WorldWideScience

Sample records for alimento vivo artemia

  1. Uso de alimento vivo como dieta inicial no treinamento alimentar de juvenis de pirarucu

    Directory of Open Access Journals (Sweden)

    Cavero Bruno Adan Sagratzki

    2003-01-01

    Full Text Available O objetivo deste trabalho foi testar a eficiência do alimento vivo como dieta inicial no treinamento alimentar de juvenis de pirarucu, Arapaima gigas. Foram usados dois tratamentos, Artemia sp. e mistura de zooplâncton nativo. O ganho de peso, a porcentagem de comedores e a sobrevivência não apresentaram diferença estatística significativa entre os tratamentos (p>0,05. A dieta inicial, à base de alimento vivo, é eficiente no treinamento alimentar de juvenis de pirarucu.

  2. Alimento vivo como alternativa en la dieta de larvas y juveniles de Pterophyllum scalare (Lichtenstein, 1823

    Directory of Open Access Journals (Sweden)

    J. Luna-Figueroa

    2010-01-01

    Full Text Available La nutrición en los estadios iniciales de los peces constituye uno de los principales problemas de cultivo, debido a que es la etapa en la que se presenta la mayor mortalidad. En el presente estudio se evaluó, como alternativa en la alimentación de larvas y juveniles de Pterophyllum scalare, el efecto de tres alimentos vivos (Moina wierzejski, Artemia franciscana y Panagrellus redivivus y un alimento comercial (Aquarian Tropical Flakes sobre la tasa específica de crecimiento (TEC y la sobrevivencia. La TEC de larvas resultó más alta con nauplios de A. franciscana (17.57 ± 0.39a% peso corporal ganado mg/ día, seguida de M. wierzejski (16.63 ± 0.41b, P. redivivus (14.25 ± 0.42c y del alimento comercial (13.20 ± 0.42d (P<0.05. En los juveniles, la TEC fue mayor con M. wierzejski (6.28 ± 0.21a% peso corporal ganado mg/día, seguida de A. franciscana (6.04 ± 0.23b, P. redivivus (4.86 ± 0.23c y del alimento comercial (4.39 ± 0.23d (P<0.05. La sobrevivencia de las larvas fue 80.00 ± 10.00a% con A. franciscana y M. wierzejski, mayor 25 y 40.62% con respecto a P. redivivus (60.00 ± 10.00b% y al alimento comercial (45.00 ± 10.00b% (P<0.05. En los juveniles, la sobrevivencia del 100% no difirió con ningún alimento. Finalmente, los nauplios de Artemia en la etapa larval y la Moina en juveniles estimularon favorablemente la TEC y la sobrevivencia de P. scalare.

  3. Substituição de alimento vivo por alimento inerte na larvicultura intensiva do tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus) = Replacement of live food for inert food on larviculture of tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus)

    OpenAIRE

    2008-01-01

    Com este trabalho objetivou-se avaliar a substituição de náuplios de Artemia salina por alimentos inertes durante a larvicultura do tambacu. Na primeira fase, com duração de 12 dias, as larvas foram alimentadas com: náuplio de Artemia salina, cyclop-eeze e ovo de Artemia salina. Na segunda fase, com duração de dez dias, foram utilizadas larvas alimentadas com náuplios de Artemia salina provenientes da primeira fase e testados os mesmos três alimentos. A qualidade da água manteve-se em condiçõ...

  4. Ensayos in vivo de crecimiento para evaluar la “calidad” de alimentos balanceados disponibles en el mercado

    OpenAIRE

    Paredes, Yela

    2005-01-01

    Ensayos in vivo de crecimiento para evaluar la “calidad” de alimentos balanceados disponibles en el mercado La “calidad” de los alimentos balanceados ha sido determinada tradicionalmente desde la perspectiva química del perfil nutricional de los niveles de proteínas, grasas, cenizas y/o fibra. Estos análisis no proveen sin embargo, información completa de la “calidad” del alimento.

  5. Substituição de alimento vivo por alimento inerte na larvicultura intensiva do tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus = Replacement of live food for inert food on larviculture of tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Danieli Cuzini Lombardi

    2008-10-01

    Full Text Available Com este trabalho objetivou-se avaliar a substituição de náuplios de Artemia salina por alimentos inertes durante a larvicultura do tambacu. Na primeira fase, com duração de 12 dias, as larvas foram alimentadas com: náuplio de Artemia salina, cyclop-eeze e ovo de Artemia salina. Na segunda fase, com duração de dez dias, foram utilizadas larvas alimentadas com náuplios de Artemia salina provenientes da primeira fase e testados os mesmos três alimentos. A qualidade da água manteve-se em condições adequadas para alarvicultura nas duas fases. As larvas da primeira fase alimentadas com náuplios de Artemia salina obtiveram os melhores resultados em crescimento, sobrevivência e desempenho produtivo. Na segunda fase, o crescimento, a sobrevivência e o desempenho produtivo das larvas alimentadas com náuplios de Artemia salina e ovo de Artemia salina foram semelhantes. Nas duas fases, o custo com alimento foi mais baixo nas larvas alimentadas com náuplios de Artemia salina. Os resultados obtidos mostram que nas duas fases de larvicultura testadas a oferta de náuplios de Artemia salina é a melhor estratégia alimentar por proporcionar boa sobrevivência, crescimento e bom desempenho produtivo, além de menor custo.The aim of this work was to evaluate the replacement of Artemia salina nauplii by inert food during larviculture of tambacu. On the first phase with duration of 12 days, the larvae were fed with one of the following foods: Artemia salina nauplii, cyclop-eeze or Artemia salina egg. On the second phase, with 10 days of duration, larvae fed with Artemia salina nauplii were utilized in the first experiment and the same food treatments were tested. Water quality was adequate forlarvae rearing in both phases. The larvae from the first phase that fed with Artemia salina nauplii presented better growth, survival rate and yield. On the second phase, the growth, survival and yield of larvae fed with Artemia salina nauplii and eggs were

  6. Substituição de alimento vivo por alimento inerte na larvicultura intensiva do tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus - DOI: 10.4025/actascianimsci.v30i4.3835 Replacement of live food for inert food on larviculture of tambacu (♀ Colossoma macropomum X ♂ Piaractus mesopotamicus - DOI: 10.4025/actascianimsci.v30i4.3835

    Directory of Open Access Journals (Sweden)

    Levy de Carvalho Gomes

    2009-03-01

    Full Text Available Com este trabalho objetivou-se avaliar a substituição de náuplios de Artemia salina por alimentos inertes durante a larvicultura do tambacu. Na primeira fase, com duração de 12 dias, as larvas foram alimentadas com: náuplio de Artemia salina, cyclop-eeze e ovo de Artemia salina. Na segunda fase, com duração de dez dias, foram utilizadas larvas alimentadas com náuplios de Artemia salina provenientes da primeira fase e testados os mesmos três alimentos. A qualidade da água manteve-se em condições adequadas para a larvicultura nas duas fases. As larvas da primeira fase alimentadas com náuplios de Artemia salina obtiveram os melhores resultados em crescimento, sobrevivência e desempenho produtivo. Na segunda fase, o crescimento, a sobrevivência e o desempenho produtivo das larvas alimentadas com náuplios de Artemia salina e ovo de Artemia salina foram semelhantes. Nas duas fases, o custo com alimento foi mais baixo nas larvas alimentadas com náuplios de Artemia salina. Os resultados obtidos mostram que nas duas fases de larvicultura testadas a oferta de náuplios de Artemia salina é a melhor estratégia alimentar por proporcionar boa sobrevivência, crescimento e bom desempenho produtivo, além de menor custo.The aim of this work was to evaluate the replacement of Artemia salina nauplii by inert food during larviculture of tambacu. On the first phase with duration of 12 days, the larvae were fed with one of the following foods: Artemia salina nauplii, cyclop-eeze or Artemia salina egg. On the second phase, with 10 days of duration, larvae fed with Artemia salina nauplii were utilized in the first experiment and the same food treatments were tested. Water quality was adequate for larvae rearing in both phases. The larvae from the first phase that fed with Artemia salina nauplii presented better growth, survival rate and yield. On the second phase, the growth, survival and yield of larvae fed with Artemia salina nauplii and eggs

  7. ALIMENTO VIVO EN LA LARVICULTURA DE PECES MARINOS: COPÉPODOS Y MESOCOSMOS

    Directory of Open Access Journals (Sweden)

    Martha Prieto

    2006-12-01

    Full Text Available El mesocosmos representa una excelente alternativa para incrementar la calidad y supervivencia de las larvas, dado que proporciona a estas, gran cantidad y variedad de presas pequeñas (nauplios de excelente perfil bromatológico en cuanto al contenido de ácidos grasos poliinsaturados y aminoácidos se refiere. Los copépodos cultivados en conjunto con diferentes especies de microalgas, rotíferos y otros microorganismos en sistemas de mesocosmos, son importantes porque ellos son una de la fuentes de alimento vivo más importantes para la acuicultura marina, habiéndose demostrado que incrementan la supervivencia y la calidad de las larvas y alevinos que los consumen

  8. DIGESTIBILIDADE IN VITRO E IN VIVO DE PROTEÍNAS DE ALIMENTOS: ESTUDO COMPARATIVO

    Directory of Open Access Journals (Sweden)

    C. V. PIRES

    2008-10-01

    Full Text Available

    O presente trabalho teve como objetivos determinar a digestibilidade in vivo, ajustar equações para a determinação da digestibilidade in vitro por meio de diferentes métodos e verificar qual método desenvolvido para a digestibilidade in vitro apresenta maior correlação com a digestibilidade in vivo. Foram utilizadas as seguintes fontes de proteína: carne de rã sem osso, carne de rã com osso, carne de rã mecanicamente separada (CMS, carne bovina, ovo em pó, caseína, trigo, milho, soja convencional, soja isenta de inibidor de tripsina Kunitz e de lipoxigenases (soja KTI-LOX-, proteína texturizada de soja (PTS e feijão. Para o cálculo da digestibilidade in vitro foram utilizados os valores de pH obtidos em 10 min (método 1 e 20 min (Método 2 após a adição da solução de enzimas e o do pH estático (método 3, o qual mede o volume de NaOH adicionado, necessário para manter em 8,0 o valor de pH da solução de proteínas após a adição da solução enzimática. No método da queda de pH, as melhores equações foram obtidas com os valores de pH obtidos após 10 min da solução de enzimas. Dessas equações, as que tiveram maiores valores de R2 foram confeccionadas sem a presença de caseína. No método do pH estático as equações que permitiram melhor correlação entre volumes de NaOH com digestibilidade foram aquelas nas quais se usavam todas as fontes de proteína e aquela em que não estava presente a caseína. O uso de técnicas in vitro para a determinação da digestibilidade protéica traz uma série de benefícios, pois requer menos tempo, é mais barato e requisita de menos mão-de-obra e espaço físico.

  9. Alimentos irradiados

    OpenAIRE

    Sendra, E.; Capellas, M.; Guamis, B.

    2001-01-01

    Not available

    La industria alimentaria y las administraciones públicas realizan grandes esfuerzos para mejorar el mantenimiento de las condiciones higiénicas y evitar la contaminación de alimentos. Pese a estos esfuerzos siguen produciéndose un gran numero de procesos patológicos relacionados con los alimentos. Las buenas prácticas higiénicas pueden reducir el nivel de contaminación, pero algunos microorganismos patógenos resulta imposible eliminarlos, especialmente de aque...

  10. Alimentos irradiados

    Directory of Open Access Journals (Sweden)

    Sendra, E.

    2001-01-01

    Full Text Available Not available

    La industria alimentaria y las administraciones públicas realizan grandes esfuerzos para mejorar el mantenimiento de las condiciones higiénicas y evitar la contaminación de alimentos. Pese a estos esfuerzos siguen produciéndose un gran numero de procesos patológicos relacionados con los alimentos. Las buenas prácticas higiénicas pueden reducir el nivel de contaminación, pero algunos microorganismos patógenos resulta imposible eliminarlos, especialmente de aquellos alimentos que se comercializan crudos y con procesado mínimo. La irradiación se presenta como un método de descontaminación posible para este grupo de alimentos, especialmente válido como método de descontaminación final. Dosis de irradiación inferiores a 10 kGy (dependiendo del alimento y condiciones son efectivas para eliminar posibles patógenos no esporulados, inactivar parásitos, tratar especias, condimentos y otros ingredientes secos, fruta fresca y productos de cuarta gama (vegetales frescos, limpios y envasados, listos para consumo. Respecto a la seguridad de los alimentos irradiados, está plenamente demostrado que no provoca la aparición de compuestos especiales y provoca una ligera reducción en el contenido de algunas vitaminas, que es equiparable a la producida por otros tratamientos tecnológicos. Se ha visto también que microorganismos que han sido sometidos a radiaciones y han sobrevivido a ellas se muestran más sensibles a las condiciones ambientales de estrés que aquellos que nunca han sido irradiados. Pese a que los organismos internacionales FAO y OMS presentan la irradiación como un método seguro, eficaz, limpio con el medio ambiente y energéticamente eficiente, los consumidores siguen estando desinformados y mostrándose reticentes a su utilización. En la actualidad se están llevando a cabo muchos sondeos, de los que se deriva que una correcta in formación al consumidor es el único método válido para conseguir la

  11. Priming the prophenoloxidase system of Artemia franciscana by heat shock proteins protects against Vibrio campbellii challenge.

    Science.gov (United States)

    Baruah, Kartik; Ranjan, Jayant; Sorgeloos, Patrick; Macrae, Thomas H; Bossier, Peter

    2011-07-01

    Like other invertebrates, the brine shrimp Artemia franciscana relies solely on innate immunity, which by definition lacks adaptive characteristics, to combat against invading pathogens. One of the innate mechanisms is melanisation of bacteria mediated by the activation of the prophenoloxidase (proPO) system. The 70 kDa heat shock proteins (Hsp70) derived from either prokaryote (Escherichia coli) or eukaryote (Artemia), well conserved and immune-dominant molecules, protect Artemia against Vibrio campbellii. However, the molecular mechanisms by which these proteins protect Artemia against Vibrio campbellii infection are unknown. Here we demonstrated that feeding gnotobiotically grown Artemia with either Artemia Hsp70 or the E. coli Hsp70 equivalent DnaK, each overproduced in E. coli, followed by V. campbellii challenge enhanced the proPO system, at both mRNA and protein activity levels. Additionally, the Artemia fed with these proteins survived well in a Vibrio challenge assay. These results indicated that Hsp70s derived from either prokaryotic or eukaryotic sources generate protective immunity in the crustacean Artemia against V. campbellii infection by priming the proPO system. This is apparently the first in vivo report on priming activity of Hsp70 in an invertebrate.

  12. Potencial toxicológico frente Artemia Salina em plantas condimentares comercializadas no município de Campina Grande-PB

    Directory of Open Access Journals (Sweden)

    Emmanuel Moreira Pereira

    2015-03-01

    Full Text Available O conhecimento do potencial toxicológico das plantas é um fator primordial para estipular o limite consumível. Objetivou-se nesse trabalho avaliar o potencial toxicológico de plantas condimentares frente Artemia salina, expostas às concentrações dos extratos das plantas erva-doce (Pimpinella anisum L., pimenta malagueta (Capsicum frutescens, endro (Anethum graveolens L. e alecrim (Rosmarinus officinalis L.. O trabalho foi desenvolvido no Laboratório de Engenharia de Alimentos - LEA pertencente ao Centro de Tecnologia e Recursos Naturais da Universidade Federal de Campina Grande-PB. A erva doce apresentou uma baixa toxicidade, atingindo uma DL50 de 428ppm do extrato. Já a pimenta malagueta exibiu um comportamento similar, atingindo o seu potencial toxicológico máximo na terceira diluição com DL50 716,1ppm. Para o endro, observou-se uma baixa taxa de mortalidade, consequentemente foi considerada não toxica, apresentando a DL50, com 2.624,5ppm. O alecrim apresentou baixos percentuais de mortalidade em náuplios de Artemia, sendo a DL50 com 3.720,6ppm, sendo considerado não toxico. No entanto necessita-se de estudos mais aprofundados para caracterizar a composição química das plantas estudadas e um teste in vivo para as que apresentaram baixa toxicidade.

  13. Produção de ciliados e nematódeos para utilização como alimento vivo para camarões na fase de berçário cultivados em meio à bioflocos

    OpenAIRE

    Loureiro, Cláudio Kinach

    2012-01-01

    Tese(doutorado) - Universidade Federal do Rio Grande, Programa de Pós–Graduação em Aqüicultura, Instituto de Oceanografia, 2012. Um Meio de Cultivo de Ciliados e Nematódeos - MCCN foi desenvolvido para produzir massivamente comunidades de flagelados, ciliados e nematódeos de forma econômica, para sua posterior utilização como alimento vivo. Após o desenvolvimento desta metodologia de produção, (Capítulo 1) foram realizados dois experimentos onde ciliados (Capítulo 2) e nematódeos (Capít...

  14. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    Energy Technology Data Exchange (ETDEWEB)

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  15. Motion control of a population of Artemias

    Directory of Open Access Journals (Sweden)

    L. Fortuna

    2010-06-01

    Full Text Available In this work, the collective behavior of Artemia Salina is studied both experimentally and theoretically. Several experiments have been designed to investigate the Artemia motion under different environment conditions. From the results of such experiments, a strategy to control the direction of motion of an Artemia population, by exploiting their sensitivity to light, has been derived and then implemented.

  16. Estudio de la posible infección de artemia con el virus del síndrome de la mancha blanca y su transmisión vertical

    OpenAIRE

    2001-01-01

    Estudio de la posible infección de Artemia con el virus del síndrome de la mancha blanca y su transmisión vertical Artemia es el principal alimento en larvicultura y reproducción de peces y crustáceos. Su producción esta limitada a unos pocos países mientras que su comercialización se presenta a escala mundial.

  17. In vitro and in vivo expression of virulence genes in Vibrio isolates belonging to the Harveyi clade in relation to their virulence towards gnotobiotic brine shrimp (Artemia franciscana).

    Science.gov (United States)

    Ruwandeepika, H A Darshanee; Defoirdt, Tom; Bhowmick, Patit Paban; Karunasagar, Indrani; Karunasagar, Iddya; Bossier, Peter

    2011-02-01

    Vibrios belonging to the Harveyi clade are pathogenic marine bacteria affecting both vertebrates and invertebrates, thereby causing a severe threat to the aquaculture industry. In this study, the expression of haemolysin, metalloprotease, serine protease, the quorum sensing master regulator LuxR and the virulence regulator ToxR in different Harveyi clade isolates was measured with reverse transcriptase real-time PCR with specific primers. There was relatively low variation in the in vitro expression levels of the quorum sensing master regulator luxR (sevenfold), whereas for the other genes, the difference in expression between the isolates showing lowest and highest expression levels was over 25-fold. Furthermore, there was a significant correlation between expression levels of toxR and luxR and between the expression levels of these regulators and the protease genes. The expression levels of luxR, toxR and haemolysin were negatively correlated with the survival of brine shrimp larvae challenged with the isolates. Finally, a non-virulent, a moderately virulent and a strongly virulent isolate were selected to study in vivo expression of the virulence genes during infection of gnotobiotic brine shrimp larvae. The in vivo gene expression study showed a clear difference in virulence gene expression between both virulent isolates and the non-virulent isolate.

  18. Estudio del etiquetado de los alimentos funcionales

    OpenAIRE

    Delgado González, Patricia

    2016-01-01

    El estudio del etiquetado de los alimentos, fundamentalmente de los alimentos funcionales, se basa en el estudio previo de éstos. Dentro de este grupo podemos encontrarnos distintos componentes como polioles, aminoácidos, ácidos grasos insaturados, fitoesteroles, vitaminas, minerales, bacterias ácido-lácticas, fibra, entre otros. Los probióticos son microorganismos vivos, bacterias acido lácticas saprófitas para nuestro organismo y que nos ayudan a mejorar ciertas funciones como las gastro...

  19. Complexity in a population of Artemia

    Energy Technology Data Exchange (ETDEWEB)

    Ali, A.A., E-mail: abduladem1@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Fortuna, L., E-mail: lfortuna@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Frasca, M., E-mail: mfrasca@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Rashid, M.T., E-mail: mofid76@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Xibilia, M.G., E-mail: mxibilia@ingegneria.unime.i [DiSIA, Faculty of Engineering, University of Messina (Italy)

    2011-04-15

    Highlights: Experiments on collective motion of populations of animals (Artemia salina). Design of low-cost experimental setup for complex systems. Control of collective motion of populations of Artemia. Models of collective motion of populations of Artemia. - Abstract: Artemia salina belongs to a genus of very primordial crustaceans, whose behavior is not widely investigated in literature. Their collective behavior is studied in this paper both experimentally and theoretically. Different experiments have been designed to control the direction of motion of an Artemia population by exploiting their sensitivity to light and to measure the response of the population to light at different wavelengths. Mathematical models have been also derived, explaining the mechanisms underlying Artemia flocking formation when a light spot is applied to the system. The results obtained allow to develop new strategies for distributed control of agents and to test them in a simple and low cost experimental setup.

  20. INVIMA – Normatividad Alimentos

    OpenAIRE

    INVIMA

    2015-01-01

    Por su carácter técnico-científico, el INVIMA procura garantizar la salud pública de la población de Colombia ejerciendo inspección y vigilancia de normas de producción, estándares de higiene y calidad de las materias primas con las que se producen los alimentos y medicamentos.

  1. Artemia cyst production in Russia

    Science.gov (United States)

    Litvinenko, Liudmila I.; Litvinenko, Aleksandr I.; Boiko, Elena G.; Kutsanov, Kirill

    2015-11-01

    In Western Siberia (Russia) there are about 100 Artemia lakes with total area over 1 600 km2. Geographically these lakes are located between 51°-56°N and 61°-82°E. In general these lakes are shallow (depth less than 1.5 m), small or medium size (0.1 to 10 km2); they are chloride; their total salinity is from 40 to 250 g/L. The harvesting of cysts per year is only in 20-40 lakes. In Russia 550 tons of dry Artemia cysts (14%-18% of the world production) were harvested annually. This includes about 350 tons in the Altai region and 200 tons in other regions. During our regular 20-year study period the cyst harvest was: 95 tons in Kurgan; 65 tons in Omsk, 20 tons in Novosibirsk, 20 tons in Tyumen. Ways of increasing cyst harvest in Russia are considered in this article. During the last 30 years the harvest of cysts in Russia has increased from 7-20 to 500-600 tons. A significant influence of dryness of the year was found on productivity in selected lakes, but taken for all the lakes together, the relationship was not significant. The optimal salinity for productivity of cysts in the lakes was determined. Analysis of productivity of the lakes and the harvesting results showed that the stocks of cysts are underutilized by approximately 1.7 times.

  2. Characterisation of cholinesterases and evaluation of the inhibitory potential of chlorpyrifos and dichlorvos to Artemia salina and Artemia parthenogenetica.

    Science.gov (United States)

    Varó, I; Navarro, J C; Amat, F; Guilhermino, L

    2002-08-01

    In this study, the acute toxicity of the organophosphorous pesticides dichlorvos and chlorpyrifos to two different species of Artemia (A. salina and A. parthenogenetica) was evaluated. In addition, the in vivo effect of these two pesticides on cholinesterase (ChE) activity of both A. salina and A. parthenogenetica was also determined. The characterisation of the ChE, using different substrates and specific inhibitors, and the normal range of activity in non-exposed individuals were previously investigated for both species. The results obtained indicate that the ChE of A. salina is different from that of A. parthenogenetica and that both enzymes cannot be classified neither as acetylcholinesterase nor as butyrylcholinesterase since they show intermediary characteristics between the two vertebrate forms. The range of normal ChE activity was 2.65+/-0.15 U/mg protein for A. salina, and 3.69+/-0.17 U/mg protein for A. parthenogenetica. Significant in vivo effects of both pesticides on Artemia ChE activity were found, at concentrations between 5.38 and 9.30 mg/l for dichlorvos and between 1.85 and 3.19 mg/l for chlorpyrifos. Both Artemia species are resistant to these pesticides and they are able to survive with more than 80% ChE inhibition. However, A. parthenogenetica is more resistant than A. salina, with about a 95% reduction in its ChE activity respect to the control for nauplii exposed to the median lethal concentrations (LC50), without lethal effects after 24 h of exposure.

  3. Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates.

    Science.gov (United States)

    Defoirdt, Tom; Crab, Roselien; Wood, Thomas K; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

    2006-09-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests.

  4. The occurrence of an exotic bisexual Artemia species, Artemia franciscana, in two coastal salterns of Shandong Province, China

    Science.gov (United States)

    Zheng, Bo; Sun, Shichun; Ma, Lin

    2004-10-01

    The alien halophilous Artemia species, Artemia franciscana, was found in Chengkou Saltern and Yangkou Saltern of Shandong Province, P.R. China. Although the indigenous parthenogenetic Artemia is detectable, the exotic species is dominant in both salterns. The cross-breeding tests between the exotic A. franciscana and 5 bisexual Artemia species were conducted. The results of hybridization and morphological observations on the exotic A. franciscana are briefly presented in this short communication.

  5. The Occurrence of an Exotic Bisexual Artemia Species, Artemia franciscana, in Two Coastal Salterns of Shandong Province, China

    Institute of Scientific and Technical Information of China (English)

    ZHENG Bo; SUN Shichun; MA Lin

    2004-01-01

    The alien halophilous Artemia species, Artemia franciscana, was found in Chengkou Saltern and Yangkou Saltern of Shandong Province, P.R. China. Although the indigenous parthenogenetic Artemia is detectable, the exotic species is dominant in both salterns. The cross-breeding tests between the exotic A. franciscana and 5 bisexual Artemia species were conducted. The results of hybridization and morphological observations on the exotic A. franciscana are briefly presented in this short communication.

  6. CORANTES ARTIFICIAIS EM ALIMENTOS

    Directory of Open Access Journals (Sweden)

    Marcelo Alexandre PRADO

    2009-07-01

    Full Text Available

    O emprego de aditivos químicos é, sem dúvida, um dos mais polêmicos avanços alcançados pela indústria de alimentos. Os corantes artificiais pertencem a uma dessas classes de aditivos alimentares e têm sido objeto de muitas críticas, já que seu uso em muitos alimentos justifica-se apenas por questões de hábitos alimentares. Ainda existem diferentes opiniões quanto à inocuidade dos diversos corantes artificiais. Visando, principalmente, o controle no uso dos corantes sintéticos, mas tendo em vista que produtos coloridos artificialmente são exportados e importados, a análise desses aditivos requer métodos eficientes e rápidos para a detecção, identificação e quantificação. A cromatografia em papel e em camada delgada, apesar de serem técnicas relativamente rápidas, apresentam dados com baixa exatidão e precisão. Já na cromatografia líquida de alta eficiência (CLAE as maiores dificuldades encontram-se nas etapas de extração, mas principalmente no alto custo do equipamento. A eletroforese capilar apresenta os mesmos problemas da CLAE, aliados ao fato de se tratar de uma técnica relativamente recente para a análise desse tipo de substância e, portanto, existem poucos estudos a cerca da determinação e quantificação. PALAVRAS-CHAVE: Corantes artificiais; análise; legislação; CLAE; EC

  7. Marine Lactobacillus pentosus H16 protects Artemia franciscana from Vibrio alginolyticus pathogenic effects.

    Science.gov (United States)

    Garcés, M E; Sequeiros, C; Olivera, N L

    2015-02-10

    Vibrio alginolyticus is an opportunistic pathogen which may affect different aquatic organisms. The aim of this study was to assess the probiotic properties and the protective mode of action of Lactobacillus pentosus H16 against V. alginolyticus 03/8525, through in vitro and in vivo studies using Artemia franciscana (hereafter Artemia). This strain showed antimicrobial activity against V. alginolyticus 03/8525 and Aeromonas salmonicida subsp. salmonicida ATCC33658 possibly related to lactobacilli organic acid production. It was able to survive at high rainbow trout bile concentrations and showed high selective adhesion to rainbow trout mucus (1.2×10(5)±8.0×10(3) cells cm(-2)). H16 outcompeted V. alginolyticus 03/8525 and A. salmonicida subsp. salmonicida ATCC33658, greatly reducing their adherence to rainbow trout mucus (64.8 and 74.1%, respectively). Moreover, H16 produced a cell-bound biosurfactant which caused an important decrease in the surface tension. H16 also protected Artemia nauplii against mortality when it was administered previous to V. alginolyticus 03/8525 inoculation. Furthermore, H16 bioencapsulated in Artemia, suggesting that it is possible to use live carriers in its administration. We conclude that the ability of L. pentosus H16 to selectively adhere to mucosal surfaces and produce cell-bound biosurfactants, displacing pathogenic strains, in addition to its antimicrobial activity, confer H16 competitive advantages against pathogens as demonstrated in in vivo challenge experiments. Thus, L. pentosus H16, a marine bacterium from the intestinal tract of hake, is an interesting probiotic for Artemia culture and also has the potential to prevent vibriosis in other aquaculture activities such as larvae culture and fish farming.

  8. The case of Artemia spp. in nanoecotoxicology.

    Science.gov (United States)

    Libralato, Giovanni

    2014-10-01

    Artemia spp. is one of the most widespread saltwater organism suitable for ecotoxicity testing, but no internationally standardised methods exist. Several endpoints can be considered with Artemia spp. including short-term (24-48 h) and long-term (14 days) mortality, cysts and nauplii hatchability, biomass productivity, biomarkers' expression/inhibition and bioaccumulation on larvae as well as organisms' reproductive ability. Recently, Artemia spp. started to be used as a reference biological model in nanoecotoxicology with both inorganic and organic engineered nanomaterials (ENMs) also in combination with traditional environmental stressors looking for potential interactive effects. Criticisms were detected about the use of Artemia spp. in relation to the hatching phase, the toxicity test design, the occasional use only of reference toxicants and the way testing solution/suspensions were prepared thus potentially compromising the reliability of nanoecotoxicological results. A full list of compulsory information that must accompany Artemia nanoecotoxicity data is provided with positive feedbacks also for other toxicity bioassays.

  9. Nutrientes minerales en alimentos industrializados

    OpenAIRE

    Hernández F., Eloisa; Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Quispe, Clara; Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Alencastre M., Ana; Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.

    2014-01-01

    Hasta el momento los alimentos industrializados que se consumen en nuestro medio aún no han sido estudiados por su contenido de nutrientes minerales. Se presenta los contenidos de fósforo, calcio, hierro, sodio, potasio, cobre y magnesio en 33 alimentos de procedencia nacional e importados. El 70% de estos alimentos son preferentemente consumidos por niños. Se ha empleado métodos oficiales de A.O.A.C.: para fósforo el método colorimétrico, los otros minerales mediante Absorción Atómica, Espec...

  10. Procesamiento de alimentos = [Food Processing

    OpenAIRE

    Orrego Alzate, Carlos Eduardo

    2003-01-01

    Este libro resume el trabajo desarrollado por el autor en las asignaturas Profundización II de la línea de profundización de alimentos y procesamiento de alimentos que se imparten en la Universidad Nacional de Colombia Sede Manizales desde 1995, dentro de los programas curriculares de pregrado de Ingeniería Química e Ingeniería Industrial y la Especialización en Ciencia y Tecnología de Alimentos. En el primer capítulo se hace una presentación, actualizada y general, de los fenómenos físico...

  11. Functional rare males in diploid parthenogenetic Artemia.

    Science.gov (United States)

    Maccari, M; Gómez, A; Hontoria, F; Amat, F

    2013-09-01

    Functional males that are produced occasionally in some asexual taxa - called 'rare males' - raise considerable evolutionary interest, as they might be involved in the origin of new parthenogenetic lineages. Diploid parthenogenetic Artemia produce rare males, which may retain the ability to mate with females of related sexual lineages. Here, we (i) describe the frequency of male progeny in populations of diploid parthenogenetic Artemia, (ii) characterize rare males morphologically, (iii) assess their reproductive role, using cross-mating experiments with sexual females of related species from Central Asia and characterize the F1 hybrid offspring viability and (iv) confirm genetically both the identity and functionality of rare males using DNA barcoding and microsatellite loci. Our result suggests that these males may have an evolutionary role through genetic exchange with related sexual species and that diploid parthenogenetic Artemia is a good model system to investigate the evolutionary transitions between sexual species and parthenogenetic strains.

  12. Comparison of the Artemia salina and Artemia fransiscana bioassays for toxicity of Indian medicinal plants

    Institute of Scientific and Technical Information of China (English)

    Thangapandi Veni; Thambusamy Pushpanathan

    2014-01-01

    Objective:To evaluate leaves extract of Azima tetracantha and Gmelina asiatica for lethality to brine shrimp larvae (Artemia salina and Artemia fransiscana). Methods: The plant materials were extracted based on polarity gradients of petroleum ether, benzene, chloroform, acetone, ethanol and methanol. The extracts were investigated for their cytotoxic potential. Results: In the brine shrimp lethality assay of all extracts, exception of acetone, ethanol and petroleum ether extracts Gmelina asiatica displayed 100%mortality at 1 000 μg/mL by Artemia salina and Artemia fransiscana. Chloroform extract was the most potent and presented the highest percentage of mortality with the lowest LC50 values by both assay too. Conclusions:The results of the present study suggest the presence of photochemical possessing cytotoxic agents.

  13. Portuguese native Artemia parthenogenetica resisting invasion by Artemia franciscana - Assessing reproductive parameters under different environmental conditions

    Science.gov (United States)

    Pinto, Pedro M.; Hontoria, Francisco; Vieira, Natividade; Bio, Ana

    2014-05-01

    There is widespread interest in the conservation of native Artemia biodiversity. In Portugal, only two known populations of native Artemia remain: one in the Rio Maior salina, the other in the Aveiro salina complex, both of the diploid Artemia parthenogenetica species. All other Portuguese hypersaline environments where Artemia can be found have been invaded by Artemia franciscana, which has eradicated the native strains. Invasiveness and resilience of, respectively, exotic and indigenous species are thought to depend on strain-specific traits and adaptation to local conditions. This work evaluates the reproductive performance of the two Portuguese native strains and the invasive species exposed to different salinities, temperatures, photoperiods and food supplies. Reproduction periods, quantity and quality of offspring varied significantly, depending on both the Artemia strain and environmental conditions. A. parthenogenetica from Rio Maior reproduced better than A. franciscana at high salinity (150) and low food supply, which may reflect an adaptation to its biotope that aids its resistance to invasion. But A. parthenogenetica form Aveiro performed much worse than its invasive competitor, under most of the conditions tested. It is unlikely that A. franciscana has not been introduced in this salina by chance alone. Other biological traits of the local A. parthenogenetica or adaptation to unstudied local factors (e.g. pollution) are probably responsible for this strain's survival. Further knowledge on specific local conditions and trait-specific tolerances to biotic and abiotic conditions are needed to understand (non-)invasion patterns and preserve the remaining native populations.

  14. Mitochondrial genome sequences of Artemia tibetiana and Artemia urmiana: assessing molecular changes for high plateau adaptation.

    Science.gov (United States)

    Zhang, Hangxiao; Luo, Qibin; Sun, Jing; Liu, Fei; Wu, Gang; Yu, Jun; Wang, Weiwei

    2013-05-01

    Brine shrimps, Artemia (Crustacea, Anostraca), inhabit hypersaline environments and have a broad geographical distribution from sea level to high plateaus. Artemia therefore possess significant genetic diversity, which gives them their outstanding adaptability. To understand this remarkable plasticity, we sequenced the mitochondrial genomes of two Artemia tibetiana isolates from the Tibetan Plateau in China and one Artemia urmiana isolate from Lake Urmia in Iran and compared them with the genome of a low-altitude Artemia, A. franciscana. We compared the ratio of the rate of nonsynonymous (Ka) and synonymous (Ks) substitutions (Ka/Ks ratio) in the mitochondrial protein-coding gene sequences and found that atp8 had the highest Ka/Ks ratios in comparisons of A. franciscana with either A. tibetiana or A. urmiana and that atp6 had the highest Ka/Ks ratio between A. tibetiana and A. urmiana. Atp6 may have experienced strong selective pressure for high-altitude adaptation because although A. tibetiana and A. urmiana are closely related they live at different altitudes. We identified two extended termination-associated sequences and three conserved sequence blocks in the D-loop region of the mitochondrial genomes. We propose that sequence variations in the D-loop region and in the subunits of the respiratory chain complexes independently or collectively contribute to the adaptation of Artemia to different altitudes.

  15. Nonhatching Decapsulated Artemia Cysts As a Replacement to Artemia Nauplii in Juvenile and Adult Zebrafish Culture.

    Science.gov (United States)

    Tye, Marc; Rider, Dana; Duffy, Elizabeth A; Seubert, Adam; Lothert, Brogen; Schimmenti, Lisa A

    2015-12-01

    Feeding Artemia nauplii as the main nutrition source for zebrafish is a common practice for many research facilities. Culturing live feed can be time-consuming and requires additional equipment to be purchased, maintained, and cleaned. Nonhatching decapsulated Artemia cysts (decaps) are a commercially available product that can be fed directly to fish. Several other ornamental fish species have been successfully cultured using decaps. Replacing Artemia nauplii with decaps could reduce the overall time and costs associated with the operation of a zebrafish facility. The objective of this study was to determine if decaps could be a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture. Wild-type zebrafish were fed one of three dietary treatments: decaps only, nauplii only, or a standard consisting of nauplii plus a commercially prepared pellet food. Survival, growth (length and weight), and embryo production were analyzed between the treatments. Fish receiving the decap diet demonstrated a significantly higher growth and embryo production when compared to the fish receiving the nauplii-only diet. When comparing the decap fish to the standard fish, no significant difference was found in mean survival, mean weight at 90 days postfertilization, or mean embryo production. It was determined that nonhatching decapsulated Artemia cysts can be used as a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture.

  16. Feeding truncated heat shock protein 70s protect Artemia franciscana against virulent Vibrio campbellii challenge.

    Science.gov (United States)

    Baruah, Kartik; Norouzitallab, Parisa; Shihao, Li; Sorgeloos, Patrick; Bossier, Peter

    2013-01-01

    The 70 kDa heat shock proteins (Hsp70s) are highly conserved in evolution, leading to striking similarities in structure and composition between eukaryotic Hsp70s and their homologs in prokaryotes. The eukaryotic Hsp70 like the DnaK (Escherichia coli equivalent Hsp70) protein, consist of three functionally distinct domains: an N-terminal 44-kDa ATPase portion, an 18-kDa peptide-binding domain and a C-terminal 10-kDa fragment. Previously, the amino acid sequence of eukaryotic (the brine shrimp Artemia franciscana) Hsp70 and DnaK proteins were shown to share a high degree of homology, particularly in the peptide-binding domain (59.6%, the putative innate immunity-activating portion) compared to the N-terminal ATPase (48.8%) and the C-terminal lid domains (19.4%). Next to this remarkable conservation, these proteins have been shown to generate protective immunity in Artemia against pathogenic Vibrio campbellii. This study, aimed to unravel the Vibrio-protective domain of Hsp70s in vivo, demonstrated that gnotobiotically cultured Artemia fed with recombinant C-terminal fragment (containing the conserved peptide binding domain) of Artemia Hsp70 or DnaK protein were well protected against subsequent Vibrio challenge. In addition, the prophenoloxidase (proPO) system, at both mRNA and protein activity levels, was also markedly induced by these truncated proteins, suggesting epitope(s) responsible for priming the proPO system and presumably other immune-related genes, consequently boosting Artemia survival upon challenge with V. campbellii, might be located within this conserved region of the peptide binding domain.

  17. Toxic Assessment of Triclosan and Triclocarban on Artemia salina.

    Science.gov (United States)

    Xu, Xiaolu; Lu, Yin; Zhang, Deyong; Wang, Yinyin; Zhou, Xianshan; Xu, Huiying; Mei, Yu

    2015-12-01

    In this study, we investigated the possible acute toxic and genotoxic effects of triclosan (TCS) and triclocarban (TCC) on Artemia salina. Genotoxicity was evaluated using single-cell gel electrophoresis and apoptotic frequency assays (Annexin V-FITC/PI assay). Acute toxicity test results showed that TCC (LC50-24 h = 17.8 µg/L) was more toxic than TCS (LC50-24 h = 171.1 µg/L). Significant increases in both genotoxic biomarkers were observed at 24 h after initial exposure, indicating that these two chemicals are potentially dangerous for this aquatic biological model. Although further studies are required, a comparison of data both in vitro and in vivo allowed us to suggest possible mechanisms of action for TCS and TCC in this sentinel organism.

  18. Factors influencing Artemia populations in Antillean salines

    NARCIS (Netherlands)

    Kristensen, Ingvar; Hulscher-Emeis, T. Marian

    1972-01-01

    In the Netherlands Antilles two extreme “forms” of Artemia salina, f. arietina and f. milhauseni, show all intermediate gradations. They hybridize constantly. When forma arietina is moved from lower concentrations into highly concentrated brine it will produce offspring that exhibit characteristics

  19. Historical Notes on Artemia salina (L.)

    NARCIS (Netherlands)

    Kuenen, D.J.

    1938-01-01

    Although an abundant literature exists on Artemia salina, there are still interesting facts in the first history of the discovery of this remarkable animal and in the first study of its habits, which seem to be now forgotten. It is generally considered that Rackett (1812) was the first to give a dra

  20. Dinucleosidasetetraphosphatase in rat liver and Artemia salina.

    Science.gov (United States)

    Vallejo, C G; Lobaton, C D; Quintanilla, M; Sillero, A; Sillero, M A

    1976-06-07

    A comparative study of an enzymatic activity present in Artemia salina and rat liver which specifically splits dinucleoside tetraphosphates is presented. All the purine and pyrimidine dinucleoside tetraphosphates tested, i.e. diadenosine, diguanosine, dixanthosine and diuridine tetraphosphates, were substrates of both enzymes with similar maximum velocities and Km values, (around 10 muM). The inhibition by nucleotides of the enzyme from the two sources is also similar. Particularly relevant is the strong inhibition caused by nucleoside tetraphosphates which have Ki values in the nanomolar range. The Artemia enzyme has a slightly lower molecular weight (17 500) than the liver enzyme (21 000) and is more resistant to acidic pH. Based on previous findings, the enzyme from Artemia salina was named diguanosinetetraphosphatase (EC 3.6.1.17) by the Enzyme Commission. The results presented in this paper show that the liver and Artemia enzymes are similar, and we propose to name this enzyme as dinucleosidetetraphosphatase or dinucleoside-tetraphosphate nucleotidehydrolase.

  1. Live and formulated diet evaluation through initial growth and survival of jundiá larvae, Rhamdia quelen Alimento vivo e formulado, crescimento inicial e sobrevivência de pós-larvas de jundiá, Rhamdia quelen

    Directory of Open Access Journals (Sweden)

    Paulo César Falanghe Carneiro

    2003-12-01

    Full Text Available Live diet (LD dependence and the lack of suitable formulated diets (FD are major constraints for the expansion of larviculture of many fish species. The low digestibility and nutritional quality of FD are factors that might explain their failure as a stand-alone starter food. To determine whether FD in combination with LD (zooplankton may efficiently increase larval growth and survival of jundiá (Rhamdia quelen, when compared to fish fed by either types of diet alone, jundiá larvae (5.57 mm; 1.41 mg were initially stocked into 12 10-L aquaria (100 larvae per aquarium. Replicate groups (n=4 were fed ad libitum one of the three diets for 20 (when fed FD or 48 days (when fed LD or the combined diets. Larvae fed FD alone presented significantly lower survival and growth rates as compared to larvae fed LD or a combination of both (co-fed. In addition, co-fed larvae grew better (170 mg in relation to those fed solely with LD (110 mg. Such better performance of combined feeding indicates that most of the required nutrients are in balance when both diet sources are included. More can be learned about fish larvae nutrition by further testing the effect of feeding combined diets, which include zooplankton, than only testing new ingredients or protein sources commonly used in the elaboration of juvenile or adult fish feeds.A larvicultura da maioria das espécies de peixes enfrenta o desafio da dependência do alimento vivo (AL e da falta de dietas formuladas (DF que atendam plenamente às necessidades das larvas. A baixa digestibilidade e a qualidade nutricional das DFs são alguns dos fatores que explicam o insucesso quando as larvas recebem apenas FD. Para avaliar o efeito da combinação da DF com o AL no crescimento e na sobrevivência de larvas de jundiá (Rhamdia quelen, comparando com o uso separado da DF ou do AL, larvas recém eclodidas (5,57 mm; 1,41 mg foram estocadas inicialmente em 12 aquários de 10 L (100 larvas por aquário. Quatro r

  2. Manual de manipuladores de alimentos

    OpenAIRE

    Montoya Campuzano, Olga Inés

    2000-01-01

    Resumen: en este manual esta referenciado en módulos, los conceptos básicos sobre las normas y hábitos; protección y conservación de alimentos; limpieza y desinfección; saneamiento básico e intoxicaciones alimentarias, que deben conocer, recordar y practicar cualquier persona que manipule alimentos, con el fin de cumplir con los requisitos higiénico sanitarios exigidos por las autoridades sanitarias competentes. EI personal Manipulador es quien en forma directa y permanente, está en contacto ...

  3. Cryptic microsporidian parasites differentially affect invasive and native Artemia spp.

    Science.gov (United States)

    Rode, Nicolas O; Lievens, Eva J P; Segard, Adeline; Flaven, Elodie; Jabbour-Zahab, Roula; Lenormand, Thomas

    2013-09-01

    We investigated the host specificity of two cryptic microsporidian species (Anostracospora rigaudi and Enterocytospora artemiae) infecting invasive (Artemia franciscana) and native (Artemia parthenogenetica) hosts in sympatry. Anostracospora rigaudi was on average four times more prevalent in the native host, whereas E. artemiae was three times more prevalent in the invasive host. Infection with An. rigaudi strongly reduced female reproduction in both host species, whereas infection with E. artemiae had weaker effects on female reproduction. We contrasted microsporidian prevalence in native A. franciscana populations (New World) and in both invaded and non-invaded Artemia populations (Old World). At a community level, microsporidian prevalence was twice as high in native compared with invasive hosts, due to the contrasting host-specificity of An. rigaudi and E. artemiae. At a higher biogeographical level, microsporidian prevalence in A. franciscana did not differ between the invaded populations and the native populations used for the introduction. Although E. artemiae was the only species found both in New and Old World populations, no evidence of its co-introduction with the invasive host was found in our experimental and phylogeographic tests. These results suggest that the success of A. franciscana invasion is probably due to a lower susceptibility to virulent microsporidian parasites rather than to decreased microsporidian prevalence compared with A. parthenogenetica or to lower microsporidian virulence in introduced areas.

  4. Uptake of metronidazole in Artemia at different developmental life stages.

    Science.gov (United States)

    Rodriguez, Loretta; Livengood, Elisa J; Miles, Richard D; Chapman, Frank A

    2011-06-01

    The purpose of this study was to examine the capacity of live brine shrimp Artemia spp. to accumulate metronidazole at different developmental life stages. Metronidazole is used in fish as an antiparasitic medication. An effective drug delivery method is to enrich the Artemia with metronidazole and offer them as live feed to the infected fish, usually ornamental species and other small fishes. Artemia cysts were hatched and then soaked in a metronidazole solution (0.05%) at instars 1-3 of larval development. Our findings indicated that Artemia were able to accumulate metronidazole at levels considered therapeutic to other animals and humans (25-100 mg/kg). However, the levels varied depending on the stage of larval development. Artemia accumulated the highest levels of metronidazole (137-143 mg/kg) when they started filter feeding (instar 2), whereas newly hatched Artemia (instar 1) contained the lowest level (85 mg/kg). Based on this study and a review of the literature, a new protocol recommended for enriching Artemia with metronidazole consists of soaking the Artemia in a 0.05% metronidazole solution for 3 h at room temperature. Because metronidazole is relatively insoluble in water, it must first be dissolved in warm water with continuous stirring.

  5. Prospects of Artemia culture in the coastal zone

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.

    The importance of the brine shrimp Artemia as live feed in shrimp hatcheries has been pointed out. The paper deals with the resource potential and status of cyst production in India. There is a need for setting up a Pilot Project for Artemia cyst...

  6. Use of the genus Artemia in ecotoxicity testing

    Energy Technology Data Exchange (ETDEWEB)

    Nunes, Bruno S. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal) and Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal)]. E-mail: bruno@ufp.pt; Carvalho, Felix D. [REQUIMTE, Departamento de Toxicologia da Faculdade de Farmacia da Universidade do Porto, Rua Anibal Cunha, 164, 4050-047 Porto (Portugal); Guilhermino, Lucia M. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal); Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal); Van Stappen, Gilbert [Laboratory of Aquaculture and Artemia Reference Centre, Ghent University, Rozier 44, B-9000 Ghent (Belgium)

    2006-11-15

    Information related to varied uses of several species of the genus Artemia (commonly known as brine shrimp), is dispersed among literature from several scientific areas, such as Ecology, Physiology, Ecotoxicology, Aquaculture and Genetics. The present paper reviews information related to Artemia that may be considered relevant for ecotoxicity testing. Integration of different areas of scientific knowledge concerning biology, life cycle and environmental needs of Artemia is of crucial importance when considering the interpretation of results drawn from tests involving this genus. Furthermore, this paper provides suggestions to overcome problems related to toxicity assessment with the use of Artemia as test organism in bioassays, under the scope of estuarine, marine and hypersaline environments. Aspects related to variability in results, adoptable toxicity end-points, culture conditions, characteristics of species and strains, influence of geographical origins over physiological features and responses to exposure to chemical agents are considered. - The physiology, reproductive processes and general use of Artemia in modern ecotoxicological testing are reviewed.

  7. Nutrient enrichment of Artemia with free methionine%蛋氨酸对卤虫营养强化

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

    Methionine is indispensable of an essential amino acid for fish growing development , Artemia nauplii is commonly used as the start feed on fish larvae stage. But Artemia in vivo amino acid imbalance, especially methionine deficiency can not meet the nutritional needs of nutrition. Methionine is of great importance to nutrient enrichment of Artemia. Methionine is a common nutritional fortifier . This paper mainly introduces the purpose, methods and results of nutrient enrichment, and discuss the impact of enrichment of Artemia with free methionine.%  蛋氨酸是鱼类生长发育不可缺少的必需氨基酸,仔稚鱼时期常常用卤虫作为仔稚鱼的开口饵料,但卤虫的体内的氨基酸不平衡,尤其是蛋氨酸缺乏难以满足仔稚鱼的营养需求,因此蛋氨酸对卤虫的营养强化有很重要的意义。蛋氨酸是常用的营养强化剂,文章综述了蛋氨酸强化的目的、方法和结果,并讨论了影响蛋氨酸营养强化的因素。

  8. 232014 Decretos – Alimentos INVIMA.

    OpenAIRE

    INVIMA

    2015-01-01

    Por su carácter técnico-científico, el INVIMA procura garantizar la salud pública de la población de Colombia ejerciendo inspección y vigilancia de normas de producción, estándares de higiene y calidad de las materias primas con las que se producen los alimentos y medicamentos.

  9. Plâncton, Artemia sp, dieta artificial e suas combinações no desenvolvimento e sobrevivência do quinguio (Carassius auratus durante a larvicultura Plankton, Artemia sp, artificial diet and their combinations on the development and survival of goldfish (Carassius auratus during larviculture phase

    Directory of Open Access Journals (Sweden)

    Eliana Maria Galdioli

    2000-05-01

    Full Text Available O objetivo deste estudo foi verificar a influência do uso de diferentes alimentos sobre o desenvolvimento de larvas de quinguio (Carassius auratus, assim como determinar o melhor manejo alimentar. O delineamento experimental utilizado foi o inteiramente casualizado com cinco tratamentos e quatro repetições. Para análise estatística utilizou-se o teste de Tukey. Utilizaram-se 20 aquários com capacidade para 10 L, sendo estocadas 20 larvas com 5,20 mm de comprimento por aquário. Os tratamentos utilizados foram: somente ração com 56,00% de proteína bruta (R; plâncton (PL; náuplios de Artemia sp (NA, ração + plâncton (R+PL e ração + náuplios de Artemia sp (R+NA, sendo seu fornecimento à vontade duas vezes ao dia. Houve mortalidade de todos os indivíduos submetidos ao tratamento R. O uso de NA e R+NA proporcionou taxas de sobrevivência superiores (p 0,05. Conclui-se que as diferentes fontes de alimento interferem no desempenho das larvas, sendo o manejo alimentar com o fornecimento de ração + náuplios de Artemia sp o mais adequado para a larvicultura do quinguioThe aim of this study was to verify the influence of different diets on the development of goldfish (Carassius auratus larvae and determine the best diet management during its larviculture phase. The experimental design was totally randomized with five treatments and four replicatess, using Tukey test for statistical analysis. Twenty 10L-aquariums were used, where twenty larvae with 5.20 mm length were stocked per aquarium. Quinguio larvae were fed daily ration of different diets: ration alone including 56.00% crude protein (R, plankton (PL, Artemia sp nauplii (AN, ration + plankton (R+PL and ration + Artemia sp nauplii (R+AN, ad libitum twice a day. Treatment R caused the death of all individuals. AN and R+AN diets provided a higher survival rate (p 0.05 was observed between the different treatments. Under the conditions of the present experiment, the results led to

  10. Comparative effects and metabolism of two microcystins and nodularin in the brine shrimp Artemia salina.

    Science.gov (United States)

    Beattie, Kenneth A; Ressler, Judith; Wiegand, Claudia; Krause, Eberhard; Codd, Geoffrey A; Steinberg, Christian E W; Pflugmacher, Stephan

    2003-02-12

    The toxicity and metabolism of the cyanobacterial toxins microcystin-LR (MCLR), Dhb-microcystin-HtyR and nodularin were investigated in the cysts, nauplii and adults of the brine shrimp Artemia salina. The presence of the phase II detoxication system glutathione S-transferase (sGST) in these stages was shown using different substrates. Exposure of adult A. salina to the toxins led to an elevation of GST activity in vivo. All three toxins were conjugated to glutathione via GST, which has been shown as an initial step of microcystin and nodularin detoxication.

  11. Comparative study on fatty acid metabolism of early stages of two crustacean species: Artemia sp. metanauplii and Grapsus adscensionis zoeae, as live prey for marine animals.

    Science.gov (United States)

    Reis, Diana B; Acosta, Nieves G; Almansa, Eduardo; Navarro, Juan C; Tocher, Douglas R; Andrade, José P; Sykes, António V; Rodríguez, Covadonga

    2017-02-01

    The present study compared the lipid composition and in vivo capability of Artemia sp. metanauplii (the main live prey used in aquaculture) and Grapsus adscensionis zoeae (as a wild zooplankton model) to metabolise unsaturated fatty acids. The two species were incubated in vivo with 0.3μM of individual [1-(14)C]fatty acids (FA) including 18:1n-9, 18:2n-6, 18:3n-3, 20:4n-6 (ARA), 20:5n-3 (EPA) and 22:6n-3 (DHA) bound to bovine serum albumin (BSA). Compared to metanauplii, zoeae contained twice the content of polar lipids (PL) and eight-fold the content of long-chain polyunsaturated fatty acids (LC-PUFA). Artemia sp. metanauplii showed increased short chain fatty acid de novo synthesis from beta-oxidation of [1-(14)C]LC-PUFA, preferentially DHA. Of the LC-PUFA, DHA showed the highest esterification rate into Artemia sp. triacylglycerols. In contrast, in Grapsus zoeae [1-(14)C]DHA displayed the highest transformation rate into longer chain-length FAs and was preferentially esterified into PL. EPA and ARA, tended to be more easily incorporated and/or retained than DHA in Artemia sp. Moreover, both EPA and ARA were preferentially esterified into Artemia PL, which theoretically would favour their bioavailability to the larvae. In addition to the inherent better nutritional value of Grapsus zoeae due to their intrinsic lipid composition, the changes taking place after the lipid incorporation, point at two distinct models of lipid metabolism that indicate zoeae as a more suitable prey than Artemia sp. for the feeding of marine animals.

  12. Embryonic diapause in two species of brine shrimp: Artemia monica and Artemia franciscana

    Energy Technology Data Exchange (ETDEWEB)

    Drinkwater, L.E.

    1986-01-01

    The brine shrimp, Artemia, has the capacity to produce encysted embryos which are resistant to severe environmental conditions. Upon release from the ovisac, these embryos, or cysts, do not hatch, but remain in a state of developmental arrest imposed by some unknown endogenous mechanism. However, once the proper abiotic signal is received, the embryo is free to resume development. Regulation of this embryonic diapause in two related species of brine shrimp, Artemia franciscana and Artemia monica, is studied. The abiotic cues which terminate diapause and the possibility of a regulatory mechanism involving depressed intracellular pH (pH/sub i/) are investigated. /sup 31/P-NMR studies show that pH/sub i/ of diapause cysts of both species is alkaline, greater than or equal to 7.9, essentially the same as that of activated cysts. A franciscana, which inhabits an unpredictable environment, is activated by several cues: low temperature, dehydration, and elevated levels of CO/sub 2/. A. monica, found in a fairly stable body of water with regular seasonal changes in temperature, breaks diapause only upon exposure to low temperature. Induction of anoxybiosis in diapause and activated cysts is studied using /sup 31/P-NMR to reveal that diapause cysts acidify rapidly in response to anoxia; pH/sub i/ falls to about 7.2 in 30 minutes, much like activated cysts, indicating the presence of a fairly active metabolism. The effects of salinity on cyst activation, hatching, water content, and carbohydrate metabolism are examined.

  13. Larvicidal activity of some marine macrophytes against Artemia salina

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    and Microdictyon pseudohapteron, seagrasses (Halophila ovalis and Syringodium isoetifolium and lichens (Umbilicaria arpina) were tested for larvicidal activity using Artemia salina nauplii. The LC50 values for the PE-fraction of M. pseudohapteron and A. muscoides...

  14. Strong environmental tolerance of Artemia under very high pressure

    Science.gov (United States)

    Minami, K.; Ono, F.; Mori, Y.; Takarabe, K.; Saigusa, M.; Matsushima, Y.; Saini, N. L.; Yamashita, M.

    2010-03-01

    It was shown by the present authors group that a tardigrade in its tun-state can survive after exposed to 7.5 GPa for 13 hours. We have extended this experiment to other tiny animals searching for lives under extreme conditions of high hydrostatic pressure. Artemia, a kind of planktons, in its dried egg-state have strong environmental tolerance. Dozens of Artemia eggs were sealed in a small Teflon capsule together with a liquid pressure medium, and exposed to the high hydrostatic pressure of 7.5 GPa. After the pressure was released, they were soaked in seawater to observe hatching rate. It was proved that 80-90% of the Artemia eggs were alive and hatched into Nauplii after exposed to the maximum pressure of 7.5 GPa for up to 48 hours. Comparing with Tardigrades, Artemia are four-times stronger against high pressure.

  15. VIDA ÚTIL DE LOS ALIMENTOS

    Directory of Open Access Journals (Sweden)

    María Luisa Carrillo Inungaray

    2013-02-01

    Full Text Available En un mundo de consumismo, en el que la duración de las cosas puede haber pasado a un segundo plano, conocer el tiempo que durarán los alimentos ha cobrado gran importancia. Esto puede explicarse por el interés de los consumidores por el cuidado de su salud, lo que los lleva a tomar precauciones para minimizar riesgos de contraer enfermedades por el consumo de alimentos contaminados, o de alimentos procesados. La elaboración de alimentos con procesamiento mínimo requiere de un conocimiento de las complejas reacciones que se llevan a cabo en el alimento, ya que si la combinación de factores de conservación que se aplican en el alimento no son en la cantidad y la intensidad adecuadas, puede ocurrir una mayor velocidad de deterioro de los mismos. La información que aquí se presenta, pretende servir de apoyo al personal de la industria alimentaria, a estudiantes y profesores del área de los alimentos, que requieran de información básica acerca de cómo lograr la estabilidad de los alimentos, así como los factores que participan en su descomposición. Los conceptos que se presentan permitirán comprender los factores relacionados con la descomposición de los alimentos y la influencia en su estabilidad. Asimismo, se mostrará cómo aplicar e interpretar pruebas para prolongar la vida útil de los alimentos, lo que contribuirá a la mejora de la calidad y a la consecuente disminución del riesgo de adquirir enfermedades transmitidas por ellos.

  16. Toxicity effect of silver nanoparticles in brine shrimp Artemia.

    Science.gov (United States)

    Arulvasu, Chinnasamy; Jennifer, Samou Michael; Prabhu, Durai; Chandhirasekar, Devakumar

    2014-01-01

    The present study revealed the toxic effect of silver nanoparticles (AgNPs) in Artemia nauplii and evaluated the mortality rate, hatching percentage, and genotoxic effect in Artemia nauplii/cysts. The AgNPs were commercially purchased and characterized using field emission scanning electron microscope with energy dispersive X-ray spectroscopy. Nanoparticles were spherical in nature and with size range of 30-40 nm. Artemia cysts were collected from salt pan, processed, and hatched in sea water. Artemia nauplii (II instar) were treated using silver nanoparticles of various nanomolar concentrations and LC50 value (10 nM) and mortality rate (24 and 48 hours) was evaluated. Hatching percentage of decapsulated cysts treated with AgNPs was examined. Aggregation of AgNPs in the gut region of nauplii was studied using phase contrast microscope and apoptotic cells in nauplii stained with acridine orange were observed using fluorescence microscope. DNA damage of single cell of nauplii was determined by comet assay. This study showed that as the concentration of AgNPs increased, the mortality rate, aggregation in gut region, apoptotic cells, and DNA damage increased in nauplii, whereas the percentage of hatching in Artemia cysts decreased. Thus this study revealed that the nanomolar concentrations of AgNPs have toxic effect on both Artemia nauplii and cysts.

  17. The swimming mechanics of Artemia Salina

    Science.gov (United States)

    Ruiz-Angulo, A.; Ramos-Musalem, A. K.; Zenit, R.

    2013-11-01

    An experimental study to analyze the swimming strategy of a small crustacean (Artemia Salina) was conducted. This animal has a series of eleven pairs of paddle-like appendices in its thorax. These legs move in metachronal-wave fashion to achieve locomotion. To quantify the swimming performance, both high speed video recordings of the legs motion and time-resolved PIV measurements of the induced propulsive jet were conducted. Experiments were conducted for both tethered and freely swimming specimens. We found that despite their small size, the propulsion is achieved by an inertial mechanism. An analysis of the efficiency of the leg wave-like motion is presented and discussed. A brief discussion on the mixing capability of the induced flow is also presented.

  18. Specific anion effects in Artemia salina.

    Science.gov (United States)

    Lo Nostro, Pierandrea; Ninham, Barry W; Carretti, Emiliano; Dei, Luigi; Baglioni, Piero

    2015-09-01

    The specific anion effect on the vitality of Artemia salina was investigated by measuring the Lethal Time LT50 of the crustaceans in the presence of different sodium salts solutions at room temperature and at the same ionic strength as natural seawater. Fluoride, thiocyanate and perchlorate are the most toxic agents, while chloride, bromide and sulfate are well tolerated. The rates of oxygen consumption of brine shrimps were recorded in mixed NaCl+NaF or NaCl+NaSCN solutions as a function of time. The results are discussed in terms of the Hofmeister series, and suggest that, besides the biochemical processes that involve F(-), SCN(-) and ClO4(-), the different physico-chemical properties of the strong kosmotropic and chaotropic anions may contribute in determining their strong toxicity for A. salina.

  19. De flores, brotes y palmitos: alimentos olvidados

    OpenAIRE

    2008-01-01

    Muchos de los alimentos que aprovecharon nuestros antepasados fueron relegados a alimentos subexplotados por los procesos de conquista o por la desaparición de sus hábitats naturales. Este trabajo exploró las razones de este cambio y el potencial nutricional, agronómico y comercial de un grupo de estos alimentos: las hortalizas subexplotadas. Se realizó a partir de fuentes documentales y entrevistas a personas, generalmente adultos mayores, de diferentes partes del país durante el 2003 y el 2...

  20. Roles and potentials of Artemia in coastal saltworks

    OpenAIRE

    Sorgeloos, P; Tackaert, W.

    1991-01-01

    The recent developments in aquaculture production of fish and shrimp have resulted in increased demands for Artemia cysts and biomass as valuable sources of life food. Solar salt works are suitable biotopes for the integrated exploitation of salt, Artemia and eventually fish or shrimp. Artemia may be present as a natural resource in local saltworks; however in some situations characteristics of the endemic strain might justify the introduction of another Artemia species to increase productivity.

  1. Artemia biodiversity in Asia with the focus on the phylogeography of the introduced American species Artemia franciscana Kellogg, 1906.

    Science.gov (United States)

    Eimanifar, Amin; Van Stappen, Gilbert; Marden, Brad; Wink, Michael

    2014-10-01

    Asia harbors a diverse group of sexual and asexual Artemia species, including the invasive Artemia franciscana, which is native to the Americas. The phylogeny of Asian Artemia species and the phylogeography of the introduced A. franciscana from 81 sampling localities in Eurasia, Africa and America were elucidated using mitochondrial (COI) and nuclear DNA (ITS1) sequences. According to a COI phylogeny, 6 distinctive genetic groups were recognized, with a complex phylogeographic structure among Asian Artemia. A haplotype complex which includes parthenogenetic lineages is distributed in 39 inland geographical localities in Asia, illustrating a wide distribution with a narrow genetic structure on this continent. The invasive A. franciscana was discovered in 31 geographical localities along the southern and eastern coastal regions of Asia. Three sexual species (A. sinica, A. tibetiana and A. urmiana) have a restricted distribution in certain geographical localities in Asia. In contrast to COI phylogeny reconstruction, ITS1 sequences showed inconsistency with the COI tree, indicating incomplete lineage sorting which provided the low genetic divergence in the Asian clade. Asian A. franciscana showed higher haplotype diversity as compared to the source population from the Great Salt Lake (USA), which could be attributed to multiple introductions by mass dispersal in Asia via human activities. The invasive success of A. franciscana in Asia could lead to a long-term biodiversity disturbance of the autochthonous Artemia species on the continent.

  2. Brine shrimp bioassay: importance of correct taxonomic identification of Artemia (Anostraca) species.

    Science.gov (United States)

    Ruebhart, David R; Cock, Ian E; Shaw, Glen R

    2008-08-01

    Despite the common use of the brine shrimp bioassay in toxicology, there is confusion in the literature regarding citation of the correct taxonomic identity of the Artemia species used. The genus Artemia, once thought to be represented by a single species Artemia salina, is now known to be composed of several bisexual species as well as parthenogenetic populations. Artemia franciscana is the best studied of the Artemia species and is considered to represent the vast majority of studies in which Artemia is used as an experimental test organism. We found that in studies referring to the use of A. salina, the zoogeography of the cyst harvest site indicated that the species used was actually A. franciscana. Those performing bioassays with Artemia need to exercise diligence in assigning correct species identification, as the identity of the test organism is an important parameter in assuring the validity of the results of the assay.

  3. Masculinización del cíclido nativo Tenhuayaca, Petenia splendida (Günther, 1862, usando nauplios de Artemia como vehículo del esteroide 17-α metiltestosterona Mazculinization of the native cichlid Tenhuayaca, Petenia splendida (Günther, 1862, using Artemia nauplii as vehicle of the steroid 17-α methyltestosterone

    Directory of Open Access Journals (Sweden)

    Juan Manuel Vidal-López

    2009-12-01

    Full Text Available El uso de esteroides para producir poblaciones monosexo en cíclidos, ha sido ampliamente utilizado con el objetivo de evitar el proceso de reproducción y sobrepoblación de los estanques de cultivo, por medio de su aplicación a través del alimento balanceado. Sin embargo, cíclidos como la tenhuayaca, la cual tiene un alto potencial acuícola en el sureste de México y Centroamérica, durante su fase larvaria no aceptan el alimento balanceado, por lo que el uso de Artemia como vehículo para la administración de esteroides sintéticos ha sido propuesto recientemente. En el presente estudio se evaluó la masculinización de crías de Petenia splendida mediante la utilización de nauplios de Artemia como vehículo del esteroide 17-α metiltestosterona (MT, para lo cual se utilizaron larvas de primera alimentación a las cuales se les suministraron nauplios de Artemia como vehículo de la MT durante 5, 10, 20, 28, 45 y 60 días de alimentación, respectivamente y un tratamiento sin MT. Se determinó que los mayores porcentajes de masculinización y supervivencia, (96% de machos, 85% respectivamente se presentaron cuando se alimentaron las larvas con nauplios por 60 días. En el tratamiento control solamente se obtuvo un 56% de machos con una supervivencia de 83%, por lo cual concluimos que el uso de presas vivas como vehículo de la MT es adecuado para la producción de crías de P. splendida.At world-wide level the use of steroids to obtain all-male population in cichlids, has been widely used with the objective to avoid the reproduction process and to canalize the energy of the food in weight gain. In this sense, the application of steroids has been commonly through the artificial diets. Nevertheless, for some cichlid such as tenhuayaca or bay snook Petenia splendida, which is considered an appropriate species for aquaculture in the Southeastern of Mexico and Central America, the use of artificial diets during the larval period is not

  4. Field culture of American strain of Artemia in India

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Pilot scale culture of Artemia was carried out in a 0.22 ha condenser unit of salt pans. Pond was fertilized with inorganic salts. The nauplii of San Francisco Bay, USA strain were inoculated. Within a period of 5 months a production of 20.6 kg dry...

  5. Acute toxicity of organic solvents on Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Barahona-Gomariz, M.V.; Sanz-Barrera, F.; Sanchez-Fortun, S. (Complutense Univ. of Madrid (Spain))

    1994-05-01

    Organic solvents can make their way into the environment as industrial wastes and components of pesticide formulation. In laboratory bioassays, the use of organic formulations. In laboratory bioassays, the use of organic solvents is often unavoidable, since many pesticides and organic pollutants have low water solubility and must be dissolved in organic solvents prior to addition into experimental systems. In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species are of recent interest as test models due to the need for developing nonmammalian test systems. Toxic effects of organic solvents have been tested with a few aquatic species, but information on the comparative toxicity of solvents towards Artemia salina is not available. Artemia salina have, within recent years, gained popularity as test organisms for short-term toxicity testing. Because Artemia salina exhibit rapid development and growth within 48 hr after hatch, their potential as a model organism for toxicology screening has been considered. To do this, synchronous populations of Artemia salina at different development intervals must be available.

  6. Los alimentos en la medicina tradicional china

    OpenAIRE

    Lorite Ayán, Nuria

    2016-01-01

    En la medicina china, el uso correcto de los alimentos es esencial para preservar la salud y se considera la forma de actuación ante un desequilibrio de salud. Esta idea esta¿ bien arraigada en dicha cultura. Las motivaciones para emprender este estudio han sido el desconocimiento en Occidente de las ideas de la medicina china en relación a la forma de abordar las propiedades de los alimentos y la posibilidad de establecer una organización sistemática adaptada en cierta medida a los conceptos...

  7. Origin and genetic diversity of diploid parthenogenetic Artemia in Eurasia.

    Science.gov (United States)

    Maccari, Marta; Amat, Francisco; Gómez, Africa

    2013-01-01

    There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia). Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca) are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages.

  8. Origin and Genetic Diversity of Diploid Parthenogenetic Artemia in Eurasia

    Science.gov (United States)

    Maccari, Marta; Amat, Francisco; Gómez, Africa

    2013-01-01

    There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia). Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca) are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages. PMID:24376692

  9. Origin and genetic diversity of diploid parthenogenetic Artemia in Eurasia.

    Directory of Open Access Journals (Sweden)

    Marta Maccari

    Full Text Available There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia. Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages.

  10. The brine shrimp artemia: adapted to critical life conditions.

    Science.gov (United States)

    Gajardo, Gonzalo M; Beardmore, John A

    2012-01-01

    The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological) to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry-out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst) capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to "perceive" forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity) when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity) that are able to maintain the population under suitable conditions. At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism). The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress response of

  11. Impact of brine acidification on hatchability, survival and reproduction of Artemia parthenogenetica and Artemia franciscana in salt ponds, Bohai Bay, China

    Science.gov (United States)

    Sui, Liying; Deng, Yuangao; Wang, Jing; Sorgeloos, Patrick; Van Stappen, Gilbert

    2014-01-01

    We studied the effect of pH (pH 5, 6, 7 and 8) on the hatching percentage, survival and reproduction of Artemia strains in Bohai Bay salt ponds. Strains included parthenogenetic Artemia from Bohai Bay (BHB), Artemia franciscana from San Francisco Bay, and A. franciscana artificially produced in salt ponds in Vietnam. The latter was included as a potential inoculum for biological management of salt ponds. The hatching percentage of cysts after 24 h and the survival rate of the tested Artemia strains were significantly reduced when exposed to a culture medium at pH 5 for 18 d ( PArtemia to 48 h acid exposure varied with developmental stage, increasing in the following order: juvenile, nauplii, pre-adult, with maximum tolerance in adults. All strains of Artemia tested could not reproduce at pH 5. At pH levels from pH 6-8, a higher pH generally resulted in a shorter brood interval and enhanced ovoviviparity. Hence, we suggest that brine acidification has a negative impact on Artemia populations in the Bohai Bay saltworks. Inoculation of Artemia with either local parthenogenetic Artemia or exotic A. franciscana should be feasible at pH 7-8.

  12. Higiene de los alimentos (Keeping Food Safe)

    Centers for Disease Control (CDC) Podcasts

    2009-05-27

    Este podcast de Kidtastics de los CDC habla de lo que pueden hacer los niños y sus padres para conservar los alimentos en buen estado y evitar enfermedades.  Created: 5/27/2009 by National Center for Zoonotic, Vector-Borne, and Enteric Diseases (NCZVED).   Date Released: 5/27/2009.

  13. Binding of white spot syndrome virus to Artemia sp. cell membranes.

    Science.gov (United States)

    Feng, Shuying; Li, Guangda; Feng, Wenpo; Huang, Jie

    2013-10-01

    Using differential velocity centrifugation, cell membranes of Artemia sp. were prepared, and their binding to white spot syndrome virus (WSSV) was analyzed in vitro. The results indicated that WSSV can specifically bind to Artemia cell membranes, and that WSSV receptor very likely existed in this membrane, which suggested that Artemia sp. may be a reservoir of WSSV. This study investigated the specific WSSV binding site by performing competitive inhibition experiments using shrimp gill cell membranes to bind WSSV to Artemia cell membranes. The results showed that shrimp gill cell membranes had a distinct inhibition effect on the specific binding of Artemia cell membranes to WSSV. Thus, potentially similar WSSV receptors or binding sites existed on Artemia sp. cell membranes and shrimp gill cell membranes. Taken together, these findings may provide experimental basis for the development of an effective approach to controlling WSSV, and theoretical basis for the study of WSSV receptors.

  14. Assessment of the role of brine shrimp Artemia in white spot syndrome virus (WSSV) transmission.

    Science.gov (United States)

    Zhang, Jia-Song; Dong, Shuang-Lin; Dong, Yun-Wei; Tian, Xiang-Li; Cao, Yi-Cheng; Li, Zuo-Jia; Yan, Dong-Chun

    2010-01-01

    Challenge tests with Artemia four different development stages (nauplii, metanauplii, pseudoadults and adults) to white spot syndrome virus was carried out by immersion challenge and virus-phytoplankton adhesion route in order to asses the possibility of Artemia acting as a vector of WSSV to penaeid shrimp Litopenaeus vannamei postlarvae. The WSSV succeeded in infecting four stages Artemia, and nested-PCR detection for WSSV revealed positive results to virus-phytoplankton adhesion route. No mass mortalities were observed in penaeid shrimp postlarvae fed with WSSV-positive Artemia which exposed to WSSV by virus-phytoplankton adhesion route, whereas WSSV DNA detected in penaeid shrimp postlarvae by nested-PCR. By contrary, no WSSV-positive was detected in any animal fed with WSSV-negative Artemia. These results indicated that Artemia could serve as a vector in WSSV transmission.

  15. Alimentos balanceados para perros en Costa Rica

    Directory of Open Access Journals (Sweden)

    Ruth Vargas

    2001-01-01

    Full Text Available Diagnóstico de la comercialización de alimentos balanceados para perros en Costa Rica. Para ampliar los reportes oficiales de la comercialización de alimentos para perros se creó una base de datos que incluyó cantidad, costo, empaque y formulación durante el período 1998 a agosto del 2000. De 1995 a 1998 y de 1996 a 1999 la producción nacional incrementó un 90,4% y la importación un 42,56% respectivamente, ocupando los alimentos nacionales un 72% del tonelaje y un 70% del valor en dólares americanos. No fue posible determinar cuál es el empaque más comercializado, pero si que los alimentos extrusados son los que ocupan el primer lugar y que los alimentos recomendados para cachorros y adultos son los que más se comercializan. La ausencia de datos en las declaraciones sugiere la necesidad de incrementar el control en las mismas en caso de requerirse un estudio de mercado, ya que contrariamente a esta situación el mayor número de garantías inscritas corresponden separadamente para las fases de cachorros y adultos. Merece también atención que las garantías indican mayores porcentajes de proteína cruda que los recomendados por la AAFCO y que al menos 36 fórmulas son recomendadas para estados sanitarios específicos (p.e. para perros con problemas de alergias, cálculos renales, pérdidas de pelo, etc. sin que oficialmente se encuentre registrada ninguna fórmula medicada

  16. On a parthenogenetic population of Artemia (Crustacea, Branchiopoda) from Algeria (El-Bahira, Sétif)

    OpenAIRE

    Mounia Amarouayache; Naim Belakri

    2015-01-01

    The brine shrimp Artemia is a small crustacean of hypersaline lakes which is commonly used in larviculture. The parthenogenetic population of Artemia from El-Bahira Lake (10 ha area), situated in the High Plateaus of Northeastern Algeria (1034 m alt), has been characterized and surveyed during two hydroperiods of 2009 and 2013. Contrary to other known parthenogenetic populations, which develop in hot seasons and reproduce by ovoviviparity, Artemia from El-Bahira was found to develop only i...

  17. The swimming behavior of Artemia (Anostraca): new experimental and observational data.

    Science.gov (United States)

    Anufriieva, Elena V; Shadrin, Nickolai V

    2014-12-01

    Artemia (Anostraca) is among the most primitive and ancient groups of crustaceans. Artemia spp. play a dominant role in the ecosystems of hypersaline waters, and often they are the only animals in these extreme biotopes. Most ethological studies on Artemia have been conducted on nauplii and metanauplii. We made ethological observations on Artemia under laboratory conditions and in the natural waters of Crimea, where we studied growth and ontogenetic changes of swimming behavior. Growth occurred during the first 50 days up to a size of 9.5-10.5mm, after which time the size did not increase (some females lived up to 6.5 months). A strong positive relation was found between maximal speed and individual length, which varied between 0.4 and 10.5mm; it may be approximated by the power equation: Vmax=1.205·K(0.820), where Vmax is the maximal speed of Artemia (in mms(-1)) of the length K (in mm). There is no similar relation between average speed and length of Artemia. The average speed of adults was 40-60% lower in environments with microalgae compared to media without food. The duration of the "riding position" for mating pairs of Artemia urmiana in our experiments varied from 10 to 27 days. In lakes we observed different Artemia aggregations varying in size and form. We conclude that the swimming behavior of Artemia is quite complex and diverse, and develops during ontogeny.

  18. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  19. Involvement of cyclin K posttranscriptional regulation in the formation of Artemia diapause cysts.

    Directory of Open Access Journals (Sweden)

    Yang Zhao

    Full Text Available BACKGROUND: Artemia eggs tend to develop ovoviviparously to yield nauplius larvae in good rearing conditions; while under adverse situations, they tend to develop oviparously and encysted diapause embryos are formed instead. However, the intrinsic mechanisms regulating this process are not well understood. PRINCIPAL FINDING: This study has characterized the function of cyclin K, a regulatory subunit of the positive transcription elongation factor b (P-TEFb in the two different developmental pathways of Artemia. In the diapause-destined embryo, Western blots showed that the cyclin K protein was down-regulated as the embryo entered dormancy and reverted to relatively high levels of expression once development resumed, consistent with the fluctuations in phosphorylation of position 2 serines (Ser2 in the C-terminal domain (CTD of the largest subunit (Rpb1 of RNA polymerase II (RNAP II. Interestingly, the cyclin K transcript levels remained constant during this process. In vitro translation data indicated that the template activity of cyclin K mRNA stored in the postdiapause cyst was repressed. In addition, in vivo knockdown of cyclin K in developing embryos by RNA interference eliminated phosphorylation of the CTD Ser2 of RNAP II and induced apoptosis by inhibiting the extracellular signal-regulated kinase (ERK survival signaling pathway. CONCLUSIONS/SIGNIFICANCE: Taken together, these findings reveal a role for cyclin K in regulating RNAP II activity during diapause embryo development, which involves the post-transcriptional regulation of cyclin K. In addition, a further role was identified for cyclin K in regulating the control of cell survival during embryogenesis through ERK signaling pathways.

  20. Why join groups? Lessons from parasite-manipulated Artemia.

    Science.gov (United States)

    Rode, Nicolas O; Lievens, Eva J P; Flaven, Elodie; Segard, Adeline; Jabbour-Zahab, Roula; Sanchez, Marta I; Lenormand, Thomas

    2013-04-01

    Grouping behaviours (e.g. schooling, shoaling and swarming) are commonly explicated through adaptive hypotheses such as protection against predation, access to mates or improved foraging. However, the hypothesis that aggregation can result from manipulation by parasites to increase their transmission has never been demonstrated. We investigated this hypothesis using natural populations of two crustacean hosts (Artemia franciscana and Artemia parthenogenetica) infected with one cestode and two microsporidian parasites. We found that swarming propensity increased in cestode-infected hosts and that red colour intensity was higher in swarming compared with non-swarming infected hosts. These effects likely result in increased cestode transmission to its final avian host. Furthermore, we found that microsporidian-infected hosts had both increased swarming propensity and surfacing behaviour. Finally, we demonstrated using experimental infections that these concurrent manipulations result in increased spore transmission to new hosts. Hence, this study suggests that parasites can play a prominent role in host grouping behaviours.

  1. Bioencapsulation of metronidazole in adult brine shrimp (Artemia sp.).

    Science.gov (United States)

    Allender, Matthew C; Kastura, Mike; George, Robert; Bulman, Frank; Yarbrough, Jason; Cox, Sherry

    2011-06-01

    A description of bioencapsulation of metronidazole in adult brine shrimp (Artemia) for 2.5 g/L, 5 g/L, and 10 g/L treatment baths is presented. Metronidazole was detected in adult brine shrimp tissue after enrichment periods of 15 min, 30 min, 1 hr, 2 hr, 4 hr, 8 hr, 12 hr, and 24 hr. The assays were performed using high performance liquid chromatography. There was a positive relationship in both dose and time. When evaluating percent uptake, all three baths demonstrated a similar pattern. All three bath concentrations had a high initial concentration that fell at 30 min and slowly began to increase through the end of the study. Survival of shrimp was not affected by bath concentration but decreased over time in all treatment baths comparatively. It can be concluded that metronidazole can be successfully bioencapsulated in adult Artemia.

  2. The brine shrimp Artemia: adapted to critical life conditions

    Directory of Open Access Journals (Sweden)

    Gonzalo M Gajardo

    2012-06-01

    Full Text Available The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to perceive forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity that are able to maintain the population under suitable conditions.At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism. The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress

  3. Molecular phylogenetics and asexuality in the brine shrimp Artemia.

    Science.gov (United States)

    Baxevanis, Athanasios D; Kappas, Ilias; Abatzopoulos, Theodore J

    2006-09-01

    Explaining cases of long-term persistence of parthenogenesis has proven an arduous task for evolutionary biologists. Interpreting sexual-asexual interactions though has recently advanced owing to methodological design, increased taxon sampling and choice of model organisms. We inferred the phylogeny of Artemia, a halophilic branchiopod genus of sexual and parthenogenetic forms with cosmopolitan distribution, marked geographic patterns and ecological partitioning. Joint analysis of newly derived ITS1 sequences and 16S RFLP markers from global isolates indicates significant interspecific divergence as well as pronounced diversity for parthenogens, matching that of sexual ancestors. Maximum parsimony, maximum likelihood, and Bayesian methods were largely congruent in reconstructing the phylogeny of the genus. Given the current sampling, at least four independent origins of parthenogenesis are deduced. Molecular clock calibrations based on biogeographic landmarks indicate that the lineage leading to A. persimilis diverged from the common ancestor of all Artemia species between 80 and 90 MYA at the time of separation of Africa from South America, whereas parthenogenesis first appeared at least 3 MYA. Common mitochondrial DNA haplotypes delineate A. urmiana and A. tibetiana as possible maternal parents of several clonal lineages. A novel topological placement of A. franciscana as a sister clade to all Asian Artemia and parthenogenetic forms is proposed and also supported by ITS1 length and other existing data.

  4. The influence of different rotifer and Artemia enrichment diets on growth, survival and pigmentation in turbot (Scophthalmus maximus L.) larvae

    DEFF Research Database (Denmark)

    Støttrup, Josianne; Attramadal, Y.

    1992-01-01

    , approximately seven days after hatching, the larvae were fed newly-hatched Artemia salina nauplii (AT-1; Brazil strain). From day 10, enriched Great Salt Lake Artemia nauplii were introduced. Each set of seven tansk was further subdivided and the larvae fed Artemia nauplii enriched with one of four enrichment...

  5. Comparison live adult Artemia and squid meat on the growth of Penaeid shrimp Metapenaeus dobsoni (Miers)

    Digital Repository Service at National Institute of Oceanography (India)

    Nair, S.R.S.; Achuthankutty, C.T.; Royan, J.P.

    An experiment lasting 14 weeks was conducted to compare the efficiency of live adult Artemia with fresh squid meat on growth of penaeid shrimp Metapenaeus dobsoni. The shrimps were found actively feeding on live Artemia and grew 84% more than those...

  6. [Composition of fat acids in three Mexican populations of Artemia franciscana from epicontinental waters].

    Science.gov (United States)

    Malpica Sánchez, Aída; Castro Barrera, Thalía; Sandoval Trujillo, Horacio; Castro Mejía, Jorge; De Lara Andrade, Ramón; Castro Mejía, Germán

    2004-03-01

    In this paper is presented the percentage of fatty acids composition of three Artemia franciscana Mexican populations of epicontinentals waters; two are from natural environments (Coahuila and San Luis Potosf) and one (Texcoco) is a culture fed with Spirulina. Determination of fatty acids composition in each population, was performed by extraction of total lipid by the soxhlet method and the fatty acids methyl esters were determined by gas chromatography. The results show that Artemia of Texcoco contains the six fatty acids recommended for the culture of fish and crustaceans (16:0; 16:1; 18:1; 18:2w6; 18:3w3 and 20:5w3); Artemia from San Luis Potosi showed the poorest content in these acids and Artemia from Coahuila, although it showed a wide profile, it lacks the linolenic acid. When comparing results among the three populations with ecological data that have been published, it can be pointed out that the environment is decisive for this crustacean; Artemia from Texcoco fed with Spirulina showed the largest variety of fatty acids; the other two populations are wild, and lives in different habitats, Artemia of Coahuila is found in waters that are rich in sulfates and Artemia of San Luis Potosf lives in evaporation saltern ponds, built with stone blocks and therefore with scarce phytoplankton growth. Both Artemia populations showed deficiencies in essential fatty acids, mainly the last one.

  7. Characterization of polymorphic microsatellite markers in the brine shrimp Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Green, Andy J.; Figuerola, Jordi;

    2009-01-01

    The brine shrimp Artemia is a complex genus containing sexual species and parthenogenetic lineages. Artemia franciscana is native to America and its cysts (diapausing eggs) are used worldwide as a food source in aquaculture. As a consequence, this anostracan has become an invasive species in many...

  8. Variedad y apariencia de los alimentos modifican la conducta alimentaria

    Directory of Open Access Journals (Sweden)

    Alma Gabriela Martínez

    2009-01-01

    Full Text Available Animales y humanos consumen más alimento si son expuestos a dietas tipo buffet, en relación con el consumo registrado en dietas monótonas o con un solo tipo de alimento. El objetivo de este trabajo fue evaluar la conducta de consumo de un grupo de sujetos expuestos a tres variedades de un mismo alimento (forma, color o sabor, después de haber sido expuestos sólo a una variedad. Los resultados mostraron que los sujetos consumen más alimento cuando éste es presentado en tres diferentes variedades de color y sabor, que cuando sólo se presenta un tipo de alimento. Estos resultados confirman que la variedad y apariencia de los alimentos representan señales que estimulan el incremento de las respuestas de ingesta.

  9. EFECTO DEL ENRIQUECIMIENTO DE Artemia FRANCISCANA CON DIFERENTES PROPORCIONES DE ω-3 DHA/EPA SOBRE EL CRECIMIENTO DE JUVENILES DE PEZ BLANCO Menidia estor.

    OpenAIRE

    Hernández Téllez, Ana Rosa

    2012-01-01

    La inclusión de los ácidos grasos ω-3 DHA y EPA en el alimento, es un factor importante para lograr mejor supervivencia y crecimiento en la mayoría de los peces cultivados. Dentro del desarrollo tecnológico para el cultivo del pez blanco de Pátzcuaro Menidia estor, se desconoce el requerimiento de ácidos grasos ω-3 DHA/EPA, y el efecto que éstos tienen en el crecimiento y supervivencia de juveniles en cautiverio. En esta especie como en otras, el alimento vivo (nauplio de Artem...

  10. The small heat shock protein p26 aids development of encysting Artemia embryos, prevents spontaneous diapause termination and protects against stress.

    Science.gov (United States)

    King, Allison M; MacRae, Thomas H

    2012-01-01

    Artemia franciscana embryos enter diapause as encysted gastrulae, a physiological state of metabolic dormancy and enhanced stress resistance. The objective of this study was to use RNAi to investigate the function of p26, an abundant, diapause-specific small heat shock protein, in the development and behavior of encysted Artemia embryos (cysts). RNAi methodology was developed where injection of Artemia females with dsRNA specifically eliminated p26 from cysts. p26 mRNA and protein knock down were, respectively, confirmed by RT-PCR and immuno-probing of western blots. ArHsp21 and ArHsp22, diapause-related small heat shock proteins in Artemia cysts sharing a conserved α-crystallin domain with p26, were unaffected by injection of females with dsRNA for p26, demonstrating the specificity of protein knock down. Elimination of p26 delayed cyst release from females demonstrating that this molecular chaperone influences the development of diapause-destined embryos. Although development was slowed the metabolic activities of cysts either containing or lacking p26 were similar. p26 inhibited diapause termination after prolonged incubation of cysts in sea water perhaps by a direct effect on termination or indirectly because p26 is necessary for the preservation of diapause maintenance. Cyst diapause was however, terminated by desiccation and freezing, a procedure leading to high mortality within cyst populations lacking p26 and indicating the protein is required for stress tolerance. Cysts lacking p26 were also less resistant to heat shock. This is the first in vivo study to show that knock down of a small heat shock protein slows the development of diapause-destined embryos, suggesting a role for p26 in the developmental process. The same small heat shock protein prevents spontaneous termination of diapause and provides stress protection to encysted embryos.

  11. The small heat shock protein p26 aids development of encysting Artemia embryos, prevents spontaneous diapause termination and protects against stress.

    Directory of Open Access Journals (Sweden)

    Allison M King

    Full Text Available Artemia franciscana embryos enter diapause as encysted gastrulae, a physiological state of metabolic dormancy and enhanced stress resistance. The objective of this study was to use RNAi to investigate the function of p26, an abundant, diapause-specific small heat shock protein, in the development and behavior of encysted Artemia embryos (cysts. RNAi methodology was developed where injection of Artemia females with dsRNA specifically eliminated p26 from cysts. p26 mRNA and protein knock down were, respectively, confirmed by RT-PCR and immuno-probing of western blots. ArHsp21 and ArHsp22, diapause-related small heat shock proteins in Artemia cysts sharing a conserved α-crystallin domain with p26, were unaffected by injection of females with dsRNA for p26, demonstrating the specificity of protein knock down. Elimination of p26 delayed cyst release from females demonstrating that this molecular chaperone influences the development of diapause-destined embryos. Although development was slowed the metabolic activities of cysts either containing or lacking p26 were similar. p26 inhibited diapause termination after prolonged incubation of cysts in sea water perhaps by a direct effect on termination or indirectly because p26 is necessary for the preservation of diapause maintenance. Cyst diapause was however, terminated by desiccation and freezing, a procedure leading to high mortality within cyst populations lacking p26 and indicating the protein is required for stress tolerance. Cysts lacking p26 were also less resistant to heat shock. This is the first in vivo study to show that knock down of a small heat shock protein slows the development of diapause-destined embryos, suggesting a role for p26 in the developmental process. The same small heat shock protein prevents spontaneous termination of diapause and provides stress protection to encysted embryos.

  12. Group 1 LEA proteins contribute to the desiccation and freeze tolerance of Artemia franciscana embryos during diapause.

    Science.gov (United States)

    Toxopeus, Jantina; Warner, Alden H; MacRae, Thomas H

    2014-11-01

    Water loss either by desiccation or freezing causes multiple forms of cellular damage. The encysted embryos (cysts) of the crustacean Artemia franciscana have several molecular mechanisms to enable anhydrobiosis-life without water-during diapause. To better understand how cysts survive reduced hydration, group 1 late embryogenesis abundant (LEA) proteins, hydrophilic unstructured proteins that accumulate in the stress-tolerant cysts of A. franciscana, were knocked down using RNA interference (RNAi). Embryos lacking group 1 LEA proteins showed significantly lower survival than control embryos after desiccation and freezing, or freezing alone, demonstrating a role for group 1 LEA proteins in A. franciscana tolerance of low water conditions. In contrast, regardless of group 1 LEA protein presence, cysts responded similarly to hydrogen peroxide (H2O2) exposure, indicating little to no function for these proteins in diapause termination. This is the first in vivo study of group 1 LEA proteins in an animal and it contributes to the fundamental understanding of these proteins. Knowing how LEA proteins protect A. franciscana cysts from desiccation and freezing may have applied significance in aquaculture, where Artemia is an important feed source, and in the cryopreservation of cells for therapeutic applications.

  13. Effect of Artemia franciscana on the removal of nickel by bioaccumulation.

    Science.gov (United States)

    Devi, S Sujatha; Sethu, M; Priya, P Gomathi

    2014-01-01

    The present study evaluates the feasibility of using Artemia franciscana in reducing the Ni concentration of synthetic wastewater by the process of bioaccumulation. Metallothionein protein plays a key role in the uptake of nickel by Artemia. Artemia (Brine shrimp) was exposed to an initial nickel concentration of 40 mg/L. Gradual decrease of nickel was observed from 40 mg/L to 5 mg/L with a removal efficiency of 87.5%. The number of organisms were varied to determine the number for the maximum removal efficiency. Metallothionein protein in Artemia was estimated by the silver saturation method. The physical parameters such as pH were maintained in an alkaline condition of 9-10, temperature was maintained at room temperature and salinity at 30-35‰. These were found to be the optimal conditions for the survival and reduction of nickel by Artemia.

  14. Characterization of polymorphic microsatellite markers in the brine shrimp Artemia (Branchiopoda, Anostraca).

    Science.gov (United States)

    Muñoz, J; Green, A J; Figuerola, J; Amat, F; Rico, C

    2009-03-01

    The brine shrimp Artemia is a complex genus containing sexual species and parthenogenetic lineages. Artemia franciscana is native to America and its cysts (diapausing eggs) are used worldwide as a food source in aquaculture. As a consequence, this anostracan has become an invasive species in many hypersaline aquatic ecosystems of other continents. Parthenogenetic Artemia lineages occur only in the Old World. Ten and five microsatellite markers were developed to characterize two populations for A. franciscana and two populations for diploid parthenogenetic Artemia, respectively. For A. franciscana the number of alleles ranged from 11 to 58 per locus, while for parthenogens the number of alleles ranged from three to 10. The levels of heterozygosity in A. franciscana and in parthenogens ranged from 0.115 to 0.976 and from 0.000 to 0.971, respectively. These microsatellite loci showed a high population assignment power, which will be useful for future studies of population genetics and invasive processes in Artemia.

  15. Alimentos industrializados congelados gama III y IV

    OpenAIRE

    2012-01-01

    El presente estudio tiene como objetivo, indagar sobre el consumo, el grado de información y contenido de sodio, grasas saturadas y colesterol de los principales alimentos congelados Gama III y V consumidos por los encuestados. A partir de esto, se realiza una encuesta de frecuencia de consumo y preguntas varias a 250 personas de entre 30 a 60 años, que concurren a cuatro supermercados de la ciudad de Mar del Plata, para determinar el conocimiento por parte de los encuestados e...

  16. Growth and survival of Hippocampus erectus (Perry, 1810 juveniles fed on Artemia with different HUFA levels

    Directory of Open Access Journals (Sweden)

    Nicolás Vite-Garcia

    2014-03-01

    Full Text Available Survival during first months after birth is one of the bottlenecks for consolidating the seahorse farming industry. In this work, Artemia metanauplii enriched with two highly unsaturated fatty acids (HUFA rich commercial emulsions with different docosahexaenoic acid (DHA levels (63% and 14% of total lipids, a vegetable oil with no DHA, and non-enriched Artemia as control, were used to feed 5-day-old juvenile Hippocampus erectus for 60 days. Enriched Artemia had similar levels of DHA (13% and 9%, despite great differences of DHA in the emulsions, with traces of DHA in non-enriched and vegetable oil enriched Artemia. More than 20% of DHA was found in 24 h starved juveniles fed both DHA-enriched treatments, similar to values in newly born juveniles, but those fed vegetable oil enriched Artemia or non-enriched Artemia had 5% of DHA. Total lipid and protein levels were similar in juveniles from the four treatments. The n-3/n-6 ratio was almost four-fold higher in seahorses fed DHA-enriched treatments compared to juveniles fed the non-enriched treatments. Survival of seahorses only partially reflected the DHA levels: it was lower in the vegetable oil treatment, similar in the seahorses fed Artemia with higher DHA and in the control treatment, and higher in seahorses fed the HUFA-enriched Artemia with lower DHA levels, although growth was similar in the two DHA-enriched Artemia treatments. Juvenile H. erectus seahorses perform better when they have at least 20% of DHA in their tissues, and these levels can be attained with no more than 14% of DHA in emulsions, eliminating the need for more expensive emulsions with higher DHA levels.

  17. Comparación biométrica del lóbulo frontal en poblaciones americanas de Artemia (Anostraca, Artemiidae Biometric comparision of the frontal knob in american populations of Artemia (Anostraca, Artemiidae

    Directory of Open Access Journals (Sweden)

    PATRICIO R DE LOS RIOS

    2000-03-01

    Full Text Available Se compararon el diámetro del lóbulo frontal y su relación con la longitud corporal, en poblaciones de Artemia franciscana (Chile y Estados Unidos, A. persimilis (Argentina y Artemia sp. (Chile, cultivadas en laboratorio bajo condiciones controladas. Se encontraron diferencias significativas en ambos parámetros entre las poblaciones de A. franciscana y Artemia sp., de Salina El Convento (Chile y entre A. persimilis y Artemia sp. de Torres del Paine (Chile. Se discuten en el presente trabajo los factores geográficos, ecológicos y genéticos que determinaron la especiación de Artemia en Chile y Argentina, y como ésta se manifiesta en distintos patrones morfométricosThe frontal knob diameter and its relationship with the total body lenght among populations of Artemia franciscana (Chile and U.S.A, A. persimilis (Argentina, and Artemia sp. (Chile, were asessed. All populations were cultured under laboratory conditions. Significant differences in both parameters between A. franciscana and Artemia sp. from Salina el Convento (Chile, and between A. persimilis and Artemia sp. from Amarga Lagoon (Chile were recorded.Geographical, ecological and genetic aspects which affected the speciation of Artemia populations in Chile and Argentina, and their expression in morphometric characters are discussed

  18. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  19. Automixis in Artemia: solving a century-old controversy.

    Science.gov (United States)

    Nougué, O; Rode, N O; Jabbour-Zahab, R; Ségard, A; Chevin, L-M; Haag, C R; Lenormand, T

    2015-12-01

    Parthenogenesis (reproduction through unfertilized eggs) encompasses a variety of reproduction modes with (automixis) or without (apomixis) meiosis. Different modes of automixis have very different genetic and evolutionary consequences but can be particularly difficult to tease apart. In this study, we propose a new method to discriminate different types of automixis from population-level genetic data. We apply this method to diploid Artemia parthenogenetica, a crustacean whose reproductive mode remains controversial despite a century of intensive cytogenetic observations. We focus on A. parthenogenetica from two western Mediterranean populations. We show that they are diploid and that markers remain heterozygous in cultures maintained up to ~36 generations in the laboratory. Moreover, parallel patterns of population-wide heterozygosity levels between the two natural populations strongly support the conclusion that diploid A. parthenogenetica reproduce by automictic parthenogenesis with central fusion and low, but nonzero recombination. This settles a century-old controversy on Artemia, and, more generally, suggests that many automictic organisms harbour steep within-chromosome gradients of heterozygosity due to a transition from clonal transmission in centromere-proximal regions to a form of inbreeding similar to self-fertilization in centromere-distal regions. Such systems therefore offer a new avenue for contrasting the genomic consequences of asexuality and inbreeding.

  20. Embryogenesis, hatching and larval development of Artemia during orbital spaceflight

    Science.gov (United States)

    Spooner, B. S.; Debell, L.; Armbrust, L.; Guikema, J. A.; Metcalf, J.; Paulsen, A.

    1994-01-01

    Developmental biology studies, using gastrula-arrested cysts of the brine shrimp Artemia franciscana, were conducted during two flights of the space shuttle Atlantis (missions STS-37 and STS-43) in 1991. Dehydrated cysts were activated, on orbit, by addition of salt water to the cysts, and then development was terminated by the addition of fixative. Development took place in 5 ml syringes, connected by tubing to activation syringes, containing salt water, and termination syringes, containing fixative. Comparison of space results with simultaneous ground control experiments showed that equivalent percentages of naupliar larvae hatched in the syringes (40%). Thus, reactivation of development, completion of embryogenesis, emergence and hatching took place, during spaceflight, without recognizable alteration in numbers of larvae produced. Post-hatching larval development was studied in experiments where development was terminated, by introduction of fixative, 2 days, 4 days, and 8 days after reinitiation of development. During spaceflight, successive larval instars or stages, interrupted by molts, occurred, generating brine shrimp at appropriate larval instars. Naupliar larvae possessed the single naupliar eye, and development of the lateral pair of adult eyes also took place in space. Transmission electron microscopy revealed extensive differentiation, including skeletal muscle and gut endoderm, as well as the eye tissues. These studies demonstrate the potential value of Artemia for developmental biology studies during spa ceflight, and show that extensive degrees of development can take place in this microgravity environment.

  1. Toxicity of organophosphates on morphology and locomotor behavior in brine shrimp, Artemia salina.

    Science.gov (United States)

    Venkateswara Rao, J; Kavitha, P; Jakka, N M; Sridhar, V; Usman, P K

    2007-08-01

    The acute toxicity and hatching success of four organophosphorus insecticides--acephate (ACEP), chlorpyrifos (CPP), monocrotophos (MCP), and profenofos (PF)--was studied in a short-term bioassay using brine shrimp, Artemia salina. Fifty percent hatchability inhibition concentration and median lethal concentration (LC(50)) values were calculated after probit transformation of the resulting data. Among the insecticides tested, CPP is found to be the most toxic and also to inhibit hatching success of A. salina cysts in a concentration-dependent manner. In addition, the effect of these pesticides on locomotor behavior (swimming speed) and morphologic differences were studied in LC(50)-exposed nauplii after 24 hours. The in vivo effect of these insecticides on acetylcholinesterase (Enzyme commission number (EC 3.1.1.7) activity was also determined in LC(50)-exposed nauplii after 24 hours. Maximum percent decrease in their swimming speed and significant morphologic alterations were noticed in CPP-exposed brine shrimps. The order of toxicity was CPP > PF > MCP > ACEP in all the parameters studied.

  2. Diffusive properties of water in Artemia cysts as determined from quasi-elastic neutron scattering spectra. [Artemia shrimp

    Energy Technology Data Exchange (ETDEWEB)

    Trantham, E.C.; Rorschach, H.E.; Clegg, J.S.; Hazlewood, C.F.; Nicklow, R.M.; Wakabayashi, N.

    1984-05-01

    Results have been obtained on the quasi-elastic spectra of neutrons scattered from pure water, 20% agarose gel (hydration four grams H/sub 2/O per gram of dry solid) and cysts of the brine shrimp Artemia for hydrations between 0.10 and 1.2 grams H/sub 2/O per gram of dry solids. The spectra were interpreted using a two-component model that included contributions from the covalently bonded protons and the hydration water, and a mobile water fraction. The mobile fraction was described by a jump-diffusion correlation function for the translation motion and a simple diffusive orientational correlation function. The results for the line widths ..gamma..(Q/sup 2/) for pure water were in good agreement with previous measurements. The agarose results were consistent with NMR measurements that show a slightly reduced translational diffusion for the mobile water fraction. The Artemia results show that the translational diffusion coefficient of the mobile water fraction was greatly reduced from that of pure water. The line width was determined mainly by the rotational motion, which was also substantially reduced from the pure water value as determined from dielectric relaxation studies. The translational and rotational diffusion parameters were consistent with the NMR measurements of diffusion and relaxation. Values for the hydration fraction and the mean square thermal displacement as determined from the Q-dependence of line areas were also obtained.

  3. Biomass production and nutritional value of Artemia sp. (Anostraca: Artemiidae) in Campeche, México.

    Science.gov (United States)

    Maldonado-Montiel, Teresita D N J; Rodríguez-Canché, Leticia G

    2005-01-01

    Biomass of the crustacean Artemia sp. has multiple uses. The biochemical composition and biomass production of Artemia grown from cysts produced by a native population from Real de Salinas were evaluated under laboratory conditions. Nauplii (instar I) were stocked at density of 10 nauplii/ml in 1.5 l tanks, fed with rice bran from day 2 to day 6, and with the microalgae Tetraselmis suecica from day 7 to day 15. At the end of the trial (day 15) the average length was 5.34 mm, biomass production was 15.72 g/l (wet weight), and survival was 79%. The proximal analysis and biochemical composition of Artemia biomass indicated that its nutrient percentages are closely similar to Artemia from other regions, making this species a suitable food for cultured fish and crustacean.

  4. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O.T. TÜZÜN, E. GÜRKAN, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  5. Biochemical studies on sphingolipids of Artemia franciscana: novel neutral glycosphingolipids.

    Science.gov (United States)

    Kojima, Hisao; Shimizu, Takemasa; Sugita, Mutsumi; Itonori, Saki; Fujita, Norihisa; Ito, Masahiro

    2011-02-01

    Neutral glycosphingolipids containing one to six sugars in their oligosaccharide chains have been isolated from cysts of the brine shrimp Artemia franciscana. The structures of these glycolipids were identified by methylation analysis, partial acid hydrolysis, gas-liquid chromatography, combined gas-liquid chromatography-mass spectrometry, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and proton nuclear magnetic resonance spectroscopy to be Glcβ1-Cer, Manβ1-4Glcβ1-Cer, Fucα1-3Manβ1-4Glcβ1-Cer, GlcNAcβ1-3Manβ1-4Glcβ1-Cer, GlcNAcα1-2Fucα1-3Manβ1-4Glcβ1-Cer, GalNAcβ1-4GlcNAcβ1-3Manβ1-4Glcβ1-Cer, GalNAcβ1-4(Fucα1-3)GlcNAcβ1-3Manβ1-4Glcβ1-Cer (CPS), and GalNAcβ1-4(GlcNAcα1-2Fucα1-3)GlcNAcβ1-3Manβ1-4Glcβ1-Cer (CHS). Two glycosphingolipids, CPS and CHS, were characterized as novel structures. Because Artemia contains a certain series of glycosphingolipids (-Fucα3Manβ4GlcβCer), which differ from the core sugar sequences reported thus far, we tentatively designated the glycosphingolipids characterized as nonarthro-series ones. Furthermore, CHS exhibited a hybrid structure of arthro-series and nonarthro-series sugar chain. Two novel glycosphingolipids were characterized from the brine shrimp Artemia franciscana; one was composed of arthrotetraose and a branching fucose attached to N-acetylglucosamine residue, and the other was composed of CPS with an additional N-acetylglucosamine residue attached to the branching fucose.

  6. Inocuidad y bioconservación de alimentos

    OpenAIRE

    Norma Margarita de la Fuente Salcido; José Eleazar Barboza Corona

    2010-01-01

    La población está interesada en consumir alimentos libre de patógenos, con la menor cantidad de aditivos químicos, que sean sensorialmente aceptables, con un valor nutricional elevado y que representen una alternativa en la prevención de enfermedades. En este trabajo, se analiza la importancia que tiene la inocuidad de los alimentos en la salud de quién los consume y la bioconservación de los alimentos a través de proteínas de origen bacteriano conocidas como bacteriocinas. De manera particul...

  7. El mercado argentino de los alimentos orgánicos

    OpenAIRE

    Gentile, Natacha; Rodríguez, Elsa Mirta M.

    2002-01-01

    El propósito de este trabajo es analizar el mercado interno de alimentos orgánicos de nuestro país, para ello se planteó como objetivo general definir el perfil del consumidor de alimentos orgánicos y evaluar los principales determinantes de sus decisiones de consumo e importancia relativa de los canales de compra. Se utilizaron dos fuentes de información: encuestas a consumidores y entrevistas a informantes calificados vinculados con la comercialización de alimentos orgánicos. El periodo de ...

  8. Development of transgenic zooplankton Artemia as a bioreactor to produce exogenous protein.

    Science.gov (United States)

    Chang, Shih-Hung; Lee, Ben-Chang; Chen, Yan-Da; Lee, Yin-Chou; Tsai, Huai-Jen

    2011-10-01

    Although the crustacean Artemia has been commonly used as an experimental organism and served as a live bait feed for aquaculture, gene transfer system on Artemia sp. to generate stable lines is not well developed. In this study, we optimized a condition for cyst-eletroporation and generated stable lines of transgenic A. sinica. Two expression plasmids directed by the hybrid promoters of cytomegalovirus (CMV) and medaka β-actin (Mβ) were co-electroporated on decapsulated cysts: pCMV-Mβ-GFP contained GFP reporter gene and pCMV-Mβ-ypGH contained yellowfin porgy GH (ypGH) cDNA. We examined the GFP shown in the Artemia larvae and found that the expression rate was 13.3% (3,219 out of 24,054 examined). We then chose 200 G0 founders which strongly expressed GFP to generate transgenic lines. Homozygotic strains derived from F4 generation of each transgenic line, A3 and A8, were obtained. We proved that transgenic lines A3 and A8 also harbored pCMV-Mβ-ypGH and produced recombinant ypGH with a concentration of 0.089 and 0.032 μg per 50 homozygotic nauplii, respectively. Ten live Artemia nauplii were fed daily to zebrafish larvae during 25 to 35 days of post-fertilization. The average body length gain rates of zebrafish larvae fed transgenic Artemia were 16-20% greater than those of control group, indicating the exogenous ypGH produced by transgenic Artemia is functional. Therefore, we concluded that the transgenesis on Artemia is developed, and transgenic Artemia might be highly potentially useful as a new bioreactor material for application in aquaculture and biological researches.

  9. Potentials of converting microalgae into brine shrimp Artemia

    OpenAIRE

    Sorgeloos, P.

    1985-01-01

    High densities of brine shrimp Artemia can be cultured in flow-through systems using the effluent of microalgae cultures as a combined source of culture medium and food. It has been proven at the "St. Croix Artificial Upwelling Mariculture Project" that in comparison with the fast growing clam Tapes japonica, brine shrimp assure a much more efficient conversion of plant into animal biomass. It appears from the given examples that microalgae conversion into brine shrimp Artemia offers efficien...

  10. Comparación biométrica del lóbulo frontal en poblaciones americanas de Artemia (Anostraca, Artemiidae) Biometric comparision of the frontal knob in american populations of Artemia (Anostraca, Artemiidae)

    OpenAIRE

    PATRICIO R DE LOS RIOS; OSCAR ZUÑIGA

    2000-01-01

    Se compararon el diámetro del lóbulo frontal y su relación con la longitud corporal, en poblaciones de Artemia franciscana (Chile y Estados Unidos), A. persimilis (Argentina) y Artemia sp. (Chile), cultivadas en laboratorio bajo condiciones controladas. Se encontraron diferencias significativas en ambos parámetros entre las poblaciones de A. franciscana y Artemia sp., de Salina El Convento (Chile) y entre A. persimilis y Artemia sp. de Torres del Paine (Chile). Se discuten en el presente trab...

  11. Bacteria associated with Artemia spp. along the salinity gradient of the solar salterns at Eilat (Israel).

    Science.gov (United States)

    Tkavc, Rok; Ausec, Luka; Oren, Aharon; Gunde-Cimerman, Nina

    2011-08-01

    The crustacean genus Artemia naturally inhabits various saline and hypersaline environments and is the most frequently laboratory-hatched animal for live feed in mari- and aquaculture. Because of its high economic importance, Artemia-bacteria interactions were so far studied mostly in laboratory strains. In this study, we focused our attention on the Artemia-associated microbiota in its natural environment in the solar salterns of Eilat, Israel. We applied a culture-independent method (clone libraries) to investigate the bacterial community structure associated with Artemia in five evaporation ponds with salinities from slightly above seawater (5%) to the point of saturation (32%), in two different developmental stages: in nauplii and in the intestine of adult animals. Bacteria found in naupliar and adult stages were classified within the Proteobacteria, Bacteroidetes, Firmicutes, Actinobacteria and Cyanobacteria. The halophilic proteobacterial genera Halomonas spp. and Salinivibrio spp. dominated the Artemia microbiota in both stages in all ponds. We also analysed a clone library of entire adult animals, revealing a novel bacterial phylogenetic lineage. This is the first molecular study of bacteria associated with two developmental stages of Artemia along a salinity gradient.

  12. Determination in oocytes of the reproductive modes for the brine shrimp Artemia parthenogenetica.

    Science.gov (United States)

    Dai, Zhong-Min; Li, Ran; Dai, Li; Yang, Jin-Shu; Chen, Su; Zeng, Qing-Guo; Yang, Fan; Yang, Wei-Jun

    2011-02-01

    The brine shrimp, Artemia, reproduces either oviparously, producing encysted embryos (diapause cysts), or ovoviviparously, producing free-swimming nauplii. Environmental factors, such as photoperiod, have been applied to control the reproduction mode of Artemia, but when the determination of a reproductive mode occurs remains unknown. We analysed the differential gene expression between oocytes from oviparous and ovoviviparous Artemia reared under different photoperiods. A total of 692 qualified cDNA clones were obtained by subtractive hybridization, 327 of which matched GenBank® Nucleotide Sequence Database entries. Gene expressions of 44 cDNAs (representing 56 clones) were analysed in oocytes using real-time PCR. Among these genes, 11 (21 clones) were significantly (PArtemia oocytes that subsequently enter diapause. Remarkably, known diapause-related proteins such as ArHsp22 (Artemia heat-shock protein 22) and chitin-binding proteins are found to be already differentially expressed. Furthermore, RNAi (RNA interference) knockdown of a differentially expressed gene, polo-like kinase 1, in oocyte of ovoviviparous Artemia led to the production of white embryos rather than free-swimming nauplii. In summary, our results provide evidence at the molecular level that the reproductive mode of Artemia is already determined at the oocyte stage of their life cycle.

  13. Use of Probiotic Bacillus spp. in Rotifer (Brachionus plicatilis) and Artemia (Artemia urmiana) Enrichment: Effects on Growth and Survival of Pacific White Shrimp, Litopenaeus vannamei, Larvae.

    Science.gov (United States)

    Jamali, Hadi; Imani, Ahmad; Abdollahi, Daruosh; Roozbehfar, Reza; Isari, Amin

    2015-06-01

    This study was to evaluate the effect of a preparation of Bacillus probiotic (Bacillus licheniformis and B. subtilis, 1:1) on growth and survival rate of Pacific white shrimp, Litopenaeus vannamei larvae. The larvae were fed on Artemia urmiana nauplii and Brachionus plicatilis enriched with the probiotic preparation at 1 × 10(6) CFU mL(-1) rate. The experimental setup was completely randomized design comprised of six treatments, namely solo Artemia nauplii (A) or rotifer (R), Artemia nauplii and rotifer without any enrichment (A + R), Artemia nauplii enrichment with probiotic bacilli (Bacillus licheniformis and B. subtilis) (A + B), rotifer enrichment with probiotic bacilli (R + B) and enriched Artemia nauplii and rotifer (A + R + B). All treatments were performed in triplicate. Chemical parameters of rearing water viz. pH, salinity and temperature were 7.5-8, 30-31 ppt and 31-32 °C, respectively. Photoperiod was 16L:8D. Shrimp larvae were fed Artemia nauplii and rotifers at 5-20 and 10-40 individuals per shrimp larvae four times a day, respectively. Growth and survival rate of larvae were determined at MII, MIII, PL1, PL4, PL7 and PL10 stages. Larvae in A + R + B treatment showed the highest total length (10.89 ± 0.51 mm), weight (674 ± 73 μg) and survival rate (65% ± 3.5). Lowest total length, weight and survival rate (7.96 ± 0.63 mm, 493 ± 52 μg and 24.5 ± 2.4%, respectively) were recorded in treatment B larvae. We concluded that Bacillus probiotic can improve growth and survival rate of Pacific white shrimp larvae without conceivably undesirable effects.

  14. Mercury accumulation and its effects an Artemia franciscana

    Energy Technology Data Exchange (ETDEWEB)

    Boia, C.M.; Duarte, A.C. [Univ. of Aveiro (Portugal)

    1995-12-31

    The effects of mercury accumulation on the brine shrimp Artemia franciscona were studied by long term (1--2 months) laboratory bioassays, using mercury chloride as the contaminant and the algae, Tetraselmis suecica as the food. These experiments were part of a larger research project aiming to contribute to the knowledge on mercury accumulation and its effects on Artemia. This crustacean is used worldwide for marine species feeding in aquafarms. This also happens on the lagoon of Aveiro, Portugal, which is partially contaminated with mercury. The first assays were conducted with concentrations of HgCl{sub 2} of the order of magnitude of those found in the waters of the lagoon of Aveiro (1.4 and 2.8 {micro}g/l). In further bioassays ranges of concentrations with observable effects have been used, from 0.02 to 1 mo. In the different assays the HgCl{sub 2} was: (a) simultaneously added to all the tanks or along the time, to evaluate the effects over different life stages (b) added directly to the tanks and then to the algae, at the same or in different quantities, to find out which was the more important pathway of contamination (c) removed from the feed stream after a certain time, to find out if detoxification would occur. The bioassays were carried out in five 100 l tanks under controlled temperature, pH, dissolved oxygen, salinity and feeding rate. Besides the content in mercury, size and number of the organisms have also been measured, as well as their content in total proteins, carbohydrates and fats.

  15. Alimentos funcionales y biotecnología

    Directory of Open Access Journals (Sweden)

    Andrés Illanes

    2015-05-01

    Full Text Available Título en ingles: Functional  foods and biotechnologyEl estilo de vida contemporáneo provoca un fuerte impacto en los hábitos alimentarios, con un consumo creciente de alimentos procesados y comidas rápidas cuyos efectos adversos sobre la salud son claramente perceptibles. La comida en el mundo occidental está asociada al placer, de modo que el compromiso entre la gratificación y la salud es un dilema en nuestra sociedad. Los problemas de salud asociados a hábitos alimentarios: diabetes, cáncer, fallas cardíacas, alergias y obesidad,  afectan por igual a adultos y niños y tienen un profundo impacto en países en vías de desarrollo donde los efectos nocivos resultan más evidentes que en países desarrollados debido a las limitaciones económicas (Ezzati et al., 2005.

  16. Nutritional Content of Artemia sp. Fed with Chaetoceros calcitrans and Skeletonema costatum

    Directory of Open Access Journals (Sweden)

    VIVI ENDAR HERAWATI

    2014-12-01

    Full Text Available Artemia sp. is a natural food with high protein content, especially amino acid. Nowadays, Indonesia still relies on import for its supply. Hence, the utilization of local Artemia sp. as an alternative to the imported product is recommended as it contains more protein and less expensive. The advantages of local Artemia sp. is its better crystal quality as it is still fresh. It also provides better income for salt farmers because waste water from salt farm can be used to culture Artemia sp.. This research is aimed at determining the quality of locally-produced Artemia sp., by evaluation of its essential amino acid and fatty acid profiles after treatments. Our results indicated that Artemia sp. cysts with good quality were produced after 8 hours and Artemia sp. reaches a hatching rate of 1,320,000 cysts (95% after 27 hours. We also found an indication that the best feed concentration was a mix of 60% Chaetoceros calcitrans with 40% Skeletonema costatum. Fatty acid profile analyses showed that the highest SAFA (12.86% and PUFA (29.91% were gained after feeding with Chaetoceros calcitrans, whereas the highest HUFA (4.93% was gained after feeding with Skeletonemacostatum. Essential amino acid profile analyses revealed the highest content of amino acid (18912.62 ppm was after feeding with a combination of Chaetoceros calcitrans and Skeletonema costatum. Finally, the proper water quality during research was at 25-30 oC of temperature, 30-31 ppt of salinity, pH 7.8-8.9, and DO was at 3.0-4.4 mg/L.

  17. [Immunocytochemical studies on the phase of differentiation of hatching gland cells in brine shrimp, Artemia salina].

    Science.gov (United States)

    Li, Ling; Fan, Ting Jun; Wang, Xiao Feng; Cong, Ri Shan; Yu, Qiu Tao; Zhong, Qi Wang

    2004-04-01

    Hatching enzyme (HE), synthesized in hatching gland cells (HGCs), plays vital roles in animal hatching. Immunocytochemical techniques employing anti-GST-UVS.2 antiserum, prepared from Xenopus HE and with specificity to brine shrimp HE, were first used to investigate the differentiation and variability of hatching gland cells (HGCs) in the hatching process of embryos of brine shrimp, Artemia salina, in this study. HGCs with immunoreactivity to anti-GST-UVS.2 antiserum were identified, for the first time, in brine shrimp embryos during hatching process. Immunocytochemical staining results showed that, (1) HE-positive immunoreactivity is really specific to Artemia HE, and its appearance and disappearance are closely correlated with the hatching process of Artemia salina. (2) Artemia HGCs, first appeared in embryos 5 hours before hatching and disappeared 4 hours after hatching, were also a transient type of cells, with an existence period of 9 hours. (3) The head portion of Artemia embryo is probably the initial position of HE secretion, and likely to be the main position of HE secretion as well. The detailed process and mechanism need to be studied. (4) The appearance of HGCs is in a synchronous mode from places all over the embryos, and their disappearance is also in a synchronous mode. (5) The number of HGCs increased gradually along with embryo development process and reached a maximum number at hatching. Contrarily, the number of HGCs decreased gradually after hatching, and HGCs disappeared 5 hours after hatching. However, the intensity of HE-positive reaction was almost at the same level at the period of HGCs'presence. (6) Artemia HGCs were distributed throughout the body of embryos at all time during their presence. Therefore, it can concluded that Artemia HGCs, as a transient type of cells, first appeared in embryos 4 hours before hatching and disappeared in embryos 5 hours after hatching, and with distinguished patterns of appearance, disappearance and

  18. De productie van Artemia-cysten, hoeksteen lokale economie in ontwikkelingslanden : ontwikkelingsmodel Tual ( Kleine Keï-eiland, Ind.)

    NARCIS (Netherlands)

    Scheerboom, J.; Leenstra, S.H.; Rothuis, A.J.

    2014-01-01

    De wereldwijde groei van de aquacultuur had een toename tot gevolg van de vraag naar cysten van Artemia (voor het voeden van larven van vissen en garnalen in een hatchery). Mondiaal worden cysten van zoutwaterkreeftje Artemia gewonnen in natuurlijke, zoute wateren. De beschikbaarheid van cysten is e

  19. Artemia Salina L. (Anostraca): uma opção para a aquicultura do Nordeste do Brasil

    OpenAIRE

    1982-01-01

    Inoculations made with cysts of Artemia salina from San Francisco Bay (California, USA) in Macau, Rio Grande do Norte, Brazil, in 1977, have dispersed this crustacean in all neighboring salt work areas. Favourable environmental conditions which have successfully contributed to this inoculation, together with suggestions for a rational utilization of similar areas for Artemia salina cultivation, are analyzed and commented.

  20. Brine shrimp Artemia in coastal saltworks: inexpensive source of food for vertically integrated aquaculture

    OpenAIRE

    Sorgeloos, P

    1983-01-01

    Proper Artemia introduction and management should lead not only to optimal salt production outputs but at the same time provide opportunities for the exploitation of valuable by-products, i.e. Artemia cysts and adult biomass as cheap sources of high quality food for intensive fish or crustacean farming.

  1. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    Directory of Open Access Journals (Sweden)

    Juan Manuel Pérez Agudelo

    2015-06-01

    Full Text Available Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20 y el grupo control fue expuesto a agua destilada (n=20 la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (Pearson para determinar la diferencia en mortalidad de los grupos.Resultados:El Grupo Control no presentó mortalidad, en tanto el Grupo Apitoxina presentó una mortalidad del 95%. Se demostró una asociación estadísticamente significativa con un p<0,05(IC: 95% entre la mortalidad de la Artemia salina y la administración de apitoxina.Conclusión:El extracto acuoso de apitoxina presenta toxicidad a una concentración de 0.35 en el modelo de Artemia salina. Palabras Clave: Apitoxina, Artemia salina, Toxicidad

  2. Artemia parthenogenetica (Branchiopoda: Anostraca) from the Large Aral Sea: Abundance, distribution, population structure and cyst production

    Science.gov (United States)

    Arashkevich, Elena G.; Sapozhnikov, P. V.; Soloviov, K. A.; Kudyshkin, T. V.; Zavialov, P. O.

    2009-03-01

    The brine shrimp Artemia parthenogenetica appeared in the Large Aral Sea (Central Asia) in 1998 when mineralization reached 63 ppt. Data on Artemia abundance and biomass, along with temperature and salinity measurements were collected in the western basin during 2002-2006, primarily in the autumn. During the study period, population density grew progressively, both in terms of number, from 250 to 1260 individuals per m 3, and in terms of biomass, from 0.3 to 1.3 g per m 3. In 2005, the population density and spatial distribution in the different parts of the sea (western and eastern basins and strait) was assessed. The horizontal distribution of the Artemia population was uniform in the deep central part of the western basin, although the distribution was quite patchy in the shallow coastal zone. Depth habitat of Artemia was restricted to the upper 20-25 m of depth, as the oxygen depletion and formation of anoxic layer prevented distribution of Artemia to the deeper waters. In autumn, all females reproduced oviparously, with an average clutch size of 30-35 eggs per female. The number of eggs in a clutch was positively correlated with female body length ( r2 = 0.36-0.44).

  3. Assessment of the production potential of an emerging Artemia population in the Aral Sea, Uzbekistan

    Science.gov (United States)

    Marden, Brad; Van Stappen, Gilbert; Musaev, Ablatdyin; Mirabdullayev, Iskandar; Joldasova, Iliya; Sorgeloos, Patrick

    2012-04-01

    The objective of this study was to provide information on the developing parthenogenetic Artemia population in the Uzbek part of the Aral Sea, and to assess its potential for commercial exploitation. A sampling campaign was designed for abiotic factors (temperature, salinity, transparency) and Artemia population parameters at least once monthly in the period March-October of the years 2005-2007. By 2007 salinity in both basins had increased to values above 100 g l - 1 . Moreover, by 2007, desiccation had rendered the eastern Aral basin practically inaccessible for sampling or cyst harvesting. The volume of the western basin remained considerable, given its depth, with a relatively accessible shoreline. Average Artemia population parameters (e.g. adult abundance Artemia sites of commercial importance. A gradual gain in population size in the western basin was observed over the period 2005-2007. The data further suggest that the low Artemia productivity is not genetically determined, but is largely the result of food limitation. The western basin may approach the threshold where a small-scale commercial operation is justified.

  4. Functional differentiation of small heat shock proteins in diapause-destined Artemia embryos.

    Science.gov (United States)

    King, Allison M; Toxopeus, Jantina; MacRae, Thomas H

    2013-10-01

    Encysted embryos of Artemia franciscana cease development and enter diapause, a state of metabolic suppression and enhanced stress tolerance. The development of diapause-destined Artemia embryos is characterized by the coordinated synthesis of the small heat shock proteins (sHsps) p26, ArHsp21 and ArHsp22, with the latter being stress inducible in adults. The amounts of sHsp mRNA and protein varied in Artemia cysts, suggesting transcriptional and translational regulation. By contrast to p26, knockdown of ArHsp21 by RNA interference had no effect on embryo development. ArHsp21 provided limited protection against stressors such as desiccation and freezing but not heat. ArHsp21 may have a non-essential or unidentified role in cysts. Injection of Artemia adults with amounts of ArHsp22 double-stranded RNA less than those used for other sHsps killed females and males, curtailing the analysis of ArHsp22 function in developing embryos and cysts. The results indicate that diapause-destined Artemia embryos synthesize varying amounts of sHsps as a result of differential gene expression and mRNA translation and also suggest that these sHsps have distinctive functions.

  5. Stress tolerance during diapause and quiescence of the brine shrimp, Artemia.

    Science.gov (United States)

    MacRae, Thomas H

    2016-01-01

    Oviparously developing embryos of the brine shrimp, Artemia, arrest at gastrulation and are released from females as cysts before entering diapause, a state of dormancy and stress tolerance. Diapause is terminated by an external signal, and growth resumes if conditions are permissible. However, if circumstances are unfavorable, cysts enter quiescence, a dormant stage that continues as long as adverse conditions persist. Artemia embryos in diapause and quiescence are remarkably resistant to environmental and physiological stressors, withstanding desiccation, cold, heat, oxidation, ultraviolet radiation, and years of anoxia at ambient temperature when fully hydrated. Cysts have adapted to stress in several ways; they are surrounded by a rigid cell wall impermeable to most chemical compounds and which functions as a shield against ultraviolet radiation. Artemia cysts contain large amounts of trehalose, a non-reducing sugar thought to preserve membranes and proteins during desiccation by replacing water molecules and/or contributing to vitrification. Late embryogenesis abundant proteins similar to those in seeds and other anhydrobiotic organisms are found in cysts, and they safeguard cell organelles and proteins during desiccation. Artemia cysts contain abundant amounts of p26, a small heat shock protein, and artemin, a ferritin homologue, both ATP-independent molecular chaperones important in stress tolerance. The evidence provided in this review supports the conclusion that it is the interplay of these protective elements that make Artemia one of the most stress tolerant of all metazoan organisms.

  6. Gamma Radiation Reduced Toxicity of Azoxystrobin Tested on Artemia franciscana.

    Science.gov (United States)

    Dvorak, P; Zdarsky, M; Benova, K; Falis, M; Tomko, M

    2016-06-01

    Fungicide azoxystrobin toxicity was monitored by means of a 96-h biotest with Artemia franciscana nauplius stages after exposure to solutions with concentrations of 0.2, 0.4, 0.6 and 0.8 mg L(-1) irradiated with (60)Co gamma radiation with doses of 1, 2.5, 5 and 10 kGy. The effects of ionization radiation on azoxystrobin toxicity were mainly manifested by a statistically significant reduction of lethality after 72- and 96-h exposure. A maximum reduction of lethality of 72 % was achieved using doses of 1-5 kGy for an azoxystrobin initial concentration of 0.4 mg L(-1) and after 72 h of exposure. At a 96-h exposure, a difference of lethal effects reached up to 70 % for a dose of 10 kGy. The observed effect of gamma ionizing radiation on azoxystrobin toxicity suggest that this approach can be applied as an alternative for a reduction of azoxystrobin residua in food.

  7. Purification and characterization of a carboxymethyl cellulase from Artemia salina.

    Science.gov (United States)

    Zin, Hyun Woo; Park, Kwang-Hyun; Choi, Tae Jin

    2014-01-03

    Brine shrimp (Artemia salina) belong to a group of crustaceans that feed on microalgae and require a cellulase enzyme that can be used in ethanol production from marine algae. Protein with potential cellulase activity was purified and the activity analyzed under different conditions. After initial identification of cellulase activity by CMC cellulase, surface sterilization and PCR using 16s rRNA primers was conducted to confirm that the cellulase activity was not produced from contaminating bacteria. The enzyme was purified by ammonium sulfate fractionation, gel filtration, and ion exchange chromatography. After the final purification, a 70-fold increase in specific enzyme activity was observed. SDS-PAGE results revealed that the cellulase enzyme had a molecular mass of 96 kDa. Temperature, pH, and salinity values were found to be optimal at 55 °C, pH 8.0, and 600 mM NaCl, respectively. Specifically, the enzyme showed a fivefold increase in enzyme activity in seawater compared to 600 mM NaCl in phosphate buffer. Further analysis of the purified enzyme by molecular spectrometry showed no match to known cellulases, indicating this enzyme could be a novel halophilic cellulase that can be used for the production of bioethanol from marine macroalgae.

  8. Acute toxicity of TBT and IRGAROL in Artemia salina.

    Science.gov (United States)

    Panagoula, Bakoulia; Panayiota, Marcouli; Iliopoulou-Georgudaki, Joan

    2002-01-01

    A 24-hour LC(50) bioassay method was carried out to study acute toxicity of Tributyltin (TBT) and IRGAROL (C(11)H(19)N(5)S) in Artemia salina. Five graded levels of both biocides were tested. According to the range test, the doses of TBT were 11.6 ng x l(-1), 21.0 ng x l(-1), 37.3 ng x l(-1), 65.2 ng x l(-1), and 116.5 ng x l(-1), and for IRGAROL were 1.0 mg x l(-1), 1.8 mg x l(-1), 3.2 mg x l(-1), 5.6 mg x l(-1), and 10 mg x l(-1). The determined LC(50) values were 41.41 ng x l(-1) and 1.62 mg x l(-1) respectively. These results indicate that in this system TBT is acutely more toxic than IRGAROL; however, both are proven environmentally toxic substances.

  9. Cyanobacterial cytotoxicity versus toxicity to brine shrimp Artemia salina.

    Science.gov (United States)

    Hisem, Daniel; Hrouzek, Pavel; Tomek, Petr; Tomšíčková, Jana; Zapomělová, Eliška; Skácelová, Kateřina; Lukešová, Alena; Kopecký, Jiří

    2011-01-01

    Heterocytous cyanobacteria from various habitats were screened for toxicity to brine shrimp Artemia salina and the murine lymphoblastic cell line Sp/2 in order to compare these two testing models for evaluation of risk posed by cyanobacteria to human health. Methanol extracts of biomass and cultivation media were tested for toxicity and selected extracts were fractionated to determine the active fraction. We found a significant toxic effect to A. salina and to Sp/2 cells in 5.2% and 31% of studied extracts, respectively. Only 8.6% of the tested strains were highly toxic to both A. salina and the Sp/2 cell line, and only two of the tested strains were toxic to A. salina and not to the murine cell line. Therefore, it is likely that the toxic effect of cyanobacterial secondary metabolites mostly targets basal metabolic pathways present in mammal cells and so is not manifested in A. salina. We conclude that it is insufficient to monitor cytotoxicity of cyanobacteria using only the brine shrimp bioassay as was usual in the past, since cytotoxicity is a more frequent feature in cyanobacteria in comparison with toxicity to A. salina. A. salina toxicity test should not be used when estimating the possible health risk for humans. We suggest that in vitro mammal cells be used for these purposes.

  10. Variation in fatty acid composition of Artemia salina nauplii enriched with microalgae and baker's yeast for use in larviculture.

    Science.gov (United States)

    Chakraborty, Rekha D; Chakraborty, Kajal; Radhakrishnan, E V

    2007-05-16

    The high content of the essential fatty acids in some microalgae and baker's yeast has made them excellent diets for boosting the fatty acid content of livefood Artemia. The influences of baker's yeast (Saccharomyces cerevisiae) and three microalgae, viz., Chlorella salina, Chaetoceros calcitrans, and Nannochloropsis salina, were tested as diet components in marine livefeed brine shrimp Artemia salina nauplii to improve the polyunsaturated fatty acid (PUFA) composition. Artemia nauplii submerged in these diets for four different enrichment intervals (3, 6, 8, and 24 h) were found to incorporate essential fatty acids, and the percentage composition of different fatty acids was measured in the enriched Artemia nauplii and enrichment diets. N. salina produced higher levels of arachidonic acid (AA, 20:4n6, 9.50%), eicosapentaenoic acid (EPA, 20:5n3, 25.80%), and docosahexaenoic acid (DHA, 22:6n3, 4.18%) as compared to other diets. The total PUFA content of the enriched Artemia by N. salina increased by 56.50% with enrichment periods up to 8 h, followed by a significant reduction in the final 24 h. N. salina yielded Artemia nauplii with considerable EPA (8.05%), AA (14.15%), and DHA (1.85%) after 8 h of enrichment, which are significantly higher levels than in nauplii fed with the other three diets (p = 0.05). The DHA/EPA values in Artemia enriched for 6 h by N. salina and C. calcitrans were found to be, respectively, 88.46 and 25% higher than freshly hatched Artemia. Artemia enriched by C. salina and baker's yeast exhibited a reduction in PUFA content even at 6 h of enrichment. Significant relative decreases in DHA, EPA, and total PUFA in Artemia enriched with all of the diets were apparent, with a corresponding increase in the total saturated fatty acid content (26.95 +/- 9.75%) in the final stages (24 h) of enrichment (p = 0.05).

  11. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2008-01-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading...... to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa......) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate...

  12. Desperdício de alimentos intra-hospitalar

    OpenAIRE

    Nonino-Borges,Carla Barbosa; Rabito, Estela Iraci; Silva,Karla da; Ferraz,Clarice Aparecida; Chiarello, Paula Garcia; Santos,José Sebastião dos; Marchini,Júlio Sérgio

    2006-01-01

    OBJETIVO: Verificar a ocorrência do desperdício, na forma de resto de alimentos, na Unidade de Alimentação e Nutrição da Unidade de Emergência do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto, da Universidade de São Paulo. MÉTODOS: Realizou-se análise descritiva de dados, levantados em um período de 14 dias, sobre os restos de alimentos deixados pelos clientes/pacientes, assim como dos custos estimados do total da produção e do resto de alimentos. RESULTADOS: Foram analisad...

  13. O risco das aminas biogênicas nos alimentos

    Directory of Open Access Journals (Sweden)

    Myrna Barbosa Gomes

    2014-04-01

    Full Text Available Aminas biogênicas são bases orgânicas de baixo peso molecular com atividade biológica, produzidas a partir da ação da enzima descarboxilase. Microrganismos utilizados na fermentação de alimentos são capazes de produzi-las. O consumo desses compostos causam graves efeitos toxicológicos, indesejáveis para a saúde humana. Embora não exista legislação específica sobre a quantidade máxima permitida de aminas em alimentos e bebidas, a presença e o acumulo destes compostos é de grande importância. O objetivo desta revisão é evidenciar a necessidade de mais estudos e discutir a presença de aminas biogênicas em alimentos variados.

  14. Interacciones empaque-alimento: migración

    Directory of Open Access Journals (Sweden)

    Diana Paola Navia P

    2014-12-01

    Full Text Available La calidad e inocuidad de los productos alimenticios es un tema relevante que involucra el comportamiento de los empaques en los procesos de preparación y almacenamiento de alimentos. En este contexto, el cumplimiento de la legislación alimentaria, cada día más exigente, requiere el conocimiento de varios aspectos clave en los sistemas empaque-alimento. Este artículo presenta una revisión acerca de los principales materiales de empaque actualmente usados en la industria alimentaria, sus interacciones con el producto empacado principalmente la migración de macro y microelementos desde el empaque hacia el alimento, abordando técnicas analíticas y modelos matemáticos usados en la identificación de elementos migrantes, así como también aspectos relacionados con la normativa establecida nacional e internacionalmente.

  15. Cestodes change the isotopic signature of brine shrimp, Artemia, hosts: implications for aquatic food webs.

    Science.gov (United States)

    Sánchez, Marta I; Varo, Nico; Matesanz, Cristina; Ramo, Cristina; Amat, Juan A; Green, Andy J

    2013-01-01

    To reach the final host (greater flamingos), the cestode Flamingolepis liguloides alters the behaviour of its intermediate host, the brine shrimp, Artemia parthenogenetica, causing it to spend more time close to the water surface. During summer 2010, we showed that the prevalence of this cestode was consistently higher at the top of the water column in the Odiel salt pans in south-western Spain. We used stable nitrogen (N) and carbon (C) isotopic analysis to test the hypothesis that cestodes also alter resource use by Artemia. In early summer, we compared stable isotopes in infected hosts at the surface with those from uninfected hosts at the bottom of the water column. In late summer, we compared infected and uninfected Artemia from the bottom. δ(15)N was consistently enriched in infected individuals compared with uninfected hosts, especially in Artemia with multiple infections of F. liguloides (family Hymenolepididae) and those with mixed infections of F. liguloides and cestodes of the family Dilepididae. Infected individuals from the surface were enriched in δ(13)C compared with uninfected ones from the bottom, but the opposite was found when comparing uninfected and infected Artemia from the same depth. This may be caused by the increase in lipid concentration in infected Artemia. Isolated cysticercoids of F. liguloides were significantly enriched in δ(13)C compared with cysticercoids in infected hosts, but surprisingly were not enriched in N. Our findings illustrate the way cestodes can alter food webs and highlight the importance of considering the parasitic status of prey in studies of trophic ecology in saline wetlands.

  16. Alimentos funcionales y nutrición óptima: ¿Cerca o lejos?

    Directory of Open Access Journals (Sweden)

    Silveira Rodríguez Manuela Belén

    2003-01-01

    Full Text Available El concepto de alimento funcional, aún no consensuado científicamente, surge en el seno de la Nutrición Óptima, encaminada a modificar aspectos genéticos y fisiológicos y a la prevención y tratamiento de enfermedades, más allá de la mera cobertura de las necesidades de nutrientes. Bajo la perspectiva de la Unión Europea, pueden ser tanto alimentos naturales como procesados industrialmente. Los alimentos funcionales más relevantes y sobre los que recae la más sólida evidencia científica son los probióticos, microorganismos vivos representados fundamentalmente por los derivados lácteos fermentados. Los prebióticos, como los fructanos tipo inulina, son el sustrato trófico de los probióticos y potenciales selectores de la flora colónica. La asociación de un prebiótico y un probiótico se denomina simbiótico. Se conocen innumerables sustancias con actividad funcional: fibra soluble e insoluble, fitosteroles, fitoestrógenos, ácidos grasos monoinsaturados y poliinsaturados, derivados fenólicos, vitaminas y otros fitoquímicos. Los alimentos funcionales ejercen su actividad en múltiples sistemas, especialmente el gastrointestinal, cardiovascular e inmunológico. Se comportan como potenciadores del desarrollo y la diferenciación, moduladores del metabolismo de nutrientes, la expresión génica, el estrés oxidativo y la esfera psíquica. La construcción de alegaciones sanitarias dirigidas al consumidor debe cimentarse en el conocimiento científico y la regulación legal. Es preciso encontrar biomarcadores eficientes del efecto biológico, analizar las posibles interacciones y realizar estudios válidos en humanos. El objetivo prioritario, sin embargo, debe ser la dieta en su conjunto. Emerge así el futuro reto de una dieta funcional.

  17. Alimentos funcionales, alfalfa y fitoestrógenos

    Directory of Open Access Journals (Sweden)

    Alejandro De Jesús

    2016-05-01

    Full Text Available El desarrollo de alimentos funcionales en los últimos años ha ido en aumento debido principalmente, al interés de la población por alimentos que no solo cumplan con la función nutricional sino también por que tengan un efecto benéfico en salud reduciendo así el riesgo a padecer diversas enfermedades. La alfalfa ha sido generalmente un alimento destinado para la alimentación del ganado, sin embargo, en diversas investigaciones alrededor del mundo se ha reportado que contiene compuestos bioactivos –fitoquímicos– y proteínas con efecto estrogénico, antimicrobiano y antioxidante, así como también protector contra enfermedades cardiovasculares, cáncer y diabetes, entre otras, clasificándola potencialmente como un alimento funcional. El presente documento tiene como objetivo dar un bosquejo general informativo a través de la búsqueda y revisión bibliográfica acerca de los alimentos funcionales y en especial de la alfalfa y constituyentes fitoquímicos (fitoestrógenos que la ubican dentro de este grupo de alimentos; así como los hallazgos que se han reportado como efectos adversos en animales experimentales específicamente en el aparato reproductivo debido al consumo de este tipo de fitocompuestos. Esta dicotomía entre los efectos adversos y benéficos no es más que la señalización de que aún falta mucha más información y estudios que realizar respecto al resultado que pueden tener los fitoestrógenos en el desarrollo y función reproductiva de animales, el agonismo y antagonismo de su efecto así como la concordancia en el riesgo-beneficio de su consumo.

  18. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    OpenAIRE

    Juan Manuel Pérez Agudelo; Juan Felipe Salazar Espinosa; Jorge Hernán Hernández Guevara

    2015-01-01

    Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20) y el grupo control fue expuesto a agua destilada (n=20) la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (...

  19. Calidad integral de alimentos y ecología microbiana

    OpenAIRE

    Rodríguez, Héctor Ricardo

    2006-01-01

    En el presente artículo, se plantea analizar y reflexionar sobre algunos aspectos ligados a la calidad y a la seguridad alimentaria -inocuidad, resaltando la necesidad de fortalecer y difundir estos conceptos, tratando de contribuir con la cadena agroalimentaria argentina, en la intención de favorecer la producción de los alimentos que el consumidor demanda, tanto en el mercado doméstico, como en el internacional. El término seguridad alimentaria / seguridad de alimentos (“Food Safety”), será...

  20. Presencia de escherichia coli en alimentos y relevancia nutricional

    OpenAIRE

    Vicario González, Noelia

    2013-01-01

    La finalidad de este trabajo es enfatizar la presencia de microorganismos, como E. coli, en los alimentos y en el agua de consumo, donde puede llegar a sobrevivir aunque las condiciones no sean óptimas para su desarrollo. Los brotes mencionados proporcionan información sobre la insuficiencia de los métodos de procesamiento. Son necesarias medidas higiénicas cada vez más estrictas en los procesos de producción, conservación, transporte, distribución y manufactura de los alimentos, tanto a n...

  1. Estabilidad de los pigmentos carotenoides en los alimentos

    OpenAIRE

    Meléndez Martínez, Antonio Jesús; Vicario Romero, Isabel; Heredia Mira, Francisco José

    2004-01-01

    Los pigmentos carotenoides son compuestos responsables de la coloración de gran número de alimentos vegetales y animales. Numerosos estudios publicados recientemente han demostrado el efecto beneficioso de estos compuestos en la salud humana, por lo que, desde un punto de vista nutricional, resulta de gran importancia conocer qué factores intervienen en la degradación de los carotenoides, ya que su pérdida, además de producir cambios de color en el alimento, conlleva una disminución de su val...

  2. Determinaci??n de carboximetillisina en alimentos tostados y horneados

    OpenAIRE

    Mes??as, M.; L??pez P??rez, N.; Guerra-Hern??ndez, E.; Garc??a-Villanova, Bel??n

    2010-01-01

    La carboximetillisina (CML) es un indicador de etapas avanzadas de la reacci??n de Maillard. Su formaci??n en los alimentos depender?? directamente de la composici??n de los mismos, pero tambi??n de la temperatura y tiempo de calentamiento al que se ven sometidos durante el procesado. Concretamente, se ve favorecida cuando el tratamiento t??rmico es m??s severo, de ah?? que est?? presente en alimentos tostados u horneados como los productos de panader??a o boller??a. En el present...

  3. Alimentos genéticamente alterados: transgénicos

    OpenAIRE

    García González, Jaime

    2016-01-01

    Se definen los términos relacionados directamente con la temática del artículo para luego citar algunas de las contradicciones de los promotores de este tipo de alimentos. Posteriormente, se mencionan los principales riesgos y preocupaciones existentes en torno al consumo de los alimentos genéticamente alterados. Además, se destacan las principales incertidumbres y cuestionamientos señalados y reconocidos por parte de diversos autores y organizaciones de profesionales en la salud, entre ellas...

  4. Alimentos industrializados en la dieta de los preescolares mexicanos

    OpenAIRE

    Dinorah González-Castell; Teresa González-Cossío; Simón Barquera; Rivera, Juan A.

    2007-01-01

    Objetivos. Clasificar los alimentos consumidos por preescolares mexicanos, en relación con su proceso de elaboración y temporalidad: a) industrializados modernos (IM), b) industrializados tradicionales (IT) y c) no industrializados (NI). Material y métodos. Con base en información del recordatorio de 24 horas de la Encuesta Nacional de Nutrición 1999 en niños de 1-4 años (n=1 070) se analizó la contribución de cada categoría de alimentos en energía, macronutrimentos y fibra. Resultados. La co...

  5. Peligros biológicos e inocuidad de alimentos

    OpenAIRE

    Alfredo Rodríguez Matos; Emilio Guzmán Torres; Armando Escalona Rosabal; Mario Otero Fernández

    2005-01-01

    I.- Introducción Cuando un consumidor adquiere un alimento, descuenta que la inocuidad o seguridad del mismo está siempre presente, las expectativas y actitudes de los consumidores están dirigidas a exigir el derecho a la protección de la seguridad, la salud y la información básica sobre los alimentos que el mercado pone a su alcance. En opinión de Erro (2002), la inocuidad se transforma entonces en una “necesidad implícita” que obviamente se pretende satisfacer, pero la toma de conciencia de...

  6. Purification and characterization of phenoloxidase from brine shrimp Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Tingjun Fan; Zhao Jing; Xianyuan Fan; Miaomiao Yu; Guojian Jiang

    2011-01-01

    Phenoloxidase from Artemia sinica (AsPO) was purified by Superdex 200 gel-filtration and Q Sepharose fast flow ionexchange chromatography,and its properties were characterized biochemically and enzymatically by using L-dihydroxyphenylalanine (L-DOPA) as the specific substrate.Results showed that AsPO was isolated as a monomeric protein of 125.5 kDa in molecular mass.The optimal pH value and temperature are 7.0 and 50℃,respectively,for its PO activity.The AsPO had an apparent Km value of 4.2 mM on L-DOPA,and 10.9 mM on catechol,respectively.Oxidase inhibitor on PO activity showed that the AsPO was extremely sensitive to ascorbic acid,sodium sulfite,and citric acid; and was very sensitive to cysteine,benzoic acid,and l-phenyl-2-thiourea.Combined with its specific enzyme activity on L-DOPA and catechol,it can be concluded that AsPO is most probably a typical catechol-type O-diphenoloxidase.Its PO activity was also sensitive to metal ions and chelators,and 20 mM DETC-inhibited PO activity was obviously recovered by 15 mM Cu2+,indicating that AsPO is most probably a copper-containing metalloenzyme.All these data about specific substrate,sensitivity to oxidase inhibitor metal ions and chelators indicate that the AsPO has the properties of a catechol-type copper-containing Odiphenoloxidase that functions as a vital humoral factor in host defense via melaninization as in other Crustaceans.

  7. Iron metallodrugs: stability, redox activity and toxicity against Artemia salina.

    Science.gov (United States)

    Vitorino, Hector Aguilar; Mantovanelli, Luca; Zanotto, Flavia Pinheiro; Espósito, Breno Pannia

    2015-01-01

    Iron metallodrugs comprise mineral supplements, anti-hypertensive agents and, more recently, magnetic nanomaterials, with both therapeutic and diagnostic roles. As biologically-active metal compounds, concern has been raised regarding the impact of these compounds when emitted to the environment and associated ecotoxicological effects for the fauna. In this work we assessed the relative stability of several iron compounds (supplements based on glucoheptonate, dextran or glycinate, as well as 3,5,5-trimethylhexanoyl (TMH) derivatives of ferrocene) against high affinity models of biological binding, calcein and aprotransferrin, via a fluorimetric method. Also, the redox-activity of each compound was determined in a physiologically relevant medium. Toxicity toward Artemia salina at different developmental stages was measured, as well as the amount of lipid peroxidation. Our results show that polymer-coated iron metallodrugs are stable, non-redox-active and non-toxic at the concentrations studied (up to 300 µM). However, TMH derivatives of ferrocene were less stable and more redox-active than the parent compound, and TMH-ferrocene displayed toxicity and lipid peroxidation to A. salina, unlike the other compounds. Our results indicate that iron metallodrugs based on polymer coating do not present direct toxicity at low levels of emission; however other iron species (eg. metallocenes), may be deleterious for aquatic organisms. We suggest that ecotoxicity depends more on metal speciation than on the total amount of metal present in the metallodrugs. Future studies with discarded metallodrugs should consider the chemical speciation of the metal present in the composition of the drug.

  8. Purification and characterization of phenoloxidase from brine shrimp Artemia sinica.

    Science.gov (United States)

    Fan, Tingjun; Jing, Zhao; Fan, Xianyuan; Yu, Miaomiao; Jiang, Guojian

    2011-09-01

    Phenoloxidase from Artemia sinica (AsPO) was purified by Superdex 200 gel-filtration and Q Sepharose fast flow ion-exchange chromatography, and its properties were characterized biochemically and enzymatically by using L-dihydroxyphenylalanine (L-DOPA) as the specific substrate. Results showed that AsPO was isolated as a monomeric protein of 125.5 kDa in molecular mass. The optimal pH value and temperature are 7.0 and 50°C, respectively, for its PO activity. The AsPO had an apparent K(m) value of 4.2 mM on L-DOPA, and 10.9 mM on catechol, respectively. Oxidase inhibitor on PO activity showed that the AsPO was extremely sensitive to ascorbic acid, sodium sulfite, and citric acid; and was very sensitive to cysteine, benzoic acid, and 1-phenyl-2-thiourea. Combined with its specific enzyme activity on L-DOPA and catechol, it can be concluded that AsPO is most probably a typical catechol-type O-diphenoloxidase. Its PO activity was also sensitive to metal ions and chelators, and 20 mM DETC-inhibited PO activity was obviously recovered by 15 mM Cu(2+), indicating that AsPO is most probably a copper-containing metalloenzyme. All these data about specific substrate, sensitivity to oxidase inhibitor metal ions and chelators indicate that the AsPO has the properties of a catechol-type copper-containing O-diphenoloxidase that functions as a vital humoral factor in host defense via melaninization as in other Crustaceans.

  9. Therapeutic effect of Artemia enriched with Escherichia coli expressing double-stranded RNA in the black tiger shrimp Penaeus monodon.

    Science.gov (United States)

    Thammasorn, Thitiporn; Somchai, Parinyachat; Laosutthipong, Chaowanee; Jitrakorn, Sarocha; Wongtripop, Somjai; Thitamadee, Siripong; Withyachumnarnkul, Boonsirm; Saksmerprome, Vanvimon

    2013-10-01

    We exploited Artemia as a double-stranded (ds)RNA-delivery system to combat viral diseases in shrimp. First, the transformed Escherichia coli (E. coli) expressing red fluorescent protein (RFP) was tested in the Artemia enrichment process. RFP signals detectable in the gut of Artemia under confocal microscope were evident for the successful encapsulation. Second, the Artemia enrichment process was performed using E. coli producing Laem-Singh virus (LSNV)-specific dsRNA, which has been previously shown to inhibit the viral infection in the black tiger shrimp Penaeus monodon by intramuscular injection and oral administration. The enriched Artemia nauplii were confirmed to contain dsRNA-LSNV by RT-PCR, and were subjected to the feeding test with P. monodon postlarvae. Quantitative RT-PCR indicated that a number of LSNV copies in most of the treated shrimp were, at least, 1000-fold lower than the untreated controls. During 11-17weeks after feeding, average body weight of the treated group was markedly increased relative to the control group. A smaller differential growth rate of the treated group as compared to the control was also noticed. These results suggested that feeding shrimp with the dsRNA-enriched Artemia can eliminate LSNV infection, which is the cause of retarded growth in P. monodon. The present study reveals for the first time the therapeutic effect of dsRNA-enriched Artemia for shrimp disease control.

  10. Survival of the probiotic bacteria Lactobacillus rhamnosus in seawater and its bioencapsulation in the brine shrimp Artemia

    Directory of Open Access Journals (Sweden)

    Claudia Ofelio

    2014-06-01

    The results obtained in the first test showed that the L. rhamnosus was able to survive in seawater during the whole experiment (30h, maintaining densities of 10e7 CFU/ml during the first 6h although decreasing progressively afterwards (10e3 CFU/ml at 30h. This allows adequate levels at sufficient time for Artemia to incorporate the probiotic. In fact, bioencapsulation test demonstrated that Artemia metanauplii were able to bioencapsulate the probiotic, reaching the highest concentration in Artemia after 30 min of bioencapsulation (10e4 CFU/Artemia. A slight further decrease (10e3 CFU/Artemia was observed after 24h. Interestingly, L. rhamnosus reduced in 1Log total Vibrionaceae bacteria in Artemia during the 3 first hours. Therefore, 3 hours was the time established for the bioencapsulation protocol and further studies are in progress to determine the ability of Artemia metanauplii to maintain bioencapsulated L. rhamnosus once transferred to rearing tanks. Also, the capability of the probiotic to inhibit potential pathogenic or opportunistic bacteria will be assessed.

  11. Estudos quimiométricos da pheo formulada em pluronics®: ação fotodinâmica Sobre Artemia salina Chemometric studies of pheo formulated in pluronics®: photodynamic action against Artemia salina

    Directory of Open Access Journals (Sweden)

    Adriana Passarella Gerola

    2013-01-01

    Full Text Available The self-aggregation of pheophytin, a possible photosensitizer for Photodynamic Therapy, is solved by formulation in polymeric surfactant as P-123. The photosensitizer incorporation was found to be time dependent, exhibiting two steps: a partition at the micellar interface followed by an incorporation into the micelle core. The photodynamic efficiency of the formulation was tested by the bioassays against Artemia salina. In order to evaluate how the experimental parameters: pheophytin concentration, P-123 percentage and illumination time influenced the death of artemia, the factorial design 2³ was chosen. The illumination time was found to be the main factor contributing to the mortality of artemia.

  12. Sustitución de alimento concentrado, con morera fresca (Morus alba), en la dieta de vacas lecheras

    OpenAIRE

    Carlos Boschini

    2003-01-01

    Se experimentaron cuatro dietas balanceadas con sustitución de alimento concentrado por la inclusión de 0, 20, 40 y 60% de materia seca de hojas de morera de 84 días. El consumo de materia seca total fue de 3,12 a 3,24% con relación al peso vivo. No se apreciaron diferencias importantes (P≥0,05) en el consumo total de MS entre vacas dentro de un mismo tratamiento. En la dieta sin morera (0%), el forraje constituyó el 42% y en la dieta con 60% de morera constituyó...

  13. In vivo toxicity study of Lantana camara

    Institute of Scientific and Technical Information of China (English)

    Badakhshan Mahdi Pour; Sreenivasan Sasidharan

    2011-01-01

    Objective: To investigate the toxicity of methanol extract of various parts (Root, Stem, Leaf, Flower and Fruit) of Lantana camara(L. Camara) in Artemia salina. Methods: The methanol extracts of L. camara were tested for in vivo brine shrimp lethality assay. Results: All the tested extract exhibited very low toxicity on brine shrimp larva. The results showed that the root extract was the most toxic part of L. camara and may have potential as anticancer agent. Conclusions:Methanolic extract of L. camara is relatively safe on short-term exposure.

  14. Peligros biológicos e inocuidad de alimentos

    Directory of Open Access Journals (Sweden)

    Alfredo Rodríguez Matos

    2005-09-01

    Full Text Available I.- Introducción Cuando un consumidor adquiere un alimento, descuenta que la inocuidad o seguridad del mismo está siempre presente, las expectativas y actitudes de los consumidores están dirigidas a exigir el derecho a la protección de la seguridad, la salud y la información básica sobre los alimentos que el mercado pone a su alcance. En opinión de Erro (2002, la inocuidad se transforma entonces en una “necesidad implícita” que obviamente se pretende satisfacer, pero la toma de conciencia de esto se da, lamentablemente, cuando aquella dejó de estar presente. Remitiéndonos a lo expresado por el Codex Alimentarius (1997, indica que las enfermedades de transmisión alimentaria y los daños provocados por los alimentos son, en el mejor de los casos desagradables, y en el peor pueden ser fatales. El deterioro de los alimentos ocasiona pérdidas, es costoso y puede influir negativamente en el comercio y la confianza de los consumidores. Por consiguiente, es imprescindible un control eficaz de la higiene, a fin de evitar los daños ocasionados por los alimentos y por el deterioro de los mismos, para la salud y la economía. Todos, fabricantes, elaboradores, manipuladores y consumidores de alimentos, tienen la responsabilidad de asegurarse de que los alimentos sean inocuos y aptos para el consumo. La responsabilidad del control de los riesgos microbiológicos recae sobre los individuos que intervienen en todas las fases de la cadena alimentaria, desde la explotación agrícola o ganadera hasta el consumidor final. Visto desde esta óptica el análisis de riesgos debería aplicarse dentro de un contexto estratégico, organizativo y operacional reconocido. Si bien en el proceso pueden haber elementos comunes, en el establecimiento de un nivel apropiado de protección los enfoques de esos sectores pueden presentar las máximas diferencias (FAO 2003.

  15. Estimativa do valor energético dos alimentos e validação das equações propostas pelo NRC (2001

    Directory of Open Access Journals (Sweden)

    Rocha Júnior Vicente Ribeiro

    2003-01-01

    Full Text Available Neste trabalho objetivou-se estimar os valores energéticos dos alimentos, através das equações propostas pelo último NRC para gado leiteiro, utilizando como banco de dados as "Tabelas Brasileiras de Composição de Alimentos para Bovinos" e um experimento com ovinos, e validar essas equações a partir de observações referentes ao NDT e às frações digestíveis da fibra em detergente neutro (FDND, proteína bruta (PBD, extrato etéreo (EED e carboidratos não fibrosos (CNFD, obtidas da literatura brasileira, a partir de experimentos in vivo, quando foram atendidas as exigências de mantença. O procedimento de validação dos parâmetros avaliados foi realizado por intermédio do ajuste de modelo de regressão linear simples dos valores preditos e dos observados. Os valores de NDT observados e preditos, tanto para os alimentos volumosos como para os concentrados, foram similares. Entretanto, quando se considerou apenas a estimativa da FDND de alimentos volumosos, verificou-se rejeição de ambas as hipóteses de nulidade, ou seja, tanto o intercepto quanto o coeficiente de inclinação foram diferentes de zero e um, respectivamente. Para a fração nitrogenada dos alimentos não foi constatada nenhuma diferença entre os parâmetros avaliados, havendo correspondência dos valores preditos aos observados. O EED de alimentos volumosos e concentrados, produzidos em condições tropicais, é subestimado pela equação utilizada pelo NRC, assim como os CNFD dos alimentos concentrados. Portanto, pode-se concluir que os valores de NDT obtidos a partir da equação proposta pelo NRC foram compatíveis com os dados observados de alimentos produzidos em condições brasileiras, todavia, sugere-se que sejam feitos alguns ajustes das equações que estimam as frações digestíveis da FDN, do EE e dos CNF.

  16. Effect of artificial regulations of Artemia n-3 HUFA content on growth and survival of black seabream ( Sparus macrocephalus) larvae

    Science.gov (United States)

    Liu, Jing-Ke

    1998-06-01

    The requirement for dietary n-3 HUFA (highly unsaturated fatty acid) for growth and survival of black seabream ( Sparus macrocephalus) larvae was tested using Artemia with various levels of n-3 HUFA. Four treatments with Artemia differing in their n-3 HUFA were prepared by feeding them various oil emulsions. The results indicated that dietary n-3 HUFA significantly influences fish n-3 HUFA levels and are necessary for good growth and survival of black seabream larvae. The proper value of n-3 HUFA level and DHA, EPA level in Artemia should be 4.273% and 0.873% (wet weight) for good growth and survival in black seabream larvae respectively.

  17. Global biodiversity and geographical distribution of diapausing aquatic invertebrates: the case of the cosmopolitan brine shrimp, Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Pacios, Fernando

    2010-01-01

    and geographic information. Our results indicate there are three Artemia complexes, A. franciscana, A. tibetiana and A. salina, suggesting at least three undescribed, and one unidentified to date, highly isolated lineages, to be re-evaluated taxonomically. Additionally, at a global scale, our data set shows two......The genus Artemia comprises passively dispersed anostracan species with a distribution all around the world, except in Antarctica. We used both published and personal data to assess and update existing knowledge on the diversity and distribution of Artemia, in particular compiling also genetic...

  18. Phylogenetic Analysis of Brine Shrimp (Artemia) in China Using DNA Barcoding

    Institute of Scientific and Technical Information of China (English)

    Weiwei Wang; Jun Yu; Qibin Luo; Haiyan Guo; Peter Bossier; Gilbert Van Stappen; Patrick Sorgeloos; Naihong Xin; Qishi Sun; Songnian Hu

    2008-01-01

    DNA barcoding is a powerful approach for characterizing species of organisms,especially those with almost identical morphological features, thereby helping to to establish phylogenetic relationships and reveal evolutionary histories. In this study, we chose a 648-bp segment of the mitochondrial gene, cytochrome c oxidase subunit 1 (COI), as a standard barcode region to establish phylogenetic relationships among brine shrimp (Artemia) species from major habitats around the world and further focused on the biodiversity of Artemia species in China, especially in the Tibetan Plateau. Samples from five major salt lakes of the Tibetan Plateau located at altitudes over 4,000 m showed clear differences from other Artemia populations in China. We also observed two consistent amino acid changes, 153A/V and 183L/F, in the COI gene between the high and low altitude species in China.Moreover, indels in the COI sequence were identified in cyst and adult samples unique to the Co Qen population from the Tibetan Plateau, demonstrating the need for additional investigations of the mitochondrial genome among Tibetan Artemia populations.

  19. Potential utilization of Artemia franciscana eggs as food for Coleomegilla maculata

    Science.gov (United States)

    We tested the hypothesis that Artemia franciscana Kellogg (brine shrimp, Anostraca: Artemiidae) eggs are suitable factitious, i.e., alternative, food to support the life history of a predatory ladybird beetle, Coleomegilla maculata DeGeer (Coleoptera: Coccinellidae). Using progeny from a stock colo...

  20. Biomass production of Artemia in air-water-lift raceway system

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Vijayaraghavan, S.; Krishnakumari, L.

    system is fairly simple. Advantages ofculturing Artemia in raceways are many; different stages of Arternia such as nauplii, pre-adults and adults produced can be used for hatcheries and pet fishery market either in live fonn/frozen or freeze-dried fonn...

  1. Mass marking of Leuciscus idus larvae using Artemia salina as a vector of fluorescent dyes.

    Science.gov (United States)

    Stańczak, K; Krejszeff, S; Dębowska, M; Mierzejewska, K; Woźniak, M; Hliwa, P

    2015-09-01

    A method for the mass marking of ide Leuciscus idus larvae by feeding them Artemia salina nauplii that were immersed in different solutions of alizarin red S, tetracycline hydrochloride and calcein was tested. The best quality marks were obtained after feeding fish for 4 days with nauplii that had been immersed in 200 mg l(-1) alizarin red S.

  2. Assessment of cyst production potential of a natural population of brine shrimp Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Studies on a natural population of Artemia in the salterns of Jamnagar indicated that the population is parthenogenetic. These shrimps reach a maximum size of 9 mm. Number of cysts per brood varies from 10-32. Adults form about 68% of the total...

  3. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay.

    Science.gov (United States)

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50  1000 µg/ml). Our subsequent studies of conifer heartwoods with strong activity confirm the assay's value for identifying new investigational leads for materials with insecticidal and fungicidal activity.

  4. Phylogenetic analysis of brine shrimp (Artemia) in China using DNA barcoding.

    Science.gov (United States)

    Wang, Weiwei; Luo, Qibin; Guo, Haiyan; Bossier, Peter; Van Stappen, Gilbert; Sorgeloos, Patrick; Xin, Naihong; Sun, Qishi; Hu, Songnian; Yu, Jun

    2008-12-01

    DNA barcoding is a powerful approach for characterizing species of organisms, especially those with almost identical morphological features, thereby helping to to establish phylogenetic relationships and reveal evolutionary histories. In this study, we chose a 648-bp segment of the mitochondrial gene, cytochrome c oxidase subunit 1 (COI), as a standard barcode region to establish phylogenetic relationships among brine shrimp (Artemia) species from major habitats around the world and further focused on the biodiversity of Artemia species in China, especially in the Tibetan Plateau. Samples from five major salt lakes of the Tibetan Plateau located at altitudes over 4,000 m showed clear differences from other Artemia populations in China. We also observed two consistent amino acid changes, 153A/V and 183L/F, in the COI gene between the high and low altitude species in China. Moreover, indels in the COI sequence were identified in cyst and adult samples unique to the Co Qen population from the Tibetan Plateau, demonstrating the need for additional investigations of the mitochondrial genome among Tibetan Artemia populations.

  5. Unique chimeric composition of the trehalase gene from brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Tanaka, Shin; Nambu, Fumiko; Nambu, Ziro

    2010-03-01

    To investigate the exon/intron structure of the Artemia trehalase gene, four overlapping clones were isolated from a genome library derived from an inbred strain of crustacean Artemia franciscana, and a 49 kb genetic area was re-constructed. The re-constructed area contained eight exons corresponding to the trehalase cDNA sequence that we had previously reported [1]. Comparative analysis of the Artemia trehalase gene with other animal trehalase genes revealed the existence of conserved exon/intron boundaries among different phyla. Comparison of the 5' UTR region of trehalase mRNA obtained by the 5' RACE method with the trehalase genes indicated the existence of a novel exon/intron boundary in the region designated "Exon I". Surprisingly, a part of a mitochondrial ribosomal protein gene (MRP-S33) was found to be inserted in the 5' UTR region of the trehalase gene. This sequence had the same polyadenylation signal that the Artemia MRP-S33 cDNAs did. Using the 3' RACE method, it was demonstrated that the poly (A) additional signal is still functional and that the chimeric mRNAs composed of the 5' UTR of the trehalase mRNA and of the 3' end derived from the MRP-S33 gene are transcribed.

  6. Emulsiones múltiples: compuestos bioactivos y alimentos funcionales

    Directory of Open Access Journals (Sweden)

    Francisco Jiménez-Colmenero

    2013-10-01

    Full Text Available La continua aparición de evidencias científicas acerca del papel de la dieta y/o sus componentes en el bienestar y la salud, ha favorecido la aparición de los alimentos funcionales que en la actualidad constituyen uno de los principales impulsores del desarrollo de nuevos productos. La aplicación de emulsiones múltiples abre nuevas posibilidades en el diseño y desarrollo de alimentos funcionales. Tales sistemas pueden emplearse como producto intermedio (ingrediente alimentario dentro de las estrategias tecnológicas habitualmente empleadas en la optimización de la presencia de compuestos bioactivos en alimentos más saludables y funcionales. Este artículo presenta un breve análisis de los tipos, características y formación de emulsiones múltiples, posibilidad de localización de compuestos bioactivos, así como su potencial aplicación en el diseño y preparación de alimentos saludables y funcionales. Tales aplicaciones se manifiestan especialmente relevantes en relación con aspectos cuantitativos y cualitativos del material lipídico (reducción de grasa/calorías y optimización del perfíl de ácidos grasos, encapsulamiento de compuestos bioactivos fundamentalmente hidrofílicos y reducción de sodio. Esta estrategia ofrece interesantes posibilidades en relación con el enmascaramiento de sabores y mejora de las propiedades sensoriales de los alimentos.

  7. The genus Artemia Leach, 1819 (Crustacea: Branchiopoda: I. True and false taxonomical descriptions El género Artemia Leach, 1819 (Crustacea: Branchiopoda: I. Descripciones taxonómicas verdaderas y falsas

    Directory of Open Access Journals (Sweden)

    Alireza Asem

    2010-01-01

    Full Text Available The brine shrimp Artemia is important for aquaculture since it is bighly nutritious. It is also used widely in biological studies because it is easy to culture. The aim of the present study is to review the literature on the taxonomical nomenclature of Artemia. The present study indicates the existence of seven species: three living in the Americas, one in Europe, and three in Asia.El camarón de salmuera Artemia es importante para la acuicultura por su alta calidad nutricional y es muy utilizado para estudios biológicos por ser de fácil cultivo. El objetivo del presente estudio es revisar la literatura sobre la nomenclatura taxonómica de Artemia. Se determina la existencia de siete especies; tres de ellas viven en América, una en Europa y tres en Asia.

  8. ALIMENTOS TRANSGÉNICOS Y ALERGENICIDAD Transgenic foods and allergenicity

    Directory of Open Access Journals (Sweden)

    Orlando Acosta Losada

    2007-12-01

    Full Text Available La utilización de la tecnología transgénica en la modificación de las fuentes alimentarias ha permitido desarrollar alimentos menos caros y más saludables. Esta tecnología tiene la potencialidad de reducir el uso de plaguicidas químicos, incrementar la productividad y proteger el hábitat de los humanos y de otras especies. No obstante, los alimentos genéticamente modificados (GM han dado origen a preocupaciones públicas entre las organizaciones no gubernamentales (NGOs, los consumidores y los medios con relación a su potencial toxicidad, alergenicidad y alteración de los nutrientes. Se presenta una revisión crítica de la literatura reciente sobre las respuestas inmunológicas adversas a las proteínas de los alimentos. Esta revisión incluye las características físicas y químicas de los alergenos, la heterogeneidad en la prevalencia de la alergia a los alimentos y los avances en la comprensión de los desordenes alérgicos producidos por alimentos. Se realiza una descripción del espectro clínico de las reacciones alérgicas inducidas por alimentos, las cuales son responsables de una variedad de síntomas que afectan la piel, el tracto respiratorio y el tracto gastrointestinal. Los métodos utilizados en las pruebas para evaluar la seguridad de los alimentos derivados de los cultivos GM se presentan y discuten. Se concluye que los riesgos alergénicos potenciales introducidos por los alimentos GM no son mayores que los presentados por los alimentos derivados de cultivos modificados genéticamente por los métodos convencionales.The use of transgenic technology to modify food sources has anticipated the possibility of developing less expensive and healthier food. This technology has the potential of reducing the use of chemical pesticides, increasing the productivity and protecting the environment in which human beings and other species live. However, genetically modified (GM foods have raised a public concern among

  9. Production, utilization and manipulation of Artemia as food source for shrimp and fish larvae

    OpenAIRE

    Lavens, P.; Léger, P.; Sorgeloos, P

    1986-01-01

    Larval culture of fish and shrimp can be seriously improved thanks to the results of recent research and development in the field of Artemia production and utilization. The present article summarizes the most recent techniques for optimation in production and use of different stages of Artemia in aquaculture:- cyst selection in function of hatching quality, purity, biometric characteristics, etc. - nauplii production: techniques for hatching, disinfection and decapsulation;- nutritional value...

  10. Acetylation of Chromatin-Associated Histone H3 Lysine 56 Inhibits the Development of Encysted Artemia Embryos.

    Directory of Open Access Journals (Sweden)

    Rong Zhou

    Full Text Available As a response to harsh environments, the crustacean artemia produces diapause gastrula embryos (cysts, in which cell division and embryonic development are totally arrested. This dormant state can last for very long periods but be terminated by specific environmental stimuli. Thus, artemia is an ideal model organism in which to study cell cycle arrest and embryonic development.Our study focuses on the roles of H3K56ac in the arrest of cell cycle and development during artemia diapause formation and termination. We found that the level of H3K56ac on chromatin increased during diapause formation, and decreased upon diapause termination, remaining basal level throughout subsequent embryonic development. In both HeLa cells and artemia, blocking the deacetylation with nicotinamide, a histone deacetylase inhibitor, increased the level of H3K56ac on chromatin and induced an artificial cell cycle arrest. Furthermore, we found that this arrest of the cell cycle and development was induced by H3K56ac and dephosphorylation of the checkpoint protein, retinoblastoma protein.These results have revealed the dynamic change in H3K56ac on chromatin during artemia diapause formation and termination. Thus, our findings provide insight into the regulation of cell division during arrest of artemia embryonic development and provide further insight into the functions of H3K56ac.

  11. Ciencia y Tecnología de alimentos

    Directory of Open Access Journals (Sweden)

    Vidal, Daniel Ramón

    2000-05-01

    Full Text Available Not available

    En este artículo se presenta la composición y actividades del área de Ciencia y Tecnología de alimentos del Consejo Superior de Investigaciones Científicas, Asimismo, se comentan las distintas líneas de investigación y se discuten posibles estrategias científicas de futuro.

  12. USE OF BRINE SHRIMP (ARTEMIA IN THE FEEDING OF STURGEON JUVENILES (ACIPENSERIDAE (REVIEW

    Directory of Open Access Journals (Sweden)

    M. Simon

    2016-06-01

    Full Text Available Purpose. To review scientific sources on the technological and biological characteristics of the use of brine shrimp (Artemia in the feeding of sturgeon juvenilse (Acipenseridae. To highlight the common biotechnological bases of the enrichment of brine shrimp with biologically active substances necessary for the full development of sturgeon juveniles. Findings. The review of scientific papers showed that the technology is the use of brine shrimp in the feeding of sturgeon speices not only had not lost its relevance in aquaculture, but also continued to evolve in response to new challenges. The review contains a description of the peculiarities of the biological structure of brine shrimp eggs and methods of their quality assessment in the field. It describes the nutritional characteristics of Artemia. It is shown that brine shrimp is the best food organism for the use in the feeding of sturgeon fingerlings. The calculation scheme for Artemia decapsulation and incubation is provided. The main technological stages of of the preparation of shrimps before their use in feeding – activation, hydration, decapsulation, incubation, dehydration were described. The effect of brine shrimp nauplia enriched with biologically active substances enriched brine shrimp on sturgeon juveniles was highlighted. Practical value. Fish farm owners search for cost-effective, easy to use, and available food that is preferred by sturgeon juveniles (Acipenseridae. Brine shrimp nauplii obtained from cysts can be readil used to feed fish just after one-day incubation. Instar I (the nauplii that just hatched and contain large yolk reserves in their body and instar II nauplii (the nauplii after first moult and with functional digestive tracts are more widely used in aquaculture, because they are easy for operation, rich in nutrients, and small, which makes them suitable for feeding fish larvae as live feed or after drying. The generalized information will be important for

  13. Surtos de enfermidades transmitidas por alimentos causados por Salmonella Enteritidis

    Directory of Open Access Journals (Sweden)

    Peresi Jacqueline T.M.

    1998-01-01

    Full Text Available OBJETIVO: São descritos surtos de salmonelose notificados no período de julho de 1993 a junho de 1997 na região Noroeste do Estado de São Paulo, Brasil, tendo em vista os vários surtos de veiculação alimentar ocasionados por Salmonella nessa região. MÉTODO: Foram obtidos 19 inquéritos epidemiológicos para análise de dados, 87 amostras de fezes e 38 amostras de alimentos, incluindo 12 de ovos para análise microbiológica. Cepas de Salmonella foram submetidas a sorotipagem, fagotipagem e teste de sensibilidade a 13 agentes antimicrobianos. RESULTADOS: Foram acometidas 906 pessoas com 295 hospitalizações. Cepas de Salmonella Enteritidis Fagotipo 4 foram isoladas de 80,5% das coproculturas, de todas amostras de alimentose de 41,7% dos ovos. Em 22 (95,7% surtos os a salmonela foi veiculada por alimentos contendo ovos crus ou semicrus. Os testes de sensibilidade a antimicrobianos revelaram sensibilidade à maioria das cepas. CONCLUSÕES: Considerando os resultados obtidos, torna-se necessária a implantação e intensificação de medidas de controle na produção e armazenamento dos ovos, além da orientação à população quanto aos riscos no consumo inadequado desse alimento.

  14. Aportes de zinc de los alimentos de mayor consumo en la encuesta nacional de consumo familiar de alimentos

    OpenAIRE

    Sanchéz Abanto, José R.; Álvarez Dongo, Doris; Cosser Gamarra, Carlos

    2009-01-01

    El objetivo es dar a conocer el aporte de zinc de los alimentos mas consumidos en los hogares encuestados por la ENCOFA; La deficiencia en la dieta, se puede conllevar a pérdida de apetito, disminución del sentido del gusto, olfato y de la función del sistema inmunitario, cicatrización lenta de las heridas y llagas en la piel.

  15. Preço dos alimentos no Brasil: prefira preparações culinárias a alimentos ultraprocessados

    Directory of Open Access Journals (Sweden)

    Rafael Moreira Claro

    2016-01-01

    Full Text Available Resumo: Estudo com objetivo de descrever o preço dos grupos de alimentos consumidos no Brasil considerando a natureza, a extensão e o propósito de seu processamento. Dados provenientes da Pesquisa de Orçamentos Familiares de 2008-2009 foram utilizados. O preço médio dos grupos (in natura, ingredientes culinários, processados e ultraprocessados e seus respectivos subgrupos de alimentos foram estimados para o Brasil segundo renda, região e área. Os produtos in natura e ingredientes culinários apresentaram menor preço por caloria quando comparado aos demais grupos, sugerindo uma vantagem econômica no preparo de refeições no lar em comparação a sua substituição por ultraprocessados. As famílias de maior nível econômico pagaram preço mais elevado por suas aquisições, enquanto as regiões Nordeste, Norte e a área rural pagaram os menores preços. Enquanto alimentos frescos (como carnes, leite, frutas e hortaliças tendem a custar mais caro que alimentos ultraprocessados, grãos secos (como o arroz e o feijão despontam como uma alternativa mais econômica para adoção de práticas alimentares saudáveis.

  16. ¿PORQUE SEGUIMOS COMIENDO LOS ALIMENTOS DE LA CHACRA? Sentidos de los alimentos en el noroeste argentino

    Directory of Open Access Journals (Sweden)

    Gloria Verónica Sammartino

    2015-12-01

    Full Text Available Las conductas ligadas a la alimentación son dinámicas, están afectadas por las condiciones socioeconómicas y políticas que inciden en las prácticas y los sentidos alimentarios. Sin embargo los ritmos de estos cambios están influenciados por los valores grupales y las prácticas del pasado que inciden en la perdurabilidad de ciertos elementos que parecerían poder resistir a las innovaciones e introducción de variedades y tecnologías nuevas. En este artículo analizamos los significados alimentarios que emergen del análisis de  relatos de personas de una región del noroeste argentino, la Quebrada de Humahuaca, provincia de Jujuy, con el propósito de visualizar algunos aspectos claves para el esbozo de explicaciones acerca de las situaciones concretas que inciden en las continuidades y modificaciones alimentarias, en la que se ponen en tensión las relaciones dadas en el marco de la expansión de la producción y consumo masivo de alimentos que provienen de las cadenas agroalimentarias hegemónicas, junto a modalidades de producción y consumo de alimentos que, con graduaciones, escapan a dicha lógica, pues existe una esfera de producción de alimentos orientada al autoconsumo.

  17. Effect of ultra-high pressure on small animals, tardigrades and Artemia

    Directory of Open Access Journals (Sweden)

    Fumihisa Ono

    2016-12-01

    Full Text Available This research shows that small animals, tardigrades (Milnesium tardigradum in tun (dehydrated state and Artemia salina cists (dried eggs can tolerate the very high hydrostatic pressure of 7.5 GPa. It was really surprising that living organisms can survive after exposure to such a high pressure. We extended these studies to the extremely high pressure of 20 GPa by using a Kawai-type octahedral anvil press. After exposure to this pressure for 30 min, the tardigrades were soaked in pure water and investigated under a microscope. Their bodies regained metabolic state and no serious injury could be seen. But they were not alive. A few of Artemia eggs went part of the way to hatching after soaked in sea water, but they never grew any further. Comparing with the case of blue-green alga, these animals are weaker under ultra-high pressure.

  18. Evolutionary Origin and Phylogeography of the Diploid Obligate Parthenogen Artemia parthenogenetica (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2010-01-01

    Background: Understanding the evolutionary origin and the phylogeographic patterns of asexual taxa can shed light on the origin and maintenance of sexual reproduction. We assessed the geographic origin, genetic diversity, and phylogeographic history of obligate parthenogen diploid Artemia...... and recent evolutionary origin of diploid A. parthenogenetica, and strongly suggested that the geographic origin of parthenogenesis in Artemia was in Central Asia. Our results indicate that the maternal sexual ancestors of diploid A. parthenogenetica were an undescribed species from Kazakhstan and A. urmiana....... Conclusions/Significance: We found evidence for multiple origin of parthenogenesis in Central Asia. Our results indicated that, shortly after its origin, diploid A. parthenogenetica populations underwent a rapid range expansion from Central Asia towards the Mediterranean region, and probably to the rest...

  19. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine.

    Science.gov (United States)

    Arcanjo, D D R; Albuquerque, A C M; Melo-Neto, B; Santana, L C L R; Medeiros, M G F; Citó, Amgl

    2012-08-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Justicia pectoralis and Equisetum sp.) against Artemia salina. Biological activity was evaluated for extracts at 1, 10, 100, and 1000 µg/mL in triplicate, and the mean lethal concentration values (LC50) were obtained by probit analysis. The species Acmella uliginosa showed the highest bioactivity, and its flower extract was more active than its leaf extract.

  20. On the motility of living invertebrates The case of Artemia Salina

    Science.gov (United States)

    Huerta, R.; Hernández, A.; Alvarado-Gil, J. J.

    1998-08-01

    Using a laser beam deflection technique a non-destructive and non-invasive method is developed. This method is applied to monitor the motility of small invertebrates, in particular we study the important case of the crustacean Artemia Salina and the motion of its different parts. We find out that its dynamics can be explained as a superposition of several periodic motions with very well defined frequencies.

  1. The transcription factor p8 regulates autophagy during diapause embryo formation in Artemia parthenogenetica.

    Science.gov (United States)

    Lin, Cheng; Jia, Sheng-Nan; Yang, Fan; Jia, Wen-Huan; Yu, Xiao-Jian; Yang, Jin-Shu; Yang, Wei-Jun

    2016-07-01

    Autophagy is an essential homeostatic process by which cytoplasmic components, including macromolecules and organelles, are degraded by lysosome. Increasing evidence suggests that phosphorylated AMP-activated protein kinase (p-AMPK) and target of rapamycin (TOR) play key roles in the regulation of autophagy. However, the regulation of autophagy in quiescent cells remains unclear, despite the fact that autophagy is known to be critical for normal development, regeneration, and degenerative diseases. Here, crustacean Artemia parthenogenetica was used as a model system because they produced and released encysted embryos that enter a state of obligate dormancy in cell quiescence to withstand various environmental threats. We observed that autophagy was increased before diapause stage but dropped to extremely low level in diapause cysts in Artemia. Western blot analyses indicated that the regulation of autophagy was AMPK/TOR independent during diapause embryo formation. Importantly, the level of p8 (Ar-p8), a stress-inducible transcription cofactor, was elevated at the stage just before diapause and was absent in encysted embryos, indicating that Ar-p8 may regulate autophagy. The results of Ar-p8 knockdown revealed that Ar-p8 regulated autophagy during diapause formation in Artemia. Moreover, we observed that activating transcription factors 4 and 6 (ATF4 and ATF6) responded to Ar-p8-regulated autophagy, indicating that autophagy targeted endoplasmic reticulum (ER) during diapause formation in Artemia. Additionally, AMPK/TOR-independent autophagy was validated in human gastric cancer MKN45 cells overexpressing Ar-p8. The findings presented here may provide insights into the role of p8 in regulating autophagy in quiescent cells.

  2. Neutron flow exposure as a test for survival of Artemia salina spores.

    Science.gov (United States)

    Matveeva, I S; Smirnov, A N; Vodennikov, B D; Popov, I M; Semenov, D S; Kolesnikov, M V; Syroeshkin, A V

    2004-11-01

    Live and heat-inactivated Artemia salina spores (samples with the same mass and filling density) were exposed to a flow of thermal neutrons from a (252)Cf radioactive source at an equivalent dose power of about 1 microSv/h. Irradiation led to a 4-fold acceleration of nauplius development and to modification of the element profiles of live spores. The difference between absorption/diffusion of thermal neutrons by live and dead spores was revealed.

  3. [Determination of Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus toxicity over Artemia salina].

    Science.gov (United States)

    Nieto R, Ivonne J; Salama, Ahmed M; Cataño P, Jorge E; Chegwin A, Carolina

    2008-09-30

    We report the toxicity of ethanolic extracts in Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus over that obtained in Artemia salina. P. involutus showed the highest toxicity (LC50 = 94.4 microg/ml), similar to that detected using potassium dichromate pattern. P. pulmonarius and P. ostreatus did not show toxicity over A. salina in concentrations lower than 1,000 microg/ml.

  4. [Study of a DNA sequence from brine shrimp artemia containing a novel DM domain].

    Science.gov (United States)

    Zeng, Hui; Song, Wen Qin; Chen, Rui Yang

    2004-10-01

    Sex-determining mechanisms are highly variable between phyla. However, there is an apparent exception in which structurally and functionally related genes control sex determination in different phyla: the sexual regulators DSX of Drosophila melanogaster and MAB-3 of Caenorhabditis elegans both containing a DNA-binding motif, DM domain. Proteins containing the domain may also play a role in sexual development of vertebrates. For examples, both the human DMRT1 (doublesex and mab-3 related transcription factor 1) gene and mouse Dmrt1 gene are necessary for male development. In this paper, through the degenerated PCR, a DNA fragment ADM was amplified out from genomic DNA of brine shrimp, Artemia sinica from YunCheng Salt Lake, Shanxi, China and Artemia parthenogenetica from GaHai, Qinghai, China, respectively. ADM encodes 47 amino acids and is highly homologous to amino acid sequence of the known DM domains. By comparing total of 27 DM domains in distant related species, a phylogenic tree of DM domain was constructed. In the tree, these DM domains were divided into different branches according to their subtypes. Among the DM domains that were compared, ADM is most homologous to the DM domain contained in human DMRT3 and mouse Dmrt3, which shares 83% identity between them. In addition, the same length of ADM could also be amplified out from cDNA of Artemia sinica and Artemia parthenogenetica, which indicated that ADM was expressed and located in one exon. The DM domain in brine shrimp reported here would make it possible for cloning the full-length cDNA containing the DM domain and further elucidating their functions.

  5. Assessment of toxic potential of Cerrado fruit seeds using Artemia salina bioassay

    Directory of Open Access Journals (Sweden)

    Raíza Cavalcante Fonseca

    2013-06-01

    Full Text Available Artemia salina bioassay was used to assess toxicity of seeds and kernels of Brazilian fruits from cerrado (central high plains region and other inner regions of the country. Water extracts of the kernels were filtered and added to Artemia cultures containing ten individuals per mL. Dose - response curves were constructed, and LD50 values were calculated. Pure potassium cyanide standard was used to draw a calibration curve for comparison to detect the presence of cyanide in the samples tested. Extracts of the seeds of araticum, mangaba, cagaita, jatobá, and tucumã were found toxic to Artemia salina, and some of the dose - response curves were very similar in shape to those obtained with pure potassium cyanide standards, while the samples of baru, cajá-manga, siriguela, trauma, and veludo showed no toxicity at all. The Guignard test, specific for cyanide detection, showed negative results in all toxic samples, suggesting the presence of other toxic compounds rather than cyanide. The comparison of araticum dose - response curve with those of other annonaceous fruits suggests the presence acetogenins as the main toxic compounds in the seeds. These results could be useful to prevent poisoning by industrial derivatives of the fruits studied.

  6. The study of fkbp and ubiquitin reveals interesting aspects of Artemia stress history.

    Science.gov (United States)

    Maniatsi, Stefania; Farmaki, Theodora; Abatzopoulos, Theodore J

    2015-08-01

    Research on stress responses in animals has increased greatly during the last decades. Though most studies focus on the cellular and molecular bases of the stress response mechanisms, the ecological and evolutionary aspects of stress responses gain more and more interest. Here, we use species and parthenogenetic strains of the genus Artemia, an extremophile model organism, to study, for the first time, a protein well known for its chaperone activity and its involvement in stress responses. More specifically, transcription and protein accumulation of an FK506-Binding Protein (FKBP) homologue were investigated under heat and salt stresses. Additionally, the mRNA levels of ubiquitin, a heat-inducible protein related to the proteasomal pathway, were quantitated under these conditions. Biochemical and phylogenetic analyses showed that the studied FKBP orthologue is a typical representative of the family that clusters with other crustacean sequences. The expression was increased in both fkbp and ubiquitin genes after salt and heat stresses. However, our results in combination with the fact that Artemia species and parthenogenetic strains, selected for this study, exhibit different heat or salt tolerance provide useful hints about the evolutionary significance of FKBP and ubiquitin. Regarding FKBP, mRNA expression and protein accumulation seem to depend on the environmental conditions and the evolutionary history of each Artemia population while ubiquitin has a clear and more conserved role under heat shock.

  7. Mechanisms associated with cellular desiccation tolerance of Artemia encysted embryos from locations around the world.

    Science.gov (United States)

    Hengherr, Steffen; Schill, Ralph O; Clegg, J S

    2011-10-01

    Using differential scanning calorimetry we demonstrated the presence of biological glasses and measured the glass transition temperatures (Tg) in dry encysted gastrula embryos (cysts) of the brine shrimp, Artemia, from eleven different locations, two of which provided cysts from parthenogenetic animals. Values for Tg were highest, by far, in Artemia franciscana cysts from the Mekong Delta, Vietnam (VN), these cysts having been produced from previous sequential inoculations into growth ponds of cysts from the San Francisco Bay, California, USA. Tg values for three groups of A. franciscana cysts were significantly higher than those of other cysts (except those of Artemia persimilis) studied here, as well as all other desiccation-tolerant animal systems studied to date. We also measured three stress proteins (hsc70, artemin and p26) in all these cysts as well as the total alcohol soluble carbohydrates (ASC), about 90% of which is the disaccharide trehalose, a known component of biological glasses. We interpret the results in terms of mechanisms involved with desiccation tolerance and, to some extent, with thermal conditions at the sites of cyst collection.

  8. Automatic Estimation of Artemia Hatching Rate Using an Object Discrimination Method

    Directory of Open Access Journals (Sweden)

    Sung Kim

    2013-09-01

    Full Text Available Digital image processing is a process to analyze a large volume of information on digital images. In this study, Artemia hatching rate was measured by automatically classifying and counting cysts and larvae based on color imaging data from cyst hatching experiments using an image processing technique. The Artemia hatching rate estimation consists of a series of processes; a step to convert the scanned image data to a binary image data, a process to detect objects and to extract their shape information in the converted image data, an analysis step to choose an optimal discriminant function, and a step to recognize and classify the objects using the function. The function to classify Artemia cysts and larvae is optimally estimated based on the classification performance using the areas and the plan-form factors of the detected objects. The hatching rate using the image data obtained under the different experimental conditions was estimated in the range of 34-48%. It was shown that the maximum difference is about 19.7% and the average root-mean squared difference is about 10.9% as the difference between the results using an automatic counting (this study and a manual counting were compared. This technique can be applied to biological specimen analysis using similar imaging information.

  9. Regulation of trehalase expression inhibits apoptosis in diapause cysts of Artemia.

    Science.gov (United States)

    Yang, Fan; Chen, Su; Dai, Zhong-Min; Chen, Dian-Fu; Duan, Ru-Bing; Wang, Hong-Liang; Jia, Sheng-Nan; Yang, Wei-Jun

    2013-12-01

    Trehalase, which specifically hydrolyses trehalose into glucose, plays an important role in the metabolism of trehalose. Large amounts of trehalose are stored in the diapause encysted embryos (cysts) of Artemia, which are not only vital to their extraordinary stress resistance, but also provide a source of energy for development after diapause is terminated. In the present study, a mechanism for the transcriptional regulation of trehalase was described in Artemia parthenogenetica. A trehalase-associated protein (ArTAP) was identified in Artemia-producing diapause cysts. ArTAP was found to be expressed only in diapause-destined embryos. Further analyses revealed that ArTAP can bind to a specific intronic segment of a trehalase gene. Knockdown of ArTAP by RNAi resulted in the release of cysts with coarse shells in which two chitin-binding proteins were missing. Western blotting showed that the level of trehalase was increased and apoptosis was induced in these ArTAP-knockdown cysts compared with controls. Taken together, these results show that ArTAP is a key regulator of trehalase expression which, in turn, plays an important role in trehalose metabolism during the formation of diapause cysts.

  10. Laboratory generation of new parthenogenetic lineages supports contagious parthenogenesis in Artemia

    Directory of Open Access Journals (Sweden)

    Marta Maccari

    2014-06-01

    Full Text Available Contagious parthenogenesis—a process involving rare functional males produced by a parthenogenetic lineage which mate with coexisting sexual females resulting in fertile parthenogenetic offspring—is one of the most striking mechanisms responsible for the generation of new parthenogenetic lineages. Populations of the parthenogenetic diploid brine shrimp Artemia produce fully functional males in low proportions. The evolutionary role of these so-called Artemia rare males is, however, unknown. Here we investigate whether new parthenogenetic clones could be obtained in the laboratory by mating these rare males with sexual females. We assessed the survival and sex ratio of the hybrid ovoviviparous offspring from previous crosses between rare males and females from all Asiatic sexual species, carried out cross-mating experiments between F1 hybrid individuals to assess their fertility, and estimated the viability and the reproductive mode of the resulting F2 offspring. Molecular analysis confirmed the parentage of hybrid parthenogenetic F2. Our study documents the first laboratory synthesis of new parthenogenetic lineages in Artemia and supports a model for the contagious spread of parthenogenesis. Our results suggest recessive inheritance but further experiments are required to confirm the likelihood of the contagious parthenogenesis model.

  11. Monitoring the Effect of Metal Ions on the Mobility of Artemia salina Nauplii.

    Science.gov (United States)

    Kokkali, Varvara; Katramados, Ioannis; Newman, Jeffrey D

    2011-03-28

    This study aims to measure the effect of toxic aqueous solutions of metals on the mobility of Artemia salina nauplii by using digital image processing. The instrument consists of a camera with a macro lens, a dark chamber, a light source and a laptop computer. Four nauplii were inserted into a macro cuvette, which contained copper, cadmium, iron and zinc ions at various concentrations. The nauplii were then filmed inside the dark chamber for two minutes and the video sequence was processed by a motion tracking algorithm that estimated their mobility. The results obtained by this system were compared to the mortality assay of the Artemia salina nauplii. Despite the small number of tested organisms, this system demonstrates great sensitivity in quantifying the mobility of the nauplii, which leads to significantly lower EC50 values than those of the mortality assay. Furthermore, concentrations of parts per trillion of toxic compounds could be detected for some of the metals. The main novelty of this instrument relies in the sub-pixel accuracy of the tracking algorithm that enables robust measurement of the deterioration of the mobility of Artemia salina even at very low concentrations of toxic metals.

  12. Toxicity and characterization of cholinesterase-inhibition induced by diisopropyl fluorophosphate in Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Barahona, M V

    2009-03-01

    The acute toxicity of diisopropyl fluorophosphate (DFP) on three age classes of Artemia salina was evaluated. An increase in toxicity of this organophosphorous (OP) compound was found following longer development of A. salina larvae. The effects of pretreatment with the non-selective muscarinic antagonist atropine, the two reversible acetylcholinesterase inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on DFP-induced lethality in 24h Artemia were also investigated. The lethal action of DFP was not prevented by pretreatment of 24h Artemia with atropine, physostigmine, and pyridostigmine, while 2-PAM proved effective against intoxication with this OP compound. The inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM or physostigmine were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Pretreatment with 2-PAM (10(-6)M) plus physostigmine or pyridostigmine was ineffective. These results suggest that the combinations of atropine plus 2-PAM or physostigmine are effective in the prevention of the lethal effects induced by DFP in A. salina larvae.

  13. On a parthenogenetic population of Artemia (Crustacea, Branchiopoda from Algeria (El-Bahira, Sétif

    Directory of Open Access Journals (Sweden)

    Mounia Amarouayache

    2015-12-01

    Full Text Available The brine shrimp Artemia is a small crustacean of hypersaline lakes which is commonly used in larviculture. The parthenogenetic population of Artemia from El-Bahira Lake (10 ha area, situated in the High Plateaus of Northeastern Algeria (1034 m alt, has been characterized and surveyed during two hydroperiods of 2009 and 2013. Contrary to other known parthenogenetic populations, which develop in hot seasons and reproduce by ovoviviparity, Artemia from El-Bahira was found to develop only in cold seasons (winter and spring, even if the lake doesn’t dry in summer. It reproduces by oviparity and produces few cysts (5.69 ± 3.6 and 98.00 ± 28.32 offsprings/brood. Individual density was much lower during the hydroperiod of 2013, whereas fecundity was higher than in the previous hydroperiod (2009. Cyst reserve was estimated at 133.13 kg of dry weight which corresponds to a rate of 13.31 kg.ha-1.

  14. Caracterización de la conservación de alimentos en diferentes instalaciones.

    OpenAIRE

    Tamara Díaz Lorenzo; Marta Cardona Gálvez; Angel Caballero Torres; Pedro Morejon Martin; Yariela Sánchez Azahares

    2005-01-01

    La conservación es uno de los elementos que influyen en la calidad sanitaria de los alimentos a lo largo de la cadena alimentaria. Las enfermedades transmitidas por los alimentos se presentan con alta incidencia en nuestro país y constituyen un problema de salud y la conservación adecuada de los alimentos una de las medidas de prevención más importante para evitar su aparición, con el objetivo de caracterizar el comportamiento de la conservación de los alimentos en diferentes instalaciones de...

  15. Fontes de espermina e atividade antioxidante in vivo

    OpenAIRE

    Cecilia Muller Bandeira

    2011-01-01

    Este trabalho teve como objetivo avaliar o efeito antioxidante in vivo da poliamina espermina. Foi pesquisada a presença desta amina em alimentos e subprodutos (fígado, testículo, casca de maracujá e milho) como fonte para extração e posterior uso em dieta animal. Diferentes tipos de milho foram analisados também para verificação do potencial deste alimento como fonte de espermina para a dieta humana. Utilizandose cromatografia em coluna a espermina foi extraída a partir de extrato de fígado....

  16. Cytological, molecular and life cycle characterization of Anostracospora rigaudi n. g., n. sp. and Enterocytospora artemiae n. g., n. sp., two new microsporidian parasites infecting gut tissues of the brine shrimp Artemia.

    Science.gov (United States)

    Rode, Nicolas Olivier; Landes, Julie; Lievens, Eva J P; Flaven, Elodie; Segard, Adeline; Jabbour-Zahab, Roula; Michalakis, Yannis; Agnew, Philip; Vivarès, Christian P; Lenormand, Thomas

    2013-08-01

    Two new microsporidia, Anostracospora rigaudi n. g., n. sp., and Enterocytospora artemiae n. g., n. sp. infecting the intestinal epithelium of Artemia parthenogenetica Bowen and Sterling, 1978 and Artemia franciscana Kellogg, 1906 in southern France are described. Molecular analyses revealed the two species belong to a clade of microsporidian parasites that preferentially infect the intestinal epithelium of insect and crustacean hosts. These parasites are morphologically distinguishable from other gut microsporidia infecting Artemia. All life cycle stages have isolated nuclei. Fixed spores measure 1·3×0·7 μm with 5-6 polar tube coils for A. rigaudi and 1·2×0·9 μm with 4 polar tube coils for E. artemiae. Transmission of both species is horizontal, most likely through the ingestion of spores released with the faeces of infected hosts. The minute size of these species, together with their intestinal localization, makes their detection and identification difficult. We developed two species-specific molecular markers allowing each type of infection to be detected within 3-6 days post-inoculation. Using these markers, we show that the prevalence of these microsporidia ranges from 20% to 75% in natural populations. Hence, this study illustrates the usefulness of molecular approaches to study prevalent, but cryptic, infections involving microsporidian parasites of gut tissues.

  17. Accumulation of mercury by Artemia populations of different salinas of Portugal

    Energy Technology Data Exchange (ETDEWEB)

    Boia, C.M.; Duarte, A.C. [Univ. of Aveiro (Portugal)

    1995-12-31

    The total mercury content in samples of the brine shrimp Artemia, sediments, water, suspended matter and, when available, algae, from nine salines of Portugal, was evaluated, to find out how mercury present in its natural habitat accumulates in Artemia. This study, carried out between 1990 and 1993, was part of a larger research project aiming to contribute to the knowledge on mercury accumulation and its effects on Artemia. This crustacean is used worldwide for marine species feeding in aquafarms, including in Portugal. The following sampling sites were chosen: some salinas of the lagoon of Aveiro, situated in the northern region of Portugal and partially contaminated with mercury-, the salt-mines of Rio Maior, in the interior of the central region of the country, where there are no sediments (the floor is cemented); and salt-marshes in the Algarve, in the south of Portugal. Mercury was determined by cold vapor absorption espectrofotometry after digestion of samples with sulfuric acid and potassium permanganate, and reference materials have been used to control the analytical performance. The concentrations of total Hg varied from 0.014 to 0.36 mg/Kg in the sediments, 0 to 0.30 {micro}g/g in the Artemia, 0.17 to 0.84 {micro}g/l in the suspended matter and 0.09 to 0.56 {micro}g/l in the water. The content of mercury in the artemias was strongly related to the concentration in the sediments, except when the algae were present, because they also accumulate a significantly percentage of the mercury. No relationships could be established with the Hg in water or in suspended matter (in mass of Hg/volume of filtered water), because their, content in Hg varied a lot with time and weather conditions, such as the wind strength. The presence of Hg in the sediments was due either to significant containing Hg discharges or to the composition of the sediments, being more important in the case of clays.

  18. Sustentabilidade quanto às embalagens de alimentos no Brasil

    Directory of Open Access Journals (Sweden)

    Ana Paula Miguel Landim

    2016-01-01

    Full Text Available Resumo A mudança de hábito e o aumento do consumismo nas últimas décadas levaram a inovações tecnológicas e consequentemente à maior produção de bens de consumo, o que gerou um aumento na produção de embalagens. As embalagens estão presentes em diversos setores, dentre eles destacam-se as indústrias de alimentos, nas quais as embalagens têm como principal função contribuir para conservação do alimento, além de vender o produto. Diferentes materiais são utilizados na fabricação de embalagens para alimentos, sendo eles os plásticos, metais, vidro e celulose. Cada material possui suas diferentes características para conservar o produto, dentre elas as principais são propriedade de barreira a gases, aroma, luz, água, microrganismos e resistência mecânica. No entanto, apesar das diversas vantagens de sua utilização, seu uso e descarte desordenado gera um grande volume de resíduos sólidos, que estão associados ao impacto ambiental. Em preocupação a essa situação têm-se buscado meios alternativos para reduzir tais impactos podendo destacar a reutilização e reciclagem das embalagens, bem como o desenvolvimento de polímeros verdes e materiais biodegradáveis.

  19. Secado de alimentos mediante energía solar

    OpenAIRE

    Saiz Jimenez, Juan Ángel; CORNEJO ROYO, LAURA

    2015-01-01

    [EN] Food drying it is a technical used to preserved food. The purpose of this practice, which has been used since ancient times, it is to extract the water inside the food, avoiding bacteria growth and their proliferation. Food dehydration can be realized using solar energy. These ideas provide a basis for the project about the food drier done by Grupo Solar of Universidad Politécnica de Valencia. [ES] El secado de alimentos es una práctica que viene utilizándose desde la anti...

  20. Interface Entre Obesos Severos e Atividade Laboral Relacionada a Alimentos

    OpenAIRE

    2011-01-01

    A obesidade é uma doença multifatorial e envolve um grande número de determinantes na sua etiologia. O preconceito social a que o obeso é submetido pode ser mais prejudicial do que os problemas de saúde decorrentes da “doença”. O objetivo deste estudo foi investigar a interface entre obesos severos e a atividade laboral relacionada a alimentos. Trata-se de uma pesquisa do tipo transversal, descritiva e documental, que envolve indivíduos de ambos os sexos, portadores de obesidade severa cadast...

  1. Microorganismos responsables de alteraciones en alimentos altamente azucarados

    OpenAIRE

    2012-01-01

    Las levaduras osmotolerantes son la principal causa de alteración de los alimentos altamente azucarados. En este trabajo se han identificado un gran número de cepas de levaduras y algunas de hongos filamentosos aisladas en su mayoría de productos a base de mazapán. Para la recuperación de estas cepas a partir de sus sustratos originales se han empleado principalmente medios con alta concentación de azúcar, para evitar el choque osmótico. Entre las levaduras, la especie aislada con más frecuen...

  2. The effects of feeding with synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia on skin mucus immune responses, stress resistance, intestinal microbiota and performance of angelfish (Pterophyllum scalare).

    Science.gov (United States)

    Azimirad, Mahmood; Meshkini, Saeed; Ahmadifard, Nasrollah; Hoseinifar, Seyed Hossein

    2016-07-01

    The aim of this study was to evaluate the effects of feeding on synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia franciscana on skin mucus immune responses, stress resistance, intestinal microbiota and growth performance of angelfish (Pterophyllum scalare). Three hundred and sixty fish with initial weight 3.2 ± 0.13 g were randomly divided into twelve aquaria (50 L) assigned to four groups in triplicates. Fish were fed for 7 weeks with dietary treatments, including treatment 1: feeding adult Artemia without enrichment (control group), treatment 2: feeding adult Artemia enriched with lyophilised probiotic P. acidilactici (700 mg L(-1)), 3: feeding adult Artemia enriched with prebiotic fructooligosaccharide (FOS) (100 mg L(-1)), group 4: feeding adult Artemia enriched with synbiotic (P. acidilactici (700 mg L(-1)) + FOS (100 mg L(-1))). Skin mucus immune responses (lysozyme activity, total Immunoglobulin and protease), stress resistance against environmental stress (acute decrease of temperature and increase salinity), intestinal microbiota as well as growth indices were measured at the end of feeding trial. Artemia enriched with synbiotic significantly improved growth performance compared to other treatments (P Artemia enriched with synbiotic (P Artemia was more effective than singular enrichment with probiotics or prebiotics.

  3. Feeding of the brine shrimp Artemia on yeast: effect of mechanical disturbance, animal density, water quality and light intensity

    OpenAIRE

    Coutteau, P. (Peter); Sorgeloos, P.

    1989-01-01

    Details are given of experiments conducted to determine the effects of tank culture conditions on the feeding of Artemia. Mechanical disturbance, animal density and water quality were found to affect the feeding rate of Artemia. The importance of culture conditions in maintaining a rate of food consumption which does not limit the growth of the brine shrimp is stressed.

  4. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Directory of Open Access Journals (Sweden)

    Behnam Shekarchi

    2016-02-01

    Full Text Available Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME (3.5% v/v. Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P < 0.05. So, the results showed that Artemia urmiana adults individuals that fed with 2MEtreated yeasts had the highest growth and total length. These results were confirmed with growth measurement in adult individuals of Artemia. Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  5. Efficacy of heterologous and homologous heat shock protein 70s as protective agents to Artemia franciscana challenged with Vibrio campbellii.

    Science.gov (United States)

    Baruah, Kartik; Ranjan, Jayant; Sorgeloos, Patrick; Bossier, Peter

    2010-11-01

    The Hsp70 class of heat shock proteins (Hsps) has been implicated at multiple points in the immune response of both vertebrates and invertebrates. This class of chaperones is highly conserved in both sequence and structure, from prokaryotes to higher eukaryotes. In view of their high degree of homology, it was assumed that these Hsp70 proteins derived either from the prokaryotes or eukaryotes would have similar functions, especially in relation to their protective ability in a challenge assay. To verify this, we compared two evolutionary diverse Hsp70s, Artemia Hsp70 and Escherichia coli Hsp70 equivalent DnaK (each overproduced in E.coli), for their ability to protect Artemia against Vibrio challenge. Results showed that Artemia fed with E. coli producing Artemia Hsp70 or DnaK proteins, as assessed by immune-probing in western blots, survived better in a Vibrio challenge assay. The observed effects could be due to enhancement of the Artemia immune system as phenoloxidase activity was found to be increased by these proteins. These two Hsp70 proteins exhibit a high degree of homology, particularly in the peptide-binding domain (the putative innate immunity-activating portion) with 59.6% identity, indicating that the observed protective capacity of homologous or heterologous Hsp70 proteins might reside within this peptide-binding domain.

  6. Comparative study of the assay of Artemia salina L. and the estimate of the medium lethal dose (LD50 value) in mice, to determine oral acute toxicity of plant extracts.

    Science.gov (United States)

    Logarto Parra, A; Silva Yhebra, R; Guerra Sardiñas, I; Iglesias Buela, L

    2001-09-01

    Artemia salina L. (Artemiidae), the brine shrimp larva, is an invertebrate used in the alternative test to determine toxicity of chemical and natural products. In this study the Medium Lethal Concentrations (LC50 value) of 20 plant extracts, Aloe vera (L.) Burm. F. (Aloeaceae), Artemisia absinthium L. (Asteraceae); Citrus aurantium L. (Rutaceae); Cymbopogon citratus (DC. Ex Nees) Stapf (Poaceae); Datura stramonium L. (Solanaceae); Justicia pectoralis Jacq. (Acanthaceae); Musa x paradisiaca L. (Musaceae); Ocimum basilicum L.; O. gratissimum L.; O. tenuiflorum L. (Lamiaceae); Pimenta dioica (L.) Merr. (Myrtaceae); Piper auritum Kunth (Piperaceae); Plantago major L. (Plantaginaceae); Plectranthus amboinicus (Lour.) Spreng. (Lamiaceae); Ruta graveolens L. (Rutaceae); Senna alata (L.) Roxb. (Fabaceae); Stachytarpheta jamaicensis (L.) Vahl (Verbenaceae); and Thuja occidentalis L. (Cupressaceae), were determined using Artemia salina L. (Artemiidae), with the objective of relating the results to the LD50 values reported in mice (tested at three concentrations: 10, 100, and 1000 microg/mL, for each extract). We found good correlation between the in vivo and the in vitro tests (r = 0.85 p < 0.05), and this method is a useful tool for predicting oral acute toxicity in plant extracts.

  7. Organización Mundial de la Salud. Inocuidad de los alimentos

    OpenAIRE

    Organización mundial de la salud

    2015-01-01

    Las enfermedades transmitidas por los alimentos suponen una importante carga para la salud. Millones de personas enferman y muchas mueren por consumir alimentos insalubres. Los Estados Miembros, seriamente preocupados, adoptaron en el año 2000 una resolución en la cual se reconoce el papel fundamental de la inocuidad alimentaria para la salud pública.

  8. Canasta Básica de Alimentos Basic Food Basket

    Directory of Open Access Journals (Sweden)

    Cecilia Antún

    2010-06-01

    Full Text Available En abril de 2009 se conformó en la Asociación Argentina de Dietistas y Nutricionistas Dietistas el Grupo de Estudio sobre Soberanía Alimentaria, constituido por un grupo de licenciados en nutrición con interés en el tema. Como primer objetivo, el Grupo se propuso estudiar tres temas: "el Derecho a la Alimentación", "la Producción y Disponibilidad de alimentos en Argentina" y "la Canasta Básica de Alimentos". En el presente artículo se expone un resumen de los avances en el tercer tema mencionado.In April 2009, the Argentina Association of Dietitians and Nutritionists-Dietitians formed the Study Group on Food Sovereignty, made up of graduates in Nutrition having an interest in the subject. As a first objective, the Group decided to study three subjects: "The Right to Food", "Production and Availability of Food in Argentina" and "Basic Food Basket." This article is a summary of the progress made on the third subject mentioned.

  9. Considerações sobre biologia e utilização de Artemia sp. (CRUSTACEA: BRANCHIOPODA: ANOSTRACA – considerations about biology and use of Artemia sp. (CRUSTACEA: BRANCHIOPODA: ANOSTRACA

    Directory of Open Access Journals (Sweden)

    Jean Michel Corrêa1

    2011-12-01

    Full Text Available ResumoA produção do microcrustáceo Artemia sp. no Brasil encontra-se voltada para uso em cultivos de larvas de crustáceos e peixes, de elevado valor comercial, sendo utilizadas vivas, como náuplios ou adultos, comobiomassa congelada e também microencapsulada.Abstract The production of microcrustacean Artemia sp. in Brazil is aimed for use in fish and crustacean larvae culture, with high commercial value, being used live, as nauplii or adults, as frozen biomass and microencapsulated.

  10. Activation of an AMP-activated protein kinase is involved in post-diapause development of Artemia franciscana encysted embryos

    Directory of Open Access Journals (Sweden)

    Dai Jie-Qiong

    2009-03-01

    Full Text Available Abstract Background Cysts of Artemia can remain in a dormant state for long periods with a very low metabolic rate, and only resume their development with the approach of favorable conditions. The post-diapause development is a very complicated process involving a variety of metabolic and biochemical events. However, the intrinsic mechanisms that regulate this process are unclear. Results Herein we report the specific activation of an AMP-activated protein kinase (AMPK in the post-diapause developmental process of Artemia. Using a phospho-AMPKα antibody, AMPK was shown to be phosphorylated in the post-diapause developmental process. Results of kinase assay analysis showed that this phosphorylation is essential for AMPK activation. Using whole-mount immunohistochemistry, phosphorylated AMPK was shown to be predominantly located in the ectoderm of the early developed embryos in a ring shape; however, the location and shape of the activation region changed as development proceeded. Additionally, Western blotting analysis on different portions of the cyst extracts showed that phosphorylated AMPKα localized to the nuclei and this location was not affected by intracellular pH. Confocal microscopy analysis of immunofluorescent stained cyst nuclei further showed that AMPKα localized to the nuclei when activated. Moreover, cellular AMP, ADP, and ATP levels in developing cysts were determined by HPLC, and the results showed that the activation of Artemia AMPK may not be associated with cellular AMP:ATP ratios, suggesting other pathways for regulation of Artemia AMPK activity. Conclusion Together, we report evidence demonstrating the activation of AMPK in Artemia developing cysts and present an argument for its role in the development-related gene expression and energy control in certain cells during post-diapause development of Artemia.

  11. Alimentos disfrazados. De la metáfora al fraude Alimentos disfrazados. De la metáfora al fraude

    Directory of Open Access Journals (Sweden)

    Rafael Díaz Maderuelo

    2006-10-01

    Full Text Available Every culinary elaboration supposes a transformation of meats. In several occasions the domestic or professional culinary ability has permitted to mislead foods to represent some aspects of reality. Since the rise of the World Food System of Industrial Production, the traditional proceedings of misleading foods have been moved from the kitchen to the alimentary industries and, frequently, the have been converted in technological ways of adulteration and food-fraud, until such point that —at present— expressions as “to know what we eat” are based only in the confidence that the consumer deposits in certain marks and labels.Toda elaboración culinaria supone una transformación de los alimentos. En ocasiones la habilidad técnica de cocineros, domésticos o profesionales, ha permitido disfrazarlos para representar ciertos aspectos de la realidad. Desde la implantación del sistema alimentario mundial de producción industrial, las formas de disfrazar los alimentos de han trasladado de la cocina a las industrias y, con frecuencia, se han convertido en técnicas de adulteración y fraude, hasta tal punto que en la actualidad expresiones como “saber lo que comemos” se basan solamente en la confianza que el consumidor deposita en ciertos legitimadores como las marcas y las etiquetas.

  12. Influence of a long duration exposure, 69 months, to the space flight factors in Artemia cysts, tobacco and rice seeds

    Science.gov (United States)

    Planel, H.; Gaubin, Y.; Pianezzi, B.; Delpoux, M.; Bayonove, J.; Bès, J. C.; Heilmann, C.; Gasset, G.

    1994-10-01

    Three french laboratories have participated in the Free Flyer Biostack experiment. Artemia cysts, tobacco seeds and rice caryopsis and embryos were used. Biological objects in monolayers were dead. In opposite, a large fraction of samples used in bulk survived. A stimulatory effect occurred in the first steps of development in Artemia cysts. In fact, the larval survival was unchanged or slightly reduced. In tobacco a drastic decrease in germination and survival rate was observed. Space flight did not induce genetic changes. In rice, results depend on the variety which was investigated; the growth rate stimulation in flight samples is discussed with respect to controls.

  13. Sex-dependent transcriptome analysis and single nucleotide polymorphism (SNP) discovery in the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Valenzuela-Miranda, Diego; Gallardo-Escárate, Cristian; Valenzuela-Muñoz, Valentina; Farlora, Rodolfo; Gajardo, Gonzalo

    2014-10-29

    In order to enhance genomic resources for the brine shrimp Artemia franciscana, RNA-Seq analysis was conducted for adult females and males. Through de novo assembly, 36,896 high quality contigs were obtained, of which 13,749 sequences were annotated with arthropod sequences. Just 4.5% matched against previously reported sequences for Artemia spp. Additionally, different transcriptional patterns between males and females were found, evidencing sex-related transcriptional responses. Furthermore, 221 and 534 putative SNPs were identified exclusively in males and females, respectively. These results will build the foundation for further genomic studies in A. franciscana.

  14. 用卤虫(Artemia salina L.)评价杀虫活性%Evaluate Insecticidal Activity Using Artemia salina L.

    Institute of Scientific and Technical Information of China (English)

    王再强; 周红; 韩俊; 何月秋; 录丽平

    2011-01-01

    [Aims]Artemia salina L.is general used for preliminary assessment of pharmacological activity.However,it is necessary to evaluate the suitability of A.salina L.before it is used as a model material for screening insecticidal activity.Here, 14 insecticides with 10 different action mechanisms were selected to evaluate insecticidal activity against A.salina L.used as a model material.[Results]13 Insecticides significantly killed A.salina L., Moulting hormone agonist and compound stimulating GABA release were the most active.[Conclusions]A.salina L.is a suitable organism to evaluate insecticidal activity and the method is simple having good sensitivity to many insecticides with different action mechanisms.%[目的]以卤虫(Artemia salina L.)为模式生物对化合物的药理活性进行初步评价.对10种不同作用机制的14种杀虫剂进行了生物筛选试验.[结果]14种供试杀虫剂中有13种对卤虫有显著的毒杀效果,作用于以γ-氨基丁酸为神经递质传导系统的化合物及蜕皮激素类似物效果最为显著.[结论]用卤虫筛选杀虫剂活性的方法简便,对多种作用机制的杀虫剂灵敏.

  15. Evolutionary origin and phylogeography of the diploid obligate parthenogen Artemia parthenogenetica (Branchiopoda: Anostraca.

    Directory of Open Access Journals (Sweden)

    Joaquín Muñoz

    Full Text Available BACKGROUND: Understanding the evolutionary origin and the phylogeographic patterns of asexual taxa can shed light on the origin and maintenance of sexual reproduction. We assessed the geographic origin, genetic diversity, and phylogeographic history of obligate parthenogen diploid Artemia parthenogenetica populations, a widespread halophilic crustacean. METHODOLOGY/PRINCIPAL FINDINGS: We analysed a partial sequence of the Cytochrome c Oxidase Subunit I mitochondrial gene from an extensive set of localities (including Eurasia, Africa, and Australia, and examined their phylogeographic patterns and the phylogenetic relationships of diploid A. parthenogenetica and its closest sexual relatives. Populations displayed an extremely low level of mitochondrial genetic diversity, with one widespread haplotype shared by over 79% of individuals analysed. Phylogenetic and phylogeographic analyses indicated a multiple and recent evolutionary origin of diploid A. parthenogenetica, and strongly suggested that the geographic origin of parthenogenesis in Artemia was in Central Asia. Our results indicate that the maternal sexual ancestors of diploid A. parthenogenetica were an undescribed species from Kazakhstan and A. urmiana. CONCLUSIONS/SIGNIFICANCE: We found evidence for multiple origin of parthenogenesis in Central Asia. Our results indicated that, shortly after its origin, diploid A. parthenogenetica populations underwent a rapid range expansion from Central Asia towards the Mediterranean region, and probably to the rest of its current geographic distribution. This contrasts with the restricted geographic distribution, strong genetic structure, and regional endemism of sexual Artemia lineages and other passively dispersed sexual continental aquatic invertebrates. We hypothesize that diploid parthenogens might have reached their current distribution in historical times, with a range expansion possibly facilitated by an increased availability of suitable

  16. Evaluation of alpha and gamma aluminum oxide nanoparticle accumulation, toxicity, and depuration in Artemia salina larvae.

    Science.gov (United States)

    Ates, Mehmet; Demir, Veysel; Arslan, Zikri; Daniels, James; Farah, Ibrahim O; Bogatu, Corneliu

    2015-01-01

    In this study, Artemia salina (crustacean filter feeders) larvae were used as a test model to investigate the toxicity of aluminum oxide nanoparticles (Al2O3 NPs) on marine microorganisms. The uptake, toxicity, and elimination of α-Al2O3 (50 nm and 3.5 μm) and γ-Al2O3 (5 nm and 0.4 μm) NPs were studied. Twenty-four and ninety-six hour exposures of different concentrations of Al2O3 NPs to Artemia larvae were conducted in a seawater medium. When suspended in water, Al2O3 NPs aggregated substantially with the sizes ranging from 6.3 nm to >0.3 µm for spherical NPs and from 250 to 756 nm for rod-shaped NPs. The phase contrast microscope images showed that NPs deposited inside the guts as aggregates. Inductively coupled plasma mass spectrometry analysis showed that large particles (3.5 μm α-Al2O3) were not taken up by Artemia, whereas fine NPs (0.4 μm γ-Al2O3) and ultra-fine NPs (5 nm γ-Al2O3 and 50 nm α-Al2O3) accumulated substantially. Differences in toxicity were detected as changing with NP size and morphology. The malondialdehyde levels indicated that smaller γ-Al2O3 (5 nm) NPs were more toxic than larger γ-Al2O3 (0.4 µm) particulates in 96 h. The highest mortality was measured as 34% in 96 h for γ-Al2O3 NPs (5 nm) at 100 mg/L (LC50 > 100 mg/L). γ-Al2O3 NPs were more toxic than α-Al2O3 NPs at all conditions.

  17. Toxicity of Five Phenolic Compounds to Brine Shrimp Artemia sinica(Crustacea:Artemiidae)

    Institute of Scientific and Technical Information of China (English)

    Ali Shaukat; LIU Guangxing; LI Zhengyan; XU Donghui; HUANG Yousong; CHEN Hongju

    2014-01-01

    The acute toxicity of five phenolic compounds each to 15 d old Artemia sinica was determined in this study. The brine shrimp A. sinica was hatched from the encysted dry eggs (Bohai Bay Brand) produced by Dongying Ocean Artemia Co., Ltd., China at 27℃± 1℃in pre-filtered (through pores of 0.45 µm in diameter) and autoclaved seawater (salinity 31, pH 7.5-8.0) in a cilindroconical glass beaker (2000 mL in volume) under continuous illumination (provided by a side set 20 W fluorescent lamp) with slight aeration. Ten Artemia individuals from the same batch of the hatched were cultured in 10 mL toxicant solution prepared with seawater (salinity 31, pH 7.5-8.0) at room temperature (about 20℃) to determine 24 h, 48 h and 72 h medium lethal concentration (LC50) of 5 phenolic compounds each. It was found that the toxicity of n-heptylphenol was the highest followed by nonylphenol, t-butylphenol, 2,4-dichlorophenol and bisphenol A in order. The LC50 values of the 5 compounds were calculated with regression analysis. The real concentration (in µg L-1) of 5 phenolic compounds each in toxicant solutions was measured with GC/MS analysis. Significant loss of phenolic compounds caused by either adsorption or desorption was not found. The significant difference of LC50 values was found among the five compounds 3 exposure times each. The range between the highest no-observed-effect concentration (NOEC) and 100%death causing concentration of five phenolic compounds each was determined. The toxicity in term of 24 h LC50 value of n-HP was 9.10 times higher than that of BPA, 1.71 times higher than t-BP, 1.53 times higher than 2,4-DCP and 1.36 times higher than NP, respectively.

  18. Larval helminths in the invasive American brine shrimp Artemia franciscana throughout its annual cycle.

    Science.gov (United States)

    Georgiev, Boyko B; Angelov, Aleksandar; Vasileva, Gergana P; Sánchez, Marta I; Hortas, Francisco; Mutafchiev, Yasen; Pankov, Plamen; Green, Andy J

    2014-09-01

    One of the best examples of rapid displacement of native species by an invader is the eradication of native Artemia salina and A. parthenogenetica in the Mediterranean by the introduced American A. franciscana. Previous studies based on sampling from limited time periods suggest that the success of the American species as a competitor may be due partly to different parasite burden, since native Artemia spp. have high cestode infection rates regulating their density. The aim of this study is to test the hypothesis that the helminth infection in A. franciscana in its invasive range is low throughout its annual life cycle. Samples of A. franciscana were collected every second month from La Tapa saltern (Andalusia) during one year. Five helminth species were recorded: cestodes Flamingolepis liguloides, F. flamingo, Gynandrotaenia stammeri (all flamingo parasites), Eurycestus avoceti (a shorebird parasite) and larval spirurids of the Acuariinae (the first record of nematodes in Artemia). The overall infection rate was low, with total prevalence 5.9% and prevalence of individual parasite species between 0.2 and 3.2%. The mean abundance of helminths was 0.005-0.155 (av. 0.068), 5-13 times lower than in native congeners. Waterbird counts indicate that the low infection rates cannot be explained by lack of definitive hosts. The results are consistent with the hypothesis that helminths have no regulating effect on the invasive brine shrimp in the Mediterranean. The replacement of the native populations by the invader can be partially explained by a competition mediated by parasites/predators through a differential impact on host fitness.

  19. Expression and characterization of the JAK kinase and STAT protein from brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Cheng, Chia-Hsiung; Chen, Gen-Der; Yeh, Maw-Sheng; Chu, Cheng-Ying; Hsu, Ya-Li; Hwang, Pung-Pung; Huang, Fore-Lien; Huang, Chang-Jen

    2010-01-01

    In this study, we isolated and characterized both JAK and STAT genes from Artemia, Artemia franciscana. Although AfJAK showed only 19% identity (33% similarity) to the Drosophila Hop protein, AfJAK contained the characteristic JAK homology domain (JH domain) from JH1 to JH7. On the other hand, AfSTAT showed higher identity (30%) to Drosophila STAT (STAT92E). The low identities of AfJAK and AfSTAT to Drosophila Hop and STAT92E suggest that JAK and STAT proteins are unique in each different species of invertebrate. RT-PCR analysis showed that both AfJAK and AfSTAT transcripts were ubiquitously expressed in the embryo, which is similar to the expression patterns of Drosophila Hop and STAT92E mRNAs during development. In addition, we generated a constitutively active form of AfSTAT by fusing the JH1 domain of AfJAK to the C-terminal end of AfSTAT. This fusion protein, AfSTAT-HA-JH1, autophosphorylated on its tyrosine residue and was able to bind to specific DNA motifs including the STAT-binding motifs in the Drosophila Raf promoter. Both AfJAK and AfSTAT proteins elicited the transactivation potential toward the fly Raf promoter in Sf9 cells. However, tyrosine phosphorylation of AfSTAT was not detected, which is consistent with the cellular localization analysis that most AfSTAT proteins were in the cytoplasm. Our results demonstrate that both JAK and STAT are present in the genome of Artemia, which can serve as the basis for further investigations to explore the role of the JAK/STAT signal pathway in the development and immune response of brine shrimp.

  20. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca).

    Science.gov (United States)

    Muñoz, Joaquín; Gómez, Africa; Green, Andy J; Figuerola, Jordi; Amat, Francisco; Rico, Ciro

    2008-07-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate an early Pleistocene expansion of A. salina in the Mediterranean Basin. Subsequent population isolation in a mosaic of Pleistocene refugia is suggested, with two or three refugia located in the Iberian Peninsula. Two instances of long-distance colonization were also observed. Surprisingly, given its strong phylogeographical structure, A. salina showed a signature of correlation between geographical and genetic distance. Owing to strong 'priority effects', extensive population differentiation is retained, despite dispersal via migrant birds and human management of saltpans. The foreseeable expansion of A. franciscana is likely to be followed by substantial loss of genetic diversity in Mediterranean A. salina. Large genetic divergences between Mediterranean and South African A. salina suggest that the latter deserves species status.

  1. May arsenic pollution contribute to limiting Artemia franciscana invasion in southern Spain?

    Directory of Open Access Journals (Sweden)

    Marta I. Sánchez

    2016-02-01

    Full Text Available Limited information exists regarding the complex interactions between biological invasions, pollution, and climate change. Most studies indicate that pollution tends to favor invasive species. Here, we provide evidence that arsenic (As pollution may have a role in limiting the invasion of the exotic brine shrimp Artemia franciscana. We tested As toxicity in natural populations of Artemia parthenogenetica (a native taxon and A. franciscana from localities in southern Spain with differing degrees of As contamination. Tests were conducted both under current mean temperature conditions (25 °C, and as per a future climate scenario (i.e., an increase in mean temperature of 4 °C. Acute toxicity was estimated on the basis of the median lethal concentration (at 24 h, and chronic toxicity was evaluated by measuring Artemia survival and growth under sublethal exposures (after 26 days. At 25 °C, native A. parthenogenetica from the highly polluted Odiel and Tinto estuary was much more resistant to acute As stress (LC50-24 h, 24.67 mg L−1 than A. franciscana (15.78 mg L−1 and A. parthenogenetica from unpolluted sites (12.04 mg L−1–suggesting that local adaptation to polluted conditions may occur. At 29 °C, resistance of A. parthenogenetica from Odiel decreased significantly, and there were no statistical differences in sensitivity between the three species/populations, suggesting that climate change may enhance the probability of invasion. Resistance increased with developmental stage from nauplii to adults, and was extremely high in cysts which still hatched at As concentrations of up to 6400 mg L−1. Under sublethal chronic exposure A. franciscana performed better (survival and growth than A. parthenogenetica, and both species experienced a faster growth when exposed to As, compared with unexposed (control individuals, probably due to the hormesis. We discuss the ecological implications of our results.

  2. Effects of rotenone and other mitochondrial complex I inhibitors on the brine shrimp Artemia.

    Science.gov (United States)

    Vehovszky, Agnes; Szabó, Henriette; Acs, A; Gyori, J; Farkas, Anna

    2010-12-01

    (Artemia) nauplii was used to asses the toxicity of rotenone, MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), MP+ (1-methyl-4-phenylpyridinium) and the effect of L-DOPA co-treatment with rotenone. Rotenone had a dose dependent effect on mortality (LC₅₀: 0.37 ± 0.04 μM mean ± S E, n = 24), while MPTP and MP+ proved to be toxic in millimolar range (LC₅₀: 0.21 ± 0.09 mM and 0.20 ± 0.08 mM, respectively, n = 4). L-DOPA (50-200 μM) co-treatment increased the survival of the rotenone-treated animals (LC₅₀: 0.51 ± 0.23 μM, 1.03 ± 0.66 μM, and 0.76 ± 0.52 μM, respectively). In the whole body tissue homogenates of Artemia, sublethal (up to 0.3 μM) concentrations of rotenone increased the glutathione S-transferase (GST) activity by up to 50 about percent (LC₅₀: 53.3 ± 6.8 nM/min/mg protein, against 34.7 ± 3.6 nM/min/mg protein, n = 4). Nauplii treated in 100 mM L-DOPA and rotenone together showed further increase of GST activity all across the range of rotenone concentrations. These results on Artemia nauplii show similarities with other animal models, when complex I inhibitors were tested. Biochemical measurements suggest a protective role of L-DOPA by increasing the GST activity as part of the intracellular defences during toxin-evoked oxidative stress.

  3. Monitoramento dos extratos brutos de espécies de Polygala (Polygalaceae utilizando Artemia salina

    Directory of Open Access Journals (Sweden)

    A.B.P. Montanher

    2003-01-01

    Full Text Available Extratos de duas espécies de Polygala foram submetidos a um biomonitoramento utilizando o teste de toxicidade frente a Artemia salina, com a finalidade de detectar atividade citotóxica. Os resultados obtidos para o extrato bruto, frações hexânica e diclorometano de Polygala sabulosa Aw. Benn. mostraram-se promissores. No entanto, bioensaios mais específicos devem ser encorajados nos extratos vegetais que apresentam atividade diante deste bioensaio, a fim de confirmar estas conclusões.

  4. Toxicidad del Metilparabeno en Artemia franciscana y sus implicacines en acuicultura

    OpenAIRE

    Comeche Sanz, Amparo; Varó, Inmaculada

    2015-01-01

    La dependencia total de la acuicultura marina en los quistes de Artemia cosechados en grandes ecosistemas hipersalinos hace que las condiciones fisicoquímicas de estos lugares sean cruciales para el desarrollo de esta actividad. En la actualidad existen en el mercado diversos productos de la industria cosmética, farmacéutica o alimentaria, que contienen parabenos (PBs) en su composición; lo que ha dado lugar a la aparición de estos compuestos en el medio ambiente. Se ha demostr...

  5. Atividade antibacteriana in vitro e toxicidade frente à Artemia salina Leach. de alguns compostos triazenos

    Directory of Open Access Journals (Sweden)

    Gustavo Luiz Paraginski

    2014-01-01

    Full Text Available Bacterial resistance to antibacterial agents is currently a major concern. We report the synthesis, in vitro antibacterial activity and toxicity toward Artemia salina of six diaryltriazene compounds bearing different substituent groups. Minimal Inhibitory Concentration (MIC and Minimal Bactericidal Concentration (MBC values against standard strains (ATCC and clinical isolates (including ESBL, MBL and AmpC strains were good to very good, in the range 8 to 128 mg mL-1. Results suggest that hydroxyl, 4-carboxyl and 4-phenyldiazenil groups attached to the diaryltriazenes provide enhanced activity. Toxicity results showed very low LC50 values for three compounds (10-fold lower than DTIC.

  6. [Detection of fungal metabolites showing toxic activity through Artemia salina bioassay].

    Science.gov (United States)

    González, Ana María; Presa, Maximiliano; Latorre, María Gabriela; Lurá, María Cristina

    2007-03-01

    The aim of this study was to detect toxic metabolites from fungi contaminating food and medicinal herbs by applying the toxicity assay to Artemia salina. According to toxicity percentages, the extracts were classified as nontoxic (NT), slightly toxic (ST), toxic (T) and highly toxic (HT). Those classified as T and HT were assayed for mycotoxins. Only 6 out of 71 strains were found to be T (8.5%) for A. salina. Penicillium brevicompactum Dierckx, isolated from sausages, was found to be HT, mainly due to the presence of ochratoxin A and two other unidentified metabolites.

  7. Phaeobacter inhibens as Probiotic Bacteria in Non-Axenic Artemia and Algae Cultures

    DEFF Research Database (Denmark)

    Grotkjær, Torben; D'Alvise, Paul; Bentzon-Tilia, Mikkel;

    2015-01-01

    Bacterial diseases are a major constraint in aquaculture, especially in larviculture. Antibiotics that can control pathogens should be avoided due to risk of antibiotic resistance. We have shown in axenic systems of live larval feed that marine Roseobacter clade bacteria can antagonize fish patho...... demonstrates that probiotic bacteria can be introduced at the stage of live feed and have a pathogen reducing effect in both an Artemia and a D. tertiolecta challenge setup. This can potentially limit the subsequent use of antibiotics for control of pathogenic bacteria....

  8. Mercury antagonists: loss of photoactive response in the brine shrimp Artemia and its prevention by thiamine

    Energy Technology Data Exchange (ETDEWEB)

    Yaeger, E.; Siegel, B.Z.; Siegel, S.M.; Lasconia, M.; Correal, T.

    1986-01-01

    The positive photoatactic behavior of Artemia was disturbed when larvae cultured in 0.25 M NaCl were introduced into 10/sup -7/ to 10/sup -5/ M HgCl/sub 2/. At 10/sup -8/ M, and in controls, Hg had no effect either on orientation or mortality, and 65% of the larvae were collected at the light source in 30 min or less. In contrast, at 10/sup -6/ M, only 29% were able to do so. The presence of 10/sup -4/ M thiamine hydrochloride in the excystment medium prevented fully the loss of light-sensitivity.

  9. The brine shrimp ( Artemia parthenogenetica) as encapsulation organism for prophylactic chemotherapy of fish and prawn

    Science.gov (United States)

    Cao, Ji-Xiang; Bian, Bo-Zhong; Li, Ming-Ren

    1996-06-01

    Brine shrimp ( Artemia parthenogenetica) which had ingested three water-insoluble antibacterial drugs i.e. sulfadiazine(SD), oxytetracycline (OTC) and erythromycin estolate (ERY-Es) were fed to Tilapia and Mysis III of Penaeus orientalis K. The drug contents in the predators were then determined. After administration of drugs to Tilapia and Mysis III, through the bio-encapsulation of the brine shrimp, efficacious therapeutical concentration of OTC and ERY-Es (but not SD) in the predators could be reached and maintained for more than 8 hours.

  10. Sharp phylogeographic breaks and patterns of genealogical concordance in the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Maniatsi, Stefania; Kappas, Ilias; Baxevanis, Athanasios D; Farmaki, Theodora; Abatzopoulos, Theodore J

    2009-12-18

    Genealogical concordance is a critical overlay of all phylogenetic analyses, irrespective of taxonomic level. To assess such patterns of congruence we have compiled and derived sequence data for two mitochondrial (16S rRNA, COI) and two nuclear (ITS1, p26) markers in 14 American populations of the hypersaline branchiopod Artemia franciscana. Cladistic analysis revealed three reciprocally monophyletic mitochondrial clades. For nuclear DNA, incomplete lineage sorting was evident presumably as a result of slower coalescence or male-mediated dispersal. Our findings capture the genealogical interval between gene splitting and population divergence. In this sense, strong indications are provided in favour of a superspecies status and ongoing speciation in A. franciscana.

  11. Mushrooms of the genus Agaricus as functional foods Hongos del género Agaricus como alimentos funcionales

    Directory of Open Access Journals (Sweden)

    J. Vinhal Costa Orsine

    2012-08-01

    Full Text Available Mushrooms of the genus Agaricus are noted for their pharmacological and culinary properties. In this study, it was performed a critical literature review, focusing primarily on aspects of the chemical composition of these mushrooms whose pharmacological properties and nutritional composition characterize them as functional foods. It was also discussed articles conducted in vitro and in vivo proving the high antioxidant potential of the Agaricaceae family, in addition to articles which emphasize the toxicity characteristics and safety for its use in therapy or in human nutrition. These mushrooms exhibit numerous bioactive substances as well as safety regarding toxicity, which characterize them as functional foods. Despite the countless beneficial effects on human health, mushrooms of the genus Agaricus are little known by the population, making it necessary partnership and combined efforts among producers, industries and researchers in order to disseminate, research and consumption of these foods.Hongos del género Agaricus son conocidos por sus propiedades farmacológicas y culinarias. En este estudio, se realizó una revisión crítica de la literatura, centrándose principalmente en los aspectos de la composición química de estos hongos, cuyas propiedades farmacológicas y composición nutricional caracterizarlos como alimentos funcionales. También se discutió artículos realizados in vitro e in vivo demostrando el potencial antioxidante de alta de la familia Agaricaceae, además de los artículos que hacen hincapié en las características de toxicidad y seguridad para su uso en terapia o en la nutrición humana. Estos hongos presentan numerosas sustancias bioactivas, así como la seguridad en relación con la toxicidad, lo que les caracterizan como alimentos funcionales. A pesar de los innumerables efectos beneficiosos sobre la salud humana, las setas del género Agaricus son poco conocidos por la población, por lo que es colaboraci

  12. Surtos de enfermidades transmitidas por alimentos causados por Salmonella Enteritidis

    OpenAIRE

    Peresi Jacqueline T.M.; Almeida Ivete A Z.C.; Lima Sonia I.; Marques Denise F.; Rodrigues Elisabete C.A.; Fernandes Sueli A.; Gelli Dilma S.; Irino Kinue

    1998-01-01

    OBJETIVO: São descritos surtos de salmonelose notificados no período de julho de 1993 a junho de 1997 na região Noroeste do Estado de São Paulo, Brasil, tendo em vista os vários surtos de veiculação alimentar ocasionados por Salmonella nessa região. MÉTODO: Foram obtidos 19 inquéritos epidemiológicos para análise de dados, 87 amostras de fezes e 38 amostras de alimentos, incluindo 12 de ovos para análise microbiológica. Cepas de Salmonella foram submetidas a sorotipagem, fagotipagem e teste d...

  13. Alimentos com denominação registada: contributo nutricional

    OpenAIRE

    Bochecha, E.S.; Albuquerque, T.G.; Costa, H.S.

    2016-01-01

    Introdução: Os produtos agroalimentares com denominação registada são considerados como alimentos de grande conteúdo simbólico associado à tradição, ruralidade, história, natureza, região ou área geográfica. A certificação ao abrigo do Regulamento (UE) n.º 1151/2012, define 3 designações: a Denominação de Origem Protegida (DOP), Indicação Geográfica Protegida (IGP) e Especialidade Tradicional Garantida (ETG). O processo de certificação é um instrumento importante e eficaz que pretende promove...

  14. Molecular cloning and expression analysis of the retinoid X receptor (RXR) gene in golden pompano Trachinotus ovatus fed Artemia nauplii with different enrichments.

    Science.gov (United States)

    Yang, Qibin; Zheng, Panlong; Ma, Zhenhua; Li, Tao; Jiang, Shigui; Qin, Jian G

    2015-12-01

    The retinoid X receptors (RXRs) are involved in the skeletal development and other biological process such as blood vessel formation and metabolism. Partial sequences of RXRα and β genes were obtained, and their expressions were quantified on golden pompano Trachinotus ovatus at 28 days post hatching (DPH) to explore the molecular response to nutritional manipulation in fish larvae. As live food, Artemia nauplii were separately enriched with Nannochloropsis and Algamac 3080 and non-enriched Artemia nauplii (control) for fish feeding. The expressions of RXRs were detected in the embryos and fish larvae at early stages, suggesting that the skeletal development in golden pompano initiated before yolk re-sorption completion. Fish fed non-enriched Artemia nauplii ended up with higher jaw malformation. The highest specific growth rate was obtained when fish were fed with the Artemia nauplii enriched with Algamac 3080, and the lowest growth rate was observed when fish were fed with unenriched Artemia nauplii. The highest survival was obtained when fish were fed with non-enriched or Nannochloropsis-enriched Artemia nauplii. This study indicates that the use of enriched formula for Artemia nauplii can significantly affect the expression levels of RXRs and jaw malformation of golden pompano larvae, but there is no clear correlation between RXRs expressions and malformation rates when fish are subjected to nutrient challenge.

  15. Evaluation of the toxicity of the methanolic extract of Caesalpinia Pyramidalis, subjected to gamma radiation, compared to saline artemias; Avaliacao da toxicidade do extrato metanolico de Caesalpinia Pyramidalis, submetido a radiacao gama, frente a artemias salinas

    Energy Technology Data Exchange (ETDEWEB)

    Pessoa, Juanna G.; Santos, Mariana L.O.; Costa, Michelle C.A.; Siqueira, Williams N.; Silva, Luanna R.S.; Cabral, Daniela L.V.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: marianasantos_ufpe@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil)

    2013-07-01

    The present study aimed to investigate the possible effect of irradiation of 60 Co in methanol extract of Caesalpinia pyramidalis (catingueira) with function of reducing the toxicity of the extract at concentrations of 1000, 500, 250 and 125 ppm irradiating them with doses of 5 kGy 7 kGy and 10 kGy, using lethality tests with saline Artemias.

  16. Intentional introduction of Artemia sinica (Anostraca) in the high-altitude Tibetan lake Dangxiong Co: the new population and consequences for the environment and for humans

    Science.gov (United States)

    Jia, Qinxian; Anufriieva, Elena; Liu, Xifang; Kong, Fanjing; Shadrin, Nickolai

    2015-11-01

    The imbalance between supply and demand of Artemia cysts in China and around the world is increasing now. Salt lakes in Tibet may contribute to the solution of the problem. In Northern Tibet there are 26 saline lakes whose salinity and temperature may support Artemia survival at an altitude of 4 000-5 100 m. We found Artemia in 15 of these lakes. The saline lakes with Artemia populations mainly belong to the shallow basin lakes, and the majority of these lakes are small in area. The total area of lakes without Artemia is more than 1 000 km2. Lake Dangxiong Co (Co means lake in Tibet) was chosen for the intentional introduction of Artemia sinica. In 2004, 850 g of A. sinica cysts, originating from Qinghai, were introduced in the lake. Surveys in 2006-2014 showed that the average abundance of Artemia adults in the lake gradually increased from 20 ind./m3 in 2006 to 1950 ind./m3 in 2013. We assume that two subpopulations of A. sinica, separated by depth, may exist in the lake. The new Artemia population caused an increase in the number of species of phytoplankton and heterotrophic protozoa with a decrease of their total abundance. Water transparency also increased. Dominance in phytoplankton passed from cyanobacteria to diatoms. Changes occurred not only in the lake ecosystem; the number of water birds using the lakes also dramatically increased. Preliminary calculations showed that is it possible to harvest at least about 150 t cysts per year from the lake as well as 3.2 thousand tons of frozen or 350 t of dried biomass of adult Artemia.

  17. Estudio microbiológico de los alimentos elaborados en comedores colectivos de alto riesgo

    OpenAIRE

    Pérez-Silva García Mª del Carmen; Belmonte Cortés Susana; Martínez Corral Javier

    1998-01-01

    FUNDAMENTO: Valorar los resultados del análisis microbiológico de los alimentos preparados en comedores colectivos de alto riesgo, con el fin de conocer el grado de contaminación de los alimentos, analizar las causas de dicha contaminación y mejorar la situación sanitaria de estos establecimientos. MÉTODOS: Estudio observacional descriptivo con los datos obtenidos de la inspección sanitaria en 44 comedores colectivos de alto riesgo, que incluyó el análisis microbiológico de 90 alimentos, así ...

  18. Percepción de la inocuidad de los alimentos entre estudiantes universitarios

    OpenAIRE

    Ema Maldonado-Simán; Liliana López-Durán; Agustín Ruiz-Flores; José Artemio Cadena-Meneses; Pedro Arturo Martínez-Hernández; Raymundo Rodríguez-De Lara

    2012-01-01

    El consumidor es uno de los eslabones de la cadena de alimentos, responsable de mantener la inocuidad de los alimentos y evitar enfermedades por contaminación de los mismos. El objetivo del estudio fue determinar el nivel de conocimiento, actitud y comportamiento respecto a la inocuidad de los alimentos entre estudiantes universitarios, mediante la aplicación de un cuestionario a 97 estudiantes en el último tercio de la carrera profesional. La información se analizó mediante Ji-cuadrado. La i...

  19. Composición de alimentos en Costa Rica: un diagnóstico

    OpenAIRE

    Fernández Piedra, Mireya; Blanco Metzler, Adriana; Lois Martínez, Mónica; Ávila Ramírez, Aurelia; Fournier Zepeda, Ana M.; Montero Campos, María de los Ángeles

    2000-01-01

    Se efectuó un diagnóstico en las instituciones nacionales que generan y utilizan los datos sobre la composición química de los alimentos con el propósito de identificar los alimentos analizados, los métodos analíticos, los usos y las limitaciones de las tablas de composición de alimentos. Para la recolección de los datos se enviaron 60 formularios estructurados, los cuales se distribuyeron a informantes de 46 instituciones, obteniéndose un 67% de respuesta. Se encontró que el 62% de los infor...

  20. Transición vítrea en alimentos congelados

    OpenAIRE

    Orrego Alzate, Carlos Eduardo

    2000-01-01

    En la congelación de alimentos la transición vitrea (TV) asociada con la fase crioconcentrada no congelada (FCNC) ha sido objeto de numerosos estudios en la última década, desde que Levine y Slade (1998) relacionaron la cinética de los polímeros con los procesos fisicoquímicos de los alimentos. Las pérdidas de calidad de los alimentos congelados, debido a reacciones enzimáticas o recristalización, pueden reducirse sustancialmente cuándo la FCNC está en estado vitreo. Es por ello útil conoc...

  1. Caracterización de la conservación de alimentos en diferentes instalaciones.

    Directory of Open Access Journals (Sweden)

    Tamara Díaz Lorenzo

    2005-01-01

    Full Text Available La conservación es uno de los elementos que influyen en la calidad sanitaria de los alimentos a lo largo de la cadena alimentaria. Las enfermedades transmitidas por los alimentos se presentan con alta incidencia en nuestro país y constituyen un problema de salud y la conservación adecuada de los alimentos una de las medidas de prevención más importante para evitar su aparición, con el objetivo de caracterizar el comportamiento de la conservación de los alimentos en diferentes instalaciones de nuestro país(hogares, hospitales, círculos infantiles, hoteles realizamos un estudio descriptivo retrospectivo durante el período de enero a diciembre el 2004 a través de una encuesta confeccionada para el estudio de las siguientes variables: conservación, educación sanitaria, limpieza y desinfección, condiciones sanitarias básicas. La conservación de los alimentos perecederos se comportó de manera inadecuada en más de la mitad de los hogares no así en los hospitales ni en los Círculos infantiles estudiados donde en su totalidad era inadecuada. En los hoteles esta fue de manera adecuada en la tercera parte de ellos. Los alimentos no perecederos se conservaban correctamente en la totalidad de los hoteles, hogares, círculos infantiles y en la mitad de los hospitales. El programa de limpieza y desinfección de frutas y hortalizas se aplicaba sólo en la mitad de los hoteles. La educación sanitaria de los manipuladores de alimentos en estas instituciones en relación a los factores que son necesarios para la conservación de los alimentos fue insuficiente en su totalidad. La presencia de vectores y la protección de los alimentos contra estos fue una deficiencia altamente observada. Consideramos que se hace necesario dentro del programa de inocuidad de los alimentos constituir un equipo multidisciplinario que desde la asistencia primaria realice acciones para prevenir las enfermedades transmitidas por los alimentos producidas por

  2. Estudos quimiométricos da pheo formulada em pluronics®: ação fotodinâmica Sobre Artemia salina

    Directory of Open Access Journals (Sweden)

    Adriana Passarella Gerola

    2013-01-01

    Full Text Available The self-aggregation of pheophytin, a possible photosensitizer for Photodynamic Therapy, is solved by formulation in polymeric surfactant as P-123. The photosensitizer incorporation was found to be time dependent, exhibiting two steps: a partition at the micellar interface followed by an incorporation into the micelle core. The photodynamic efficiency of the formulation was tested by the bioassays against Artemia salina. In order to evaluate how the experimental parameters: pheophytin concentration, P-123 percentage and illumination time influenced the death of artemia, the factorial design 2³ was chosen. The illumination time was found to be the main factor contributing to the mortality of artemia.

  3. Sudden weaning of angel fish pterophyllum scalare (Lichtenstein) (Pisces; Cichlidae) larvae from brine shrimp (Artemia sp) nauplii to formulated larval feed

    OpenAIRE

    2013-01-01

    This study investigated the effects of sudden weaning of angel fish larvae (Pteraphylum scalari) from Artemia nauplii to commercial larval feed. Four days post hatch (DPH) larvae were reared in four different weaning protocols (TR1-TR4) with triplicates in a complete randomize design. Larvae in TR1 and TR4 were exclusively fed Artemia nauplii and dry feed respectively. In TR2 and TR3, larvae were initially fed Artemia nauplii and suddenly wean to formulated feed on 14 DPH and 7 DPH respective...

  4. A specific DNA fragment of Gahai parthenogenesis Artemia genome%尕海孤雌生殖卤虫基因组的特异DNA片段

    Institute of Scientific and Technical Information of China (English)

    曾辉; 陈成彬; 刘凤岐; 宋文芹; 陈瑞阳

    2004-01-01

    Artemia is not only valuable for aquaculture but also exhibits unique biological characters. In this study, based on the silkworm Bmdsx gene, a pair of primers was designed. After amplification with these primers, a DNA fragment Apdsx900 from parthenogenesis Artemia genomic DNA was obtained. The following Southern blotting and FISH analysis also proved the fragment was specific for Gahai parthenogenesis Artemia genome. To our knowledge, this is the first report of parthenogenesis genome specific DNA fragments. Apdsxg00 shares little similarity with the silkworm Bmdsx gene. [Acta Zoologica Sinica 50 (3): 470-474, 2004].

  5. Cloning and Expression Analysis of p26 Gene in Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Lijuan JIANG; Lin HOU; Xiangyang ZOU; Ruifeng ZHANG; Jiaqing WANG; Wenjing SUN; Xintao ZHAO; Jialu AN

    2007-01-01

    The protein p26 is a small heat shock protein that functions as a molecular chaperone to protect embryos by preventing irreversible protein damage during embryonic development. A 542 bp fragment of the p26 gene was cloned and sequenced. The fragment encoded 174 amino acid residues and the amino acid sequence contained the α-crystallin domain. Phylogenetic analysis showed that eight Artemia populations were divided into four major groups. Artemia sinica (YC) belonged to the East Asia bisexual group. Expression of the p26 gene at different developmental stages of A. sinica was quantified using real-time quantitative polymerase chain reaction followed by cloning and sequencing. The relationship between the quantity of p26 gene expression and embryonic development was analyzed. The results indicated that massive amounts of p26 were expressed during the development of A. sinica. At the developmental stage of 0 h, A. sinica expressed the highest level of p26. As development proceeded, expression levels of the p26 gene reduced significantly. There was a small quantity of p26 gene expression at the developmental stages of 16 h and 24 h. We concluded that p26 might be involved in protecting the embryo from physiological stress during embryonic development.

  6. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Ana D’ors

    2014-08-01

    Full Text Available Objective: To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods: Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results: Biotoxin equivalent values obtained by immunodetection were (2.12±0.10, (8.60±1.30 and (4.32±1.67 pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions: These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  7. Assessment of endemic microalgae as potential food for Artemia franciscana culture

    Directory of Open Access Journals (Sweden)

    Juan M Pacheco-Vega

    2015-03-01

    Full Text Available In this study, five microalgal strains were isolated from Bahía de La Paz, Baja California Sur, Mexico and identified as Grammatophora sp., Navícula sp., Rhabdonema sp., Schizochytrium sp., and Nitzschia sp., and their evaluation as potential food for Artemia franciscana. The isolated strains were cultured outdoors and harvested after four days. Chaetoceros muelleri was cultured under laboratory conditions and used as control. The protein, lipid, and carbohydrate composition and the fatty acid profiles of the strains were determined by gas chromatography. To assess the effect of microalgal strains on A. franciscana, decapsulated cysts were cultured at outdoor conditions in 15 L containers. The experiment was conducted for twelve days. Samples from the five different feeding treatments were taken at the beginning and end of the experiment to assess number, size, and weight of Artemia larvae. Treatment with Rhabdonema sp. showed larvae with a lower percentage of polyunsaturated fatty acids (PUFAs while Grammatophora sp. showed those with the greatest PUFA proportion, even more than those fed Chaetoceros muelleri (control. Larvae consuming Schizochytrium sp. had no docosahexanoic (DHA nor eicosapentaenoic (EPA fatty acid content. Growth and survival of A. franciscana did not show significant differences among feed treatments, except when it was fed Nitzschia sp., showing lower survival and dry weight. Treatment based on Schizochytrium sp. and Rhabdonema sp. had a greater A. franciscana size but reduced dry weight; additional tests including two or more algal species for every treatment should be carried out to determine the best yield.

  8. Peningkatan Kuantitas dan Kualitas Kista Artemia franciscana setelah Pemberian Silase Ikan

    Directory of Open Access Journals (Sweden)

    ENDAH BUDI SULISTYOWATI

    2007-11-01

    Full Text Available Artemia is one of live feed needed in aquaculture as fishes and crustacean. Commercially, Artemia usually sold in dry cysts which can kept for years. The aim of this research were to know increasing quantity and quality A. franciscana cysts after exposing various concentration of fish silage as artificial food and to know optimal concentration of fish silage that can increase quantity and quality A. franciscana cysts. This research was done in Laboratory of Live Feed BBPBAP Jepara Central Java. This research was conducted by 5 treatments. Treatments were grouped based on amount of concentration given, i.e: control (coconut cake with concentrate 10 g/m3, fish silage concentrate 10, 20, 30, and 40 g/m3. Parameter investigated were number of cysts produced by individual female A. franciscana, diameter of A. franciscana cysts, hatching percentage, and hatching rate of A. franciscana cysts. Data were analyzed using ANOVA and continued using Tukeys test at significant level 5%. The result of this research showed that exposing fish silage can increase quantity and quality A. franciscana cysts. They were increase number of cysts production by individual females, decrease cysts diameter, increase hatching percentage and hatching rate. Optimal concentration of fish silage on increase quantity and quality of A. franciscana cysts was 20 g/m3.

  9. Artemia salina as test organism for assessment of acute toxicity of leachate water from landfills.

    Science.gov (United States)

    Svensson, B M; Mathiasson, L; Mårtensson, L; Bergström, S

    2005-03-01

    Artemia salina has, for the first time, been used as test organism for acute toxicity of leachate water from three landfills (the municipal landfills at Kristianstad, Sweden and Siauliai, Lithuania, and an industrial landfill at Stena fragmenting AB, Halmstad, as well as for leachate from Kristianstad treated in different ways in a pilot plan). Artemia can tolerate the high concentrations of chloride ions found in such waters. Large differences in toxicities were found, the leachate from Siauliai being the most toxic one. To increase the selectivity in the measurements, a fractionation was done by using ion exchange to separate ammonium/ammonia and metal ions from the leachate, and activated carbon adsorbents for organic pollutants. The influence of some metals and phenol compounds on the toxicity was investigated separately. It was found that most of the toxicity emanated from the ammonium/ammonia components in the leachate. However, there was also a significant contribution n from organic pollutants, other than phenol compounds, since separate experiments had in this latter case indicated negligible impact. The concentrations of metals were at a level, shown by separate experiments, where only small contribution to the toxicity could be expected.

  10. Cytotoxicity of Dorema auchri, Achillea millefolium and Artemisia aucheri by Artemia

    Directory of Open Access Journals (Sweden)

    M Ghavamizadeh

    2013-09-01

    Full Text Available Abstract Background & aim: Nowadays, toxic compounds derived from plants used against microbes and cancer cells. The aim of this study was to evaluate cytotoxicity of Dorema aucheri, Achillea millefollium and Artemisia aucheri using brine shrimp, Artemia urmiana, lethality test. Methods: In this experimental study, the plants were collected from the Kohgiluyeh and Boyer-Ahmad Province, then identified by a botanist. Clean and air-dried aerial parts of plants were extracted with suitable solvents. Cytotoxicity evaluation was performed using larvae hatched cysts were purchased from Urmia. Live larvae were exposed to different concentrations of extract and the numbers of live and dead larvae were counted after 24 hours. Mean of LC 50 of any extracts from control and exposed live larvae were examined. The data were analyzed using the Finney’s Probit analysis. Results: Hydro ethanol and chloroform extracts of Achillea millefolium, Dorema aucheri and Artemisia aucheri exhibited potent brine shrimp lethality with LC50 67.8±0.53μg.ml-1, 76.50±0.60μg.ml-1, 92.70±6.05μg.ml-1 respectively. The degree of lethality was found to be directly proportional to the concentration of extracts. Conclusion: According to BSLT, LC50 of D. aucheri, A. millefolium and A. aucheri, they were considered as toxic. So these plants could be a source of new compounds with biological activity. Key words: Artemia urmiana, Dorema auchri, Achillea millefolium, Artemisia aucheri, Cytotoxicity

  11. Purification and characterization of hatching enzyme from brine shrimp Artemia salina.

    Science.gov (United States)

    Fan, Tingjun; Wang, Jing; Yuan, Wenpeng; Zhong, Qiwang; Shi, Ying; Cong, Rishan

    2010-02-01

    By using Artemia chorion as a specific substrate, the hatching enzyme from Artemia salina (AHE) was purified by gel-filtration and ion-exchange chromatography, and characterized biochemically and enzymatically in this study. It was found that the AHE had a molecular weight of 82.2 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and often contained 73.3 kDa molecules in preparation. The AHE had obvious choriolytic activity, which was optimal at pH 7.0 and a temperature of 408C. The Km value of the AHE for dimethyl casein was 8.20 mg/ml. The AHE activity was almost completely inhibited by soybean trypsin inhibitor and p-amidinophenyl methane sulfonyl fluoride hydrochloride, greatly inhibited by N-tosyl-L-lysyl chloromethyl ketone, phenylmethanesulfonyl fluoride, and lima bean trypsin inhibitor, slightly inhibited by pepstatin, N-tosyl-L-phenylalanyl chloromethyl ketone, leupeptin, N-ethylmaleimide, and iodoacetamide, and not inhibited by chymostatin and bestatin. All these results imply that AHE is most probably a trypsin-type serine protease. Besides of these, AHE was also sensitive to EDTA and Zn21. Combined with the results that the EDTA-pre-treated HE activity could be perfectly recovered by Zn21, it is indicated that AHE might be also a kind of Zn-metalloprotease.

  12. A proteomic study on postdiapaused embryonic development of brine shrimp (Artemia franciscana).

    Science.gov (United States)

    Wang, Weiwei; Meng, Bo; Chen, Weihua; Ge, Xiaomeng; Liu, Siqi; Yu, Jun

    2007-10-01

    Encysted gastrula of brine shrimp (Artemia, Crustacea, and Anostraca) provides an excellent model for studying molecular processes of diapause. We report a proteomic study on early molecular responses of Artemia's postdiapaused cysts and found that dehydrated cysts actually store more proteins, in both kind and amount, than developing cysts. We identified 75 differentially expressed proteins over a course of cyst development, and also exploited PTMs of dehydrate cysts. We further surveyed gene expression of postdiapaused cysts in early developmental phases in a 0.5 h interval up to the seventh hour, and discovered that the activation of cellular activities is ignited as early as 0.5 h after rehydration. We traced nine differentially expressed proteins (COXI, COXIII, heat shock proteins (HSP26, HSP60, and HSP70), CDC48, late embryogenesis abundant (LEA), GS1-like protein, and cathepsin L-associated protein (CLAP)) for quantitative transcriptional changes, monitored by real-time PCR, and found these proteins exhibiting distinct expression patterns that suggest complex gene regulations for cyst reactivation after diapause breakage. Future experiments should be designed to focus on early activation concerning signal transduction, energy generation, and PTMs.

  13. A bioassay using Artemia salina for detecting phototoxicity of plant coumarins.

    Science.gov (United States)

    Ojala, T; Vuorela, P; Kiviranta, J; Vuorela, H; Hiltunen, R

    1999-12-01

    Artemia salina (brine shrimp) has been successfully used for toxicity testing, and a screening test for phototoxicity has been developed based on this method. The ability of the method to test the phototoxic potential of seven known compounds was investigated. Athamantin (an angular furanocoumarin) and umbelliferone (a simple coumarin) showed no phototoxicity, while linear furanocoumarins exhibited phototoxic activity in the following order: psoralen > bergapten > peucedanin > xanthotoxin. The applicability of this method was also tested in screening the phototoxicity of plant material. Six plants from Apiaceae [Aegopodium podagraria L., Anethum graveolens L., Angelica archangelica L., Levisticum officinalis Koch, Petroselinum crispum (P. Mill) A. W. Hill., and Peucedanum palustre (L.) Moench] and one from Rutaceae (Ruta graveolens L.) were selected, all of them known to contain furanocoumarins. Extracts from leaves collected at different times during the growth period were used in the screening. Our results were in accordance with the furanocoumarin content of these plants and with the results of other phototoxicity tests. The Artemia salina method proved to be rapid, simple and inexpensive, and is therefore ideal in the initial biological screening of large numbers of samples for simultaneous detection of both toxicity and phototoxicity.

  14. Habitat diversity and adaptation to environmental stress in encysted embryos of the crustacean Artemia

    Indian Academy of Sciences (India)

    Joshua A Tanguay; Reno C Reyes; James S Clegg

    2004-12-01

    Encysted embryos (cysts) of the brine shrimp, Artemia, provide excellent opportunities for the study of biochemical and biophysical adaptation to extremes of environmental stress in animals. Among other virtues, this organism is found in a wide variety of hypersaline habitats, ranging from deserts, to tropics, to mountains. One adaptation implicated in the ecological success of Artemia is p26, a small heat shock protein that previous evidence indicates plays the role of a molecular chaperone in these embryos. We add to that evidence here. We summarize recently published work on thermal tolerance and stress protein levels in embryos from the San Francisco Bay (SFB) of California inoculated into experimental ponds in southern Vietnam where water temperatures are much higher. New results on the relative contents of three stress proteins (hsp70, artemin and p26) will be presented along with data on cysts of A. tibetiana collected from the high plateau of Tibet about 4.5 km above sea level. Unpublished results on the stress protein artemin are discussed briefly in the context of this paper, and its potential role as an RNA chaperone. Interestingly, we show that the substantial tolerance of A. franciscana embryos to ultraviolet (UV) light does not seem to result from intracellular biochemistry but, rather, from their surrounding thick shell, a biophysical adaptation of considerable importance since these embryos receive heavy doses of UV in nature.

  15. Morphological differentiation of seven parthenogenetic Artemia (Crustacea: Branchiopoda) populations from China, with special emphasis on ploidy degrees.

    Science.gov (United States)

    Asem, Alireza; Sun, Shi-Chun

    2016-04-01

    Parthenogenetic Artemia from seven Chinese locations with different elevations and various ploidies are characterized by phenotypic and morphometric analyses. Our findings show that the studied populations exhibit dissimilar patterns of ovisac. Four phenotypic patterns of furca are qualified and one of them is shared among di-, tetra- and pentaploid Artemia. Results of discriminant analysis based on morphometric data reveal that tetra- and pentaploid populations are grouped together, but the Aqqikkol Lake population is clearly differentiated. Previous hypothesis/conclusion that polyploid Artemia are larger than diploids is only partly supported by the present results, which show that pentaploid and tetraploid populations are larger than the mostly diploid populations in terms of the total length, but the body size of the Aibi Lake triploids has not significant difference with the sympatric diploids and the mostly diploid Aqqikkol population that inhabit in very high altitude has the largest body size among all parthenogenetic populations. The founding confirms that body size of Artemia is following with Bergmann's rule.

  16. Does a change from whole to powdered food (Artemia franciscana eggs) increase oviposition in the ladybird Coleomegilla maculata

    Science.gov (United States)

    The limited availability of alternative foods to replace natural prey hinders cost-effective mass production of ladybird beetles for augmentative biological control. We compared the effects of powdered versus whole Artemia franciscana (brine shrimp) eggs with or without a dietary supplement on devel...

  17. Evaluation of commercial Artemia enrichment products on growth, survival, stress tolerance, and fatty acid composition of larval Florida pompano

    Science.gov (United States)

    Rearing live feed organisms represents the majority of time and labor associated with larviculture operations vital to the seed stock supply of marine finfish aquaculture production facilities. No information exists with respect to optimal Artemia enrichment protocols for Florida pompano Trachinotu...

  18. Successful Replacement of Artemia salina nauplii with Marine Rotifers (Brachionus plicatilis) in the Diet of Preadult Zebrafish (Danio rerio).

    Science.gov (United States)

    Lawrence, Christian; James, Althea; Mobley, Scottie

    2015-10-01

    Previously established rearing protocols for zebrafish begin feeding with marine rotifers (Brachionus plicatilis), followed by Artemia nauplii until the fish reach subadult stage, the developmental time point at which they can be most easily transitioned onto a processed diet. However, the inclusion of Artemia is less than ideal, given its fluctuating availability and high costs. We tested whether or not we could replace Artemia with rotifers during our normal rearing sequence and still meet published performance standards for (i) weaning fish onto a processed diet by 25 days postfertilization (dpf) and (ii) successful breeding by 60 dpf. Here, we present the results of trials where wild-type and casper zebrafish were fed exclusively with rotifers (R) or rotifers followed by Artemia (RA) for the first 25 dpf after which point all fish were transitioned to a processed diet (Gemma Micro 300). We measured growth and survival at days 25 and 60, and tested for reproductive capability at 60 dpf. While growth performance was significantly better in the RA groups, we were still able to meet goals for both weaning and generation time in the R groups without compromising survival or sex ratios.

  19. Post-prandial protease activity in the digestive tract of African catfish, Clarias gariepinus, larvae fed decapsulated cysts of Artemia

    NARCIS (Netherlands)

    García Ortega, A.; Verreth, J.; Segner, H.

    2000-01-01

    The alkaline proteolytic activity in the gut of African catfish larvae was studied during short time ranges from 30 min to 4 h after ingestion of decapsulated Artemia cysts. The variation in total protease and trypsin activities during the day was monitored during starvation, after one single meal i

  20. [Biological and biochemical quality of the Artemia (Anostraca: Artemiidae) population from Real de Salinas saltworks, Calkiní, Campeche, Mexico].

    Science.gov (United States)

    Rodríguez-Canché, Leticia G; Maldonado-Montiel, Teresita D N J; Carrillo Navarro, Luciano A

    2006-12-01

    Cysts of Artemia spp. collected from February 1997 to February 2000 in the Real de Salinas solar saltworks, Campeche, Mexico, were compared with Artemia franciscana (batch number 8,131 Microfeast Artemia Cysts, Texas, USA). The variables determined in these two populations were: number of cysts per gram, hatching percentage, hatching efficiency, hatching rate, hatching synchrony and hatching biomass, as well as diameter of the cysts and length of the nauplii (instar I). For Salinas, the average diameters of the encapsulated and decapsulated cysts were 230.5 +/- 4.14 and 221.8 +/- 3.39 microm, respectively. The thickness of the cyst shell was 4.35 +/- 0.68 microm and the length of the nauplii was 388.11 +/- 4.39 microm, this last value is among the smallest reported in the literature. For the commercial population of A. franciscana, the average diameters of the encapsulated and decapsulated cysts were 230.21 +/- 12.49 and 216.96 +/- 13.71, respectively. With respect to the corion thickness and length of the nauplii the values were 6.62 +/- 2.72 and 424.70 +/- 30.08, respectively. The protein value of the cysts (47.91 %) and nauplii (50.5 %) of Artemia population from Real de Salinas, are considered adequate to be used as food in aquaculture. The results indicate that the population from Real de Salinas presents positive features for its use in aquaculture in the region.

  1. Ribosomal S6 kinase is activated as an early event in preemergence development of encysted embryos of Artemia salina.

    Science.gov (United States)

    Malarkey, K; Coker, K J; Sturgill, T W

    1998-01-15

    Dormant Artemia salina cysts contain desiccated gastrulae that are metabolically inactive, and physiologically arrested. Following rehydration, embryos resume development via alterations in protein expression, in the complete absence of cell division. In mammals, activation of p70 ribosomal S6 kinase (p70S6k) has been implicated in translational control, in particular the selective up-regulation of translation of mRNAs with polypyrimidine tracts at their 5' start sites. We therefore investigated ribosomal S6 kinase activity in preemergence development. We demonstrate that an S6 kinase activity is rapidly stimulated (within Artemia S6 kinase was inactivated by treatment with protein phosphatase 2A. Activation of S6 kinase activity was shown to be due to an enzymatic step(s), and not simply rehydration of stored, active enzyme. The temporal profile of activation of S6 kinase activity is compatible with a regulatory function for p70S6k in early preemergence development of encysted Artemia. These studies identify activated Artemia cysts as a system for biochemical studies of p70S6k regulation.

  2. Formation of diapause cyst shell in brine shrimp, Artemia parthenogenetica, and its resistance role in environmental stresses.

    Science.gov (United States)

    Liu, Yu-Lei; Zhao, Yang; Dai, Zhong-Min; Chen, Han-Min; Yang, Wei-Jun

    2009-06-19

    Artemia has attracted much attention for its ability to produce encysted embryos wrapped in a protective shell when subject to extremely harsh environmental conditions. However, what the cyst shell is synthesized from and how the formative process is performed remains, as yet, largely unknown. Over 20 oviparous specifically expressed genes were identified through screening the subtracted cDNA library enriched between oviparous and ovoviviparous Artemia ovisacs. Among them, a shell gland-specifically expressed gene (SGEG) has been found to be involved in the cyst shell formation. Lacking SGEG protein (by RNA interference) caused the cyst shell to become translucent and the chorion layer of the shell to become less compact and pultaceous and to show a marked decrease of iron composition within the shell. The RNA interference induced defective diapause cysts with a totally compromised resistibility to UV irradiation, extremely large temperature differences, osmotic pressure, dryness, and organic solvent stresses. In contrast, the natural cyst would provide adequate protection from all such factors. SGEG contains a 345-bp open reading frame, and its consequentially translated peptide consists of a 33-amino acid residue putative signal peptide and an 81-amino acid residue mature peptide. The results of Northern blotting and in situ hybridization indicate that the gene is specifically expressed in the cells of shell glands during the period of diapause cyst formation of oviparous Artemia. This investigation adds strong insight into the mechanism of cyst shell formation of Artemia and may be applicable to other areas of research in extremophile biology.

  3. Reproductive performance of the guppy fish Poecilia reticulata [Peters, 1859] fed with live Artemia franciscana [Kellog, 1906] cultured with inert and live diets

    Directory of Open Access Journals (Sweden)

    M. García-Ulloa

    2004-01-01

    Full Text Available El comportamiento reproductivo del guppy Poecilia reticulata —evaluado como número de crías, longitud estándar, peso húmedo y seco de las crías y su proporción sexual— fue estudiado usando varias dietas para los reproductores. Los tratamientos consistieron en adultos vivos de Artemia franciscana cultivada con microalgas vivas (Tetraselmis suecica y Chaetoceros calcitrans, harina de Spirulina, harina de soya, harina de trigo, una mezcla 50%/50% de dichas harinas y una dieta comercial como grupo control. Después de 45 días bajo condiciones experimentales de laboratorio, no se encontraron diferencias significativas (P > 0.05 en el número de crías producidas por hembra y en la longitud estándar individual de las crías entre los tratamientos. Las crías producidas por el grupo control fueron más pesadas que las del resto de los tratamientos (4.14 y 1.06 mg de peso húmedo y seco, respectivamente. En promedio, el grupo de reproductores alimentado con Spirulina produjo mayor cantidad de machos. Los resultados destacan el uso de la dieta comercial para cubrir con los requerimientos reproductivos de P. reticulata.

  4. A new look at an old visual system: structure and development of the compound eyes and optic ganglia of the brine shrimp Artemia salina Linnaeus, 1758 (Branchiopoda, anostraca).

    Science.gov (United States)

    Wildt, Miriam; Harzsch, Steffen

    2002-08-01

    Compared to research carried out on decapod crustaceans, the development of the visual system in representatives of the entomostracan crustaceans is poorly understood. However, the structural evolution of the arthropod visual system is an important topic in the new debate on arthropod relationships, and entomostracan crustaceans play a key role in this discussion. Hence, data on structure and ontogeny of the entomostracan visual system are likely to contribute new aspects to our understanding of arthropod phylogeny. Therefore, we explored the proliferation of neuronal stem cells (in vivo incorporation of bromodeoxyuridine) and the developmental expression of synaptic proteins (immunohistochemistry against synapsins) in the developing optic neuropils of the brine shrimp Artemia salina Linnaeus, 1758 (Crustacea, Entomostraca, Branchiopoda, Anostraca) from hatching to adulthood. The morphology of the adult visual system was examined in serial sections of plastic embedded specimens. Our results indicate that the cellular material that gives rise to the visual system (compound eyes and two optic ganglia) is contributed by the mitotic activity of neuronal stem cells that are arranged in three band-shaped proliferation zones. Synapsin-like immunoreactivity in the lamina ganglionaris and the medulla externa initiated only after the anlagen of the compound eyes had already formed, suggesting that the emergence of the two optic neuropils lags behind the proliferative action of these stem cells. Neurogenesis in A. salina is compared to similar processes in malacostracan crustaceans and possible phylogenetic implications are discussed.

  5. Avances en biotecnología de alimentos

    Directory of Open Access Journals (Sweden)

    Ramón, Daniel

    2014-08-01

    . De hecho, la biotecnología de los alimentos es la más antigua de todas las biotecnologías. Recientemente, las técnicas de ADN recombinante se han aplicado en la tecnología de alimentos creando los llamados alimentos modificados genéticamente o alimentos transgénicos. Ejemplos de este tipo de productos son unas patatas transgénicas que funcionan como una vacuna oral contra el cólera, unas levaduras vínicas transgénicas capaces de producir vino con aroma más afrutado o vacas u ovejas que producen leche con altos niveles de proteínas terapéuticas. En cualquier caso, la fecha de partida para el futuro de la biotecnología de los alimentos fue la publicación en 2001 del primer borrador del genoma humano: este descubrimiento abrió la puerta a la búsqueda de genes de nuestro genoma que se activan o desactivan en respuesta a la ingesta de nutrientes específicos. No solo eso, hoy en día también es posible determinar las diferencias genéticas entre individuos que producen diferentes respuestas nutricionales. Además cada día se publican en las bases de datos varios nuevos genomas de animales, plantas o microorganismos que son componentes habituales de nuestra dieta. Algunos casos sobresalientes son los genomas del arroz, la levadura del pan, la bacteria probiótica Bifidobacterium bifidum o patógenos responsables de la intoxicación alimentaria, como Escherichia coli. Estos datos proporcionan información sobre genes clave, con la que es posible diseñar estrategias de mejora por genética clásica o ingeniería clásica, delimitar los mecanismos de defensa para combatir la patogenicidad o definir nuevas funciones fisiológicas. Su aplicación a la alimentación y la nutrición está mucho más próxima de lo que muchos imaginan.

  6. Two p90 ribosomal S6 kinase isoforms are involved in the regulation of mitotic and meiotic arrest in Artemia.

    Science.gov (United States)

    Duan, Ru-Bing; Zhang, Li; Chen, Dian-Fu; Yang, Fan; Yang, Jin-Shu; Yang, Wei-Jun

    2014-06-06

    There are multiple isoforms of p90 ribosomal S6 kinase (RSK), which regulate diverse cellular functions such as cell growth, proliferation, maturation, and motility. However, the relationship between the structures and functions of RSK isoforms remains undetermined. Artemia is a useful model in which to study cell cycle arrest because these animals undergo prolonged diapauses, a state of obligate dormancy. A novel RSK isoform was identified in Artemia, which was termed Ar-Rsk2. This isoform was compared with an RSK isoform that we previously identified in Artemia, termed Ar-Rsk1. Ar-Rsk2 has an ERK-docking motif, whereas Ar-Rsk1 does not. Western blot analysis revealed that Ar-Rsk1 was activated by phosphorylation, which blocked meiosis in oocytes. Knockdown of Ar-Rsk1 reduced the level of phosphorylated cdc2 and thereby suppressed cytostatic factor activity. This indicates that Ar-Rsk1 regulates the cytostatic factor in meiosis. Expression of Ar-Rsk2 was down-regulated in Artemia cysts in which mitosis was arrested. Knockdown of Ar-Rsk2 resulted in decreased levels of cyclin D3 and phosphorylated histone H3, and the production of pseudo-diapause cysts. This indicates that Ar-Rsk2 regulates mitotic arrest. PLK and ERK RNAi showed that Ar-Rsk2, but not Ar-Rsk1, could be activated by PLK-ERK in Artemia. This is the first study to report that RSK isoforms with and without an ERK-docking motif regulate mitosis and meiosis, respectively. This study provides insight into the relationship between the structures and functions of RSK isoforms.

  7. Comportamento de craving por alimentos em população brasileira

    OpenAIRE

    Medeiros, Anna Cecilia Queiroz de

    2016-01-01

    O craving por alimentos pode ser definido como um desejo intenso de comer um tipo de alimento em particular. Trata-se de um comportamento bastante comum na população em geral. O presente trabalho se propôs a investigar o comportamento de craving por alimentos em população brasileira, validando questionários para este fim, além de pesquisar a relação do craving por alimentos com o estado de cromo no organismo. Como resultado, foi realizada a tradução, adaptação cultural e validação dos Food Cr...

  8. La Irradiación de alimentos: Lo que usted debe saber

    Science.gov (United States)

    La irradiaciÃÆ'ƒÂ³n de alimentos (la aplicaciÃÆ'Æ’ ³n de radiaciÃÆ'ƒÂ³n ionizante a los alimentos ...

  9. Alimentos funcionais no manejo da diabetes mellitus = Functional foods in the management of diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Zaparolli, Marília Rizzon

    2013-01-01

    Full Text Available Objetivo: Analisar o conhecimento e o consumo de alimentos funcionais que auxiliam no controle da Diabetes mellitus em pacientes de um hospital público de Curitiba - PR. Materiais e Métodos: Trata-se de um estudo transversal e quantitativo, realizado com pacientes diabéticos hospitalizados (Hospital de Clínicas/UFPR, no período de dezembro de 2011 a março de 2012. Para a coleta de dados foi utilizado um questionário, através do qual se obteve informações sobre o conhecimento de alimentos funcionais e consumo de cinco alimentos funcionais importantes no controle da diabetes: alho, batata yacon, cebola, farinha de casca de maracujá e linhaça. Os dados coletados foram tabulados no programa Libre Office 3. 5® e após isso se realizou análise estatística descritiva. Resultados: Observou-se que somente 12 pacientes (35,29% da amostra haviam recebido informações anteriormente sobre alimentos funcionais e apenas 11 (32,35% responderam saber da importância desses alimentos no controle da diabetes. Dos cinco alimentos funcionais estudados, o alho e a batata yacon foram os que apresentaram maior consumo entre os diabéticos. Conclusão: O conhecimento de alimentos funcionais bem como seu consumo é pequeno por parte de pacientes diabéticos. Há a necessidade de uma maior intervenção por parte dos profissionais da Nutrição na orientação do consumo desses alimentos na dieta habitual dos diabéticos, visando promover um melhor controle da diabetes mellitus

  10. Preparación y distribución de alimentos para ganado

    OpenAIRE

    2000-01-01

    En este trabajo se analizan las distintas máquinas que existen actualmente para la preparación de granos, forrajes, tubérculos, y raíces, así como para la distribución de alimentos en nuestras J explotaciones. Podemos dividir la cadena de trabajo de la alimentación del ganado en dos fases principales: 1) Preparación del alimento. 2) Transporte y distribución del mismo.

  11. Estudio microbiológico de los alimentos elaborados en comedores colectivos de alto riesgo

    Directory of Open Access Journals (Sweden)

    Pérez-Silva García Mª del Carmen

    1998-01-01

    Full Text Available FUNDAMENTO: Valorar los resultados del análisis microbiológico de los alimentos preparados en comedores colectivos de alto riesgo, con el fin de conocer el grado de contaminación de los alimentos, analizar las causas de dicha contaminación y mejorar la situación sanitaria de estos establecimientos. MÉTODOS: Estudio observacional descriptivo con los datos obtenidos de la inspección sanitaria en 44 comedores colectivos de alto riesgo, que incluyó el análisis microbiológico de 90 alimentos, así como la inspección sanitaria de los establecimientos. RESULTADOS: En los colegios los microorganismos mesófilos fueron los contaminantes más frecuentes; en las guarderías y residencias de ancianos predominaron los indicadores de higiene deficiente en la manipulación de alimentos. Los microorganismos mesófilos se encontraron durante los meses fríos en mayor proporción que durante los meses cálidos. Los indicadores de higiene deficiente aparecieron generalmente en los alimentos preparados en establecimientos en los que se observaron deficiencias. Los microorganismos psicrótrofos no se encontraron en ninguno de los alimentos recogidos en guarderías y sí en colegios y residencias de ancianos. CONCLUSIONES: Este estudio indica qué problemas predominan en cada tipo de comedor colectivo de alto riesgo. Los mesófilos aparecen en los alimentos elaborados en cocinas de tamaño grande, los indicadores de higiene deficiente se encontraron asociados a una manipulación de alimentos por personal no profesional y a establecimientos con deficiencias, y los psicrótrofos se detectaron en aquellos establecimientos que guardan la comida sobrante. Se sugieren recomendaciones para la eliminación de los problemas detectados.

  12. Grado de conocimiento y actitudes de los consumidores espanoles hacia los alimentos modificados geneticamente

    OpenAIRE

    Rouhia NOOMENE; Gil, Jose Maria

    2006-01-01

    Los alimentos transgenicos han sido objecto de un consuderabke debate en los ultimos anos, manteniendose posturas radicalmente opuestas. A pesar de que la aceptacion entre los productores es notable, los consumidores, sobre todo en Europa, se han mostrado tradicionalmente reacios a este tipo de productos. Una vez que se ha aprobado la regulacion sobre el etiquetado de estos alimentos y, por tanto, que el consumidor va a disponer de cierta informacion sobre la naturaleza de los productos que v...

  13. Consumo de alimentos fora do domicílio no Brasil Consumo de alimentos fuera del domicilio en Brasil Consumption of foods away from home in Brazil

    Directory of Open Access Journals (Sweden)

    Rosangela Alves Pereira

    2013-02-01

    Full Text Available OBJETIVO: Analisar características do consumo de alimentos fora do domicílio no Brasil. MÉTODOS: Foram analisados dados do Inquérito Nacional de Alimentação, conduzido com 34.003 indivíduos acima de dez anos de idade em 24% dos domicílios participantes da Pesquisa de Orçamentos Familiares em 2008-2009. O consumo de alimentos e bebidas foi coletado por meio de registros dos alimentos consumidos, tipo de preparação, quantidade, horário e fonte do alimento (dentro ou fora de casa. A frequência de indivíduos que consumiu alimentos fora do domicílio foi calculada segundo faixas de idade, sexo, faixas de renda, área de localização do domicílio, tamanho da família, presença de criança no domicílio e idade do chefe do domicílio no Brasil e em cada região brasileira. Para as análises, considerou-se o peso amostral específico do inquérito e incorporou-se o efeito do desenho amostral. RESULTADOS: O consumo de alimentos fora do domicílio no Brasil foi reportado por 40% dos entrevistados, variando de 13% entre os idosos da região Sul a 51% entre os adolescentes da região Sudeste. Esse percentual diminuiu com a idade e aumentou com a renda em todas as regiões brasileiras; foi maior entre os homens e na área urbana. Os grupos de alimentos com maior percentual de consumo fora de casa foram bebidas alcoólicas, salgadinhos fritos e assados, pizza, refrigerantes e sanduíches. CONCLUSÕES: A alimentação fora de casa apresenta predominância de alimentos de alto conteúdo energético e pobre conteúdo nutricional, indicando que o consumo de alimentos fora do domicílio deve ser considerado nas ações de saúde pública voltadas para a melhoria da alimentação dos brasileiros.OBJETIVO: Analizar características del consumo de alimentos fuera del domicilio. MÉTODOS: se analizaron datos de la Pesquisa Nacional de Alimentación, conducido con 34.003 individuos con edades mayores a diez años en 24% de los domicilios participantes

  14. Determinación de la canasta básica de alimentos de la Fundación Banco Arquidiocesano de Alimentos de Bogotá

    OpenAIRE

    Jhon Jairo Bejarano-Roncancio; Edwin Arley Rivera-Torres

    2014-01-01

    Antecedentes. Desde el año 2001, el Banco de Alimentos de Bogotá tiene como propósito recuperar productos frescos y manufacturados por la industria para entregarlos a grupos vulnerables del Distrito Capital y algunos municipios de Cundinamarca. Sin embargo, existe una Canasta Básica de Alimentos (CBA) estandarizada para determinar una estructura para su entrega. Objetivo. Determinar la CBA para establecer los componentes permanentes y adicionales del paquete por población. Materiales y método...

  15. SNP detection in Na/K ATP-ase gene α1 subunit of bisexual and parthenogenetic Artemia strains by RFLP screening.

    Science.gov (United States)

    Manaffar, R; Zare, S; Agh, N; Abdolahzadeh, N; Soltanian, S; Sorgeloos, P; Bossier, P; Van Stappen, G

    2011-01-01

    In order to find a marker for differentiating between a bisexual and a parthenogenetic Artemia strain, Exon-7 of the Na/K ATPase α(1) subunit gene was screened by RFLP technique. The results revealed a constant synonymous SNP (single nucleotide polymorphism) in digestion by the Tru1I enzyme that was consistent with these two types of Artemia. This SNP was identified as an accurate molecular marker for discrimination between bisexual and parthenogenetic Artemia. According to the Nei's genetic distance (1973), the lowest genetic distance was found between individuals from Artemia urmiana Günther 1890 and parthenogenetic populations, making the described marker the first marker to easily distinguish between these two cooccurring species.

  16. Survival and retention of the probiotic properties of Bacillus sp. strains under marine stress starvation conditions and their potential use as a probiotic in Artemia culture.

    Science.gov (United States)

    Mahdhi, Abdelkarim; Esteban, Maria Ángeles; Hmila, Zeineb; Bekir, Karima; Kamoun, Fathi; Bakhrouf, Amina; Krifi, Boubaker

    2012-12-01

    The probiotic properties of Bacillus strains isolated from Artemia culture and the effect of marine stress on viability and survival were investigated, as well as the changes occurring in their properties. Analyses showed that these bacteria corresponded to the genus Bacillus sp. Antagonism and adherence assays revealed that Bacillus strains have an inhibitory effect against tested pathogenic bacteria and are fairly adherent. Normal and starved cells showed different enzymatic profiles. Challenge tests performed with Artemia larvae provided evidence that the tested Bacillus strains were neither pathogenic nor toxic to the host and conferred protection for Artemia culture against pathogens. The tested strains maintained their viability and their probiotic properties during the period of study. The results suggest that the tested strains have suffered changes allowing them to survive in seawater in the absence of nutrients and outside their natural host, identifying them as potential probiotic candidates for Artemia culture.

  17. Some observations on the growth and cyst production characteristics of the brine shrimp Artemia sp. (Gujarat strain) in pond culture and its potential for import substitution

    OpenAIRE

    Gopalakrishnan, P.; Krishna Raju, V.; Thaker, S R

    1989-01-01

    Experimental culture of the brine shrimp Artemia sp. (Gujarat strain) and production of cyst is discussed. The qualitative and quantitative aspects of the cyst and its economic potential for import substitution are highlighted.

  18. Multigenerational demographic responses of sexual and asexual Artemia to chronic genotoxicity by a reference mutagen.

    Science.gov (United States)

    Sukumaran, Sandhya; Grant, Alastair

    2013-11-15

    Genotoxins are capable of multigenerational impacts on natural populations via DNA damage and mutations. Sexual reproduction is assumed to reduce the long term consequences of genotoxicity for individual fitness and should therefore reduce population level effects. However, rather few empirical studies have quantified the magnitude of this effect. We tried to analyse the multigenerational demographic responses of sexual Artemia franciscana and asexual Artemia parthenogenetica due to chronic genotoxicity by a reference mutagen, ethyl methane sulfonate (EMS). A prospective (elasticity analysis) and retrospective (differences and contributions) perturbation analysis was carried out to understand the interactions of life history traits with population growth rate λ by comparing elasticities, differences and contributions of vital rates to λ. None of the previous studies have compared the effects of chronic genotoxicity using prospective and retrospective perturbation analyses in a sexual and asexual species over generations. The behaviour of a population with lower growth rate in the presence of genotoxicants in the field was studied by simulating reduced fertilities in the LTRE design. The results of prospective and retrospective perturbation analyses of effects on λ showed that population growth rate was proportionally more sensitive to juvenile survival whereas the effect of EMS on juvenile fertility contributed more to the variations in population growth rate in both the species and this effect was due to the high growth rate of Artemia. Simulations of lower population growth rate in the model showed that adult fertility and survival are also of importance. Sexual reproduction substantially mitigated the long term consequences of genetic damage, although these would be greater if population growth rate were lower. So multigenerational population level consequences of genotoxicity were much greater in an asexual species. So asexual species, and those with a

  19. Efecto del alimento sobre variables productivas de dos especies de Cladóceros bajo condiciones de laboratorio

    Directory of Open Access Journals (Sweden)

    Angélica Otero P.

    2013-10-01

    Full Text Available Objetivo. Evaluar los efectos de diferentes tipos de alimentos sobre la productividad de Diaphanosoma sp., y Alona sp bajo condiciones de laboratorio. Materiales y métodos. Juveniles de Diaphanosoma sp., y Alona sp., fueron sembrados en acuarios de 20 L a una densidad de 6 org L-1 y mantenidos con aireación constante y fotoperíodo 12:12 (luz : oscuridad. Se alimentaron con Saccharomyces cereviseae y Chlorella vulgaris a concentración de 4 x 105 Cel/ml cada uno, en tres combinaciones: 1. C. vulgaris, 2. S. cereviseae, 3. C. vulgaris + S. cereviseae en proporciones iguales; de cada tratamiento se realizaron 3 réplicas. Con el propósito de determinar la densidad poblacional, cada 3 días y durante un período de 27 días, y se midió la concentración de individuos por ml. Resultados. Se obtuvieron mejores resultados en el tratamientos de microalgas + levadura, con valores de TCE=0.1323±0.07 y 0.1598±0.04 días-1; R=0.010 ±0.004 y 0.019±0.01 org ml-1 día-1, TD=5.2±0.5 y 4.3±0.38 días para Diaphanosoma sp., y Alona sp., respectivamente, pero sin presentar diferencias significativas (p>0.05. Conclusiones. La dieta mixta de levadura y microalgas produjo mayor eficiencia productiva en las dos especies estudiadas, constituyendo una alternativa de fuente de alimento vivo para la acuicultura.

  20. Tendencia de los consumos de alimentos en Colombia

    Directory of Open Access Journals (Sweden)

    Kalmanovitz Salomón

    1980-12-01

    Full Text Available En un tipo de economía como la colombiana, caracterizada por salarios que tienen muy poca ligazón con la productividad social del trabajo, estos son por lo general muy bajos y una parte de ellos, que llega a ser más de la mitad, se dedica a la adquisición de alimentos. Mientras el salario mínimo en Colombia era en enero de 1979 de US$ 3.10 diarios, en Estados Unidos era de US$ 3.75 la hora, al tiempo que la jornada de trabajo acá era un 20% más larga (48 horas a la semana contra 40 , lo que representa una diferencia abismal de 12 veces. Las diferencias de productividad industrial en 1974 eran de sólo 4 veces en términos de valor agregado por trabajador o sea que un capitalista operando en el país estrujaba 3 veces más trabajo sobrante a cada obrero que el correspondiente a un empresario yanki.

  1. Effects of salinity and ultraviolet radiation on the bioaccumulation of mycosporine-like amino acids in Artemia from Lake Urmia (Iran).

    Science.gov (United States)

    Khosravi, Sanaz; Khodabandeh, Saber; Agh, Naser; Bakhtiarian, Mahdieh

    2013-01-01

    We investigated the effects of salinity and artificial UV radiation on the accumulation of mycosporine-like amino acids (MAAs) in sexual and parthenogenetic Artemia from Lake Urmia. The nauplii hatched from the cysts were cultured until adulthood under two salinities (150 and 250 g L(-1) ) and two light treatments (PAR and PAR+UVR) in the laboratory. Finally, the Artemia were analyzed for their concentration of MAAs. In most of the cases, the higher salinity level applied was found to increase the MAA concentrations in both Artemia populations significantly. The acquisition efficiency of MAAs in both Artemia populations increased under exposure to UVR-supplemented photosynthetically active radiation (PAR) compared to those raised under PAR, except for Porphyra-334. It was observed that combination of UV radiation and elevated salinity significantly increased the bioaccumulation of MAAs. Thus, the presence of these compounds in these populations of Artemia may increase their adaptability for living in high-UV and high-salinity conditions prevailing in Lake Urmia. Higher concentrations of MAAs in the parthenogenetic population of Artemia could be probably attributed to its mono sex nature and higher adaptation capacities to extreme environmental conditions.

  2. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Institute of Scientific and Technical Information of China (English)

    Behnam Shekarchi; Ali Nekuiefard; Ramin Manaffar

    2016-01-01

    Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME) (3.5% v/v). Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms) were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate) in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  3. Brine shrimp (Artemia salina Leach bioassay of extracts from Lychnophoriopsis candelabrum and different Lychnophora species

    Directory of Open Access Journals (Sweden)

    Z.S Ferraz Filha

    2012-01-01

    Full Text Available The present study aimed to evaluate on Artemia salina the citotoxicity of twenty-two extracts from five species of the genus Lychnophora and one species of the genus Lychnophoriopsis. The extracts solubilized in DMSO and prepared at the final concentrations of 100, 250, 375, 500 and 600 μg mL-1 were added to tubes containing Artemia salina nauplii (10 units each and filled to 5 mL total volume with artificial salt water. Lapachol and 5% DMSO were used as positive and negative controls, respectively. The samples were kept under light and dead larvae were counted after 24 hours of contact. LC50 was calculated by using Probit software. The crude ethanol extracts from five species showed low lethality in the following order: Lychnophora trichocarpha (LC50 = 672.38 μg mL-1 > Lychnophora pinaster (LC50 = 678.73 μg mL-1 > Lychnophora ericoides (LC50 = 738.09 μg mL-1 > Lychnophoriopsis candelabrum (LC50 = 812.57 μg mL-1 > Lychnophora passerina (LC50 = 921.78 μg mL-1. All tested extracts from L. candelabrum and chloroform extract from L. staavioides showed light toxicity on A. salina. Results indicated that there are substances with potential pharmacological activity in all tested species.O presente estudo teve como objetivo avaliar a citotoxicidade sobre Artemia salina de vinte e dois extratos de cinco espécies do gênero Lychnophora e de uma espécie de Lychnophoriopsis. Os extratos solubilizados em DMSO, preparados nas concentrações finais de 100, 250, 375, 500 e 600 μg mL-1, foram adicionados a recipientes contendo náuplios de Artemia salina (10 unidades cada e completou-se o volume para 5 mL com solução marinha. Lapachol e DMSO 5% foram usados como controles positivo e negativo, respectivamente. As amostras foram mantidas sob iluminação e as larvas mortas foram contadas após 24 horas de contato. O cálculo da LC50 foi feito utilizando-se o programa Probitos. Os extratos etanólicos brutos de cinco espécies apresentaram baixa

  4. First secondary metabolites from Herissantia crispa L (Brizicky and the toxicity activity against Artemia salina Leach

    Directory of Open Access Journals (Sweden)

    Danielly Albuquerque da Costa

    2009-01-01

    Full Text Available The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-β-D-glucopyranoside, stigmasterol 3-O-β-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol, 3,5,7,3',4'-pentahydroxyflavone (quercetin, unpublished in the genus Herissantia, besides β-sitosterol, kaempferol 3-O-β-D-(6''-E-p-coumaroil (tiliroside glucopyranoside and kaempferol 3,7-di-O-α-L-ramnopyranoside (lespedin, described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, ¹H and 13C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out.

  5. Can Artemia Hatching Assay Be a (Sensitive) Alternative Tool to Acute Toxicity Test?

    Science.gov (United States)

    Rotini, A; Manfra, L; Canepa, S; Tornambè, A; Migliore, L

    2015-12-01

    Artemia sp. is extensively used in ecotoxicity testing, despite criticisms inherent to both acute and long-term tests. Alternative endpoints and procedures should be considered to support the use of this biological model. The hatching process comprises several developmental steps and the cyst hatchability seems acceptable as endpoint criterion. In this study, we assessed the reliability of the hatching assay on A. franciscana by comparing with acute and long-term mortality tests, using two chemicals: Diethylene Glycol (DEG), Sodium Dodecyl Sulphate (SDS). Both DEG and SDS tests demonstrated a dose dependent hatching inhibition. The hatching test resulted more sensitive than acute mortality test and less sensitive than the long-term one. Results demonstrate the reliability and high sensitivity of this hatching assay on a short time lag and support its useful application in first-tier risk assessment procedures.

  6. Preliminary results of the Artemia salina experiments in biostack on LDEF

    Science.gov (United States)

    Graul, E. H.; Ruether, W.; Hiendl, C. O.

    1992-01-01

    The mosaic egg of the brine shrimp, Artemia salina, resting in blastula or gastrula state represents a system that during further development, proceeds without any further development to the larval stage, the free swimming nauplius. Therefore, injury to a single cell of the egg will be manifest in the larvae. In several experiments, it was shown that the passage of a single heavy ion through the shrimp egg damaged a cellular area large enough to disturb either embryogenesis or further development of the larvae, or the integrity of the adult individual. Emergence from the egg shell was heavily disturbed by the heavy ions as was hatching. Additional late effects, due to a hit by a heavy ion, are delayed of growth and of sexual maturity, and reduced fertility. Anomalies in the body and the extremities could be observed more frequently for the nauplii which had developed from eggs hit by heavy ions.

  7. IDENTIFIKASI DAN UJI AKTIVITAS ANTIKANKER EKSTRAK SPONS Ianthella basta TERHADAP LARVA Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Ni Wayan Sri Sukmarianti

    2013-05-01

    Full Text Available The main purpose of this research is to determine the toxicity of extracts sponge Ianthella basta against Artemia salina larvae and to identify the chemical compounds contained in those toxic isolates. The preliminary test of the anticancer activity has conducted by Brine Shrimp Letalithy (BST test. The results showed that the chloroform extract was the most toxic with LC50 value of 22,39 ppm. Futher, the cloroform extract was separated and purified by coloumn chromatography using eluent of solvent mixture of chloroform : ethyl acetate : n-hexane by 7 : 2 : 1 and 4 fractions were obtained. The most toxic fraction was the fraction C with LC50 value of 35,36 ppm. Based on the GC-MS results, the toxic isolate is allegedly containing chemicals compound of hexadecanoic methyl ester and hexadecanoic acid.

  8. Genetic variation in parthenogenetic Artemia from the Shandong Peninsula, P.R.C.

    Science.gov (United States)

    King, Charles E.; Zhao, Yuqi; Liu, Xin; Li, Mingren

    1988-06-01

    Results are presented of a survey of isozyme frequencies in parthenogenetic Artimia from six salterns in the Shandong Peninsula, P.R.C. Three of the eleven enzymes we scored using polyacryamide gel electrophoresis proved to be useful for analysis of electromorph frequency variation. These enzymes are tetrazolium oxidase (TO), lactate dehydrogenase (LDH), and malate dehydrogenase (MDH). Each of these systems showed extensive isozyme variation both within and between salterns. In addition, we have examined the possibility that electromorph frequencies may vary as the result of natural selection for adaptation to specific salinity, or salinity-associated environmental conditions. An indication of clinal variation was found in two series of ponds differing in salinity, however more extensive data are needed before it is possible to conclude that these patterns are the result of natural selection. Finally, the use of isozyme analyses such as ours, for unraveling taxonomic problems in Artemia is discussed.

  9. Toxicity of cylindrospermopsin to the brine shrimp Artemia salina: comparisons with protein synthesis inhibitors and microcystins.

    Science.gov (United States)

    Metcalf, J S; Lindsay, J; Beattie, K A; Birmingham, S; Saker, M L; Törökné, A K; Codd, G A

    2002-08-01

    The Artemia salina bioassay was successfully applied to the analysis of the hepatotoxic cyanobacterial alkaloid and protein synthesis inhibitor, cylindrospermopsin. A dose-dependent response in mortality was observed for purified cylindrospermopsin and LC(50) values decreased with time from 8.1 to 0.71 microg/ml(-1), between 24 and 72 h, respectively. Cylindrospermopsin was slightly less potent than micro cystin-LR, with similar LC(50) values on a gravimetric basis, but was more toxic to A.salina than the protein synthesis inhibitors, cycloheximide, chloramphenicol and tetracycline. Cylindrospermopsin-containing strains of the cyanobacterium Cylindrospermopsis raciborskii were found to be toxic to A.salina and the LC(50) concentration for these strains over time was greater than the LC(50) for purified cylindrospermopsin, with the exception of C. raciborskii strain CR1.

  10. Sharp Phylogeographic Breaks and Patterns of Genealogical Concordance in the Brine Shrimp Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Theodora Farmaki

    2009-12-01

    Full Text Available Genealogical concordance is a critical overlay of all phylogenetic analyses, irrespective of taxonomic level. To assess such patterns of congruence we have compiled and derived sequence data for two mitochondrial (16S rRNA, COI and two nuclear (ITS1, p26 markers in 14 American populations of the hypersaline branchiopod Artemia franciscana. Cladistic analysis revealed three reciprocally monophyletic mitochondrial clades. For nuclear DNA, incomplete lineage sorting was evident presumably as a result of slower coalescence or male-mediated dispersal. Our findings capture the genealogical interval between gene splitting and population divergence. In this sense, strong indications are provided in favour of a superspecies status and ongoing speciation in A. franciscana.

  11. Identification of a novel DNA methyltransferase 2 from the brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Feng, Chen-Zhuo; Zhu, Xiao-Jing; Dai, Zhong-Min; Liu, Feng-Qi; Xiang, Jian-Hai; Yang, Wei-Jun

    2007-06-01

    DNA methyltransferase 2 (Dnmt2) is a dual-specificity DNA methyltransferase, which contains a weak DNA methyltransferase and novel tRNA methyltransferase activity. However, its biological function is still enigmatic. To elucidate the expression profiles of Dnmt2 in Artemia franciscana, we isolated the gene encoding a Dnmt2 from A. franciscana and named it as AfDnmt2. The cDNA of AfDnmt2 contained a 1140-bp open reading frame that encoded a putative Dnmt2 protein of 379 amino acids exhibiting 32% approximately 39% identities with other known Dnmt2 homologs. This is the first report of a DNA methyltransferase gene in Crustacean. By using semi-quantitative RT-PCR, AfDnmt2 was found to be expressed through all developmental stages and its expression increased during resumption of diapause cysts development. Southern blot analysis indicated the presence of multiple copies of AfDnmt2 genes in A. franciscana.

  12. Interactive effect of selenium and mercury on development and mortality of brine shrimp, Artemia sp.

    Energy Technology Data Exchange (ETDEWEB)

    Forsythe, B.L. II; Bailey, F.C.; Klaine, S.J. [Clemson Univ., Pendleton, SC (United States)

    1994-12-31

    The interactions between organic mercury and selenium derivatives are well documented. Inorganic mercury has been shown to have a deleterious effect on the development of brine shrimp, Artemia franciscana while selenate has no effect. In this study, concentrations as low as 0.1 mg/l Hg (as Hg(NO{sub 3})2) slowed the rate of development. Selenate concentrations ranging from 0.1 to 5.0 mg/l as Se decreased the effect of Hg on brine shrimp developmental rate. Both selenate and inorganic mercury alone produced a dose-response with respect to nauplii mortality. Preliminary data suggest that combinations of selenate and inorganic mercury act antagonistically to lower this mortality.

  13. First secondary metabolites from Herissantia crispa L (Brizicky) and the toxicity activity against Artemia salina Leach

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Danielly Albuquerque da; Matias, Wemerson Neves; Lima, Igara Oliveira; Xavier, Aline Lira; Costa, Vivian Bruna Machado; Diniz, Margareth de Fatima Formiga Melo; Agra, Maria de Fatima; Batista, Leonia Maria; Souza, Maria de Fatima Vanderlei de [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Lab. de Tecnologia Farmaceutica Prof. Delby Fernandes de Medeiros; Silva, Davi Antas e [Universidade Federal Rural de Pernambuco, Serra Talhada, PE (Brazil). Dept. de Quimica

    2009-07-01

    The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-{beta}-D-glucopyranoside, stigmasterol 3-O-{beta}-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol), 3,5,7,3',4'-pentahydroxyflavone (quercetin), unpublished in the genus Herissantia, besides {beta}-sitosterol, kaempferol 3-O-{beta}-D-(6''-E-p-coumaroil) (tiliroside) glucopyranoside and kaempferol 3,7-di-O-{alpha}-L-ramnopyranoside (lespedin), described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, {sup 1}H and {sup 13}C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out. (author)

  14. Further characterization of the cathepsin L-associated protein and its gene in two species of the brine shrimp, Artemia.

    Science.gov (United States)

    Liu, Liqian; Warner, Alden H

    2006-12-01

    The major cysteine protease in embryos and larvae of the brine shrimp Artemia franciscana is a heterodimer composed of a cathepsin L-like polypeptide of 28.5 kDa and a 31.5 kDa polypeptide called the cathepsin L-associated protein or CLAP. In a previous study, CLAP was shown to be a cell adhesion protein containing two Fas I domains and two GTP/ATP binding sites known as Walker A and B motifs. Here, we have characterized CLAP and its genes to better understand the role of this protein in Artemia development. The polymerase chain reaction was used to investigate the structure of the CLAP gene in two species of Artemia, the New World bisexual diploid A. franciscana and the Old World parthenogenetic tetraploid Artemia parthenogenetica. The protein coding region of the CLAP gene from each species was 99.5% identical for a protein of 332 amino acids, while the 3' non-coding region, representing nearly 45% of the gene, was only 86% identical between the two related species. However, while the CLAP gene is intronless in A. franciscana, in A. parthenogenetica the gene contained a mini-intron of 30 base pairs in the 3' non-coding region. The sequences representing the CLAP gene in A. franciscana and A. parthenogenetica have been entered into the NCBI database as AY757920 and DQ100385, respectively. Northern blot analysis showed that while the cathepsin L gene is expressed constitutively in Artemia franciscana embryos and young larvae, the CLAP gene is not expressed in late embryos and young larvae. In contrast, Western blots indicated that CLAP is present in developing embryos and young larvae, at least to the first larval molt, supporting results obtained previously showing CLAP's resistance to degradation by its dimeric partner, cathepsin L. At the protein level we showed that the GTP/ATP binding sites in CLAP are functional with rate constants of 0.024 and 0.022 for GTP and ATP hydrolase activity, respectively. GTP but not ATP also had a slight stimulatory effect on

  15. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Institute of Scientific and Technical Information of China (English)

    Ana Dors; Mara Carmen Bartolom; Sebastin Snchez-Fortn

    2014-01-01

    Objective:To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods:Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI)-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results:Biotoxin equivalent values obtained by immunodetection were (2.12±0.10), (8.60±1.30) and (4.32±1.67) pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions:These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  16. Maladaptive Sex Ratio Adjustment in the Invasive Brine Shrimp Artemia franciscana.

    Science.gov (United States)

    Lievens, Eva J P; Henriques, Gil J B; Michalakis, Yannis; Lenormand, Thomas

    2016-06-06

    Sex allocation theory is often hailed as the most successful area of evolutionary theory due to its striking success as a predictor of empirical observations [1]. Most naturally occurring sex ratios can be explained by the principle of equal investment in the sexes [2-4] or by cases of "extraordinary" sex allocation [5]. Deviations from the expected sex ratio are often correlated with weak selection or low environmental predictability (e.g., [6, 7]); true cases of aberrant sex allocation are surprisingly rare [8]. Here, we present a case of long-lasting maladaptive sex allocation, which we discovered in invasive populations of the exclusively sexual brine shrimp Artemia franciscana. A. franciscana was introduced to Southern France roughly 500 generations ago [9]; since then, it has coexisted with the native asexual species Artemia parthenogenetica [10]. Although we expect A. franciscana to produce balanced offspring sex ratios, we regularly observed extremely male-biased sex ratios in invasive A. franciscana, which were significantly correlated to the proportion of asexuals in the overall population. We experimentally proved that both invasive- and native-range A. franciscana overproduced sons when exposed to excess females, without distinguishing between conspecific and asexual females. We conclude that A. franciscana adjust their offspring sex ratio in function of the adult sex ratio but are information limited in the presence of asexual females. Their facultative adjustment trait, which is presumably adaptive in their native range, has thus become maladaptive in the invasive range where asexuals occur. Despite this, it has persisted unchanged for hundreds of generations.

  17. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    Directory of Open Access Journals (Sweden)

    J.M. Lima

    2009-03-01

    Full Text Available A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qualificados no extrato aquoso, com exceção de cumarinas. Em diclorometano, verificou se a presença de saponinas, derivados triterpênicos e esteróides. No teste de toxicidade sobre Artemia salina, os dados convergiram para frações de extrato aquoso de 5.117,2 ppm, indicando ser um extrato de baixa toxicidade.Sonchus oleraceus is a common weed in Brazil, also used as a medicinal plant. Phytochemical prospecting of this species was carried out in this work using extracts obtained in ethanol, water and dichloromethane. A toxicity study of the aqueous extract was also conducted, using the micro crustaceous Artemia salina. The aqueous extract presented sugar reducers, phenolic compounds, tannins, flavonoids and coumarins in its composition. The compounds found in the aqueous extract were also detected in the ethanol extract, except for the coumarins. Saponin, triterpenes and steroids were identified in the dichloromethane extract. The toxicity test on Artemia salina pointed to aqueous extract fractions of 5,117.2 ppm, indicative of low toxicity.

  18. El tamaño de la porción modifica el consumo de alimento en estudiantes universitarios

    OpenAIRE

    Alma Gabriela Martínez Moreno; Karina Franco Paredes; Felipe de Jesús Díaz Reséndiz; Asucena Cárdenas Villalvazo; Virginia Gabriela Aguilera Cervantes; Elia Herminia Valdés Miramontes; Antonio López-Espinoza

    2011-01-01

    El objetivo del presente estudio fue evaluar el efecto de modificar el tamaño de la porción sobre la cantidad de alimento consumida en universitarios. La mitad de los participantes, hombres y mujeres universitarios, fueron expuestos a dos sesiones experimentales en las que recibieron un alimento en una porción grande y después el mismo alimento en diez porciones pequeñas con el mismo sabor y textura que la porción grande. El resto de los participantes recibió el alimento en orden contrario. L...

  19. TRANSGÉNICOS, ALERTA NARANJA EN LOS ALIMENTOS

    Directory of Open Access Journals (Sweden)

    Camilo Alviar F.

    2005-01-01

    Full Text Available La ingeniería genética en el área de la agricultura, y más concretamente de la producción de alimentos, desde hace varias décadas está modificando la estructura genética de origen para dar lugar a las superplantas, a los supercultivos. La obtención de los transgénicos responde a intereses comerciales y mercantilistas y no a una respuesta para el campesino ni para el medio ambiente ni para el consumidor. Al consumidor se le está negando una información vital cuando no se le suministra información visible y medianamente comprobable para que tenga la posibilidad de elegir cómo alimentarse. Los organismos modificados genéticamente (OMG pueden representar peligros muy grandes para el planeta. Actualmente, los cultivos transgénicos han incrementado las áreas productivas en forma exponencial, y están prácticamente en todo el orbe. Y aunque las áreas de agricultura orgánica, limpia, y sostenible han aumentado enormemente con resultados positivos demostrados contundentemente, la proporción con respecto a los transgénicos coloca a la humanidad en serios riesgos. Para los recursos naturales no es menos crítica la situación, ya que se han podido demostrar categóricamente las consecuencias negativas con estudios serios y de varios años. El agua, el suelo, la biodiversidad como un todo está en peligro, pues los organismos alterados están provocando la extinción de plantas nativas, de plantas promisorias: el germoplasma silvestre está siendo atacado en forma frontal.

  20. ALIMENTOS CONSUMIDOS PELOS ALUNOS DE ESCOLAS DE TEMPO INTEGRAL

    Directory of Open Access Journals (Sweden)

    Marina VIEIRA DA SILVA

    2009-07-01

    Full Text Available

    Descreve-se o consumo alimentar de amostra (n = 224 de alunos matriculados em escolas de tempo integral do município de Americana, Estado de São Paulo. Utilizou-se o registro de alimentos ingeridos pelos escolares, durante 3 dias não consecutivos da semana. Para a definição das recomendações de energia e nutrientes, adotou-se padrão proposto por Martins & Hidalgo para a população brasileira. Com o objetivo de conhecer a qualidade nutricional, utilizou-se o índice proposto por Sorenson & Hansen. Entre os princípais resultados destacam-se: o consumo de lácteos que ocorre de forma praticamente exclusiva no desjejum (efetuado nas escolas e o elevado número de citações de consumo de pão, embutidos e refrigerantes em domicílio. Esse resultado sugere que os escolares estão substituindo, sobretudo, o jantar tradicional por lanches, considerados, pelos jovens, de maior praticidade. Quanto à qualidade nutricional da dieta, ressaltam-se os elevados valores do índice de Qualidade Nutricional (IQN, verificados para o ácido ascórbico, e números superiores a 1,0, observados para o IQN do ferro das refeições da maioria dos escolares analisados, com exceção somente para as refeições consumidas pelos alunos de maior idade (13 anos ou mais. Recomenda- se a correção de falhas no conteúdo nutricional das refeições distribuidas nas escolas, pois elas constituem parte fundamental do consumo alimentar dos alunos das escolas de tempo integral.

  1. Characterization of PHB1 and its role in mitochondrial maturation and yolk platelet degradation during development of Artemia embryos.

    Directory of Open Access Journals (Sweden)

    Xiang Ye

    Full Text Available BACKGROUND: To cope with harsh environments, crustaceans such as Artemia produce diapause gastrula embryos (cysts with suppressed metabolism. Metabolism and development resume during post-diapause development, but the mechanism behind these cellular events remains largely unknown. PRINCIPAL FINDING: Our study investigated the role of prohibitin 1 (PHB1 in metabolic reinitiation during post-diapause development. We found that PHB1 was developmentally regulated via changes in phosphorylation status and localization. Results from RNA interference experiments demonstrated PHB1 to be critical for mitochondrial maturation and yolk degradation during development. In addition, PHB1 was present in yolk platelets, and it underwent ubiquitin-mediated degradation during the proteolysis of yolk protein. CONCLUSIONS/SIGNIFICANCE: PHB1 has an indispensable role in coordinating mitochondrial maturation and yolk platelet degradation during development in Artemia. This novel function of PHB1 provides new clues to comprehend the roles of PHB1 in metabolism and development.

  2. Ultrastructure of cyst shell and underlying membranes of three strains of the brine shrimp Artemia (Branchiopoda: Anostraca) from South India.

    Science.gov (United States)

    Sugumar, V; Munuswamy, N

    2006-12-01

    The cyst of Artemia has shell and membranous coverings over the embryo. The membranous coverings have special adaptive features to allow the physical changes accompanying repeated hydration and dehydration cycles that might occur and adversely influence postembryonic development. Whole and slices of cryptobiotic cysts were processed for electron microscopy to study the internal details and to compare the morphological architecture of three Artemia strains of South India. Surface topography of scanning electron microscopic (SEM) studies revealed distinct button shaped structures on the cyst of Puthalam strain. Transmission electron microscopic (TEM) studies of the cysts displayed the conventional pattern of anostracan crustaceans with outer cortex and alveolar layer, cuticular membranes, and the cytoplasmic inclusions namely nucleus, yolk droplets, lipoid bodies, and mitochondria. The prominent wavy outer cortex layer of Puthalam cysts corroborates the results of SEM studies.

  3. 温度对中国卤虫(Artemia sinica)种群的影响%EFFECTS OF TEMPERATURE ON THE POPULATION OF ARTEMIA SINICA

    Institute of Scientific and Technical Information of China (English)

    贾沁贤; 庄玲; 周望舒; 杨孟科

    1995-01-01

    本文采用生命表和数值模型分析等方法,对中国卤虫(Artemia sinica)的温度特性做了研究.1.孵化发育起始温度9.07℃,幼虫发育起始温度9.07℃.有效积温(℃·d)前者为0.921±o.979,后者为205.26士24.1,平均世代有效积温458.4士39.6.2.各项生命表参数均与温度呈显著的函数关系,其适温范围基本介于18-34℃,最适点介于26.5-28.5℃,种群增长倍数>2的温度范围在18-34℃. 3.在山西盐池水域,该卤虫的年世代数为6.2±0.62个世代,第2-5个世代是种群生产力高峰期.在此期间种群的加倍时间<15d,内禀增长率>0.04d-1,因此资源开发价值最大.

  4. Consumo de alimentos fora do domicílio no Brasil

    Directory of Open Access Journals (Sweden)

    Ilana Nogueira Bezerra

    2013-02-01

    Full Text Available OBJETIVO: Analisar características do consumo de alimentos fora do domicílio no Brasil. MÉTODOS: Foram analisados dados do Inquérito Nacional de Alimentação, conduzido com 34.003 indivíduos acima de dez anos de idade em 24% dos domicílios participantes da Pesquisa de Orçamentos Familiares em 2008-2009. O consumo de alimentos e bebidas foi coletado por meio de registros dos alimentos consumidos, tipo de preparação, quantidade, horário e fonte do alimento (dentro ou fora de casa. A frequência de indivíduos que consumiu alimentos fora do domicílio foi calculada segundo faixas de idade, sexo, faixas de renda, área de localização do domicílio, tamanho da família, presença de criança no domicílio e idade do chefe do domicílio no Brasil e em cada região brasileira. Para as análises, considerou-se o peso amostral específico do inquérito e incorporou-se o efeito do desenho amostral. RESULTADOS: O consumo de alimentos fora do domicílio no Brasil foi reportado por 40% dos entrevistados, variando de 13% entre os idosos da região Sul a 51% entre os adolescentes da região Sudeste. Esse percentual diminuiu com a idade e aumentou com a renda em todas as regiões brasileiras; foi maior entre os homens e na área urbana. Os grupos de alimentos com maior percentual de consumo fora de casa foram bebidas alcoólicas, salgadinhos fritos e assados, pizza, refrigerantes e sanduíches. CONCLUSÕES: A alimentação fora de casa apresenta predominância de alimentos de alto conteúdo energético e pobre conteúdo nutricional, indicando que o consumo de alimentos fora do domicílio deve ser considerado nas ações de saúde pública voltadas para a melhoria da alimentação dos brasileiros.

  5. Study of model systems to test the potential function of Artemia group 1 late embryogenesis abundant (LEA) proteins.

    Science.gov (United States)

    Warner, Alden H; Guo, Zhi-hao; Moshi, Sandra; Hudson, John W; Kozarova, Anna

    2016-01-01

    Embryos of the brine shrimp, Artemia franciscana, are genetically programmed to develop either ovoviparously or oviparously depending on environmental conditions. Shortly upon their release from the female, oviparous embryos enter diapause during which time they undergo major metabolic rate depression while simultaneously synthesize proteins that permit them to tolerate a wide range of stressful environmental events including prolonged periods of desiccation, freezing, and anoxia. Among the known stress-related proteins that accumulate in embryos entering diapause are the late embryogenesis abundant (LEA) proteins. This large group of intrinsically disordered proteins has been proposed to act as molecular shields or chaperones of macromolecules which are otherwise intolerant to harsh conditions associated with diapause. In this research, we used two model systems to study the potential function of the group 1 LEA proteins from Artemia. Expression of the Artemia group 1 gene (AfrLEA-1) in Escherichia coli inhibited growth in proportion to the number of 20-mer amino acid motifs expressed. As well, clones of E. coli, transformed with the AfrLEA-1 gene, expressed multiple bands of LEA proteins, either intrinsically or upon induction with isopropyl-β-thiogalactoside (IPTG), in a vector-specific manner. Expression of AfrLEA-1 in E. coli did not overcome the inhibitory effects of high concentrations of NaCl and KCl but modulated growth inhibition resulting from high concentrations of sorbitol in the growth medium. In contrast, expression of the AfrLEA-1 gene in Saccharomyces cerevisiae did not alter the growth kinetics or permit yeast to tolerate high concentrations of NaCl, KCl, or sorbitol. However, expression of AfrLEA-1 in yeast improved its tolerance to drying (desiccation) and freezing. Under our experimental conditions, both E. coli and S. cerevisiae appear to be potentially suitable hosts to study the function of Artemia group 1 LEA proteins under environmentally

  6. Effects of Surface-Engineered Nanoparticle-Based Dispersants for Marine Oil Spills on the Model Organism Artemia franciscana

    OpenAIRE

    Rodd, April L.; Creighton, Megan A.; Vaslet, Charles A.; Rangel-Mendez, J. Rene; Hurt, Robert H.; Kane, Agnes B.

    2014-01-01

    Fine particles are under active consideration as alternatives to chemical dispersants for large-scale petroleum spills. Fine carbon particles with engineered surface chemistry have been shown to stabilize oil-in-water emulsions, but the environmental impacts of large-scale particle introduction to the marine environment are unknown. Here we study the impact of surface-engineered carbon-black materials on brine shrimp (Artemia franciscana) as a model marine microcrustacean. Mortality was chara...

  7. Riesgos sobre la salud de los alimentos modificados genéticamente: una revision bibliografica

    Directory of Open Access Journals (Sweden)

    José L. Domingo Roig

    2000-01-01

    Full Text Available A lo largo de 1999, se ha venido intensificando el debate sobre la seguridad de los alimentos modificados genéticamente, una importante y compleja área de investigación científica, la cual demanda unos estándares rigurosos. Diversos grupos, incluyendo asociaciones de consumidores y Organizaciones no Gubernamentales (ONGs han sugerido que todos los alimentos modificados genéticamente deberían ser sometidos a estudios a largo plazo con animales antes de su aprobación para el consumo humano. El principal objetivo de la presente revisión ha sido conocer cual es el estado actual de la cuestión en lo referente a los potenciales efectos adversos sobre la salud de los alimentos modificados genéticamente. Dos bases de datos, Medline y Toxline, así como una serie de direcciones de internet, han sido empleadas para la obtención de bibliografía. Aunque son numerosos los comentarios, noticias generales y cartas al Editor aparecidos en prestigiosas revistas, los artículos referentes a estudios experimentales sobre la seguridad de los alimentos modificados genéticamente son, sorprendentemente, muy escasos. Si se han obtenido resultados procedentes de la evaluación toxicológica de estos alimentos, no han sido publicados en revistas científicas y, por lo tanto, no han podido ser debidamente juzgados o contrastados.

  8. Publicidade de alimentos e escolhas alimentares de crianças

    Directory of Open Access Journals (Sweden)

    Marcia Hiroko Ueda

    Full Text Available O efeito de vídeos de desenhos com publicidade de alimentos saudáveis e não saudáveis versus vídeos neutros sobre as escolhas alimentares foi avaliado em 24 crianças de escola pública. Os vídeos foram apresentados em cinco sessões, sendo cada grupo exposto a uma sequência específica de publicidade. Após a exposição, a criança escolhia figuras de alimentos para as refeições do dia. Análises intra e entre sujeitos, por meio da Ancova de medidas repetidas, demonstraram que, com a mudança de vídeo, as crianças alteraram em até 13% a escolha de alimentos saudáveis ou não. O aumento da exibição de publicidade de alimentos saudáveis e a diminuição da publicidade de alimentos não saudáveis pode contribuir para a alimentação e peso saudáveis.

  9. Validação de fotografias de alimentos para estimativa do consumo alimentar

    Directory of Open Access Journals (Sweden)

    Rávila Graziany Machado de SOUZA

    2016-06-01

    Full Text Available RESUMO Objetivo Validar fotografias de um guia fotográfico de alimentos para estimativa do consumo alimentar. Métodos As fotografias de 12 alimentos (bolo simples, macarrão ao sugo, mamão formosa, melancia, repolho roxo ralado, quiabo refogado, churrasco em tiras, filé de frango grelhado, pudim de leite condensado, pizza, amendoim cru e queijo tipo minas, retratadas em três tamanhos de porções (pequena, média e grande, foram avaliadas por 90 indivíduos adultos. Foram também investigados o peso, a estatura e o sexo dos participantes. Para análise de concordância entre o tamanho da porção do alimento retratado nas fotos e o tamanho real do alimento, utilizou-se o teste Kappa. Os dados foram analisados no software Stata, considerando-se p 0,05. Conclusão As 12 fotografias apresentaram uma boa concordância com as porções dos alimentos e podem ser um instrumento útil para aumentar a acurácia dos relatos do consumo alimentar.

  10. 卤虫属分类研究进展%Progress on Researches of Taxonomy on Genus Artemia

    Institute of Scientific and Technical Information of China (English)

    张伟峰; 郝浩永; 陈莉

    2008-01-01

    卤虫(Anemia)属于节肢动物门(Phylum Arthropoda),甲壳纲(Class Crustacea),鳃足亚纲(SubclassBranchiopoda),无甲目(Order Anostraca),卤虫科(Family Artemidae).世界卤虫根据生殖方式可分为两性生殖卤虫和孤雌生殖卤虫两大类.利用生殖隔离实验将世界两性卤虫分为8个种:Anemiafranciscana Kellogg、Artemia persimilis Piccinelli et Prosdoeimi、Anemia rnonica Verrill、Anemia salina Linnaeus、Artemia urmianaGünther、Anemia tunisiana Bowen et Sterling、Anemia sinica Cai和Anemia tibetiana Abatzopouios,Zhang et Sorge-loos.其中,我国发现有A.sinica和A.tibetiana两种两性卤虫.孤雌生殖卤虫统称为Artemia parthenogenetica,并在其后加上产地的地名以示区别.

  11. Multiple {gamma}-glutamylation: A novel type of post-translational modification in a diapausing Artemia cyst protein

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Mai [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Ikeda, Yuka [Institute of High Polymer Research, Faculty of Textile Science and Technology, Shinshu University, 3-15-1, Tokida, Ueda 386-8567 (Japan); Kanzawa, Hideaki [Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Sakamoto, Mika [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Goto, Mina [Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Tsunasawa, Susumu [Analytical and Measuring Instruments Division, Shimadzu Corporation, Nishinokyo Kuwabaracho 1, Nakagyo-Ku, Kyoto 604-8511 (Japan); Uchiumi, Toshio, E-mail: uchiumi@bio.sc.niigata-u.ac.jp [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Odani, Shoji [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan)

    2010-03-26

    A highly hydrophilic, glutamate-rich protein was identified in the aqueous phenol extract from the cytosolic fraction of brine shrimp (Artemia franciscana) diapausing cysts and termed Artemia phenol soluble protein (PSP). Mass spectrometric analysis revealed the presence of many protein peaks around m/z 11,000, separated by 129 atomic mass units; this value corresponds to that of glutamate, which is strongly suggestive of heterogeneous polyglutamylation. Polyglutamylation has long been known as the functionally important post-translational modification of tubulins, which carry poly(L-glutamic acid) chains of heterogeneous length branching off from the main chain at the {gamma}-carboxy groups of a few specific glutamate residues. In Artemia PSP, however, Edman degradation of enzymatic peptides revealed that at least 13, and presumably 16, glutamate residues were modified by the attachment of a single L-glutamate, representing a hitherto undescribed type of post-translational modification: namely, multiple {gamma}-glutamylation or the addition of a large number of glutamate residues along the polypeptide chain. Although biological significance of PSP and its modification is yet to be established, suppression of in vitro thermal aggregation of lactate dehydrogenase by glutamylated PSP was observed.

  12. Shell-bound iron dependant nitric oxide synthesis in encysted Artemia parthenogenetica embryos during hydrogen peroxide exposure.

    Science.gov (United States)

    Veeramani, Sivaram; Baskaralingam, Vaseeharan

    2011-12-01

    Artemia is a tiny marine crustacean, serves as an excellent tool in both basic and applied aspects of stress biology research. In the current manuscript, we report that Artemia parthenogenetica embryos (cysts), in diapause stage, undergo iron transition changes when exposed to chemical diapause deactivation stimulus (hydrogen peroxide). X-ray surface analysis of A. parthenogenetica embryos exposed to H(2)O(2) showed significant transitional changes in iron, as seen in cyst cross-sections. Electron paramagnetic resonance study revealed that upon H(2)O(2) exposure, increased nitric oxide (NO) production was observed in non-decapsulated cysts (ND), but not in decapsulated cysts (DC) (shell-removed cysts). Spin trapping studies also showed an increase in hydroxyl radical formation in NDs exposed to H(2)O(2) through Fenton-like reaction. On the contrary, exposure of DCs to H(2)O(2) did not induce hydroxyl radical formation. Taken together, results from the present study indicate a key role of cyst shell-bound iron and reactive oxygen species on successful diapause termination in eukaryotic extremophile animal model, such as Artemia.

  13. Salt sensitivity of the morphometry of Artemia franciscana during development: a demonstration of 3D critical windows.

    Science.gov (United States)

    Mueller, Casey A; Willis, Eric; Burggren, Warren W

    2016-02-01

    A 3D conceptual framework of 'critical windows' was used to examine whether the morphometry of Artemia franciscana is altered by salinity exposure during certain key periods of development. Artemia franciscana were hatched at 20 ppt (designated control salinity) and were then exposed to 10, 30, 40 or 50 ppt either chronically (days 1-15) or only on days 1-6, 7-9, 10-12 or 13-15. On day 15, maturity was assessed and morphometric characteristics, including mass, total body length, tail length and width, length of the third swimming appendage and eye diameter, were measured. Maturation and morphometry on day 15 were influenced by the exposure window and salinity dose. Artemia franciscana were generally larger following exposure to 10 and 40 ppt during days 1-6 and 7-9 when compared with days 10-12 and 13-15, in part due to a higher percentage of mature individuals. Exposure to different salinities on days 1-6 produced the greatest differences in morphometry, and thus this appears to be a period in development when A. franciscana is particularly sensitive to salinity. Viewing the developmental window as three-dimensional allowed more effective visualization of the complex interactions between exposure window, stressor dose and the magnitude of morphometric changes in A. franciscana.

  14. The use of a brine shrimp (Artemia salina) bioassay to assess the toxicity of diatom extracts and short chain aldehydes.

    Science.gov (United States)

    Caldwell, Gary S; Bentley, Matthew G; Olive, Peter J W

    2003-09-01

    Water soluble algal extracts, the aldehydes 2E,4E-decadienal, decanal, undecanal and the fatty acid eicosapentaenoic acid (EPA) were assayed for toxicity to hatching success and larval mortality of the brine shrimp Artemia salina. Both crude cellular extracts of the diatoms Skeletonema costatum and Nitzschia commutata and the diatom-derived short chain aldehyde decadienal were found to inhibit hatching success of A. salina cysts in a dose-dependent manner. Decadienal also significantly affected larval mortality rates in 24 and 72 h exposure incubations. The Artemia hatching success assay was the least sensitive of the three (EC50=3.94 microg ml(-1)). A greater sensitivity was observed for the 72 h compared with the 24 h exposure trials (EC50 for 24h=2.14, 72 h=0.023 microg ml(-1)). Decanal did not significantly affect survival or hatching success at the concentrations tested. Undecanal and EPA showed a limited toxic effect in naupliar mortality trials. We suggest that 72 h Artemia exposure trials represent an acceptable bioassay for diatom toxicity where alternative bioassays are unavailable.

  15. Protective effect induced by atropine, carbamates, and 2-pyridine aldoxime methoiodide Artemia salina larvae exposed to fonofos and phosphamidon.

    Science.gov (United States)

    Victoria Barahona, M; Sánchez-Fortún, Sebastián

    2007-01-01

    The acute toxicity of fonofos and phosphamidon on three age classes of Artemia salina was evaluated. An increase in toxicity of these organophosphorous (OP) insecticides was found following longer development of A. salina. The effects of pretreatment with the nonselective muscarinic antagonist atropine, the two reversible acetylcholinesterease inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on OP-induced lethality in 24 h Artemia were also investigated. The lethal action of both OP insecticides was prevented by pretreatment of 24 h Artemia with atropine and 2-PAM, while physostigmine proved ineffective against intoxication with both OP insecticides and pyridostigmine exhibited a low synergic effect. In both cases, the inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Combined pretreatment of atropine (10(-5)M) plus physostigmine practically abolished the lethal effects induced by both insecticides. Pretreatment with 2-PAM (10(-6)M) plus physostigmine afforded maximal protection of 100% and 76% on the lethality induced by fonofos and phosphamidon, respectively. The data obtained suggest that the combination of atropine plus 2-PAM or physostigmine and the combined pretreatment of 2-PAM plus physostigmine are effective in the prevention of the lethal effects induced by fonofos and phosphamidon in A. salina larvae.

  16. Is polyploidy a persevering accident or an adaptive evolutionary pattern? The case of the brine shrimp Artemia.

    Science.gov (United States)

    Maniatsi, Stefania; Baxevanis, Athanasios D; Kappas, Ilias; Deligiannidis, Panagiotis; Triantafyllidis, Alexander; Papakostas, Spiros; Bougiouklis, Dimitrios; Abatzopoulos, Theodore J

    2011-02-01

    Asexual organisms are confronted with substantial drawbacks, both immediate and delayed, threatening their evolutionary persistence. Yet, genetic associations with asexuality may refresh the gene pool promoting adaptation of clonal lineages; polyploidy is one of them. Parthenogenesis itself and/or polyploidy are responsible for the maintenance and spread of clones in Artemia, a sexual-asexual genus of halophilic anostracans. We applied flow cytometry, microsatellite genotyping, and mtDNA sequencing to 23 asexual populations. Artemia parthenogens have evolved multiple times either through hybridization or spontaneously. Nine out of 23 populations contained clones of mixed ploidy (2n, 3n, 4n). Most clones were diploid (20/31) while two and nine clones were triploid and tetraploid, respectively. Apomictic triploids and tetraploids formed two distinct groups of low genetic diversity compared with the more divergent automictic diploids. Polyploidy is also polyphyletic in Artemia, with triploids and tetraploids having independent origins from different sexual ancestors. We discern a pattern of geographical parthenogenesis with all clonal groups being more widespread than their closest sexuals. In favour of a specialist model, asexual diploids are restricted to single locations and are strikingly segregated from generalist triploids and tetraploids occupying a variety of sites. This is a rare pattern of mixed life-history strategies within an asexual complex.

  17. Coadaptation: lessons from the brine shrimp Artemia, "the aquatic Drosophila" (Crustacea; Anostraca Coadaptación: lecciones desde el camarón de salmuera Artemia, "la Drosophila acuática" (Crustacea; Anostraca

    Directory of Open Access Journals (Sweden)

    GONZALO GAJARDO

    2001-03-01

    Full Text Available During the fifties Brncic and the Dobzhansky's school, using the fruit fly Drosophila as a test organism, introduced the term integration of the genotype, or genetic coadaptation, which has had great impact on thinking in today's evolutionary biology. In this work we use the brine shrimp Artemia - in many respects a sort of aquatic Drosophila- as a model organism to evaluate the relationship between population structure, potential for divergence and the degree of morphological and/or genetic change. These aspects, tightly linked with the organization of the genotype, are important to understanding how recombination and adaptive release of genetic and phenotypic variation affect the speciation process in Artemia. Analysis of genetic (allozyme, diploid and chromocentre numbers, morphological (Mahalanobis distances and reproductive data (cross-fertility tests available for populations of the bisexual, endemic species of the Americas, Artemia franciscana and A. persimilis, indicate that: (i A. franciscana and A. persimilis are morphologically distinct in correspondence with observed genetic differences (D Nei > 1; 2n = 42 and 44; 12.5 and 1.5 mean chromocentre numbers, respectively; (ii populations from Chile and other South American localities (mainly A. franciscana display high levels of genetic variability and a trend to develop large genetic distances between populations; (iii the plasticity of Artemia gene pool is associated, at least in part, with ecological heterogeneity. Hence an adaptive divergence mode is thought to best define the speciation process in Artemia; (iv the succesful production of laboratory hybrids in the allopatric Artemia populations studied in the Americas, a feature seen in other anostracods, could be explained by the fact that formerly allopatric populations have not achieved later sympatry, as required by the allopatric speciation paradigmEn los años cincuenta Brncic y la escuela de Dobzhansky introdujeron el t

  18. Vigilancia de Escherichia coli O157: H7 en alimentos y aguas

    OpenAIRE

    Guerrero Barrantes, César; Facultad de Tecnología Médica. Universidad Nacional Federico Villarreal. Calle Río Chepén s/n. El Agustino. Lima - Perú.; Guillén Oneeglio, Alfredo; Facultad de Tecnología Médica. Universidad Nacional Federico Villarreal. Calle Río Chepén s/n. El Agustino. Lima - Perú.; Rojas León, Roberto; Facultad de Tecnología Médica. Universidad Nacional Federico Villarreal. Calle Río Chepén s/n. El Agustino. Lima - Perú.

    2015-01-01

    Los alimentos como la carne molida de vacuno, queso, jamón y lechuga son de alta demanda de consumo por la población y son susceptibles de contaminación. Así mismo, las aguas de los ríos son usadas por pobladores de las riberas. En nuestro medio, no contamos con reportes sobre estudios de vigilancia de E. coli O157:H7 en muestras de aguas del río Rímac este, ni en alimentos en los mercados de Lima. Para la evaluación de alimentos se procedió como lo describe Feng & Weagant (2002) y para a...

  19. Aproveitamento Integral de Alimentos e o seu Impacto na Saúde

    OpenAIRE

    Fabiane Toste Cardoso; Silvana Camello Fróes; Reis Friede; Maria Geralda de Miranda; Carla Junqueira Moragas; Kátia Eliane Santos Avelar

    2015-01-01

    A fome e o desperdício de alimentos são dois grandes problemas enfrentados pelo Brasil, constituindo-se em um dos paradoxos do país, que é um dos maiores exportadores de alimentos e, também, campeão em desperdício. Este estudo aborda a importância do aproveitamento integral dos alimentos e a sua relação com a saúde das pessoas e do ambiente em que vivem, a partir da análise de estudos publicados anteriormente. Após a análise dos dados constantes nos estudos, concluiu-se que os resíduos alimen...

  20. MICROBIOLOGIA E SISTEMAS DE GESTÃO DA SEGURANÇA DE ALIMENTOS

    OpenAIRE

    2013-01-01

    pesquisa de Campo A saúde humana pode ser gravemente afetada pela ingestão de perigos físicos, químicos e biológicos veiculados através dos alimentos, e a consciência disso, em nível nacional e internacional, tem levado a grandes avanços na área da segurança de alimentos. Em muitos países, um progresso considerável tem sido alcançado, demonstrando que é possível diminuir e prevenir muitas Doenças Transmitidas por Alimentos (DTA). Mesmo assim, um número inaceitável d...

  1. Acute toxicity of several organophosphorous insecticides and protection by cholinergic antagonists and 2-PAM on Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Sanz, F; Barahona, M V

    1996-10-01

    The acute toxicity of chlorpyrifos, methylchlorpyrifos, parathion and methylparathion to three age classes of Artemia salina was determined. In general, A. salina 24-h old was less sensitive to these organophosphorous insecticides (OPI) than A. salina 48-h old and A. salina 48-h old was significantly more tolerant than A. salina 72-h old, in contrast, chlorpyrifos was equally toxic to A. salina 48- and 72-h old. There were some differences among the three age classes of A. salina in the relative order of toxicity of OPI tested. The rank order of toxicity to A. salina 48-h old was methylparathion salina 24- and 72-h old it was methylparathion = parathion Artemia salina 24-h old was investigated. The lethal action of OPI tested was completely prevented by pretreatment of Artemia salina 24-h old with 2-PAM (10(-5) M) and atropine (10(-4 )M). However no concentration of hexamethonium, pirenzepine or AF-DX 116 protected 100% of the animals poisoned by LC84 of the OPI selected, maximum protection obtained was 71 to 88%. In contrast, the maximum inhibition of mortality obtained with AF-DX 116 pretreatment was about 55% because this compound was used at concentrations which were non toxic to control Artemia salina. Atropine, hexamethonium, pirenzepine, AF-DX 116 and 2-PAM afforded 50 % protection (IC50) of Artemia salina against mortality by LC84 of the OPI selected at concentrations in the range of 6.62x10(-7)-1.6x10(-6) M, 2. 38x10(-4)-2.05x10(-3)M, 8.91x10(-7)-1.24x10(-6) M, 9.66x10(-8)-1. 34x10(-7 )M, and 1.95x10(-8)-2.73x10(-8 )M, respectively. Pretreatment of atropine plus 2-PAM to determine whether this combination afforded greater inhibition of the lethality induced by four OPI tested than pretreatment with either atropine or 2-PAM alone was investigated. Atropine (10(-5) M) in combination with 2-PAM (10(-7 )M) inhibited completely the acute toxicity of all OPI tested, while the pretreatment with atropine (10(-6) M) plus 2-PAM at the same concentration gave a

  2. Sustitución de alimento comercial por excretas en la dieta de conejos en crecimiento

    Directory of Open Access Journals (Sweden)

    S. P. Castillo-Rodríguez

    2007-01-01

    Full Text Available La presente investigación se llevó a cabo para evaluar el efecto de la sustitución de alimento comercial por una mezcla de excretas [gallinas, cerdos y vacas] sobre el crecimiento de conejos Nueva Zelanda. Se utilizaron 30 animales con un promedio de peso de 600 + 18.2 g, y edad de 35 días, los cuales se colocaron en jaulas individuales. Los tratamientos consistieron en la sustitución parcial del alimento comercial en niveles de 0, 15, 20, 25, 30 y 35%, con una mezcla de excretas (gallinaza, cerdaza y bovinaza. La prueba tuvo una duración de 42 días, el alimento y agua de bebida fueron ofrecidos ad libitum. Todos los días se pesó el alimento ofrecido y el rechazado; el peso de los animales se registró semanalmente. Las medias generales ± desviación estándar para ganancia de peso, consumo de alimento y digestibilidad aparente fueron 866 ± 129 g, 3.02 ± 0.35 kg y 64.0 ± 0.5%, respectivamente. La ganancia de peso, consumo de alimento y digestibilidad aparente fueron afectadas por el nivel de excretas en la ración (P 0.05, pero la digestibilidad aparente fue menor en los niveles de 30 y 35% de excretas. Se puede concluir que las excretas pueden ser usadas hasta en un 25% con resultados satisfactorios y sin efectos adversos sobre la ganancia de peso y la conversión alimenticia.

  3. EFEITOS DO PROCESSAMENTO INDUSTRIAL DE ALIMENTOS SOBRE A ESTABILIDADE DE VITAMINAS

    Directory of Open Access Journals (Sweden)

    L. F. M. CORREIA

    2008-12-01

    Full Text Available

    O processamento industrial de alimentos promove o prolongamento da sua vida útil, tornando-os mais atraentes ao paladar; entretanto, induz mudanças e interações entre os constituintes de alimentos. Assim, o processamento pode ter um impacto positivo (destruição de inibidores ou formação de complexos desejáveis entre os componentes dos alimentos e os íons metálicos ou um impacto negativo (perdas de nutrientes. Durante o processamento, o alimento é exposto a diversos fatores que podem interferir na sua estrutura e composição nutricional, sendo que temperatura, luz, oxigênio, umidade e pH do meio são os fatores que mais contribuem para essa alteração. A importância da ingestão de alimentos seguros e saudáveis e o conhecimento relacionado a este assunto, ainda disperso e insuficiente, justifi cam a revisão, apresentada por este estudo, sobre a estabilidade de vitaminas em alimentos processados industrialmente. A análise crítica dos estudos encontrados mostra que alguns métodos de processamento industrial retêm melhor as vitaminas enquanto outros promovem uma maior perda. Entre os trabalhos analisados, pôde-se observar maior referência à vitamina C e ao ß-caroteno, sendo que as vitaminas K, D e ácido pantotênico foram as vitaminas menos estudadas. As vitaminas mais sensíveis ao processamento industrial são a vitamina C e tiamina.

  4. Embalagens metálicas e alimentos : o caso do atum enlatado

    OpenAIRE

    2010-01-01

    Desde seu surgimento no século 19, alimentos enlatados e processos de enlatamento evoluíram a fim de suprir a demanda por alimentos não-perecíveis. Em termos de consumo mundial, atum enlatado é uma das escolhas mais populares quando se trata de peixes. Nos últimos anos, o atum enlatado se tornou uma fonte importante de proteínas, vitamina D e ácidos graxos essenciais. Por outro lado, as altas concentrações de metais pesados encontradas no atum têm gerado dúvidas quanto aos benefícios de uma d...

  5. Revisão: alimentos frescos minimamente processados embalados em atmosfera modificada

    OpenAIRE

    Santos,Joana Silva; Oliveira, Maria Beatriz Prior Pinto

    2012-01-01

    Os alimentos frescos, minimamente processados e embalados sob atmosfera modificada atraem os consumidores que procuram produtos frescos e saudáveis, e que, ao mesmo tempo, são fáceis de transportar e preparar. A atmosfera no interior das embalagens consiste numa mistura de gases que está otimizada para cada alimento, de modo a preservar as suas qualidades durante mais tempo. A manutenção da temperatura de refrigeração durante o processamento, o armazenamento, a distribuição e a comercializaçã...

  6. Contenido de grasa en alimentos fritos en equipo casero usando diferentes tratamientos de fritura

    OpenAIRE

    Araya, Yesennia; Sedó Masís, Patricia

    2002-01-01

    Para determinar el porcentaje de grasa pos-fritura se estudiaron siete alimentos, dos de ellos en dos presentaciones (papa en fritas, plátano maduro en tajadas y en rodajas, yuca en trozos, bistec de res, muslo de pollo, salchichón, huevo en torta y entero) fueron fritos en aceite de soya y manteca de aceite de palma, utilizando sartén y olla freidora. A todos los alimentos se les determinó la humedad en crudo y a los de origen animal, además, el contenido de grasa. Para determinar la pérdida...

  7. Composición del mercado nacional de alimentos balanceados para tilapia en Costa Rica

    OpenAIRE

    Ruth Vargas

    2003-01-01

    Se evaluó el origen y proceso de fabricación de los alimentos balanceados para tilapias comercializados en el país e inscritos en el Programa de Registro y Control de Calidad de Alimentos Balanceados para Animales del Ministerio de Agricultura y Ganadería. Además, se determinaron las prescripciones según la fase fisiol ógica y su composición química, así como las relaciones proteína cruda versus energía metabolizable y calcio – fósforo para compararlos contra los ...

  8. Riesgos sobre la salud de los alimentos modificados genéticamente: una revision bibliografica

    OpenAIRE

    2000-01-01

    A lo largo de 1999, se ha venido intensificando el debate sobre la seguridad de los alimentos modificados genéticamente, una importante y compleja área de investigación científica, la cual demanda unos estándares rigurosos. Diversos grupos, incluyendo asociaciones de consumidores y Organizaciones no Gubernamentales (ONGs) han sugerido que todos los alimentos modificados genéticamente deberían ser sometidos a estudios a largo plazo con animales antes de su aprobación para el consumo humano. El...

  9. Congreso Iberoamericano de Ingeniería de Alimentos CIBIA9

    OpenAIRE

    Fito Maupoey, Pedro; Andrés Grau, Ana María; Argüelles Foix, Angel Luís; Ortolá Ortolá, Mª Dolores

    2014-01-01

    Esta publicación recoge las 463 comunicaciones presentadas al congreso, agrupadas en 4 volúmenes, mas un libro de resúmenes. La Ingeniería de Alimentos se ha consolidado como una disciplina académica, científica y profesional fundamental para hacer frente al desafío de alimentar a la población mundial, mejorando la producción y distribución de alimentos más saludables, nutritivos y accesibles, especialmente para los sectores menos desarrollados. Este CIBIA 9, con los más de 400 trabajo...

  10. Temas éticos en investigación internacional con alimentos transgénicos

    OpenAIRE

    2013-01-01

    El presente artículo reflexiona sobre los problemas éticos que se generan socialmente por la producción y el uso de alimentos transgénicos o genéticamente modificados obtenidos por la biotecnología, como: los intereses comerciales que guían esta nueva tecnología, los riesgos ecológicos y para la salud humana, y la posibilidad de introducir nuevas plagas. Cada país debe buscar su propia forma de regularizar el tema de los alimentos transgénicos para evitar abusos por empresas transnacionales, ...

  11. Aporte de vitaminas y minerales por grupo de alimentos en estudiantes universitarios chilenos

    OpenAIRE

    2013-01-01

    Introducción: La etapa universitaria es un proceso en el cual las personas pasan por periodos prolongados de inactividad física y horarios irregulares de comidas, lo que conlleva al incremento en el consumo de alimentos procesados y de comida rápida. Objetivo: Fue determinar el aporte vitaminas y minerales por grupo de alimentos en la alimentación de estudiantes universitarios. Métodos: Se trabajó con una muestra de 654 estudiantes universitarios chilenos (18-24 años, 54% mujeres), a quienes ...

  12. Procedimiento de descontaminación superficial de alimentos sólidos envasados

    OpenAIRE

    López Gómez, Antonio; López Cánovas, David Antonio

    2015-01-01

    Número de publicación: 2 534 529 Número de solicitud: 201530326 Procedimiento de descontaminación microbiana de alimentos sólidos envasados mediante aceites esenciales (AEs) que comprende una evaporación de los AEs a vacío, y una aplicación a vacío de los vapores de AEs sobre el alimento sólido situado en un envase abierto, en donde dichos vapores son arrastrados por aire o por una mezcla de gases de grado alimentario y conducidos hasta el recinto al vacío, en donde se encuentra el alim...

  13. Aplicación del ultrasonido en la industria de los alimentos

    OpenAIRE

    Delgado, Javier Orlando

    2012-01-01

    El ultrasonido es una de las tecnologías emergentes con más investigación y desarrollo para la conservación de alimentos, utilizada, principlamente para la disminución de la concentracion de microorganismos y la inhibicion de la actividad enzimática, sin alterar las propiedades físicas, químicas y nutricionales de los alimentos. Gracias al análisis de direfentes fuentes bibliográficas, se logró elaborar este documento en el que se destacan las aplicaciones del ultrasonido en los p...

  14. Qualidade sanitária de grãos de soja tipo alimento

    OpenAIRE

    Ronaldo, Adilson Bizzeto; Universidade Estadual de Londrina; Levy, Mauricio; Universidade Estadual de Londrina; Homechin, Martin; Universidade Estadual de Londrina; Destro, Deonisio; Universidade Estadual de Londrina; Miranda, Lilian Azevedo; Universidade Estadual de Londrina

    1996-01-01

    O objetivo foi quantificar a incidência de fungos em grãos de soja (Glycine max ( L.) Merrill) provenientes de cruzamentos de soja tipo alimento com soja tipo grão. A soja tipo alimento inclui a soja com sementes grandes, com peso de cem sementes (PCS) igual ou maior que 20 gramas (soja tipo hortaliça) e a soja com sementes pequenas, com PCS menor que 10 gramas (soja para consumo na forma de brotos ou "natto"). A soja tipo grão tem sementes de tamanho médio, com PCS entre 10 e 19 gramas, e é ...

  15. Disponibilidad de alimentos en los hogares mexicanos de acuerdo con el grado de inseguridad alimentaria

    OpenAIRE

    Reyna Guadalupe Valencia-Valero; Luis Ortiz-Hernández

    2014-01-01

    Objetivo. Analizar las diferencias en la disponibilidad de alimentos en los hogares mexicanos de acuerdo con el grado de inseguridad alimentaria (IA). Material y métodos. Análisis de la Encuesta Nacional de Ingresos y Gastos de los Hogares del año 2010 (n= 27 445 hogares). Los hogares fueron clasificados según la Escala Latinoamericana y Caribeña de Seguridad Alimentaria. La disponibilidad de alimentos se estimó como gramos al día por adulto equivalente. Resultados. En los hogares inseguros e...

  16. PARA ALÉM DAS CRENÇAS SOBRE ALIMENTOS, COMIDAS E SABORES DA NATUREZA

    OpenAIRE

    Almeida, Maria Geralda de

    2017-01-01

    RESUMO Consiste em discussão preliminar que procura evidenciar os significados dos sabores e dos alimentos para se criar relações entre os homens e a natureza, entendendo que as razões culturais atribuem os significados dos sabores aos alimentos. As referências antropológicas constituem a base teórica para se discutir as possibilidades de existência de uma identidade alimentar. Além disso, a comida já é um aspecto da identidade. Discute-se, ainda, o que condiciona o uso da natureza, o rechaço...

  17. Alimentos funcionais no manejo da diabetes mellitus = Functional foods in the management of diabetes mellitus

    OpenAIRE

    Zaparolli, Marília Rizzon

    2013-01-01

    Objetivo: Analisar o conhecimento e o consumo de alimentos funcionais que auxiliam no controle da Diabetes mellitus em pacientes de um hospital público de Curitiba PR Materiais e Métodos: Trata-se de um estudo transversal e quantitativo, realizado com pacientes diabéticos hospitalizados (Hospital de Clínicas/UFPR), no período de dezembro de 2011 a março de 2012. Para a coleta de dados foi utilizado um questionário, através do qual se obteve informações sobre o conhecimento de alimentos fu...

  18. A Novel Porous Carrier Found in Nature for Nanocomposite Materials Preparation: A Case Study of Artemia Egg Shell-Supported TiO2 for Formaldehyde Removal

    Directory of Open Access Journals (Sweden)

    Sufeng Wang

    2015-01-01

    Full Text Available Artemia egg shells have an asymptotic sized pore structure (pore diameter: 500 nm–2500 nm, which could be used as a porous carrier for the preparation of nanocomposite materials. The objective of the present study was to prepare shell-supported TiO2 using a naturally porous carrier, Artemia egg shell, and to exhibit a case study of shell-supported TiO2 for formaldehyde removal. Characterization of shell-TiO2 using SEM-EDS, TEM, and XRD proved that Artemia shell with asymptotic reduction pores (pore diameter: 500 nm–2500 nm can be used as the carrier for nanocomposite materials. Artemia egg shell-supported TiO2 in polycrystalline-like nanostructures can be used for the high efficiency removal (adsorption and degradation of formaldehyde under visible light. Our results suggest that iron, one of the shell’s components, should broaden the absorption of visible light and enhance the photocatalytic efficiency of nanotitanium dioxide under visible light. Due to their interesting absorption and formaldehyde removal qualities, Artemia egg shell, as a novel naturally porous carrier for nanocomposite materials preparation, especially in the preparation of nanocatalysts, is worthy of further study.

  19. Optimum level of fish liver oil as enrichment for Artemia fed to the tiger tail seahorse Hippocampus comes for reproduction and juvenile survival

    Directory of Open Access Journals (Sweden)

    Mac Nhu Binh

    2012-09-01

    Full Text Available Reproductive performance of broodstocks and juvenile stress resistance of seahorseHippocampus comes afed Artemia enriched with varying fish liver oil (FLO were evaluated. Artemia wasenriched in seven media with 0%, 1%, 2%, 3%, 4%, 5% and 10% FLO supplemented with egg yolk,baker’s yeast and vitamins 12 h before feeding to seahorse broodstocks. In general, responseparameters increased at lower concentration of FLO, peaked at 5% and decreased at 10%; thus, forparabolic relationships, the quadratic regression was appropriate to estimate quantitative optimum level.Artemia enrichment with FLO increased considerably its saturated FA content in the form of myristic acidand the total HUFA content, particularly DHA and arachidonic acid. Feeding seahorse broodstock with FLOenriched Artemia resulted in: (1 significant increase in brood size both during the first and secondbrooding, (2 significant shortening of interbrooding period, and (3 significant extension of the time tototal mortality during the salinity shock test of juveniles. Quantitative estimates of mean optimum FLOlevel for the enrichment of Artemia fed to H. comes awas 6.3% (range 5.9–7.0% using each responseparameter fitted in a quadratic model.

  20. Determinación de la canasta básica de alimentos de la Fundación Banco Arquidiocesano de Alimentos de Bogotá

    Directory of Open Access Journals (Sweden)

    Jhon Jairo Bejarano-Roncancio

    2014-12-01

    Full Text Available Antecedentes. Desde el año 2001, el Banco de Alimentos de Bogotá tiene como propósito recuperar productos frescos y manufacturados por la industria para entregarlos a grupos vulnerables del Distrito Capital y algunos municipios de Cundinamarca. Sin embargo, existe una Canasta Básica de Alimentos (CBA estandarizada para determinar una estructura para su entrega. Objetivo. Determinar la CBA para establecer los componentes permanentes y adicionales del paquete por población. Materiales y métodos. Este estudio descriptivo observacional se organizó en cuatro fases: primero se analizaron las actividades de frecuencia en requisición de las fundaciones, entrega y despacho de productos por el banco. Luego, se examinó el comportamiento externo de las donaciones y el proceso de compra. Tercera fase: se estimó el inventario de alimentos en el periodo del estudio. Por último, se determinó la CBA por características poblacionales y recomendaciones nutricionales. La información se consignó en bases de datos. Resultados. La canasta está constituida por siete grupos de alimentos colombianos; se elaboró un sistema de codificación por grupo, subgrupo y rango. La CBA fue analizada nutricionalmente por tabla de composición, organizados por minuta patrón, porciones y medidas por grupo poblacional. Conclusiones. La CBA del Banco comparada con la colombiana, cumple con los ejes que la definen desde el concepto de seguridad alimentaria y nutricional. El aporte solidario garantiza que las comunidades valoren los productos que reciben y facilita la compra de productos que no son donados, de esta manera se mejora en calidad nutricional y se facilitan las funciones técnicas administrativas del proceso.

  1. PROGRAMA DE INVESTIGACIÓN DE LA CALIDAD SANITARIA DE LOS ALIMENTOS (ICSA: 30 AÑOS DE VIGILANCIA SANITARIA DE LOS ALIMENTOS EN BARCELONA

    Directory of Open Access Journals (Sweden)

    Mireia Fontcuberta-Famadas

    2015-01-01

    Full Text Available La Agencia de Salud Pública de Barcelona (ASPB dispone, desde 1984, del Programa de Investigación de la Calidad Sanitaria de los Alimentos (ICSA como instrumento para la vigilancia de determinados parámetros químicos y microbiológicos relacionados con el estado sanitario de los alimentos comercializados en la ciudad. Este trabajo analiza la importancia de la vigilancia en salud, particularizando con el análisis de la utilidad y beneficios del programa ICSA. El objetivo principal del programa es valorar si, una vez en el mercado, los alimentos cumplen con la ausencia y/o niveles de tolerancia establecidos para determinados parámetros. No obstante, su carácter abierto permite incorporar o suprimir parámetros o alimentos reflejando nuevos peligros emergentes o intereses más allá de lo legislado. Además, el programa no solo obtiene una visión puntual de los parámetros estudiados en cada edición sino que la acumulación de datos en el tiempo permite evaluar riesgos, realizar cálculos de ingestas de contaminantes a través de la dieta, analizar tendencias, valorar la efectividad de las normativas para la reducción de contaminantes o ayudar en la planificación de programas de control. La información resultante se divulga local e internacionalmente, formando parte de los trabajos de recopilación de contaminantes de agencias de salud estatales y europeas, lo que muestra que es posible desarrollar un sistema de vigilancia a nivel local pero con alcance y objetivos globales y con información útil para gestores, administraciones, operadores económicos y consumidores.

  2. Environmental heat stress induces epigenetic transgenerational inheritance of robustness in parthenogenetic Artemia model.

    Science.gov (United States)

    Norouzitallab, Parisa; Baruah, Kartik; Vandegehuchte, Michiel; Van Stappen, Gilbert; Catania, Francesco; Vanden Bussche, Julie; Vanhaecke, Lynn; Sorgeloos, Patrick; Bossier, Peter

    2014-08-01

    The notion that phenotypic traits emerging from environmental experiences are heritable remains under debate. However, the recent report of nonmendelian transgenerational epigenetic inheritance, i.e., the inheritance of traits not determined by the DNA sequence, might make such a phenomenon plausible. In our study, by carrying out common garden experiments, we could provide clear evidences that, on exposure to nonlethal heat shocks, a parental population of parthenogenetic (all female) Artemia (originating from one single female) experiences an increase in levels of Hsp70 production, tolerance toward lethal heat stress, and resistance against pathogenic Vibrio campbellii. Interestingly, these acquired phenotypic traits were transmitted to three successive generations, none of which were exposed to the parental stressor. This transgenerational inheritance of the acquired traits was associated with altered levels of global DNA methylation and acetylated histones H3 and H4 in the heat-shocked group compared to the control group, where both the parental and successive generations were reared at standard temperature. These results indicated that epigenetic mechanisms, such as global DNA methylation and histones H3 and H4 acetylation, have particular dynamics that are crucial in the heritability of the acquired adaptive phenotypic traits across generations.

  3. Vibrio hispanicus sp. nov., isolated from Artemia sp. and sea water in Spain.

    Science.gov (United States)

    Gomez-Gil, B; Thompson, F L; Thompson, C C; Garcia-Gasca, A; Roque, A; Swings, J

    2004-01-01

    Three Gram-negative, small, motile, rod-shaped bacteria were isolated from Artemia sp. and sea water in Barcelona, Spain, during 1990 and 1991. They were fermentative, oxidase-positive, sensitive to vibriostatic agent O/129, arginine dihydrolase-positive, lysine and ornithine decarboxylase-negative and grew in the absence of NaCl. They differed from phenotypically related species by their ability to grow at 4 degrees C and utilize L-rhamnose. Cloning of the 16S rRNA gene of the type strain produced two different 16S rRNA gene sequences, which differed by 15 bases (0.99%); comparison of these sequences with those deposited in GenBank showed close relationships with Vibrio proteolyticus (97.6% similarity), Vibrio diazotrophicus (97.9%), Vibrio campbellii (96.8%) and Vibrio alginolyticus (96.8%), among others. DNA-DNA hybridization levels with the closest phylogenetically related Vibrio species were Vibrio, for which the name Vibrio hispanicus sp. nov. is proposed, with the type strain LMG 13240T (=CAIM 525T=VIB 213T).

  4. Male-female coevolution in the wild: evidence from a time series in artemia franciscana.

    Science.gov (United States)

    Rode, Nicolas O; Charmantier, Anne; Lenormand, Thomas

    2011-10-01

    Sexual conflicts are ubiquitous in nature and are expected to lead to an antagonistic coevolution between the sexes. This coevolutionary process is driven by selection on sexually antagonistic traits that can either be directional or fluctuating. In this study, we used dormant cysts of Artemia franciscana, collected in the same population in three different years over a 23-year period (corresponding to ∼160 generations in this system), to investigate male-female coevolution in natural conditions over time. We performed a cross experiment study where reproduction of females mated to males from the past, present, or future was monitored until death. In agreement with a model of "fluctuating selection," we found that females survived better and had longer interbrood intervals when mated with their contemporary males compared to when mated with males from the future or the past. However, female weekly and lifetime reproductive successes displayed no differences between contemporary and noncontemporary matings. Finally, the coevolutionary patterns ("arms race dynamics" or "fluctuating selection dynamics") possibly acting on female relative fitness could not be discriminated. This study is the first direct demonstration that the process of male-female coevolution, previously revealed by experimental evolution in laboratory artificial conditions, can occur in nature on a short evolutionary time scale.

  5. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    Directory of Open Access Journals (Sweden)

    Sahgal Geethaa

    2013-01-01

    Full Text Available Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT] to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC 50 for the solvents were 8.5% (DMSO, 6.4% (methanol, 3.4% (ethanol and 2.5% (Tween 20. The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  6. 运城盐湖卤虫Artemia sinica饵料分析

    Institute of Scientific and Technical Information of China (English)

    刘承松; 王宏毅

    1995-01-01

    Artemia Sinica为山西运城盐湖特有种.我们于1991年5月在运城盐化局一工段涝取成虫,立即用4%的福尔马林溶液浸制.将成虫50条取其消化遭,挤出内容物,客于100毫升蒸馏水并搅匀,取其中的水溶液做成50目装片,全部在显微镜下镜检.镜检结果如下:1.50目装片中所包括的种类:原生动物3种,藻类4种和有机质碎屑.2.50目装片中有机质碎屑最多,其次为绿色杜氏藻和盐生杜氏藻.隐杆藻属和原生动物则较少.在实验室人工饲养以盐生杜氏藻作为饵料效果最佳.

  7. Evaluation of the photodynamic activity of Xanthene Dyes on Artemia salina described by chemometric approaches

    Directory of Open Access Journals (Sweden)

    Diogo S. Pellosi

    2013-10-01

    Full Text Available The development of drugs for photodynamic therapy (PDT is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i photosensitizers concentration, (ii the LED irradiation time and (iii the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 23 full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  8. Analyzing the movement of the Nauplius 'Artemia salina' by optical tracking of plasmonic nanoparticles.

    Science.gov (United States)

    Kirchner, Silke R; Fedoruk, Michael; Lohmüller, Theobald; Feldmann, Jochen

    2014-07-15

    We demonstrate how optical tweezers may provide a sensitive tool to analyze the fluidic vibrations generated by the movement of small aquatic organisms. A single gold nanoparticle held by an optical tweezer is used as a sensor to quantify the rhythmic motion of a Nauplius larva (Artemia salina) in a water sample. This is achieved by monitoring the time dependent displacement of the trapped nanoparticle as a consequence of the Nauplius activity. A Fourier analysis of the nanoparticle's position then yields a frequency spectrum that is characteristic to the motion of the observed species. This experiment demonstrates the capability of this method to measure and characterize the activity of small aquatic larvae without the requirement to observe them directly and to gain information about the position of the larvae with respect to the trapped particle. Overall, this approach could give an insight on the vitality of certain species found in an aquatic ecosystem and could expand the range of conventional methods for analyzing water samples.

  9. Comparative evaluation of short-term toxicity of inorganic arsenic compounds on Artemia salina.

    Science.gov (United States)

    GuŢu, Claudia Maria; Olaru, Octavian Tudorel; Purdel, Nicoleta Carmen; Ilie, Mihaela; NeamŢu, Marius Cristian; Dănciulescu Miulescu, Rucsandra; Avramescu, Elena Taina; Margină, Denisa Marilena

    2015-01-01

    The study aimed to assess the short-term effects exerted by two inorganic arsenic species (arsenite and arsenate) on Artemia salina after 24, 48 and 72 h. The dose-lethality curves obtained indicate that the lethality induced by arsenite was higher than by arsenate. The lowest observed effect concentration for arsenite (0.5 μg/mL) is similar with the no observed effect concentration for arsenate, thus indicating that the toxicity of arsenite is higher compared with arsenate. Also, the lethal concentration 50 values confirm that arsenite induced about 1.24-fold higher toxicity than arsenate at 24 h and about three-fold higher toxicity at 48 h and 72 h of exposure. Both LC50 (lethal concentration 50) values are indicating negligible effects exhibited by arsenic at this trophic level after short-term exposure. The predicted no effect concentration in the surface aquatic compartment corresponds to 10.38 μg/L, similar to the limit imposed by Directive 98/83/EC.

  10. Toxicity of some glucose/mannose-binding lectins to Biomphalaria glabrata and Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir Feitosa; Cavada, Benildo Sousa; da Rocha, Bruno Anderson Matias; do Nascimento, Kyria Santiago; Sant'Ana, Antônio Euzébio Goulart

    2010-01-01

    Schistosomiasis or bilharzia, which affects millions of people living in Africa, Asia and Latin America, is closely associated with certain species of aquatic snails. One way of attacking the disease is to eradicate the host snails. Molluscicidal activities of natural compounds are especially important in the widespread control of this tropical disease. As part of our search for natural compounds with molluscicidal properties for the vector control of schistosomiasis, we are now evaluating for the first time the toxicity of the plant lectins from Canavalia brasiliensis (ConBr), Cratylia floribunda (CFL), Dioclea guianensis (Dgui), Dioclea grandiflora (DGL) and Dioclea virgata (Dvir) to Biomphalaria glabrata Say and Artemia salina Leach. Results indicate that all the samples were toxic to A. salina Leach, some of them with values of lethal concentration that kills 90% of the population (LC(90))<10 microg mL(-1). They are also active against B. glabrata Say, killing 100% of adult snails, at a concentration of 50 microg mL(-1). The lectins CFL and Dgui possess properties lethal to mollusks, with values of LC(90)=50.3 microg mL(-1) and LC(90)=41.0 microg mL(-1), respectively.

  11. Chronic toxicity bioassay with populations of the crustacean Artemia salina exposed to the organophosphate diazinon.

    Science.gov (United States)

    Bustos-Obregon, Eduardo; Vargas, Alvaro

    2010-01-01

    A chronic toxicity bioassay was conducted with the microcrustacean Artemia salina as the testing organism for the toxic organophosphate diazinon in order to determine if the species is an appropriate indicator of pollution in aquatic environments. Tests of animal exposure to different concentrations of the toxicant were performed for 24, 48 and 72 hours after larvae hatching. Registered mortality data was used to obtain the lethal dose 50 (LD50) of the organophosphate for each exposure time, considering the immobilization of A. salina larvae as the mortality parameter. The lethal concentration (LD50) in the same exposure times was calculated by evaluating morphological changes on the three initial stages of larval development. Both doses were determined by using probit statistical analysis. Results indicate greater dose-response exactitude after 24 hours of exposure to the toxicant. High sensitivity of the organism to the toxicant was determined, thus indicating that A. salina is an appropriate ecotoxicological bioindicator of aquatic environments polluted with pesticides, with the special consideration that this species is a natural resident of saline water bodies, and thus could be used to control pollution in these environments as a result of the unrestrained usage of such toxic substances.

  12. Evaluation of the photodynamic activity of xanthene dyes on Artemia salina described by chemometric approaches.

    Science.gov (United States)

    Pellosi, Diogo S; Batistela, Vagner R; Souza, Vagner R de; Scarminio, Ieda S; Caetano, Wilker; Hioka, Noboru

    2013-01-01

    The development of drugs for photodynamic therapy (PDT) is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y) with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i) photosensitizers concentration, (ii) the LED irradiation time and (iii) the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 2³ full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  13. Toxicity assessment of fumonisins using the brine shrimp (Artemia salina) bioassay.

    Science.gov (United States)

    Hartl, M; Humpf, H U

    2000-12-01

    The Fusarium mycotoxins fumonisin B(1) (FB(1)) (1) and B(2) (FB(2)) (2), their hydrolysed analogues HFB(1) (3) and HFB(2) (4) and the recently discovered fumonisin derivatives N-palmitoyl-HFB(1) (5) and N-carboxymethyl-FB(1) (6) were compared for their toxicity in a short term bioassay using brine shrimp (Artemia salina). The brine shrimp were hatched in artificial sea water and exposed to the fumonisins in microwell plates with a mortality endpoint after 48 hours. LC(50) values were calculated after Probit transformation of the resulting data. Of the substances tested, fumonisin B(1) emerged to be the most toxic whereas its N-carboxymethyl analogue was 100-fold less effective. The hydrolysed fumonisins showed a four- to sixfold reduced toxicity compared to FB(1). N-Palmitoyl-HFB(1) had a higher LC(50) value than its precursor HFB(1). The brine shrimp assay proved to be a convenient and rapid system for toxicity assessment of this group of mycotoxins.

  14. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test.

    Science.gov (United States)

    Geethaa, Sahgal; Thavamany, Priscilla Jayanthi; Chiew, Siah Poh; Thong, Ong Ming

    2013-10-01

    Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO) are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT]) to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v) for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC50 for the solvents were 8.5% (DMSO), 6.4% (methanol), 3.4% (ethanol) and 2.5% (Tween 20). The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  15. Artemia salina acute immobilization test: a possible tool for aquatic ecotoxicity assessment.

    Science.gov (United States)

    Kalčíková, Gabriela; Zagorc-Končan, Jana; Zgajnar Gotvajn, Andreja

    2012-01-01

    Despite the fact that the marine crustacean Artemia salina is extensively used in ecotoxicology, there is still a lack of information about its sensitivity to commonly used chemicals. In the presented study, acute toxicity of 18 commonly used chemicals - including organic solvents, industrial chemicals, metals and inorganic compounds - to A. salina was evaluated. A. salina showed a range of sensitivities to tested chemicals. Regarding all of the investigated organics, phenolic compounds expressed the highest toxicity to A. salina. Nitrite and mercury were the most toxic inorganic substances applied in the study. On the other hand, dimethyl sulfoxide, nitrate and ammonium were the least toxic. The possibility to use A. salina for interspecies correlation was assessed by comparison of sensitivities of different organisms (bacteria, fish, crustacean) to organic compounds. Correlation between various species was observed, especially between A. salina and fish. Due to the strong relation between toxicity and the logarithm of the octanol/water partition coefficient logP(OW,) lipophilicity was found to be the main factor influencing toxicity of the chosen organic compounds. No significant correlation between toxicity to A. salina and physico-chemical parameters of metals was observed.

  16. Toxicity of four antifouling biocides and their mixtures on the brine shrimp Artemia salina.

    Science.gov (United States)

    Koutsaftis, A; Aoyama, I

    2007-11-15

    Zinc pyrithione (ZPT), Copper pyrihione (CPT), Chlorothalonil and Diuron are four of the most widely used as alternative to tributlytin (TBT) antifouling biocides in boat paints. As most previous laboratory bioassays for these biocides have been conducted solely based on acute tests with a single compound, information on the possible combined toxicity of these common biocides to marine organisms are limited. In this study, the toxicity of binary (in several proportions), ternary and quaternary mixtures were evaluated using the brine shrimp Artemia salina as test organism. Mixture toxicities were studied using the concentration addition model (isobolograms and toxic unit summation), and the mixture toxicity index (MTI). The ZPT-CPT combination had a strictly synergistic effect which requires attention because the coexistence of ZPT and CPT in the marine environment, due to transchelation of ZPT, may occur. The binary mixtures of Diuron with the metal pyrithiones exhibited various interactive effects (synergistic, antagonistic or additive) depending on concentration ratios, whereas all binary mixtures that contained Chlorothalonil exhibited antagonistic effects. The different types of combined effects subsequent to proportion variation of binary mixtures underline the importance of the combined toxicity characterization for various ratios of concentrations. The four ternary mixtures tested, also exhibited various interactive effects, and the quaternary mixture exhibited synergism. The models applied were in agreement in most cases. The observed synergistic interactions underline the requirement to review water quality guidelines, which are likely underestimating the adverse combined effects of these chemicals.

  17. Impacts of harvesting on brine shrimp (Artemia franciscana) in Great Salt Lake, Utah, USA.

    Science.gov (United States)

    Sura, Shayna A; Belovsky, Gary E

    2016-03-01

    Selective harvesting can cause evolutionary responses in populations via shifts in phenotypic characteristics, especially those affecting life history. Brine shrimp (Artemia franciscana) cysts in Great Salt Lake (GSL), Utah, USA are commercially harvested with techniques that select against floating cysts. This selective pressure could cause evolutionary changes over time. Our objectives are to (1) determine if there is a genetic basis to cyst buoyancy, (2) determine if cyst buoyancy and nauplii mortality have changed over time, and (3) to examine GSL environmental conditions over time to distinguish whether selective harvesting pressure or a trend in environmental conditions caused changes in cyst buoyancy and nauplii mortality. Mating crosses between floating and sinking parental phenotypes with two food concentrations (low and high) indicated there is a genetic basis to cyst buoyancy. Using cysts harvested from 1991-2011, we found cyst buoyancy decreased and nauplii mortality increased over time. Data on water temperature, salinity, and chlorophyll a concentration in GSL from 1994 to 2011 indicated that although water temperature has increased over time and chlorophyll a concentration has decreased over time, the selective harvesting pressure against floating cysts is a better predictor of changes in cyst buoyancy and nauplii mortality over time than trends in environmental conditions. Harvesting of GSL A. franciscana cysts is causing evolutionary changes, which has implications for the sustainable management and harvesting of these cysts. Monitoring phenotypic characteristics and life-history traits of the population should be implemented and appropriate responses taken to reduce the impacts of the selective harvesting.

  18. Tolerance to cadmium and cadmium-binding ligands in Great Salt Lake brine shrimp (Artemia salina)

    Energy Technology Data Exchange (ETDEWEB)

    Jayasekara, S.; Drown, D.B.; Sharma, R.P.

    1986-02-01

    Information on the accumulation of cadmium in cytosolic proteins of Great Lake brine shrimp (Artemia salina) was obtained from animals collected directly from the lake and also from animal hatched and maintained in three sublethal concentrations of cadmium (0.5, 2.0, 5.0 ppm) in saltwater aquaria. Brine shrimp growth under these conditions was monitored by measuring body lengths during a 7-day exposure period. Heat-stable, cadmium-binding ligands were isolated and identified by Sephadex G-75 chromatography and atomic absorption spectrophotometry. Cadmium was found to be equally distributed between high and low molecular weight proteins in animals collected from the lake and the 0.5 ppm cadmium group. There was also a slight growth stimulation noted in the 0.5-pm group. Higher cadmium incorporation was noted in low molecular weight fractions with increasing cadmium concentration in the exposure media. Low molecular weight fractions were also found to have high uv absorption characteristics at 250 nm and low absorption at 280 nm. Molecular weight of the cadmium-binding ligands was found to be 11,000 as estimated by the gel filtration method. De novo synthesis of this protein was increased as a function of cadmium concentration in the media. However, slow accumulation of cadmium in other protein fractions was also noticed in higher cadmium exposure groups, suggesting the existence of possible tolerance mechanisms in brine shrimp exposed to suspected acute cadmium concentrations.

  19. Investigations of the effects of cosmic rays on Artemia cysts and tobacco seeds: results of Exobloc II experiment, flown aboard Biocosmos 1887

    Energy Technology Data Exchange (ETDEWEB)

    Gaubin, Y.; Pianezzi, B.; Gasset, G.; Planel, H. (Laboratoire de Biologie Medicale, Faculte de Medecine, Toulouse (France)); Delpoux, M. (Laboratoire de Biogeographie, Faculte des Sciences, Toulouse (France)); Heilmann, C. (Strasbourg-1 Univ., 67 (France). Centre de Recherches Nucleaires)

    1990-01-01

    Artemia (Brine shrimp) cysts and tobacco seeds, dormant biological material devoid of metabolic activity, were flown aboard the Soviet Biocosmos 1887 in order to investigate the effects of cosmic rays. Artemia cysts and tobacco seeds were used in bulk or in monolayers sandwiched with track detectors. Biological and physical units were located outside and inside the spacecraft. Stacks included lead shielding in order to expose the objects to different doses of radiation. Total dosimetry was performed using thermoluminescent detectors. In spite of low levels of doses, the space flight resulted in a decrease in developmental capacity of Artemia cysts, and in a higher mutation rate in tobacco seeds. The more obvious responses occurred, in both cases, in biological objects exposed to the highest doses. These results are compared to those of previous space experiments. (author).

  20. Aplicação de nanotecnologia em embalagens de alimentos

    Directory of Open Access Journals (Sweden)

    Ana Carolina Sergio Almeida

    2015-12-01

    Full Text Available Resumo A nanotecnologia tem grande potencial de aplicação na indústria de alimentos. No desenvolvimento de embalagens, pode proporcionar diferentes alternativas, tais como o desenvolvimento de nanopartículas, nanodispersões, nanolaminados, e nanotubos, que, associados aos polímeros, podem fornecer diversas funções. Por exemplo, pela incorporação de nanopartículas com propriedades antimicrobianas; nanosensores capazes de detectar produtos químicos, agentes patogênicos e toxinas em alimentos; nanopartículas bioativas capazes de manter os compostos em condições ideais, até a sua migração para o produto alimentício e nanocompósitos, que melhorem as propriedades de flexibilidade, barreira a gases e umidade e quanto à absorção de irradiação UV dos materiais aos quais são incorporados, assim como a estabilidade frente à temperatura. Este artigo relata algumas aplicações da nanotecnologia em embalagens de alimentos, bem como questões sobre toxicidade e regulamentação relacionadas à possibilidade de migração das nanopartículas para os alimentos; razão pela qual o setor alimentício tem sido cauteloso com a utilização desses materiais.

  1. Alimentos funcionales: importancia del laboratorio clínico y nuevas perspectivas.

    OpenAIRE

    Olmedilla Alonso, Begoña

    2009-01-01

    VII Jornadas del Comité Científico de la Sociedad Española de Bioquímica Clínica y Patología Molecular (SEQC)Gerona 11-mayo-2009.Papel del laboratorio clínico en el estudio de la relación entre alimentos funcionales (nutrición) y salud / enfermedad

  2. Derechos de alimentos: trámites para su reclamación

    OpenAIRE

    Cárdenas Palacios, María Ximena

    2006-01-01

    Opina la autora : El derecho de alimentos es considerado estruturalmente social, humano y preferente, por ello es protegido y garantizado por distintos cuerpos legales. Sin embargo, es constantemente violador por personas irresponsables teniendo, como consecuencia, que recurrir a la ley para que estas personas cumplan a la fuerza, el deber del que a menudo quieren desentenderse

  3. COMPETENCIA INTRA-INDUSTRIA, AGLOMERACIONES REGIONALES Y CRECIMIENTO ECONÓMICO: CASO INDUSTRIA DE ALIMENTOS

    Directory of Open Access Journals (Sweden)

    ANDRÉS CAMACHO MURILLO

    2011-01-01

    Superintendencia de Sociedades, periodo 1979-2007. Estimando una función de producción de tipo Cobb-Douglas con datos de panel balanceado, se pudo encontrar que la mayor competencia y concentración industrial de empresas de alimentos está asociada a un mayor crecimiento económico.

  4. Avaliação da bioatividade dos extratos de cúrcuma (Curcuma longa L., Zingiberaceae em Artemia salina e Biomphalaria glabrata Bioactivity evaluation of the turmeric (Curcuma longa L., Zingiberaceae extracts in Artemia salina and Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Carlos R. M. da Silva Filho

    2009-12-01

    Full Text Available A cúrcuma é o rizoma limpo, em boas condições, seco e moído da Curcuma longa L., uma planta herbácea da família Zingiberaceae. Visando novas alternativas para o controle da esquistossomose, os extratos de Curcuma longa L. foram testados para a avaliação da atividade moluscicida contra caramujos adultos da espécie Biomphalaria glabrata, e toxicidade (ensaio de letalidade com Artemia salina. A oleoresina e o óleo essencial de cúrcuma foram ativos contra Artemia salina (CL50 = 80,43 e CL50 = 319,82 μg/mL, respectivamente e também ativos contra os indivíduos adultos de Biomphalaria glabrata (CL50 = 58,3 e CL50 = 46,73 μg/mL, respectivamente. A partir dos resultados obtidos pôde ser concluído que ambos os extratos podem constituir uma alternativa no controle da população desses caramujos e na redução da esquistossomose.The turmeric is the clean rhizome at good conditions, dried and powdered of Curcuma longa L., an herbaceous plant of Zingiberaceae family. Aiming new alternatives for Schistosomiasis control, the Curcuma longa L. extracts were tested for molluscicidal activity evaluation against adult snails of Biomphalaria glabrata specie, and the toxicity (Brine Shrimp Lethality-BSL-bioassay. The oleoresin and the essential oil of turmeric were active against Artemia salina (CL50 = 80.43 and CL50 = 319.82 μg.mL-1, respectively and also active against the adult snails of Biomphalaria glabrata (CL50 = 58.3 and CL50 = 46.73 μg.mL-1, respectively. From the obtained results it was concluded that both extracts can constitute an alternative to population control of these snails and in the reduction of Schistosomiasis.

  5. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    OpenAIRE

    LIMA, J.M. de; SILVA, C. A.; Rosa, M. B.; J.B. Santos; OLIVEIRA, T. G. de; Silva,M.B.

    2009-01-01

    A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qual...

  6. Publicidad y consumo de alimentos en estudiantes de Huánuco (Perú

    Directory of Open Access Journals (Sweden)

    María Luisa Sevillano García

    2012-10-01

    Full Text Available Las importantes carencias nutritivas apreciadas en estudiantes del distrito de Huánuco (Perú, junto con la publicidad televisiva de productos de dudosa calidad nutricional observada, nos llevó a plantear y desarrollar una investigación con el objeto de analizar la relación entre ambos fenómenos titulada: Influencia de los anuncios televisivos en el consumo de alimentos publicitados durante el 2010, cuyo resumen se presenta en este artículo. En la investigación planteamos un estudio correlacional con una muestra de 120 escolares de diversas instituciones educativas, a quienes se aplicaron satisfactoriamente encuestas, entrevistas y guía de evaluación física; también se analizó la publicidad emitida por los canales de televisión sobre alimentos y su contenido nutricional. El análisis inferencial aplicado fue Ji cuadrado (?2. Con esta investigación se ha demostrado que el estado de salud de los escolares está afectado, siendo muy agudo respecto a la caries dental, problema que se atribuye al consumo de ciertos alimentos. Se constata que existe relación positiva, con alta significancia estadística, entre la adherencia a los anuncios televisivos y el consumo de alimentos publicitados de alto contenido en sodio, calcio, azúcar y de calorías por los escolares estudiados; así mismo, se prueba la interdependencia entre la exposición a los anuncios televisivos y el consumo de alimentos con productos de alto contenido en grasa que merecen ser vigilados y controlados por los responsables.

  7. Crises de Segurança do Alimento e a Demanda por Carnes no Brasil

    Directory of Open Access Journals (Sweden)

    Moisés de Andrade Resende Filho

    Full Text Available Resumo: Investiga-se se crises de segurança do alimento deslocam para baixo as demandas por carne bovina, suína e de frango no Brasil. Constroem-se três séries de índices de crises de segurança do alimento, um para cada tipo de carne, somando-se o total de notícias na Folha de São Paulo que atenderam a critérios predefinidos de busca. Utilizam-se estas três séries, os preços das carnes e de um bem composto e o gasto per capita com consumo como variáveis explicativas em seis especificações alternativas de um sistema de quatro equações de demanda. Seleciona-se a melhor especificação do modelo por meio de testes ajustados de razão de verossimilhança. Testes com o modelo selecionado não rejeitam a hipótese de que as demandas não são afetadas por crises de segurança do alimento. Conclui-se que se deslocamentos da demanda para baixo em reação a crises de segurança do alimento criam incentivos para que as empresas adotem medidas para produzir um alimento mais seguro, tais incentivos não existem nos setores de carnes no Brasil. Assim, reforça-se a importância e necessidade de um sistema público ativo para regulamentar e estabelecer padrões de segurança da carne no Brasil.

  8. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures

    DEFF Research Database (Denmark)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul;

    2016-01-01

    -DNA hybridization indicated that they could belong to a new species. The genomes contained genes involved in synthesis of the antibacterial compound tropodithietic acid (TDA), and its production was confirmed by UHPLC-TOFMS. The new Phaeobacter colonized live feed (Artemia) cultures and reduced Vibrio counts...... significantly, since they reached only 104 CFUmL-1, as opposed to 108 CFUmL-1 in non-Phaeobacter treated controls. Survival of V. anguillarum-challenged Artemia nauplii was enhanced by the presence of wild type Phaeobacter compared to challenged control cultures (89±1.0% vs 8±3.2%). In conclusion, TDA...

  9. High prevalence of cestodes in Artemia spp. throughout the annual cycle: relationship with abundance of avian final hosts.

    Science.gov (United States)

    Sánchez, Marta I; Nikolov, Pavel N; Georgieva, Darina D; Georgiev, Boyko B; Vasileva, Gergana P; Pankov, Plamen; Paracuellos, Mariano; Lafferty, Kevin D; Green, Andy J

    2013-05-01

    Brine shrimp, Artemia spp., act as intermediate hosts for a range of cestode species that use waterbirds as their final hosts. These parasites can have marked influences on shrimp behavior and fecundity, generating the potential for cascading effects in hypersaline food webs. We present the first comprehensive study of the temporal dynamics of cestode parasites in natural populations of brine shrimp throughout the annual cycle. Over a 12-month period, clonal Artemia parthenogenetica were sampled in the Odiel marshes in Huelva, and the sexual Artemia salina was sampled in the Salinas de Cerrillos in Almería. Throughout the year, 4-45 % of A. parthenogenetica were infected with cestodes (mean species richness = 0.26), compared to 27-72 % of A. salina (mean species richness = 0.64). Ten cestode species were recorded. Male and female A. salina showed similar levels of parasitism. The most prevalent and abundant cestodes were those infecting the most abundant final hosts, especially the Greater Flamingo Phoenicopterus ruber. In particular, the flamingo parasite Flamingolepis liguloides had a prevalence of up to 43 % in A. parthenogenetica and 63.5 % in A. salina in a given month. Although there was strong seasonal variation in prevalence, abundance, and intensity of cestode infections, seasonal changes in bird counts were weak predictors of the dynamics of cestode infections. However, infection levels of Confluaria podicipina in A. parthenogenetica were positively correlated with the number of their black-necked grebe Podiceps nigricollis hosts. Similarly, infection levels of Anomotaenia tringae and Anomotaenia microphallos in A. salina were correlated with the number of shorebird hosts present the month before. Correlated seasonal transmission structured the cestode community, leading to more multiple infections than expected by chance.

  10. Chitin-binding proteins of Artemia diapause cysts participate in formation of the embryonic cuticle layer of cyst shells.

    Science.gov (United States)

    Ma, Wen-Ming; Li, Hua-Wei; Dai, Zhong-Min; Yang, Jin-Shu; Yang, Fan; Yang, Wei-Jun

    2013-01-01

    The brine shrimp Artemia reproduces either ovoviviparously, producing free-swimming nauplii, or oviparously, producing encysted embryos (diapause cysts) able to cope with harsh and complex habitats. When the cysts enter diapause they are encased in a complex external shell that protects them from certain extreme environments. The genomic comparison of oviparous and ovoviviparous ovisacs has been described previously. We isolated three significantly up-regulated genes in oviparous oocytes and identified them as Arp-CBP (Artemia parthenogenetica chitin-binding protein) genes. Quantitative real-time PCR indicated that the expression of Arp-CBP genes gradually increases during diapause cyst formation and significant mRNA accumulation occurs during the ovisac stage of oviparous development. Moreover, in situ hybridization results demonstrated that Arp-CBP mRNAs are expressed in the embryo. Interestingly, the results of immune electron microscopy showed that all three Arp-CBPs are distributed throughout the cellular ECL (embryonic cuticle layer) of the cyst shell. Furthermore, knockdown of Arp-CBP by RNA interference resulted in marked changes in the composition of the embryonic cuticular layer. The fibrous layer of the cyst shell adopted a loose conformation and the inner and outer cuticular membranes exhibited marked irregularities when Arp-CBP expression was suppressed. Finally, an in vitro recombinant protein-binding assay showed that all three Arp-CBPs have carbohydrate-binding activities. These findings provide significant insight into the mechanisms by which the ECL of Artemia cyst shell is formed, and demonstrate that Arp-CBPs are involved in construction of the fibrous lattice and are required for formation of the ECL of the cyst shell.

  11. Identification of the glycerol kinase gene and its role in diapause embryo restart and early embryo development of Artemia sinica.

    Science.gov (United States)

    Cheng, Cheng; Yao, Feng; Chu, Bing; Li, Xuejie; Liu, Yan; Wu, Yang; Mei, Yanli; Wang, Peisheng; Hou, Lin; Zou, Xiangyang

    2014-03-01

    Glycerol kinase (GK) catalyzes the rate-limiting step in glycerol utilization by transferring a phosphate from ATP to glycerol, yielding glycerol 3-phosphate, which is an important intermediate for both energy metabolism and glycerolipid production. Artemia sinica has an unusual diapause process under stress conditions of high salinity, low temperature and lack of food. In the process, diapause embryos of A. sinica (brine shrimp) accumulate high concentrations of glycerol as a cryoprotectant to prevent low temperature damage to embryos. Upon embryo restart, glycerol is converted into glucose and other carbohydrates. Therefore, GK plays an important role in the diapause embryo restart process. However, the role of GK in diapause termination of embryo development in A. sinica remains unknown. In the present study, a 2096 bp full-length cDNA of gk from A. sinica (As-gk) was obtained, encoding putative 551 amino acids, 60.6 kDa protein. As a crucial enzyme in glycerol uptake and metabolism, GK has been conserved structurally and functionally during evolution. The expression pattern of As-gk was investigated by quantitative real-time PCR and Western blotting. Expression locations of As-gk were analyzed using in situ hybridization. As-gk was widely distributed in the early embryo and several main parts of Artemia after differentiation. The expression of As-GK was also induced by stresses such as cold exposure and high salinity. This initial research into the expression pattern and stress response of GK in Artemia provides a sound basis for further understanding of the function and regulation of genes in early embryonic development in A. sinica and the stress response.

  12. High prevalence of cestodes in Artemia spp. throughout the annual cycle: relationship with abundance of avian final hosts

    Science.gov (United States)

    Sánchez, Marta I.; Nikolov, Pavel N.; GEorgieva, Darina D.; Georgiev, Boyko B.; Vasileva, Gergana P.; Pankov, Plamen; Paracuellos, Mariano; Lafferty, Kevin D.; Green, Andy J.

    2013-01-01

    Brine shrimp, Artemia spp., act as intermediate hosts for a range of cestode species that use waterbirds as their final hosts. These parasites can have marked influences on shrimp behavior and fecundity, generating the potential for cascading effects in hypersaline food webs. We present the first comprehensive study of the temporal dynamics of cestode parasites in natural populations of brine shrimp throughout the annual cycle. Over a 12-month period, clonal Artemia parthenogenetica were sampled in the Odiel marshes in Huelva, and the sexual Artemia salina was sampled in the Salinas de Cerrillos in Almería. Throughout the year, 4–45 % of A. parthenogenetica were infected with cestodes (mean species richness = 0.26), compared to 27–72 % of A. salina (mean species richness = 0.64). Ten cestode species were recorded. Male and female A. salina showed similar levels of parasitism. The most prevalent and abundant cestodes were those infecting the most abundant final hosts, especially the Greater Flamingo Phoenicopterus ruber. In particular, the flamingo parasite Flamingolepis liguloides had a prevalence of up to 43 % in A. parthenogenetica and 63.5 % in A. salina in a given month. Although there was strong seasonal variation in prevalence, abundance, and intensity of cestode infections, seasonal changes in bird counts were weak predictors of the dynamics of cestode infections. However, infection levels of Confluaria podicipina in A. parthenogenetica were positively correlated with the number of their black-necked grebe Podiceps nigricollis hosts. Similarly, infection levels of Anomotaenia tringae and Anomotaenia microphallos in A. salina were correlated with the number of shorebird hosts present the month before. Correlated seasonal transmission structured the cestode community, leading to more multiple infections than expected by chance.

  13. beta-Hydroxybutyrate in developing nauplii of brine shrimp (Artemia franciscana K.) under feeding and non-feeding conditions.

    Science.gov (United States)

    Weltzien, F A; Hemre, G I; Evjemo, J O; Olsen, Y; Fyhn, H J

    2000-01-01

    Body content of beta-hydroxybutyrate, and individual dry mass, carbon content, and survival rate, were studied in developing nauplii of the brine shrimp Artemia franciscana K. from hatching to 96-97 h post hatching at 27 +/- 1 degrees C. The effect of two diets was studied in the experiment: Super Selco (SS) with a high lipid content; and Protein Selco (PS) with a high protein content. A starving group (S) was used as reference. The level of beta-hydroxybutyrate at hatching was 0.6 nmol.ind-1; it increased to 1.0-1.5 nmol.ind-1 in the SS- and S-groups, while in the PS-group it remained stable between 0.6-0.8 nmol.ind-1. At 60-80 h post hatch in the SS- and S-groups, the levels of beta-hydroxybutyrate were similar to the initial levels. The survival rate remained higher than 95% until 24 h post hatching in all groups. At the end of the experiment, the survival rate was 63% in the PS-group, 13% in the S-group and 3% in the SS-group. The Artemia nauplii individual dry mass and carbon content remained relatively stable in the SS-group; both parameters showed a significant increase in the PS-group and a significant decrease in the S-group. The results suggest that Artemia nauplii utilise ketone bodies as a fuel during development and growth, but that ketone catabolism may be overloaded by excessive lipid feeding resulting in increased mortality and possibly a ketotic acidosis.

  14. Effects of aqueous suspensions of titanium dioxide nanoparticles on Artemia salina: assessment of nanoparticle aggregation, accumulation, and toxicity.

    Science.gov (United States)

    Ates, Mehmet; Daniels, James; Arslan, Zikri; Farah, Ibrahim O

    2013-04-01

    Aquatic stability and impact of titanium dioxide nanoparticles (TiO2 NPs, 10-30 nm) were investigated using Artemia salina. Acute exposure was conducted on nauplii (larvae) and adults in seawater in a concentration range from 10 to 100 mg/L TiO2 NPs for 24 and 96 h. Rapid aggregation occurred in all suspensions of TiO2 NPs to form micrometer size particles. Yet, both nauplii and adults accumulated the aggregates significantly. Average TiO2 content in nauplii ranged from 0.47 to 3.19 and from 1.29 to 4.43 mg/g in 24 and 96 h, respectively. Accumulation in adults was higher ranging from 2.30 to 4.19 and from 4.38 to 6.20 mg/g in 24 and 96 h, respectively. Phase contrast microscopy images revealed that Artemia were unable to excrete the particles. Thus, the TiO2 aggregates filled inside the guts. No significant mortality or toxicity occurred within 24 h at any dose. Lipid peroxidation levels characterized with malondialdehyde concentrations were not statistically different from those of the controls (p > 0.05). These results suggested that suspensions of the TiO2 NPs were nontoxic to Artemia, most likely due to the formation of benign TiO2 aggregates in water. In contrast, both mortality and lipid peroxidation increased in extended exposure to 96 h. Highest mortality occurred in 100 mg/L TiO2 NP suspensions; 18 % for nauplii and 14 % for adults (LC50 > 100 mg/L). These effects were attributed to the particle loading inside the guts leading to oxidative stress as a result of impaired food uptake for a long period of time.

  15. SEM study of diversity in the cyst surface topography of nine parthenogenetic Artemia (Crustacea: Anostraca) populations from China.

    Science.gov (United States)

    Asem, Alireza; Sun, Shi-Chun

    2014-12-01

    The cysts of nine Chinese populations of parthenogenetic Artemia were studied by scanning electron microscope. In the 270 cysts examined, 15 different morphological patterns were recognized with most of them not recorded in previous studies and the "tubercled shell surface" being the most common pattern. Results also displayed high intrapopulation variability, with the maximum of 11 patterns (in 30 cysts) recorded from the Barkol population. No positive correlation between the diversity of cyst shell patterns and ploidy compositions was found. Principal components analysis suggests higher similarity among coastal populations than among inland populations, which may be attributed to the identity of physicochemical conditions among coastal salterns and dissimilarity among inland saline lakes.

  16. Proteomic analysis of acute responses to copper sulfate stress in larvae of the brine shrimp,Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    周茜; 吴长功; 董波; 李富花; 刘凤岐; 相建海

    2010-01-01

    Proteomics was used to reveal the differential protein expression profiles of acute responses to copper sulfate exposure in larvae of Artemia sinica.Fourteen differentially displayed protein spots were detected and seven of them were identified.Three spots were up-expressed and identified:actin, heat shock protein 70,and chaperone subunit 1;three down-regulated proteins were identified:arginine kinase,elongation factor-2,and glycine-rich protein;and a newly expressed protein was identified as peroxiredoxin....

  17. Naked eye instant reversible sensing of Cu(2+) and its in situ imaging in live brine shrimp Artemia.

    Science.gov (United States)

    Nair, Ratish R; Raju, M; Patel, Neha P; Raval, Ishan H; Suresh, E; Haldar, Soumya; Chatterjee, Pabitra B

    2015-08-21

    A Cu(2+)-specific colorimetric reversible fluorescent receptor was designed and synthesized which showed a naked eye observable colour change from colourless to pink on addition of an aqueous buffer (pH 7.4) solution of 30 ppb Cu(2+). Short response time (≤5 s) and low detection limit (nearly 3 ppb) make suitable as a reliable "dip-in" open eye sensor for Cu(2+). Bio-imaging application in live brine shrimp Artemia enabled to detect Cu(2+) at as low as 10 ppb exposure.

  18. Prototipo para la determinación de propiedades térmicas en alimentos semisólidos

    OpenAIRE

    Radrigan Ewoldt, Rudi

    2008-01-01

    Los sistemas productivos en la actualidad han evolucionado cada día y la ingeniería de procesos debe ser más activa en lo que al control de procesos lo exige un mundo globalizado, ya que permite optimizar las materias primas y las fuentes energéticas necesarias para producir un alimento. Las propiedades térmicas de alimentos son fundamentales para la industria agroalimentaria, permiten o dificultan la transferencia térmica entre la fuente calefactora y el alimento en si; la característica pri...

  19. Percepciones sobre disponibilidad de alimentos y autorreporte de ingesta alimentaria en mujeres urbanas costarricenses: Un estudio piloto

    OpenAIRE

    Bekelman, Traci A.; Carolina Santamaría-Ulloa; Dufour,Darna L.; Ana Laura Dengo

    2016-01-01

    Antecedentes: Se considera que la disponibilidad y consumo de alimentos han contribuido al aumento de obesidad entre las mujeres de bajo nivel socioeconómico (NSE) en Latinoamérica. En Costa Rica, pocos estudios han investigado cómo la disponibilidad y consumo varían según NSE. Objetivos: Los objetivos de este estudio en San José, Costa Rica, son (1) evaluar percepciones sobre la disponibilidad de alimentos y (2) describir el consumo de alimentos en mujeres que viven en áreas de alto y bajo N...

  20. Exactitud de las tablas de composición de alimentos en la determinación de nutrientes

    OpenAIRE

    R. Pérez Grana

    2013-01-01

    Las tablas de composición de alimentos constituyen una herramienta imprescindible para realizar una valoración nutricional de alimentos o de ingesta en las Fuerzas Armadas. Ofrecen una información semicuantitativa, más exacta para los macronutrientes o algunos elementos minerales mayoritarios (potasio, calcio y fósforo), y menos exacta para vitaminas y elementos minerales traza. Las diferencias entre las tablas de composición de alimentos y los análisis químicos son variables dependiendo de l...

  1. Competencias profesionales de un ingeniero en alimentos. Un estudio sobre su formación matemática

    OpenAIRE

    Muñoz, Hernán

    2004-01-01

    Esta presentación da cuenta de una investigación de tipo cualitativo que genera y sistematiza la información sobre las competencias profesionales y matemáticas de un Ingeniero en Alimentos. Las fuentes utilizadas fueron análisis bibliográfico sobre competencias profesionales, focus group realizados con ingenieros en alimentos de empresas y con académicos de universidades y entrevistas en profundidad realizadas a académicos de las universidades y a ingenieros en alimentos. Se integró y comparó...

  2. Historia de la microbiología de los alimentos y su desarrollo en Latino América

    OpenAIRE

    Mendoza Galindo, Silvia; Universidad Simón Bolívar; Caracas-Venezuela.

    2014-01-01

    Quisiera empezar recordando algo obvio, y es que nada, excepto el oxígeno que respiramos, es más importante en la vida que los alimentos, de ahí entonces, que este sea de tanto interés para los seres humanos y está relacionado con la producción, el procesamiento, distribución e la preservación, inocuidad de los alimentos y todas estas opciones, sin duda. involucran un fuerte componente microbiológico.Mucho antes que se conocieran los microorganismos ya se hacían alimentos como el pan con lev...

  3. PRODUÇÃO DE ALIMENTOS TRADICIONAIS Contribuindo para o desenvolvimento local/regional e dos pequenos produtores rurais

    OpenAIRE

    Zuin, Luís Fernando Soares; Zuin, Poliana Bruno

    2008-01-01

    Esse artigo tem como finalidade apresentar uma proposta de produção para o desenvolvimento de alimentos tradicionais, baseada no modelo de Processo e Desenvolvimentos de Produtos Rurais (PDP-rural), proposto por Zuin e Alliprandini (2006). Essa proposta objetiva contribuir com os pequenos produtores rurais e com o desenvolvimento local e regional, por meio da agregação de valor aos produtos do tipo commodities. Mas o que são os alimentos tradicionais? São os alimentos chamados, também, de pro...

  4. Fortification of industrialized foods with vitamins Fortificação de alimentos industrializados com vitaminas

    Directory of Open Access Journals (Sweden)

    Selma Coelho Liberato

    2006-04-01

    Full Text Available Vitamins are essential to life. Inadequate eating habits, high caloric intake and metabolic defects lead to micronutrient deficiencies, affecting more than two billion people worldwide. The increasing intake of industrialized foods, combined with low vitamin stability has led to the common practice of adding these nutrients to processed foods. This review discusses the terminology, availability, intake and risk of hypervitaminosis, due to the intake and nutritional importance of foods fortified with vitamins. The addition of nutrients should occur in foods that are effectively consumed by the target population and must meet the real needs of a significant segment of the population. In Brazil, a total of 166 products available in supermarkets are vitamin-enriched. A 10-year study involving children and adolescents in Germany showed that 90% of those surveyed used at least one fortified food. During this 10-year period, 472 fortified products were consumed. The enrichment of foods should be based on the needs of each country and, if possible, regional needs. For instance, in order to increase its intake, Vitamin D is added to foods in Denmark during the winter, mainly for the elderly. However, in Brazil, there is no evidence of the need to fortify food with this vitamin. A survey showed that of the 76 enriched dairy products, 37 contained vitamin D. Food-fortification is a very important strategy to solve nutritional deficiency problems, but it can also cause many health problems.Vitaminas são nutrientes essenciais à vida. Hábitos alimentares inadequados, alto consumo energético e falhas no metabolismo levam a deficiências de micronutrientes, que afetam mais de dois bilhões de pessoas mundialmente. O consumo, cada vez maior, de alimentos industrializados, somado à baixa estabilidade das vitaminas, têm induzido à prática de adição de nutrientes aos alimentos processados. Esta revisão discute terminologia, disponibilidade, ingestão e

  5. Toxicоlogical evaluation of the plant products using Brine Shrimp (Artemia salina L. model

    Directory of Open Access Journals (Sweden)

    Меntor R. Hamidi

    2014-04-01

    Full Text Available Many natural products could serve as the starting point in the development of modern medicines because of their numerous biological and pharmacological activities. However, some of them are known to carry toxicological properties as well. In order to achieve a safe treatment with plant products, numerous research studies have recently been focused on both pharmacology and toxicity of medicinal plants. Moreover, these studies employed efforts for alternative biological assays. Brine Shrimp Lethality Assay is the most convenient system for monitoring biological activities of various plant species. This method is very useful for preliminary assessment of toxicity of the plant extracts. Rapidness, simplicity and low requirements are several advantages of this assay. However, several conditions need to be completed, especially in the means of standardized experimental conditions (temperature, pH of the medium, salinity, aeration and light. The toxicity of herbal extracts using this assay has been determined in a concentration range of 10, 100 and 1000 µg/ml of the examined herbal extract. Most toxicity studies which use the Brine Shrimp Lethality Assay determine the toxicity after 24 hours of exposure to the tested sample. The median lethal concentration (LC50 of the test samples is obtained by a plot of percentage of the dead shrimps against the logarithm of the sample concentration. LC50 values are estimated using a probit regression analysis and compared with either Meyer’s or Clarkson’s toxicity criteria. Furthermore, the positive correlation between Meyer’s toxicity scale for Artemia salina and Gosselin, Smith and Hodge’s toxicity scale for higher animal models confirmed that the Brine Shrimp Lethality Assay is an excellent predictive tool for the toxic potential of plant extracts in humans.

  6. Assessment of toxicity of Moringa oleifera flower extract to Biomphalaria glabrata, Schistosoma mansoni and Artemia salina.

    Science.gov (United States)

    Rocha-Filho, Cláudio A A; Albuquerque, Lidiane P; Silva, Luanna R S; Silva, Patrícia C B; Coelho, Luana C B B; Navarro, Daniela M A F; Albuquerque, Monica C P A; Melo, Ana Maria M A; Napoleão, Thiago H; Pontual, Emmanuel V; Paiva, Patrícia M G

    2015-08-01

    This study reports the effect of an aqueous extract from Moringa oleifera Lam. flowers on Biomphalaria glabrata embryos and adults and on Schistosoma mansoni adult worms. The extract contains tannins, saponins, flavones, flavonols, xanthones, and trypsin inhibitor activity. The toxicity of the extract on Artemia salina larvae was also investigated to determine the safety of its use for schistosomiasis control. After incubation for 24h, the flower extract significantly (p<0.05) delayed the development of B. glabrata embryos and promoted mortality of adult snails (LC50: 2.37±0.5mgmL(-1)). Furthermore, treatment with the extract disrupted the development of embryos generated by snails, with most of them remaining in the blastula stage while control embryos were already in the gastrula stage. Flower extract killed A. salina larvae with a LC50 value (0.2±0.015mgmL(-1)) lower than that determined for snails. A small reduction (17%) in molluscicidal activity was detected when flower extract (2.37mgmL(-1)) was exposed to tropical environmental conditions (UVI index ranging from 1 to 14, temperature from 25 to 30°C, and 65% relative humidity). Toxicity to A. salina was also reduced (LC50 value of 0.28±0.01mgmL(-1)). In conclusion, M. oleifera flower extract had deleterious effects on B. glabrata adults and embryos. However, unrestricted use to control schistosomiasis should be avoided due to the toxicity of this extract on A. salina.

  7. Recreating the seawater mixture composition of HOCs in toxicity tests with Artemia franciscana by passive dosing

    Energy Technology Data Exchange (ETDEWEB)

    Rojo-Nieto, E., E-mail: elisa.rojo@uca.es [Andalusian Centre of Marine Science and Technology (CACYTMAR), Department of Environmental Technologies, University of Cadiz, 11510 Puerto Real (Spain); Smith, K.E.C. [Department of Environmental Science, Aarhus University, DK-4000 Roskilde (Denmark); Perales, J.A. [Andalusian Centre of Marine Science and Technology (CACYTMAR), Department of Environmental Technologies, University of Cadiz, 11510 Puerto Real (Spain); Mayer, P. [Department of Environmental Science, Aarhus University, DK-4000 Roskilde (Denmark)

    2012-09-15

    The toxicity testing of hydrophobic organic compounds (HOCs) in aquatic media is generally challenging, and this is even more problematic for mixtures. The hydrophobic properties of these compounds make them difficult to dissolve, and subsequently to maintain constant exposure concentrations. Evaporative and sorptive losses are highly compound-specific, which can alter not only total concentrations, but also the proportions between the compounds in the mixture. Therefore, the general aim of this study was to explore the potential of passive dosing for testing the toxicity of a PAH mixture that recreates the mixture composition found in seawater from a coastal area of Spain, the Bay of Algeciras. First, solvent spiking and passive dosing were compared for their suitability to determine the acute toxicity to Artemia franciscana nauplii of several PAHs at their respective solubility limits. Second, passive dosing was applied to recreate the seawater mixture composition of PAHs measured in a Spanish monitoring program, to test the toxicity of this mixture at different levels. HPLC analysis was used to confirm the reproducibility of the dissolved exposure concentrations for the individual PAHs and mixtures. This study shows that passive dosing has some important benefits in comparison with solvent spiking for testing HOCs in aquatic media. These include maintaining constant exposure concentrations, leading to higher reproducibility and a relative increase in toxicity. Passive dosing is also able to faithfully reproduce real mixtures of HOCs such as PAHs, in toxicity tests, reproducing both the levels and proportions of the different compounds. This provides a useful approach for studying the toxicity of environmental mixtures of HOCs, both with a view to investigating their toxicity but also for determining safety factors before such mixtures result in detrimental effects.

  8. Liposomes with diverse compositions are protected during desiccation by LEA proteins from Artemia franciscana and trehalose.

    Science.gov (United States)

    Moore, Daniel S; Hansen, Richard; Hand, Steven C

    2016-01-01

    Intracellular accumulation of Late Embryogenesis Abundant (LEA) proteins and the disaccharide trehalose is associated with cellular desiccation tolerance in a number of animal species. Two LEA proteins from anhydrobiotic embryos of the brine shrimp Artemia franciscana were tested for the ability to protect liposomes of various compositions against desiccation-induced damage in the presence and absence of trehalose. Damage was assessed by carboxyfluorescein leakage after drying and rehydration. Further, using a cytoplasmic-localized (AfrLEA2) and a mitochondrial-targeted (AfrLEA3m) LEA protein allowed us to evaluate whether each may preferentially stabilize membranes of a particular lipid composition based on the protein's subcellular location. Both LEA proteins were able to offset damage during drying of liposomes that mimicked the lipid compositions of the inner mitochondrial membrane (with cardiolipin), outer mitochondrial membrane, and the inner leaflet of the plasma membrane. Thus liposome stabilization by AfrLEA3m or AfrLEA2 was not dependent on lipid composition, provided physiological amounts of bilayer and non-bilayer-forming lipids were present (liposomes with a non-biological composition of 100% phosphatidylcholine were not protected by either protein). Additive protection by LEA proteins plus trehalose was dependent on the lipid composition of the target membrane. Minimal additional damage occurred to liposomes stored at room temperature in the dried state for one week compared to liposomes rehydrated after 24h. Consistent with the ability to stabilize lipid bilayers, molecular modeling of the secondary structures for AfrLEA2 and AfrLEA3m revealed bands of charged amino acids similar to other amphipathic proteins that interact directly with membranes.

  9. Artemia franciscana as a vector for infectious myonecrosis virus (IMNV) to Litopenaeus vannamei juvenile.

    Science.gov (United States)

    da Silva, Suzianny Maria Bezerra Cabral; Lavander, Henrique David; de Santana Luna, Manuella Maria; de Melo Eloi da Silva, Ana Odete; Gálvez, Alfredo Olivera; Coimbra, Maria Raquel Moura

    2015-03-01

    In 2004, the infectious myonecrosis virus (IMNV) was recognized as the main cause of Litopenaeusvannamei shrimp culture's drop in Brazil. In health animal control programs, in order to reduce virus prevalence in production units it is necessary to screen live feed used. Among live diets used in aquaculture, the brine shrimp Artemia sp. is essential in crustacean larviculture and maturation. The aim of the present study was to investigate the susceptibility of Artemiafranciscana to IMNV through an immersion challenge and virus-phytoplankton adhesion route and to elucidate its role as a vector for IMNV transmission to L.vannamei. A. franciscana adults were infected with IMNV through both routes, as demonstrated by PCR-positive reactions. However, infected A. franciscana showed no signs of infection. More than 40% of L. vannamei juveniles fed with IMNV-infected A. franciscana by virus-phytoplankton adhesion route were positive by real-time PCR, whereas only a 10% infection rate was found among shrimp fed with IMNV-infected brine shrimp using the immersion challenge. Significant differences were found in mean viral load between immersion and virus-phytoplankton adhesion shrimp treatments (p ⩽ 0.05). Moreover, the mean viral loads were 1.34 × 10(2) and 1.48 × 10(4) copies/μg(-1) of total RNA for virus-phytoplankton adhesion and IMNV-infected tissue treatments, respectively, and the difference was not significant (p ⩾ 0.05). The results indicated that A. franciscana act as a vector for IMNV transmission under the experimental conditions examined. Although no mass mortalities were detected in L. vannamei fed with IMNV-infected brine shrimp, these infected shrimp should not be disregarded as a source of IMNV in grow-out units.

  10. Nano-sized polystyrene affects feeding, behavior and physiology of brine shrimp Artemia franciscana larvae.

    Science.gov (United States)

    Bergami, Elisa; Bocci, Elena; Vannuccini, Maria Luisa; Monopoli, Marco; Salvati, Anna; Dawson, Kenneth A; Corsi, Ilaria

    2016-01-01

    Nano-sized polymers as polystyrene (PS) constitute one of the main challenges for marine ecosystems, since they can distribute along the whole water column affecting planktonic species and consequently disrupting the energy flow of marine ecosystems. Nowadays very little knowledge is available on the impact of nano-sized plastics on marine organisms. Therefore, the present study aims to evaluate the effects of 40nm anionic carboxylated (PS-COOH) and 50nm cationic amino (PS-NH2) polystyrene nanoparticles (PS NPs) on brine shrimp Artemia franciscana larvae. No signs of mortality were observed at 48h of exposure for both PS NPs at naplius stage but several sub-lethal effects were evident. PS-COOH (5-100μg/ml) resulted massively sequestered inside the gut lumen of larvae (48h) probably limiting food intake. Some of them were lately excreted as fecal pellets but not a full release was observed. Likewise, PS-NH2 (5-100µg/ml) accumulated in larvae (48h) but also adsorbed at the surface of sensorial antennules and appendages probably hampering larvae motility. In addition, larvae exposed to PS-NH2 undergo multiple molting events during 48h of exposure compared to controls. The activation of a defense mechanism based on a physiological process able to release toxic cationic NPs (PS-NH2) from the body can be hypothesized. The general observed accumulation of PS NPs within the gut during the 48h of exposure indicates a continuous bioavailability of nano-sized PS for planktonic species as well as a potential transfer along the trophic web. Therefore, nano-sized PS might be able to impair food uptake (feeding), behavior (motility) and physiology (multiple molting) of brine shrimp larvae with consequences not only at organism and population level but on the overall ecosystem based on the key role of zooplankton on marine food webs.

  11. Identification, expression pattern, cellular location and potential role of the caveolin-1 gene from Artemia sinica.

    Science.gov (United States)

    Li, Xuejie; Yao, Feng; Zhang, Wei; Cheng, Cheng; Chu, Bing; Liu, Yan; Mei, Yanli; Wu, Yang; Zou, Xiangyang; Hou, Lin

    2014-05-01

    Caveolins are integral membrane proteins that serve as scaffolds to recruit numerous signaling molecules. Caveolins play an important role in membrane trafficking, signal transduction, substrate transport and endocytosis in differentiated cells. In this study, a caveolin-1 gene from Artemia sinica (As-cav-1) was successfully cloned for the first time. The full-length cDNA of As-cav-1 comprises 974 bp, with a 675 bp open reading frame (ORF) that encodes a polypeptide of 224 amino acids with a caveolin scaffolding domain (CSD) and two transmembrane domains. Multiple sequence alignment revealed that the putative As-CAV-1 protein sequence was relatively conserved across species, especially in the CSD domain. Real-time PCR revealed high levels of the As-cav-1 transcript at 0h of embryo development. Furthermore, As-cav-1 transcripts were highly upregulated under high salinity (200‰) and low temperature stresses (15°C). To further characterize As-cav-1, recombinant pET30a-cav-1 protein was expressed using a prokaryotic expression system. The recombinant protein comprised 290 amino acids with a theoretical molecular weight of 32kDa, and a predicted isoelectric point of 5.6. Western blotting of the expression levels of As-CAV-1 during different embryo development stages revealed that As-CAV-1 levels decreased gradually during development stages from 0 h to 40 h, and increased at 3d. Furthermore, western blotting showed that As-CAV-1 was upregulated to its highest expression level by low temperature stress (15°C) and high salinity. Confocal laser microscopy analysis, using antibodies generated against the recombinant As-CAV-1 protein, showed that As-CAV-1 was mostly located in the cell membrane. Our results suggested that As-cav-1 plays a vital role in protecting embryos from high salt damage and low temperature stress, especially during post-diapause embryonic development.

  12. Metabolic restructuring during energy-limited states: insights from Artemia franciscana embryos and other animals.

    Science.gov (United States)

    Hand, Steven C; Menze, Michael A; Borcar, Apu; Patil, Yuvraj; Covi, Joseph A; Reynolds, Julie A; Toner, Mehmet

    2011-05-01

    Many life history stages of animals that experience environmental insults enter developmental arrested states that are characterized by reduced cellular proliferation, with or without a concurrent reduction in overall metabolism. In the case of the most profound metabolic arrest reported in invertebrates, i.e., anaerobic quiescence in Artemia franciscana embryos, acidification of the intracellular milieu is a major factor governing catabolic and anabolic downregulation. Release of ions from intracellular compartments is the source for approximately 50% of the proton equivalents needed for the 1.5 unit acidification that is observed. Recovery from the metabolic arrest requires re-sequestration of the protons with a vacuolar-type ATPase (V-ATPase). The remarkable facet of this mechanism is the ability of embryonic cells to survive the dissipation of intracellular ion gradients. Across many diapause-like states, the metabolic reduction and subsequent matching of energy demand is accomplished by shifting energy metabolism from oxidative phosphorylation to aerobic glycolysis. Molecular pathways that are activated to induce these resilient hypometabolic states include stimulation of the AMP-activated protein kinase (AMPK) and insulin signaling via suite of daf (dauer formation) genes for diapause-like states in nematodes and insects. Contributing factors for other metabolically depressed states involve hypoxia-inducible factor-1 and downregulation of the pyruvate dehydrogenase complex. Metabolic similarities between natural states of stasis and some cancer phenotypes are noteworthy. Reduction of flux through oxidative phosphorylation helps prevent cell death in certain cancer types, similar to the way it increases viability of dauer stages in Caenorhabditis elegans. Mechanisms that underlie natural stasis are being used to pre-condition mammalian cells prior to cell biostabilization and storage.

  13. Evaluando la aceptación de alimentos en escolares: registro visual cualitativo frente a análisis de residuos de alimentos

    Directory of Open Access Journals (Sweden)

    Alejandra Rodríguez-Tadeo

    2014-05-01

    Full Text Available Introducción: Los comedores escolares cuentan con normativa de gestión y supervisión de menús, sin embargo no se ha valorado si son consumidos en su totalidad. Objetivo: Valorar la aceptación de alimentos mediante pesado de restos y validación de una metodología visual para su estimación en comedores escolares de Murcia. Metodología: Participaron escolares de segundo y tercer ciclo de educación primaria, de 8-12 años. La estimación de restos se realizó mediante pesado de alimentos de 765 bandejas. La valoración visual (300 bandejas se realizó con escala categórica: 1 = 0-25%; 2 = 26-50%; 3 = 5175% y 4 = 76-100%, por dos dietistas y se valoró la fiabilidad con respecto al pesado de alimentos. La concordancia entre ambos métodos fue evaluada en dos muestras estratificadas por la presencia/ausencia de cocina en la escuela. Resultados: Los primeros platos con más restos fueron pasta, arroz y purés de verduras siendo mayor en aquellos colegios sin cocina en el centro (p < 0,05. También los segundos platos a base de legumbres, ave y pescado y ensaladas de guarnición. Las frutas y el total de restos son superiores en colegios sin cocina (p < 0,05. La concordancia entre evaluadoras fue alta en platos a base de carnes y en ensaladas, y considerable en legumbres, precocinados, tortilla de huevo, pasta, pescado y arroz. Conclusiones: Los restos son elevados y existieron diferencias en la aceptación de ciertos alimentos acorde al tipo de menú ofertado. La escala visual es una herramienta confiable para medir la aceptación de forma indirecta, pero necesita capacitación y entrenamiento del personal implicado.

  14. Seguridad y riesgo de toxicidad de los alimentos: un debate actual

    Directory of Open Access Journals (Sweden)

    Mariné Font, Abel

    2001-01-01

    Full Text Available Not available

    El progreso científico y tecnológico ha tenido muchas consecuencias beneficiosas para la humanidad pero también conlleva riesgos. Un ámbito en el que estos dos aspectos de la cuestión se manifiestan más claramente es el de la alimentación humana. Las posibilidades actuales de la industria alimentaria permiten la obtención de productos cada vez más adaptados a las necesidades y gustos del consumidor No obstante, existe una desconfianza frente a los alimentos transformados que se juzgan, injustamente, como menos seguros que los frescos o naturales. Ciertos escándalos de gran resonancia alimentan esta desconfianza, y no suele tenerse en cuenta que las vacas locas, los pollos con dioxinas o la carne con hormonas, por ejemplo, son problemas de las fases primarias de producción, agrícola y ganadera, y no de la industria alimentaria propiamente dicha. Bajo la perspectiva global de lo que son los alimentos y de lo que conocemos de su composición y funciones en el ser humano, y teniendo en cuenta de que el riesgo cero no existe para ninguna actividad, y por lo tanto tampoco en la alimentación, se puede afirmar que nuestros alimentos nunca han sido tan seguros como en la actualidad, aunque sigue habiendo problemas y en un tema como éste, de evidente implicación sanitaria, toda precaución es poca.
    En este artículo se discuten las relaciones entre alimentación y riesgo y la percepción social sobre estas relaciones, se describen someramente los componentes tóxicos naturales de los alimentos, la contaminación de los mismos, los problemas de alteración y deterioro, así como la adulteración y el fraude y sus consecuencias. También se aborda la significación de casos actuales que cuestionan la seguridad de los alimentos y el papel del control alimentario, por parte de productores y administraciones públicas, para garantizar la calidad y la seguridad de los alimentos.

  15. Composición del mercado nacional de alimentos balanceados para tilapia en Costa Rica

    Directory of Open Access Journals (Sweden)

    Ruth Vargas

    2003-01-01

    Full Text Available Se evaluó el origen y proceso de fabricación de los alimentos balanceados para tilapias comercializados en el país e inscritos en el Programa de Registro y Control de Calidad de Alimentos Balanceados para Animales del Ministerio de Agricultura y Ganadería. Además, se determinaron las prescripciones según la fase fisiol ógica y su composición química, así como las relaciones proteína cruda versus energía metabolizable y calcio – fósforo para compararlos contra los requerimientos recomendados. La calidad física fue evaluada en términos del tamaño de part ícula versus el tamaño del pez. El estudio de mercado consider ó el precio de venta de cada unidad de nutriente y su relaci ón que aportan los alimentos disponibles. Se determinó que un 82,35% de los registros son de origen nacional, un 88,23% de los alimentos son producidos por extrusión, y un 41% de las fórmulas son ofrecidas para todos los estadios, lo que provoca poca sustentación para comparar contra los requerimientos; a manera de ejemplo metodológico se determinó que los contenidos de proteína cruda de aquéllas fórmulas que son ofrecidas para alevines concuerdan con los niveles recomendados por la literatura. La situación de la calidad fí- sica es más crítica, por cuanto solamente un 23,53% de las garantías indican el tamaño del gránulo. Dado que el estudio de mercado arrojó que de las 17 garantías solamente se comercializan cinco se concluyó que comparar los alimentos por los precios unitarios de los nutrientes no coadyuva tampoco en la escogencia del alimento de manera importante.

  16. Protección Sanitaria de los alimentos en Círculos Infantiles.

    Directory of Open Access Journals (Sweden)

    Yariela Sánchez Azahares

    2005-01-01

    Full Text Available La Educación Sanitaria es fundamental para prevenir las Enfermedades transmitidas por los alimentos al despertar en la conciencia de los manipuladores la modificación de sus hábitos. Se realizó un estudio descriptivo transversal para comparar el nivel de conocimientos adquiridos en 64 manipuladores pertenecientes a 30 Círculos Infantiles de Ciudad de la Habana, de los municipios Playa, Plaza, Centro Habana, y Habana Vieja antes y después de realizar una intervención educativa mediante una encuesta de conocimientos durante los meses de noviembre del año 2003 a febrero del 2004. Los datos obtenidos se procesaron a través del sistema estadístico Epinfo 6. La mayoría de los manipuladores llevan trabajando mas de 5 años en el sector, su nivel de escolaridad fue entre 6to y 9no grado y no habían recibido cursos de Educación Sanitaria a pesar de manifestar gran interés por los mismos. Antes de la intervención se encontró que existían pocos conocimientos en relación con el lavado correcto de las manos, el tiempo entre la elaboración y el consumo, la importancia de la desinfección de frutas, vegetales y huevos, la temperatura de cocción y conservación de los alimentos, los factores relacionados con la contaminación de los alimentos, nivel de conocimiento sobre los alimentos de alto riesgo y las causas de las enfermedades transmitidas por los alimentos. Se observó que el 82% de los manipuladores mejoraron los conocimientos básicos después de la intervención educativa. Concluimos que la intervención educativa produjo evidentes cambios en los conocimientos de los manipuladores sobre las temáticas de higiene de los alimentos por lo que recomendamos confeccionar una Guía Didáctica que brinde los conocimientos necesarios a todos los manipuladores de los Círculos Infantiles del país.

  17. Probing the phenomenon of trained immunity in invertebrates during a transgenerational study, using brine shrimp Artemia as a model system.

    Science.gov (United States)

    Norouzitallab, Parisa; Baruah, Kartik; Biswas, Priyanka; Vanrompay, Daisy; Bossier, Peter

    2016-02-15

    The invertebrate's innate immune system was reported to show some form of adaptive features, termed trained immunity. However, the memory characteristics of innate immune system and the mechanisms behind such phenomena remain unclear. Using the invertebrate model Artemia, we verified the possibility or impossibility of trained immunity, examining the presence or absence of enduring memory against homologous and heterologous antigens (Vibrio spp.) during a transgenerational study. We also determined the mechanisms behind such phenomenon. Our results showed the occurrence of memory and partial discrimination in Artemia's immune system, as manifested by increased resistance, for three successive generations, of the progenies of Vibrio-exposed ancestors towards a homologous bacterial strain, rather than to a heterologous strain. This increased resistance phenotype was associated with elevated levels of hsp70 and hmgb1 signaling molecules and alteration in the expression of key innate immunity-related genes. Our results also showed stochastic pattern in the acetylation and methylation levels of H4 and H3K4me3 histones, respectively, in the progenies whose ancestors were challenged. Overall results suggest that innate immune responses in invertebrates have the capacity to be trained, and epigenetic reprogramming of (selected) innate immune effectors is likely to have central place in the mechanisms leading to trained immunity.

  18. A note on the biogeographical origin of the brine shrimp Artemia urmiana Günther, 1899 from Urmia Lake, Iran.

    Science.gov (United States)

    Eimanifar, Amin; Asem, Alireza; Djamali, Morteza; Wink, Michael

    2016-03-30

    The brine shrimp Artemia urmiana, an abundant inhabitant of the hypersaline Urmia Lake in northwestern Iran, has recently been described from Lake Koyashskoe, also a shallow hypersaline lake that is located on the Black Sea coast of the Crimean Peninsula (Ukraine). This discovery has questioned the endemicity of A. urmiana in Urmia Lake and has also brought into question the biogeographical origin of this species. In the present study, we combined recent genetic divergence data (mtDNA-COI) with palaeoecological evidence to address the biogeographical origin of A. urmiana. Calibration of the molecular clock of the COI region was set by assigning the age of the micro-crustacean Daphnia pulex minimally at 145 Mya. The divergence age of A. urmiana in Urmia Lake dates back to 383,000 years, whereas Ukrainian Artemia reflects a very young populations that diverged about 196,000 years ago. Palaeoecological evidence suggests that the age of the major habitat of A. urmiana i.e. Urmia Lake goes back to the Tertiary Period while the Ukranian habitats of the species are very young, by virtue of geological features of the Holocene age. We conclude that the biogeographical origin of A. urmiana is outside of Europe and the current state of knowledge strongly suggests that Urmia Lake has been the major source of its expansion into its modern habitats in Europe.

  19. Identification, expression pattern and functional characterization of As-kip2 in diapause embryo restarting process of Artemia sinica.

    Science.gov (United States)

    Zhang, Mengchen; Yao, Feng; Qin, Tong; Hou, Lin; Zou, Xiangyang

    2017-04-15

    Proper control of the cellular processes requires a variety of regulatory proteins that are involved in the cell cycle, proliferation and apoptosis. Cyclin-dependent kinase inhibitor (CKI) negatively regulates transcription and arrests the cell cycle in G1 phase. KIP2 is a member of CKI family, which could inhibit proliferation by tight-binding with several cyclin-CDK complexes. During the embryonic development of the brine shrimp, Artemia sinica, KIP2 plays a key role in the cell cycle regulation, but the specific mechanisms remain unknown. Herein, the 1023bp full-length cDNA of kip2 from A. sinica was cloned. The mRNA expression patterns of As-kip2, As-carp-1 in different development stages and pattern of As-kip2 under environmental stresses were investigated. In situ hybridization of As-kip2 mRNA and immunofluorescence of As-CARP-1 protein showed no tissue or organ specificity. Furthermore, western blotting showed the expressions levels of As-KIP2, As-E2F1, As-p53, As-cyclin E, As-SODD protein, and pattern of As-KIP2 under environmental stresses. Our research revealed that As-KIP2 plays crucial role in the restarting process of diapause embryo in Artemia sinica.

  20. Multi-response optimization of Artemia hatching process using split-split-plot design based response surface methodology

    Science.gov (United States)

    Arun, V. V.; Saharan, Neelam; Ramasubramanian, V.; Babitha Rani, A. M.; Salin, K. R.; Sontakke, Ravindra; Haridas, Harsha; Pazhayamadom, Deepak George

    2017-01-01

    A novel method, BBD-SSPD is proposed by the combination of Box-Behnken Design (BBD) and Split-Split Plot Design (SSPD) which would ensure minimum number of experimental runs, leading to economical utilization in multi- factorial experiments. The brine shrimp Artemia was tested to study the combined effects of photoperiod, temperature and salinity, each with three levels, on the hatching percentage and hatching time of their cysts. The BBD was employed to select 13 treatment combinations out of the 27 possible combinations that were grouped in an SSPD arrangement. Multiple responses were optimized simultaneously using Derringer’s desirability function. Photoperiod and temperature as well as temperature-salinity interaction were found to significantly affect the hatching percentage of Artemia, while the hatching time was significantly influenced by photoperiod and temperature, and their interaction. The optimum conditions were 23 h photoperiod, 29 °C temperature and 28 ppt salinity resulting in 96.8% hatching in 18.94 h. In order to verify the results obtained from BBD-SSPD experiment, the experiment was repeated preserving the same set up. Results of verification experiment were found to be similar to experiment originally conducted. It is expected that this method would be suitable to optimize the hatching process of animal eggs. PMID:28091611

  1. Multi-response optimization of Artemia hatching process using split-split-plot design based response surface methodology

    Science.gov (United States)

    Arun, V. V.; Saharan, Neelam; Ramasubramanian, V.; Babitha Rani, A. M.; Salin, K. R.; Sontakke, Ravindra; Haridas, Harsha; Pazhayamadom, Deepak George

    2017-01-01

    A novel method, BBD-SSPD is proposed by the combination of Box-Behnken Design (BBD) and Split-Split Plot Design (SSPD) which would ensure minimum number of experimental runs, leading to economical utilization in multi- factorial experiments. The brine shrimp Artemia was tested to study the combined effects of photoperiod, temperature and salinity, each with three levels, on the hatching percentage and hatching time of their cysts. The BBD was employed to select 13 treatment combinations out of the 27 possible combinations that were grouped in an SSPD arrangement. Multiple responses were optimized simultaneously using Derringer’s desirability function. Photoperiod and temperature as well as temperature-salinity interaction were found to significantly affect the hatching percentage of Artemia, while the hatching time was significantly influenced by photoperiod and temperature, and their interaction. The optimum conditions were 23 h photoperiod, 29 °C temperature and 28 ppt salinity resulting in 96.8% hatching in 18.94 h. In order to verify the results obtained from BBD-SSPD experiment, the experiment was repeated preserving the same set up. Results of verification experiment were found to be similar to experiment originally conducted. It is expected that this method would be suitable to optimize the hatching process of animal eggs.

  2. Characterization of a group 1 late embryogenesis abundant protein in encysted embryos of the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Sharon, Michelle A; Kozarova, Anna; Clegg, James S; Vacratsis, Panayiotis O; Warner, Alden H

    2009-04-01

    Late embryogenesis abundant (LEA) proteins are hydrophilic molecules that are believed to function in desiccation and low-temperature tolerance in some plants and plant propagules, certain prokaryotes, and several animal species. The brine shrimp Artemia franciscana can produce encysted embryos (cysts) that enter diapause and are resistant to severe desiccation. This ability is based on biochemical adaptations, one of which appears to be the accumulation of the LEA protein that is the focus of this study. The studies described herein characterize a 21 kDa protein in encysted Artemia embryos as a group 1 LEA protein. The amino acid sequence of this protein and its gene have been determined and entered into the NCBI database (no. EF656614). The LEA protein consists of 182 amino acids and it is extremely hydrophilic, with glycine (23%), glutamine (17%), and glutamic acid (12.6%) being the most abundant amino acids. This protein also consists of 8 tandem repeats of a 20 amino acid sequence, which is characteristic of group 1 LEA proteins from non-animal species. The LEA protein and its gene are expressed only in encysted embryos and not in larvae or adults. Evidence is presented to show that the LEA protein functions in the prevention of drying-induced protein aggregation, which supports its functional role in desiccation tolerance. This report describes, for the first time, the purification and characterization of a group 1 LEA protein from an animal species.

  3. Effect of municipal waste water effluent upon the expression of Glutathione S-transferase isoenzymes of brine shrimp Artemia.

    Science.gov (United States)

    Grammou, Athina; Papadimitriou, Chrisa; Samaras, Peter; Vasara, Eleni; Papadopoulos, Athanasios I

    2011-06-01

    Multiple isoenzymes of the detoxification enzyme family Glutathione S-transferase are expressed in the brine shrimp Artemia. The number of the major ones detected in crude extract by means of chromatofocusing varied between three and four, depending on the age. Two isoenzymes, one alkaline and one neutral (with corresponding isoelectric points of 8.5 and 7.2) appear to be dominant in all three developmental stages studied, (24, 48, and 72 h after hatching). Culturing Artemia for 48 h after hatching, in artificial sea water prepared by municipal wastewater effluent resulted to significant alterations of the isoenzyme profile. In comparison to organisms cultured for the same period of time in artificial sea water prepared by filtered tap water, the expression of the alkaline isoenzyme decreased by 62% while that of the neutral isoenzyme increased by 58%. Furthermore, the enzyme activity of the major isoenzyme of the acidic area increased by more than two folds. It is worth mentioning that although the specific activity of the total enzyme in the whole body homogenate was elevated, no statistically significant alteration of the Km value was observed. These findings suggest that study of the isoenzyme profile of Glutathione S-transferase may offer high sensitivity in detecting environmental pollution and needs to be further investigated.

  4. Molecular cloning and its expression of trachealess gene (As-trh) during development in brine shrimp, Artemia sinica.

    Science.gov (United States)

    Wang, Jia-Qing; Hou, Lin; Yi, Nan; Zhang, Riu-Feng; Zou, Xiang-Yang; Xiao, Qin; Guo, Ran

    2012-02-01

    Basic helix-loop-helix-PAS (bHLH-PAS) family transcription factors are implicated in multiple developmental and physiological regulatory processes. Herein, a full-length cDNA encoding a bHLH-PAS domain transcription factor trachealess gene (designated as As-trh) was cloned and characterized from brine shrimp (Artemia sinica) for the first time. The full-length cDNA of As-trh was 2,698 bp with a 2,319 bp open reading frame encoding a deduced protein of 772 amino acid polypeptide with a calculated molecular mass of 86.02 kDa and an isoelectric point of 5.87. Sequence alignment revealed that As-trh had high homology with other species trh gene, including the D-trh gene in Drosophila melanogaster and Bm-trh in Bombyx mori. The early and persistent expression of As-trh in the naupliar stages by whole-mount embryonic in situ hybridization and immunohistochemistry suggest that As-trh functions very early in the salt gland and may be required continuously in this tissue. Later in development, expression of As-trh begins to decrease and disappear in salt gland of the older nauplius and appears in the thoracic epipods of the sub-adult Artemia. These results indicated that As-trh might play an important role in osmoregulatiory organ development from the larvae stages through adult stages.

  5. Incidencia de los atributos de calidad en las percepciones y elecciones de los consumidores de alimentos orgánicos

    OpenAIRE

    Rodríguez, Elsa Mirta M.; Lupín, Beatriz; Lacaze, María Victoria

    2006-01-01

    Este trabajo plantea como objetivo identificar potenciales consumidores de alimentos orgánicos a partir de sus percepciones de riesgos, y evaluar la incidencia de los atributos de calidad de estos productos en las decisiones de consumo.

  6. A first AFLP-based genetic linkage map for brine shrimp Artemia franciscana and its application in mapping the sex locus.

    Science.gov (United States)

    De Vos, Stephanie; Bossier, Peter; Van Stappen, Gilbert; Vercauteren, Ilse; Sorgeloos, Patrick; Vuylsteke, Marnik

    2013-01-01

    We report on the construction of sex-specific linkage maps, the identification of sex-linked markers and the genome size estimation for the brine shrimp Artemia franciscana. Overall, from the analysis of 433 AFLP markers segregating in a 112 full-sib family we identified 21 male and 22 female linkage groups (2n = 42), covering 1,041 and 1,313 cM respectively. Fifteen putatively homologous linkage groups, including the sex linkage groups, were identified between the female and male linkage map. Eight sex-linked AFLP marker alleles were inherited from the female parent, supporting the hypothesis of a WZ-ZZ sex-determining system. The haploid Artemia genome size was estimated to 0.93 Gb by flow cytometry. The produced Artemia linkage maps provide the basis for further fine mapping and exploring of the sex-determining region and are a possible marker resource for mapping genomic loci underlying phenotypic differences among Artemia species.

  7. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine) : The use of Brine Shrimp Artemia salina in a variably saline lagoon complex

    NARCIS (Netherlands)

    Verkuil, Y.I.; Van der Have, TM; Van der Winden, J; Chernichko, [No Value

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  8. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine): the use of brine shrimp Artemia salina in a variably saline lagoon complex.

    NARCIS (Netherlands)

    Verkuil, Y.; Have, van der T.M.; Winden, van der J.; Chernichko, I.I.

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  9. Cestode parasitism in invasive and native brine shrimps (Artemia spp.) as a possible factor promoting the rapid invasion of A. franciscana in the Mediterranean region.

    Science.gov (United States)

    Georgiev, B B; Sánchez, M I; Vasileva, G P; Nikolov, P N; Green, A J

    2007-11-01

    Artemia franciscana is an invasive crustacean expanding its range in hypersaline wetlands in the Mediterranean region and replacing native Artemia parthenogenetica and Artemia salina. Native brine shrimps are known as intermediate hosts of cestodes; infected individuals exhibit changes in their behaviour and appearance, thus facilitating the parasite transmission to the avian hosts by predation. To assess whether invasive brine shrimps participate in the cestode life cycles to the same extent as the native species, we examined the natural infections in seven populations of Artemia spp. along the southern coast of Spain and Portugal: three populations of each A. franciscana and A. parthenogenetica and one population of A. salina. Ten cestode species were found in A. parthenogenetica, while only six were recorded in each of A. salina and A. franciscana. The overall infection was consistently higher in native than in invasive populations. For a particular cestode species, the prevalence or abundance was significantly higher in a native population for 54 pairwise comparisons and only higher for an invasive population for 4 pairwise comparisons. These results suggest that cestodes may influence competitive interactions between native and invasive brine shrimps, thus partly explaining the invasive success of A. franciscana.

  10. Preparation of chitosan from brine shrimp (Artemia urmiana) cyst shells and effects of different chemical processing sequences on the physicochemical and functional properties of the product.

    Science.gov (United States)

    Tajik, Hossein; Moradi, Mehran; Rohani, Seyed Mehdi Razavi; Erfani, Amir Mehdi; Jalali, Farnood Shokouhi Sabet

    2008-06-06

    Chitosan (CS) was prepared from Artemia urmiana cyst shells using the same chemical process as described for the other crustacean species, with minor adjustments in the treatment conditions. The influence of modifications of the CS production process on the physiochemical and functional properties of the CS obtained was examined. The study results indicate that Artemia urmiana cyst shells are a rich source of chitin as 29.3-34.5% of the shell's dry weight consisted of this material. Compared to crab CS (selected as an example of CS from a different crustacean source) Artemia CS exhibited a medium molecular weight (4.5-5.7 x10(5) Da), lower degree of deacetylation (67-74%) and lower viscosity (29-91 centiposes). The physicochemical characteristics (e.g., ash, nitrogen and molecular weight) and functional properties (e.g., water binding capacity and antibacterial activity) of the prepared Artemia CSs were enhanced, compared to control and commercial samples, by varying the processing step sequence.

  11. Inbred strains of brine shrimp derived from Artemia franciscana: lineage, RAPD analysis, life span, reproductive traits and mode, adaptation, and tolerance to salinity changes.

    Science.gov (United States)

    Nambu, Fumiko; Tanaka, Shin; Nambu, Ziro

    2007-02-01

    Inbred strains of the brine shrimp were developed from dry dormant cysts of wild-type Artemia franciscana produced in the Great Salt Lake, U.S.A. The established strains were named GSL2, 4, and 7. They were raised in 2% natural sea salt solution at 28 degrees C under a long-day condition, and fed on food sold for Artemia. Ovoviviparous offspring (free-swimming nauplii) in each brood derived from full sib (sister x brother) matings were used for succeeding generations. The ordinal number of the filial generation increased at a rate of ten generations per year. The number was over 60, and the lineage was recorded. Random amplified polymorphic DNA (RAPD) analyses of the inbred strains revealed the uniqueness, homogeneity, and genetic similarity among them. Their life span, the time required to become sexually mature, brood size, mode of reproduction, and adaptation and tolerance to salinity changes were investigated. The inbred strains usually released free-swimming nauplii rather than spawning encysted gastrulae (dormant cysts). On the other hand, the opposite results were obtained from wild-type Artemia under the same conditions. Both adults and nauplii of the inbred strains appeared to be less adaptive and less tolerant to salinity changes compared to those of the wild type. The established inbred strains should provide a wider and deeper scope for Artemia biology in particular, and the life sciences in general.

  12. Preparation of Chitosan from Brine Shrimp (Artemia urmiana Cyst Shells and Effects of Different Chemical Processing Sequences on the Physicochemical and Functional Properties of the Product

    Directory of Open Access Journals (Sweden)

    Farnood Shokouhi Sabet Jalali

    2008-06-01

    Full Text Available Chitosan (CS was prepared from Artemia urmiana cyst shells using the same chemical process as described for the other crustacean species, with minor adjustments in the treatment conditions. The influence of modifications of the CS production process on the physiochemical and functional properties of the CS obtained was examined. The study results indicate that Artemia urmiana cyst shells are a rich source of chitin as 29.3-34.5% of the shell’s dry weight consisted of this material. Compared to crab CS (selected as an example of CS from a different crustacean source Artemia CS exhibited a medium molecular weight (4.5-5.7 ×105 Da, lower degree of deacetylation (67-74% and lower viscosity (29-91 centiposes. The physicochemical characteristics (e.g., ash, nitrogen and molecular weight and functional properties (e.g., water binding capacity and antibacterial activity of the prepared Artemia CSs were enhanced, compared to control and commercial samples, by varying the processing step sequence.

  13. Esterilização de alimentos por microondas para pacientes receptores de transplante de medula

    Directory of Open Access Journals (Sweden)

    Luciola de Sales Seabra Matos

    1990-12-01

    Full Text Available Receptores de transplante de medula apresentam inúmeros problemas gastrointestinais que interferem com uma adequada ingestão oral. Estudos prévios mostram que o ambiente com fluxo laminar, dieta estéril, descontaminação oral com antibióticos e limpeza da pele são fatores significantes na prevenção da infecção. A literatura recomenda a esterilização dos alimentos por autoclagem, irradiação ou forno. Nesse trabalho propõe-se a esterilização por microondas, por ser um processo rápido, seguro e não alterar o aspecto e sabor dos alimentos.

  14. REDUÇÃO DO DESPERDÍCIO DE ALIMENTOS EM UM RESTAURANTE POPULAR

    OpenAIRE

    Parisoto, Debora Fabiano; Hautrive,Tiffany Prokopp; Cembranel, Fernando Macedo

    2013-01-01

    Objetivou-se analisar e reduzir o desperdício de alimentos em um Restaurante Popular localizado no Estado de Santa Catarina. Realizou-se durante três dias consecutivos, antes e após medidas de intervenções, o índice de resto-ingesta. Foram pesados os restos de alimentos que sobraram nos pratos dos comensais, sendo todos os materiais não comestíveis descartados. As medidas de intervenção realizadas na unidade foram: elaboração de Fichas Técnicas de Preparação (FTP), Educação Nutricional com o...

  15. Estudo piloto sobre alimentos que devem ser evitados nos portadores de psoríase

    OpenAIRE

    FESTUGATO,Moira

    2011-01-01

    FUNDAMENTOS: Psoríase é uma doença inflamatória crônica, sistêmica, mediada por fatores imunológicos. Serão abordados os alimentos que atuam sobre estes fatores, contribuindo para a psoríase. Como doença sistêmica, que compartilha o mesmo substrato fisiopatológico com outras comorbidades, a dieta alimentar também leva à piora das comorbidades. OBJETIVO: Destacar um grupo de alimentos que pode atuar como um fator de manifestação e/ou agravo da psoríase e ao mesmo tempo viabilizar estratégias i...

  16. Crecimiento restringido por la balanza de pagos en países exportadores de alimentos

    Directory of Open Access Journals (Sweden)

    Pablo Ignacio Chena

    2008-01-01

    Full Text Available El presente trabajo analiza las posibilidades de los países exportadores de alimentos en América Latina de evitar la restricción externa y crecer de forma sostenida con las nuevas tendencias en los precios mundiales de los commodities agropecuarios. En este nuevo escenario, el artículo destaca la importancia de la elasticidad ingreso de la demanda interna de alimentos como freno a un modelo de crecimiento impulsado por las exportaciones de bienes de primera necesidad. Todo ello en un contexto en el cual la heterogeneidad estructural propia de las economías latinoamericanas disminuye la efectividad de los cambios en los precios relativos como instrumento para sortear la restricción externa en el largo plazo.

  17. Utensílios para alimentos e implicações nutricionais

    Directory of Open Access Journals (Sweden)

    QUINTAES Késia Diego

    2000-01-01

    Full Text Available Há grande variedade de materiais empregados na confecção de utensílios para os alimentos: barro, ferro, vidro, cerâmica, inox, pedra, alumínio e outros. Cerca de 43% de panelas vendidas atualmente nos Estados Unidos são de aço inoxidável. Outra parcela da população utiliza utensílios de alumínio. Este artigo visa especular a contribuição nutricional de utensílios usados na preparação de alimentos e feitos de três diferentes materiais (alumínio, ferro e aço inoxidável, através de revisão de literatura científica.

  18. Debate en torno a la comercialización de los alimentos transgénicos

    Directory of Open Access Journals (Sweden)

    Ramón, Daniel

    2001-01-01

    Full Text Available Not available

    La aplicación de la genética a la alimentación es tan antigua como la agricultura o la ganadería. Desde que el hombre comenzó a cultivar vegetales o domesticar animales viene llevando a cabo un proceso de mejora genética valiéndose sobre todo de la técnica del cruce sexual. Por ello podemos afirmar que ninguno de los alimentos que consumimos en nuestra dieta es, desde el punto de vista genético, igual al que comían nuestros abuelos. Los últimos años han dado lugar a la aplicación de t��cnicas genéticas novedosas como la ingeniería genética a la tecnología de alimentos. La consecuencia ha sido la aparición de los denominados alimentos transgénicos. La comercialización de estos nuevos alimentos ha generado una gran polémica en los países miembros de la Unión Europea. Sus posibles riesgos sanitarios, medioambientales o económicos son tema constante de debate, en la mayoría de los casos con grandes dosis de apasionamiento y pocas de racionalidad. En este trabajo se pretende llevar a cabo una revisión sobre dicha situación. La aplicación de la genética a la alimentación es tan antigua como la agricultura o la ganadería. Desde que el hombre comenzó a cultivar vegetales o domesticar animales viene llevando a cabo un proceso de mejora genética valiéndose sobre todo de la técnica del cruce sexual. Por ello podemos afirmar que ninguno de los alimentos que consumimos en nuestra dieta es, desde el punto de vista genético, igual al que comían nuestros abuelos. Los últimos años han dado lugar a la aplicación de técnicas genéticas novedosas como la ingeniería genética a la tecnología de alimentos. La consecuencia ha sido la aparición de los denominados alimentos transgénicos. La comercialización de estos nuevos alimentos ha generado una gran polémica en los países miembros de la Unión Europea. Sus posibles riesgos sanitarios, medioambientales o económicos son tema constante de debate

  19. Alimentos Funcionales: Problemática y relación con la infancia

    OpenAIRE

    Sánchez Trigueros, Ada

    2016-01-01

    Actualmente la nutrición está enmarcada en la relación entre alimentación y salud, como objetivo principal de la prevención de las enfermedades. La dieta y el estilo de vida desempeñan roles importantes, pues suponen un desarrollo armónico del ser humano, para incrementar su calidad de vida. El interés por los Alimentos Funcionales se ha visto incrementado en un corto periodo de tiempo entre la población de los países desarrollados, de forma que este tipo de alimentos están cada vez más prese...

  20. Organismos geneticamente modificados (OGMs): alimentos, teorias e tendências no mundo

    OpenAIRE

    Carmo, Aurélio Hipólito do

    2006-01-01

    Esta tese diz respeito aos alimentos transgênicos; dentre eles foi dado maior ênfase à soja transgênica, pois o Brasil é o segundo país do mundo nessa área de alimento, só sendo sobrepujado pelos Estados Unidos. Muitas pesquisas foram feitas, sobre tal assunto, a fim de aquilatar, em todos os países do Globo, o grau de concepção desse produto. De fato, a resposta foi obtida com certa rapidez; não há no mundo um só país, cuja população sinta-se segura com a imposição feita pelas multinacionais...

  1. Artemia nauplii enrichment with poly-β-hydroxybutyrate%聚β-羟基丁酸酯对卤虫幼体的强化作用

    Institute of Scientific and Technical Information of China (English)

    孙慧贤; 隋丽英

    2011-01-01

    Effect of poly-β-hydroxybutyrate (PHB) on survival and growth of Artemia was investigated.Various levels of PHB concentration (0, 50, 100, 150,200,400 and 800 mg/L, respectively) and different enrichment periods (24 h, 48 h and 72 h, respectively) were applied during Artemia enrichment in two separate trials.PHB suspension was prepared with ultrasonieator to make the particle size smaller (ranging from 10 to 50 μm) and fed to the newly-hatched Artemia nauplii according to the designed concentration.The initial density of Artemia nauplii was 100 ind/200 mL.The results showed that survival of Artemia enriched with 100 mg/L PHB for 24 h was significantly higher than that of other treatments, which was reduced remarkably when Artemia were enriched with other PHB concentrations and longer periods (48 h and 72 h)(P <0.05 ).And the 72 h-growth of Artemia enriched with 100 mg/L PHB was also significantly higher than that of other groups ( P < 0.05 ).The result of quantitative determination indicated that, within 24 h enrichment, PHB content in Artemia increased along with enrichment time and reached the highest at 24 h,accounting for 10.73% of Artemia dry weight.In conclusion, we proposed that PHB can be applied efficiently in larviculture through Artemia enrichment at a level of 100 mg/L PHB for 24 h.%通过投喂实验,探讨了不同浓度聚β-羟基丁酸酯PHB(0,50,100,150,200,400和800 mg/L)和不同强化培养时间(24h,48 h和72 h)对卤虫生长和存活的影响.实验采用超声波处理方法将不溶于水的PHB粉末分散成颗粒较小的均匀悬浮液(直径为10~50 μm),并按上述浓度投喂初孵卤虫.卤虫无节幼体初始密度为100个/200mL.结果表明,当PHB浓度为100 mg/L时,卤虫成活率显著高于其它组,且成活率随PHB浓度的增加而明显降低,24 h卤虫成活率明显高于48 h和72 h(P<0.05),同时72 h卤虫的体长也显著高于其它实验组(P<0.05).定量测定结果表明,24 h内卤虫体内PHB

  2. Estudio de la migración de melamina en materiales destinados al contacto con alimentos.

    OpenAIRE

    García Ibarra, Verónica Alejandra

    2012-01-01

    Las resinas de melamina son polímeros que constan de sustancias de partida (monómeros) de melamina y formaldehido, ampliamente utilizadas en todo el mundo para la producción de utensilios de cocina, debido a su durabilidad, resistencia y bajo costo. Estos artículos pueden liberar melamina especialmente cuando entran en contacto con los alimentos a altas temperaturas.

  3. Fatores de influência no comportamento de compra de alimentos por crianças

    Directory of Open Access Journals (Sweden)

    Alipio Ramos Veiga Neto

    2013-06-01

    Full Text Available A escolha alimentar nas sociedades contemporâneas passa, inevitavelmente, pelo comércio, pois o alimento constitui-se mercadoria que é consumida, assim como tantos outros bens e serviços. Atualmente muitas crianças já definem sozinhas suas escolhas alimentares, provocando a atenção tanto de empresas como de organizações preocupadas com sua nutrição. Utilizando o modelo BPM (Behavioral Perpective Model, criado por Foxall (2010, fundamentado na psicologia do consumidor e estruturado na tríplice contingência de Skinner, analisaram-se os fatores que influenciam crianças em seu comportamento de compra de alimentos. Tendo como sujeitos 175 alunos com idades compreendidas entre 10 e 12 anos, identificaram-se 35 variáveis que foram classificadas entre estímulos antecedentes (cenário ou histórico de aprendizado e consequentes (reforço utilitário ou informativo no comportamento de compra. Verificou-se que os estímulos reforçadores (consequentes têm maior grau de importância para a decisão de compra de alimentos desses sujeitos do que os estímulos antecedentes, sendo que as consequências utilitárias são mais influentes do que as informativas. Conclui-se que os atributos dos produtos, como sabor e qualidade, têm maior influência na decisão de compra do que os estímulos ambientais, como as promoções e publicidade dos alimentos.

  4. Sistemas de almacenamiento y conservación de alimentos en tierras valencianas

    OpenAIRE

    Abad Casal, Lorenzo; Sala Sellés, Feliciana

    2009-01-01

    Se presenta el estado de la investigación sobre los sistemas de almacenamiento y conservación de alimentos descubiertos hasta la fecha en los poblados ibéricos de Castellón, Valencia y Alicante. Se describe asimismo el registro arqueológico relacionado con dichas actividades. Proyecto de investigación HUM2006-09874 del Ministerio de Educación y Ciencia, Programa Nacional de Investigación 2004-2007.

  5. Utilização do azeite na fritura de alimentos

    OpenAIRE

    Carapinha, Pedro Gomes

    2012-01-01

    Mestrado em Engenharia Alimentar - Processamento de Alimentos - Instituto Superior de Agronomia Olive oil has been widely used in the cuisine of the Mediterranean basin, due to its organoleptic properties and also to its oxidative thermostability.ascribed to the richness in monounsaturated fatty acids and high concentration of natural antioxidants. Two heating trials were performed to.evaluate the thermostability of two olive oils with the name: “extra virgin olive oil” and “olive oil” ...

  6. Aporte de vitaminas y minerales por grupo de alimentos en estudiantes universitarios chilenos

    Directory of Open Access Journals (Sweden)

    Samuel Durán Agüero

    2013-06-01

    Full Text Available Introducción: La etapa universitaria es un proceso en el cual las personas pasan por periodos prolongados de inactividad física y horarios irregulares de comidas, lo que conlleva al incremento en el consumo de alimentos procesados y de comida rápida. Objetivo: Fue determinar el aporte vitaminas y minerales por grupo de alimentos en la alimentación de estudiantes universitarios. Métodos: Se trabajó con una muestra de 654 estudiantes universitarios chilenos (18-24 años, 54% mujeres, a quienes se les aplicó un cuestionario de frecuencia semanal de consumo de alimentos, la información recolectada se clasificó en 12 grupos representativos de cada conjunto de alimentos y se determinó la ingesta de vitaminas y minerales. Resultados: Los principales resultados fueron: (a las mujeres presentaron menor ingesta de la mayoría de micronutrientes que los hombres; (b el ácido pantotenico, la vitamina B12 y E, el calcio, magnesio y el hierro son los nutrientes que presentaron ingestas promedio inferiores a las recomendaciones diarias; (c el consumo de pan es fundamental para el aporte de vitaminas del complejo B, hierro, cobre y selenio. Conclusión: En la dieta habitual de los estudiantes universitarios chilenos, el pan constituye un elemento fundamental para el aporte dietario de vitaminas del complejo B, hierro, cobre y selenio; así como los lácteos para el calcio; las carnes y pescado para la vitamina B12 y el zinc; las verduras para la vitamina A y las frutas para la vitamina C.

  7. COMPETENCIAS CULINARIAS Y CONSUMO DE ALIMENTOS PROCESADOS O PREPARADOS EN ESTUDIANTES UNIVERSITARIOS DE BARCELONA

    Directory of Open Access Journals (Sweden)

    Pedro Sainz García

    2016-01-01

    Full Text Available Fundamentos: Las competencias culinarias pueden tener relevancia en la salud. El objetivo del estudio fue conocer el estado de las competencias culinarias y el consumo de alimentos procesados o preparados en estudiantes universitarios en Barcelona así como su asociación con variables sociodemográficas y la confianza en algunas competencias culinarias y el saber cocinar. Métodos: Diseño transversal, durante el curso 2014-2015, con 525 estudiantes (81,3% mujeres, edad mediana 21 años, mediante un cuestionario en línea. Se realizaron análisis bivariados y multivariados con modelos de regresión logística. Como medida de asociación se estimó la odds ratio y su intervalo de confianza del 95%. Resultados: Entre el 53% y el 89% de los estudiantes declararon sentirse muy confiados en 10 de las 18 competencias culinarias estudiadas. No se observaron diferencias estadísticamente significativas por sexo y entre el 62% y el 86% de las personas mayores de 21 años expresaron mucha confianza en 9 competencias. La prevalencia del consumo de alimentos procesados o preparados fue del 49,4% y se asoció a la edad (OR=0,95 IC95%: 0,91-0,99, al sexo (hombre, OR=1,98 IC95%: 1,23-3,18 y a no saber cocinar (OR=2,25 IC95%: 1,10-4,60. Entre quienes sabían cocinar este consumo se asoció al sexo (hombre, OR=1,67 IC95%: 1,00-2,77 y a no tener confianza en preparar más de un alimento al mismo tiempo (OR=1,73 IC95%: 1,58-2,60. Conclusiones: Los estudiantes universitarios de Barcelona tienen competencias culinarias mejorables y consumen alimentos procesados o preparados habitualmente.

  8. TRATAMIENTO DE DATOS POR MEDIO DE LA COMPUTADORA, PARA LA PREPARACIÓN DE ALIMENTOS CONCENTRADOS.

    Directory of Open Access Journals (Sweden)

    Pizza Jorge

    2010-09-01

    Full Text Available La explotación industrial de animales para el consumo humano exige estudios de formulación analítica de los alimentos concentrados, especialmente en lo que concierne al requerimiento calórico del animal y a su peso metabólico. En toda formulación para alimentos concentrados, la estandarización de una fórmula cualquiera exige cálculos muy largos, basados únicamente en el método de ensayo y error, debido a que en cada tanteo es necesario efectuar un alto número de permutaciones de los porcentajes de la composición de las materias primas que intervienen en la constitución del concentrado. El presente trabajo constituye el primer intento realizado en este campo, mediante el uso racional de la computadora. Hemos elaborado un programa de cálculo CALICON en FORTRAN IV, el cual suministra la fórmula de un alimento concentrado dependiendo de la clase de animal que va a ser alimentado. Además, dentro de una misma formulación, el programa elabora simultáneamente una serie de fórmulas, las cuales suministran la misma energía metabolizable y que proporcionan una composición alimenticia semejante, todas dentro de los límites permisibles que el usuario podrá elegir, dependiendo de sus propios criterios y necesidades industriales.

  9. Alimentos Balanceados Para Animales A Partir De Residuos Orgánicos

    Directory of Open Access Journals (Sweden)

    Amelia Vidales Olivo

    2004-01-01

    Full Text Available En esta investigación se encontró un proceso idóneo para la elaboración de alimentos balanceados para animales domésticos y mascotas; cuyo contenido nutricional cumplió con las expectativas de los parámetros establecidos y regidos por la norma 499 de NRC (Comité sobre Nutrición Animal de la Academia Nacional de Ciencia de Estados Unidos – National Research Council, tomando en cuenta primordialmente que el proceso empleado no generara contaminación para el medio ambiente; sino todo lo contrario este alimento utilizó como materia prima los residuos orgánicos (esqueleto de pescado, cascarón de huevo, olote, tortilla, para balancear los constituyentes del producto elaborado. El proyecto de investigación fue realizado en el segundo semestre del 2000 al primer semestre del 2003, tiempo suficiente para probar la eficiencia del alimento elaborado para (pollos; observando el desarrollo de los animales y registrando cada día los cambios en peso presentados en ellos. También se comprobó la hipótesis del trabajo aportando resultados (ver tabla 4, beneficios y conclusiones

  10. Representaciones sociales de los alimentos orgánicos entre consumidores de Chiapas

    Directory of Open Access Journals (Sweden)

    Cynthia Gutiérrez Pérez

    2012-01-01

    Full Text Available Ante un modelo intensivo en el uso de agroquímicos y sus consecuencias en la salud y en el medio ambiente, los alimentos orgánicos emergen como una opción de producción sustentable y saludable para los consumidores. Este artículo expone los resultados de un estudio sobre los factores generales que organizan la representación social de los alimentos frescos orgánicos en tres grupos de consumidores en San Cristóbal de Las Casas, Chiapas. El estudio se realizó con dispositivos cuantitativos y cualitativos con 250 consumidores en tres espacios de venta. Los resultados muestran similitudes y diferencias según grupo social estudiado. Los tres casos comparten preocupaciones por la salud las cuales se enmarcan en diversos factores de riesgo. Las diferencias se muestran en cuanto a sus posicionamientos políticos e ideológicos así como por su oportunidad de acceso a los alimentos orgánicos. La escolaridad no fue determinante para diferenciar las representaciones sociales emitidas.

  11. Eficiencia en la adquisición de alimentos en el sector público colombiano

    Directory of Open Access Journals (Sweden)

    Diego Alejandro Peralta Borray

    2015-12-01

    Full Text Available Dada la magnitud y el potencial del mercado de compras públicas dealimentos en Colombia y la tendencia que se ha venido dando en AméricaLatina en relación a la utilización de la contratación como mecanismo paraintervenir las entidades públicas y la economía, se hace imperiosa la necesidad de contar con herramientas que permitan medir la gestión de los administradores públicos al respecto. Este documento propone un indicador para la medición de la eficiencia en relación a la compra de alimentos de las entidades públicas, además, analiza si el uso de diferentes formas de contratación influye en sus niveles de eficiencia. También entrega elementos estadísticos razonables para determinar la mejor forma de abastecimiento de alimentos para los proyectos, programas y servicios estatales. La muestra evaluada corresponde a la observación de 139 referencias de alimentos crudos, comprados periódicamente por las entidades entre los años 2005 y 2009, y utilizados en su mayoría para la prestación de servicios de alimentación y/o su entrega directa a la población con una inversión promedio a 43 302 millones de pesos anuales.

  12. Zebrafish fed on recombinant Artemia expressing epinecidin-1 exhibit increased survival and altered expression of immunomodulatory genes upon Vibrio vulnificus infection.

    Science.gov (United States)

    Jheng, Yu-Hsuan; Lee, Lin-Han; Ting, Chen-Hung; Pan, Chieh-Yu; Hui, Cho-Fat; Chen, Jyh-Yih

    2015-01-01

    Artemia has been used extensively in aquaculture as fodder for larval fish, shrimp, and shellfish. Epinecidin-1, an antimicrobial peptide, was isolated from grouper (Epinephelus coioides) in 2005. Epinecidin-1 has been previously reported to possess antimicrobial activity against several Gram-positive and Gram-negative bacterial species, including Staphylococcus coagulase, Pseudomonas aeruginosa, Streptococcus pyogenes, and Vibrio vulnificus. In this study, we used electroporation to introduce plasmid DNA encoding a green fluorescent protein (EGFP)-epinecidin-1 fusion protein under the control of the cytomegalovirus (CMV) promoter into decapsulated Artemia cysts. Optimization of various properties (including cyst weight (0.2 g), plasmid concentration (50 μg/100 μl), and pulse voltage (150 V), length (10 ms), and number (2)) resulted in a hatching rate of 41.15%, a transfection efficiency of 49.81%, and a fluorescence intensity (A.U.) of 47.46. The expression of EGFP-epinecidin-1 was first detected by quantitative RT-PCR at 120 h post-electroporation, and protein was identified by Western blot at the same time. Furthermore, the EGFP-epinecidin-1 protein inhibited V. vulnificus (204) growth, as demonstrated by zone of inhibition studies. Zebrafish fed on transgenic Artemia expressing CMV-gfp-epi combined with commercial fodder were more resistant to infection by V. vulnificus (204): survival rate was enhanced by over 70% at 7, 14, and 21 days post-infection, and bacterial numbers in the liver and intestine were reduced. In addition, feeding of transgenic Artemia to zebrafish affected the immunomodulatory response to V. vulnificus (204) infection; expression of immune-responsive genes, including hepcidin and defbl2, was altered, as shown by qPCR. These findings suggest that feeding transgenic Artemia expressing CMV-gfp-epi to larval fish has antimicrobial effects, without the drawbacks of introducing drug residues or inducing bacterial drug resistance.

  13. Poly-ß-hydroxybutyrate content and dose of the bacterial carrier for Artemia enrichment determine the performance of giant freshwater prawn larvae.

    Science.gov (United States)

    Thai, Truong Quoc; Wille, Mathieu; Garcia-Gonzalez, Linsey; Sorgeloos, Patrick; Bossier, Peter; De Schryver, Peter

    2014-06-01

    The beneficial effects of poly-β-hydroxybutyrate (PHB) for aquaculture animals have been shown in several studies. The strategy of applying PHB contained in a bacterial carrier has, however, hardly been considered. The effect of administering PHB-accumulated Alcaligenes eutrophus H16 containing 10 or 80 % PHB on dry weight, named A10 and A80, respectively, through the live feed Artemia was investigated on the culture performance of larvae of the giant freshwater prawn (Macrobrachium rosenbergii). Feeding larvae with Artemia nauplii enriched in a medium containing 100 and 1,000 mg L(-1) A80 significantly increased the survival with about 15 % and the development of the larvae with a larval stage index of about 1 as compared to feeding non-enriched Artemia. The survival of the larvae also significantly increased with about 35 % in case of a challenge with Vibrio harveyi. The efficiency of these treatments was equal to a control treatment of Artemia enriched in an 800 mg L(-1) PHB powder suspension, while Artemia enriched in 10 mg L(-1) A80, 100 mg L(-1) A10, and 1,000 mg L(-1) A10 did not bring similar effects. From our results, it can be concluded that PHB supplemented in a bacterial carrier (i.e., amorphous PHB) can increase the larviculture efficiency of giant freshwater prawn similar to supplementation of PHB in powdered form (i.e., crystalline PHB). When the level of PHB in the bacterial carrier is high, similar beneficial effects can be achieved as crystalline PHB, but at a lower live food enrichment concentration expressed on PHB basis.

  14. Sustitución de alimento concentrado, con morera fresca (Morus alba, en la dieta de vacas lecheras

    Directory of Open Access Journals (Sweden)

    Carlos Boschini

    2003-01-01

    Full Text Available Se experimentaron cuatro dietas balanceadas con sustitución de alimento concentrado por la inclusión de 0, 20, 40 y 60% de materia seca de hojas de morera de 84 días. El consumo de materia seca total fue de 3,12 a 3,24% con relación al peso vivo. No se apreciaron diferencias importantes (P≥0,05 en el consumo total de MS entre vacas dentro de un mismo tratamiento. En la dieta sin morera (0%, el forraje constituyó el 42% y en la dieta con 60% de morera constituyó el 86% de la materia seca. El consumo de morera fue cercano a 2% en la dieta con 60%. La tasa de sustitución fue de 677 g/animal- /día de materia seca de concentrado por cada kilogramo de materia seca de morera agregada a la dieta, más la sustitución de 323 g/animal/día del sorgo negro forrajero y de la soja en mezcla para los dietas que contienen esta última. El reemplazo de proteína fue de 576 g/animal/día del concentrado y 424 g/animal/día del sorgo negro forrajero y soja por cada kilogramo de proteína cruda de morera adicionada. Cada megacalor ía de energía digestible de morera agregada a la dieta sustituyó 0,675 mcal/animal/día de energía del concentrado y 0,325 mcal/animal/día de la mezcla sorgo negro forrajero y soja. Se encontraron diferencias (P0,05 entre el peso inicial y final de los animales y las variaciones de producción de leche diaria fueron de pequeña magnitud dentro de dietas.

  15. Detrimental effect of CO2-driven seawater acidification on a crustacean brine shrimp, Artemia sinica.

    Science.gov (United States)

    Zheng, Chao-qun; Jeswin, Joseph; Shen, Kai-li; Lablche, Meghan; Wang, Ke-jian; Liu, Hai-peng

    2015-03-01

    The effects of the decline in ocean pH, termed as ocean acidification due to the elevated carbon dioxide in the atmosphere, on calcifying organisms such as marine crustacean are unclear. To understand the possible effects of ocean acidification on the physiological responses of a marine model crustacean brine shrimp, Artemia sinica, three groups of the cysts or animals were raised at different pH levels (8.2 as control; 7.8 and 7.6 as acidification stress according to the predictions for the end of this century and next century accordingly) for 24 h or two weeks, respectively, followed by examination of their hatching success, morphological appearance such as deformity and microstructure of animal body, growth (i.e. body length), survival rate, expression of selected genes (involved in development, immunity and cellular activity etc), and biological activity of several key enzymes (participated in antioxidant responses and physiological reactions etc). Our results clearly demonstrated that the cysts hatching rate, growth at late stage of acidification stress, and animal survival rate of brine shrimp were all reduced due to lower pH level (7.6 & 7.8) on comparison to the control group (pH 8.2), but no obvious change in deformity or microstructure of brine shrimp was present under these acidification stress by microscopy observation and section analysis. In addition, the animals subjected to a lower pH level of seawater underwent changes on their gene expressions, including Spätzle, MyD88, Notch, Gram-negative bacteria binding protein, prophenoloxidase, Apoptosis inhibitor 5, Trachealess, Caveolin-1 and Cyclin K. Meanwhile, several key enzyme activities, including superoxide dismutase, catalase, peroxidase, alkaline phosphatase and acid phosphatase, were also affected by acidified seawater stress. Taken together, our findings supports the idea that CO2-driven seawater acidification indeed has a detrimental effect, in case of hatching success, growth and survival, on

  16. Toxigenicity of enniatins from Western Australian Fusarium species to brine shrimp (Artemia franciscana).

    Science.gov (United States)

    Tan, Diana C; Flematti, Gavin R; Ghisalberti, Emilio L; Sivasithamparam, Krishnapillai; Barbetti, Martin J

    2011-04-01

    The high prevalence (14 of 24 isolates) of enniatin-producing isolates from Western Australian Fusarium species isolated from pasture legumes associated with sheep feed refusal and rat deaths, and the high toxicity of their crude extracts to brine shrimp (Artemia franciscana) from a previous study warranted further investigation of this class of mycotoxin. Crude extracts from Fusarium acuminatum, Fusarium avenaceum, Fusarium tricinctum and Fusarium sambucinum, along with enniatins A, A1, B and B1 purified from a Western Australian strain of F. acuminatum using semi-preparative HPLC, were bioassayed using brine shrimp. All Fusarium isolates produced both enniatins B and B1, except for F. tricinctum WAC 8019, and 11 of the 17 isolates produced enniatin A1. Overall, all of the F. avenaceum isolates produced high amounts of enniatins, in particular enniatin B. One isolate of F. acuminatum (WAC 5715) and of F. tricinctum (WAC 11486) also produced high amounts of both enniatins B and B1. Only F. acuminatum WAC 5715 produced enniatin A among the tested isolates. All four purified enniatins A, A1, B, B1, individually and in combination, caused brine shrimp toxicity after 6 h of exposure, implicating that this emerging class of mycotoxin as a cause of the acute toxicity to brine shrimp observed. The mixture of all four enniatins was the most toxic to brine shrimp compared to purified individual enniatins, where the relative toxicity order was B > B1 > A1 > A. Enniatin B was the individual most toxic enniatin with some bioactivity at 5 μg/mL and almost 100% brine shrimp death at 50 μg/mL after 24 h of exposure. This study is the first report to confirm the acute toxicity of enniatins A, A1, B and B1 to brine shrimp, and also highlights the need for further investigation of the potential toxicity of these cyclic hexadepsipeptides to animals and humans.

  17. Effects of copper, cadmium, and zinc on the hatching success of brine shrimp (Artemia franciscana).

    Science.gov (United States)

    Brix, K V; Gerdes, R M; Adams, W J; Grosell, M

    2006-11-01

    Previous studies indicate that the hatching success of brine shrimp (Artemia franciscana) cysts is surprisingly sensitive to ambient metal concentrations. These studies estimated median effective concentrations (EC50s) of 7, 5, and 28 microg l-1 for Cd, Cu, and Zn, suggesting that the hatching end point for A. franciscana is the most sensitive tested to date for Cd and Zn in saline environments and comparable in sensitivity with the most sensitive tested to date for Cu. Furthermore, these data suggest that brine shrimp are at significant risk from Cu and Zn in Great Salt Lake (GSL), UT, where ambient concentrations as high as 10 and 14 microg l-1, respectively, have been measured. Given that brine shrimp appear to be successfully reproducing in GSL, we hypothesized that these toxicity values were either biased low as a result of an artifact of the test method used or that site-specific water-quality conditions in the lake had decreased metal bioavailability such that brine shrimp could successfully reproduce. To test these hypotheses, we initiated a step-wise series of experiments. First we investigated the effects of pretreatment of brine shrimp cysts with antibiotics on brine shrimp sensitivity to metals because previous investigators as part of their test methods have used antibiotics. Next we considered the effect of ionic composition of the artificial test media on sensitivity. Finally, we evaluated the effects of the site-specific water quality of the GSL on metal bioavailability and toxicity. Results indicate that pretreatment of cysts with antibiotics had no effect on sensitivity. However, we were unable to repeat the previous values for Cd and Zn, obtaining EC50s of 11,859 and 289 microg l-1 for Cd and Zn, respectively. For Cu, however, we estimated an EC50 of 12 microg l-1, so we conducted further testing on the artificial media, adjusting the media composition to better reflect the Ca2+ and HCO3- concentration of normal seawater. This increased the EC50

  18. Efeito alelopático e toxicidade frente à Artemia salina Leach dos extatos do fruto de Euterpe edulis Martius Allelopathic effects and toxicity against Artemia salina Leach of extracts of the fruit of Euterpe edulis Martius

    Directory of Open Access Journals (Sweden)

    Cristina Peitz de Lima

    2011-06-01

    Full Text Available Alelopatia é um processo envolvendo metabólitos secundários produzidos por plantas que infl uenciam o crescimento e desenvolvimento de sistemas agrícolas. Devido à toxicidade dos herbicidas sintéticos para o meio ambiente e para a saúde humana tem-se aumentado o interesse na exploração da alelopatia como uma alternativa para o controle de plantas daninhas. O presente trabalho avaliou efeito dos extratos dos frutos de Euterpe edulis Martius sobre o desenvolvimento de cipselas e plântulas de Lactuca sativa Linné, foram determinados o índice de velocidade de germinação, o crescimento da radícula e do hipocótilo. Para a avaliação da toxicidade dos extratos foi realizado o ensaio de toxicidade frente ao microcrustáceo Artemia salina Leach determinando-se a CL50 e percentual de mortalidade. A fração remanescente demonstrou efeito alelopático, pois todas as concentrações alteraram os valores do índice de velocidade de germinação e as concentrações de 0,2 e 0,4 mg inibiram tanto o crescimento da radícula quanto o crescimento do hipocótilo. No ensaio de toxicidade todos os extratos apresentaram CL50 superior a 1000 ppm e 0% de mortalidade das artemias, indicando a não toxicidade dos extratos.Allelopathy is a process involving secondary metabolites produced by plants that influence growth and development of agricultural systems. Because of the toxicity of synthetic herbicides to the environment and human health, there has been increased interest in exploiting allelopathy as an alternative for weed control. This study evaluated the eff ect of extracts of Euterpe edulis Martius fruits on the development of cypselae and seedlings of Lactuca sativa Linné; the germination speed index, radicle and hypocotyl growth were determined. To evaluate the toxicity of the extracts the toxicity test against Artemia salina Leach was used, where the LC50 and mortality rate were determined. Th e remaining fraction showed allelopathic effect

  19. Embriões liofilizados e flocos de Artemia no cultivo pós-larval de Litopenaeus vannamei (Boone, 1931 = Use of freeze-dried embryos and Artemia flakes in the post-larval culture of Litopenaeus vannamei (Boone, 1931

    Directory of Open Access Journals (Sweden)

    Pedro Hercílio de Oliveira Cavalcante

    2008-01-01

    Full Text Available O objetivo do estudo foi avaliar o crescimento e sobrevivência de 1pós-larvas de Litopenaeus vannamei que receberam embriões liofilizados (EMB e flocos (FLO de Artemia como suplementos alimentares a uma dieta microparticulada (DMP. Nos tratamentos T1,T2 e T3, os camarões receberam DMP e após 2h, acréscimos de FLO (T1; de EMB (T2; e da mesma DMP, anteriormente, ofertada (T3. No T4, as pós-larvas foram alimentadas com DMP, mas sem suplementações posteriores. Não houve diferença significativa (p > 0,05 na sobrevivência dos camarões após o período experimental de 21 dias. Por outro lado, o ganho de peso absoluto (mg peso seco das pós-larvas, cuja dieta foi suplementada com BEM, foi significativamente superior (p The objective of the study was to evaluate the growth and survival of Litopenaeus vannamei post-larvae fed with freeze-driedembryos and Artemia flakes as feeding supplements to a microparticulate diet (DMP. In treatments T1, T2 and T3, the shrimp were fed with DMP and after 2 hours, received supplements of FLO (T1; EMB (T2; and the same DMP previously offered (T3. In T4,post-larvae were fed with DMP but without additional supplementation. There was no significant difference (p > 0.05 in shrimp survival after the experimental period of 21 days. On the other hand, the absolute weight gain (mg of dry weight of post-larvae whose dietwas supplemented with EMB (T2 was significantly higher (p < 0.05 than growth found in the other experimental groups (T1, T3 and T4. Shrimp fed with DMP and EMB obtained a significantly higher absolute weight gain (6.7 mg than those found in treatments that used DMP and FLO (5.4 mg or DMP alone (5.8 mg in T3 and 5.7 mg in T4. Theseresults underline the nutritional value of freeze-dried Artemia embryos and recommend their inclusion in the post-larval diet of Litopenaeus vannamei.

  20. Feed transition in larval rearing of bocudo, Steindachneridion scripta (Pisces, Pimelodidae, using Artemia spp. nauplii and artificial diet Transição alimentar na larvicultura do bocudo, Steindachneridion scripta (Pisces, Pimelodidae, com o uso de náuplios de Artemia spp. e dieta artificial

    Directory of Open Access Journals (Sweden)

    W.B. Adamante

    2007-10-01

    Full Text Available Feed transition of Steindachneridion scripta larvae was investigated using seven treatments in which the reference diet, Artemia spp. nauplii, was totally substituted for a 56% crude protein artificial diet in two-day intervals. Initially, all treatments were fed with Artemia spp. nauplii and, subsequently, during the transition period, feed was equally composed by Artemia sp. nauplii and artificial diet. Everyday, one of the treatments began the feed transition, which was implemented between the second and the eighth days of culturing. Two treatments were used as control: one exclusively fed Artemia spp. nauplii and another only with artificial diet. Total weight, total length, and survival rate were not influenced by the day in which feed transition was implemented (P>0.05, and their mean values (± SD were 31.1±25.0mg, 13.3±1.5mm and 58.8±12.0%, respectively. This suggests that Steindachneridion scripta larvae adapted well the transition to artificial diet.A transição alimentar de larvas de Steindachneridion scripta foi investigada utilizando-se sete tratamentos, nos quais a dieta básica, composta por náuplios de Artemia spp., foi integralmente substituída, em intervalo de dois dias, por uma dieta artificial contendo 56% de proteína bruta. Inicialmente, todos os tratamentos receberam náuplios de Artemia spp. No período de transição alimentar, metade da alimentação foi formada por náuplios de Artemia spp. e metade por dieta artificial. A cada dia, um dos tratamentos entrou na fase de transição, que foi implementada entre o segundo e o oitavo dia de cultivo. Utilizaram-se dois tratamentos como controle; em um as larvas foram alimentadas, exclusivamente, com náuplios de Artemia spp. e em outro, somente, com dieta artificial. Peso total, comprimento total e sobrevivência não foram influenciados pelo dia de implantação da transição alimentar (P>0,05 e, apresentaram valores médios iguais a (± desvio padrão 31,1±25,0mg

  1. Desperdício de alimentos intra-hospitalar Food wastage in a hospital

    Directory of Open Access Journals (Sweden)

    Carla Barbosa Nonino-Borges

    2006-06-01

    Full Text Available OBJETIVO: Verificar a ocorrência do desperdício, na forma de resto de alimentos, na Unidade de Alimentação e Nutrição da Unidade de Emergência do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto, da Universidade de São Paulo. MÉTODOS: Realizou-se análise descritiva de dados, levantados em um período de 14 dias, sobre os restos de alimentos deixados pelos clientes/pacientes, assim como dos custos estimados do total da produção e do resto de alimentos. RESULTADOS: Foram analisadas 650 dietas, totalizando 402kg de alimentos, tendo retornado à Unidade de Alimentação e Nutrição 123kg (31% de alimentos. Das dietas distribuídas, 71 (15% retornaram intactas. Desconsiderando as dietas intactas, o peso total de alimentos produzidos foi de 353kg e o resto de 77kg (22%. O custo total mensal estimado das dietas foi de US$25,000.00 e o custo estimado dos restos foi de US$7,580.00. CONCLUSÃO: Os resultados demonstram uma perda excessiva de alimentos, incompatível com as normas operacionais de uma Unidade de Alimentação e Nutrição hospitalar, o que nos remete à necessidade de reflexão acerca das possibilidades de ajustes, introduzindo revisões nas práticas gerenciais e operacionais do serviço com enfoque nas ações interdisciplinares.OBJECTIVE: The aim of the current study was to assess food wastage in the Hospital Emergency Section of the Clinical Hospital of the School of Medicine of Ribeirão Preto, University of Sao Paulo and to propose a strategy to face this problem. METHODS: Food wastage by patients and hospital staff was analyzed. The cost of all the food, supplied and wasted, was estimated. RESULTS: The results were calculated based on descriptive analytical data collected during a 14d period. A total of 650 meals were analyzed, totaling 402kg of food, from which 123kg (31% returned to the Division. From the delivered meals, 71 (15% were returned intact, that is, they had not been tried by the patient

  2. Nutritional Composition, in vitro Antioxidant Activity and Artemia salina L. Lethality of Pulp and Seed of Tamarindus indica L. Extracts.

    Science.gov (United States)

    Khairunnuur, F A; Zulkhairi, A; Azrina, A; Moklas, Ma M; Khairullizam, S; Zamree, M S; Shahidan, M A

    2009-03-01

    This study was designed to examine the nutritional composition, antioxidant activity and medium lethal concentration (LC50 value) of Tamarindus indica L. pulp and seed extracts in vitro. The extraction was set at 40◦C, 60◦C and 100◦C for 12 hours, 6 hours and 15 minutes respectively to determine the optimum extraction parameter whereas the anti-oxidant activity of the extracts was measured using iron (III) reduction (FRAP) assay. Total phenolic content (TPC) of the extracts was estimated as gallic acid equivalent by Folin-Ciocalteau method. Toxicity potential of the extract was assessed in vitro by Artemia salina lethality test both in seed and pulp samples. The results showed that tamarind seed contained a higher percentage of carbohydrate, protein, fat and energy (15%, 82%, 95% and 33.13% respectively) than the pulp. On the other hand, the pulp demonstrated a high moisture (51.1%) and ash (34.84%) content than the seed. For the mineral analysis, tamarind seed contained higher Ca and C (1.0% and 50.73% respectively) than the pulp (0.27% and 40.40% respectively). No heavy metals were detected in both samples. Seed extracted at 60◦C/6 hours and 100◦C/15 minutes showed the highest TPC value and were significantly different (pseed extracted at 40◦C/12 hours. Anti-oxidant activity is positively correlated to the TPC value of the extracts (R=0.991). The pulp and seed extracted at 100◦C/15 minutes showed the highest FRAP value among its groups (216.17 ± 14.06 μmol (Fe)/g and 659.74 ± 16.40 μmol (Fe)/g respectively). This study indicates that tamarind pulp and seed extracts possess beneficial antioxidant properties and the optimum extraction parameter is 100◦C for 15 minutes. In Artemia salina lethality test, tamarind pulp caused significant mortality of the crustacean larvae with LC50 in the range of 26-28 μL/mL. Tamarind seed were not toxic to Artemia salina since the LC50 of the extracts was higher than 1000 μL/mL.

  3. The potential role of As-sumo-1 in the embryonic diapause process and early embryo development of Artemia sinica.

    Science.gov (United States)

    Chu, Bing; Yao, Feng; Cheng, Cheng; Wu, Yang; Mei, Yanli; Li, Xuejie; Liu, Yan; Wang, Peisheng; Hou, Lin; Zou, Xiangyang

    2014-01-01

    During embryonic development of Artemia sinica, environmental stresses induce the embryo diapause phenomenon, required to resist apoptosis and regulate cell cycle activity. The small ubiquitin-related modifier-1 (SUMO), a reversible post-translational protein modifier, plays an important role in embryo development. SUMO regulates multiple cellular processes, including development and other biological processes. The molecular mechanism of diapause, diapause termination and the role of As-sumo-1 in this processes and in early embryo development of Artemia sinica still remains unknown. In this study, the complete cDNA sequences of the sumo-1 homolog, sumo ligase homolog, caspase-1 homolog and cyclin B homolog from Artemia sinica were cloned. The mRNA expression patterns of As-sumo-1, sumo ligase, caspase-1, cyclin B and the location of As-sumo-1 were investigated. SUMO-1, p53, Mdm2, Caspase-1, Cyclin B and Cyclin E proteins were analyzed during different developmental stages of the embryo of A. sinica. Small interfering RNA (siRNA) was used to verify the function of sumo-1 in A. sinica. The full-length cDNA of As-sumo-1 was 476 bp, encoding a 92 amino acid protein. The As-caspases-1 cDNA was 966 bp, encoding a 245 amino-acid protein. The As-sumo ligase cDNA was 1556 bp encoding, a 343 amino acid protein, and the cyclin B cDNA was 739 bp, encoding a 133 amino acid protein. The expressions of As-sumo-1, As-caspase-1 and As-cyclin B were highest at the 10 h stage of embryonic development, and As-sumo ligase showed its highest expression at 0 h. The expression of As-SUMO-1 showed no tissue or organ specificity. Western blotting showed high expression of As-SUMO-1, p53, Mdm2, Caspase-1, Cyclin B and Cyclin E at the 10 h stage. The siRNA caused abnormal development of the embryo, with increased malformation and mortality. As-SUMO-1 is a crucial regulation and modification protein resumption of embryonic diapause and early embryo development of A. sinica.

  4. Comparación entre dos métodos para medir el consumo de alimentos en un área rural costarricense

    Directory of Open Access Journals (Sweden)

    Anne Chinnock

    1999-12-01

    Full Text Available El objetivo del presente trabajo fue comparar, mediante dos métodos, el consumo de alimentos en un grupo de treinta familias de una zona rural costarricense. Los métodos comparados fueron el Consumo Aparente de Alimentos y el Registro con Pesos. Para el primero se realizaron tres entrevistas a cada familia los días cero, ocho y veintidós del estudio. El Registro con Pesos se aplicó durante un periodo de siete días (desde el día uno hasta el día siete. Los resultados señalaron que no hubo diferencias estadísticamente significativas entre ambos métodos para la mayoría de los alimentos y nutrientes. Sin embargo, el método de Consumo Aparente de Alimentos sobreestimó significativamente el consumo de 7 alimentos, incluyendo el arroz y el azúcar y algunos alimentos de producción casera. Debido a estas diferencias, el método de Consumo Aparente de Alimentos sobreestimó la cantidad promedia de energía, carbohidratos, calcio, fósforo y tiamina. Se concluye que el método de Consumo Aparente de Alimentos no debe ser utilizado para estimar el consumo de alimentos e ingesta de nutrientes a nivel de cada familia. Sin embargo, al mejorar la capacidad del método de Consumo Aparente de Alimentos para estimar cantidades consumidas de arroz, azúcar y alimentos de autoconsumo, puede utilizarse para estimar el consumo promedio de alimentos, energía y nutrientes de grupos de familias de características similares a las del presente estudio.

  5. Observações preliminares sobre a toxicidade do ϒBHC e do cloreto de mercúrio à Artemia salina Preliminary observations on the toxicity of ϒBHC and mercuric cloride on Artemia salina

    Directory of Open Access Journals (Sweden)

    Salvador Airton Gaeta

    1983-01-01

    Full Text Available São apresentados os resultados de bioensaios com larvas de Artemia salinacolocadas em misturas de γBHC e HgCl2, a fim de se compararem os efeitos das mesmas com aqueles obtidos quando essas duas substancias atuam isoladamente. A CL50 para o yBHC foi quase que o dobro do valor para o HgCl2. O efeito da primeira dose foi observado para aproximadamente 16% da população (CL16, enquanto que, para o γBHC, o foi em 2,3% da população (CL2,3. Assim, as doses subseqüentes foram mais efetivas para o HgCl2 que para o γBHC. A dose efetiva 50% (ED50 ê mais ou menos igual para o γBHC e para o γBHC + HgCl2, mas em doses altas o YBHC seria mais efetivo, enquanto que em doses baixas a mistura e que o seria.Results of bio-assays using Artemia salina larvae in γBHC-HgCl2 mixture are presented. The results obtained are compared with those obtained using the two chemicals separately. The LC50 for γBHC was almost double that for HgCl2. The effect due to the primary dose of HgCl2 was observed for approximately 16% of the population (LC2.3 while for γBHC the population percentage was 2.3 (LC2.3. As a consequence, subsequent doses were more effective for HgCl2 than for γBHC. The effective dose 50% (ED50 is about the same for γBHC and for γBHC + HgCl2 mixture, though in higher doses BHC would be more effective, while in smaller doses the mixture would predominate.

  6. Bacillus sp. LT3 improves the survival of gnotobiotic brine shrimp (Artemia franciscana) larvae challenged with Vibrio campbellii by enhancing the innate immune response and by decreasing the activity of shrimp-associated vibrios.

    Science.gov (United States)

    Niu, Yufeng; Defoirdt, Tom; Baruah, Kartik; Van de Wiele, Tom; Dong, Shuanglin; Bossier, Peter

    2014-10-10

    Bacteria belonging to the genus Bacillus are amongst the most intensively studied group of bacteria for use as probiotics in aquaculture. However, the exact mechanism of action of these bacteria is often not well described, and the microbiota that are naturally present in cultures of test organisms often compromise the interpretation of the results. The present study aimed to evaluate the putative probiotic effect of Bacillus sp. LT3 in a model system with gnotobiotic brine shrimp Artemia franciscana larvae. The strain significantly increased the survival of brine shrimp larvae challenged with Vibrio campbellii when administered 6h before the challenge. Under these conditions, LT3 was able to colonize the brine shrimp gastrointestinal tract and to decrease the in vivo pathogen activity as indicated by the bioluminescence of the V. campbellii associated with brine shrimp larvae. In order to investigate the effect of the Bacillus strain on the innate immune system of the brine shrimp larvae, prophenoloxidase and transglutaminase mRNA levels were monitored, while heat shock protein 70 mRNA levels were measured as an indicator of physiological stress. Interestingly, 12h after challenge, the prophenoloxidase mRNA level in the larvae pre-treated with LT3 and challenged with V. campbellii was approximately 8-fold higher than in the other treatments. Further, a decreased mRNA level of transglutaminase gene and heat shock protein 70 gene suggested that pretreatment with LT3 results in less stress and tissue damage in the brine shrimp larvae upon V. campbellii challenge. These results indicated that Bacillus sp. LT3 could improve the survival of brine shrimp larvae when challenged with pathogenic V. campbellii, both by decreasing the in vivo activity of the pathogen and by priming the innate immune response through activating the prophenoloxidase system.

  7. ANÁLISE DE PATENTES DO MERCADO DE ALIMENTOS INDUSTRIALIZADOS NO MUNDO COM BASE NA CLASSIFICAÇÃO “A” DA WIPO

    OpenAIRE

    Cajavilca, Erick Samuel Rojas; UFOB; Marques, Natan de Souza; UFOB; Melo, Elaine Machado; UFOB; Santana, Vinício Gonçalves; UFOB; Sales, Gessica Feitoza; UFOB; Lobo, Rayldson de Souza; UFOB

    2014-01-01

    Esse artigo tem como objetivo analisar as patentes depositadas no banco de dados do Espacenet referentes a tecnologias de alimentos industrializados que correspondem à classificação “A” do Código Internacional de Patentes da WIPO. Os segmentos selecionados englobam subclasses de alimentos, a saber: confeitos; produtos diets; produtos lights; alimentos semi-prontos; e alimentos funcionais. Para tanto, utilizou-se a metodologia de prospecção tecnológica em base de patentes a fim de identificar ...

  8. Tabela Brasileira de Composição de Alimentos (TBCA-USP): atualização e inclusão de dados de vitaminas

    OpenAIRE

    2013-01-01

    A Tabela Brasileira de Composição de Alimentos (TBCA-USP) tem como meta a disseminação de dados de qualidade sobre a composição química dos alimentos, sendo que sua base de dados é continuamente atualizada com a inserção de novos alimentos e nutrientes. Vários estudos tem sido realizados com o objetivo de quantificar vitaminas em alimentos brasileiros, entretanto estas informações encontram-se dispersas em diversas publicações. O objetivo do trabalho foi a elaboração de uma base de dados refe...

  9. Consumo de alimentos orgânicos e de produtos light ou diet no Brasil: fatores condicionantes e elasticidades-renda.

    OpenAIRE

    Oliveira, Fabíola Cristina Ribeiro de; Hoffmann,Rodolfo

    2015-01-01

    O expressivo crescimento da variedade de alimentos disponíveis para grande parte dos brasileiros durante o último século não levou, necessariamente, a uma alimentação saudável. Cresce a preocupação com o sobrepeso e a obesidade e com a qualidade dos alimentos, expandindo-se a demanda por alimentos com atributos especiais, como os orgânicos, os light e os diet. O principal objetivo deste artigo é estimar as elasticidades-renda das despesas e do consumo de diversos tipos de alimentos orgânicos ...

  10. Influência de alimentos sólidos e líquidos na saciação e na saciedade

    OpenAIRE

    2006-01-01

    Os alimentos podem ser classificados segundo suas diferenças sensoriais, propriedades físicas e químicas. Dentre as propriedades físicas dos alimentos, a consistência tem um papel importante na saciedade. O alto consumo de bebidas, especialmente refrigerantes, tem sido apontado como um dos possíveis fatores responsáveis pelo ganho de peso. Alguns autores observaram que alimentos sólidos suprimem o apetite por um período de tempo maior do que alimentos líquidos, ao passo que outros encontraram...

  11. Lethal and sublethal endpoints observed for Artemia exposed to two reference toxicants and an ecotoxicological concern organic compound.

    Science.gov (United States)

    Manfra, Loredana; Canepa, Sara; Piazza, Veronica; Faimali, Marco

    2016-01-01

    Swimming speed alteration and mortality assays with the marine crustacean Artemia franciscana were carried out. EC50 and LC50 values after 24-48h exposures were calculated for two reference toxicants, copper sulphate pentahydrate (CuSO4·5H2O) and Sodium Dodecyl Sulphate (SDS), and an ecotoxicological concern organic compound, Diethylene Glycol (DEG). Different end-points have been evaluated, in order to point out their sensitivity levels. The swimming speed alteration (SSA) was compared to mortality values and also to the hatching rate inhibition (literature data). SSA resulted to be more sensitive than the mortality and with a sensitivity comparable to (or even higher than) the hatching rate endpoint.

  12. Proteomic analysis of acute responses to copper sulfate stress in larvae of the brine shrimp, Artemia sinica

    Science.gov (United States)

    Zhou, Qian; Wu, Changgong; Dong, Bo; Li, Fuhua; Liu, Fengqi; Xiang, Jianhai

    2010-03-01

    Proteomics was used to reveal the differential protein expression profiles of acute responses to copper sulfate exposure in larvae of Artemia sinica. Fourteen differentially displayed protein spots were detected and seven of them were identified. Three spots were up-expressed and identified: actin, heat shock protein 70, and chaperone subunit 1; three down-regulated proteins were identified: arginine kinase, elongation factor-2, and glycine-rich protein; and a newly expressed protein was identified as peroxiredoxin. The study indicates the involvement of all the differentially expressed proteins in the early responses of protein expression, and in the survival of A. sinica in the presence of copper and other heavy metals; the findings improve understanding of the organism’s adaptive responses and resistance.

  13. Optimizing the co-feeding strategy of Persian sturgeon (Acipenser persicus larvae using Artemia nauplii and formulated diet

    Directory of Open Access Journals (Sweden)

    Naser Agh

    2013-07-01

    Full Text Available High mortality and labor costs are associated with first-feeding sturgeon culture, particularly during the period of dietary transition from live to formulated feed. Therefore we investigated the effects of various feeding treatments on the survival and growth of the Persian sturgeon (Acipenser persicus larvae during a 20-day culture period. Three replicate groups (250 fish/replicate of first-feeding larvae were fed according to four main feeding regimes: (1 live food (live nauplii of brine shrimp Artemia urmiana; (2 indirect transition (5 days live food followed by gradual transition to formulated diet; (3 direct transition (using different combinations of live and formulated diet from the start feeding onwards; (4 formulated feed (FD from the start feeding. Results indicated that growth and survival were higher in the indirect transition feeding regime than in other regimes. Based on our study, co-feeding of A. persicus should start five days after prior feeding with live food.

  14. Toxicity of lapachol and isolapachol and their potassium salts against Biomphalaria glabrata, Schistosoma mansoni cercariae, Artemia salina and Tilapia nilotica.

    Science.gov (United States)

    Lima, Nadja Maria Fernandes; dos Santos, Aldenir Feitosa; Porfírio, Zenaldo; Goulart, Marília O F; Sant'Ana, Antônio Euzébio G

    2002-07-01

    The toxicity of soluble derivatives (potassium salt) of lapachol and isolapachol in different stages of the life cycle of Schistosoma mansoni is evaluated. The potassium salts of isolapachol and lapachol showed significant molluscicidal activity against the adult snail (LC90Artemia salina Leach) indicated very high toxicity for the potassium salt of isolapachol (LC90=1.54 ppm), differently from the potassium salt of lapachol that can be considered non toxic (LC90=176.3 ppm). The same tendency is observed with piscicidal activity, for which the isolapachol salt has showed higher toxicity. The obtained selectivity ratios concerning LC50 and LC90 for lapachol, in relation to Tilapia nilotica lethality assay are 2.33 and 1.26, respectively. Despite the piscicidal toxicity, the use of the salt of lapachol can be recommended for field tests in Schistosomiasis, with caution.

  15. A butyrylcholinesterase in the early development of the brine shrimp (Artemia salina) larvae: a target for phthalate ester embryotoxicity?

    Science.gov (United States)

    Acey, Roger A; Bailey, Stacie; Healy, Patricia; Jo, Chang; Unger, Thomas F; Hudson, Richard A

    2002-12-13

    The phthalate ester insensitive blue-green algae (Synechococcus lividus) were used as a food source to extend the survival of synchronously hatched brine shrimp (Artemia salina) larvae allowing measurement of a reduced toxic response to phthalate esters at late post-hatching stages of development. The maximum acute toxicity due to di-n-butyl phthalate (DNBP) correlated with the expression of a phthalate ester-hydrolyzing enzyme. The purified enzyme was identified as a butyrylcholinesterase due to its rapid inactivation by low concentrations (10(-7)M) of diisopropyl fluorophosphate and inhibition by physostigmine (IC(50)=6 x 10(-7)M) and tetraisopropylpyrophosphoramide (I-OMPA, IC(50)=x 10(-6)M) but not by BW284c5. Apparently competition of the phthalates with the endogenous substrates of the enzyme led to development-dependent toxicity.

  16. Toxicity of tannins towards the free-living nematode Caenorhabditis elegans and the brine shrimp Artemia salina.

    Science.gov (United States)

    Yamasaki, Toru; Sato, Masashi; Mori, Tomoaki; Mohamed, Ahmed S A; Fujii, Kyoko; Tsukioka, Junko

    2002-08-01

    Toxicities of gallo- and condensed tannins towards the free-living nematode Caenorhabditis elegans is dependent on the tannins' molecular sizes. In the present paper we investigate the toxicity of ellagitannins to C elegans and the toxicity of ellagi-, gallo-, and condensed tannins to the brine shrimpArtemia salina. Ellagitannins 1 and 2 were isolated from Euphorbia supina and identified as tellimagrandin I and rugosin A methyl ester, respectively. An ellagitannin preparation from Cornus officinalis was chromatographically fractionated into ellagitannins A through H, having different molecular weights and specific rotations. Three of the ten ellagitannins, 2, G, and H produced significant toxicity towards C. elegans, showing the presence of an activity-structure relationship, as opposed to the results from tests of gallo- and condensed tannins. Ellagi-, gallo-, and condensed tannins also produced toxicity in A. salina.

  17. The lethality of Euphorbia conspicua to adults of Biomphalaria glabrata, cercaria of Schistosoma mansoni and larvae of Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir F; de Azevedo, Denise P L; dos Santos Mata, Rosalina da C; de Mendonça, Dina I M Dinis; Sant'Ana, Antônio E Goulart

    2007-01-01

    Leaf extracts of Euphorbia conspicua (Euphorbiaceae), together with the latex and fractions derived therefrom, were evaluated for their molluscicidal and cercaricidal activities and their toxicities to brine shrimps. Whilst the leaf extracts were inactive against Biomphalaria glabrata, the latex, its triterpenic fraction and irritant fractions I and II exhibited high activities against adult snails with LC90 values of 4.87, 10.55, 0.64 and 0.10 microg/mL, respectively. The latex and its derived fractions were considered lethal to the cercaria of Schistosoma mansoni at concentrations of 100 microg/mL. The toxicities of the latex and the irritant fractions, but not of the triterpenic fraction, against Artemia salina were high with LC50 values < 10 microg/mL. The possible application of the latex of E. conspicua as an alternative natural molluscicide is considered.

  18. Evaluation of metabolic responses of Artemia salina to oil and oil dispersant as a potential indicator of toxicant stress

    Energy Technology Data Exchange (ETDEWEB)

    Verriopoulos, G.; Moraitou-Apostolopoulou, M.; Xatzispirou, A.

    1986-03-01

    Oil represents an obvious hazard for the coastal environment and studies on its impact on marine organisms are necessary. Solvent based oil dispersants constitute one of the most important means for removing oil from shores. Although recently new dispersants have been developed, which are much less toxic than the first ones, dispersants still remain toxic substances. Since in the case of oil pollution treatment, oils and detergents are acting in combination, a realistic approach of laboratory studies must also include the combined action of these substances on marine organisms. Although acute toxicity studies are very useful for the determination of the range of animal tolerance, other effects causing physiological alterations may be detrimental to a population's survival. This paper concerns research on the effects of an oil, an oil dispersant and of the mixture of oil and dispersant on a physiological process, the respiration of the brine shrimp Artemia salina.

  19. Temperature-dose relationships with aflatoxin M1 in milk on the brine shrimp (Artemia salina larvae

    Directory of Open Access Journals (Sweden)

    Lejla Duraković

    2011-06-01

    Full Text Available Temperature-dose relationships with aflatoxin M1 (AFM1 were studied using the brine shrimp Artemia salina larvae as an biological indicator in the temperature range from 20 °C to 40 °C. Increase in the incubation temperature resulted in sensitivity increase by the brine shrimp to AFM1. Optimum sensitivity occured at 30 °C. Positive results were obtained at 0.18 μg AFM1 x L-1 of whole pasteurized milk with a mortality of over 15%. Greater than 90 % mortality occurred at dose levels of 0.9 μg AFM1 x L-1 and above. The test can be conducted during 30-60 hours.

  20. Hemolymph patterns of free amino acids in the brine shrimp Artemia franciscana after three days starvation at different salinities.

    Science.gov (United States)

    Nakamura, Kaworu; Iwaizumi, Koichi; Yamada, Shoji

    2007-05-01

    The hemolymph pattern of free amino acids was examined in the brine shrimp, Artemia franciscana (Great Salt Lake origin). After one-month acclimation to 35 or 60 ppt salinity at 27 degrees C, the animals were transferred to 10, 35 or 60 ppt salinities to continue acclimation for 3 days without feeding at 27 degrees C. The osmolarity of one of the new media was raised by glycerol addition. In the hemolymph, 8 amino acids such as taurine, alanine, threonine, serine, lysine, glycine, arginine and leucine, comprised approximately 70% of the total content of free amino acids. This pattern suggested internal proteolysis due to starvation at high temperature. The total content of free amino acids significantly increased at 10 and 60 ppt salinities in comparison to 35 ppt. The hemolymph patterns from the 10 ppt and glycerol-added media showed a singularly high peak of taurine or alanine.

  1. Formation of a covalent Nepsilon2-guanylylhistidyl reaction intermediate by the GTP:GTP guanylyltransferase from the brine shrimp Artemia.

    Science.gov (United States)

    Cartwright, J L; McLennan, A G

    1999-01-01

    The chemical nature of the enzyme-nucleotide phosphoramidate reaction intermediate employed by the unique GTP:GTP guanylyltransferase from yolk platelets of Artemia franciscana cysts to synthesize diguanosine tetraphosphate (Gp4G) has been investigated. Labeling of the enzyme with [alpha-32P]GTP followed by isolation of the labeled phosphoamino acid by periodate treatment and alkaline hydrolysis and comparison of the product with phosphoamino acid standards by thin-layer and ion-exchange chromatography showed that the linkage involves the Nepsilon2 ring nitrogen of an enzyme histidyl residue. Thus, this enzyme is distinct from the mRNA capping enzymes which can also synthesize Gp4G but which employ a lysyl-nucleotide intermediate. Based on its reaction mechanism and substrate specificity, GTP:GTP guanylyltransferase may belong to the GAFH superfamily which includes the histidine triad proteins, Ap4A phosphorylases, and galactose-1-phosphate uridylyltransferase.

  2. Molecular analysis and its expression of a pou homeobox protein gene during development and in response to salinity stress from brine shrimp, Artemia sinica.

    Science.gov (United States)

    Wang, Jia-Qing; Hou, Lin; Yi, Nan; Zhang, Riu-Feng; Zou, Xiang-Yang

    2012-01-01

    Brine shrimps of the genus Artemia are aquatic species of economic importance because of their important significance to aquaculture and are used as a model species in physiology and developmental biology. Research on Artemia POU homeobox gene function will enhance our understanding of the physiological and developmental processes of POU homeobox gene in animals. Herein, a full-length cDNA encoding an Artemia POU homeobox protein gene 1 (APH-1) from Artemia sinica (designated as As-APH-1) was cloned and characterized by a reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) method. The As-APH-1 gene encoded a protein of 388 amino acid polypeptide with a calculated molecular mass of 42.85kDa and an isoelectric point of 6.90 and the protein belongs to the POU III family. Multiple sequence alignments revealed that A. sinica As-APH-1 protein sequence shared a conserved POU homeobox domain with other species. The early and persistent expression of As-APH-1 in the naupliar stages by semi-quantitative RT-PCR and whole-mount embryonic immunohistochemistry suggest that As-APH-1 functions very early in the salt gland and may be required continuously in this organ. Later in development, expression of As-APH-1 begins to dramatically decrease and disappear in salt gland of the sub-adult Artemia. In addition, we also discovered that As-APH-1 increased obviously as the salinity increased, indicating that As-APH-1 might be used as a good indicator of salinity stress. In summary, we are the first to identify the As-APH-1 gene and to determine its gene expression patterns in early embryogenesis stages and in different salinity stress in brine shrimp, A. sinica. The result of expression of As-APH-1 affected by salinity changes will provide us further understanding of the underlying mechanisms of osmoregulation in Artemia early embryonic development.

  3. Analysis of toxicity of Anacardium occidentale L. extract submitted to ionizing radiation on embryos of Biomphalaria glabrata and Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Hianna A.M.F.; Sa, Jose L.F.; Lima, Claudia S.A.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: hiannaamfs@gmail.com, E-mail: luismuma6@gmail.com, E-mail: claudia.salima@gmail.com, E-mail: amancioff@bol.com.br, E-mail: amdemelo@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Biofisica e Radiobiologia; Ribeiro, Luanna R.S.; Santos, Gustavo H.F.; Silva, Edvane B., E-mail: luannaribeiro_lua@hotmail.com, E-mail: santosghf@hotmail.com, E-mail: edvborges@yahoo.com.br [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Energia Nuclear. Grupo de Estudos em Radioprotecao e Radioecologia

    2013-07-01

    The use of gamma radiation as a sterilization method for herbs, herbal medicines and foods, shows positive results regarding the retention of such products, economy and safety of the method. However, it is known that this method of processing plant material can cause chemical changes in these products related to the type of material, its components and the dose received. Evaluated, in the present study, the action of gamma radiation as a modifier of toxicity extract of Anacardium occidentale Linn. To evaluate the toxicity of the extract irradiated at doses of 5.0, 7.5 and 10.0 kGy and concentrations of 250, 500 and 1000 mg/L was used bioassays with Artemia salina and Biomphalaria glabrata. For the test to A. salina, 520 specimens were used divided into groups of 10 larvae. For the bioassay with B. glabrata, 3900 specimens were used divided into groups of, approximately, 100 embryos. Larvae of A. salina and embryos were subjected to extracts irradiated and unirradiated for 24 hours. The bioassay with A. salina, showed a decrease, compared to extract unirradiated and irradiated at doses of 5.0 and 7.5 kGy, of extract irradiated with 10 kGy, where the mortality did not differ from the control group. In tests with embryos was observed an increase in the toxicity of the extract at a dose of 7.5 kGy and a decrease in the dose of 10.0 kGy. The radiation promoted changes in the toxicity of leaves extracts of Anacardium occidentale Linn. on embryos of Biomphalaria glabrata and Artemia salina. (author)

  4. Effect of different microcystin profiles on toxin bioaccumulation in common carp (Cyprinus carpio) larvae via Artemia nauplii.

    Science.gov (United States)

    El Ghazali, Issam; Saqrane, Sanaa; Carvalho, António Paulo; Ouahid, Youness; Del Campo, Francisca F; Oudra, Brahim; Vasconcelos, Vitor

    2010-07-01

    In this study, a 12-day growth trial was conducted to compare the effect of the variation in microcystin (MC) composition in two Microcystis aeruginosa bloom samples on the growth performance and MC accumulation/transfer in the common carp (Cyprinus carpio L.) larvae. Fish were fed Artemia salina nauplii that had been preexposed to extracts from two M. aeruginosa natural blooms with different microcystins (MCs) profiles. Bloom A had MC-LR as major toxin (74.05%) while bloom B had a diversity of MC (MC-RR; MC-(H4)YR; MC-YR; MC-LR; MC-FR; MC-WR) with no dominance of MC-LR. Newly-hatched Artemia nauplii were exposed separately to the two M. aeruginosa extracts A and B (100 microg L(-1)EqMC-LR) for 2h. The MC concentration in the nauplii was 73.60+/-7.88ngEqMC-LRg(-1)FW (n=4, mean+/-SE) for bloom A and 87.04+/-10.31ngEqMC-LRg(-1)FW for bloom B. These contaminated nauplii were given at the same ration to different groups (A and B) of fish larvae. Larval weight and length from day 9 were significantly different between groups A and B, and in both cases lower than that of a control group fed non-exposed nauplii. MCs accumulation by larvae, inversely correlated with the growth performance, was also significantly different between groups A and B (37.43+/-2.61 and 54.55+/-3.01ngEqMC-LRg(-1) FW, respectively, at the end of the experimental period). These results indicate that MC profile of a bloom may have differential effects on toxin accumulation/transfer and toxicity.

  5. Regulation and function of lysine-substituted Na,K pumps in salt adaptation of Artemia franciscana.

    Science.gov (United States)

    Jorgensen, Peter Leth; Amat, Francisco

    2008-01-01

    The brine shrimp Artemia thrives at extreme conditions of up to 300 g/l salt in hypersaline lakes, but the molecular aspects of this salt adaptation are not clarified. To examine the influence of salt on the expression of two isoforms of Na,K-ATPase, adult Artemia franciscana were cultured for 39 days with the microalga Dunaliella salina as fodder at increasing salt from 30 to 280 g/l. Quantitative reverse-transcriptase polymerase chain reaction showed that the abundance of mRNA of the lysine-substituted alpha(2)(KK)-subunit was very low at 30 g/l salt but rose steeply in the range of 70-200 g/l to a level at 200-280 g/l salt, similar to the abundance of the mRNA of the alpha(1)(NN)-subunit, which was insignificantly affected by increasing salt. Site-directed mutagenesis showed that Asn324Lys and Asn776Lys in the alpha(1)-subunit of pig kidney Na,K-ATPase reduced the stoichiometry of (204)Tl binding from 2 to about 1 Tl(+)(K(+)) per alpha-subunit and Na(+)-dependent phosphorylation from ATP to 25-30%. In structure models, the epsilon-amino group of Lys776 is located at cation site 1 in the E(1)P form and near cation site 2 in the E(2) conformation, while the side chain of Lys324 points away from the cation sites. Salt-induced expression of the alpha(2)(KK)-subunit Na,K-ATPase in A. franciscana may reduce the Na(+)/ATP ratio and enable the Na,K pump to extrude Na(+) against steeper gradients and, thus, contribute to salt adaptation.

  6. Transmissão Intergeracional: uma contribuição ao estudo do comportamento do consumidor de alimentos

    Directory of Open Access Journals (Sweden)

    Maria de Fátima Evangelista Mendonça Lima

    2010-02-01

    Full Text Available A escolha dos alimentos tem sido estudada por várias áreasdo conhecimento, entre elas destacando-se o Marketing, aEconomia, a Psicologia, a Nutrição, a Medicina, a Sociologiae a Antropologia. A área do Marketing e da Economiatrata da escolha de produtos, utilizando modelos na maioriaquantitativo-econométricos, ao contrário deste estudo, queutiliza a metodologia qualitativa, baseando-se na teoria daintergeracionalidade, por considerar a escolha, sobretudo ade alimentos, um fenômeno complexo. Para tanto, foram realizadasentrevistas semiestruturadas com dez mães residentesna cidade de Campo Grande/MS. A técnica utilizadapara o estudo dos dados é a análise de conteúdo. Os resultadosapontam que, além das restrições estruturais, existe apresença do fenômeno da intergeracionalidade como fatorimportante na escolha de alimentos. Sendo assim, pode-sedizer que no processo de escolha de alimentos está presentea herança simbólica recebida, principalmente da mãe, influenciandoas atuais escolhas dos indivíduos por alimentos.

  7. El mercado de los alimentos funcionales y los nuevos retos para la educación alimentaria - nutricional

    Directory of Open Access Journals (Sweden)

    Patricia Sedó Masís

    2002-07-01

    Full Text Available El estudio de los alimentos cobra cada día más importancia, dada la alta incidencia de enfermedades crónicas y cáncer, y el reconocimiento de que la dieta, como parte de un estilo de vida saludable, tiene un papel preponderante en la prevención y cura de enfermedades. Paralelo a la investigación de alimentos naturales, surgen nuevas corrientes en el procesamiento de alimentos, las cuales vienen a dar respuesta a las necesidades de los consumidores por adquirir productos procesados más "saludables". El mercado de alimentos procesados con supuestas propiedades benéficas y la mayor información circulante, plantea nuevos retos a la educación nutricional. El objetivo de este trabajo es, partir de una revisión bibliográfica, describir algunas de las tendencias actuales del mercado de alimentos con características "funcionales", su Influencia en el comportamiento del consumidor, y los nuevos retos que significa esta situación para la educación alimentaria nutricional en Costa Rica.

  8. Intervención educativa sobre alimentación y nutrición en manipuladores de alimentos

    Directory of Open Access Journals (Sweden)

    Bertha Nieves Domínguez Fernández

    2015-01-01

    Full Text Available Se realizó un estudio experimental de intervención educativa sobre conocimientos de alimentación y nutrición, en manipuladores de alimentos de unidades estatales y trabajadores por cuenta propia del municipio de Puerto Padre, en el período comprendido entre el 15 de agosto y el 31 de diciembre de 2012; con el objetivo de incrementar el conocimiento de los mismos sobre aspectos de la alimentación, que revisten gran importancia para la salud comunitaria. El universo estuvo constituido por los trabajadores gastronómicos del municipio de Puerto Padre y la muestra formada por 50 de ellos, seleccionados de forma aleatoria simple. El estudio se realizó en tres etapas: diagnóstico, intervención y evaluación. Se exploraron los conocimientos sobre la clasificación de los alimentos desde el punto de vista sanitario y por su naturaleza, adecuada nutrición, factores que influyen en la contaminación de los alimentos, enfermedades trasmitidas por agua y alimentos contaminados y medidas para prevenir la transmisión de estas enfermedades. Antes de la intervención los manipuladores de alimentos tenían escasos conocimientos sobre estos aspectos y después de la actividad educativa sus conocimientos se incrementaron

  9. RESISTENCIA A ANTIBIOTICOS DE BACTERIAS AISLADAS DE BIOPELÍCULAS EN UNA PLANTA DE ALIMENTOS

    Directory of Open Access Journals (Sweden)

    María Vanegas L

    2009-08-01

    Full Text Available Objetivo. Evaluar la resistencia a antibióticos y la capacidad de formación de biopelículas de bacterias aisladas en una planta de producción de alimentos. Materiales y métodos. Se tomaron muestras de 3 zonas diferentes, en una planta procesadora de alimentos; en la lavadora de canastas, la mesa de producción y en la banda empacadora. Se aislaron e identificaron las bacterias presentes en cada una de las tres zonas y se determinó la capacidad formadora de biopelículas por medio de cuantificación celular. Asimismo se evaluó la resistencia de cada una de las bacterias aisladas frente a ocho diferentes antibióticos. Resultados. Se recuperaron 29 cepas, correspondientes a 13 géneros diferentes, los cuales fueron todos formadores de biopelículas. Se encontró que cerca del 50% de las bacterias aisladas fueron resistentes a antibióticos como la penicilina G y vancomicina. Adicionalmente se evidenció un alto grado de multirresistencia a los diferentes antibióticos. Conclusiones. La alta multirresistencia encontrada a antibióticos entre las bacterias analizadas podría ser un problema para salud pública ya que pueden ser transmitidas por alimentos. De igual manera es de gran importancia la capacidad de producción de biopelículas de la microbiota analizada así como la alta concentración de bacterias entéricas y ambientales, lo que sugiere deficiencia del programa de limpieza y desinfección de la planta.

  10. Tecnologías emergentes para la conservación de alimentos sin calor

    Directory of Open Access Journals (Sweden)

    Fernández Molina, Juan José

    2001-01-01

    Full Text Available Not available

    Se han investigado los principios básicos de tres tecnologías emergentes para pasteurizar y esterilizar alimentos sin empleo del calor Mediante numerosos estudios se ha comprobado la efectividad de los campos eléctricos pulsantes de alta intensidad (CEPAI, los pulsos de luz (PL y los campos magnéticos oscilantes (CMO en la destrucción de microorganismos y enzimas de sistemas alimentarios. En la inactivación microbiana por CEPA!, el blanco principal es la membrana celular que, al ser sometida a campos eléctricos de alta intensidad, se hace permeable formando huecos o poros cuyo tamaño se incrementa a medida que aumenta la intensidad del campo eléctrico o el tiempo de tratamiento o se reduce la resistencia iónica del medio de pulsación. Por otra parte, los PL inducen reacciones fotoquímicas y fototérmicas en los alimentos, causando la muerte de gran cantidad de microorganismos, especialmente en productos alimenticios envasados. Los CMO producen simulación o inhibición en el crecimiento y reproducción de los microorganismos, un simple pulso de intensidad de 5-10 teslas y frecuencias de 5-500 kHz es suficiente para reducir el número de microorganismos en un mínimo de 2 ciclos logarítmicos. Se ha comprobado que estas tecnologías alargan la vida de anaquel de diversos productos alimenticios y pueden ser consideradas como sustitutos parciales de los procesos convencionales de pasteurización y esterilización de alimentos por tratamientos térmicos.

  11. Resistencia antimicrobiana de Salmonella spp aislada de alimentos de origen animal para consumo humano

    Directory of Open Access Journals (Sweden)

    Adriana Quesada

    2016-01-01

    Full Text Available Objetivos. Analizar la información disponible sobre la resistencia antimicrobiana de aislamientos de Salmonella spp de alimentos de origen animal para consumo humano en América Latina. Materiales y métodos. Se realizó una revisión sistemática de estudios epidemiológicos observacionales realizados en América Latina entre los años 2003 y 2014 en las bases de datos PubMed y LILACS. Se excluyeron estudios realizados como parte de estudio de brotes o casos de infecciones en humanos. Tres revisores de forma independiente participaron en la selección de estudios. Además, se realizó la evaluación de calidad a los estudios incluidos. Resultados. Un total de 25 estudios cumplieron con los criterios de inclusión. Los estudios incluidos fueron realizados en Brasil, México, Colombia, Argentina y Venezuela. Los aislamientos de Salmonella spp se obtuvieron principalmente de alimentos de origen avícola, porcino y vacuno, siendo Salmonella typhimurium y Salmonella enteritidis los serotipos que se aislaron con mayor frecuencia (17 y 11 estudios, respectivamente. En 23 de los estudios, Salmonella spp fue resistente a más de un antibiótico, incluyendo ácido nalidíxico, estreptomicina, tetraciclina, cloranfenicol, ampicilina, trimetoprim/sulfametoxazol, gentamicina, ciprofloxacina y cefalosporinas. Conclusiones. Los aislamientos de Salmonella spp obtenidos de alimentos de origen animal para consumo humano en los países analizados presentan con frecuencia resistencia a múltiples antibióticos. Es importante que más países en América Latina realicen y publiquen estudios sobre la resistencia de Salmonella spp para establecer y monitorear estrategias de control adecuadas.

  12. Síntese de 1,3,5-triazinas substituídas e avaliação da toxicidade frente a Artemia Salina leach Synthesis of substituted 1,3,5-triazines and toxicity evaluation against Artemia Salina leach

    Directory of Open Access Journals (Sweden)

    Márcia Ferreira Cavalcante

    2000-02-01

    Full Text Available The synthesis of ten symmetrically and unsymmetrically substituted 1,3,5-triazines by Phase Transfer Catalysis (PTC method is described. Their toxicities were determined against Artemia salina Leach. The LD50 values have also been obtained for these compounds.

  13. Alimentos kilométricos y gases de efecto invernadero: Análisis del transporte de las importaciones de alimentos en el Estado español (1995-2007)

    OpenAIRE

    Simón Fernández, Xavier; Copena Rodríguez, Damián; Pérez Neira, David; Delgado Cabeza, Manuel; Soler Montiel, Marta

    2014-01-01

    Este trabajo analiza la presión ambiental de las importaciones alimentarias en el Estado español durante el período 1995- 2007 a través de tres indicadores biofísicos: la cantidad de alimentos importados (t), las emisiones de CO2-eq y la distancia recorrida por los alimentos o “food miles” (km). El análisis se realiza según medios de transporte (aéreo, ferrocarril, carretera y marítimo) y por países para 10 grupos de productos de la división “alimentos y animales vivos” de la Clas...

  14. Formación de derivados oxidados del colesterol en alimentos

    Directory of Open Access Journals (Sweden)

    Guardiola, F.

    1995-06-01

    Full Text Available This review focuses on the mechanisms of formation of oxysterols and factors that influence on their formation and content in foods. Aspects of growing interest because of the numerous biological effects reported for these compounds.

    Este trabajo constituye una revisión bibliográfica en donde se recogen los mecanismos de formación de los diferentes oxiesteroles, los factores que influyen en la formación de estos compuestos en alimentos y su contenido en los mismos. Aspectos de creciente interés debido a la gran cantidad de efectos biológicos descritos para estos derivados.

  15. Modelo de inventarios para control económico de pedidos en empresa comercializadora de alimentos

    OpenAIRE

    Causado Rodríguez, Edwin; Universidad del Magdalena

    2016-01-01

    En el estudio que originó este artículo se elaboró una propuesta de mejora del sistema de inventarios para una comercializadora de alimentos en la ciudad de Santa Marta, a fin de lograr una reducción en los costos de inventario y un incremento en el beneficio económico de la organización, mediante la planificación y control de las compras y ventas de los productos. El proceso aplicado consiste en la clasificación de los productos manejados por la empresa con el método ABC, de acuerdo con la i...

  16. Impacto nutricional y sensorial de un alimento infantil (papilla) adicionado con lactosuero

    OpenAIRE

    Vela Gutiérrez, Gilber; Vargas Gerardo, Flor de María; Cortés Pérez, Édgar; López Díaz, Alejandro; Flores Guillén, Leonides Elena; López Zúñiga, Erika Judith

    2011-01-01

    El objetivo del presente trabajo fue determinar el impacto sensorial y nutricional de un alimento infantil (papilla) elaborado a base de suero de leche y frutas de temporada. Se realizó un diagnóstico nutricional en la comunidad Francisco Villa, municipio de San Lucas, Chiapas, México, y, posteriormente, se alimentó a un grupo de 12 niñosen edad preescolar (3 a 6 años de edad) quienes resultaron con problemas de desnutrición. La alimentación consistió en suministrar, durante seis meses (del 1...

  17. Alimentos Transgénicos : Organismos Genéticamente Modificados (OGM)

    OpenAIRE

    Martín López, Jimena

    2016-01-01

    Los alimentos transgénicos son aquellos que proceden de un organismo modificado genéticamente. La introducción de este tipo de productos en nuestra dieta es un tema que genera controversia ya que en muchos casos no se conoce con exactitud los efectos que esta modificación puede tener en el ser humano. A lo largo de las páginas de este trabajo se explica la historia de la aparición de estos organismos gracias a procedimientos de ingeniería genética, en los que se modifican fragmentos de su ADN...

  18. SIMULACION COMPUTACIONAL DE PROCESOS DE CONGELACION Y DESHIDRATACION PARA ALIMENTOS SOLIDOS POROSOS Y LIQUIDOS NO NEWTONIANOS

    OpenAIRE

    LEMUS MONDACA, ROBERTO ALEJANDRO

    2012-01-01

    Esta Tesis Doctoral corresponde a parte de las actividades de los Proyectos FONDECYT 1070186 y 1111067, donde se utiliza la modelación matemática y la simulación computacional para describir los fenómenos de transporte de fluidos, calor y masa que ocurren en los procesos de congelación y deshidratación de alimentos sólidos porosos y líquidos no Newtonianos. En paralelo se estudian diferentes características de gran complejidad para cada proceso térmico, como son: uso de modelos conjugados ...

  19. Tecnologías emergentes para la conservación de alimentos sin calor

    OpenAIRE

    Fernández Molina, Juan José; Gustavo V. Barbosa-Cánovas; Swanson, Barry G.

    2001-01-01

    Not available

    Se han investigado los principios básicos de tres tecnologías emergentes para pasteurizar y esterilizar alimentos sin empleo del calor Mediante numerosos estudios se ha comprobado la efectividad de los campos eléctricos pulsantes de alta intensidad (CEPAI), los pulsos de luz (PL) y los campos magnéticos oscilantes (CMO) en la destrucción de microorganismos y enzimas de sistemas alimentarios. En la inactivación microbiana por CEPA!, el blanco principal es la me...

  20. Riesgos y preocupaciones sobre los alimentos transgénicos y la salud humana

    OpenAIRE

    2011-01-01

    La tecnología transgénica en la agricultura se ha visto recientemente implicada en un intenso debate entre dos corrientes opuestas. Algunas organizaciones no gubernamentales (ONG) consideran esta tecnología como de alto riesgo para la salud, el ambiente y la economía de los países no desarrollados. Por el contrario, la comunidad científica ha respaldado públicamente esta tecnología asegurando que la clave para su aceptación es la educación. Aunque los alimentos genéticamente modificados (GM) ...

  1. Consumo de alimentos y calidad de la dieta en estudiantes universitarios: Proyecto uniHcos

    OpenAIRE

    Ortiz Moncada, Rocío; Norte Navarro, Aurora; E. Jiménez Mejías; Delgado, M.; Valero, L.F.; Cancela, J.M.; ALGUACIL, J.; Martín, V.

    2014-01-01

    Antecedentes/Objetivos: La etapa universitaria se caracteriza por cambios en estilos de vida y, la alimentación es uno de los de mayor variación, especialmente en los primeros cursos. El objetivo de este estudio es describir la frecuencia de consumo de alimentos y la calidad de la dieta de los universitarios españoles. Métodos: Estudio observacional, descriptivo, transversal, multicéntrico de estudiantes universitarios de primer año participantes en el proyecto uniHcos. Población de 1363 est...

  2. Fluoruro en alimentos: contenidos, bioaccesibilidad y absorción por el epitelio intestinal.

    OpenAIRE

    ROCHA BARRASA, RENE

    2013-01-01

    El fluoruro se considera importante para la salud debido a su efecto beneficioso en la prevención de la caries dental y en el desarrollo óseo en la población infantil. Sin embargo, una ingesta excesiva produce determinadas patologías, como fluorosis dental y esquelética, incluso reducciones de las capacidades cognitivas en la población infantil. El objetivo de esta tesis doctoral es la evaluación de los contenidos de fluoruro en los alimentos, su bioaccesibilidad y su absorción por el epiteli...

  3. Extinción del derecho de alimentos del adolescente emancipado

    OpenAIRE

    Villamar Moran, Lidia Lorena

    2015-01-01

    El presente trabajo de investigación aborda una de estas situaciones detectadas en el ejercicio de la noble profesión de abogacía en los suprimidos juzgados de la Niñez y Adolescencia y actualmente en las unidades judiciales especializadas en este ámbito, relacionado a la extinción de la obligación de prestar alimentos a un menor emancipado, pues se ha encontrado un sinnúmero de casos de juicios declarados sin lugar de padres (alimentantes) que han planteado judicialmente la extinción del der...

  4. Salud dental: relación entre la caries dental y el consumo de alimentos

    OpenAIRE

    Ángel Miguel González Sanz; Blanca Aurora González Nieto; Esther González Nieto

    2013-01-01

    A pesar de que la reducción de la incidencia y prevalencia de la caries dental en muchos países se relaciona en gran medida con el uso sistemático del flúor en las pastas dentífricas y la mejora de la higiene dental, se debe tener presente la importancia de los hábitos alimentarios en la prevención primaria y secundaria de la caries dental. En este sentido, destacan los carbohidratos fermentables, determinadas características de los alimentos, la frecuencia de consumo, distintos tipos de alim...

  5. Concentración empresarial y cambio estructural: alimentos, bebidas y tabaco en México

    OpenAIRE

    Raúl Vázquez

    2015-01-01

    Este artículo analiza las características de la expansión de los grandes grupos corporativos en las industrias de alimentos, bebidas y tabaco en México, y sus posibles implica ciones para la estructura y los niveles de eficiencia del sector. La construcción de un indicador de productividad laboral para 12 ramas y 38 clases de actividad para el periodo 1994-2008 y la aplicación sobre las series obtenidas de una técnica de descomposición shift-share, permiten destacar una creciente heterogeneid...

  6. Alimentación y OGM: los alimentos transgénicos

    OpenAIRE

    2015-01-01

    El presente trabajo trata de introducir los aspectos básicos de un tema tan amplio y controvertido como es el de los alimentos transgénicos. Se empieza con una introducción para comprender como los avances de la biotecnología han dado lugar a la aparición de los organismos genéticamente modificados (OGM) y como las investigaciones han evolucionado desde ese momento hasta la actualidad. Se habla de los diferentes tipos de OGM y sus aplicaciones, de la transformación de las plantas transgénicas...

  7. Mecanismos de transporte y toxicidad intestinal de especies de mercurio presentes en los alimentos

    OpenAIRE

    Vázquez San Antonio, Marta

    2014-01-01

    El mercurio es un metal tóxico ampliamente distribuido en el medioambiente. Las formas químicas mayoritarias en los alimentos son el mercurio mercúrico [Hg(II)] y el metilmercurio (CH3Hg). La principal vía de exposición para el ser humano la constituye la dieta, siendo los productos pesqueros los que mayor aporte de mercurio realizan. Teniendo en cuenta que la principal vía de exposición al mercurio es la oral, el tracto gastrointestinal se considera la puerta de entrada de este tóxico al org...

  8. Elaboración de un alimento funcional a base de Saccharomyces boulardii e inulina

    OpenAIRE

    Zamora Vega, Rafael

    2013-01-01

    En el presente trabajo se evaluó la viabilidad de la levadura probiótica Saccharomyces boullardii sin encapsular y encapsulada en queso fresco, con el objetivo de proteger al probiótico de la degradación con el fin de garantizar un mayor número de levaduras viables en el alimento funcional de acuerdo a lo estipulado por la FAO. El probiótico fue encapsulado con una mezcla de hidrocoloides de alginato de sodio, mucílago de nopal e inulina empleando la técnica de emulsión, donde fueron estudiad...

  9. COMPETENCIA INTRA-INDUSTRIA, AGLOMERACIONES REGIONALES Y CRECIMIENTO ECONÓMICO: CASO INDUSTRIA DE ALIMENTOS

    OpenAIRE

    ANDRÉS CAMACHO MURILLO; HECTOR RÍOS HERNÁNDEZ

    2011-01-01

    El artículo analiza la incidencia que ha tenido la competencia intra-industria y las aglomeraciones empresariales a nivel regional en el crecimiento económico de la industria de fabricación de alimentos de Colombia. El estudio se basa en las teorías de la transferencia de conocimientos entre empresas. Se trabaja con información estadística del DANE e información financiera de la Superintendencia de Sociedades, periodo 1979-2007. Estimando una función de producción de tipo Cobb-Douglas c...

  10. Aflatoxinas e ocratoxina A em alimentos e riscos para a saúde humana

    Directory of Open Access Journals (Sweden)

    Eloisa Dutra Caldas

    2002-06-01

    Full Text Available OBJETIVOS: A presença de micotoxinas em alimentos tem sido correlacionada a várias patologias humanas, e as autoridades de saúde no mundo todo têm implementado ações para diminuir a ingestão desses compostos pela dieta. Realizou-se pesquisa para analisar os níveis de aflatoxinas e ocratoxina A de alimentos para consumo e avaliar o potencial de risco da exposição humana a essas micotoxinas. MÉTODOS: Foram analisadas 366 amostras de alimentos consumidos no Distrito Federal, no período de julho de 1998 a dezembro de 2001, como amendoim e derivados, castanhas, milho, produtos de trigo e/ou aveia, arroz e feijão. As amostras foram processadas, e as micotoxinas extraídas, detectadas e quantificadas por fluorescência após separação em cromatografia camada delgada. RESULTADOS: Foram detectadas aflatoxinas em 19,6% das amostras, em amendoim cru e derivados, milho de pipoca, milho em grão e castanha-do-pará (>2 mig/kg. Amendoim e derivados apresentaram maior incidência de contaminação por aflatoxinas (34,7% com amostras contendo até 1.280 mig/kg de AFB1+AFG1 e 1.706 mig/kg de aflatoxinas totais. Das amostras positivas, AFB1 estava presente em 98,5%, AFB2 em 93%, AFG1 em 66,7% e AFG2 em 65,4%. A ocratoxina A não foi detectada (<25 mig/kg em nenhuma amostra analisada. CONCLUSÃO: Os níveis de contaminação encontrados em amendoim e derivados ultrapassaram os níveis máximos permitidos pela legislação brasileira, podendo significar fator de risco para a população que os consome regularmente. A conscientização dos produtores de alimentos e as ações de vigilância sanitária permanentes são essenciais para diminuir a exposição humana a esses compostos e prevenir doenças crônicas advindas dessa exposição.

  11. Aflatoxinas e ocratoxina A em alimentos e riscos para a saúde humana

    Directory of Open Access Journals (Sweden)

    Caldas Eloisa Dutra

    2002-01-01

    Full Text Available OBJETIVOS: A presença de micotoxinas em alimentos tem sido correlacionada a várias patologias humanas, e as autoridades de saúde no mundo todo têm implementado ações para diminuir a ingestão desses compostos pela dieta. Realizou-se pesquisa para analisar os níveis de aflatoxinas e ocratoxina A de alimentos para consumo e avaliar o potencial de risco da exposição humana a essas micotoxinas. MÉTODOS: Foram analisadas 366 amostras de alimentos consumidos no Distrito Federal, no período de julho de 1998 a dezembro de 2001, como amendoim e derivados, castanhas, milho, produtos de trigo e/ou aveia, arroz e feijão. As amostras foram processadas, e as micotoxinas extraídas, detectadas e quantificadas por fluorescência após separação em cromatografia camada delgada. RESULTADOS: Foram detectadas aflatoxinas em 19,6% das amostras, em amendoim cru e derivados, milho de pipoca, milho em grão e castanha-do-pará (>2 mig/kg. Amendoim e derivados apresentaram maior incidência de contaminação por aflatoxinas (34,7% com amostras contendo até 1.280 mig/kg de AFB1+AFG1 e 1.706 mig/kg de aflatoxinas totais. Das amostras positivas, AFB1 estava presente em 98,5%, AFB2 em 93%, AFG1 em 66,7% e AFG2 em 65,4%. A ocratoxina A não foi detectada (<25 mig/kg em nenhuma amostra analisada. CONCLUSÃO: Os níveis de contaminação encontrados em amendoim e derivados ultrapassaram os níveis máximos permitidos pela legislação brasileira, podendo significar fator de risco para a população que os consome regularmente. A conscientização dos produtores de alimentos e as ações de vigilância sanitária permanentes são essenciais para diminuir a exposição humana a esses compostos e prevenir doenças crônicas advindas dessa exposição.

  12. Vigilancia de enfermedades transmitidas por alimentos en el Perú 2007

    OpenAIRE

    Zamudio, María; Arias, Isabel; Luna, Miguel; Valenzuela, Aydee; Segovia, Elizabeth; Villanueva, Edith

    2008-01-01

    El propósito del Sistema Nacional de Vigilancia Epidemiológica en Salud Pública, (SINAVESP) es prevenir, controlar daños y reducir la carga de morbilidad y mortalidad en el Perú. Esta constituido por la Red Nacional de Epidemiología (RENACE), conformado por 7360 unidades notificantes descentralizados en 33 regiones y 108 cabeceras de red. La Dirección General de Salud Ambiental (DIGESA), es responsable de la vigilancia sanitaria de alimentos y bebidas. A través de la Dirección de Higiene d...

  13. XILITOL: UM ADOÇANTE ALTERNATIVO PARA A INDÚSTRIA DE ALIMENTOS

    Directory of Open Access Journals (Sweden)

    SILVIO SILVéRIO DA SILVA

    2009-07-01

    Full Text Available

    RESUMO: O xilitol é um açúcar-álcool de grande valor econômico e social, devido à sua ampla utilização em vários segmentos industriais. Esta revisão pretende mostrar algumas das aplicações mais significativas do xilitol nas indústrias de alimentos, odontológica e farmacêutica. PALAVRAS – CHAVE: Xilitol; adoçante.

  14. Inocuidad microbiológica de los alimentos para animales en Costa Rica

    OpenAIRE

    Molina-Alvarado, Andrea; Granados-Chinchilla, Fabio

    2015-01-01

    En esta revisión se analizan 3 contaminantes distintos que afectan directamente la inocuidad alimentaria y que están siendo investigados constantemente en Costa Rica y forman parte de programas de vigilancia a nivel nacional e internacional. Los mismos debido a su importancia en salud humana y animal han sido investigados en alimentos para animales comercializados en Costa Rica por investigadores del Centro de Investigación en Nutrición Animal (CINA) en conjunto con otros grupos de investigac...

  15. Estratégias de inovação das MPEs peruanas de alimentos

    OpenAIRE

    2013-01-01

    Frente ao fenômeno da globalização, o desemprego e à crise econômica, a população peruana foi obrigada a procurar novas soluções para subsistir e melhorar sua qualidade de vida. Nessa problemática as micro e pequenas empresas (MPEs) representam uma oportunidade, mas, para criar valor agregado é necessário fomentar o processo de inovação. Algumas MPEs, principalmente, as do setor agroalimentar que empregam estratégias de inovação, ultimamente, baseadas no desenvolvimento de novos alimentos de ...

  16. La obligacion de alimentos en el derecho de familia alemán

    OpenAIRE

    Bover Castaño, María Pilar

    2014-01-01

    El presente artículo pretende dar una visión general acerca de la obligación de alimentos en el derecho de Familia alemán, y su regulación en el Bürgerliches Gesetzbuch (Código Civil alemán). Sintéticamente se exponen las obligaciones alimenticias entre los cónyuges durante el matrimonio y tras el divorcio, entre las parejas de hecho y entre los parientes en línea recta: de padres respecto a hijos, de hijos respecto a padres y de abuelos respecto a nietos. This paper aims to give an overal...

  17. Nutrição e saúde: o papel do ultraprocessamento de alimentos

    OpenAIRE

    Maria Laura da Costa Louzada

    2015-01-01

    Introdução: A prevalência de obesidade e doenças crônicas não transmissíveis tem aumentado em todo o mundo, enquanto as deficiências de micronutrientes continuam sendo um grave problema de saúde pública. Este cenário tem sido impulsionado, entre outros fatores, por transformações recentes no sistema alimentar global, caracterizadas principalmente pela substituição dos hábitos alimentares tradicionais pelo consumo de alimentos ultraprocessados. Objetivos: Os objetivos deste estudo são analisar...

  18. Estudio del comportamiento del consumidor de alimentos ecológicos en Castilla-La Mancha

    OpenAIRE

    Ureña Pardo, Félix

    2012-01-01

    La agricultura ecología (ae), considerada en el pasado como un elemento marginal destinado a cubrir un determinado segmento del mercado, ha cobrado importancia al materializar un enfoque que, además de brindar la posibilidad de producir alimentos seguros, propugna una actitud responsable desde el punto de vista ambiental, a la vez que cada vez existe una mayor conciencia de la relación entre alimentación y salud. El conocimiento del sector y el estudio del comportamiento del consumidor de ali...

  19. Frecuencia de parasitismo intestinal en manipuladores de alimentos de cinco ciudades de Colombia, 2008

    OpenAIRE

    2009-01-01

    El objetivo principal de este estudio fue hallar la frecuencia de parásitos intestinales en manipuladores de alimentos que laboran en restaurantes de comidas diversas para el público, ubicados en cinco ciudades capitales del país, y conocer en estos establecimientos la implementación de las buenas prácticas de manufactura como una estrategia para la disminución de la morbilidad parasitaria y como una herramienta para su prevención. Se visitaron 300 restaurantes donde se encuestaron 905 manipu...

  20. Intoxicación por alimentos, plantas y setas Poisoning by foodstuffs, plants and mushrooms

    OpenAIRE

    Pinillos, M.A. (Miguel Angel); Gómez, J.; Elizalde, J.; Dueñas, A.

    2003-01-01

    La intoxicación alimentaria se define como aquella intoxicación provocada por cualquier alimento o producto alimenticio que por contener sustancias tóxicas, gérmenes, metales, aditivos, hormonas, etc. provocan una intoxicación. Supone una parte muy importante de la Toxicología Clínica, aunque en la mayoría de las estadísticas, las toxiinfecciones alimentarias provocada por bacterias, protozoos y virus no son contabilizadas como intoxicaciones, ya que son provocadas por gérmenes y son recogida...