; ii) lípidos, particularmente a componente polinsaturada e monoinsaturada; iii) fibra, especialmente a fracção solúvel; iv) saponinas; e v) fitos...

  11. Segurança alimentar: a abordagem dos alimentos transgênicos Food safety: the approach to transgenic foods

    OpenAIRE

    Suzi Barletto CAVALLI

    2001-01-01

    O objetivo desta comunicação é discutir a relação entre a segurança alimentar e os alimentos geneticamente modificados. A biotecnologia e a engenharia genética têm sido encaradas como parte da segunda revolução verde, justificando-se, entre outras prerrogativas, o uso de alimentos transgênicos como solução do problema da fome no mundo, sem risco à saúde da população e ao meio ambiente. Face a essa premissa, discute-se a segurança alimentar sob os enfoques qualitativos e quantitativos, destaca...

  12. INTERPRETAÇÕES ACERCA DA INFLUÊNCIA DAS INFORMAÇÕES NUTRICIONAIS NA ESCOLHA DE ALIMENTOS INFANTIS

    Directory of Open Access Journals (Sweden)

    Marcelo Pais Moreira Lopes

    2013-04-01

    Full Text Available Diversos estudos têm demonstrado que, nas últimas décadas, mudanças nos hábitos alimentares vêm ocorrendo e que a proliferação de alimentos com diferentes finalidades passou a exigir do consumidor um alto nível de informação. Este artigo tem por objetivo principal investigar os fatores que influenciam a compra de alimentos infantis, observando especialmente os significados atribuídos por mães às informações nutricionais. Foram entrevistadas mães de diferentes níveis de escolaridade, renda, profissão e bairro de residência na cidade do Rio de Janeiro. O tratamento dos dados coletados ocorreu por meio da análise de conteúdo e, ao longo das entrevistas, foram questionados, por exemplo, quais fatores as mães entrevistadas consideravam importantes ao comprar alimentos para seus filhos e se tinham o costume de consultar as tabelas nutricionais dos alimentos no supermercado quando os estavam comprando. Adicionalmente, buscamos compreender o que, na perspectiva das mães, significam “alimentos pouco saudáveis” e qual conceito tinham sobre alimentos “nutritivos” e “saudáveis” - investigando se seriam sinônimos ou não. A partir de tais procedimentos, os resultados mostram que os três principais fatores que influenciam a compra de alimentos para os filhos são: i preço; ii marca; e iii a influência dos filhos. As interpretações a respeito das informações nutricionais puderam ser agrupadas em cinco categorias, quais sejam: 1 comprando besteira; 2 nutritivo versus saudável; 3 comer bem; 4 fatores importantes ao comprar alimentos para os filhos; e 5 informações nutricionais na intenção de compra.

  13. Estudio de la migración de distintos componentes de los materiales plásticos a los alimentos

    OpenAIRE

    Sendón García, Raquel

    2005-01-01

    Los materiales en contacto con alimentos son todos aquellos materiales y artículos destinados a entrar en contacto directo con los alimentos, incluidos los materiales de envasado pero también cubiertos, platos, máquinas de procesado, recipientes, etc. Los principales recubrimientos usados son bisfenol A epoxi resinas y/o epoxi novolacs; ambas son mezclas complejas de especies químicas de naturaleza fenólica de diferentes pesos moleculares. Las resinas epoxi bisfenol A son principalmente pr...

  14. Estudo de um TTI fotocrómico para aplicação em alimentos refrigerados

    OpenAIRE

    Verdade, Patrícia Simões

    2010-01-01

    Os consumidores actuais são cada vez mais exigentes no que respeita à sua alimentação, pretendendo alimentos com melhores propriedades funcionais e nutricionais combinadas com uma longa data de validade, bem como produtos contendo poucas calorias e aditivos, fáceis e rápidos de preparar. Aliados a estes conceitos estão ainda o melhoramento na segurança e na qualidade sensorial dos alimentos. Para se atingir tais objectivos é necessário a monitorização, registo e controlo dos...

  15. Contaminantes em alimentos para crianças: simulação in vitro do processo digestivo de nitratos

    OpenAIRE

    Pina, Zeila Cristina Neves Évora de

    2011-01-01

    Uma alimentação adequada durante a infância é importante para o desenvolvimento adequado da criança. Os alimentos destinados a lactentes e crianças jovens devem ser monitorizados relativamente à presença de contaminantes, uma vez que as crianças constituem um grupo fisiologicamente vulnerável à acção de contaminantes nos alimentos. Os nitratos são iões que ocorrem naturalmente na natureza com alto potencial cumulativo em vegetais. A toxicidade dos nitratos resulta da sua conversão a nitritos,...

  16. Preferencias en canales de distribución y nivel de ingresos: un análisis para alimentos frescos

    OpenAIRE

    Berges, Miriam; Casellas, Karina

    2001-01-01

    En este trabajo, abarcando una muestra de todo el país, se intenta analizar el tipo de canal elegido por las familias para realizar sus compras de alimentos, en especial para el caso de la carne vacuna, el pollo, las frutas y verduras y los productos lácteos. Esta selección obedece a que se ha dicho mucho sobre si prevalece o no la preferencia de ciertos sectores de la población por elegir los alimentos frescos en negocios del tipo tradicional, como las carnicerías, las verdulerías y las frut...

  17. Análisis de aflatoxinas y ocratoxina A en alimentos y evaluación de la ingesta poblacional.

    OpenAIRE

    Juan García, Cristina

    2008-01-01

    Las micotoxinas son sustancias producidas por determinados hongos presentes en alimentos destinados para alimentación humana o animal, y por su carácter tóxico pueden dar lugar a las enfermedades denominadas micotoxicosis.De ellas son las aflatoxinas (AFs) y la ocratoxina A (OTA) las que mayor preocupación han generado en el Comité Científico de Alimentación Humana de la Unión Europea, debido a los riesgos que el consumo continuado de estas micotoxinas a través de los alimentos comporta para ...

  18. Análisis de aflatoxinas y ocratoxina A en alimentos y evaluación de la ingesta poblacional.

    OpenAIRE

    Juan García, Cristina

    2008-01-01

    RESUMEN Las micotoxinas son sustancias producidas por determinados hongos presentes en alimentos destinados para alimentación humana o animal, y por su carácter tóxico pueden dar lugar a las enfermedades denominadas micotoxicosis. De ellas son las aflatoxinas (AFs) y la ocratoxina A (OTA) las que mayor preocupación han generado en el Comité Científico de Alimentación Humana de la Unión Europea, debido a los riesgos que el consumo continuado de estas micotoxinas a través de los alimentos...

  19. Plan de saneamiento para una distribuidora de alimentos que atiende a niños y adultos mayores

    OpenAIRE

    Liliana SERNA-COCK; Correa-Gómez, Maria D.C.; ALFREDO A. AYALA-APONTE

    2012-01-01

    Los niños y adultos mayores representan los consumidores más vulnerables a adquirir enfermedades transmitidas por alimentos, ETA, por lo que se hace más estricto disminuir los factores de riesgo que se generan en la elaboración de alimentos dirigidos para este grupo de población. En este reporte, con el fin de disminuir los factores de riesgo de ETA a una población de niños y adultos mayores, se diseñó y se implementó un plan de saneamiento, siguiendo los lineamientos de decreto 3075 de 1997 ...

  20. Ocorrência de Vibrio vulnificus em alguns alimentos de origem marinha

    Directory of Open Access Journals (Sweden)

    Maria Luz Garcia Moreno

    1997-08-01

    Full Text Available Vibrio vulnificus é uma bactéria Gram-negativa que habita águas marinhas. É patogênica para o homem e a doença está associada ao consumo de frutos do mar, com aproximadamente 60% dos casos sendo fatais em pacientes imunocomprometidos. O objetivo desta pesquisa foi estudar a ocorrência de V. vulnificus em amostras de alguns alimentos de origem marinha. As amostras de ostras, mariscos e camarões foram coletadas nos períodos de abril-agosto de 1993, maio-setembro de 1994 e fevereiro de 1995. De 55 amostras de ostras, 36 (65% foram positivas para V. vulnificus; das 19 amostras de mariscos, 8 (42,1% foram positivas e das 7 amostras de camarão, 1 (4,3% foi positiva para esta bactéria. Os resultados permitiram-nos concluir que a bactéria foi recuperada durante todos os meses de análise, demonstrando que estes alimentos, principalmente quando consumidos crus, são potencialmente perigosos para os seres humanos na faixa de risco.

  1. Salud dental: relación entre la caries dental y el consumo de alimentos

    Directory of Open Access Journals (Sweden)

    Ángel Miguel González Sanz

    2013-07-01

    Full Text Available A pesar de que la reducción de la incidencia y prevalencia de la caries dental en muchos países se relaciona en gran medida con el uso sistemático del flúor en las pastas dentífricas y la mejora de la higiene dental, se debe tener presente la importancia de los hábitos alimentarios en la prevención primaria y secundaria de la caries dental. En este sentido, destacan los carbohidratos fermentables, determinadas características de los alimentos, la frecuencia de consumo, distintos tipos de alimentos, algunos como factores protectores, la cantidad y la calidad de la saliva, en tanto que ello determina el índice de remineralización de los dientes etc. Todos estos elementos son analizados a través de los factores sociodemográficos, de comportamiento, físico-ambientales y biológicos relacionados directa o indirectamente con dieta y caries.

  2. El control corporativo de la distribución de alimentos en México

    Directory of Open Access Journals (Sweden)

    José Gasca

    2014-01-01

    Full Text Available En este trabajo se analizan algunos factores relevantes que intervienen en la configuración del sistema de distribución de alimentos en México y en los cuales se basa el liderazgo y dominio corporativo de éste. Se ubican las causas y efectos que operan en la expansión de un nuevo esquema empresarial de distribución de alimentos más competitivo y mejor organizado en comparación con los canales tradicionales que operaban antes del surgimiento de esta hegemonía. La importancia de este proceso, asociado a la apertura económica, se refleja en un conjunto de estrategias de expansión territorial mediante múltiples modalidades de operación y tamaños de establecimientos para dominar cuotas importantes del consumo alimentario ubicados principalmente en las ciudades mexicanas. Palabras clave: comercio alimentario, canales minoristas, supermercados, corporativos comerciales, abasto alimentario, México.

  3. Cadenas productivas y disponibilidad de alimentos en Argentina Productive chains and food availability in Argentina

    Directory of Open Access Journals (Sweden)

    Malena Giai

    2010-06-01

    Full Text Available En abril de 2009 se conformó en la Asociación Argentina de Dietistas y Nutricionistas Dietistas el Grupo de Estudio sobre Soberanía Alimentaria, constituido por un grupo de Licenciados en Nutrición con interés en el tema. Como primer objetivo, el Grupo se propuso estudiar tres temas: "el Derecho a la Alimentación", "la Producción y Disponibilidad de alimentos en Argentina" y "la Canasta Básica de Alimentos". En el presente artículo se expone un resumen de los avances en el segundo tema mencionado.In April 2009, was formed in the Argentina Association of Dieticians and Nutritionists Dietitians the Study Group on Food Sovereignty, established by a group of graduates in nutrition with interest in the subject. As a first objective, the Group was to examine three issues: "The Right to Food", "Production and Availability of food in Argentina" and "Basic Food Basket." This article is a summary of progress on the second topic mentioned.

  4. Artemia salina as a model organism in toxicity assessment of nanoparticles

    OpenAIRE

    Rajabi, Somayeh; Ramazani, Ali; Hamidi, Mehrdad; Naji, Tahereh

    2015-01-01

    Background Because of expanding presence of nanomaterials, there has been an increase in the exposure of humans to nanoparticles that is why nanotoxicology studies are important. A number of studies on the effects of nanomatrials in in vitro and in vivo systems have been published. Currently cytotoxicity of different nanoparticles is assessed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay on different cell lines to determine cell viability, a tedious and ex...

  5. Alimentos tradicionales en Sonora, México: factores que influyen en su consumo

    Directory of Open Access Journals (Sweden)

    Joel Enrique Espejel Blanco

    2014-05-01

    Full Text Available La alimentación se considera un fenómeno biocultural, ya que cumple funciones biológicas de supervivencia y se basa en componentes culturales que se encuentran asociados a los patrones de consumo de los individuos. Desde el punto de vista de marketing, los elementos culturales, junto con las características de los productos, así como sus valores simbólicos, emocionales, de seguridad, de riesgo percibido y personales, pueden llegar a condicionar las elecciones y preferencias de los individuos. Cuando se trata de alimentos tradicionales, resulta probable que la conjugación de elementos culturales y del producto se vuelvan fundamentales en las decisiones de los consumidores. Al analizar alimentos tradicionales/típicos, se los puede identificar desde una visión “nacional”; sin embargo, se trata de una perspectiva muy generalista, ya que dentro de un mismo territorio existe una amplia variabilidad alimentaria. Los componentes y características regionales también pueden variar y favorecer con ello la formación de una identidad gastronómica regional. En esta línea, la investigación que se realiza se centra específicamente en los alimentos tradicionales de Sonora -estado ubicado al noroeste de México-, en donde existe una cocina que mantiene elementos en común con la tradicional cocina mexicana, pero que a su vez tiene un sentido emblemático y de identidad regional. En este contexto, el objetivo general de esta investigación es analizar la influencia que ejercen distintos atributos sobre la satisfacción del consumidor respecto a los alimentos tradicionales sonorenses. Para ello, primero se analiza cómo la calidad extrínseca afecta la seguridad y confianza alimentaria, y cómo a su vez la seguridad, confianza y conveniencia alimentaria influyen sobre la satisfacción del consumidor. Para llevar a cabo la investigación se ha realizado un muestreo aleatorio estratificado considerando la edad y el género como los criterios de

  6. Cuantificación de folato total en alimentos ready-to-eat

    Directory of Open Access Journals (Sweden)

    Violeta Fajardo Martín

    2013-08-01

    Full Text Available Introducción: Los productos ready-to-eat, ya cocinados, envasados y refrigerados, son cada vez más consumidos en nuestro país. Sin embargo, no existen estudios que cuantifiquen su disponibilidad comercial, composición e información detallada para poder estimar su impacto sobre las ingestas, particularmente de folatos, en los diferentes grupos de población. Objetivos: La finalidad de este trabajo de investigación ha consistido en conocer la disponibilidad actual de alimentos ready-to-eat de base vegetal y aportar datos sobre el contenido de folato total de los mismos. Métodos: La concentración de folato total se determinó en 17 productos precocinados refrigerados, con ingredientes vegetales, mediante el método microbiológico basado en el crecimiento del Lactobacillus casei subespecie rhamnosus resistente a cloranfenicol. La precisión del procedimiento analítico se comprobó mediante un material de referencia certificado y por una prueba de recuperación con ácido fólico tritiado. Resultados y discusión: El contenido medio de FT varió desde 13,6 hasta 103,8 μg/100 g de peso fresco, siendo superior en hamburguesas vegetales, recetas con garbanzos, guisantes o alcachofas con jamón. Los alimentos se sometieron al tratamiento térmico indicado por el fabricante previo a su consumo, observándose que no existen pérdidas de folatos durante este último procesado. El coeficiente de variación de los duplicados del mismo producto fue inferior al 15%. Conclusiones: Se presentan datos pioneros relativos al análisis de folatos en alimentos ready-to-eat en el mercado español, que ayudarán a evaluar la adecuación de la ingesta de folatos en la población. El contenido de folatos de estos productos, su facilidad de consumo y atractiva presentación, los convierte en fuentes potenciales de la vitamina.

  7. Polímeros reciclados para contato com alimentos Recycled polymers for food contact

    Directory of Open Access Journals (Sweden)

    Sandra A. Cruz

    2011-01-01

    Full Text Available Os resíduos sólidos urbanos (RSUs são atualmente um dos maiores problemas ambientais, por serem gerados em grande quantidade e ocuparem extensos espaços por um longo período, resultando na diminuição do tempo de vida útil dos aterros sanitários. Os polímeros constituem um grande percentual da composição do RSUs, sendo que as embalagens plásticas contribuem com maior volume e massa. Apesar da reciclagem de polímeros estarem se consolidando no Brasil, graças ao seu mercado ascendente e promissor, existem ainda restrições quanto a sua utilização em contato com alimentos devido aos eventuais processos de migração de contaminantes que podem ocorrer da resina reciclada para o alimento. Por outro lado, dados recentes do setor indicam que a maior parte do consumo de resina virgem é destinada, justamente, para o mercado de embalagens alimentícias. Assim, o desenvolvimento e o gerenciamento de tecnologias que possibilitem o retorno destes materiais a sua aplicação original é de grande importância para sociedade contemporânea. Em um panorama geral, este trabalho aborda as exigências e limitações do uso de polímeros reciclados para contato com alimentos.Municipal solid waste has recently become one of the severest environmental problems. This is because it is generated on a large scale and occupies large spaces for long periods resulting in a decrease in the useful life of landfills. Polymers comprise a large percentage of municipal solid waste and polymer packaging is responsible for the large mass and volume amount. Despite the consolidation of polymer recycling in Brazil, due to the promising and growing market, there are still restrictions concerning to its application for food contact due to eventual migration process that might occur from the recycled resin into the food. On the other hand, recent data of the sector indicates that food packaging market is responsible for the highest consumption of the produced amount of

  8. Intoxicación por alimentos, plantas y setas Poisoning by foodstuffs, plants and mushrooms

    Directory of Open Access Journals (Sweden)

    M.A. Pinillos

    2003-01-01

    Full Text Available La intoxicación alimentaria se define como aquella intoxicación provocada por cualquier alimento o producto alimenticio que por contener sustancias tóxicas, gérmenes, metales, aditivos, hormonas, etc. provocan una intoxicación. Supone una parte muy importante de la Toxicología Clínica, aunque en la mayoría de las estadísticas, las toxiinfecciones alimentarias provocada por bacterias, protozoos y virus no son contabilizadas como intoxicaciones, ya que son provocadas por gérmenes y son recogidas como infecciones. En este tema se hace referencia a todos los tipos de patologías debidas a los alimentos, haciendo hincapié en el botulismo, comentando el cuadro clínico en sus diferentes formas clínicas, pero sobre todo en la forma adulta y contraída mediante el consumo de alimentos mal conservados o poco cocinados; la intoxicación por pescado y por marisco. Se describen también los cuadros toxicológicos a los que puede avocar el consumo de plantas que contienen sustancias tóxicas, encuadradas por las diferentes sintomatologías que producen; por último, se exponen las intoxicaciones por setas según el periodo de incubación y las posibles confusiones.Food poisoning is defined as poisoning caused by any foodstuff or alimentary product that causes poisoning because it contains toxic substances, germs, metals, additives, hormones, etc. It forms an important part of Clinical Toxicology, although in the majority of statistics, alimentary toxic infections provoked by bacteria, protozoa and viruses are not classified as poisonings, since they are caused by germs, and are classified as infections. Reference is made within this subject to all types of pathologies due to food, with special emphasis given to botulism. The clinical picture of botulism is discussed in its different clinical forms, but above all in its adult form which is contracted through the consumption of undercooked or badly preserved foods; poisoning by fish and seafood

  9. Contenido nutricional de alimentos y bebidas publicitados en la franja infantil de la televisión colombiana

    Directory of Open Access Journals (Sweden)

    Diana Margarita Mejía-Díaz

    2014-04-01

    Full Text Available Objetivo: Describir el contenido nutricional de alimentos y bebidas no alcohólicas publicitados en la franja infantil vs general, en dos canales gratuitos privados de televisión nacional colombiana. Métodos: Estudio descriptivo transversal. La grabación se realizó en julio de 2012, durante cuatro días seleccionados aleatoriamente de 6:00 am a 12:30 pm. El contenido nutricional se clasificó según los criterios de perfiles nutricionales de la Food Standards Agency para nutrientes trazadores de riesgo, la Organización Panamericana de la Salud para grasa trans, y la Resolución colombiana 333 de 2011 para clasificar los alimentos como fuente o no, de nutrientes protectores. Se utilizó estadística descriptiva, prueba de Kolmogorov-Smirnov para establecer la normalidad y prueba de Chi cuadrado para la comparación entre variables. Se consideró un p < 0,05. Resultados: En 52 horas de grabación se emitieron 1.560 pautas publicitarias, de las cuales el 23,3% (364 pautas, fue de publicidad de alimentos y bebidas y de estas, el 56,3% se publicitaron en la franja infantil. En cuanto al contenido nutricional, se destacó mayor porcentaje de alimentos y bebidas no alcohólicas clasificados como "altos" en azúcar, sodio y grasa saturada en la franja infantil (69,0%, 56,0%, 57,1% respecto a la franja general. Por el contrario, el porcentaje de alimentos y bebidas no alcohólicas clasificados como "alto" en grasa total fue mayor en la franja general vs la franja infantil (70,4%, 29,6% respectivamente. Conclusiones: Una mayor exposición a la publicidad de alimentos y bebidas no alcohólicas se evidenció en la franja infantil, caracterizada por alto contenido de nutrientes trazadores de riesgo y bajo contenido de nutrientes protectores de los alimentos y bebidas no alcohólicas publicitados.

  10. Does a Change from Whole to Powdered Food (Artemia franciscana eggs Increase Oviposition in the Ladybird Coleomegilla maculata?

    Directory of Open Access Journals (Sweden)

    Eric W. Riddick

    2015-09-01

    Full Text Available The limited availability of alternative foods to replace natural prey hinders cost-effective mass production of ladybird beetles for augmentative biological control. We compared the effects of powdered vs. whole Artemia franciscana (A. franciscana (brine shrimp eggs with or without a dietary supplement on development and reproduction of Coleomegilla maculata (C. maculata (Coleoptera: Coccinellidae. We tested the hypotheses that (1 powdered A. franciscana eggs are more suitable than whole eggs; and (2 palmitic acid, a common fatty acid in natural prey, i.e., aphids, is an effective dietary supplement. Development time, pre-imaginal survival, sex ratio, and body weight of adults did not differ significantly amongst individuals fed powdered vs. whole eggs, with or without 5% palmitic acid. Significantly more oviposition occurred when females were fed powdered eggs than whole eggs and powdered eggs with 5% palmitic acid than whole eggs with or without 5% palmitic acid. A weak functional relationship was found between pre-oviposition time and total oviposition by females fed powdered eggs with 5% palmitic acid; pre-oviposition time decreased as oviposition increased. Food treatments had no significant differential effect on progeny (egg hatch rate. In conclusion, a simple change in A. franciscana egg texture and particle size (i.e., blending whole eggs into a dust-like powder increases oviposition in C. maculata. Supplementing powdered eggs with 5% palmitic acid might accelerate oogenesis (egg maturation in some females.

  11. Copper(II) complexes with 2-pyridineformamide-derived thiosemicarbazones: Spectral studies and toxicity against Artemia salina

    Science.gov (United States)

    Ferraz, Karina O.; Wardell, Solange M. S. V.; Wardell, James L.; Louro, Sonia R. W.; Beraldo, Heloisa

    2009-07-01

    The copper(II) complexes [Cu(H2Am4DH)Cl 2] ( 1), [Cu(H2Am4Me)Cl 2] ( 2), [Cu(H2Am4Et)Cl 2] ( 3) and [Cu(2Am4Ph)Cl] ( 4) with 2-pyridineformamide thiosemicarbazone (H2Am4DH) and its N(4)-methyl (H2Am4Me), N(4)-ethyl (H2Am4Et) and N(4)-phenyl (H2Am4Ph) derivatives were studied by means of infrared and EPR spectral techniques. The crystal structure of 4 was determined. The studied compounds proved to be toxic to Artemia salina, suggesting that they could present cytotoxic activity against solid tumors. Among the free thiosemicarbazones H2Am4Ph presented higher toxicity than all other compounds, which showed comparable effects. In the case of complexes 2 and 3 toxicity is probably attributable to the complex as an entity or to a synergistic effect involving the thiosemicarbazone and copper. H2Am4Ph and complexes 2 and 3 revealed to be the most promising compounds as potential antineoplasic agents.

  12. Primary Screening of the Bioactivity of Brackishwater Cyanobacteria: Toxicity of Crude Extracts to Artemia salina Larvae and Paracentrotus lividus Embryos

    Directory of Open Access Journals (Sweden)

    Viviana R. Lopes

    2010-03-01

    Full Text Available Cyanobacteria are a diverse group of Gram-negative bacteria that produce an array of secondary compounds with selective bioactivity against vertebrates, invertebrates, plants, microalgae, fungi, bacteria, viruses and cell lines. The aim of this study was to assess the toxic effects of aqueous, methanolic and hexane crude extracts of benthic and picoplanktonic cyanobacteria isolated from estuarine environments, towards the nauplii of the brine shrimp Artemia salina and embryos of the sea urchin Paracentrotus lividus. The A. salina lethality test was used as a frontline screen and then complemented by the more specific sea urchin embryo-larval assay. Eighteen cyanobacterial isolates, belonging to the genera Cyanobium, Leptolyngbya, Microcoleus, Phormidium, Nodularia, Nostoc and Synechocystis, were tested. Aqueous extracts of cyanobacteria strains showed potent toxicity against A. salina, whereas in P. lividus, methanolic and aqueous extracts showed embryo toxicity, with clear effects on development during early stages. The results suggest that the brackishwater cyanobacteria are producers of bioactive compounds with toxicological effects that may interfere with the dynamics of invertebrate populations.

  13. Reporting a new siderophore based Ca(2+) selective chemosensor that works as a staining agent in the live organism Artemia.

    Science.gov (United States)

    Raju, M; Nair, Ratish R; Raval, Ishan H; Haldar, Soumya; Chatterjee, Pabitra B

    2015-11-21

    A Ca(2+)-specific chemosensor involving acyclic non-ether and non-carboxylato-type metal chelating ligands is rare. The tetradentate OONO artificial receptor, HL, possessing a sulfur-containing intermediate siderophore aeruginic acid, tethered to a rhodamine 6G based signalling unit in a single molecule has been synthesized. The fluoroionophore required excitation in the visible wavelength (510 nm) and showed highly selective and sensitive detection of Ca(2+) ions in 100% water solution in HEPES buffer at physiological pH (7.4). The probe HL, with LOD as low as 70 nM, behaves reversibly and showed nearly 17-fold enhanced selectivity for Ca(2+) over other cell abundant alkali and alkaline metal ions such as Na(+), K(+), Li(+), and Mg(2+) without any intervention. Job's plot, (1)H NMR titration and ESI-MS data provided corroborative evidence in support of 1 : 1 association between HL and Ca(2+). From a wide range of transition and heavy metal ions series, HL also binds Cu(2+). However, the use of l-cysteine removes the interference from Cu(2+) and results in highly selective detection specificity of HL for Ca(2+). As a reversible "off-on-off" fluorescent chemosensor, it is possible to detect Ca(2+) at as low as 5 μM in the midgut region of the gastrointestinal tract of the live animal Artemia, a brine shrimp. PMID:26460620

  14. Proposta de utilização da microestrutura de pelos-guarda para fins de estudos forenses e no controle de qualidade de alimentos

    Directory of Open Access Journals (Sweden)

    Fabiana Silveira

    2013-10-01

    Full Text Available A identificação de mamíferos através das características microscópicas de seus pelos é possível com a utilização de várias técnicas tais como a análise dos padrões microestruturais encontrados nas escamas cuticulares e células medulares dos pelos-guarda. Tais técnicas utilizadas comumente no reconhecimento espécie específica podem também ser ferramenta em estudos forenses e de controle de qualidade de alimentos. Neste sentido, este estudo tem como objetivo a identificação microscópica de pelos-guarda de espécies domiciliares e peridomiciliares que possam ter ocorrência em locais de crime ou como contaminantes de alimentos. Assim, foram utilizados pelos-guardas coletados de coleções zoológicas e de espécimes vivos de gambás-de-orelha-preta e gambá-de-orelha-branca, camundongo, ratazana-de-casa, ratazana-de-esgoto, algumas espécies de morcegos, gato-doméstico, cão-doméstico e a espécie humana. Por meio do método utilizado, foram encontrados quatro padrões de cutícula: conoidal, ondeada, folidácea e losângica, sendo que a ondeada apresentou as variações lisa e ornamentada nas bordas das escamas. Para a medula foram encontrados seis padrões: ausente, presente unisseriada e presente multisseriada crivada, trabecular, matricial e alveolar. Com os resultados obtidos foi possível diferenciar todas as espécies abordadas através da análise dos padrões microestruturais de seus pelos-guarda, sendo os resultados apresentados em uma chave dicotômica ilustrada por fotomicrografias dos padrões.

  15. Exactitud de las tablas de composición de alimentos en la determinación de nutrientes

    Directory of Open Access Journals (Sweden)

    R. Pérez Grana

    2013-06-01

    Full Text Available Las tablas de composición de alimentos constituyen una herramienta imprescindible para realizar una valoración nutricional de alimentos o de ingesta en las Fuerzas Armadas. Ofrecen una información semicuantitativa, más exacta para los macronutrientes o algunos elementos minerales mayoritarios (potasio, calcio y fósforo, y menos exacta para vitaminas y elementos minerales traza. Las diferencias entre las tablas de composición de alimentos y los análisis químicos son variables dependiendo de la fuente bibliográfica consultada. Así se citan unas diferencias elevadas para algunos nutrientes: fibra dietética, sodio, hierro, ácidos grasos monoinsaturados, ácidos grasos poliinsaturados y algunas vitaminas. Estas diferencias se explican por la variabilidad natural de los alimentos (alimentación animal, fertilización del suelo, grado de maduración, región de origen, etc., tratamientos tecnológicos, plan de muestreo y otros. Su exactitud aumenta cuando se llevan a cabo estimaciones de ingesta en periodos largos de tiempo o en el caso de grandes grupos de población. Cuando se requiere una alta exactitud (estudios metabólicos, investigación clínica, etc. el cálculo de nutrientes debería basarse en análisis químicos directos. No todas las tablas de composición de alimentos indican la variabilidad de cada nutriente (desviación estándar, límites de confianza, número de muestras analizadas, códigos de confianza para cada nutriente, que informen al usuario de su fiabilidad.

  16. Control biológico en cultivos hortícolas: efecto de los alimentos suplementarios en depredadores y parasitoides

    OpenAIRE

    Fernández Oveja, Marta

    2014-01-01

    Els aliments suplementaris poden jugar un paper important en el control biològic de plagues ja que afegint l’aliment adequat en un cultiu, pot facilitar la instal•lació dels enemics naturals en aquest cultiu i a més permeti la seva dispersió dins del cultiu. Els quists d’Artemia sp. i el pol•len comercial d’abella millorarien la longevitat i reproducció dels depredadors polífags. A més l’addició dels quists en el cultiu no interferiria en la dispersió dels depredadors i en condicions de hiver...

  17. Interactions between antihypertensive drugs and food Interacciones entre fármacos antihipertensivos y alimentos

    Directory of Open Access Journals (Sweden)

    B. Jáuregui-Garrido

    2012-12-01

    Full Text Available Objective: A drug interaction is defined as any alteration, pharmacokinetics and/or pharmacodynamics, produced by different substances, other drug treatments, dietary factors and habits such as drinking and smoking. These interactions can affect the antihypertensive drugs, altering their therapeutic efficacy and causing toxic effects. The aim of this study was to conduct a review of available data about interactions between antihypertensive agents and food. Methods: The purpose of this review was to report an update of main findings with respect to the interactions between food and antihypertensive drugs by way of a search conducted in PubMed, which yielded a total of 236 articles initially. Results: After excluding different articles, which were not focusing on the specific objective, the main results refer to interactions between antihypertensive drugs and food (in general as well as between antihypertensive agents and grapefruit juice. Discussion: Food may affect the bioavailability of antihypertensive drugs and this should be carefully considered. Advising patients to remove the grapefruit juice from their diet when treatment with these drugs seems to be the best recommendation. Given these interactions and the associated potential adverse effects the anamnesis must include detailed information about the specific eating habits of the patients.Objetivo: la interacción de medicamentos se define como cualquier alteración, farmacocinética y/o farmacodinámica, producida por diferentes sustancias, otros tratamientos, factores dietéticos y hábitos como beber y fumar. Estas interacciones pueden afectar a los fármacos antihipertensivos, alterando su eficacia terapéutica y causando efectos tóxicos. El objetivo de este estudio fue realizar una revisión de los datos disponibles acerca de las interacciones entre los fármacos antihipertensivos y los alimentos. Métodos: El objetivo de esta revisión fue proporcionar una puesta al día sobre los

  18. Teores de poliaminas em alguns alimentos da dieta básica do povo brasileiro

    Directory of Open Access Journals (Sweden)

    Lima Giuseppina Pace Pereira

    2006-01-01

    Full Text Available Os teores de poliaminas variam, assim como a sua necessidade, por estarem relacionadas diretamente com o crescimento de células. Neste estudo, foram analisados os teores de putrescina, espermidina e espermina em diversos alimentos de origem vegetal e em ovos. O cozimento não afetou os teores em arroz ou feijão, porém em batata inglesa houve diferença, sendo que a fritura incrementou o teor principalmente de putrescina. Alface, laranja, banana e tomate apresentaram teores de putrescina maiores, enquanto que em cebola, alho, ovos, arroz e feijão houve predominância de espermidina e espermina. Estes resultados são relevantes para uma possível elaboração da dieta de muitas pessoas, dependendo da sua necessidade diária.

  19. Implicaciones jurídicas de los alimentos transgénicos en Colombia

    Directory of Open Access Journals (Sweden)

    Mario Ernesto García Martínez

    2003-01-01

    Full Text Available Las implicaciones juridicas de los alimentos transgénicos en Colombia demuestra que es necesario que se establezca un marco legal de Bioseguridad sólido. Es imperativo que la autoridad medioambiental, entendiendo por éstá no sólo el Ministerio del Medio Ambiente sino también, el Ministerio de Salud, el Ministerio de Agricultura, el lCA y ellNVlMA, desarrollen una política integral de Bioseguridad y Biotecnología, y como consecuencia de ello presenten cuanto antes un proyecto de Ley Marco que se encargue de regular la Biotecnología en Colombia

  20. NOVAS APLICAÇÕES DE SISTEMAS SFE "HOME-MADE".: IV. QUALIDADE DOS ALIMENTOS

    Directory of Open Access Journals (Sweden)

    LANÇAS Fernando M.

    1997-01-01

    Full Text Available São apresentadas algumas aplicações de um sistema "Home-Made" para Extração com Fluido Supercrítico (EFS na análise de resíduos de pesticidas e de óleos essenciais em alimentos. Foram desenvolvidos diversos estudos com os parâmetros: temperatura, pressão, escolha e concentração de modificadores. Os resultados são apresentados para amostras de maracujá (resíduos de pesticidas organofosforados e piretróides, mel (resíduos de pesticidas organoclorados e laranja (óleo essencial.

  1. Perspectivas de la biotecnología de alimentos en Colombia

    Directory of Open Access Journals (Sweden)

    Villate S.

    1998-12-01

    Full Text Available Hace dos siglos, Malthus afirmaba que el crecimiento de la población mundial superaría al suministro de alimentos. Este pronóstico no se ha cumplido porque la actividad agrícola ha aumentado considerablemente, gracias a factores como la mecanización, técnicas agrícolas intensificadas y la utilización de abonos entre otros. Los sistemas agrícolas actuales, aunque son capaces de generar excedentes regionales en los países desarrollados, dejan a la cuarta parte de la población mundial subalimentada y es incierto si se abastecerán sus necesidades para el 2030. Es así como la biotecnología, bajo sus diferentes formas, se puede considerar como una de las mejores posibilidades para evitar un empobrecimiento catastrófico de la humanidad y su medio natural.

  2. COMPORTAMENTO DE ESTAFILOCOCOS COAGULASE NEGATIVOS PAUCIPRODUTORES DE ENTEROTOXINAS, EM ALIMENTOS EXPERIMENTALMENTE INOCULADOS

    Directory of Open Access Journals (Sweden)

    PEREIRA Maria Lúcia

    2001-01-01

    Full Text Available Linhagens de estafilococos coagulase negativos e pauciprodutores de enterotoxina de A a E, com capacidade de síntese variando de 1,4 a 16ng/mL oriundas de sítios anatômicos de cabras sadias, procedentes da Espanha, foram estudadas com o intuito de se avaliar a capacidade de desenvolvimento e produção de enterotoxina estafilocócica ("SE", em alimentos experimentalmente inoculados. Para tal, leite integral "tipo longa vida" e presunto cozido foram, de maneira isolada e em duplicata, inoculados com 14 linhagens teste, S.caprae, duas amostras; S.chromogenes; S.cohnii; S.epidermidis; S.haemolyticus, duas amostras; S.hyicus; S.lentus; S.sciuri; S.xylosus, duas amostras; e S.warneri, duas amostras; previamente caracterizadas bioquimicamente. Estes substratos alimentícios, uma vez inoculados, foram mantidos em estufa a 30°C, durante 24 e 48h de incubação e, neste período, submetidos à contagem de células estafilocócicas em ágar Baird Parker e à avaliação de presença de "SE", através do ensaio de "ELISA-SET-EIA, Enzyme Linked-Immunosorbent Assay," e "RPLA, Reversed Passive Latex Agglutination Assay". Os resultados obtidos evidenciaram, tanto em leite integral "tipo longa vida" como em presunto cozido, desenvolvimento mínimo estipulado em 10(6 e máximo de 10(9UFC/g ou mL do alimento, decorridas 48h de incubação.De acordo com as condições aplicadas neste experimento não apresentaram, contudo, em nenhuma ocasião produção de "SE" que pudesse ter sido detectada .

  3. Aplicación del método de diseño de mezclas en la formulación de un alimento para perros

    OpenAIRE

    Carlos Elías Peñafiel; Eliana Contreras López; Antonio Obregón La Rosa; Ricardo Yuli Posadas

    2015-01-01

    El objetivo del presente trabajo fue formular un alimento para perros similar a uno presente en el mercado. El alimento del mercado tomado como base declaró en su etiqueta los siguientes ingredientes: harina de pollo (mayor a 27 %), harina de trigo, harina de soya, harina de maíz, azúcar y grasa de pollo. El análisis de los componentes declarado en la etiqueta del alimento base fue: 27,0 % de proteína, 10,0 % de lípidos, 3,0 % de fibra y 22,0 % de humedad. Estos componentes se usaron como res...

  4. Diseño de un baño termostático para la cocción de alimentos al vacío

    OpenAIRE

    Bernales López, Anna

    2014-01-01

    El sector hostelero está experimentando diferentes cambios en cuanto a los procedimientos utilizados para preparar alimentos. Diferentes técnicas de manipulación y elaboración de alimentos están surgiendo día a día en la actualidad y en ese ámbito es dónde se enmarca este proyecto, en la maquinaria a nivel industrial utilizada para cocinarlos. En este proyecto se ha desarrollado un producto utilizado para la cocción de alimentos envasados al vacío. Un baño termostático útil par...

  5. Utilización del análisis hiperespectral como método para la detección de levaduras en alimentos deteriorados

    OpenAIRE

    Gil de Prado, Elena; Rivas, Eva María; Silóniz Jiménez, María Isabel; Lleó García, Lourdes

    2012-01-01

    La microbiología predictiva desarrolla modelos matemáticos que describen el comportamiento microbiano en alimentos. Su eficiencia es limita da en alimentos con algún grado de estructura, que son la mayoría, porque estos modelos están basados en datos experimentales obtenidos en cultivos líquidos, mucho más homogéneos. En este trabajo se evalúa la técnica de análisis hiperespectral como una nueva tecnología para la detección precoz de levaduras en alimentos sólidos mediante a...

  6. Las regulaciones de alimentos y los consumidores: estudio de caso en el sector lácteo de la Argentina actual

    OpenAIRE

    Lacaze, María Victoria

    2008-01-01

    Desde finales del siglo XX, los mercados de alimentos están experimentando importantes cambios. La seguridad alimentaria se ha convertido, en consecuencia, en uno de los temas clave de discusión. Las poblaciones con excedentes alimentarios están interesadas y preocupadas por la alimentación, la nutrición y la inocuidad de los alimentos. Cobra importancia, en ese contexto, la calidad de los alimentos y los mecanismos regulatorios que proporcionan garantías al respecto. La regulación de la cali...

  7. Perfil nutricional de alimentos com alegação de zero gordura trans Nutritional profile of foods with zero trans fatty acids claim

    OpenAIRE

    Ana Carolina Moron Gagliardi; Jorge Mancini Filho; Santos, Raul D.

    2009-01-01

    OBJETIVO: Avaliar a composição de ácidos graxos de alguns alimentos industrializados disponíveis no mercado brasileiro nos quais houve redução da quantidade de ácidos graxos trans. Verificar também se estes alimentos atendem às quantidades recomendadas de consumo de gordura saturada, após redução de gordura trans. MÉTODOS: Alimentos industrializados (margarina cremosa A e B, margarina com fitosterol, biscoito doce recheado, biscoito salgado sem recheio, batata frita e lanche com hambúrguer de...

  8. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine Avaliação da bioatividade frente à Artemia salina Leach de plantas medicinais utilizadas na medicina popular na Região Nordeste do Brasil

    OpenAIRE

    DDR. Arcanjo; ACM. Albuquerque; B. Melo-Neto; LCLR. Santana; MGF Medeiros; AMGL. Citó

    2012-01-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Just...

  9. Artemia (Crustacea, Anostraca in Chile: a review of basic and applied biology Artemia Crustacea, Anostraca en Chile: revisión de la biología básica y aplicada

    Directory of Open Access Journals (Sweden)

    Patricio De los Rios-Escalante

    2012-09-01

    Full Text Available The brine shrimp Artemia in Chile has been studied since the 1980s, initially on populations inhabiting shallow coastal and inland mountain ponds, and saltworks in northern and central Chile. Based on morphometric and molecular evidence, these populations were identified as A. franciscana. In the 1990s, A. persimilis was recorded from southern Patagonia, a species previously considered endemic to Argentina. Recently, two new populations of A.franciscana have been recorded, from one saline coastal pond in northern Chile and from a saltwork in central Chile. The scope for further research to increase both understanding of the strain characterization and basic population ecology descriptions of the Chilean brine shrimps and improve their conservation status is discussed. It is suggested that future studies should investigate first the management of local brine shrimp population for local aquaculture or conservation resources, other direction would be the effects of ultraviolet radiation (UVR exposition that is notoriously high in brine shrimp habitats. This last factor is very important because the UVR is an important mutagen on the genetic structure of the populations. In this scenario, it is suggest a carefully management for introduced brine shrimp populations for local aquaculture for avoid alterations in native populations that due their genetic isolation would need conservation procedures for avoid local extinctions.El camarón de salmuera o Artemia ha sido estudiado en Chile desde la década de 1980, las primeras descripciones de poblaciones fueron para lagunas someras en zonas costeras y de montana, y en salinas artificiales en la zona central y norte de Chile. Sobre la base de evidencias morfométricas y moleculares estas poblaciones fueron descritas como A. franciscana. En la década de 1990, se describió la presencia de A. persimilis en la zona sur de la Patagonia, lo cual fue una ampliación del rango de distribución significativa

  10. Kinetic properties and heme pocket structure of two domains of the polymeric hemoglobin of Artemia in comparison with the native molecule.

    Science.gov (United States)

    Borhani, Heshmat Akbari; Berghmans, Herald; Trashin, Stanislav; De Wael, Karolien; Fago, Angela; Moens, Luc; Habibi-Rezaei, Mehran; Dewilde, Sylvia

    2015-10-01

    In this project, we studied some physicochemical properties of two different globin domains of the polymeric hemoglobin of the brine shrimp Artemia salina and compared them with those of the native molecule. Two domains (AsHbC1D1 and AsHbC1D5) were cloned and expressed in BL21(DE3)pLysS strain of Escherichia coli. The recombinant proteins as well as the native hemoglobin (AfHb) were purified from bacteria and frozen Artemia, respectively by standard chromatographic methods and assessed by SDS-PAGE. The heme environment of these proteins was studied by optical spectroscopy and ligand-binding kinetics (e.g. CO association and O2 binding affinity) were measured for the two recombinant proteins and the native hemoglobin. This indicates that the CO association rate for AsHbC1D1 is higher than that of AsHbC1D5 and AfHb, while the calculated P50 value for AsHbC1D1 is lower than that of AsHbC1D5 and AfHb. The geminate and bimolecular rebinding parameters indicate a significant difference between both domains. Moreover, EPR results showed that the heme pocket in AfHb is in a more closed conformation than the heme pocket in myoglobin. Finally, the reduction potential of -0.13V versus the standard hydrogen electrode was determined for AfHb by direct electrochemical measurements. It is about 0.06V higher than the potential of the single domain AsHbC1D5. This work shows that each domain in the hemoglobin of Artemia has different characteristics of ligand binding. PMID:26004089

  11. A novel model of early development in the brine shrimp, Artemia franciscana, and its use in assessing the effects of environmental variables on development, emergence, and hatching.

    Science.gov (United States)

    Neumeyer, Courtney H; Gerlach, Jamie L; Ruggiero, Kristin M; Covi, Joseph A

    2015-03-01

    The brine shrimp, Artemia (Crustacea, Anostraca), is a zooplankton that is commonly used in both basic and applied research. Unfortunately, Artemia embryos are often cultured under conditions that alter early development, and reports based on these cultures oversimplify or fail to describe morphological phenotypes. This is due in part to the lack of a comprehensive developmental model that is applicable to observations of live specimens. The objective of this study was to build and test a descriptive model of post-diapause development in Artemia franciscana using observations made with a standard dissecting microscope. The working model presented is the first to comprehensively place all known "abnormal" embryonic and naupliar phenotypes within the context of a classic hatching profile. Contrary to previous reports, embryos and nauplii with aberrant phenotypes often recover and develop normally. Oval prenauplii may emerge as normal prenauplii (E2 stage). A delay of this transition leads to incomplete hatching or direct hatching of first instar larvae with a curved thoracoabdomen. When hatching is incomplete, retained cuticular remnants are shed during the next molt, and a "normal" second instar larva is produced. By differentiating between molting events and gross embryonic patterning in live embryos, this new model facilitates fine time-scale analyses of chemical and environmental impacts on early development. A small increase in salinity within what is commonly believed to be a permissive range (20‰-35‰) produced aberrant morphology by delaying emergence without slowing development. A similar effect was observed by decreasing culture density within a range commonly applied in toxicological studies. These findings clearly demonstrate that morphological data from end-point studies are highly dependent on the time points chosen. An alternate assessment method is proposed, and the potential impact of heavy metals, hexachlorobenzene, Mirex, and cis

  12. Efficacy of fish oil- and linseed oil-enriched Artemia nauplii on growth performance and stress resistance of tiger barb larvae (Puntius tetrazona

    Directory of Open Access Journals (Sweden)

    Mohammad Hadi Abolhasani

    2013-10-01

    Full Text Available Fish oil is the important fat source in fish nutrition. High demand for fish oil and low global supply arise a need of alternative oils in fish culture. Plant oils are a good candidate in this case. The aim of the present study was to compare the efficacy of fish oil and linseed oil on growth and stress resistance of tiger barb (Puntius tetrazona larvae. Artemia nauplii were enriched by 2.5, 5 and 7.5 of each oil. The enriched nauplii were offered to larvae for 14 d. thereafter, fish were fed non-enriched nauplii for another 14 d. At the end of the trial, larvae were subjected to osmotic stress and their survival was recorded. There was no significant difference in final weight, SGR and weight gain among the treatments at day 14. However, oil type and oil levels significantly affected these parameters after 28 d. Fish of 2.5-LO and 5-FO groups showed the best and worst performance, respectively. There was no significant difference in survival rate among the treatments, after 14 and 28 d; however, oil type significantly affected survival of the larvae after osmotic stress. Survival of larvae fed on linseed oil-enriched nauplii was significantly higher than that of those fed on fish oil-enriched nauplii. Linseed oil showed significantly better results in growth performance and stress resistance compared to fish oil. It is concluded that linseed oil is more suitable than fish oil for Artemia enrichment to feed tiger barb larvae. The potential reasons for the better performance of larvae fed on linseed oil-enriched Artemia were discussed.

  13. Optimización del enriquecimiento de nauplios de Artemia mediante el uso de emulsiones lipídicas formuladas a partir de aceites sintéticos ricos en DHA

    OpenAIRE

    Viciano Delibano, Elena

    2015-01-01

    Los nauplios de Artemia se utilizan como presa viva en criaderos de organimos marinos de todo el mundo debido a su disponibilidad y digestibilidad, pero su valor nutricional no se ajusta a las demandas o necesidades de las larvas de peces, moluscos o crustáceos marinos, ya que carecen de los ácidos grasos esenciales (EFA, Essential Fatty Acids) para estos organismos. Por tanto, es indispensable llevar a cabo un enriquecimiento de los nauplios de Artemia. El enriquecimiento consiste en incubac...

  14. Contributions towards a specific DHA enrichment in the live food Brachionus plicatilis and Artemia sp.

    OpenAIRE

    Dhert, Ph.; Sorgeloos, P.; Devresse, B.

    1993-01-01

    This paper reports on enrichment techniques oriented towards a specific DHA accumulation in the live prey Brachionus plicatilis and Artemia sp. The product used in these experiments (DHA7) is an experimental emulsion with a DHA/EPA ratio 6.7:1. Rotifers enriched with this pure DHA7 emulsion contained up to 69 mg/g DW DHA and a DHA/EPA ratio of 1.6. The DHA/EPA ration could be increased to a much higher level by different enrichment techniques. Dilution of the DHA7 emulsion with coconut oil pr...

  15. Evaluation of Toxic, Cytotoxic, Mutagenic, and Antimutagenic Activities of Natural and Technical Cashew Nut Shell Liquids Using the Allium cepa and Artemia salina Bioassays

    OpenAIRE

    Aracelli de Sousa Leite; Alisson Ferreira Dantas; George Laylson da Silva Oliveira; Gomes Júnior, Antonio L.; Sidney Gonçalo de Lima; Antônia Maria das Graças Lopes Citó; de Freitas, Rivelilson M.; Melo-Cavalcante, Ana Amélia de C.; José Arimateia Dantas Lopes

    2015-01-01

    The cashew nut releases a substance that is known as cashew nut shell liquid (CNSL). There are both natural (iCNSL) and technical (tCNSL) cashew nut shell liquids. This study used an Artemia salina bioassay to evaluate the toxic effects of iCNSL and tCNSL cashew nut shell liquids. It also evaluated the toxicity, cytotoxicity, and mutagenicity of CNSL and its effects on the damage induced by copper sulfate (CuSO4·5H2O) on the meristems’ root of Allium cepa. Effects of the damage induced by CuS...

  16. A first AFLP-Based Genetic Linkage Map for Brine Shrimp Artemia franciscana and Its Application in Mapping the Sex Locus

    OpenAIRE

    De Vos, Stephanie; Bossier, Peter; Van Stappen, Gilbert; Vercauteren, Ilse; Sorgeloos, Patrick; Vuylsteke, Marnik

    2013-01-01

    We report on the construction of sex-specific linkage maps, the identification of sex-linked markers and the genome size estimation for the brine shrimp Artemia franciscana. Overall, from the analysis of 433 AFLP markers segregating in a 112 full-sib family we identified 21 male and 22 female linkage groups (2n = 42), covering 1,041 and 1,313 cM respectively. Fifteen putatively homologous linkage groups, including the sex linkage groups, were identified between the female and male linkage map...

  17. Efficacy of fish oil- and linseed oil-enriched Artemia nauplii on growth performance and stress resistance of tiger barb larvae (Puntius tetrazona)

    OpenAIRE

    2013-01-01

    Fish oil is the important fat source in fish nutrition. High demand for fish oil and low global supply arise a need of alternative oils in fish culture. Plant oils are a good candidate in this case. The aim of the present study was to compare the efficacy of fish oil and linseed oil on growth and stress resistance of tiger barb (Puntius tetrazona) larvae. Artemia nauplii were enriched by 2.5, 5 and 7.5 of each oil. The enriched nauplii were offered to larvae for 14 d. thereafter, fish were fe...

  18. Contenido de ácidos grasos trans en alimentos comercializados en la Comunidad de Madrid (España

    Directory of Open Access Journals (Sweden)

    Santiago Moreno Alcalde

    2014-01-01

    Full Text Available Introducción: Como consecuencia de las evidencias científicas que indican que la ingesta elevada de ácidos grasos trans es un factor de riesgo de algunas enfermedades, las autoridades sanitarias recomiendan consumos de ácidos grasos trans menores del 1% de la ingesta energética total. Por otra parte, la Comisión Europea deberá presentar, antes del mes de diciembre del año 2014, un informe sobre la presencia de grasas trans en los alimentos y en la dieta de la población de la unión, por lo que este trabajo puede aportar información útil para conseguir ese objetivo. Objetivos: Conocer los contenidos de ácidos grasos trans en algunos grupos de alimentos de la Comunidad de Madrid. Métodos: Se han seleccionado y analizado 170 muestras de diferentes alimentos de consumo habitual entre niños y adolescentes, que fueron adquiridas durante el mes de febrero de 2010 en centros comerciales de la Comunidad de Madrid. Los resultados se han expresado como porcentaje de cada uno de los ácidos grasos frente al total de los que contiene el alimento. Resultados: Únicamente en 33 alimentos (un 19,4% se ha constatado la presencia de ácidos grasos trans por encima del límite de detección de la técnica (≥ 0,1 g por 100 g, encontrándose las cifras más elevadas en el grupo de los derivados lácteos, con un contenido medio de un 0,4%. Discusión/conclusiones: El contenido en ácidos grasos trans en los productos analizados puede considerarse bajo, en comparación con las cantidades que refieren diferentes autores en alimentos comercializados tanto en España como en otros países a lo largo de los últimos años. Es preciso continuar este tipo de estudios para controlar la calidad y seguridad nutricional de la ingesta de grasa por parte de la población española en general y, en particular, niños y jóvenes.

  19. Group 3 late embryogenesis abundant proteins from embryos of Artemia franciscana: structural properties and protective abilities during desiccation.

    Science.gov (United States)

    Boswell, Leaf C; Menze, Michael A; Hand, Steven C

    2014-01-01

    Group 3 late embryogenesis abundant (LEA) proteins are highly hydrophilic, and their expression is associated with desiccation tolerance in both plants and animals. Here we show that two LEA proteins from embryos of Artemia franciscana, AfrLEA2 and AfrLEA3m, are intrinsically disordered in solution but upon desiccation gain secondary structure, as measured by circular dichroism. Trifluoroethanol and sodium dodecyl sulfate are both shown to induce α-helical structure in AfrLEA2 and AfrLEA3m. Bioinformatic predictions of secondary-structure content for both proteins correspond most closely to conformations measured in the dry state. Because some LEA proteins afford protection to desiccation-sensitive proteins during drying and subsequent rehydration, we tested for this capacity in AfrLEA2 and AfrLEA3m. The protective capacities vary, depending on the target enzyme. For the cytoplasmic enzyme lactate dehydrogenase, neither AfrLEA2 nor AfrLEA3m, with or without trehalose present, was able to afford protection better than that provided by bovine serum albumin (BSA) under the same conditions. However, for another cytoplasmic enzyme, phosphofructokinase, both AfrLEA2 and AfrLEA3m in the presence of trehalose were able to afford protection far greater than that provided by BSA with trehalose. Finally, for the mitochondrial enzyme citrate synthase, 400-μg/mL AfrLEA3m without trehalose provided significantly more protection than the same concentration of either AfrLEA2 or BSA. PMID:25244376

  20. Profiles of nuclear and mitochondrial encoded mRNAs in developing and quiescent embryos of Artemia franciscana.

    Science.gov (United States)

    Hardewig, I; Anchordoguy, T J; Crawford, D L; Hand, S C

    1996-05-24

    Embryos of the brine shrimp Artemia franciscana are able to withstand long bouts of environmental anoxia by entering a quiescent state during which metabolism is greatly depressed. Recent evidence supports a global arrest of protein synthesis during quiescence. In this study we measured the amounts of mRNA for a mitochondrial-encoded subunit of cytochrome c oxidase (COX I) and for nuclear-encoded actin during aerobic development, anaerobiosis, and aerobic acidosis (artificial quiescence imposed by intracellular acidification under aerobic conditions). The levels of both COX I and actin transcripts increased significantly during aerobic development. COX I mRNA levels were tightly correlated with previous measures of COX catalytic activity, which suggests that COX synthesis could be regulated by message concentration during aerobic development. The ontogenetic increase for these mRNAs was blocked by anoxia and aerobic acidosis. Importantly, the levels of COX I and actin mRNA did not decline appreciably during the 6 h bouts of quiescence, even though protein synthesis is acutely arrested by these same treatments. Thus, the constancy of mRNA levels during quiescence indicate that reduced protein synthesis is not caused by message limitation, but rather, is likely controlled at the translational level. One advantage of this regulatory mechanism is the conservation of mRNA molecules during quiescence, which would potentially favor a quick resumption of translation as soon as oxygen is returned to the embryos. Finally, because anoxia and aerobic acidosis are both characterized by acidic intracellular pH, the reduction in pH may serve, directly or indirectly, as one signal regulating levels of mRNA in this embryo during quiescence. PMID:8817476

  1. Bird migratory flyways influence the phylogeography of the invasive brine shrimp Artemia franciscana in its native American range

    Directory of Open Access Journals (Sweden)

    Joaquín Muñoz

    2013-11-01

    Full Text Available Since Darwin’s time, waterbirds have been considered an important vector for the dispersal of continental aquatic invertebrates. Bird movements have facilitated the worldwide invasion of the American brine shrimp Artemia franciscana, transporting cysts (diapausing eggs, and favouring rapid range expansions from introduction sites. Here we address the impact of bird migratory flyways on the population genetic structure and phylogeography of A. franciscana in its native range in the Americas. We examined sequence variation for two mitochondrial gene fragments (COI and 16S for a subset of the data in a large set of population samples representing the entire native range of A. franciscana. Furthermore, we performed Mantel tests and redundancy analyses (RDA to test the role of flyways, geography and human introductions on the phylogeography and population genetic structure at a continental scale. A. franciscana mitochondrial DNA was very diverse, with two main clades, largely corresponding to Pacific and Atlantic populations, mirroring American bird flyways. There was a high degree of regional endemism, with populations subdivided into at least 12 divergent, geographically restricted and largely allopatric mitochondrial lineages, and high levels of population structure (ΦST of 0.92, indicating low ongoing gene flow. We found evidence of human-mediated introductions in nine out of 39 populations analysed. Once these populations were removed, Mantel tests revealed a strong association between genetic variation and geographic distance (i.e., isolation-by-distance pattern. RDA showed that shared bird flyways explained around 20% of the variance in genetic distance between populations and this was highly significant, once geographic distance was controlled for. The variance explained increased to 30% when the factor human introduction was included in the model. Our findings suggest that bird-mediated transport of brine shrimp propagules does not result

  2. Legislação brasileira referente à rotulagem nutricional de alimentos Brazilian food labeling regulations

    Directory of Open Access Journals (Sweden)

    Andréa Benedita Ferreira

    2007-02-01

    Full Text Available O objetivo deste trabalho é apresentar uma reflexão sobre a evolução histórica da legislação brasileira de alimentos sob o aspecto da rotulagem nutricional, contextualizando as principais leis das últimas quatro décadas, destacando os avanços e identificando os pontos críticos que ainda necessitam de aprimoramento. De uma forma geral pode-se afirmar que, ao longo dos últimos 40 anos, o Brasil aperfeiçoou a sua legislação, incorporando evidências científicas nos regulamentos buscando melhorar a qualidade dos alimentos e promover a Saúde Pública, levando em consideração a realidade brasileira. Contudo, com a publicação da Resolução nº 360 da Diretoria Colegiada da Agência Nacional de Vigilância Sanitária em 2003, que retira a obrigatoriedade da declaração dos conteúdos de ferro, cálcio e colesterol dos rótulos, pode-se afirmar que ocorreu uma involução em relação à saúde pública, embora a Resolução tenha mérito em relação à harmonização da legislação com os países membros do Mercosul, permitindo o livre comércio entre estes. Esforços devem ser envidados para que as empresas mantenham a declaração dos nutrientes que deixaram de ser obrigatórios. Ademais, é importante atualizar regulamentos já ultrapassados, incorporar conhecimento novo, preencher lacunas e recomendar ações integradas e contínuas de educação alimentar subsidiadas por pesquisas científicas. A rotulagem nutricional de alimentos é um apoio valioso para os consumidores, dando-lhes a oportunidade de conhecer a composição do alimento, a segurança quanto à ingestão de nutrientes e energia, bem como informações importantes para a manutenção de sua saúde. A legislação na área de alimentos deve ser vista como estratégia para auxiliar na redução dos índices de obesidade, das deficiências nutricionais e das doenças crônicas não-transmissíveis associadas ao padrão de consumo.The objective of this work is to

  3. ACEITAÇÃO E PERCEPÇÃO DOS ESTUDANTES DE GASTRONOMIA E NUTRIÇÃO EM RELAÇÃO AOS ALIMENTOS FUNCIONAIS

    Directory of Open Access Journals (Sweden)

    Graziele Resende MELO

    2010-12-01

    Full Text Available

    O termo “alimento funcional” foi introduzido no Japão (1980 e, apesar de comumente utilizado, ainda não existe defi nição mundialmente aceita. Estudos afirmam que sua aceitação está relacionada à informação recebida. Assim, profi ssionais da área de alimentos devem divulgar informações acerca de seus benefícios para promoção de alimentação saudável. Portanto, buscou-se verifi car aceitação e percepção dos alunos de Gastronomia e Nutrição do DF em relação aos “alimentos funcionais” por meio de estudo transversal com questões fechadas e posterior análise estatística. Foram aplicados 128 questionários: 80 em estudantes de nutrição (EN e 48 em estudantes de gastronomia (EG. Dos estudantes de nutrição (EN, 100% já ouviram falar sobre “alimentos funcionais” e sabe seu significado. Dos estudantes de Gastronomia (EG, 23% desconheciam o termo e, com isso, este percentual foi excluído da pesquisa, restando um universo de 117 respondentes. Apenas 22% dos EN não realizam pesquisas relativas ao assunto, assim como 42% dos EG. Quanto à prevenção de doenças 96% EN e 89% EG acreditam que seja possível por meio da ingestão regular desses alimentos. Porém, apenas 29% EN e 38% EG comprariam um alimento desconhecido sabendo que ele possui alegação de propriedade funcional ou de saúde. Além disso, 50% EN e 70% EG acreditam que o sabor de um alimento é mais importante que seus efeitos na saúde. Da mesma forma, 56% EN e 54% EG não comprariam um “alimento funcional” sem conhecer o seu sabor. Portanto, observa-se que os alunos estão cientes da importância do consumo de alimentos que possam promover saúde e prevenir o surgimento de doenças. Porém, ao optar por utilizar esses alimentos, se deparam com fatores como a falta de hábitos alimentares e, principalmente, o sabor diferenciado dos “alimentos funcionais” que dificultam no momento da sua escolha.

  4. Resistência ao estresse e crescimento de larvas de peixes neotropicais alimentadas com diferentes dietas Stress resistance and growth of larvae of neotropical fish feed with different diets

    Directory of Open Access Journals (Sweden)

    Ronald Kennedy Luz

    2007-01-01

    Full Text Available O objetivo deste trabalho foi avaliar o efeito da alimentação na resistência ao estresse e no crescimento de larvas das espécies de peixes neotropicais: Astronotus ocellatus (Oscar, Piaractus mesopotamicus (pacu e Pseudoplatystoma coruscans (pintado. As larvas receberam diferentes tipos de alimentos (Artemia sp., larvas de Colossoma macropomum e dieta artificial Fry Feed Kyowa. Foram realizados testes de exposição ao ar e a taxa de sobrevivência, determinada 24 horas depois. A fim de avaliar o crescimento, medidas de peso foram realizadas em larvas dos diferentes tratamentos. Larvas de A. ocellatus alimentadas com náuplios de Artemia sp. apresentaram tendência de maior peso e resistência ao estresse, quando comparadas com o uso de dieta artificial. Larvas de P. mesopotamicus apresentaram melhores valores de peso e taxas de resistência ao estresse, quando alimentadas com Artemia sp. ou alimentação mista (Artemia sp. + dieta artificial. Em P. coruscans, o uso de larvas forrageiras resultou em indivíduos mais resistentes aos testes de exposição ao ar do que os que receberam apenas Artemia sp. Valores de peso, nos dois manejos alimentares, foram semelhantes entre si. O alimento vivo desempenha importante atuação no crescimento em peso e na melhora da resistência ao estresse das espécies estudadas.The objective of this work was to evaluate the effect of feeding on stress resistance and growth in larvae of neotropical fish of the species: Astronotus ocellatus, Piaractus mesopotamicus, and Pseudoplatystoma coruscans. Larvae received different types of food (Artemia sp., Colossoma macropomum larvae and artificial microdiet Fry Feed Kyowa. Resistance tests to air exposure were applied, and larvae survival was determined after 24 hours. To evaluate the growth, weight measures were performed during the different treatments. A. ocellatus larvae fed on Artemia sp. nauplii tended to better resistant and weight than others that received

  5. Estado nutricional y consumo de alimentos de estudiantes universitarios admitidos a la carrera de medicina. bogotá 2010-2011

    OpenAIRE

    Becerra Bulla, Fabiola; Pinzón Villate, Gloria; Vargas Zárate, Melier

    2012-01-01

    Antecedentes. En la Universidad Nacional de Colombia - Sede Bogotá, se  han realizado algunos estudios tendientes a conocer el estado nutricional y el consumo de alimentos de los estudiantes de las diferentes facultades. Estos han reportado prevalencia de malnutrición y consumo deficiente de macro y micronutrientes por inadecuados hábitos alimentarios. Objetivo. Determinar el estado nutricional y algunas características del consumo de alimentos de los estudiantes de pregrado admitidos a prime...

  6. EL CULTIVO DE CAMARÓN EN AGUA DE BAJA SALINIDAD CON ALIMENTO A BASE DE HARINA DE LOMBRIZ

    OpenAIRE

    Wenceslao Valenzuela-Quiñónez; Héctor Manuel Esparza-Leal; Eusebio Nava-Pérez; Gerardo Rodríguez Quiroz

    2012-01-01

    El cultivo del camarón en el estado de Sinaloa es una de las principales actividades en la región, ya que genera una gran cantidad de empleos como de divisas cada año. La alimentación del camarón es una parte esencial para tener una producción sana. Como un acercamiento inicial al crecimiento del camarón en agua de baja salinidad se probaron dos fórmulas a base de proteína animal en el alimento del camarón, con un 40% (APL1) y 20% (APL2) de proteína de lombriz, un alimento comercial y otro si...

  7. Conocimiento, actitudes, creencias y valores en los argumentos sobre un tema socio-científico relacionado con los alimentos

    OpenAIRE

    Ramos España, Enrique

    2008-01-01

    Este trabajo se sitúa en una línea de investigación sobre Ciencia-Tecnología-Sociedad (CTS) como enfoque en el aula de Ciencias y en él se ha indagado sobre "cierto" contenido de los argumentos que ponen de manifiesto alumnos/as de 14-15 años y licenciado en Biología o Química, estudiantes del curso del CAP, cuando se les pregunta sobre un problema socio-científico como el de los alimentos transgénicos y los alimentos naturales y no naturales. Se han obtenido datos a partir de cuestionarios, ...

  8. La ocratoxina A en alimentos de consumo humano: revisión Ochratoxin A in foods for human consumption: review

    Directory of Open Access Journals (Sweden)

    A. Ravelo Abreu

    2011-12-01

    Full Text Available Introducción: La Ocratoxina A (OTA es una micotoxina neurotóxica, inmunosupresora, genotóxica, carcinógena y teratogénica de gran actualidad que contamina alimentos de consumo humano, principalmente cereales y derivados, bebidas alcohólicas y productos de molienda (café, cacao. Los niveles de Ocratoxina A en los alimentos están estrechamente relacionados con las condiciones de producción y conservación. Objetivo: Esta revisión tiene como objetivo evaluar la presencia de OTA en diferentes grupos de alimentos, así como actualizar el conocimiento sobre su toxicidad, mecanismo de acción, métodos de análisis utilizados para su detección y cuantificación, y diferentes aspectos sobre su legislación. Método: Se buscaron y seleccionaron, en base a unos criterios de inclusión, artículos y publicaciones relacionados con los mecanismos de acción, toxicidad, análisis y legislación de la OTA en alimentos, publicados en las bases de datos de MEDLINE/PubMed, Scielo, Science Direct, Ebscohost. Resultados: La presencia de OTA sigue observándose en diferentes grupos de alimentos. Los niveles detectados son inferiores a los permitidos por la legislación vigente. Sin embargo, se observa como prácticas agrotecnológicas de producción poco adecuadas y la incorrecta conservación de algunos alimentos siguen constituyendo puntos de control crítico para evitar los riesgos tóxicos derivados de la exposición humana a esta toxina. Conclusiones: Se recomienda fomentar el uso correcto de prácticas agrotecnológicas sobre las materias primas y productos transformados, con el objetivo de reducir la concentración de OTA presente en los alimentos y evitar la toxicidad consecuente al consumo de alimentos contaminados por OTA.Introduction: Ochratoxin A is a neurotoxic, immunosuppressive, genotoxic, carcinogenic and teratogenic mycotoxins present in human food, mainly cereals and cereals products, alcoholic beverages and mill products (coffee, cocoa

  9. Microencapsulación con alginato en alimentos. Técnicas y aplicaciones

    Directory of Open Access Journals (Sweden)

    Bryshila Lupo Pasin

    2012-06-01

    Full Text Available El objetivo de este trabajo fue realizar una revisión de las técnicas de microencapsulación con alginato para aplicaciones en alimentos. El alginato ha sido uno de los polímeros más empleado en la microencapsulación, este forma una matriz altamente versátil, biocompatible y no tóxica para la protección de componentes activos, células o microorganismos sensibles al calor, pH, oxígeno y luz, entre otros factores, a los que son expuestos los alimentos durante el procesamiento y almacenaje. El proceso de microencapsulación con alginato se lleva a cabo a través de dos mecanismos de gelificación iónica: la gelificación externa y la gelificación interna, dependiendo de si el calcio se suministra desde fuera de las cápsulas o en el interior de las mismas. Para la preparación de microcápsulas de alginato de calcio con aplicaciones alimentarias, se tienen las técnicas por extrusión, en emulsión y secado por atomización. Aunque el secado por atomización ha sido para la industria un proceso práctico y económico, su aplicación con alginato se ha visto limitada por la viscosidad y velocidad de gelificación. Por el contrario, la técnica por extrusión ha sido la técnica tradicional empleada en las últimas décadas, debido a la uniformidad de las microcápsulas en su forma y tamaño. En este sentido, la técnica en emulsión es la aplicada más recientemente, la cual ha demostrado ser sencilla y de producción a gran escala. En la actualidad se desarrollan nuevas tecnologías a fin de disminuir el tamaño de las microcápsulas para así ampliar sus usos en la industria. Entre las últimas tendencias de microencapsulación, se estudian sistemas mixtos de matrices poliméricas con la finalidad de obtener propiedades físico-químicas combinadas, permitiendo hacer el proceso de encapsulación más eficiente tanto para la protección como para la liberación controlada del principio activo.

  10. Microencapsulación con alginato en alimentos. Técnicas y aplicaciones

    Directory of Open Access Journals (Sweden)

    Bryshila Lupo Pasin

    2012-01-01

    Full Text Available El objetivo de este trabajo fue realizar una revisión de las técnicas de microencapsulación con alginato para aplicaciones en alimentos. El alginato ha sido uno de los polímeros más empleado en la microencapsulación, este forma una matriz altamente versátil, biocompatible y no tóxica para la protección de componentes activos, células o microorganismos sensibles al calor, pH, oxígeno y luz, entre otros factores, a los que son expuestos los alimentos durante el procesamiento y almacenaje. El proceso de microencapsulación con alginato se lleva a cabo a través de dos mecanismos de gelificación iónica: la gelificación externa y la gelificación interna, dependiendo de si el calcio se suministra desde fuera de las cápsulas o en el interior de las mismas. Para la preparación de microcápsulas de alginato de calcio con aplicaciones alimentarias, se tienen las técnicas por extrusión, en emulsión y secado por atomización. Aunque el secado por atomización ha sido para la industria un proceso práctico y económico, su aplicación con alginato se ha visto limitada por la viscosidad y velocidad de gelificación. Por el contrario, la técnica por extrusión ha sido la técnica tradicional empleada en las últimas décadas, debido a la uniformidad de las microcápsulas en su forma y tamaño. En este sentido, la técnica en emulsión es la aplicada más recientemente, la cual ha demostrado ser sencilla y de producción a gran escala. En la actualidad se desarrollan nuevas tecnologías a fin de disminuir el tamaño de las microcápsulas para así ampliar sus usos en la industria. Entre las últimas tendencias de microencapsulación, se estudian sistemas mixtos de matrices poliméricas con la finalidad de obtener propiedades físico-químicas combinadas, permitiendo hacer el proceso de encapsulación más eficiente tanto para la protección como para la liberación controlada del principio activo.

  11. Detección de parásitos intestinales en agua y alimentos de Trujillo, Perú

    OpenAIRE

    Gregorio Pérez-Cordón; María J. Rosales; Renzo A. Valdez; Franklin Vargas-Vásquez; Ofelia Cordova

    2008-01-01

    Detectamos distintas especies de parásitos intestinales, tanto protozoos como helmintos, presentes en muestras de agua provenientes de acequias y pozos (Giardia lamblia, Blastocystis hominis, Entamoeba coli, Cyclospora cayetanensis, Cryptosporidium spp. y Balantidium coli), así como en alimentos crudos y cocidos (Giardia lamblia, Cyclospora cayetanensis., Endolimax nana, Iodamoeba butschlii y Blastocystis hominis Fasciola hepatica y Ascaris lumbricoides) recolectadas en varios distritos de la...

  12. Segurança alimentar: a abordagem dos alimentos transgênicos Food safety: the approach to transgenic foods

    Directory of Open Access Journals (Sweden)

    Suzi Barletto CAVALLI

    2001-01-01

    Full Text Available O objetivo desta comunicação é discutir a relação entre a segurança alimentar e os alimentos geneticamente modificados. A biotecnologia e a engenharia genética têm sido encaradas como parte da segunda revolução verde, justificando-se, entre outras prerrogativas, o uso de alimentos transgênicos como solução do problema da fome no mundo, sem risco à saúde da população e ao meio ambiente. Face a essa premissa, discute-se a segurança alimentar sob os enfoques qualitativos e quantitativos, destacando as atribuições dos órgãos responsáveis e suas interfaces com alimentos geneticamente modificados. Acredita-se que os alimentos transgênicos não sejam a solução para o problema da fome no mundo.The objective of this communication is to discuss the relationship between food safety and genetically modified foods. Biotechnology and genetic engineering are being considered as part of the second green revolution, showing that the use of transgenic foods is the solution for the world's hunger problem, without risk to the population's health and the environment. Because of this matter, food safety is being discussed, not only in qualitative but also in quantitative aspects, emphasizing the attributions of the responsible institutions and their interfaces with genetically modified foods. The transgenic foods are believed not to be the solution of the hunger problem in the world.

  13. GLOBALIZACIÓN Y COSTO DE LOS ALIMENTOS: SITUACIÓN ACTUAL, PRONÓSTICO Y POSIBLES SOLUCIONES

    Directory of Open Access Journals (Sweden)

    Jacques Reinaldo Gabay

    2009-01-01

    Full Text Available En este trabajo, se analizan las causas y consecuencias de la inflación experimentada por el sector de los alimentos en el ámbito mundial hasta el segundo semestre del 2008. Entre las causas más destacadas que afectan directamente el costo de los alimentos, se encuentran el aumento exagerado del precio del barril de petróleo, la utilización de gramíneas y oleaginosas para la elaboración de bioetanol y biodiesel, la especulación de los mercados a futuro de commodities alimenticios en lugares como el Chicago Board of Trade (CBOT y el impacto producido por el aumento del consumo en las economías de los países BRIC (Brasil, Rusia, India y China. Se toman en cuenta las opiniones de expertos internacionales y en especial organismos multinacionales que desarrollan esfuerzos continuos para frenar la crisis: IPCC, FAO, ONU, FMI, BM, OECD, Bill Clinton, Al Gore, George Soros, entre otros. Así mismo, se incluye un breve panorama de la situación venezolana actual en cuanto al tema alimenticio, con algunos análisis del experto nacional Hiram Gaviria. Posteriormente, se evalúan otras opciones energéticas actuales en elmundo para evitar destinar los alimentos a la elaboración de biocombustibles, como la energía nuclear y la energía eólica.

  14. Inocuidad en alimentos tradicionales: el queso de Poro de Balancán como un caso de estudio

    Directory of Open Access Journals (Sweden)

    Mayra Díaz Ramírez

    2016-01-01

    Full Text Available La variabilidad de los alimentos tradicionales producidos de manera artesanal es admisible, pero su inocuidad debe garantizarse. La ejecución de Buenas Prácticas de Manufactura (BPM es fundamental para la construcción de sistemas de gestión de la inocuidad como el Análisis de Riesgos y Puntos Críticos de Control (HACCP e ISO-22000-Food Safety Management System. El cumplimiento de este tipo de prácticas en la producción de alimentos tradicionales en México es escaso. Tomando al queso de Poro, como ejemplo de este tipo de alimentos, el presente docu- mento describe las condiciones y controles de su proceso de producción. Ello como el primer paso para documentar la factibilidad de implementar sistemas de gestión de la inocuidad. Esto es dado que la legislación en México permite la comercialización de este tipo de quesos si su producción cumple con controles basados en BPM.

  15. The effects of probiotic bacillus for promotion of growth and feeding parameters in beluga (Huso huso larvae via feeding by bioencapsulated Artemia

    Directory of Open Access Journals (Sweden)

    Hojatollah Jafaryan

    2010-12-01

    Full Text Available In this study five species of probiotic bacillus as bacterial blend under the commercial title ofProtexin aquatic were used for bioencapsulation of Artemia urmiana (Gunther, 1899. This experimentwas conducted in a completely random design. A. urmiana naupli I was used as a vector to carryprobiotic bacillus to digestive tract of Huso huso (Linnaeus, 1758 larvae. Nauplii with threeconcentrations of bacteria, 1×105, 2×105 and 3×105 bacteria per milliliter in suspension of broth for 10hours were bioencapsulated and beluga larvae were fed by them. Beluga larvae were fed 50 percent oftheir body weight for 6 times a day. The control treatment was fed by unbioencapsulated artemia nauplii.The results indicated that the probiotic bacillus could influence on growth and feeding parameters inbeluga larvae. The final body weight and specific growth rate (SGR for weight in experimentaltreatments had significant difference in comparison to control treatment (P0.05. In experimentaltreatments the Food efficiency was increased significantly in comparison with control. The probioticbacillus had significant positive effects on conversion efficiency ratio (CER, Daily growth coefficient(DGC and average weight gain (AWG in comparison to control treatment (P-1 significantly increased (P<0.05.

  16. Real-time PCR detection and quantification of fish probiotic Phaeobacter strain 27-4 and fish pathogenic Vibrio in microalgae, rotifer, Artemia and first feeding turbot (Psetta maxima) larvae

    DEFF Research Database (Denmark)

    Prol, M.J.; Bruhn, Jesper Bartholin; Pintado, J.; Gram, Lone

    2009-01-01

    presence of microalgae (Isochrysis galbana), rotifers (Brachionus plicatilis), Artemia nauplii or turbot (Psetta maxima) larvae by real-time PCR based on primers directed at genetic loci coding for antagonistic and virulence-related functions respectively. The optimized protocol was used to study...

  17. ALTURA DE VÔO DAS ABELHAS AFRICANIZADAS (Apis mellifera L. PARA COLETA DE ALIMENTOS

    Directory of Open Access Journals (Sweden)

    MORETI A.C. de C.C.

    1998-01-01

    Full Text Available O presente trabalho foi realizado com o objetivo de verificar até que altura as abelhas africanizadas deslocam-se para a coleta de alimentos e se existe preferência destas abelhas por alguma altura. Instalou-se, num eucalipto de mais de 30m, um sistema de roldana que possibilitava a colocação de armadilhas a diferentes alturas, para a captura dos insetos que ali fossem se alimentar. As médias do número de abelhas coletadas em sete alturas (de 0 a 30m decresceram com o aumento da altura e o melhor ajuste foi o de um polinômio linear. No detalhamento da primeira altura (0-5m, que apresentou a maior concentração de abelhas, o melhor ajuste foi o de um polinômio de segundo grau, com um máximo entre 1 e 2m, apesar da maior media observada corresponder à altura de 3m. Não ocorreram diferenças (P>0,05 entre as médias do número de abelhas coletadas nos períodos da manhã e da tarde.

  18. Alinhamento estratégico entre empresas fabricantes de equipamentos e alimentos

    Directory of Open Access Journals (Sweden)

    Roberto Giro Moori

    2009-08-01

    Full Text Available Este trabalho tem por objetivo verificar o alinhamento das prioridades competitivas entre empresas compradoras e usuárias de máquinas e equipamentos para a fabricação de produtos alimentícios e seus fornecedores industriais. Está fundamentado em uma pesquisa exploratória descritiva em que se aplicou um questionário estruturado junto a gestores das áreas relacionadas a compras, vendas e produção das empresas. Foram obtidas 77 respostas de gestores de empresas fabricantes de alimentos e 55 de fabricantes de equipamentos. Os dados, submetidos à estatística descritiva e à correlação bivariada não paramétrica, revelaram que: a no âmbito do relacionamento entre compradores e vendedores de máquinas e equipamentos, o fator qualidade foi a prioridade competitiva alinhada entre eles; b no âmbito de empresas usuárias de máquinas e equipamentos, houve evidência de trade-off entre as variáveis reduzir estoques e velocidade de entrega rápida. Essas revelações permitiram concluir que: a a qualidade é um fator de alinhamento externo e interno; b o trade-off é usado como um instrumento para o alinhamento das prioridades competitivas no ambiente interno das empresas compradoras e usuárias de máquinas e equipamentos.

  19. Modelo matemático para secador de alimentos de flujo radial

    Directory of Open Access Journals (Sweden)

    Néstor Durango

    2004-01-01

    Full Text Available Los resultados obtenidos en esta investigación ajustan el modelo matemático en un secador de alimentos de flujo radial. La metodología siguió el diseño de un experimento factorial, el cual, mediante análisis estadístico, posibilitó la obtención del modelo matemático que describe el comportamiento del proceso para un tiempo de secado de tres horas. Las variable estudiadas fueron: relación superficie / volumen, masa de yuca, temperatura del aire de recirculación y velocidad de flujo de aire. El análisis estableció que las variables de mayor influencia en el proceso son la relación superficie/ volumen, seguida por la masa de material que se iba a secar. También se encontró que independientemente de la cantidad de masa de yuca, la mayor cantidad de humedad retirada se obtiene cuando las otras tres variables se encuentran en su nivel alto

  20. Concentración empresarial y cambio estructural: alimentos, bebidas y tabaco en México

    Directory of Open Access Journals (Sweden)

    Raúl Vázquez

    2015-01-01

    Full Text Available Este artículo analiza las características de la expansión de los grandes grupos corporativos en las industrias de alimentos, bebidas y tabaco en México, y sus posibles implica ciones para la estructura y los niveles de eficiencia del sector. La construcción de un indicador de productividad laboral para 12 ramas y 38 clases de actividad para el periodo 1994-2008 y la aplicación sobre las series obtenidas de una técnica de descomposición shift-share, permiten destacar una creciente heterogeneidad estructural concomitante de avances de eficiencia limitados a un número reducido de actividades. Asimismo, los resultados indican que la contribución del desplazamiento intrasectorial de trabajadores a la evolución de la productividad varía en función de las estrategias empresariales adoptadas, pero es negativo en su conjunto en el periodo, lo que evidencia un cambio estructural regresivo en el sector.

  1. Staphylococcus aureus: portadores entre manipuladores de alimentos Staphylococcus aureus: food handler carriers

    Directory of Open Access Journals (Sweden)

    Maria Stella Gonçalves Raddi

    1988-02-01

    Full Text Available Foram colhidas amostras de mãos e fossas nasais de 48 manipuladores de alimentos das principais casas comerciais da cidade de Araraquara, Estado de São Paulo (Brasil, e de 20 estudantes universitários. Dentre os indivíduos foram encontrados 44,1% e 34,8% que portavam Staphylococcus aureus em fossas nasais e mãos, respectivamente. Observou-se predomínio de fagotipos dos grupos I e III. Dos 12 portadores do microrganismo, concomitantemente em mãos e fossas nasais, 75,0% apresentaram cepas com vínculo epidemiológico. Os achados mostram o risco potencial representado pelas mãos nas intoxicações alimentares.Material was collected from the hands and nasal passages of forty-eight food handlers and twenty college students of Araraquara (S. Paulo State, Brazil and analized in order to evaluate the carrier function with regard to Staphylococcus aureus. The organism discovered in both samples of nine out of the twelve volunteers were of the same S. aureus phage types. The incidence of carriage on the hands was much greater in the handlers' group. These findings demonstrate the potential risk represented by hands in the transmission of food poisoning.

  2. Alimentos mais consumidos no Brasil: Inquérito Nacional de Alimentação 2008-2009

    Directory of Open Access Journals (Sweden)

    Amanda de M. Souza

    2013-02-01

    Full Text Available OBJETIVO: Caracterizar o consumo alimentar mais frequente da população brasileira. MÉTODOS: Foram analisados dados referentes ao primeiro dia de registro alimentar de 34.003 indivíduos com dez anos ou mais de idade que responderam ao Inquérito Nacional de Alimentação, composto por amostra probabilística da Pesquisa de Orçamentos Familiares 2008-2009. O padrão de consumo foi analisado segundo sexo, grupo etário, região e faixa de renda familiar per capita. RESULTADOS: Os alimentos mais frequentemente referidos pela população brasileira foram arroz (84,0%, café (79,0%, feijão (72,8%, pão de sal (63,0% e carne bovina (48,7%, destacando-se também o consumo de sucos e refrescos (39,8%, refrigerantes (23,0% e menor presença de frutas (16,0% e hortaliças (16,0%. Essa configuração apresenta pouca variação quando se consideram os estratos de sexo e faixa etária; contudo, observa-se que os adolescentes foram o único grupo etário que deixou de citar qualquer hortaliça e que incluiu doces, bebida láctea e biscoitos doces entre os itens mais consumidos. Alimentos marcadamente de consumo regional incluem a farinha de mandioca no Norte e Nordeste e o chá na região Sul. Houve discrepâncias no consumo alimentar entre os estratos de menor e maior renda: indivíduos no quarto de renda mais elevada referiram sanduíches, tomate e alface e aqueles no primeiro quarto de renda citaram os peixes e preparações à base de peixe e farinha de mandioca entre os alimentos mais referidos. CONCLUSÕES: Existe um padrão básico do consumo alimentar no Brasil que inclui entre os alimentos mais consumidos arroz, café, feijão, pão de sal e carne bovina, associado ao consumo regional de alguns poucos itens. Particularmente entre os adolescentes, alimentos ricos em gordura e açúcar são também de consumo frequente.

  3. Avanços da segurança de alimentos no Brasil | Advances in food safety in Brazil

    Directory of Open Access Journals (Sweden)

    Eduardo Cesar Tondo

    2015-05-01

    Full Text Available Nos últimos anos, um expressivo avanço na regulação e utilização de sistemas de gestão da segurança de alimentos (SGSA tem ocorrido no Brasil. Ainda que seja difícil afirmar que o número de Doenças Transmissíveis por Alimentos (DTA tenha diminuído, sistemas como as Boas Práticas de Fabricação ou Boas Práticas (BPF/BP, Procedimentos Operacionais Padronizados (POP e Análise de Perigos e Pontos Críticos de Controle (APPCC estão cada vez mais presentes nos serviços de alimentação e indústrias de alimentos brasileiras. Além disso, ultimamente o Brasil vem utilizando os conceitos de Análise de Riscos (AR na elaboração de suas legislações e no estudo de problemas relacionados à segurança de alimentos. Como resultado desses avanços, as vigilâncias estão cada vez mais preparadas e atuantes, as legislações têm contemplado as especificidades brasileiras e, ao mesmo tempo, estão alinhadas com algumas das mais modernas do mundo e os órgãos que fomentam as implementações dos SGSA têm trabalhado incessantemente. O presente estudo tem o objetivo de abordar alguns dos recentes avanços da segurança de alimentos no Brasil, enfocando principalmente legislações sobre os SGSA e dados de implementação desses sistemas. ------------------------------------------------------------------------------------------- In recent years, developments related to food safety regulation and implementation of food safety management systems (FSMS have occurred in Brazil. Although it is difficult to affirm if the number of foodborne diseases has decreased, implementation of Good Manufacturing Practices (GMP, Standard Operation Procedures (SOP, and Hazard Analysis and Critical Control Points (HACCP have increased in Brazilian food services and food industries. Furthermore, at present, Brazil uses the risk analysis concept for the elaboration of food regulation and to carry out food safety studies. As a result of this development, sanitary

  4. Insegurança alimentar e sua associação com consumo de alimentos regionais brasileiros

    Directory of Open Access Journals (Sweden)

    Stefanie Eugênia dos Anjos Campos COELHO

    2015-10-01

    Full Text Available Objetivo: Verificar se existem diferenças no consumo de alimentos regionais entre adolescentes em situação de insegurança alimentar quando comparados aos seguros.Métodos: Estudo transversal realizado com adolescentes estudantes do 9º ano das 26 capitais brasileiras e Distrito Federal em 2011/2012. A amostra foi composta por 15.084 jovens. O consumo de alimentos regionais foi avaliado por meio de imagens. O participante deveria identificar o alimento, referindo seu consumo ou não. A situação de segurança alimentar foi aferida através da Escala Curta de Insegurança Alimentar, adaptada da escala americana e validada para o público adolescente brasileiro.Resultados: Foram analisados os dados de 14.690 adolescentes com média de idade de 14,4 anos, predominantemente do sexo feminino (55,7% e alunos de escolas públicas (78,2%. Apenas 3,1% das mães eram analfabetas. A insegurança alimentar foi mais prevalente nos domicílios com jovens do sexo masculino, que estudavam em escolas púbicas, filhos de mães analfabetas e residentes na região Norte. O consumo de hortaliças e frutas foi maior entre adolescente residentes em domicílios em insegurança alimentar e insegurança alimentar grave do que entre os seguros, em todas as regiões geográficas brasileiras. As preparações regionais são mais consumidas por jovens que vivem em domicílios seguros.Conclusão: Observou-se que a insegurança alimentar está associada ao maior consumo de alimentos marcadores de dieta saudável, como frutas e hortaliças regionais. A produção e consumo de alimentos regionais deve ser estimulada e valorizada como forma de promoção da alimentação saudável e de garantia da segurança alimentar e nutricional.

  5. Efecto de la publicidad de alimentos anunciados en la televisión sobre la preferencia y el consumo de alimentos: revisión sistemática Effect of food television advertising on the preference and food consumption: systematic review

    OpenAIRE

    G. Díaz Ramírez; M. C. Souto-Gallardo; M. Bacardí Gascón; A. Jiménez-Cruz

    2011-01-01

    Objetivo: El propósito de esta revisión sistemática es evaluar estudios acerca del efecto de los anuncios de alimentos en TV sobre las preferencias y el consumo de alimentos en diferentes grupos de edad. Métodos: Se realizó una búsqueda de ensayos aleatorios controlados publicados en Pubmed, Ebsco, Cochrane, Scielo hasta Noviembre del 2010. Se incluyeron aquéllos que evaluaran el efecto de la exposición directa a anuncios de alimentos en TV sobre las preferencias, demanda, compra y consumo. R...

  6. Investigating the in vitro and in vivo angiogenic activity of five Philippine medicinal plants associated with wound healing properties

    International Nuclear Information System (INIS)

    Plants have been used since time immemorial to treat many ailments and speed up healing process. Plant parts and extracts have been traditionally used to heal wounds. Angiogenesis is one of the events associated with wound healing. It is a tightly regulated process of blood vessel formation and an important target for diseases like coronary infarction, ischemia and stroke. Several in vitro and in vivo methods have been developed to assess the angiogenic activity of different compounds. These include the chorio-allantaoic membrane (CAM) assay which uses the egg's gas exchange membrane to assess the angiogenic potential of a substance and the tube formation assay which uses endothelial cells grown in the lab. Aqueous ethanolic extracts of five Philippine medicinal plants associated with wound healing were used in the study. Preliminary phytochemical screening using spray raegents and toxicity test using brine shrimp (Artemia salina) nauplii was done. 10% of the computed LC50 value was used to screen the angiogenic potential of the plant extracts using human umbilical vein endothelial cells (HUVECs) in an in vitro tube formation assay and in vivo chorio-allantoic membrane (CAM) assay. Phorbol myristate (PMA) a known pro-angiogenic compound was used as positive control. Initial phytochemical screening showed that the crude enthanolic extracts of the leaves of the five contain flavonoids, steroids, phenols, saponins, alkanoids, coumarins, anthranoids, anthraquinones, sugars and essential oils. Brine shrimp lethality assay revealed that the plants used were not toxic to Artemia salina nauplii at 1000 μg/mL. In vitro tube formation assay revealed the crude ethanolic extracts of the leaves of M. indica showed the greatest angiogenic activity, closely followed by C. pubescens, T. catappa, A. barbadensis and C. odorata. The effect of the crude ethanolic extracts of the plants on blood vessel formation in the in vivo CAM model showed A. barbadensis with the highest

  7. Óxidos de colesterol em alimentos Cholesterol oxides in foods

    Directory of Open Access Journals (Sweden)

    Alfredo Tenuta-Filho

    2003-09-01

    Full Text Available A oxidação do colesterol em alimentos leva à formação de óxidos com características aterogênicas, citotóxicas, cancerígenas e mutagênicas, tornando obrigatório o exame criterioso da ingestão desses compostos. Leite integral em pó, manteiga, hambúrguer frito, bife grelhado e gema de ovo, fresca, frita e em pó foram quantificados em relação ao colesterol, 7±-hidroxicolesterol (7±-OH, 7²-hidroxicolesterol (7²-OH, 7-cetocolesterol (7-ceto e 25-hidroxicolesterol (25-OH, por HPLC. Os níveis de colesterol foram de 22,81±9,00 mg/100 g (leite integral em pó a 1843,62±92,69 mg/100 g (gema em pó. O somatório dos óxidos derivados do carbono 7(7±-OH, 7²-OH e 7ceto foi de 18,76±9,50 µg/g no leite integral em pó, 34,56±11,63 µg/g na manteiga, 11,11±1,26 µg/g no hambúrguer frito e 22,84±8,43 µg/g no bife grelhado. O 7-ceto e 25-OH não foram detectados na gema fresca. O 7-ceto ocorreu em nível de 9,46±0,15 µg/g na gema frita, enquanto 110,54±11,82 e 112,67±13,52 µg/g, respectivamente, de 7-ceto e 25-OH foram encontrados na gema em pó. Muitos dos resultados obtidos foram mais elevados que os relatados na literatura, sugerindo estudos mais detalhados visando indicar em que fase(s (processamento e/ou armazenamento e em que grau a oxidação do colesterol ocorre nos alimentos.Cholesterol oxidation in foods yields oxides that show cytotoxic, atherogenic, mutagenic and carcinogenic properties suggesting that the intake of these compounds should then be examined criteriously. Whole milk powder, butter, fried hamburger, grilled beef and egg yolk, fresh, fried and powder, were analyzed in relation to cholesterol and their oxides 7±-hydroxycholesterol (7±-OH, 7²-hydroxycholesterol (7²-OH, 7-ketocholesterol (7-keto and 25-hydroxycholesterol (25-OH, by HPLC. Cholesterol values varied from 22.81±9.00 mg/100 g (whole milk powder to 1843.62±92.69 mg/100 g (egg yolk powder. The total values of the oxides derived from carbon

  8. LACTOSUERO: IMPORTANCIA EN LA INDUSTRIA DE ALIMENTOS WHEY: IMPORTANCE IN THE FOOD INDUSTRY

    Directory of Open Access Journals (Sweden)

    Ricardo Adolfo Parra Huertas

    2009-06-01

    Full Text Available El lactosuero de quesería es un subproducto líquido obtenido después de la precipitación de la caseína durante la elaboración del queso. Contiene principalmente lactosa, proteínas como sustancias de importante valor nutritivo, minerales, vitaminas y grasa. La composición y tipo de lactosuero varía considerablemente dependiendo del tipo de leche, tipo de queso elaborado y el proceso de tecnología empleado. La lactosa es el principal componente nutritivo (4,5 % p-v, proteína (0,8% p/v, y lípidos (0,5%. Si en la coagulación de la leche se utiliza enzimas el lactosuero se denomina dulce, y si se reemplaza la enzima por ácidos orgánicos se denomina ácido. Para la industria alimentaria, el lactosuero constituye una fuente económica de proteínas que otorga múltiples propiedades en una amplia gama de alimentos. Los productos del suero, incluyendo la lactosa, mejoran la textura, realzan el sabor y color, emulsifican y estabilizan, mejoran las propiedades de flujo y muestran muchas otras propiedades funcionales que aumentan la calidad de los productos alimenticios. Basados en el valor nutricional del lactosuero, un número de usos comerciales se han obtenido como etanol, ácidos orgánicos, bebidas no alcohólicas, bebidas fermentadas, biomasa, concentrados, aislados e hidrolizados de proteína, películas comestibles, medio de soporte para encapsular sustancias, producción de xantana, enzimas, separación de la lactosa para fines endulzantes en alimentos entre otras aplicaciones.Cheese whey is a by-product liquid obtained after precipitation of casein during the production cheese. Mainly contains lactose, protein and important nutritional substances, minerals, vitamins and fat. The type and composition of whey varies considerably depending on the type of milk, cheese produced and the process technology used. Lactose is the primary nutritional component (4.5% pv, protein (0.8% w / v and lipids (0.5%. If the milk clotting enzyme used is

  9. Brotes de diarrea e intoxicaciones transmitidas por alimentos en Costa Rica, 2005

    Directory of Open Access Journals (Sweden)

    Hilda Ma Bolaños-Acuña

    2007-10-01

    Full Text Available Justificación y objetivo: En la actualidad, las enfermedades de transmisión alimentaria, incluyendo las diarreas e intoxicaciones, constituyen uno de los problemas de salud pública de mayor importancia a nivel mundial, ya que ocasionan alta morbilidad y mortalidad, generan grandes costos a los servicios de salud, pérdidas económicas, demandas y pérdida de confianza de los consumidores. El objetivo del trabajo es analizar la información disponible en el Centro Nacional de Referencia en Bacteriología del INCIENSA (CNRB, de los brotes de diarrea e intoxicaciones alimentarias ocurridos en 2005, en los que se refirieron muestras clínicas o de alimentos, para identificar los agentes y vehículos de infección asociados. Materiales y métodos:Se realizó el análisis descriptivo de la información epidemiológica y de laboratorio disponible en el CNRB en relación con los brotes de diarrea e intoxicaciones alimentarias ocurridos en 2005. Resultados:Durante el período el CNRB documentó 23 brotes de diarrea e intoxicaciones alimentarias, para un total aproximado de 819 afectados, en su mayoría procedentes de la gran área metropolitana. Trece de los brotes fueron intrafamiliares (diez de ellos debidos a especies y serotipos de Shigella; sin embargo, el mayor número de enfermos se presentó en los brotes comunitarios y los que se produjeron en poblaciones cautivas, asociados a rotavirus, Escherichia coli enterotoxigénica y Clostridium perfringens productor de toxina A, con 518, 138 y 54 enfermos, respectivamente. Conclusión:Estos hallazgos evidencian deficiencias en la cadena de transporte, conservación y manipulación de los alimentos, así como en la higiene personal, y pueden ser de utilidad para la implementación de intervenciones inmediatas.Justification and objective:Food borne diseases ncluding diarrhea and food poisoning represent one of the major public health problems worldwide, since they cause high morbidity and mortality

  10. Interacciones entre los alimentos y las estatinas Interactions between foodstuffs and statins

    Directory of Open Access Journals (Sweden)

    S. de Andrés

    2004-07-01

    Full Text Available Cada vez es más conocida la existencia de interacciones de distintos fármacos entre sí y de éstos con la dieta. Las estatinas son medicamentos ampliamente utilizados en la actualidad para el tratamiento de las hiperlipemias. La dieta tiene gran influencia en la prevención y/o tratamiento de estas patologías ya que la estrategia terapéutica que se emplea consiste en una dieta adecuada, y si esto no da resultado se inicia la terapia farmacológica siempre en combinación con la dieta. Por este motivo es necesario el conocimiento de las posibles interacciones entre este tipo de fármacos y los alimentos con el fin de evitar alteraciones en los efectos terapéuticos e incluso la aparición de efectos adversos. Todas las estatinas se absorben por vía oral por lo que es muy importante la influencia de la ingesta a la hora de la administración para alcanzar un adecuado efecto terapéutico. Muchas de las interacciones de las estatinas residen en su metabolismo a través del citocromo P-450 (excepto pravastatina lo que facilita su posible interacción con determinados alimentos o componentes de los mismos, como es el caso del zumo de pomelo. En este trabajo se hace una revisión de las interacciones fármaco-nutriente con especial atención a las propias de las estatinas y se describe el mecanismo de dichas interacciones para así poder contribuir a evitarlas y mejorar de este modo el tratamiento en personas con hiperlipemias.The existence of interactions between different drugs or between drugs and the diet is becoming better and better known. Statins are medicines currently in widespread use for the treatment of hyperlipidaemias. Diet has a great influence on the prevention and/or treatment of these pathologies as the therapeutic strategy used comprises appropriate diet and, if this does not succeed, pharmacological therapy is begun in combination with dietary advice. For this reason it is necessary to be aware of the potential interactions

  11. Contaminación de alimentos marinos por cadmio en Lima, 2015

    Directory of Open Access Journals (Sweden)

    Gloria Marín Vallejos

    2015-12-01

    Full Text Available Los objetivos fueron determinar las concentraciones de cadmio en ocho especies de alimentos marinos y comparar con los valores máximos permitidos según la Comisión de la Unión Europea en su Reglamento (CE Nº 1881/2006 y su modificatoria Reglamento (UE N° 488/2014. La investigación fue de carácter descriptivo, trasversal. Las muestras fueron de 100 g de cada ejemplar de pescado en tres oportunidades; los ejemplares fueron: jurel (Trachurus picturatus murphyi, langostinos (Penaeus vannamei, conchas abanico (Argopecten purpuratus, conchas blancas (Semele sp, choros (Aulacomya ater, almejas (Gari solida, machas (Mesonesma donacium y pota (Dosidicus gigas recolectadas al azar en el terminal pesquero de Villa María del Triunfo, provenientes del litoral de la región Lima, sub área 3: Chorrillos – Islas Pachacámac. El proceso de análisis se realizó por espectrofotometría de absorción atómica. Como resultados de los promedios de las concentraciones de cadmio tenemos: en pescados, jurel (Trachurus picturatus murphyi fue 0,35 mg/kg peso fresco; en crustáceos, langostino (Penaeus vannamei fue 0,42 mg/kg peso fresco; en moluscos bivalvos tenemos conchas blancas (Semele sp, conchas abanico (Argopecten purpuratus, choros (Aulacomya ater, machas (Mesonesma donacium y almejas (Gari solida fueron 0,82 – 0,83 – 1,00 – 1,28 y 1,39 mg/kg peso fresco respectivamente. Con este estudio se concluyó que las concentraciones de cadmio en pescados, en moluscos bivalvos y cefalópodos superan los límites permitidos, pero en crustáceos no superan estos límites.

  12. The Cytotoxicity Study of Carboxymethyl Starch (CMS) of Sago Starch (Metro xylon sago) by Brine Shrimp Lethality Test (Artemia salina nauplii)

    International Nuclear Information System (INIS)

    CMS can be produced by substitution of the hydroxyl groups with sodium monochloroacetate in the presence of strong alkali. Carboxy methylation can be performed in water as a solvent or in a water-miscible organic solvent containing a small amount of water such as ethanol, isopropanol, methanol or toluene. The use of organic solvent will preserve the final product in the granular form and the side product can be washed out easily but some of them may be having potential toxicity and carcinogenic effect. In this study, CMS was investigated the level of toxicity by using brine shrimp lethality (BSLT). Brine shrimp test method was used to screen CMS for their biological activity. The screening results showed that the LC50, of CMS is more than 100 mg/ ml dose concentration. In conclusion, CMS is not cytotoxicity to Artemia salina nauplii and BSLT method is simple, inexpensive and convenient assay for the detection of cytotoxic compound. (author)

  13. A novel heparan sulphate with high degree of N-sulphation and high heparin cofactor-II activity from the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Chavante, S F; Santos, E A; Oliveira, F W; Guerrini, M; Torri, G; Casu, B; Dietrich, C P; Nader, H B

    2000-03-16

    With the aid of heparinase and heparitinases from Flavobacterium heparinum and 13C and IH NMR spectroscopy it was shown that the heparan sulphate isolated from the brine shrimp Artemia franciscana exhibits structural features intermediate between those of mammalian heparins and heparan sulphates. These include an unusually high degree of N-sulphation (with corresponding very low degree of N-acetylation), a relatively high content of iduronic acid residues (both unsulphated and 2-O-sulphated) and a relatively low degree of 6-O-sulphation of the glucosamine residues. The major sequences (glucuronic acid-->N-sulphated glucosamine and glucuronic acid-->N, 6-disulphated glucosamine) are most probably arranged in blocks. Although exhibiting negligible anticlotting activity in the APTT and anti-factor Xa assays the A. franciscana heparan sulphate has a high heparin cofactor-II activity (about 1/3 that of heparin). PMID:10704986

  14. Determinación de la toxicidad aguda (cl50) del extracto de polvillo de carbón frente a larvas de artemia franciscana

    OpenAIRE

    Pacheco Gómez, Jesús David

    2011-01-01

    El carbón es una de las fuentes de energía más utilizada, su uso es globalizado y está muy ligado con el desarrollo industrial, sin embargo, es considerado como el contaminante de fuente de energía fósil más importante del mundo y su explotación está relacionada con la aparición de efectos tóxicos en diferentes organismos. El presente estudio tuvo por objetivo determinar la concentración letal media (CL50) del extracto metanólico de polvillo de carbón frente a larvas de Artemia franciscana; l...

  15. Effect of temperature and viscosity on swimming velocity of the copepod Acartia tonsa, brine shrimp Artemia salina and rotifer Brachionus plicatilis

    DEFF Research Database (Denmark)

    Larsen, Poul Scheel; Madsen, C.V.; Riisgard, H.U.

    2008-01-01

    Beating cilia are important organelles for swimming in many zooplanktonic aquatic organisms, including many invertebrate larvae, rotifers and ciliates, but other planktonic organisms, such as copepods and brine shrimps, use muscle-powered swimming appendages. In recent studies we found that the...... of swimming velocity for a 10 degrees C temperature reduction) that is found to be largest for the brine shrimp Artemia salina nauplius (37 %) and the rotifer Brachionus plicatilis (26%), but negligible for the copepod Acartia tonsa (4%). We suggest that experimental data on change in swimming...... velocity (V) due to change in kinematic viscosity (v) be correlated in terms of a power law, V proportional to v(-m). The present data on swimming velocity of copepods, brine shrimps and rotifers show values of exponent m approximate to 1.5 to 3, with a trend of decreasing values for increasing size of...

  16. Salmonelosis no tifoidea y su transmisión a través de alimentos de origen aviar.

    Directory of Open Access Journals (Sweden)

    Catalina Uribe

    2009-11-01

    Full Text Available La infección de origen alimentario por Salmonella spp., es una de las causas más importantes de gastroenteritis en seres humanos. Los principales reservorios de estos microorganismos son animales portadores asintomáticos y las fuentes de infección más frecuente son los alimentos o los productos derivados de estos. El aumento de la incidencia de Salmonella spp., es de gran impacto tanto en salud pública como en salud animal y se ha relacionado con un incremento de la diseminación de los microorganismos a través de las cadenas productivas animales (bovinos, cerdos, pollos asaderos y en especial gallinas ponedoras. En la presente revisión se busca realizar una compilación sistemática de información referida a la gastroenteritis y otras manifestaciones causadas por serovariedades no tíficas de Salmonella spp., con énfasis en la importancia de los alimentos de origen aviar en su transmisión. Las canales de aves frecuentemente pueden estar infectadas con el microorganismo; los huevos se pueden contaminar por transmisión vertical (transovárica, durante la postura o durante la manipulación o el almacenamiento. La infección en el hombre se adquiere por consumo de pollo, huevo crudo o parcialmente cocido, o alimentos preparados con éstos. El cuadro clínico de la salmonelosis no tífica (gastroenteritis o enterocolitis puede incluir diarrea, cefalalgia, dolor abdominal, náusea, vómito, fiebre y deshidratación especialmente en niños y ancianos. Las serovariedades no tíficas de Salmonella spp., pueden causar septicemia, estado portador o infecciones como meningitis, artritis, osteomielitis, colangitis, neumonía, arteritis, endocarditis o infecciones del aparato urinario.

  17. Salmonelosis no tifoidea y su transmisión a través de alimentos de origen aviar

    Directory of Open Access Journals (Sweden)

    Martha Cecilia Suárez

    2006-06-01

    Full Text Available La infección de origen alimentario por Salmonella spp., es una de las causas más importantes de gastroenteritis en seres humanos. Los principales reservorios de estos microorganismos son animales portadores asintomáticos y las fuentes de infección más frecuente son los alimentos o los productos derivados de estos. El aumento de la incidencia de Salmonella spp., es de gran impacto tanto en salud pública como en salud animal y se ha relacionado con un incremento de la diseminación de los microorganismos a través de las cadenas productivas animales (bovinos, cerdos, pollos asaderos y en especial gallinas ponedoras. En la presente revisión se busca realizar una compilación sistemática de información referida a la gastroenteritis y otras manifestaciones causadas por serovariedades no tíficas de Salmonella spp., con énfasis en la importancia de los alimentos de origen aviar en su transmisión. Las canales de aves frecuentemente pueden estar infectadas con el microorganismo; los huevos se pueden contaminar por transmisión vertical (transovárica, durante la postura o durante la manipulación o el almacenamiento. La infección en el hombre se adquiere por consumo de pollo, huevo crudo o parcialmente cocido, o alimentos preparados con éstos. El cuadro clínico de la salmonelosis no tífica (gastroenteritis o enterocolitis puede incluir diarrea, cefalalgia, dolor abdominal, náusea, vómito, fiebre y deshidratación especialmente en niños y ancianos. Las serovariedades no tíficas de Salmonella spp., pueden causar septicemia, estado portador o infecciones como meningitis, artritis, osteomielitis, colangitis, neumonía, arteritis, endocarditis o infecciones del aparato urinario.

  18. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures.

    Science.gov (United States)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul; Dourala, Nancy; Nielsen, Kristian Fog; Gram, Lone

    2016-05-01

    Fish-pathogenic Vibrio can cause large-scale crashes in marine larval rearing units and, since the use of antibiotics can result in bacterial antibiotic resistance, new strategies for disease prevention are needed. Roseobacter-clade bacteria from turbot larval rearing facilities can antagonize Vibrio anguillarum and reduce mortality in V. anguillarum-infected cod and turbot larvae. In this study, it was demonstrated that antagonistic Roseobacter-clade bacteria could be isolated from sea bass larval rearing units. In addition, it was shown that they not only antagonized V. anguillarum but also V. harveyi, which is the major bacterial pathogen in crustaceans and Mediterranean sea bass larvae cultures. Concomitantly, they significantly improved survival of V. harveyi-infected brine shrimp. 16S rRNA gene sequence homology identified the antagonists as Phaeobacter sp., and in silico DNA-DNA hybridization indicated that they could belong to a new species. The genomes contained genes involved in synthesis of the antibacterial compound tropodithietic acid (TDA), and its production was confirmed by UHPLC-TOFMS. The new Phaeobacter colonized live feed (Artemia) cultures and reduced Vibrio counts significantly, since they reached only 10(4)CFUmL(-1), as opposed to 10(8)CFUmL(-1) in non-Phaeobacter treated controls. Survival of V. anguillarum-challenged Artemia nauplii was enhanced by the presence of wild type Phaeobacter compared to challenged control cultures (89±1.0% vs 8±3.2%). In conclusion, TDA-producing Phaeobacter isolated from Mediterranean marine larviculture are promising probiotic bacteria against pathogenic Vibrio in crustacean live-feed cultures for marine fish larvae. PMID:26922490

  19. Webquest y edublog : experiencia en la enseñanza universitaria de toxicología de alimentos

    OpenAIRE

    Degrossi, María Claudia; Carnevali de Falke, Susana

    2009-01-01

    El presente trabajo relata una experiencia educativa, con desarrollo de una webquest y creación de un edublog, realizada en el año 2007 durante el dictado de Toxicología de Alimentos de la Carrera en Nutrición en dos instituciones educativas. Se eligió como tema el Análisis de Riesgos, aplicado a edulcorantes no calóricos, por su carácter central en la asignatura y la gran cantidad de información disponible en la red sobre los mismos. Se organizaron actividades grupales, dentro...

  20. Oxiesteroles: efectos biológicos; formación, contenido y determinación en alimentos

    OpenAIRE

    Guardiola, F.; Rafecas, M; Codony, R.; Boatella, J.

    1991-01-01

    We make a bibliographical review on the main aspects related to the cholesterol oxidation products, including their biological effects, their presence and formation in food and their analytical determination.

    Se realiza una revisión bibliográfica de los aspectos nutricionales y bromatológicos de los llamados oxiesteroles. Se recogen los efectos biológicos descritos para estos compuestos, su presencia y formación en alimentos y la metodología analítica para su determinación....

  1. Valorização de cogumelos silvestres como alimentos funcionais: estudos de química computacional

    OpenAIRE

    Froufe, Hugo J. C.; Abreu, Rui M. V.; Ferreira, Isabel C. F. R.

    2011-01-01

    As interacções intermoleculares desempenham um papel essencial nos diversos processos biológicos, sendo fundamental a compreensão destas interacções nos Sectores das Indústrias Farmacêuticas e de Alimentos Funcionais. Os cogumelos representam uma fonte ilimitada de compostos com propriedades antitumorais e imunoestimulantes, e o seu consumo foi já relacionado com a redução do risco de cancro da mama. No presente trabalho, foram desenvolvidos dois estudos in silico com o intuito de compreender...

  2. Cogumelos silvestres portugueses: valorização como alimentos funcionais e fonte de nutracêuticos

    OpenAIRE

    Ferreira, Isabel C. F. R.; Vaz, Josiana A.; Barros, Lillian; Almeida, Gabriela M.; Martins, Anabela; Vasconcelos, M. Helena

    2012-01-01

    Os cogumelos silvestres possuem grande diversidade de biomoléculas com valor nutricional e/ou propriedades medicinais. Têm sido reconhecidos como alimentos funcionais e como fonte de compostos para o desenvolvimento de fármacos e nutracêuticos, incluindo compostos com propriedades anti-tumorais. Exemplos disso são os β-glucanos “Lentinan” (do cogumelo Lentinus edodes) e “Schizophyllan” (do meio de cultura de Schizophyllum commune) ou os glucopéptidos PSP e “Krestin” (PSK) (do micélio de Corio...

  3. Contenido nutricional de alimentos y bebidas publicitados en la franja infantil de la televisión colombiana

    OpenAIRE

    Diana Margarita Mejía-Díaz; Isabel Cristina Carmona-Garcés; Paula Andrea Giraldo-López; Laura González-Zapata

    2014-01-01

    Objetivo: Describir el contenido nutricional de alimentos y bebidas no alcohólicas publicitados en la franja infantil vs general, en dos canales gratuitos privados de televisión nacional colombiana. Métodos: Estudio descriptivo transversal. La grabación se realizó en julio de 2012, durante cuatro días seleccionados aleatoriamente de 6:00 am a 12:30 pm. El contenido nutricional se clasificó según los criterios de perfiles nutricionales de la Food Standards Agency para nutrientes trazadores de ...

  4. Prevalencia de parásitos intestinales en manipuladores de alimentos en una comunidad rural de Cojedes, Venezuela

    OpenAIRE

    Gilberto Bastidas; Carolina Rojas; Elisa Martínez-Silva; Lisbeth Loaiza; María Guzmán; Varuna Hernández; Luis Rodríguez; Flor Rodríguez; Lesbia Meertens

    2012-01-01

    Introducción: las parasitosis intestinales constituyen un problema de salud pública, por la elevada prevalencia que muestran, donde los manipuladores de alimentos parasitados, se convierten en potenciales fuentes de infección, pues algunas formas parasitarias se transmiten directamente de la fuente de infección al susceptible, por vía fecal-oral. A esto se suma el incremento en el consumo de comida fuera del núcleo familiar, en residentes de zonas urbanas y rurales. El objeto es recolectar in...

  5. Trends in dietary patterns of Latin American populations Tendencias en el consumo de alimentos en poblaciones latinoamericanas

    Directory of Open Access Journals (Sweden)

    Odilia I. Bermudez

    2003-01-01

    Full Text Available It is important to characterize the level and magnitude of changes in food consumption patterns in Latin American populations as they undergo demographic and developmental transitions because of the effects of such changes on the development and progression of chronic diseases. This paper examines trends in food intake across regions in Latin America. Although trends in apparent food consumption differ in magnitude and timing, the overall patterns of change are remarkably consistent. Intakes of total fat, animal products, and sugar are increasing, even while there have been rapid declines in the intake of cereals, fruit, and some vegetables. The costs of the increased prevalence of chronic disease associated with these dietary changes are already affecting health systems still coping with malnutrition and infectious disease. Because this pattern of change is predictable, it is important to learn from the experiences gained in countries that are more advanced in the transition. Efforts to educate the population on the importance of a healthy diet and to issue policies to improve the availability of a healthy food supply can help to reduce the rapid escalation of obesity and chronic diseases.A la vez que las poblaciones latinoamericanas atraviesan por sus transiciones demográficas y de desarrollo, es importante caracterizar las dimensiones de los cambios que se producen simultáneamente en los patrones de consumo de alimentos de estas poblaciones. Este trabajo examina las tendencias en consumo de alimentos en América Latina, aunque estas tendencias se diferencian en tiempo de ocurrencia y magnitud, los patrones globales son muy consistentes. El consumo de grasas totales, productos animales y azúcares está en aumento y al mismo tiempo se está disminuyendo la ingesta de cereales, frutas y algunos vegetales. Los costos de la creciente prevalencia de enfermedades crónicas asociadas con estos cambios en el consumo están afectando a los sistemas

  6. Nanotecnología y producción de alimentos: impactos económicos, sociales y ambientales

    OpenAIRE

    Gian Carlo Delgado

    2009-01-01

    La nanotecnología, dígase la capacidad de manipular la materia a escala nanométrica, se perfila, junto con la biotecnología, la electroinformática y las ciencias congnitivas, como uno de los frentes tecnológicos de vanguardia de principios del siglo XXI. Las fuertes promesas que genera y la incertidumbre que la caracteriza son ciertamente algunos de sus elementos distintivos. El presente texto revisa el contexto social-discursivo del desarrollo de la nanotecnología en el área de los alimentos...

  7. Análisis del desarrollo de un material multimedia orientado al manejo higiénico de los alimentos

    OpenAIRE

    Guerrero Segovia, Mónica; Gay Segura, Martha; Robles Noriega, Heidy

    2016-01-01

    La integración de recursos multimedia en los diferentes niveles educativos ofrece una nueva posibilidad de mejora en los procesos de enseñanza-aprendizaje. Este artículo explica los elementos que se consideraron para desarrollar un material multimedia en el tema del Manejo Higiénico de Alimentos dirigido a estudiantes de Gastronomía en una institución privada en México. El objetivo fue evaluar los aspectos pedagógicos, funcionales, técnicos y estéticos del recurso multimedia. Se describen las...

  8. CDC Signos Vitales- Los alimentos más seguros salvan vidas (Safer Food Saves Lives)

    Centers for Disease Control (CDC) Podcasts

    2015-11-03

    Este podcast se basa en la edición de noviembre del 2015 del informe Signos Vitales de los CDC. Los alimentos contaminados que se envían a múltiples estados pueden causar brotes de enfermedades y enfermar gravemente a muchas personas. Sepa lo que se puede hacer para prevenir y detener los brotes.  Created: 11/3/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 11/3/2015.

  9. Revisión de los niveles de acidos grasos trans encontrados en distintos tipos de alimentos

    Directory of Open Access Journals (Sweden)

    Vicario, I. M.

    2007-03-01

    Full Text Available In this paper a comprehensive review of trans-fatty acid levels reported in different types of food products is offered. The lowest levels are found in some types of bread (0,1% while the highest levels (up to 40% are found in fried potatoes. Some foods like shortenings, cakes and pastries may have up to 30% of these fatty acids. In milk and dairy products the reported levels are between 1.50% and 5.20%, in meat and derived products between 0.20% and 21,30%; in chocolates from 0% to 15, 70%. The greatest variability is found in margarines, where a variety has been reported from “trans-free products” to products containing up to 34. 30%. In relation to the trans-fatty acid profile, 18:1t is the most abundant fatty acid found in the majority of foods, followed by C18:2t, C18:3t, C18:1t y C14:1t. Due to the negative health effects of these fatty acids, there is a trend to reduce their levels in food products and to include them in the nutritional label of food packaging.En este trabajo se realiza una exhaustiva revisión bibliográfica de los contenidos en grasos trans en alimentos de distinto origen. Los niveles más bajos se encuentran en algunos tipos de pan (0,10%, y los más elevados (hasta 40%, en algunas muestras de patatas fritas. Alimentos tales como shortenings, algunos tipos de galletas y bollería contienen hasta el 30% de dichos ácidos grasos. En las leches y derivados se encuentran cantidades entre 1,50% y 5,20%; en carnes y derivados entre 0,20% y 21,30%; en chocolates desde cantidades nulas hasta 15,70%. La mayor variabilidad se registra en margarinas, entre las que se encuentran desde las “libres de trans”, hasta algunas con 34,30% de estos ácidos grasos. En cuanto a los distintos isómeros, el mayoritario es el C18:1t seguido del C18:2t, C18:3t, C18:1t y C14:1t. Debido a los efectos desfavorables que presentan sobre la salud se observa en los últimos años una tendencia a reducir este tipo de ácidos grasos en algunos

  10. Salmonelosis no tifoidea y su transmisión a través de alimentos de origen aviar.

    OpenAIRE

    Martha Cecilia Suárez; Catalina Uribe

    2009-01-01

    La infección de origen alimentario por Salmonella spp., es una de las causas más importantes de gastroenteritis en seres humanos. Los principales reservorios de estos microorganismos son animales portadores asintomáticos y las fuentes de infección más frecuente son los alimentos o los productos derivados de estos. El aumento de la incidencia de Salmonella spp., es de gran impacto tanto en salud pública como en salud animal y se ha relacionado con un incremento de la diseminación de los micro...

  11. Alimentos geneticamente modificados vs. saúde pessoal e ambiental: um estudo de opinião

    OpenAIRE

    Silva, Margarida; Frada, Mariana; Marques, Sandra; Santos, Ana; Santos, Luísa

    2004-01-01

    A comercialização de alimentos geneticamente modificados (OGM) desencadeou um debate social importante em toda a Europa a que Portugal não foi totalmente alheio. Embora a entrada de OGM na cadeia alimentar apresente a chancela governamental quanto à sua segurança sanitária e ambiental, a desconfiança dos consumidores europeus conduziu à efectiva eliminação dos mercados onde os OGM são sujeitos a rotulagem obrigatória que lhes acarreta visibilidade. Possivelmente tal postura terá sido de...

  12. Evaluación del contenido de hierro total en alimentos de la canasta básica de consumo de los costarricenses

    OpenAIRE

    Pulina Silva Trejos

    2009-01-01

    Se determinó el contenido de hierro total en 35 alimentos de la canasta básica de consumo de los costarricenses. Los alimentos se escogieron de acuerdo con una encuesta realizada por el comité de usuarios de COSTA RICA FOODS en el 2001. En la muestra se consideraron alimentos de las siguientes categorías: A. Cereales y derivados B. Vegetales y derivados C. Grasas y aceites D. Pescados y productos del mar F. Carnes y derivados E. Leche y derivados J. Huevos y derivados Q. Productos infantiles ...

  13. ACEITAÇÃO E PERCEPÇÃO DOS ESTUDANTES DE GASTRONOMIA E NUTRIÇÃO EM RELAÇÃO AOS ALIMENTOS FUNCIONAIS

    OpenAIRE

    Graziele Resende MELO; Ana Paula TEIXEIRA; Renata Puppin ZANDONADI

    2010-01-01

    O termo “alimento funcional” foi introduzido no Japão (1980) e, apesar de comumente utilizado, ainda não existe defi nição mundialmente aceita. Estudos afirmam que sua aceitação está relacionada à informação recebida. Assim, profi ssionais da área de alimentos devem divulgar informações acerca de seus benefícios para promoção de alimentação saudável. Portanto, buscou-se verifi car aceitação e percepção dos alunos de Gastronomia e Nutrição do DF em relação aos “alimentos ...

  14. Conhecimento e atitudes sobre alimentos irradiados de nutricionistas que atuam na docência Knowledge and views of professors of nutrition about food irradiation

    Directory of Open Access Journals (Sweden)

    Kelly Daiane Silva

    2010-09-01

    Full Text Available A irradiação de alimentos é eficiente tecnologia que pode ser empregada na conservação dos alimentos. Porém, o conhecimento dos consumidores sobre os alimentos irradiados tem se mostrado insuficiente, resultando em baixa aceitação destes alimentos. Considerando que o nutricionista é o profissional de saúde habilitado para orientar pacientes e consumidores sobre a ingestão e seleção de alimentos, este estudo avaliou o conhecimento e a atitude frente aos alimentos irradiados entre nutricionistas que atuam na docência em instituições de ensino superior em Belo Horizonte - MG, Brasil. Dos 66 participantes, 86,4% referiram saber o que são alimentos irradiados, todavia 71,2% desconhecem o processo, 75,8% desconhecem a legislação, 21,2% desconhecem as finalidades da irradiação, 12,1% consideram os alimentos irradiados como sendo radioativos e, 31,8% acreditam que a irradiação de alimentos resulta em redução do valor nutritivo dos alimentos. Os alimentos irradiados não seriam recusados pelos doutores, porém seriam recusados por 5 mestres e por 6 especialistas. Foi concluído que a formação dos futuros nutricionistas pode estar sendo realizada sem o mínimo de conhecimento necessário a respeito dos alimentos irradiados, podendo estar corroborando para a atitude negativa dos consumidores.Food irradiation is an efficient technology that can be used in the conservation of foods. However, consumers' knowledge about irradiated foods has proved insufficient resulting in low acceptance of such foods. Considering that dietitians and nutritionists are the qualified health professionals to guide patients and consumers towards the ingestion and selection of foods, this study aims to evaluate the knowledge and views about radiated foods of professors of nutrition working in higher education institutions in the city of Belo Horizonte - MG, Brazil. A total of 86.4% out of the 66 participants had general knowledge about irradiated foods

  15. Determinação da vida útil de 2 grupos de alimentos prontos a comer comercializados em estabelecimentos de take away

    OpenAIRE

    Mendes, Petra Vanessa Faria

    2009-01-01

    Desde sempre que a alimentação, a qualidade e a segurança dos alimentos constituem uma preocupação para o Homem, ainda que estes conceitos tenham evoluído ao longo dos tempos. As mudanças na sociedade, a sofisticação da produção de alimentos, as mudanças nos hábitos de vida, de rotina e de alimentação, resultaram na alteração das preferências do consumidor. O consumidor actual, ao mesmo tempo que prefere alimentos caracterizados essencialmente pela rapidez de confecção e conven...

  16. Técnica de digestibilidad in vitro en ingredientes y alimentos para camarón

    OpenAIRE

    NIETO LO?PEZ, MARTHA GUADALUPE; CRUZ SUA?REZ, LUCI?A ELIZABETH; RICQUE MARIE, DENIS; EZQUERRA BRAUER, MARINA

    2005-01-01

    En el presente trabajo se evaluo? si algunas te?cnicas in vitro o la digestibilidad en otras especies podri?an ser aplicadas en el control de calidad de harinas de pescado, dietas y otros ingredientes utilizados en la alimentacio?n del camaro?n Litopenaeus vanname. Para ello se determinaron los coeficientes de correlacio?n obtenidos en la digestibilidad in vivo en camaro?n y la digestibilidad in vivo en otras especies (salmo?n, trucha o mink), o con cada una de las diferentes te?cnicas in vit...

  17. Valores de energia metabolizável de alguns alimentos obtidos com aves de diferentes idades Metabolizable energy values of feedstuffs obtained from poultry at different ages

    OpenAIRE

    Heloisa Helena de Carvalho Mello; Paulo Cezar Gomes; Horacio Santiago Rostagno; Luiz Fernando Teixeira Albino; Renata Mara de Souza; Arele Arlindo Calderano

    2009-01-01

    Foram realizados quatro ensaios de metabolismo com a finalidade de determinar a energia metabolizável aparente (EMA) e a energia metabolizável aparente corrigida (EMAn) de dez alimentos em aves em diversas idades. Os alimentos testados foram: milho, farelo de soja, sorgo, farelo de trigo, farelo de arroz integral, duas farinhas de penas, duas farinhas de vísceras e plasma sangüíneo. Utilizou-se o método de coleta total de excretas, em delineamento experimental inteiramente casualizado, com 11...

  18. ÍNDICE GLUCÉMICO DE UN ALIMENTO (TORTA DE JAMÓN) CONSUMIDO POR ESCOLARES DE EDUCACIÓN PRIMARIA DEL ESTADO DE MORELOS

    OpenAIRE

    Alcantar Rodríguez, Victor Eduardo

    2014-01-01

    El Índice Glucémico (IG) permite clasificar a los alimentos de acuerdo a la respuesta glucémica que provocan en los individuos y se emplea como herramienta en el manejo dietético y prevención de enfermedades como: diabetes, sobrepeso, obesidad, enfermedades cardiovasculares y dislipidemias. Los alimentos se clasifican en IG alto, medio y bajo, siendo estos últimos los recomendados en el tratamiento de las enfermedades mencionadas. El objetivo de este trabajo fue medir el Índice Gluc...

  19. Intervenciones poblacionales relacionadas con el etiquetado y rotulación de los alimentos respecto a su composición nutricional

    OpenAIRE

    Sebastián Ponce, Miren Itxaso

    2015-01-01

    Objetivo General. Revisar sistemáticamente la literatura científica indizada en las principales bases de datos de ciencias de la salud, sobre las intervenciones realizadas mediante el etiquetado y/o la rotulación en la prevención de la obesidad, el contenido de sal de los alimentos, los alimentos transgénicos y el contenido en grasa. Material y Método. Estudio descriptivo de los trabajos recuperados en la revisión bibliográfica mediante técnica sistemática. Se estudiaron textos publicados en ...

  20. Cobre en alimentos de consumo básico por espectroscopia de absorción atómica modalidad de llama, Costa Rica

    OpenAIRE

    Paulina Silva Trejos

    2012-01-01

    Objetivo: Cuantificar el contenido de cobre en alimentos de la canasta básica de consumo del costarricense. Materiales y métodos: Los alimentos se procesaron de acuerdo con el patrón de consumo costarricense, se determinó la cantidad óptima de HNO3.al 65 % óptimo para su digestión en horno de microondas por evaluación de los porcentajes de recuperación. La cuantificación se realizó sobre las muestras digeridas por espectroscopia de absorción atómica de llama., las mediciones se hicieron a 324...

  1. El CITA realiza un estudio sobre las declaraciones nutricionales y de propiedades saludables que aparecen en las etiquetas de los alimentos

    OpenAIRE

    Area de Información, Documentación y Cultura Científica. Centro de Investigación y Tecnología Agroalimentaria de Aragón

    2014-01-01

    Las declaraciones nutricionales y de propiedades saludables ofrecen información en las etiquetas de los alimentos que pueden ayudar a los consumidores a identificar aquellos alimentos que suponen una opción saludable. Sin embargo, hasta el momento, se sabe muy poco sobre como influyen esas informaciones en el comportamiento de compra del consumidor. La Dra. Azucena Gracia de la Unidad de Economía Agroalimentaria del CITA lidera el equipo que realiza esta investigación con el no...

  2. Prevalência de enteroparasitoses em manipuladores de alimentos, Florianópolis, SC Enteroparasitosis prevalence in food handlers, Florianópolis, SC

    Directory of Open Access Journals (Sweden)

    Alexandre Costa Nolla

    2005-12-01

    Full Text Available Analisamos 238 amostras fecais oriundas de duas populações de indivíduos na cidade de Florianópolis, Santa Catarina, Brasil: os que trabalhavam em uma empresa de alimentos e trabalhadores de feiras livres e sacolões. Observou-se que esses manipuladores de alimentos apresentaram elevados índices de parasitose.We analyzed 238 feces samples in two populations of individuals in the city of Florianópolis, Santa Catarina State, Brazil: we selected workers in a fast food company and workers in street markets and vegetable and fruit markets. The intestinal parasites were high in these food handlers.

  3. Efecto de distintos tratamientos de conservación de alimentos sobre la morfología y propiedades de materiales poliméricos de envase

    OpenAIRE

    LÓPEZ RUBIO, MARÍA DE LOS DESAMPARADOS

    2008-01-01

    Para la mayoría de los alimentos, el envase forma parte fundamental de su sistema de conservación, recibiendo, a menudo junto al alimento y en ocasiones de forma independiente, tratamientos de diversos tipos con los que se pretende alargar la vida útil del producto envasado mediante la reducción de su carga microbiológica inicial, así como mediante la inactivación de diversos enzimas. Algunos de estos tratamientos de conservación, como la esterilización térmica en autoclave, pueden producir e...

  4. Coeficientes de digestibilidade aparente de alimentos energéticos para juvenis de surubim Apparent digestibility coefficients of different energetic ingredients for surubim juveniles

    OpenAIRE

    Edgar de Alencar Teixeira; Eloísa de Oliveira Simões Saliba; Ana Carolina Castro Euler; Paulo Mário Carvalho de Faria; Daniel Vieira Crepaldi; Lincoln Pimentel Ribeiro

    2010-01-01

    Neste trabalho, determinou-se o valor nutritivo de quatro alimentos energéticos (fubá de milho, sorgo, farelo de arroz integral e quirera de arroz) para juvenis de surubim. Os coeficientes de digestibilidade aparente da matéria seca (MS), proteína bruta (PB) e energia bruta (EB) foram avaliados pela metodologia de substituição do alimento numa ração-referência usando-se 0,1% de óxido crômico como indicador externo. Utilizaram-se 240 alevinos com 30 g de peso médio distribuídos em tanques apro...

  5. Reducción de desastres: indicadores de riesgo asociados al manejo territorial de enfermedades transmitidas por alimentos (ETA

    Directory of Open Access Journals (Sweden)

    Yolanda Suárez Fernández (*; Maylín Soca Pérez (*; Yolexis Fabré Rodríguez (*;Maritza Fuentes Cintra (* ;Miguel Torres (*;

    2006-09-01

    Full Text Available el objetivo deincrementar las acciones territoriales dereducción de desastres naturales y susconsecuencias sanitarias en el municipioSan Nicolás de Bari, se evaluaronalgunos indicadores de riesgo asociadosal manejo de las EnfermedadesTransmitidas por Alimentos (ETA solaso asociadas a los desastres naturales yse propusieron acciones para lareducción de sus riesgos solos o comoconsecuencia de desastres naturales. Losniveles de percepción de riesgos deEnfermedades Transmitidas porAlimentos (ETA fueron ALTOS paratodos los grupos encuestados, sinrelación estadística con la cultura deprevención en los grupos de población enriesgo y susceptible estudiados, y conrelación estadística de significación conla competencia profesional y esta con lagestión institucional en los trabajadores,profesionales y decisores del sectorsalud. Se concluye sobre la importanciade la capacitación y la cooperaciónintersectorial en el manejo del problemapara una adecuada reducción de losdesastres naturales y sus consecuencias

  6. Kaɨmakɨ guiye fɨnuafue: Preparación de los alimentos de nuestra gente

    Directory of Open Access Journals (Sweden)

    Anastasia Candre Yamacuri

    2014-09-01

    Full Text Available Este texto bilingüe (uitoto-español sobre la chagra y los alimentos contiene tres partes. La primera trata sobre los procesos de trabajo de la chagra: tumba, quema, selección de semillas, siembra, cuidado de la chagra, e importancia de la chagra para la alimentación y para la construcción de hombres y mujeres verdaderos. La segunda parte contiene varios relatos autobiográficos narrados desde el punto de vista de los alimentos: el ingreso de Anastasia Candre al internado de Chorrera (1969-1975, lo que comían y cómo eras las chagras de la gente y los productos que vendían al internado; el “tiempo de mafia” (1980-1983 cuando, por el auge de la coca, la gente dejó de hacer chagras y llegaron nuevos productos; la llegada de Anastasia a Leticia (1983-1985, los nuevos productos que vio y los paisanos que conoció y cómo tenían sus chagras; y la visita de Anastasia, cuando regresa a La Chorrera (2013 a la chagra a su hermana y su crítica a lo que ve allí sembrado. La tercera parte contiene los procesos de preparación de casabe seco, arepa de yuca, tamales de yuca, fariña, casabe grueso, ají negro y almidón.

  7. De alimento a poesía: la identidad cubana en Paradiso de José Lezama Lima

    Directory of Open Access Journals (Sweden)

    María Adelaida Escobar-Trujillo

    2012-06-01

    Full Text Available Partiendo de los estudios sobre lo cubano en Paradiso de José Lezama Lima, este trabajo busca contribuir al análisis de la transculturación a través del paisaje y la comida como imágenes que fundan la identidad cubana en la novela. Igualmente, se busca establecer la relación entre comida y poesía a partir del proceso de preparación, transformación y presentación que experimentan alimento y palabra. El trabajo está dividido en tres secciones: el producto vegetal primario, la elaboración de los alimentos y, finalmente, su presentación en los banquetes gastronómicos.Starting from works related to Cuban identity in Paradiso from José Lezama Lima, this paper will contribute to the study of the concept of transculturation by means of landscape and food that are presented as images used to build the Cuban identity in the novel. The paper will also establish a relationship between food and poetry based on the preparation, transformation and presentation of both, ingredients and words. The paper is divided in three sections: the primary vegetal products, food elaboration and food presentations through gastronomic banquets.

  8. Expectativas de la distribución electrónica de alimentos en México

    Directory of Open Access Journals (Sweden)

    Felipe Torres Torres

    2016-01-01

    Full Text Available El objetivo de este artículo es analizar los cambios ocurridos en el esquema tradicional de distribución y abasto de alimentos en México, derivados de su adaptación al modelo de economía abierta. Enfatiza la concentración demográfica en ciudades, los avances tecnológicos y la simplificación de etapas de intermediación. Se aplica una metodología simple que emplea datos sobre el número de usuarios de computadora, celular, con acceso a internet y que tienen además con medios de pago electrónico. Los resultados sugieren que las actuales redes de abastecimiento en ciudades transitan hacia otros esquemas como la distribución electrónica de alimentos, aunque con ciertas limitaciones, como es la aún incipiente infraestructura digital y de transporte en empresas distribuidoras así como el bajo nivel de consumo. Las conclusiones indican que este canal cuenta con expectativas amplias de desarrollo, como consecuencia de la concentración de consumidores en ciudades, su acceso más fácil al crédito y la paulatina incorporación de plataformas digitales en tiendas comerciales, como es el caso de Amazon, 99minutos. com o Hellofood, así como de las tiendas de formato tradicional tipo Walmart o Comercial Mexicana.

  9. In situ caecal degradation of roughages in horses Degradação cecal in situ de alimentos volumosos em equinos

    Directory of Open Access Journals (Sweden)

    Vinícius Pimentel Silva

    2010-02-01

    , amendoim forrageiro (Arachis pintoi cv. Amarillo, desmódio (Desmodium ovalifolium, estilosantes (Stylosanthes guianensis cv. Mineirão, guandu (Cajanus cajan, macrotiloma (Macrotyloma axillare e feno de coastcross (Cynodon dactylon cv. coastcross. O ensaio teve duração de 35 dias e foi realizado em delineamento inteiramente casualizado com sete alimentos e três repetições. Utilizou-se uma égua fistulada no ceco, alimentada com dieta composta por feno de coastcross (80% e concentrado (20%, fornecida quatro vezes ao dia em quantidade equivalente a 2% do peso vivo. No ceco, foram inseridos 3 a 4 sacos de náilon de porosidade 45 μ de 6,5 × 20 cm, contendo 5,2 g de MS/saco, nos tempos de 2, 4, 6, 8, 12, 24 e 48 horas de incubação. Os parâmetros de degradação da MS de todos os volumosos foram significativos. Não houve ajuste no modelo de degradação da PB e FDN do guandu. O amendoim, estilosantes e macrotiloma apresentaram maior fração potencialmente degradável da MS, com valores de 53, 46,5 e 40%, respectivamente, e os maiores valores da fração solúvel de 20, 21, 28,6%, além de elevadas taxas de degradação (10,36, 20,26 e 14,8%h-1. Nestes alimentos, também foram observadas as maiores taxas de degradação da FDN (9,1 e 11,3, 11,2%h-1, das frações potencialmente degradáveis (55, 51,8 e 47,2% e as mais altas taxas de degradação da PB em 48 horas de incubação (87, 95, 94,8%, respectivamente. O amendoim forrageiro, o estilosantes e o macrotiloma apresentam potencial de uso nas dietas para equinos.

  10. Hortaliças como alimentos funcionais Vegetable crops as functional food

    Directory of Open Access Journals (Sweden)

    Patrícia G B de Carvalho

    2006-12-01

    Full Text Available Embora remonte às origens da civilização, a relação entre alimentação e saúde nunca foi tão estreita quanto nos dias de hoje. Dietas ricas em gordura, sal e açúcar e pobres em carboidratos complexos, vitaminas e minerais, aliadas a um estilo de vida mais sedentário, são responsáveis pelo aumento de doenças ligadas à dieta, tais como obesidade, diabetes, problemas cardiovasculares, hipertensão, osteoporose e câncer. Há muito tempo acredita-se que o consumo de frutas e hortaliças auxilia na prevenção destas doenças. As hortaliças são um importante componente da dieta, sendo tradicionalmente servidas junto com um alimento protéico e um carboidrato. Elas fornecem não apenas variedade de cor e textura às refeições, mas também nutrientes importantes. As hortaliças têm pouca gordura e calorias, relativamente pouca proteína, mas são ricas em carboidratos e fibras e fornecem níveis significativos de micronutrientes à dieta. Além disso, elas possuem compostos funcionais, que beneficiam uma ou mais funções orgânicas, além da nutrição básica, contribuindo para melhorar o estado de saúde e bem-estar e/ou reduzir o risco de doenças. O desenvolvimento de cultivares mais ricas nestes compostos tem se consolidado como um dos principais focos dos modernos programas de melhoramento genético de hortaliças. Vários destes programas, trabalhando com diferentes hortaliças, estão em andamento no Brasil e no mundo visando aumentar os teores e diversificar os tipos de carotenóides presentes na dieta. Neste trabalho são discutidos os principais aspectos relacionados às hortaliças como alimentos funcionais, bem como são detalhados os principais avanços obtidos nesta área no melhoramento de cenoura e tomate no Brasil.Although a very old concept, the relationship between food and health has never been as close as it is today. Diets rich in fat, salt, and sugar and poor in complex carbohydrates, vitamins, and minerals

  11. Traffic light labelling: traduzindo a rotulagem de alimentos Traffic light labeling: translating food labeling

    Directory of Open Access Journals (Sweden)

    Giovana Longo-Silva

    2010-12-01

    Full Text Available OBJETIVO: Apresentar uma adaptação do Traffic Light Labelling, ou "Semáforo Nutricional", adotado no Reino Unido e outros países da Europa, às normas vigentes no Brasil e classificar produtos industrializados comercializados no país. MÉTODOS: Esta ferramenta baseia-se na utilização das cores do semáforo para valorar concentrações de gorduras total, saturada e trans, açúcar, sódio e fibra correspondente a 100g ou 100mL do produto. O sinal vermelho indica que o nutriente está presente em quantidade excessiva; o amarelo, média e o verde, adequada. Para fibras as baixas concentrações têm cor vermelha e as recomendadas, verde. A adaptação e aplicação desses conceitos para consumidores brasileiros fundamentaram-se nas normas do Regulamento Técnico Referente à Informação Nutricional Complementar da Agência Nacional de Vigilância Sanitária e da Food Standards Agency. RESULTADOS: Foram classificados cem produtos industrializados, os quais foram selecionados da página eletrônica de um hipermercado brasileiro, optando pelos primeiros cinco a oito produtos listados na página, para cada uma das 17 categorias. A análise mostra que são altas as quantidades de gordura total, saturada e sódio e baixas as quantidades de gordura trans e fibra. CONCLUSÃO: A adaptação dessa metodologia visa facilitar a escolha de alimentos saudáveis, sensibilizando os consumidores quanto às desvantagens no que se refere a qualidade nutricional dos alimentos industrializados, e estimular as indústrias a melhorar a composição nutricional de seus produtos, sob a perspectiva de receberem maior quantidade de sinais verdes e menor quantidade de sinais vermelhos; assim, contribuindo para a prevenção de erros alimentares, obesidade e doenças crônicas não-transmissíveis, principais causas de incapacidade e mortes precoces no Brasil.OBJECTIVE: This study presented an adaptation of the Traffic Light Labeling or Nutrition Traffic Light adopted

  12. Los usuarios ante los alimentos genéticamente modificados y su información en el etiquetado

    Directory of Open Access Journals (Sweden)

    Miren Itxaso Sebastian-Ponce

    2014-02-01

    Full Text Available OBJETIVO : Analizar la opinión que los usuarios tienen sobre alimentos genéticamente modificados y su información en el etiquetado. MÉTODOS : Realizada revisión sistemática de la literatura científica sobre los alimentos transgénicos y el etiquetado a partir de la consulta de las bases de datos bibliográficas: Medline (vía PubMed, EMBASE, ISI-Web of Knowledge, Cochrane Library Plus, FSTA, LILACS, CINAHL y AGRICOLA. Los descriptores seleccionados fueron: «organisms, genetically modified » y «food labeling». La búsqueda se realizó desde la primera fecha disponible hasta junio de 2012, seleccionando los artículos pertinentes escritos en inglés, portugués y castellano. RESULTADOS : Se seleccionaron 40 artículos. En todos ellos, se debía haber realizado una intervención poblacional enfocada al conocimiento de los consumidores sobre los alimentos genéticamente modificados y su necesidad, o no, de incluir información en el etiquetado. El consumidor expresa su preferencia por el producto no-genéticamente modificado, y apunta que está dispuesto a pagar algo más por él, pero, en definitiva compra el artículo que está a mejor precio en un mercado que acoge las nuevas tecnologías. En 18 artículos la población se mostraba favorable a su etiquetado obligatorio y seis al etiquetado voluntario; siete trabajos demostraban el poco conocimiento de la población sobre los transgénicos y, en tres, la población subestimó la cantidad que consumía. En todo caso, se observó la influencia del precio del producto genéticamente modificado. CONCLUSIONES : La etiqueta debe ser homogénea y aclarar el grado de tolerancia en humanos de alimentos genéticamente modificados en comparación con los no modificados. Asimismo, debe dejar claro su composición, o no, de alimento genéticamente modificado y la forma de producción de estos artículos de consumo. La etiqueta también debe ir acompañada de un sello de certificación de una agencia

  13. Siberian sturgeon (Acipenser baerii) larvae fed Artemia nauplii enriched with poly-beta-hydroxybutyrate (PHB): effect on growth performance, body composition, digestive enzymes, gut microbial community, gut histology and stress tests

    OpenAIRE

    Najdegerami, H; K. Baruah; Shiri, A.; Rekecki, A.; Van Den Broeck, W.; Sorgeloos, P.; Boon, N.; P. Bossier; De Schryver, P.

    2015-01-01

    The effects of feeding Artemia nauplii enriched with or without poly-ß-hydroxybutyrate (PHB) and/or highly unsaturated fatty acids (HUFA) on Siberian sturgeon (Acipenser baerii) larvae were investigated. Feeding larvae with PHB-enriched nauplii (PHB, PHB + HUFA) decreased the growth performance of the larvae. PHB affected the body composition by increasing the lipid content of the whole body and decreasing total saturated, monoenoic, n3, n6 and decosahexanoeic acid (DHA) in the larvae, indica...

  14. Actividad antibacteriana y citotoxicidad in vivo de extractos etanólicos de Bauhinia variegata L. (Fabaceae Antibacterial activity and in vivo cytotoxicity of ethanol extracts from Bauhinia variegata L. (Fabaceae

    Directory of Open Access Journals (Sweden)

    Maby M Martínez

    2011-12-01

    Full Text Available Introducción: diversas investigaciones han identificado el potencial biológico de diferentes compuestos como flavonoides, taninos, esteroides, naftoquinonas y sesquiterpenoides presentes en el género Bauhinia. Se ha reportado para la especie Bauhinia variegata la presencia de flavonoides con propiedades antidiabéticas y antivirales; sin embargo, el estudio del potencial antibacterial y citotóxico in vivo es incipiente, tanto para compuestos de flavonoides como de alcaloides. Objetivo: determinar la actividad antibacteriana y citotóxica in vivo de los extractos alcaloidales de Bauhinia variegata L. Métodos: se aplicó cromatografía de columna para la extracción y el aislamiento de los alcaloides presentes en las hojas de B. variegata. Extractos y fracciones alcaloidales se evaluaron para determinar el potencial citotóxico por medio del bioensayo sobre "camarones de mar" (Artemia salina y el potencial antibacterial sobre Escherichia coli por medio del método de difusión en disco (antibiograma por difusión. Resultados: se obtuvieron 6 compuestos depurados, a los cuales se les determinó la presencia del núcleo protoberberinico según espectrofotometría ultravioleta. En relación con el bioensayo sobre Artemia salina, el extracto crudo mostró menor toxicidad (CL50> 1 000 µg/mL, mientras que la fracción de los alcaloides totales y el compuesto CD1 mostró alta toxicidad (CL50Introduction: several research studies have identified the biological potential of different compounds such as flavonoids, tannins, steroids, naphtoquinones and sesquiterpenoid present in the genus Bauhinia. It has been reported for the species B. variegata the presence of flavonoids with anti-diabetic and antiviral properties, but the study of antibiotic and cytotoxic potential is just incipient for both flavonoid and alkaloid compounds. Objective: to determine the antibacterial and in vivo cytotoxic activity of alkaloid extracts from Bauhinia variegata L

  15. Marcador in vitro da resposta glicêmica dos alimentos como ferramenta de auxílio à prescrição e avaliação de dietas In vitro indicator of the glycemic response to foods as a tool for diet prescriptions and evaluation

    OpenAIRE

    Vanessa Dias Capriles; Andréa Carvalheiro Guerra-Matias; José Alfredo Gomes Arêas

    2009-01-01

    As dietas de baixo índice glicêmico e baixa carga glicêmica têm sido associadas à redução do risco de doenças crônicas. Por esse motivo há um interesse crescente na sua aplicação para avaliação e orientação nutricional. No entanto, existem limitações quanto ao uso de dados publicados de índice glicêmico e carga glicêmica, pela variedade e formas de processamento dos alimentos vegetais existentes. Devido à dificuldade de realização de ensaios in vivo, uma vez que são custosos, trabalhosos, inv...

  16. Efecto de la publicidad de alimentos anunciados en la televisión sobre la preferencia y el consumo de alimentos: revisión sistemática Effect of food television advertising on the preference and food consumption: systematic review

    Directory of Open Access Journals (Sweden)

    G. Díaz Ramírez

    2011-12-01

    Full Text Available Objetivo: El propósito de esta revisión sistemática es evaluar estudios acerca del efecto de los anuncios de alimentos en TV sobre las preferencias y el consumo de alimentos en diferentes grupos de edad. Métodos: Se realizó una búsqueda de ensayos aleatorios controlados publicados en Pubmed, Ebsco, Cochrane, Scielo hasta Noviembre del 2010. Se incluyeron aquéllos que evaluaran el efecto de la exposición directa a anuncios de alimentos en TV sobre las preferencias, demanda, compra y consumo. Resultados: Diez estudios cumplieron con los criterios de inclusión. En los tres estudios que evaluaron el efecto de la exposición a anuncios de alimentos en preescolares se observó un aumento en la selección y demanda de los alimentos. Todos los cinco estudios realizados en escolares presentaron resultados negativos en los expuestos a alimentación no saludable. De los tres estudios realizados en adultos, dos reportaron un mayor consumo de los alimentos anunciados en el grupo expuesto. Conclusión: Los estudios evaluados demuestran que en pre-escolares y escolares el efecto de los anuncios sobre el consumo de alimentos es consistente, mientras que en adultos los resultados apuntan hacia una fuerte asociación entre la exposición a los anuncios de alimentos en TV con la preferencia, consumo y demanda por los alimentos anunciados.Objective: The aim of this study was to perform a systematic review of papers that assess the effect of television food advertisings (TFA in the food preferences and consumption in different age groups. Methods: Randomized clinical trials published up to November 2010 were searched in Pubmed, Ebsco, Cochrane and Scielo. Studies were included if they assessed the effect of direct exposition to TFA over the food preferences, demand, and consumption. Results: Ten studies fulfilled the inclusion criteria. In the three studies conducted on preschooler children an increase in selection and demand of advertized foods was

  17. Seguridad alimentaria y ‘calidad’ de los alimentos: ¿una estrategia campesina?

    Directory of Open Access Journals (Sweden)

    Kirsten Appendini

    2003-10-01

    Full Text Available Food security and ‘quality of food’: a peasant strategy?In this paper we discuss the concept of ‘food  security’ with a focus on the issue of ‘life quality’.  This is related to the agricultural development  agenda that proposes a different view of agriculture for the ‘North’ as for the ‘South’. While the first protect their agriculture and rural environment, the latter are requested to enter international  markets complying with rules of competitiveness  and efficiency. This has had a negative impact on  food production in many countries of the ‘South’  including Mexico. We discuss this contradiction,  and then launch the idea that food security,  whether the result of public policy or of market  forces, should not be in attentive to the fact that  people seek a quality of life. This is illustrated with the case study of communities in the Sierra  Norte of Oaxaca. Here, as in many other parts of  rural Mexico, peasant families choose to grow and  consume maize of native varieties and how high  quality, even though the cost of production is  above market prices, this is due to the importance  of maize agriculture and consumption in their welfare and life quality.  Resumen:En este artículo se discute la ‘seguridad alimentaria’ desde una perspectiva de ‘calidad de vida’  lo cuál se relaciona con una visión distinta para el  desarrollo agrícola con respecto a los países del  ‘Norte’ y del ‘Sur’. Mientras que los primeros protegen sus agriculturas y su ámbito rural, para  los segundos se exige entrar al mercado internacional con estrictas reglas de competitividad y  eficiencia, lo cuál ha tenido un impacto negativo  sobre la producción de alimentos en muchos  países, incluyendo México. Además de señalar la contradicción en dicha propuesta, queremos lanzar la idea de que la seguridad alimentaria, tanto  si es producto de la política pública – o resultado  del mercado

  18. Reconocimiento de alimentos vegetales: caracterización micro-gráfica del grano de avena Reconhecimento de alimentos vegetais: caracterização micrográfica do grão de aveia

    Directory of Open Access Journals (Sweden)

    N.O. Crivaro

    2006-06-01

    Full Text Available Se estudia la estructura micrográfica del grano de seis variedades de avena con la finalidad de su caracterización, para desarrollar parámetros de identificación en alimentos elaborados con la misma y, consecuentemente, determinar su autenticidad, contribuyendo a optimizar la producción, la comercialización y el consumo del cereal y sus derivados. El diseño experimental consistió en el estudio micrográfico de los granos vestidos y desnudos efectuando un análisis morfológico mediante observación con lupa binocular y fotografía, ultraestructural utilizando microscopio electrónico de barrido, micrográfico y micrométrico, empleando el sistema de video microscopia digitalizado y software adecuado. Dada su variabilidad natural, los estudios se efectuaron durante tres temporadas consecutivas sobre muestras cosechadas de variedades procedentes de cultivos de semillas certificadas, y sobre alimentos procesados (avena arrollada y salvado de avena comerciales. Los resultados consistieron en diseños micrográficos, y en valores micrométricos de gránulos de almidón relacionados, además, en modelos matemáticos. En todos los casos se validó estadísticamente. Como parámetros micrográficos de caracterización se seleccionaron las estructuras diferenciales, que revelaron una presencia constante en el vegetal y resistieron los tratamientos tecnológicos, y las características y dimensiones del almidón.Este trabalho estuda a estrutura micrográfica do grão de seis variedades de aveia com a finalidade de sua caracterização para desenvolver parâmetros de identificação em alimentos elaborados com a mesma e, conseqüentemente, determinar sua genuinidade, contribuindo para otimizar a produção, a comercialização e o consumo do cereal e seus derivados. O experimento consistiu no estudo micrográfico dos grãos com casca e sem casca, efetuando análise morfológica mediante observação com lupa binocular e fotografia ultra

  19. FLAVONÓIS E FLAVONAS: FONTES BRASILEIRAS E FATORES QUE INFLUENCIAM A COMPOSIÇÃO EM ALIMENTOS

    Directory of Open Access Journals (Sweden)

    L. S. HUBER

    2008-12-01

    Full Text Available

    O interesse em pesquisar os flavonóides se deve a estudos que indicam efeitos benéfi cos à saúde, principalmente na prevenção de doenças degenerativas, como câncer e doenças cardiovasculares. A determinação dos flavonóides em alimentos, bem como a investigação dos fatores que influenciam a composição, são necessários para apontar as fontes e otimizar as condições de produção, processamento e estocagem, a fi m de manter ou incrementar seus teores na dieta da população, para promoção da saúde. Os chás preto e verde e a erva mate são muito ricos em quercetina, sendo os dois primeiros fontes também de miricetina e kaempferol e o último de kaempferol. As melhores fontes entre as frutas são pitanga e caju, que contém quercetina, kaempferol e miricetina; acerola, tendo quercetina e kaempferol, e taperebá e maçã com altos conteúdos de quercetina. Entre as hortaliças consumidas no Brasil, as principais fontes são cebola, couve e rúcula, com altos teores de quercetina, rúcula e couve com altos níveis de kaempferol, e salsa com grande quantidade de apigenina. Os teores de flavonóides nos alimentos são determinados geneticamente, porém, são influenciados também por fatores como estação do ano, clima, composição do solo, estádio de maturação, preparo, processamento e estocagem dos alimentos.

  20. Surtos de enfermidades transmitidas por alimentos causados por Salmonella Enteritidis Food borne disease outbreaks caused by Salmonella Enteritidis

    Directory of Open Access Journals (Sweden)

    Jacqueline T.M. Peresi

    1998-10-01

    Full Text Available OBJETIVO: São descritos surtos de salmonelose notificados no período de julho de 1993 a junho de 1997 na região Noroeste do Estado de São Paulo, Brasil, tendo em vista os vários surtos de veiculação alimentar ocasionados por Salmonella nessa região. MÉTODO: Foram obtidos 19 inquéritos epidemiológicos para análise de dados, 87 amostras de fezes e 38 amostras de alimentos, incluindo 12 de ovos para análise microbiológica. Cepas de Salmonella foram submetidas a sorotipagem, fagotipagem e teste de sensibilidade a 13 agentes antimicrobianos. RESULTADOS: Foram acometidas 906 pessoas com 295 hospitalizações. Cepas de Salmonella Enteritidis Fagotipo 4 foram isoladas de 80,5% das coproculturas, de todas amostras de alimentose de 41,7% dos ovos. Em 22 (95,7% surtos os a salmonela foi veiculada por alimentos contendo ovos crus ou semicrus. Os testes de sensibilidade a antimicrobianos revelaram sensibilidade à maioria das cepas. CONCLUSÕES: Considerando os resultados obtidos, torna-se necessária a implantação e intensificação de medidas de controle na produção e armazenamento dos ovos, além da orientação à população quanto aos riscos no consumo inadequado desse alimento.OBJECTIVE: It is to describe outbreaks of salmonellosis reported from July 1993 through June 1997 in the Northwest region of S. Paulo State, Brazil, one of the areas where several foodborne outbreaks of salmonellosis have been recently detected. METHOD: Data of 19 epidemiological investigations were analysed; 87 stool specimens and 38 food samples (including 12 of shell eggs were processed for microbiological analysis. Salmonella strains were identified by serotyping, phagetyping and antimicrobial susceptibility testing. RESULTS: There were 906 ill persons including 295 hospitalized patients. Phage type 4 (PT 4 Salmonella Enteritidis strains were isolated from 80.5% of stool samples, from all food samples and from 41.7% of eggs. Of the outbreaks, 95.7% were

  1. Food allergy: system immunologic and main food involved Alergia alimentar: sistema imunológico e principais alimentos envolvidos

    Directory of Open Access Journals (Sweden)

    Patrícia Beltrão Lessa Constant

    2008-10-01

    Full Text Available Food allergy can be defined as an adverse reaction to a food antigen mediated by fundamentally immunological mechanisms. It is a nutritional problem that has shown an increase in the last decades probably due to the population’s exposure to a higher number of available food allergens. It has become a health problem worldwide being associated to a significant negative impact on life quality. The foods most cited as those which cause food allergy are: milk, eggs, peanuts, nuts, shrimps, fish and soy bean. The main food allergens are protein-nature ones. There must be investment in research in order to reduce the damage caused by foods containing allergens. Biotechnology studies can be considered an efficient and safe alternative. The purpose of this research is to present an updated review on food allergies focusing on its action mechanism in the body, main food involved and alternatives that have been used to minimize this problem. A alergia alimentar pode ser definida como uma reação adversa a um antígeno alimentar mediada por mecanismos fundamentalmente imunológicos. É um problema nutricional que apresentou um crescimento nas ultimas décadas, provavelmente devido à maior exposição da população a um número maior de alérgenos alimentares disponíveis. Ele vem se tornando um problema de saúde em todo o mundo e está associado a um impacto negativo significativo na qualidade de vida. Os alimentos mais citados como causadores de alergias alimentares são: leite, ovos, amendoim, castanhas, camarão, peixe e soja, e os principais alérgenos alimentares identificados são de natureza protéica. É importante que haja investimento em pesquisas no sentido de reduzir os danos causados por alimentos que contém alérgenos. Estudos com a biotecnologia podem apresentar-se como uma alternativa eficiente e segura. Esta pesquisa tem como objetivo apresentar uma revisão atualizada das alergias alimentares, com foco principal no seu mecanismo de

  2. Perfil nutricional de alimentos com alegação de zero gordura trans Nutritional profile of foods with zero trans fatty acids claim

    Directory of Open Access Journals (Sweden)

    Ana Carolina Moron Gagliardi

    2009-01-01

    Full Text Available OBJETIVO: Avaliar a composição de ácidos graxos de alguns alimentos industrializados disponíveis no mercado brasileiro nos quais houve redução da quantidade de ácidos graxos trans. Verificar também se estes alimentos atendem às quantidades recomendadas de consumo de gordura saturada, após redução de gordura trans. MÉTODOS: Alimentos industrializados (margarina cremosa A e B, margarina com fitosterol, biscoito doce recheado, biscoito salgado sem recheio, batata frita e lanche com hambúrguer de fast food multinacional com alegação de 0% de gordura trans foram adquiridos em pontos comerciais e analisados em cromatógrafo gasoso. RESULTADOS: Apesar da redução nas quantidades de ácidos graxos trans, os alimentos analisados contêm grandes quantidades de gorduras saturadas principalmente o ácido palmítico. Além disso, alguns dos alimentos estudados apresentam uma razão n-3/n-6 fora do recomendado para a prevenção da aterosclerose. CONCLUSÃO: O consumo irrestrito desses alimentos tem forte potencial deletério para a saúde. O rótulo de ausência de ácidos graxos trans deve ser visto com cuidado e não significa uma liberação para o consumo irrestrito desses alimentos.OBJECTIVE: To evaluate the composition of fatty acids in some foods available in the Brazilian market in which there was a claimed reduction in the amount of trans fatty acids. Also evaluate whether these foods meet recommended amounts for saturated fat consumption, after reduction of trans fat amounts. METHODS: Industrialized food (creamy margarine A and B, plant sterol margarine, stuffed sweet biscuit, salty biscuit without stuffing, French fried potatoes and a burger lunch from a multinational chain of "fast food" all with the allegation of 0% trans fat content were purchased in commercial points and analyzed by gas chromatography. RESULTS: Despite the reduction in trans fatty acid amounts, analyzed foods contained large concentrations of saturated fats

  3. Coeficientes de digestibilidad total y de proteínas en alimentos experimentales para juveniles de Oplegnathus insignis (Kner, 1867 (Perciformes, Oplegnathidae

    Directory of Open Access Journals (Sweden)

    Avelino Muñoz

    2015-05-01

    Full Text Available Los alimentos para peces están formulados con diversos ingredientes, donde la harina de pescado es la principal fuente de proteína. Sin embargo, este insumo tiene un alto costo que lleva a la necesidad de evaluar nuevas fuentes de proteínas y probarlas en especies marinas. Oplegnathus insignis (San Pedro, Pacific beakfish es una especie omnívora en su etapa intermareal y carnívora en su etapa submareal, que ha sido cultivada de manera experimental, siendo necesario incorporar dietas formuladas. Este estudio reporta la experiencia en alimentación y nutrición, de juveniles de O. insignis alimentados con dietas formuladas con distintas fuentes de proteína. Se efectuó una experiencia con juveniles de O. insignis provenientes de un cultivo experimental. Se formularon cuatro alimentos, uno en base de harina de pescado (referencia y tres modificando la fuente de proteína del alimento de referencia, intercambiando un 30% de harina de pescado, por harina de soya, harina de moluscos y harina de quinoa. Se experimentó con 180 ind de 295,6 g y de 450 días post-eclosión, distribuidos en 12 estanques rectangulares de 1,6 m³. La alimentación fue a saciedad. Se efectuaron análisis próximales de los alimentos experimentales de las heces colectadas. Se determinó los coeficientes de digestibilidad total y proteína. El alimento con mayor contenido de proteína fue el que contenía harina de moluscos. El mayor coeficiente de digestibilidad total lo tienen los alimentos con harina de pescado (68,0% y harina de moluscos (67,1%, mientras que en los alimentos en base a harinas vegetales, la digestibilidad total para la harina de soya fue de 62,7% y para harina de quinoa de 64,1%. Estos resultados indican que es factible reemplazar un 30% de la harina de pescado por harinas de origen vegetal.

  4. Methods for predicting the energy value of pet foods Métodos para predição do valor energético de alimentos pet

    Directory of Open Access Journals (Sweden)

    Carlos Castrillo

    2009-07-01

    Full Text Available The energy value of foods as well as energy requirements of dogs and cats is currently expressed in terms of metabolizable energy (ME. The determination of ME content of foods requires experimental animals and is too expensive and time consuming to be used routinely. Consequently, different indirect methods have been proposed in order to estimate as reliably an accurately as possible the ME content of pet food. This work analyses the main approaches proposed to date to estimate the ME content of foods for cats and dogs. The former method proposed by the NRC estimates the ME content of pet foods from proximal chemical analysis using the modified Atwater factors, assuming constant apparent digestibility coefficients for each analytical fraction. Modified Atwater factors systematically underestimate the ME content of low-fibre foods whereas they overestimate those that are high in fibre. Recently, different equations have been proposed for dogs and cats based in the estimation of apparent digestibility of energy by the crude fibre content, which improve the accuracy of prediction. In any case, whatever the method of analysis used, differences in energy digestibility related with food processing and fibre digestibility are unlikely to be accounted for. A simple in vitro enzymatic method has been recently proposed based in the close relationship that exist between energy digestibility and organic matter disappearance after two consecutive enzymatic (pepsin-pancreatin incubation of food sample. Nutrient composition and energy value of pet foods can be also accurately and simultaneously predicted using near infrared reflectance spectroscopy (NIRS.O valor energético dos alimentos, bem como os requerimentos em energia para cães e gatos são expressos em termos de energia metabolizável (EM. A determinação do conteúdo de EM dos alimentos requer ensaios com animais e apresentam alto custo. Consequentemente, diferentes métodos indiretos tem sido

  5. Nível de desenvolvimento e tecnologia de distribuição de alimentos em países selecionados

    Directory of Open Access Journals (Sweden)

    Leidy Diana Souza de Oliveira

    2013-03-01

    Full Text Available Este artigo tem como objetivo comparar os sistemas de distribuição de alimentos em países com diferentes níveis de desenvolvimento. Especificamente: i identificar padrões de demanda e analisar as características do mercado de alimentos; ii verificar as relações entre a estrutura dos sistemas varejistas de alimento e padrões econômicos, sociais, culturais e prevalecentes de compra e iii identificar as estratégicas adotadas pelos varejistas. Para tanto, foi efetuada uma revisão em estudos prévios disponíveis. Os países estudados foram: renda alta (Estados Unidos e Reino Unido; renda média-alta (África do Sul e Brasil; renda média-baixa (China e Guatemala e renda baixa (Madagascar e Vietnã. Os resultados mostram a existência de importantes diferenças no desenvolvimento do varejo de alimentos entre os países analisados. Revelam, ainda, que qualidade e variedade dos produtos são fatores importantes na estratégia de varejo em países de renda alta e média-alta; nos países de renda média-baixa e baixa destaca-se o preço dos alimentos. A principal implicação é o impacto que os supermercados causam em todos os elos das cadeias agroindustriais.

  6. Alimentos funcionales: análisis general acerca de las características químico - nutricionales, desarrollo industrial y legislación alimentaria

    Directory of Open Access Journals (Sweden)

    Patricia Sedó Masís

    2001-07-01

    Full Text Available El proceso de transición socio demográfica que vive actualmente Costa Pica, coloca a este país en una situación particular. Por un lado, se presentan problemas nutricionales, tanto por deficiencia como por exceso en ciertos componentes de la dieta, lo que da como resultado una mayor incidencia de enfermedades crónico degenerativas; y, por otro, se presenta un envejecimiento acelerado de la población, siendo ésta más vulnerable al desarrollo de enfermedades crónicas y cáncer. La investigación científica que se ha llevado a cabo en las últimas décadas, ha demostrado el papel que juegan ciertos componentes químico-nutricionales en la prevención y tratamiento de muchas enfermedades. Esta situación ha provocado un cambio del simple concepto de alimento como fuente de nutrientes, a uno más integral que traduce la potencialidad que los alimentos pueden tener, no sólo de nutrir, sino también de prevenir y curar enfermedades. Este enfoque en el estudio de los alimentos se orienta hacia la exaltación de las propiedades benéficas de ciertos componentes químicos, situación reconocida desde hace muchísimos años, y en la cual se basa la ciencia de la Nutrición. Los objetivos de este trabajo son: presentar los nuevos avances en el estudio de los alimentos, como fuente de sustancias esenciales para la salud humana, así como reflexionar acerca del mercado floreciente de los alimentos "funcionales", y los retos que enfrenta en la actualidad y en el futuro todos los sectores involucrados con la producción, comercialización y regulación de estos productos alimenticios.

  7. Efeito da monensina na fermentação da proteína de algumas fontes de alimentos

    OpenAIRE

    Lana Rogério de Paula; Cunha Luciane Tavares da; Borges Arnaldo Chaer

    2000-01-01

    Este trabalho foi conduzido com o objetivo de avaliar o efeito da monensina sobre a degradação protéica do farelo de soja, farelo de trigo e fubá de milho. Utilizou-se o líquido de rúmen de um novilho fistulado recebendo 40% de ração concentrada. As incubações foram feitas anaerobicamente a 39ºC, utilizando-se 100 mg de alimentos em 14,7 mL de líquido ruminal e 0,3 mL de etanol contendo ou não monensina dissolvida (5µM de monensina como concentração final nos tubos de incubação). O farelo de ...

  8. ESTRATÉGIA DE PLANEJAMENTO DO SORTIMENTO: UM ESTUDO DE CASO DO VAREJO DE ALIMENTOS NO BRASIL

    Directory of Open Access Journals (Sweden)

    Claudimar Pereira Da Veiga

    2011-05-01

    Full Text Available Na cadeia de suprimentos é o varejo quem seleciona a ocupação dos depósitos e do espaço de prateleira. Entretanto, para sobreviver em um ambiente competitivo e estabelecer uma forte posição no mercado, os varejistas devem gerenciar de maneira eficaz suas atividades e fornecer um nível de serviço adequado ao consumidor. Neste contexto, o objetivo deste estudo é avaliar a estratégia de planejamento do sortimento com redução do mix. Trata-se de um estudo de caso no varejo de alimentos. Os resultados da nova estratégia demonstraram considerável aumento no volume de vendas e no share de mercado.

  9. FLAVONÓIS E FLAVONAS: FONTES BRASILEIRAS E FATORES QUE INFLUENCIAM A COMPOSIÇÃO EM ALIMENTOS

    OpenAIRE

    L. S. HUBER; RODRIGUEZ-AMAYA D.B.

    2008-01-01

    O interesse em pesquisar os flavonóides se deve a estudos que indicam efeitos benéfi cos à saúde, principalmente na prevenção de doenças degenerativas, como câncer e doenças cardiovasculares. A determinação dos flavonóides em alimentos, bem como a investigação dos fatores que influenciam a composição, são necessários para apontar as fontes e otimizar as condições de ...

  10. Nanotecnología y producción de alimentos: impactos económicos, sociales y ambientales

    Directory of Open Access Journals (Sweden)

    Gian Carlo Delgado

    2009-01-01

    Full Text Available La nanotecnología, dígase la capacidad de manipular la materia a escala nanométrica, se perfila, junto con la biotecnología, la electroinformática y las ciencias congnitivas, como uno de los frentes tecnológicos de vanguardia de principios del siglo XXI. Las fuertes promesas que genera y la incertidumbre que la caracteriza son ciertamente algunos de sus elementos distintivos. El presente texto revisa el contexto social-discursivo del desarrollo de la nanotecnología en el área de los alimentos, tanto en términos de sus potenciales impactos económicos y sociales, como en cuanto a sus posibles implicaciones ambientales y a la salud.

  11. Interactions between antiarrhythmic drugs and food Interacciones entre fármacos antiarrítmicos y alimentos

    Directory of Open Access Journals (Sweden)

    B. Jáuregui-Garrido

    2012-10-01

    datos disponibles acerca de las interacciones entre los fármacos antiarrítmicos y los alimentos. Métodos: El objetivo de esta revisión fue realizar una actualización de los datos de la literatura existente sobre los principales resultados con respecto a las interacciones entre alimentos y fármacos antiarrítmicos por medio de una búsqueda realizada en PubMed, que arrojó un total de 250 artículos inicialmente. Resultados: Tras la exclusión de diferentes artículos que no estaban centrados en el objetivo específico, los resultados principales se refieren a las interacciones entre los fármacos antiarrítmicos y alimentos en general, el zumo de pomelo y otros como plantas medicinales o fibra. Discusión: Los alimentos pueden afectar a la biodisponibilidad de los fármacos antiarrítmicos y en algunos casos específicos (productos lácteos, dietas ricas en proteínas, zumo de pomelo, este aspecto debe ser considerado cuidadosamente. La mejor recomendación parece ser que los pacientes supriman el zumo de pomelo en su dieta cuando están en tratamiento con estos fármacos. La fibra debería ser separada de la toma de estos medicamentos y en relación con las plantas medicinales y dado su creciente uso, la anamnesis debería incluir información sobre dicho uso y la razón del mismo, y qué tipo de plantas se utilizan, todo ello con el fin de dar las recomendaciones correspondientes.

  12. Qualidade microbiológica de alimentos de origem animal comercializados na região de Minas Gerais

    Directory of Open Access Journals (Sweden)

    Bruno Ricardo de Castro Leite Júnior

    2013-10-01

    Full Text Available Objetivou-se, neste estudo, avaliar a qualidade microbiológica de leite pasteurizado, queijo Minas Frescal (QMF e carne moída bovina. Um total de 74 amostras, coletadas nos estabelecimentos comerciais dos municípios de Barbacena, Juiz de Fora, Muriaé, Rio Pomba e Ubá, foram submetidas às análises de coliformes totais, coliformes termotolerantes, Escherichia coli e Salmonella sp. Além disso, as amostras de QMF foram submetidas às análises de estafilococos coagulase positiva (ECP e Listeria monocytogenes. Todas as amostras apresentaram contaminação por coliformes totais, e 81,6 % das amostras apresentaram valores acima do preconizado pela RDC n°12 da ANVISA para coliformes termotolerantes, além de alta incidência de E. coli. Dentre as amostras de QMF, 75% estavam em desacordo com a legislação para ECP. Todas as amostras apresentaram ausência de Salmonella sp. e L. monocytogenes. Os resultados mostraram que esses alimentos de origem animal comercializados na região de Minas Gerais não estão aptos para o consumo humano devido à baixa qualidade microbiológica. Existe, portanto, a necessidade de adoção de boas práticas de fabricação, além de sanitização eficiente para minimizar os riscos de transmissão de patógenos de origem alimentar por meio destes alimentos.

  13. Síntesis y caracterización del lactato ferroso para la fortificación de alimentos infantiles

    Directory of Open Access Journals (Sweden)

    Anabel Pacios

    2009-01-01

    Full Text Available Para prevenir y controlar la deficiencia de hierro, el MINAL, el MINSAP y la UNICEF están llevando a cabo un proyecto para la fortificación con hierro de los purés de frutas de la canasta básica. Esta suplementación hace que estos alimentos tengan un alto porcentaje de la dosis diaria de vitaminas y minerales que los niños deben ingerir. El programa de fortificación de alimentos infantiles se soporta sobre la importación de lactato ferroso. Con el objetivo de disminuir el costo de este programa y generar desarrollo tecnológico se realiza un estudio para la obtención nacional de lactato ferroso, producido por síntesis química a partir del Ácido Láctico. La síntesis del lactato ferroso se realiza en dos pasos de reacción formando el lactato de bario y, posteriormente, sustituyendo el ión bario por el ferroso. Se estudiaron dos variantes de síntesis en dependencia al orden de adición de los reactivos y dos solventes en las etapas de lavado del producto para la remoción del color. Los rendimientos obtenidos en la reacción estuvieron entre el 60 y el 77% del teórico, disminuyendo a la mitad en la purificación. Se comparó por técnicas analíticas convencionales y termogravimetría el producto obtenido con el comercial de importación y se determinó que tienen la misma naturaleza química. El balance económico preliminar estimó la posibilidad de la sustitución del lactato ferroso de importación por el de factura nacional.

  14. Brazilian legislation for functional foods and the interface with the legislation for other food and medicine classes: contradictions and omissions A legislação brasileira de alimentos funcionais e a interface com a legislação de outras classes de alimentos e medicamentos: um caso de contradições e omissões

    Directory of Open Access Journals (Sweden)

    Tatiana Feitoza Vianna da Silveira

    2009-01-01

    Full Text Available Functional foods are generally defined as foods that, due to their physiologically active substances, benefit health in addition to providing basic nourishment. As Brazilian legislation does not provide a definition for functional foods, the only possible actions is to claim that some foods have functional health proprieties. Based on a review of legislation, this paper discusses not only the lack of transparency in relation to the categories of products classified as foods and medicinal plants, but also the interactions and contradictions of functional food product legislation. Products may be classified either within the "New Food/or Ingredient category" or as "Bioactive Substances or Isolated Probiotics with Functional Properties and/ or Health Claims". Products such as garlic can also be classified into multiple food categories and as medicinal plants. Intersections in food legislation, especially with respect to functional and new food products, lead to misunderstandings and even omissions on the part of Brazilian National Sanitary Surveillance Agency (ANVISA. Moreover, health claims on food product labels can make distinction between foods and medicines difficult for consumers. In Brazil, clearer rules for the industry are necessary so that the consumer is not deceived by false cure promises.Alimentos funcionais são aqueles que, por seus componentes fisiologicamente ativos, beneficiam à saúde além da nutrição básica. A legislação Brasileira não contempla definição sobre Alimentos Funcionais, possibilitando apenas alegar que determinados alimentos possuem propriedades funcionais e/ou de saúde. Com base na revisão da legislação, apresenta-se uma discussão sobre sua ausência de clareza a respeito da categorização dos produtos que são registrados como alimentos e como medicamentos fitoterápicos; assim como interações e contradições da legislação de alimentos funcionais. Assim, um produto pode ser registrado tanto

  15. Colesterol e gorduras em alimentos brasileiros: implicações para a prevenção da aterosclerose Colesterol y grasas en alimentos brasileños: implicaciones en la prevención de la aterosclerosis Cholesterol and fats in Brazilian foods: implications for prevention of atherosclerosis

    OpenAIRE

    Carlos Scherr; Jorge Pinto Ribeiro

    2009-01-01

    FUNDAMENTO: Para realização de inquérito alimentar e prescrição de dieta, faz-se necessário consultar tabelas de composição de alimentos. Entretanto, estas são limitadas quanto à descrição do conteúdo de ácidos graxos e colesterol, e não oferecem informações sobre as diferentes formas de preparo. OBJETIVO: A partir de dados derivados de extensa análise da composição química de alimentos brasileiros, avaliamos o impacto de determinados tipos de alimentos em dietas recomendadas para prevenção d...

  16. Introdução de alimentos industrializados e de alimentos de uso tradicional na dieta de crianças de creches públicas no município de São Paulo Introduction of processed and traditional foods to the diets of children attending public daycare centers in São Paulo, Brazil

    OpenAIRE

    Maysa Helena de Aguiar Toloni; Giovana Longo-Silva; Rita Maria Monteiro Goulart; José Augusto de Aguiar Carrazedo Taddei

    2011-01-01

    OBJETIVO: Descrever e discutir a introdução de alimentos industrializados na dieta de crianças frequentadoras de berçários em creches, considerando a recomendação do Ministério da Saúde para uma alimentação saudável. MÉTODOS: Estudo transversal com 270 crianças frequentadoras de berçários de 8 creches públicas e filantrópicas do município de São Paulo. Por meio de questionário estruturado e pré-codificado, foi avaliada a introdução de alimentos a partir de 11 perguntas. Para cada alimento ana...

  17. Contribución a la recuperación y normalización de un alimento tradicional canario: chorizo de Teror. Evaluación de riesgos

    OpenAIRE

    Guerrero Méndez, Rosa María

    2007-01-01

    [ES] Se plantea este estudio sobre el chorizo rojo de Teror, debido a la falta total y absoluta de definición de este alimento tradicional. Muchos elaboradores comercializan este alimento sin un referente de calidad y seguridad alimentaria básico, existiendo la necesidad de ofertar un producto de calidad contrastada al consumidor canario que demanda alimentos tradicionales para incorporar a su dieta. Por ello, se ha estudiado el proceso de elaboración, la evolución de los parámetros químicos ...

  18. Atitudes e motivações em relação ao consumo de alimentos orgânicos em Belo Horizonte - MG Attitudes and motivations towards organic foods consumption in Belo Horizonte, MG

    OpenAIRE

    Luísa Mol Senna Andrade; Michele Corrêa Bertoldi

    2012-01-01

    O objetivo deste estudo foi caracterizar o mercado consumidor de alimentos orgânicos em Belo Horizonte-MG, incluindo o perfil socioeconômico e o comportamento dos consumidores, sua percepção e seu conhecimento sobre alimentos orgânicos, além das principais motivações e limitações em relação ao consumo desses produtos. Uma pesquisa descritiva direta e estruturada (survey) foi realizada com 400 consumidores de alimentos orgânicos, por meio da aplicação de questionários semiestruturados. A maior...

  19. Propuesta de consulta para desregulación de alimentos derivados de cultivos genéticamente mejorados, desarrollados en Costa Rica Request for consultation for deregulation of foods derived from genetically enhanced crops developed in Costa Rica

    OpenAIRE

    M-Eugenia Villalobos Hernández; Ana M Espinoza Esquivel

    2009-01-01

    Objetivo: Proponer un proceso de desregulación de alimentos derivados de cultivos genéticamente mejorados desarrollados en Costa Rica, plantea un trámite a la Consulta de desregulación de un nuevo alimento desarrollado por ingeniería genética, labor que le competerá al Ministerio de Salud principalmente. Material y Métodos: La propuesta incluye procedimientos de iniciar la Consulta, conformación del equipo de evaluadores, información que se solicita en el dossier sobre alimentos derivados de ...

  20. Análise: indicadores de pesquisa do XX Congresso Brasileiro de Ciência e Tecnologia de Alimentos Analysis: research indicators of the XX Brazilian Congress of Food Science and Technology

    OpenAIRE

    Renato João Sossela de Freitas; Rui Sérgio dos Santos Ferreira da Silva; Sônia Cachoeira Stertz; Elza Iouko Ida; Rupérsio Alvares Cançado

    2007-01-01

    Em outubro de 2006, a Regional do Paraná sediou em Curitiba o XX Congresso Brasileiro de Ciência e Tecnologia de Alimentos (XX CBCTA) com o tema Alimentos e Agroindústrias Brasileiras no Contexto Internacional. O objetivo deste Congresso foi discutir o desenvolvimento científico e tecnológico e a inovação na indústria de alimentos no cenário nacional e internacional. O programa científico foi abrangente e diversificado, com Conferências, Palestras, Mesas-Redondas, Curso de Atualização, Clínic...

  1. Fidedignidade de rótulos de alimentos comercializados no município de São Paulo, SP Fidedignidad de rótulos de alimentos comercializados en municipio de Sao Paulo, Sureste de Brasil Reliability of food labels from products marketed in the city of São Paulo, Southeastern Brazil

    OpenAIRE

    Cássia Maria Lobanco; Gabriela Milhassi Vedovato; Cristiane Bonaldi Cano; Deborah Helena Markowicz Bastos

    2009-01-01

    OBJETIVO: Avaliar a fidedignidade das informações sobre dados nutricionais declarados em rótulos de alimentos comercializados. MÉTODOS: Foram avaliados 153 alimentos industrializados habitualmente consumidos por crianças e adolescentes, comercializados no município de São Paulo (SP) entre os anos de 2001 e 2005. Os teores de nutrientes informados pelos rótulos foram confrontados com os resultados obtidos por métodos analíticos (físico-químicos) oficiais, considerando a variabilidade de 20% to...

  2. Evaluation of toxic, cytotoxic, mutagenic, and antimutagenic activities of natural and technical cashew nut shell liquids using the Allium cepa and Artemia salina bioassays.

    Science.gov (United States)

    Leite, Aracelli de Sousa; Dantas, Alisson Ferreira; Oliveira, George Laylson da Silva; Gomes Júnior, Antonio L; de Lima, Sidney Gonçalo; Citó, Antônia Maria das Graças Lopes; de Freitas, Rivelilson M; Melo-Cavalcante, Ana Amélia de C; Dantas Lopes, José Arimateia

    2015-01-01

    The cashew nut releases a substance that is known as cashew nut shell liquid (CNSL). There are both natural (iCNSL) and technical (tCNSL) cashew nut shell liquids. This study used an Artemia salina bioassay to evaluate the toxic effects of iCNSL and tCNSL cashew nut shell liquids. It also evaluated the toxicity, cytotoxicity, and mutagenicity of CNSL and its effects on the damage induced by copper sulfate (CuSO4·5H2O) on the meristems' root of Allium cepa. Effects of the damage induced by CuSO4·5H2O were evaluated before (pre-), during (co-), and after (post-) treatments. The iCNSL contained 94.5% anacardic acid, and the tCNSL contained 91.3% cardanol. The liquids were toxic to A. salina. Toxicity, cytotoxicity, and mutagenicity were observed with iCNSL compared with the negative control. Similarly, iCNSL failed to inhibit the toxicity and cytotoxicity of CuSO4·5H2O. The tCNSL was not toxic, cytotoxic, or mutagenic in any of the concentrations. However, the lowest iCNSL concentrations and all of the tCNSL concentrations had preventive, antimutagenic, and reparative effects on micronuclei and on chromosomal aberrations in the A. cepa. Therefore, protective, modulating, and reparative effects may be observed in the A. cepa, depending on the concentration and type of CNSL used. PMID:25861638

  3. Evaluation of Toxic, Cytotoxic, Mutagenic, and Antimutagenic Activities of Natural and Technical Cashew Nut Shell Liquids Using the Allium cepa and Artemia salina Bioassays

    Directory of Open Access Journals (Sweden)

    Aracelli de Sousa Leite

    2015-01-01

    Full Text Available The cashew nut releases a substance that is known as cashew nut shell liquid (CNSL. There are both natural (iCNSL and technical (tCNSL cashew nut shell liquids. This study used an Artemia salina bioassay to evaluate the toxic effects of iCNSL and tCNSL cashew nut shell liquids. It also evaluated the toxicity, cytotoxicity, and mutagenicity of CNSL and its effects on the damage induced by copper sulfate (CuSO4·5H2O on the meristems’ root of Allium cepa. Effects of the damage induced by CuSO4·5H2O were evaluated before (pre-, during (co-, and after (post- treatments. The iCNSL contained 94.5% anacardic acid, and the tCNSL contained 91.3% cardanol. The liquids were toxic to A. salina. Toxicity, cytotoxicity, and mutagenicity were observed with iCNSL compared with the negative control. Similarly, iCNSL failed to inhibit the toxicity and cytotoxicity of CuSO4·5H2O. The tCNSL was not toxic, cytotoxic, or mutagenic in any of the concentrations. However, the lowest iCNSL concentrations and all of the tCNSL concentrations had preventive, antimutagenic, and reparative effects on micronuclei and on chromosomal aberrations in the A. cepa. Therefore, protective, modulating, and reparative effects may be observed in the A. cepa, depending on the concentration and type of CNSL used.

  4. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae.

    Science.gov (United States)

    Mesarič, Tina; Gambardella, Chiara; Milivojević, Tamara; Faimali, Marco; Drobne, Damjana; Falugi, Carla; Makovec, Darko; Jemec, Anita; Sepčić, Kristina

    2015-06-01

    We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration-dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5mg/mL carbon black and 0.1mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change. PMID:25889088

  5. Short-term effects on Artemia salina of aponin and Gomphosphaeria aponina in unialgal cultures and in mixed cultures with gymnodinium breve.

    Science.gov (United States)

    Eng-Wilmot, D L; Martin, D F

    1979-08-01

    Previous investigations showed that the natural marine substance aponin, produced by the blue-gree alga Gomphosphaeria sponina, was cytolytic towards Florida's red tide organism, Gymnodinium breve. As part of a study of the aponin-alga biological interactions, the effects of unialgal (G. aponina) and mixed cultures (G. aponina + G. breve) on the viability of artemia salina were investigated. Two contrasting effects were observed in mixed cultures: survival of A. salina was promoted in low G. aponina populations, while enhanced toxicity of G. breve to A. salina occurred at higher culture populations. Unialgal G. aponina cultures exerted no adverse effects on A. salina. The apparent protective effect is thought to result from the observed change in G. breve morphology (motile to sessile); toxicity was the result of enhanced toxin release by cytolyzed G. breve cells. In dose-response studies, aponin exhibited no adverse effect on A. salina at concentrations (1 unit) that were deleterious to G. breve. However, at higher applied levels (4--6 units), mortality was substantial (greater than 70%) after 48 hr of incubation. Probit analysis yielded an apparent LD50 of 2.3 units, where 1 unit was that amount required to cytolyze 50% of the G. breve cells (2000 cells/ml) after 20 hr of incubation. PMID:113525

  6. The use of a brine shrimp (Artemia salina) bioassay to assess the water quality in Hangzhou section of Beijing-Hangzhou Grand Canal.

    Science.gov (United States)

    Lu, Yin; Xu, Xiaolu; Li, Tian; Xu, Yifei; Wu, Xu

    2012-03-01

    As physical and chemical tests alone are not sufficient enough for the assessment of potential effects on aquatic organisms, bioassays are required for the integrated evaluation of water pollution. In this study, invertebrate crustacean Artemia salina (brine shrimp) was applied as an indicator to assess the water quality of Hangzhou Section of Beijing-Hangzhou Grand Canal. The percentage mortality of brine shrimp was recorded after 24-h exposure to the Canal water. The water samples were collected from five typical sites during October 2008 and April 2009. It exhibited 11% ± 8.3%, 26.7% ± 17%, 31.7% ± 8.5%, 28.0% ± 11.7%, and 4% ± 4.3% percentage mortality for the sample from Tangxi Bridge, Yi Bridge, Gongchen Bridge, Maiyu Bridge, and Gujia Bridge in 2008, respectively. And it exhibited 5.7% ± 4.2%, 10.3% ± 8.2%, 24.3% ± 12.3%, 16.0% ± 12.3%, and 0%, percentage mortality in 2009, respectively. According to the results, a relative improvement in water quality was observed, although the results were not significantly different at the p water toxicity when alternative bioassays were unavailable. PMID:22187021

  7. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae

    Energy Technology Data Exchange (ETDEWEB)

    Mesarič, Tina, E-mail: tina.mesaric84@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Gambardella, Chiara, E-mail: chiara.gambardella@ge.ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Milivojević, Tamara, E-mail: milivojevictamara@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Faimali, Marco, E-mail: marco.faimali@ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Drobne, Damjana, E-mail: damjana.drobne@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Centre of Excellence in Nanoscience and Nanotechnology (CO Nanocentre), Ljubljana (Slovenia); Centre of Excellence in Advanced Materials and Technologies for the Future (CO NAMASTE), Ljubljana (Slovenia); Falugi, Carla, E-mail: carlafalugi@hotmail.it [Department of Earth, Environment and Life Sciences, University of Genova, Genova (Italy); Makovec, Darko, E-mail: darko.makovec@ijs.si [Jožef Stefan Institute, Jamova 39, 1000 Ljubljana (Slovenia); Jemec, Anita, E-mail: anita.jemec@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Sepčić, Kristina, E-mail: kristina.sepcic@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia)

    2015-06-15

    Highlights: • Carbon-based nanomaterials adsorb onto the body surface of A. salina larvae. • Surface adsorption results in concentration–dependent inhibition of larval swimming. • Carbon-based nanomaterials induce no significant mortality of A. salina larvae. - Abstract: We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration–dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5 mg/mL carbon black and 0.1 mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change.

  8. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae

    International Nuclear Information System (INIS)

    Highlights: • Carbon-based nanomaterials adsorb onto the body surface of A. salina larvae. • Surface adsorption results in concentration–dependent inhibition of larval swimming. • Carbon-based nanomaterials induce no significant mortality of A. salina larvae. - Abstract: We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration–dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5 mg/mL carbon black and 0.1 mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change

  9. Restaurantes self-service: segurança e qualidade sanitária dos alimentos servidos Self-service restaurants: food safety and sanitary quality

    Directory of Open Access Journals (Sweden)

    Mariana Gardin Alves

    2010-08-01

    Full Text Available OBJETIVO: Esse trabalho teve por objetivo avaliar a temperatura e a qualidade sanitária de alimentos servidos nos balcões de distribuição em restaurantes self-service no município de Taubaté (SP, com vistas à discussão da segurança alimentar. MÉTODOS: Foram coletadas quatro amostras, sendo dois alimentos quentes e dois alimentos frios de 16 restaurantes; antes da coleta mediu-se a temperatura dos alimentos expostos nos balcões de distribuição. As amostras foram analisadas quanto aos seguintes parâmetros: contagem de bactérias aeróbias mesófilas, determinação de coliformes a 35ºC e a 45ºC, contagem de Staphylococcus coagulase positiva e detecção de Salmonella. RESULTADOS: Cinquenta e seis (87,5% alimentos estavam em temperaturas inadequadas, alimentos frios expostos em temperaturas acima de 10ºC e alimentos quentes abaixo de 60ºC. Bactérias aeróbias mesófilas em contagem acima de 10(6 UFC/g foram detectadas em 11% das amostras e coliformes a 35ºC e coliformes a 45ºC foram detectadas em 76,6% e 43,7% das amostras, respectivamente. Dois alimentos, sendo um frio e um quente, provenientes de um mesmo restaurante, apresentaram contagem de Staphylococcus coagulase positivo acima de 10(4 UFC/g. Todas as amostras apresentaram ausência de Salmonella. CONCLUSÃO: A manutenção dos alimentos servidos, nos balcões de distribuição, em temperaturas abusivas e a presença de microrganismos indicadores de qualidade sanitária em número elevado comprometem a segurança e podem colocar em risco a saúde dos consumidores, em restaurantes self-service. Os instrumentos utilizados demonstraram-se como ferramentas importantes de avaliação da segurança das refeições servidas.OBJECTIVE: This work aimed to assess the temperature and sanitary quality of the foods available on the buffet table of self-service restaurants located in the city of Taubaté (SP, in order to discuss food safety. METHODS: Four samples, two of cold dishes

  10. Concentração de fluoreto em arroz, feijão e alimentos infantis industrializados Fluoride concentrations in typical Brazilian foods and in infant foods

    Directory of Open Access Journals (Sweden)

    Renato C V Casarin

    2007-08-01

    Full Text Available OBJETIVO: Determinar a concentração de fluoreto na refeição brasileira típica (arroz e feijão e em alimentos infantis industrializados e estimar suas contribuições para fluorose dental. MÉTODOS: Os alimentos foram adquiridos de supermercados das cidades de Piracicaba e Campinas, SP, Brasil. Os alimentos infantis industrializados foram comprados em 2001 e o arroz e feijão em 2003, e imediatamente analisados. Foram analisadas três marcas de arroz, três de feijão e 36 amostras de alimentos infantis divididos em cinco grupos: prontos para o consumo; mingaus; alimentos formulados; leites em pó e outros alimentos. No arroz e feijão, foram determinadas as concentrações de fluoreto nas sementes "in natura" e após cozimento com água destilada ou fluoretada (0,7 ppm. Todas as análises de fluoreto foram feitas com eletrodo específico. Considerou-se 0,07 mg/kg/dia como a dose limite de exposição a fluoreto para risco de fluorose. RESULTADOS: A concentração de fluoreto encontrada nos grãos de arroz e feijão foi baixa. Porém, a concentração aumentou 100-200 vezes após cozimento em água fluoretada e mesmo assim, foi menor que a encontrada em alguns alimentos industrializados. Uma refeição com arroz e feijão preparada com água fluoretada seria responsável por 29% da dose limite de ingestão de fluoreto em termos de fluorose aceitável; a contribuição de alguns alimentos industrializados atingiria 45%. CONCLUSÕES: A alimentação típica brasileira, mesmo preparada com água fluoretada, é mais segura em termos de risco de fluorose dental que alguns alimentos infantis industrializados.OBJECTIVE: To determine fluoride concentrations in the typical Brazilian meal (rice with beans and in processed infant foods, and to estimate their contribution towards dental fluorosis. METHODS: The foods were purchased at supermarkets in the cities of Piracicaba and Campinas, Southeastern Brazil. The processed infant foods were bought in

  11. Crecimiento y supervivencia de crías de pulpo (Octopus maya : alimentados con dietas inertes bajo condiciones de laboratorio en Yucatán, México Growth and survival of larvals of octopus (Octopus maya : fed with inert diets under conditions of laboratory in Yucatan, Mexico

    Directory of Open Access Journals (Sweden)

    Miguel Rodríguez-Serna

    2008-12-01

    Full Text Available Bajo un diseño experimental se probaron tres dietas con el objetivo de determinar el crecimiento y la supervivencia de las crías de Octopus maya (Voss y Solís 1966, utilizando dos tipos de alimento inerte (A2 = Balanceado, A3 = Surimi y comparándolo con un alimento vivo (A1 = Artemia, bajo condiciones controladas. Los resultados mostraron diferencias significativas entre el alimento vivo y el alimento inerte. Se encontró un mejor crecimiento en peso ganado en las crías de pulpo alimentadas con una dieta viva en comparación con las dietas inertes (A1 = 11.88 g, A2 = 8.9 g, A3 = 8.83 g; sin embargo, para las tres dietas se obtuvo una baja supervivencia. El análisis estadístico arrojó diferencias estadísticas (p > 0.05 entre todos los tratamientos, siendo el alimento vivo el que presentó la mayor supervivencia con un 61.3%, seguido del surimi con un 42.3% y finalmente el balanceado con un 27.6%. La alimentación de O. maya en cautiverio aún requiere de muchos esfuerzos para desarrollar un alimento balanceado adecuado desde el punto de vista nutrimental o de formulación, así como desde la parte de atracción y aceptación por los animales.Three experimental diets were probed for the growth and survival rates of young Octopus maya (Voss and Solis 1966, using two inert foods (A2 = shrimp pellets, A3 = Surimi and one alive food (A1 = Artemia, under controlled conditions. The results showed significant differences between the live food and the inert ones. Young octopus feed with artemia, reported better growth in weight gained compared with the inert diets (A1 = 11.88 g, A2 = 8.9 g, A3 = 8.83 g. All three diets obtained low survivorships, being the alive food the best one with a rate of 61.3%, followed by surimi with 42.3%, and finally the pellet food with 27.6%. Statistical analysis showed differences (p > 0.05 between all the treatments for both growth and survival results. Artificial feeding of O. maya in captivity still requires many

  12. Evaluación de la actividad enzimática y contenido de proteína en larvas de camarón blanco Litopenaeus vannamei alimentadas con diferentes dietas (Evaluation of the enzymatic activity and protein content in larvae of white shrimp Litopenaeus vannamei fed with different diets

    Directory of Open Access Journals (Sweden)

    Isiordia-Pérez E

    2007-08-01

    Full Text Available El alimento vivo para el cultivo de camarón requiere especial atención. Los alimentos comúnmente empleados en esta industria, se han seleccionado principalmente por la facilidad de su cultivo más que por sus propiedades nutricionales. El presente trabajo compara el uso de copépodos (Tisbe monozota vivos y muertos y una dieta microligada y microparticulada como alternativa alimenticia de nauplios de Artemia para larvas de camarón evaluando la actividad enzimática y contenido de proteínas de las misma. El estudio se realizó en estadios larvales de camarón blanco Litopenaeus vannamei bajo condiciones controladas de temperatura (28°C, salinidad (35‰ y fotoperiodo (12 h luz / 12h oscuridad. En ambos experimentos el mayor contenido proteico se obtuvo en larvas alimentadas con la dieta experimental y con Artemia viva. a diferencia de la actividad enzimática que fue mayor al utilizar copépodos tanto vivos como muertos. Los resultados demostraron que no hay diferencia significativa en contenido proteico y en actividad de tripsina al usar copépodos (vivos o muertos y nauplios de Artemia , y sugieren a la dieta experimental como buena fuente alternativa en los primeros estadios larvales de camarón blanco L. vannamei The live food for the shrimp culture requires special attention. The food commonly used in this industry, have been selected mainly for the feasibility of their culture rather than their nutritional properties. This present work include alive and dead copepods (Tisbe monozota and a microparticulate microbound diet as alternative live food to Artemia nauplii for shrimp larvae, evaluating their enzymatic activity and protein content. The study was made with larval stages of white shrimp Litopenaeus vannamei under control culture conditions: temperature (28°C, salinity (35% and photoperiodo (12 h light/12h dark. In both experiments the higher protein content was obtained in larvae fed with the microdiet and Artemia nauplii

  13. Alimentos geneticamente modificados: a engenharia genética no nosso prato

    OpenAIRE

    Gaspar, Pedro João Soares

    2009-01-01

    A Alimentação é um tema que envolve e interessa a todos os seres vivos. No caso dos humanos, e dada a sua racionalidade, este assunto reveste-se de particular importância, uma vez que lhe é reconhecido, de forma inequívoca, um papel determinante na sua sobrevivência, desenvolvimento, saúde e bem-estar. Na década de 60, milhões de pessoas, nomeadamente na China, Índia e Paquistão, estavam em risco de morrer de desnutrição, e foram salvos por uma combinação de herbicidas, adubos e s...

  14. Artemia hemoglobins. Increase in net synthesis of the beta-polypeptide (relative to the alpha-polypeptide) in hypoxia.

    Science.gov (United States)

    Ferry, J A; Nichols, R C; Condon, S J; Stubbs, J D; Bowen, S T

    1983-04-15

    Previous studies have shown that in the brine shrimp there are three dimeric hemoglobins with polypeptide composition alpha 2, alpha beta, beta 2. Concentrations of the alpha- and beta-polypeptides increase in hypoxia. We now report a two-dimensional electrophoretic method for assay of radiolabelled polypeptides in each hemoglobin. Net synthesis (synthesis minus degradation) of the beta-chain, relative to that of the alpha-chain, increases more than 3-fold (in male and female adults) within 3 days following a downshift in oxygen concentration from 0.2 to 0.1 mM in the culture medium. 3 days after downshift (2 days after in vivo incorporation of radiolabelled leucine), the beta-homodimer contained 10-20% of the radiolabel in the three hemoglobins although beta 2 was usually not detectable in the protein stain of an overloaded gel. The amount of radioactive leucine incorporated per unit amount of protein was more than 300-times greater in the beta 2 homodimer than in the beta-subunit of the heterodimer, suggesting that beta 2 does not dissociate rapidly during electrophoresis on the first dimension non-denaturing gel. This evidence for stable association of the two beta-monomers and the 5-8 heme-binding domains within each monomer (in vivo and during electrophoresis on non-denaturing gels) allows us to exclude one of two alternative interpretations of genetic data published previously. We present an independent line of evidence for the dimer model of the native hemoglobins (which states that each polypeptide has many heme-binding domains). PMID:6830806

  15. http://revistas.unicordoba.edu.co/revistamvz/mvz-182/v18n2a12.pdf

    Directory of Open Access Journals (Sweden)

    Rubén Valbuena V.

    2013-08-01

    Full Text Available Objetivo. Evaluar el desempeño y sobrevivencia de larvas de capaz Pimelodus grosskopfii suministrando alimento vivo (Cladóceros, Copépodos y Artemia salina. Materiales y métodos. Larvas de capaz fueron ubicadas en recipientes plásticos con un volumen útil de 3 L, a una densidad de 10 larvas L-1, fueron alimentadas cuatro veces al día, durante 15 días con nauplios de Artemia recién eclosionadas, Cladóceros de los géneros Moina y Ceriodaphnia y Copépodos calanoides. Las larvas de capaz se pesaron y se midieron al inicio y al final del experimento para estimar ganancia en peso (GP, ganancia en longitud (GL, tasa de crecimiento específico (TCE, Factor de crecimiento relativo (FCR y sobrevivencia (S Resultados. El tratamiento que presentó los mejores resultados en GP, GL y S fue el de larvas alimentadas con nauplios de Artemia (3.8 ± 0.2 mg, 8 ± 0.7 mm y 48.3% respectivamente seguido de los tratamientos donde adicionó cladóceros y copépodos Conclusiones. Los nauplios de Artemia fue el tratamiento que presentó los mejores resultados en las variables productivas evaluadas en larvas de P. grosskopfii al inicio de su alimentación exógena.

  16. Stability of cassava flour-based food bars Estabilidade de alimento em barra à base de farinha de mandioca

    Directory of Open Access Journals (Sweden)

    Erica Caroline da Silva

    2013-03-01

    durante 180 dias, com o intuito de garantir um alimento seguro e possibilitar sua entrada no mercado. As barras perderam textura dentro das embalagens após 90 dias, mas as características organolépticas permitiram aos provadores perceberem essa tendência a partir de 30 dias. As análises fisico-químicas e microbianas confirmaram que as barras permaneceram como alimento seguro durante 180 dias. Os resultados mostraram que 45 g de barras de farinha de mandioca enriquecidas com castanhas e frutas secas podem satisfazer 6% da ingestão diária de fibras, com valor calórico intermediário entre barras comuns e as do tipo energéticas. A adaptação da formulação com ingredientes locais (frutas, castanhas de diferentes regiões brasileiras poderá proporcionar a valorização deste produto tradicional como alimento rápido.

  17. Uso de aceites esenciales extraídos por medio de fluidos supercríticos para la elaboración de alimentos funcionales

    OpenAIRE

    Angélica Esquivel F.; Pedro Vargas

    2007-01-01

    El consumo de alimentos funcionales y la tendencia a productos cada vez más naturales se ha incrementado en los últimos años, dando pie a nuevas investigaciones en el campo de la obtención de aditivos que pueden generar alimentos funcionales. En esta revisión, se discutió sobre la técnica de obtención de extractos naturales conocida como extracción por medio de fluidos supercríticos, se evaluó el método de extracción, las ventajas y desventajas de este, así como las condiciones ideales de ext...

  18. Extração de zeína e sua aplicação na conservação dos alimentos

    OpenAIRE

    Índira da Silva Papalia; Patrícia Medianeira Grigoletto Londero

    2015-01-01

    As proteínas do endosperma dos grãos de milho, referente às zeínas, apresentam grau de polimerização importante para formação de filmes em alimentos, sendo útil na conservação destes. Nesta revisão, serão abordadas formas de extração destas proteínas, através da solubilidade de seus aminoácidos em solventes alcoolicos e métodos combinados dos tratamentos químicos e enzimáticos. O polímero de zeína pode substituir polímeros sintéticos empregados em embalagens para alimentos, atribuindo valor e...

  19. Implantação do HACCP na indústria de alimentos Implementation of the HACCP in the food industry

    OpenAIRE

    Veruschka Franca de Figueiredo; Pedro Luiz de Oliveira Costa Neto

    2001-01-01

    O conceito da Análise de Perigos e Pontos Críticos de Controle (APPCC) é uma abordagem sistemática para garantir a segurança do alimento. O método é baseado em vários princípios diferentes de detecção direta ou indireta de contaminação. O objetivo é controlar a segurança do alimento analisando os perigos em potencial, planejando o sistema para evitar problemas, envolvendo os operadores em tomada de decisão e registro das ocorrências. O conceito da HACCP (APPCC) deveria ser aplicado em conjunt...

  20. A certificação de alimentos orgânicos: influência na decisão de compra do consumidor ecologicamente consciente

    OpenAIRE

    Batista, Manuel José Marques

    2015-01-01

    Doutoramento em Gestão, Especialidade em Marketing Apesar de crescente, o consumo de alimentos orgânicos (AO’s) defronta ainda várias barreiras que, em parte, derivam não só do facto dos referidos alimentos terem atributos de qualidade específicos como também não serem facilmente identificáveis mediante simples observação ou mesmo a sua degustação. Daqui resulta a necessidade da implementação de sistemas de monotorização e de certificação que assinalam e atestam a qualidade dos AO’s e cujo...