WorldWideScience

Sample records for alguses point aga

  1. VERBA DICENDI, SENTIENDI ET SCIENDI JA NEID SISALDAVAD KONSTRUKTSIOONID 17. SAJANDI JA 18. SAJANDI ALGUSE KIRJAKEELES

    Directory of Open Access Journals (Sweden)

    Kristiina Ross

    2010-01-01

    Full Text Available Eesti kirjakeele morfosüntaksi kujunemisel mängisid olulist osa 16.–18. sajandi vaimulikud tõlked, mille loomise käigus kohandati seni suulisena funktsioneerinud rahvakeel kirjalike kristlike tekstide nõuetele. Artiklis vaadeldakse ühe väikese morfosüntaktilise rühma arenguid sel perioodil. Analüüsitakse konstruktsioone, milles ütlemist, tajumist ja teadmist väljendavaid verbe laiendab infiniitne vorm. Kirjeldatakse niisuguseid konstruktsioone rahvalaulukeeles, eeskujukeeltes ja varases kirjakeeles ning jõutakse järeldusele, et vastavad rahvakeelsed mallid võeti kirjakeeles suhteliselt vara kasutusele tänu sellele, et eeskujukeeled pakkusid nende rakendamiseks soodsaid võimalusi. 17. sajandi alguse põhjaeesti kirjakeeles tarvitati neis konstruktsioonides läbisegi partitsiipi ja infinitiivi, sest eri murded pakkusidki eri võimalusi (tüdruk kuulis poissi laulVAT /laulMA. Partitsiipsete konstruktsioonide kirjakeelne kasutus põhjaeesti tekstides erines alguses rahvakeelsest ning selles võib oletada klassikaliste keelte eeskuju. 17. sajandi lõpus loobuti põhjaeesti kirjakeeles infinitiivsetest konstruktsioonidest partitsiipsete kasuks. Niisuguses valikus võib näha lõunaeesti mõju, aga ka soovi vältida võimalikke germanisme, millega infinitiivseid konstruktsioone võidi siduda.

  2. President Toomas Hendrik Ilvese tervitus kooliaasta alguse puhul

    Index Scriptorium Estoniae

    Ilves, Toomas Hendrik, 1953-

    2010-01-01

    Ilmunud ka: Lääne Elu 2. sept. 2010, lk. 2, pealk.: Omakeelne haridus on privileeg; Nädaline 2. sept. 2010, lk. 2, pealk.: President Toomas Hendrik Ilvese tervitus kooliaasta alguse puhul; Eesti Elu 3. sept. 2010, lk. 2,3, pealk.: Vabariigi Presidendi tervitus kooliaasta alguse puhul; Meie Kodu 8. sept. 2010, lk. 2, pealk.: President kutsus mõtlema omakeelsele haridusele. Tsitaat kõnest ilmunud ka: Järva Teataja 2. sept. 2010, lk. 2; Hiiu Leht 3. sept. 2010, lk. 2

  3. Alguses oli Piaf / Kaisa Karu

    Index Scriptorium Estoniae

    Karu, Kaisa

    2010-01-01

    Režissöör Christopher Nolani põnevusfilmis "Algus" (USA-Inglise 2010) teeb kaasa ka prantsuse näitleja Marion Cotillard. Tuntuks sai näitlejanna peaosaga režissöör Olivier Dahani filmis "Edith Piaf - elusse armunud"

  4. 21. sajandi alguse julgeolekudilemmadest / Ramon Loik

    Index Scriptorium Estoniae

    Loik, Ramon

    2006-01-01

    21. sajandi alguse julgeolekuküsimused: riikidevahelised asümmeetrilised konfliktid, rünnakuohud, tuumaterrori oht, rahvusvaheline terrorism, võitlus selle vastu, Euroopast lähtuv terrorioht. Euroopa Liidu riikide ja USA vaheliste erimeelsuste allikatest julgeoleku küsimustes

  5. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  6. Alguses oli: Arvo Pärdi juubelikuu algas etendusega Noblessi valukojas

    Index Scriptorium Estoniae

    2010-01-01

    Tõnu Kaljuste ja Peeter Jalaka lavastusest "Alguses oli", lavastuse aluseks Arvo Pärdi teosed "In Principio" ja "Miserere", 17. augustil Noblesse valukojas toimunud etendusest, muusikaline juht Tõnu Kaljuste

  7. Eesti laevaehituse uus algus / Aldur Vunk

    Index Scriptorium Estoniae

    Vunk, Aldur, 1959-

    2016-01-01

    Varasemast laevaehitusest Läänemere ida- ja kirderannikul. Laevaehitusest Läänemere idaosas 1670. aastatest 1770. aastateni. Harderite laevatehasest Pärnus. Laevaehitusest Eestimaa kubermangus 18. sajandi lõpus ja 19. sajandi alguses. Christoph Friedrich Schmidti laevaehitusest Kuressaares. Majandusliku madalseisu ajal Pärnus ehitatud laevadest. Kuramaa mõjust laevaehituse kujunemisel tööstusharuks Liivimaa kubermangudes. Harderi laevatehase taastamisest Pärnus 1840. aastatel. 1840. ja 1850. aastate laevaehitusest Eestimaal ja Narvas. Saaremaa laevaehitusest 1840. ja 1850. aastatel. Eesti soost laevameistrite ja reederite läbimurdest

  8. Näidendivõistlusel triumfeeris taas kord Martin Algus / Kaarel Kressa

    Index Scriptorium Estoniae

    Kressa, Kaarel, 1983-

    2009-01-01

    Eesti Teatri Agentuuri näidendivõistlusel sai esikoha Martin Algus näidendiga "Postmodernsed leibkonnad", teise koha Siim Nurliku kirjatükk "Kas ma olen nüüd elus" ja kolmanda koha Loone Otsa töö "Libuhunt"

  9. Alguses oli HELI ja PÄRT, siis Jalaka LAVASTUS / Riina Luik

    Index Scriptorium Estoniae

    Luik, Riina, 1962-

    2010-01-01

    Tõnu Kaljuste ja Peeter Jalaka lavastusest "Alguses oli", lavastuse aluseks Arvo Pärdi teosed "In Principio" ja "Miserere", 17. augustil Noblesse valukojas toimunud etendusest, muusikaline juht Tõnu Kaljuste. Arvo Pärdi pidunädalate ürituste loetelu

  10. Elu alguse kaitse läbi Euroopa Inimõiguste Kohtu lahendite : [magistritöö] / Ele-Liis Jõgi ; Tartu Ülikool, õigusteaduskond ; juhendaja: Ants Nõmper

    Index Scriptorium Estoniae

    Jõgi, Ele-Liis

    2008-01-01

    Elu alguse mõiste, loode kui inimolend, abordi mõiste, elu alguse kaitse kehtivas õiguses (rahvusvaheline regulatsioon, Euroopa võrrelduna teiste mandritega , Eesti, Prantsusmaa), Euroopa Inimõiguste Kohtu praktika

  11. Alguses oli Arvo Pärdi muusika ja siis tulid Jalakas ja videokunstnikud / Tiiu Laks

    Index Scriptorium Estoniae

    Laks, Tiiu, 1984-

    2010-01-01

    Tõnu Kaljuste ja Peeter Jalaka lavastusest "Alguses oli", lavastuse aluseks Arvo Pärdi teosed "In Principio" ja "Miserere", 17. augustil Noblesse valukojas toimunud etendusest, muusikaline juht Tõnu Kaljuste

  12. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  13. AGA: Interactive pipeline for reproducible gene expression and DNA methylation data analyses [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael Considine

    2015-10-01

    Full Text Available Automated Genomics Analysis (AGA is an interactive program to analyze high-throughput genomic data sets on a variety of platforms. An easy to use, point and click, guided pipeline is implemented to combine, define, and compare datasets, and customize their outputs. In contrast to other automated programs, AGA enables flexible selection of sample groups for comparison from complex sample annotations. Batch correction techniques are also included to further enable the combination of datasets from diverse studies in this comparison. AGA also allows users to save plots, tables and data, and log files containing key portions of the R script run for reproducible analyses. The link between the interface and R supports collaborative research, enabling advanced R users to extend preliminary analyses generated from bioinformatics novices.

  14. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  15. [Vene impeerium ja Baltikum. Venestus, rahvuslus ja moderniseerimine 19. sajandi teisel poolel ja 20. sajandi alguses] / Olaf Mertelsmann

    Index Scriptorium Estoniae

    Mertelsmann, Olaf, 1969-

    2015-01-01

    Arvustus: Vene impeerium ja Baltikum : venestus, rahvuslus ja moderniseerimine 19. sajandi teisel poolel ja 20. sajandi alguses. II / koostanud Tõnu Tannberg ja Bradley Woodworth. Tartu : Eesti Ajalooarhiiv, 2010

  16. Nähtamatu näitleja / Yoshi Oida, Lorna Marshall ; tõlk. Peeter Raudsepp

    Index Scriptorium Estoniae

    Oida, Yoshi

    2005-01-01

    Jaapani näitlejaYoshi Oida näitlemisest erinevates traditsioonilistes jaapani teatristiilides, aga ka lääne stiili näidendites. Katkendid tema raamatust "Nähtamatu näitleja", mille kaasautor on Lorna Marshall. "The Invisible Actor", Methuen, 1997). Algus: TMK 2004, nr.12. Järg nr. 2, lk. 27-32

  17. Esimesed läti naismaalikunstnikud 20. sajandi alguses = The first Latvian female painters in the early 20th century / Baiba Vanaga

    Index Scriptorium Estoniae

    Vanaga, Baiba, 1981-

    2014-01-01

    Läti kunstiharidusest ja kunstikoolidest 20. sajandi alguses. Naiste kunstihariduse kvaliteedist, nende mõjutajatest, kunstilisest stiilist, arenguteedest ning naiste tegelikust kohast oma aja kunstiväljal.

  18. [Vene impeerium ja Baltikum: venestus, rahvuslus ja moderniseerimine 19. sajandi teisel poolel ja 20. sajandi alguses. 1] / Toomas Karjahärm

    Index Scriptorium Estoniae

    Karjahärm, Toomas, 1944-

    2010-01-01

    Arvustus: Vene impeerium ja Baltikum : venestus, rahvuslus ja moderniseerimine 19. sajandi teisel poolel ja 20. sajandi alguses. I / koostanud Tõnu Tannberg, Bradley Woodworth. Eesti Ajalooarhiivi toimetised ; 16 (23). (Tartu : Eesti Ajalooarhiiv, 2009)

  19. The role of anthropometric, growth and maturity index (AGaMI) influencing youth soccer relative performance

    Science.gov (United States)

    Bisyri Husin Musawi Maliki, Ahmad; Razali Abdullah, Mohamad; Juahir, Hafizan; Muhamad, Wan Siti Amalina Wan; Afiqah Mohamad Nasir, Nur; Muazu Musa, Rabiu; Musliha Mat-Rasid, Siti; Adnan, Aleesha; Azura Kosni, Norlaila; Abdullah, Farhana; Ain Shahirah Abdullah, Nurul

    2018-04-01

    The main purpose of this study was to develop Anthropometric, Growth and Maturity Index (AGaMI) in soccer and explore its differences to soccer player physical attributes, fitness, motivation and skills. A total 223 adolescent soccer athletes aged 12 to 18 years old were selected as respondent. AGaMI was develop based on anthropometric components (bicep, tricep, subscapular, suprailiac, calf circumference and muac) with growth and maturity component using tanner scale. Meanwhile, relative performance namely physical, fitness, motivation and skills attributes of soccer were measured as dependent variables. The Principal Component Analysis (PCA) and Analysis of Variance (ANOVA) are used to achieve the objective in this study. AGaMI had categorized players into three different groups namely; high (5 players), moderate (88 players) and low (91 players). PCA revealed a moderate to very strong dominant range of 0.69 to 0.90 of factor loading on AGaMI. Further analysis assigned AGaMI groups as treated as independent variables (IV) and physical, fitness, motivation and skills attributes were treated as dependent variables (DV). Finally, ANOVA showed that flexibility, leg power, age, weight, height, sitting height, short and long pass are the most significant parameters statistically differentiate by the groups of AGaMI (p<0.05). As a summary, body fat mass, growth and maturity are an essential component differentiating the output of the soccer players relative performance. In future, information of the AGaMI model are useful to the coach and players for identifying the suitable biological and physiological demand reflects more comprehensive means of youth soccer relative performance. This study further highlights the importance of assessing AGaMI when identifying soccer relative performance.

  20. Comparison of Patent Claim Construction between Netherlands and Germany on Basis of AGA v. Occlutech

    NARCIS (Netherlands)

    Tsoutsanis, A.; Kau, C.

    2013-01-01

    This article provides a brief overview on how the Dutch and German courts interpret the claims of a patent. It briefly compares each national approach on the basis of the recent AGA v Occlutech litigation in both countries. The dispute between AGA and Occlutech involved socalled ‘‘occluders’’, a

  1. Screening strategies for gestational diabetes mellitus at the Aga ...

    African Journals Online (AJOL)

    Background: Universal screening strategy for gestational diabetes mellitus offers biochemical screening to all women irrespective of risk factor status while selective strategy screens only those with risk factors. The Aga Khan University Hospital adopted a selective screening protocol by consensus. This study compares both ...

  2. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    Energy Technology Data Exchange (ETDEWEB)

    Ermolayev, Vladimir [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Cohrs, Christian M. [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Mohajerani, Pouyan; Ale, Angelique [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Hrabé de Angelis, Martin [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Ntziachristos, Vasilis, E-mail: v.ntziachristos@tum.de [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany)

    2013-03-08

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1{sup Aga2/+}, animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing.

  3. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    International Nuclear Information System (INIS)

    Ermolayev, Vladimir; Cohrs, Christian M.; Mohajerani, Pouyan; Ale, Angelique; Hrabé de Angelis, Martin; Ntziachristos, Vasilis

    2013-01-01

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1 Aga2/+ , animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing

  4. Urinary tract infections at aga Khan University hospital nairobi - a ...

    African Journals Online (AJOL)

    2013-06-11

    Jun 11, 2013 ... (Uti) are normally treated empirically and urine culture is usual ordered for as a last ... symptomatic Uti in patients at aga Khan University hospital by looking at the trends of Uti ... in the context of pyelonephritis in pregnancy(9).

  5. Aga sellepärast, et on po... / Aleksandr Astrov

    Index Scriptorium Estoniae

    Astrov, Aleksandr

    2005-01-01

    Arutledes venekeelse valija hääletuskäitumise ümber juhib autor tähelepanu, et Eestis sätestab üks konkreetne seadus venelastele valimisõiguse, andes neile reaalse poliitilise jõu, teine aga piirab nende juurdepääsu ainult keele kaudu ligipääsetavatele eetikaressurssidele, mis võimaldaksid teha teadlikku valikut

  6. Nõrk või tugev raha? : mündireformid ja nende põhjused Euroopas 15. sajandi alguses / Ivar Leimus

    Index Scriptorium Estoniae

    Leimus, Ivar, 1953-

    2014-01-01

    Saksa Ordu majanduslikust pankrotist Tannenbergi lahingu järel. Katsetest olukorda lahendada. Danzigi veriselt maha surutud mündimässust, misjärel kõrgmeistril tuli siiski loobuda reformist algselt mõeldud kujul. Mündireform toimus 15. sajandi alguses ka Liivimaal. Küsimuseks jääb kuivõrd mõjutas seda kõrgmeistrile osutatud rahalinae abi. Suurem kriis Liivimaa mündinduses näib olevat alanud alles 1415. aastal. 15. sajandi algul halvenes raha peaaegu kõikjal Euroopas, kuid selle põhjused ja käik olid erinevad

  7. Hassan Aga and his Government in Algiers. The Consolidation of a Mediterranean Myth

    Directory of Open Access Journals (Sweden)

    Fernando FERNÁNDEZ LANZA

    2014-12-01

    Full Text Available This work tries to describe graphically the consolidation of a social myth in the unsettled Mediterranean of the 16th century, through a personage: the Spanish convert to Islam Hassan Aga (Azan Aga, the Sardinian renegade who succeeded Hayreddin Barbarrosa at the helms of Algiers from 1533 till his death ten years later. This was a period of intense activity, with the climax that came with the expedition of Charles to Algiers in 1541, whose spectacular defeat can be considered as the principal nucleus of the myth of this popular personage who as a Sardinian slave came to defeat the Emperor. A myth of social ascension with maquiavelical profiles of a new prince of the frontiers.

  8. KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

    Directory of Open Access Journals (Sweden)

    Saprial Saprial

    2004-11-01

    Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

  9. AGA answers complaints on burner tip prices

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that the American Gas Association has rebutted complaints that natural gas prices have dropped at the wellhead but not at the burner tip. AGA Pres. Mike Baly the an association study of the issue found that all classes of customers paid less for gas in 1991 than they did in 1984, when gas prices were at their peak. He the, the study also shows that 100% of the wellhead price decline has been passed through to natural gas consumers in the form of lower retail prices. Baly the the average cost of gas delivered to all customers classes fell by $1.12/Mcf from 1984 to 1991, which exceeds the $1.10/Mcf decline in average wellhead prices during the same period

  10. "Parim" on subjektiivne, aga kõhutundest ka ei piisa / Inga Kuusik

    Index Scriptorium Estoniae

    Kuusik, Inga, 1961-

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 13 apr. lk. 6-7. Saku Õlletehase uus finantsjuht oma tööst tubakatootja Imperial Tobacco Grupi Kesk-Aasia regiooni finantsdirektorina Kõrgõzstanis, Saku Õlletehase kapitali struktuurist, finantsdirektori rollist ettevõttes ja tööjõu värbamisest Saku Õlletehases. Lisad: Saku Õlletehas 2006: mõõdukas käibe-, aga suur kasumikasv; Tabel: Saku Õlletehase dividendimaksed 1997-2007

  11. Cardiopulmonary dysfunction in the Osteogenesis imperfecta mouse model Aga2 and human patients are caused by bone-independent mechanisms.

    Science.gov (United States)

    Thiele, Frank; Cohrs, Christian M; Flor, Armando; Lisse, Thomas S; Przemeck, Gerhard K H; Horsch, Marion; Schrewe, Anja; Gailus-Durner, Valerie; Ivandic, Boris; Katus, Hugo A; Wurst, Wolfgang; Reisenberg, Catherine; Chaney, Hollis; Fuchs, Helmut; Hans, Wolfgang; Beckers, Johannes; Marini, Joan C; Hrabé de Angelis, Martin

    2012-08-15

    Osteogenesis imperfecta (OI) is an inherited connective tissue disorder with skeletal dysplasia of varying severity, predominantly caused by mutations in the collagen I genes (COL1A1/COL1A2). Extraskeletal findings such as cardiac and pulmonary complications are generally considered to be significant secondary features. Aga2, a murine model for human OI, was systemically analyzed in the German Mouse Clinic by means of in vivo and in vitro examinations of the cardiopulmonary system, to identify novel mechanisms accounting for perinatal lethality. Pulmonary and, especially, cardiac fibroblast of perinatal lethal Aga2/+ animals display a strong down-regulation of Col1a1 transcripts in vivo and in vitro, resulting in a loss of extracellular matrix integrity. In addition, dysregulated gene expression of Nppa, different types of collagen and Agt in heart and lung tissue support a bone-independent vicious cycle of heart dysfunction, including hypertrophy, loss of myocardial matrix integrity, pulmonary hypertension, pneumonia and hypoxia leading to death in Aga2. These murine findings are corroborated by a pediatric OI cohort study, displaying significant progressive decline in pulmonary function and restrictive pulmonary disease independent of scoliosis. Most participants show mild cardiac valvular regurgitation, independent of pulmonary and skeletal findings. Data obtained from human OI patients and the mouse model Aga2 provide novel evidence for primary effects of type I collagen mutations on the heart and lung. The findings will have potential benefits of anticipatory clinical exams and early intervention in OI patients.

  12. "Vedes päi elo tulob..." = "Veest saab elu alguse..." : [luuletused] / Miikul Pahomov ; tlk. Jaan Õispuu

    Index Scriptorium Estoniae

    Pahomov, Miikul

    2006-01-01

    Sisu: "Vedes päi elo tulob..." = "Veest saab elu alguse..." ; "Ei skuup voi pajatada denguush..." = "Ei kooner rahast laulda või..." ; "Coma neicud lyydilaane..." = "Kaunis neiu, lüüdi neiu..." ; "Olizhbo purjeh..." = "Oleks puri mul..." ; "Mi om meiden lyhyd elo..." = "Mis on meie pisku elu..." ; "Sinizhed lindud..." = "Sinised linnud..." ; "Ole, kaivo, puhtaz..." = "Ole, allik, puhas..." ; "Pimedas..." = "Pimedas..." ; Ken miä olen? = Kes ma olen ; Lüüdiland = Lüüdiland ; "Sa kuna mäned, minun rahvaz..." = "Kuhu lähed sa, minu rahvas..." ; Minu kibu - minun mua = Minu valu on minu maa ; Lüüdikiel̀ = Lüüdi keel ; Dälgmäizhed = Viimased ; Kand da latv = Känd ja latv ; Kardàlaine külü = Karjala saun ; Petruskoi = Petruskoi ; "Tägä Suomen taivhan al..." = "Siinse soome taeva all..." ; Viiburin - Piiterin tiel = Viiburi - Piiteri teel

  13. A novel base change leading to Hb Vanderbilt [β89(F5)Ser→Arg, AGT>AGA].

    Science.gov (United States)

    Goodyer, Matthew J; Elhassadi, Ezzat I; Percy, Melanie J; McMullin, Mary F

    2011-01-01

    We describe a high oxygen affinity hemoglobin (Hb) variant (Hb Vanderbilt) as a result of a heterozygous novel base change from T to A at codon 89 (AGT>AGA) leading to an amino acid change from serine to arginine.

  14. The German Working Group of Obesity in Childhood and Adolescence (AGA): improving the quality of care for overweight and obese children in Germany.

    Science.gov (United States)

    Reinehr, Thomas; Holl, Reinhard W; Wabitsch, Martin

    2008-01-01

    The Working Group of Obesity in Childhood and Adolescence (AGA) comprises scientists, clinicians, and therapists dealing with obesity in children and adolescents. More than 250 pediatricians, psychiatrics, dieticians, psychologists and sports therapists are integrated. On an international level, the AGA cooperates with the European Childhood Obesity Group and the International Obesity Taskforce (IOTF) for Childhood Obesity. The aims of the AGA are to initiate clinical and scientific studies, to join diagnostic, therapeutic and scientific centers, to improve the education, to support self-help groups, and to standardize diagnostic and therapeutic procedures in the field of obesity in childhood and adolescence. The milestones in the history of the AGA are the consensus process to define overweight and obesity in Germany, the development of guidelines for diagnostic procedures and treatment of obesity in childhood and adolescence, the determination of all therapy centers for obese children and adolescents in Germany, the development of a PC software (APV) to document longitudinally diagnostic and therapeutic procedures as well as outcomes by a quality management program, the certification of therapeutic institutions, and the implementation of prevention and treatment studies. As effect of these initiatives, the quality of care in overweight children has been improved in the last years. For example, the APV quality program demonstrated an increase of diagnostic procedures such as blood pressure measurement in the last 4 years. Copyright 2008 S. Karger AG, Basel.

  15. Enzymatic liquefaction of agarose above the sol-gel transition temperature using a thermostable endo-type β-agarase, Aga16B.

    Science.gov (United States)

    Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon

    2017-02-01

    The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.

  16. Evaluation of lipid and glucose metabolism and cortisol and thyroid hormone levels in obese appropriate for gestational age (AGA) born and non-obese small for gestational age (SGA) born prepubertal Slovak children.

    Science.gov (United States)

    Blusková, Zuzana; Koštálová, Ludmila; Celec, Peter; Vitáriušová, Eva; Pribilincová, Zuzana; Maršálková, Marianna; Šemberová, Jana; Kyselová, Tatiana; Hlavatá, Anna; Kovács, László

    2014-07-01

    Obesity is the major determinant of metabolic syndrome. Being born small for gestational age (SGA) may be co-responsible. We aimed at evaluating the association between 1. obesity and 2. being born SGA and the presence of endocrine-metabolic abnormalities in prepubertal Slovak children. The study included 98 children, aged 3-10.9 years: 36 AGA-born obese children (OB), 31 SGA-born children (SGA) and 31 appropriate for gestational age born non-obese children (AGA). Fasting serum levels of glucose, total cholesterol, LDL, HDL, triglycerides, fT4, TSH, cortisol and insulin were determined. HOMA-IR was calculated. Personal data about birth weight and length and family history were collected. Actual anthropometric measurement was done. In every group, high prevalence of positive family history of metabolic disorder was found. In comparison with AGA children, OB children were taller (plevels and homeostasis model assessment for insulin resistance (HOMA-IR) (pcortisol levels (p=0.069) was noted. SGA-born children were shorter (plevels (plevels (p=0.085) and increased fT4 levels (pobese children and twice more metabolic abnormalities were present in SGA-born children in comparison with AGA-born children. SGA-born children are more prone to developing endocrine-metabolic abnormalities than non-obese children born AGA, but they are at less risk than obese AGA-born children. We should provide specialized care for obese children already in prepubertal age and pay attention to SGA-born children.

  17. Neoplasia yield and colonoscopic workload of surveillance regimes for colorectal cancer in colitis patients: a retrospective study comparing the performance of the updated AGA and BSG guidelines.

    Science.gov (United States)

    Mooiweer, Erik; van der Meulen, Andrea E; van Bodegraven, Adriaan A; Jansen, Jeroen M; Mahmmod, Nofel; Nijsten, Joyce; van Oijen, Martijn G H; Siersema, Peter D; Oldenburg, Bas

    2013-11-01

    Due to the increased risk of colorectal cancer, colonoscopic surveillance is recommended for patients with ulcerative and Crohn's colitis. Because surveillance intervals differ considerably between the recently updated American Gastroenterological Association (AGA) and British Society of Gastroenterology (BSG) guidelines, we compared the neoplasia yield and colonoscopic workload of these guidelines. Patients with inflammatory bowel disease undergoing surveillance were identified using medical records. Patients were stratified according to the BSG and AGA guidelines, and corresponding colonoscopic workload was calculated based on the risk factors present during follow-up. The incidence of colitis-associated neoplasia (CAN), defined as a low-grade dysplasia in flat mucosa or a non-adenoma-like mass, high-grade dysplasia, or colorectal cancer was compared between the risk groups of either guidelines. In total, 1018 patients with inflammatory bowel disease who underwent surveillance were identified. Using the AGA surveillance intervals, 64 patients (6%) were assigned to annual and 954 patients (94%) to biannual surveillance, resulting in 541 colonoscopies per year. The yield of CAN was 5.3% and 20.3% in the low- and high-risk groups, respectively (P = 0.02). Using the BSG surveillance intervals, 204 patients received surveillance annually (20%), 393 patients every 3 years (39%), and 421 patients every 5 years (41%), resulting in 420 colonoscopies per year, which is 22% lower than the AGA guidelines. The yield of CAN was 3.6%, 6.9%, and 10.8%, for the low-, intermediate-, and high-risk groups, respectively (P = 0.26). Although the BSG surveillance intervals offer the advantage of a lower colonoscopic workload, the risk stratification of the AGA seems superior in distinguishing patients at higher risk of CAN.

  18. An Assessment of the AGA and CCFA Quality Indicators in a Sample of Patients Diagnosed with Inflammatory Bowel Disease.

    Science.gov (United States)

    Tkacz, Joseph; Brady, Brenna L; Meyer, Roxanne; Lofland, Jennifer H; Ruetsch, Charles; Coelho-Prabhu, Nayantara

    2015-11-01

    Inflammatory bowel disease (IBD) is a chronic relapsing disease characterized by activation of the mucosal immune system and inflammation of the gastrointestinal tract. Management of IBD places a significant burden on the health care system because of the complexity of treatment, variability in patient outcomes, and chronic nature of the disease.  To investigate the American Gastroenterological Association (AGA) and Crohn's and Colitis Foundation of America's (CCFA) quality measurement sets in a sample of IBD patients. Fourteen quality measures were restated for application to a claims database and calculated using Optum Clinformatics DataMart database. Selected measures were calculated over calendar year 2011. Performance measures ranged from 0.4% for AGA measure 9, prophylaxis for venous thromboembolism, to 66.9% for AGA measure 8, testing for Clostridium difficile. CCFA outcome measures ranged from 0.6% qualifying for CCFA O10, report of fecal incontinence, to 32.9% for CCFA O1, prednisone usage. In addition to Clostridium difficile testing, the use of appropriate corticosteroid-sparing therapy (51.1%) and testing for latent tuberculosis before initiating anti-tumor necrosis factor therapy (45.0%) were the highest achieved measures. This is the first examination of IBD quality measures using administrative claims. Rates of achievement across measures were variable and likely affected by the ability to calculate certain measures with claims data. Future studies should further examine measurement of IBD quality indicators in claims data to assess the validity of claims-based analyses and to ascertain whether measure attainment translates into better overall health or IBD-related outcomes.

  19. Stapled hemorrhoidopexy: The Aga Khan University Hospital Experience

    International Nuclear Information System (INIS)

    Athar, Ali; Chawla, Tabish; Turab, Pishori

    2009-01-01

    Stapled hemorrhoidopexy for prolapsing hemorrhoids is conceptually different from excision hemorrhoidectomy. It does not accompany the pain that usually occurs after resection of the sensitive anoderm. This study was carried out to evaluate the clinical outcome of stapled hemorrhoidopexy at The Aga Khan University Hospital. A sample of 140 patients with symptomatic second-, third-, and fourth-degree hemorrhoids and circumferential mucosal prolapse underwent stapled hemorrhoidopexy from July 2002 to July 2007. They were evaluated for postoperative morbidity, analgesic requirement, and recurrence. Seventy-eight percent were males and the mean age was 45 (range 16-90) years. The mean operative time was 35 (15-78) min. The mean parenteral analgesic doses during the first 24 h were 2.1. All patients received oral analgesics alone after 24 h. No significant postoperative morbidity was observed. The mean in-patient hospital stay was 1.3 (0-5) days. Patients were followed-up for 24 (range, 2-48) months. Minor local recurrence of hemorrhoids was seen in four patients and was managed by band ligation. Stapled hemorrhoidopexy procedure was found safe, well tolerated by patients with minimal parenteral analgesic use and early discharge from the hospital. (author)

  20. Does gender affect career satisfaction and advancement in gastroenterology? Results of an AGA institute-sponsored survey.

    Science.gov (United States)

    Gerson, Lauren B; Twomey, Kay; Hecht, Gail; Lee, Linda; McQuaid, Ken; Pizarro, Theresa T; Street, Sarah; Yoshida, Cynthia; Early, Dayna

    2007-04-01

    Women comprise 19% of the American Gastroenterological Association (AGA) membership. We performed a prospective study to determine whether female gastroenterologists were less likely to achieve career advancement and satisfaction. We administered an online survey to AGA members from 2004-2006. The survey contained questions regarding effects of gender on career advancement, satisfaction with career, promotional policies, and integration of family and career. A total of 457 individuals (response rate 9% after 2 major invitations) completed the survey, including 262 (57%) women (20% in private practice, 53% in academic careers, and 27% trainees) and 195 men (23% in private practice, 58% in academic careers, and 19% trainees). The male gastroenterologists were significantly older (P careers for significantly more years (P = .002). There were no significant differences with respect to marital status, number of children, or number of hours worked between the genders. Men were more likely to achieve the rank of full professor (P = .035), and significantly more women reported that gender affected their career advancement (47% vs 9%; P careers reported less satisfaction with their careers (P = .01) and perceived more difficulty in achieving promotion and tenure. Women were more likely to choose private practice careers because of part-time options (P = .025). Equal numbers of men and women in practice reported difficulty balancing work and family life. Significantly more female than male gastroenterologists perceive that gender has affected their career advancement. Female academic gastroenterologists reported less overall career satisfaction and promotion than male academic gastroenterologists.

  1. An analysis of Canada-US natural gas trade using the AGAS energy model

    International Nuclear Information System (INIS)

    Quon, D.; Wong, S.

    1989-01-01

    The strength of AGAS is that it was structurally designed to address the primary issue of EMF9, namely the medium and long-term prospects for Canada-US natural gas trade. Consequently, it is one of the very few models with the following necessary features: (1) it treats all the regions of Canada and the United States as one continental entity, both with respect to demand and supply; (2) All regional supplies and demands are integrated. Hence, regional gas prices are endogenous; inter-regional gas flows, including Canadian-US gas exchanges, are endogenous. Models that do not have both of these features require that the answers that are being sought have to be specified exogenously. An iterative procedure can be used to reconcile unrealistic results but only with difficulty

  2. A.G.A. program gives utilities a leg up on benchmarking

    International Nuclear Information System (INIS)

    Share, J.

    1997-01-01

    In this era of downsizing, distribution companies are banding together under the aegis of the American Gas Association to improve their performance, ultimately saving money and jobs. The Best Practice Benchmarking program began in 1990 when New Orleans Public Service coordinated an effort by several utilities wanting to compare practices and data. It is not benchmarking in the traditional sense. Best Practices stresses functional rather than competitive or numerical benchmarking by focusing on what utilities have done to improve their operations. In a report on Best Practices, John Bayko, Director of System Operations for Consumers Gas in Toronto, noted these success stories: Building odorant storage and transport facilities were found to save one company $17,500 annually because it could buy odorant in bulk as opposed to 55-gallon drums. Upgrading its cathodic protection system helped a company realize a 40 percent reduction in corrosion leaks over a two-year period, saving $200,000 a year. Another company began studying partnering with contractors which would eliminate the need of a pipeline inspector in each crew. Those potential savings are over $2 million. This paper describes three other Best Practices related to worker safety, system mapping, and activity-based accounting. A.G.A.'s role is briefly discussed

  3. "Alguses oli tema üksinda, sest oli küll..." : [luuletused] / Kabir ; tlk. Doris Kareva

    Index Scriptorium Estoniae

    Kabir

    2006-01-01

    Sisu: "Alguses oli tema üksinda, sest oli küll..." ; "Kõik loodud on Kõiksuse poolt..." ; "Otsid Sa mind?..." ; "Kabir oma meele puhtaks..." ; "Pole pühades järvedes midagi muud peale vee..." ; "Otsisin kelme ja kõveraid..." ; "Ütle, vend, mida küll teha..." ; "Mis kurja on teinud su juuksed..." ; "Ära tõuse, et minna õue vaatama lilli..." ; "Sinu sünd inimesena on küps vili..." ; "Öö saatsid sa magades mööda..." ; "Pole ma hindu..." ; "Ma vaatan sind..." ; "Veskikivisid vaadeldes ; "Nähes aednikku lähenemas, õhkasid pungad..." ; "Tasa, tasa tõtta, mu meel..." ; "Ära kurvasta..." ; "Imetlusväärne on teemant..." ; "Kuula, sõber, see keha on Tema lüüra..." ; "Nagu seemnes varjul on õli..." ; "Olgugi ookean leekides..." ; "Tilka, mis lahustub meres..." ; "Jõgi ja lained on üks..." ; "Kes sa oled ja kust oled tulnud?..." ; "Kaovad kuningad, kauneimad kuningannad..." ; "Rohkem kui midagi muud..." ; "Lihalik, surelik tantsib selle ees..." ; "Väike rubiin, mida igaüks ihkab..." ; "Mine heade juurde, kus Armastatugi elab..." ; "Eksitus sulgeb väravad..." ; "Keelilt vallandub helisid..." ; "Kõik algab lahusoleku valust..." ; "Ärka, sõber! Miks ikka veel magad?..." ; "Kuu on mu kehas, kuid ise ma seda ei näe..." ; "Miks oled nii kärsitu, süda?..." ; "Kellele kuulub see flööt..." ; "Kui raske on Külalist kohata!..." ; "Kandetool toodi minule järgi mu isakoju..." ; "Siia ilma sündides nutsid..." ; "Oh mu süda! Ei jõudnud sa tundma õppida..." ; "Õige kulunud on sinu rüü..." ; "Õhkõrn on see õhuke rüü..." ; "Lipp, mida keegi ei näe..." ; "Oh otsija, lihtne liit lähim on südamele..." ; "Õhtu varjud on sügavaks saanud..." ; "Kuis saakski katkeda armastus me kahe vahel..." ; "Luik, tahaksin, et mulle räägiksid kõik oma loo..." ; "Kuhu ihaled küll, minu süda?..." ; "Ei lakka Lõpmatu flöödiheli..." ; "Mida näed, seda pole...". Autori kohta eluloolisi andmeid lk. 11

  4. Kuriteokatse võrdlev käsitlus kriminaalkoodeksis ja karistusseadustikus : [bakalaureusetöö] / Vaho Vahkal ; Õigusinstituut ; juhendaja: Priit Pikamäe

    Index Scriptorium Estoniae

    Vahkal, Vaho

    2002-01-01

    Kuriteokatse käsitlus kriminaalkoodeksis, karistusseadustikus, süüteokaitse käsitlemine Saksa õigusteoorias ja seosed Eesti karistusseadustikuga, süüteokatse alguse määratlemine, katse alguse käsitlemine karistusseadustikus

  5. Morbility, clinical data and proteomic analysis of IUGR and AGA newborns at different gestational ages

    Directory of Open Access Journals (Sweden)

    M.D. Ruiz-González

    2016-12-01

    Full Text Available The data are related to the proteomic analysis of 43 newborns with intrauterine growth retardation (IUGR and 45 newborns with appropriate weight for gestational age (AGA carried out by separation via 2DE and analyzed by MS–TOF/TOF. All newborns were separated into three gestational age groups, "Very Preterm" 29–32 weeks, "Moderate Preterm" 33–36 weeks, and, "Term" ≥37weeks. From each newborn, blood was drawn three times from birth to 1 month life. High-abundant serum proteins were depleted, and the minority ones were separated by 2DE and analyzed for significant expression differences. The data reflect analytic and clinic variables analyzed globally and categorized by gestational age in relation to IUGR and the optimization of conditions for 2-DE separation. The data from this study are related to the research article entitled "Alterations of Protein Expression in Serum of Infants with Intrauterine Growth Restriction and Different Gestational Ages" (M.D. Ruis-González, M.D. Cañete, J.L. Gómez-Chaparro, N. Abril, R. Cañete, J. López-Barea, 2015 [1]. The present dataset of serum IUGR newborn proteome can be used as a reference for any study involving intrauterine growth restriction during the first month of life.

  6. Füüsika Higgsi bosoni lugu

    CERN Document Server

    Hektor, Andi

    2013-01-01

    Eesti osakestefüüsikud Andi Hektor ja Kristjan Kannike on kirjutanud kaheksanda „Looduse raamatukogu” sarja raamatu füüsikast ja Higgsi bosonist, nende oma sõnade järgi 2012. aasta ja vahest kogu 21. sajandi alguse teadusuudiste suurimast kangelasest. Aga miks peaks üldse mõtlema Higgsi bosonist ? osakesest, mis kaalub imevähe ja pärast sündi kohe laguneb? „Kas seepärast, et Briti füüsikateoreetik Peter Higgs ärkas nelikümmend kaheksa aastat igal hommikul lootusega, et tema ennustatud osake on lõpuks ometi avastatud? Või on põhjus hoopis selles, et tuhanded teadlased töötasid aastakümneid selle nimel, et laboris mõned Higgsi bosonid tekitada ja nende murdosa sekundist kestev olemasolu ära mõõta?” küsivad autorid. Ja vastavad: „Too osake on osakestefüüsikute jaoks justkui täpp i peal. Ilma selle täpita, mille kindlakstegemine võttis aastakümneid, polnud sugugi kindel, kas meie arusaamine maailma algtõdedest on ikka õige.” Et selgitada Higgsi bosoni auväärset rol...

  7. The effect of a knowledge-based ergonomic intervention amongst administrators at Aga Khan University Hospital, Nairobi.

    Science.gov (United States)

    Wanyonyi, Nancy; Frantz, Jose; Saidi, Hassan

    2015-01-01

    Low back pain (LBP) and neck pain are part of the common work-related musculoskeletal disorders with a large impact on the affected person. Despite having a multifactorial aetiology, ergonomic factors play a major role thus necessitating workers' education. To determine the prevalence of ergonomic-related LBP and neck pain, and describe the effect of a knowledge-based ergonomic intervention amongst administrators in Aga Khan University Hospital, Nairobi. This study applied a mixed method design utilizing a survey and two focus group discussions (FGD). A self-administered questionnaire was distributed to 208 participants through systematic sampling. A one hour knowledge-based ergonomic session founded on the survey results was thereafter administered to interested participants, followed by two FGDs a month later with purposive selection of eight participants to explore their experience of the ergonomic intervention. Quantitative data was captured and analyzed using SPSS by means of descriptive and inferential statistics, whereas thematic content analysis was used for qualitative data. Most participants were knowledgeable about ergonomic-related LBP and neck pain with a twelve month prevalence of 75.5% and 67.8% respectively. Continual ergonomic education is necessary for adherence to health-related behaviours that will preventwork-related LBP and neck pain.

  8. Kuhu on Tiiger tänaseks jõudnud? / Enel Mägi

    Index Scriptorium Estoniae

    Mägi, Enel

    2003-01-01

    Autor teeb ülevaate Tiigrihüppe programmi raames saavutatust alates 1997. aastast ja edasist arengut takistavatest teguritest, mille tõttu Tiigrihüppe Pluss programm on hakanud venima. Diagrammid: õpilaste ja arvuti suhe maakonniti 2003. a. alguses; internetiühendused Eesti koolides 2003. a. alguses; arvutite paiknemine koolis 2002. a. lõpus

  9. Quaternary selenostannates Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs) through rapid cooling of melts. Kinetics versus thermodynamics in the polymorphism of AGaSnSe{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S -J; Iyer, R G; Kanatzidis, M G

    2004-10-01

    The quaternary alkali-metal gallium selenostannates, Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs), were synthesized by reacting alkali-metal selenide, Ga, Sn, and Se with a flame melting-rapid cooling method. Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} crystallizes in the non-centrosymmetric space group C2 with cell constants a=13.308(3) A, b=7.594(2) A, c=13.842(3) A, {beta}=118.730(4) deg., V=1226.7(5) A{sup 3}. {alpha}-KGaSnSe{sub 4} crystallizes in the tetragonal space group I4/mcm with a=8.186(5) A and c=6.403(5) A, V=429.1(5) A{sup 3}. {beta}-KGaSnSe{sub 4} crystallizes in the space group P2{sub 1}/c with cell constants a=7.490(2) A, b=12.578(3) A, c=18.306(5) A, {beta}=98.653(5) deg., V=1705.0(8) A{sup 3}. The unit cell of isostructural RbGaSnSe{sub 4} is a=7.567(2) A, b=12.656(3) A, c=18.277(4) A, {beta}=95.924(4) deg., V=1741.1(7) A{sup 3}. CsGaSnSe{sub 4} crystallizes in the orthorhombic space group Pmcn with a=7.679(2) A, b=12.655(3) A, c=18.278(5) A, V=1776.1(8) A{sup 3}. The structure of Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} consists of a polar three-dimensional network of trimeric (Sn,Ga){sub 3}Se{sub 9} units with Na atoms located in tunnels. The AGaSnSe{sub 4} possess layered structures. The compounds show nearly the same Raman spectral features, except for Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6}. Optical band gaps, determined from UV-Vis spectroscopy, range from 1.50 eV in Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} to 1.97 eV in CsGaSnSe{sub 4}. Cooling of the melts of KGaSnSe{sub 4} and RbGaSnSe{sub 4} produces only kinetically stable products. The thermodynamically stable product is accessible under extended annealing, which leads to the so-called {gamma}-form (BaGa{sub 2}S{sub 4}-type) of these compounds.

  10. Excavations on the Coasts of Prehistoric and Medieval Saaremaa / Marika Mägi

    Index Scriptorium Estoniae

    Mägi, Marika, 1968-

    2006-01-01

    Viltina võimaliku sadamakoha kaevamistest. Leiti järjekordne 11. sajandi leiukompleks, seekord tüüpilistest Saaremaa naise ehetest. Pällamõisas on inimtegevus saanud alguse ilmselt I aastatuhande keskel, mil see paiknes otse mererannal. Inimtegevus Pällamõisas lakkas ilmselt keskaja alguses. 16. sajandi algul rajati sellele kohale hoonekompleks, mis juba 17. sajandil hüjati. Proovikaevamistest Tammese asulakohal

  11. Kompleksi kujunemine ja tsaariaegsed ehitised / Karin Hallas-Murula

    Index Scriptorium Estoniae

    Hallas-Murula, Karin, 1957-

    2004-01-01

    20. sajandi alguse Tallinna arhitektuurist. Pangakvartali kujunemise algus: Eestimaa Aadli Mõisate Krediitseltsi (Aadlipanga) hoone Estonia pst. 11 (1902-1904, arhitekt August Reinberg, ehituse järelevalve: Carl Jacoby, stukitöö, reljeefid: August Volz, vitraaž, vapid: Ernst Tode). Venemaa Riigipanga Tallinna osakonna hoone Estonia pst 13 (1907-1908, ehituse järelevalve: Aleksandr Jaron). Panga teenistujate elamu Sakala 6

  12. Archaeological investigations in the inner courtyard of the puppet theatre 'Nuku' / Eero Heinloo

    Index Scriptorium Estoniae

    Heinloo, Eero

    2014-01-01

    Leidude põhjal võib rääkida puithoonestusest 13. sajandist, mis 14. sajandi lõpus asendati kivihoonestusega. Aktiivsem elutegevus on antud alale iseloomulik alates 14. sajandi keskpaigast. Keskaegse hoone kohale rajati 17. sajandi alguses uus kivihoone. 19. sajandi alguses krundil asunud kivihooned lammutati ja nende asemele rajati uued kivihooned. Leidudest moodustavad enamiku importkeraamika katkendid. Muust leiuainesest võib esile tõsta puitleide

  13. Mobile Sensor System AGaMon for Breath Control: Numerical Signal Analysis of Ternary Gas Mixtures and First Field Tests

    Directory of Open Access Journals (Sweden)

    Rolf Seifert

    2018-01-01

    Full Text Available An innovative mobile sensor system for breath control in the exhaled air is introduced. In this paper, the application of alcohol control in the exhaled air is considered. This sensor system operates semiconducting gas sensor elements with respect to the application in a thermo-cyclic operation mode. This operation mode leads to so-called conductance-over-time-profiles (CTPs, which are fingerprints of the gas mixture under consideration and can be used for substance identification and concentration determination. Especially for the alcohol control in the exhaled air, ethanol is the leading gas component to be investigated. But, there are also other interfering gas components in the exhaled air, like H2 and acetone, which may influence the measurement results. Therefore, a ternary ethanol-H2-acetone gas mixture was investigated. The establishing of the mathematical calibration model and the data analysis was performed with a newly developed innovative calibration and evaluation procedure called ProSens 3.0. The analysis of ternary ethanol-H2-acetone gas samples with ProSens 3.0 shows a very good substance identification performance and a very good concentration determination of the leading ethanol component. The relative analysis errors for the leading component ethanol were in all considered samples less than 9 %. First field test performed with the sensor system AGaMon shows very promising results.

  14. Role of adiponectin and leptin on body development in infants during the first year of life

    Directory of Open Access Journals (Sweden)

    Gasparoni Antonella

    2010-03-01

    Full Text Available Abstract Background The control of growth and nutritional status in the foetus and neonate is a complex mechanism, in which also hormones produced by adipose tissue, such as adiponectin and leptin are involved. The aim of this study was to evaluate levels of adiponectin, leptin and insulin in appropriate (AGA and small for gestational age (SGA children during the 1st year of life and to correlate these with auxological parameters. Methods In 33 AGA and 29 SGA infants, weight, length, head circumference, glucose, insulin, adiponectin and leptin levels were evaluated at the second day of life, and at one, six and twelve months, during which a portion of SGA could show catch-up growth (rapid growth in infants born small for their gestational age. Results Both total and isoform adiponectin levels were comparable between AGA and SGA infants at birth and until age one year. These levels significantly increased from birth to the first month of life and then decreased to lower values at 1 year of age in all subjects. Circulating leptin concentrations were higher in AGA (2.1 ± 4.1 ng/ml than in SGA neonates (0.88 ± 1.03 ng/ml, p st and the 6th month of age, but they increased in SGA from six months to one year, when they showed catch-up growth. Circulating insulin levels were not statistically different in AGA and SGA neonates at any study time point. Insulin levels in both AGA and SGA infants increased over the study period, and were significantly lower at birth compared to one, six and 12 months of age. Conclusions During the first year of life, in both AGA and SGA infants a progressive decrease in adiponectin levels was observed, while a difference in leptin values was correlated with the nutritional status.

  15. Clinical Practice Update: The Use of Per-Oral Endoscopic Myotomy in Achalasia: Expert Review and Best Practice Advice From the AGA Institute.

    Science.gov (United States)

    Kahrilas, Peter J; Katzka, David; Richter, Joel E

    2017-11-01

    The purpose of this review is to describe a place for per-oral endoscopic myotomy (POEM) among the currently available robust treatments for achalasia. The recommendations outlined in this review are based on expert opinion and on relevant publications from PubMed and EMbase. The Clinical Practice Updates Committee of the American Gastroenterological Association proposes the following recommendations: 1) in determining the need for achalasia therapy, patient-specific parameters (Chicago Classification subtype, comorbidities, early vs late disease, primary or secondary causes) should be considered along with published efficacy data; 2) given the complexity of this procedure, POEM should be performed by experienced physicians in high-volume centers because an estimated 20-40 procedures are needed to achieve competence; 3) if the expertise is available, POEM should be considered as primary therapy for type III achalasia; 4) if the expertise is available, POEM should be considered as treatment option comparable with laparoscopic Heller myotomy for any of the achalasia syndromes; and 5) post-POEM patients should be considered high risk to develop reflux esophagitis and advised of the management considerations (potential indefinite proton pump inhibitor therapy and/or surveillance endoscopy) of this before undergoing the procedure. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  16. Promising therapies for treating and/or preventing androgenic alopecia.

    Science.gov (United States)

    McElwee, K J; Shapiro, J S

    2012-06-01

    Androgenetic alopecia (AGA) may affect up to 70% of men and 40% of women at some point in their lifetime. While men typically present with a distinctive alopecia pattern involving hairline recession and vertex balding, women normally exhibit a diffuse hair thinning over the top of their scalps. The treatment standard in dermatology clinics continues to be minoxidil and finasteride with hair transplantation as a surgical option. Here we briefly review current therapeutic options and treatments under active investigation. Dutasteride and ketoconazole are also employed for AGA, while prostaglandin analogues latanoprost and bimatoprost are being investigated for their hair growth promoting potential. Laser treatment products available for home use and from cosmetic clinics are becoming popular. In the future, new cell mediated treatment approaches may be available for AGA. While there are a number of potential treatment options, good clinical trial data proving hair growth efficacy is limited.

  17. Tallinna Planeerimine 1910. aastatel: rahvusvahelise planeerimiskonkursi ärgitajatest ja korraldajatest / Karin Hallas-Murula

    Index Scriptorium Estoniae

    Hallas-Murula, Karin, 1957-

    2014-01-01

    Uutest suundadest Tallinna linnavalitsemises 20. sajandi alguses. Tallinna Majaomanikkude Seltsist. Planeerimise asjatundjast varjunimega Vis. Kompetentsi küsimustest. Linnaplaani ettevalmistamise komisjonist.

  18. Perinatal Changes of Cardiac Troponin-I in Normal and Intrauterine Growth-Restricted Pregnancies

    Directory of Open Access Journals (Sweden)

    Nicoletta Iacovidou

    2007-01-01

    Full Text Available Intrauterine growth restriction (IUGR implies fetal hypoxia, resulting in blood flow redistribution and sparing of vital organs (brain, heart. Serum cardiac Troponin-I (cTnI, a well-established marker of myocardial ischaemia, was measured in 40 mothers prior to delivery, the doubly clamped umbilical cords (representing fetal state, and their 20 IUGR and 20 appropriate-for-gestational-age (AGA neonates on day 1 and 4 postpartum. At all time points, no differences in cTnI levels were observed between the AGA and IUGR groups. Strong positive correlations were documented between maternal and fetal/neonatal values (r≥.498, P≤.025 in all cases in the AGA and r≥.615, P≤.009 in all cases in the IUGR group. These results may indicate (a normal heart function, due to heart sparing, in the IUGR group (b potential crossing of the placental barrier by cTnI in both groups

  19. Isejuhtivate sõidukite ajastu algus

    Index Scriptorium Estoniae

    2018-01-01

    Riigikantselei strateegiabüroo tellimusel valminud isejuhtuvate sõidukite ekspertrühma raportist: isejuhtivate sõidukite sotsiaal-majanduslikud hüved ja mõjud, õigusruum, ühiskondlik omaksvõtt, eetika, ohud ja riskid

  20. Alguses oli Henrik / Juhan Kreem

    Index Scriptorium Estoniae

    Kreem, Juhan, 1971-

    2012-01-01

    Arvustus: Crusading and chronicle writing on the medieval Baltic frontier : a companion to the Chronicle of Henry of Livonia / edited by Marek Tamm, Linda Kaljundi, Carsten Selch Jensen. Farnham ; Burlington : Ashgate, 2011

  1. Süsinikuajastu alguses / Harry Alles

    Index Scriptorium Estoniae

    Alles, Harry, 1966-

    2010-01-01

    2010. aasta Nobeli keemiapreemia läks kolmele teenekale keemikule, Ühendriikide teadlasele Richard F. Heckile ning jaapanlastele Ei-ichi Negishile ja Akira Suzukile. Füüsikapreemia said Manchesteri ülikooli füüsikud, Venemaalt pärit Andre Geim ja Konstantin Novoselov

  2. A Single-Centre, Randomized, Double-Blind, Placebo-Controlled Clinical Trial to Investigate the Efficacy and Safety of Minoxidil Topical Foam in Frontotemporal and Vertex Androgenetic Alopecia in Men.

    Science.gov (United States)

    Hillmann, Kathrin; Garcia Bartels, Natalie; Kottner, Jan; Stroux, Andrea; Canfield, Douglas; Blume-Peytavi, Ulrike

    2015-01-01

    5% minoxidil formulations twice daily are effective in treating vertex male androgenetic alopecia (AGA); however, efficacy and safety data in frontotemporal regions are lacking. To assess the efficacy of 5% minoxidil topical foam (5% MTF) in the frontotemporal region of male AGA patients after 24 weeks of treatment compared to placebo treatment and to the vertex region. Seventy males with moderate AGA applied 5% MTF or placebo foam (plaTF) twice daily for 24 weeks in frontotemporal and vertex regions. Target area non-vellus hair count (TAHC) was the primary end point. Frontotemporal and vertex TAHC and target area cumulative non-vellus hair width (TAHW) showed similar responses to 5% MTF with significant increases up to week 16 compared to baseline (p < 0.001). After 24 weeks of treatment, frontotemporal TAHW increased significantly in the 5% MTF group compared to the plaTF group (p = 0.017), while TAHC showed a similar non-significant increase from baseline in both regions. At 24 weeks, 5% MTF users rated a significant improvement in scalp coverage for the frontotemporal (p = 0.016) and vertex areas (p = 0.027). 5% MTF twice a day promotes hair density and width in both frontotemporal and vertex regions in men with moderate stages of AGA. © 2015 S. Karger AG, Basel.

  3. Androgenetic alopecia in men aged 40-69 years: prevalence and risk factors.

    Science.gov (United States)

    Severi, G; Sinclair, R; Hopper, J L; English, D R; McCredie, M R E; Boyle, P; Giles, G G

    2003-12-01

    The epidemiology of androgenetic alopecia (AGA) is not fully understood. Although a strong genetic basis has long been identified, little is known of its non-genetic causes. To estimate the prevalence of and to determine risk factors for AGA in men aged 40-69 years in Australia. Men (n = 1390) were recruited at random from the electoral rolls to serve as controls in a population-based case-control study of prostate cancer. All were interviewed in person and direct observations of AGA were made. Men were grouped into the following categories; no AGA, frontal AGA, vertex AGA and full AGA (frontal and vertex AGA). Epidemiological data collected from these men were used for an analysis of risk factors for each AGA category using unconditional logistic regression with AGA category as the response variable adjusting for age, education and country of birth. The prevalence of vertex and full AGA increased with age from 31% (age 40-55 years) to 53% (age 65-69 years). Conversely, the proportion of men with only frontal AGA was very similar across all age groups (31-33%). No associations were found between pubertal growth spurt or acne, reports of adult body size at time of interview, urinary symptom score, marital status, or current smoking status or duration of smoking and the risk of any form of AGA. The consumption of alcohol was associated with a significant increase in risk of frontal and vertex AGA but not full AGA. Men with vertex AGA had fewer female sexual partners but average ejaculatory frequency did not differ between men in different AGA categories. Reported weight and lean body mass at reaching maturity at about 21 years of age were negatively associated with vertex balding (P for trend body mass at age 21 years would be worthy of further research if they were able to be replicated in other studies.

  4. Ethiopian Journal of Education and Sciences - Vol 13, No 1 (2017)

    African Journals Online (AJOL)

    Sixth order stable central difference method for self-adjoint singularly perturbed two-point boundary value problems · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Yitbarek Zeslassie, Gemechis File, Tesfaye Aga, 23-41 ...

  5. Study of the International Epidemiology of Androgenetic Alopecia in Young Caucasian Men Using Photographs From the Internet.

    Science.gov (United States)

    Avital, Yaniv Shalom; Morvay, Marta; Gaaland, Magdolna; Kemény, Lajos

    2015-01-01

    The epidemiological evaluation of androgenetic alopecia (AGA) is based mainly on direct observation and questionnaires. The international epidemiology and environmental risk factors of AGA in young Caucasian men remain unknown. To use photographs and data from the Internet to evaluate severe AGA and generate greater understanding of the international epidemiology of the disorder in young Caucasian men. A population-based cross-sectional study design was used. The sample included 26,340 Caucasian men aged 30 to 40 years who had uploaded profiles to two dating websites. Their photographs were evaluated for AGA and graded as follows: severe AGA (Norwood type VI-VII), non-severe AGA, and unknown. Epidemiological data were collected from the sites. Logistic regression was used to analyze the effect of risk factors on the prevalence of severe AGA. The overall success rate for identifying severe AGA by indirect evaluation of Internet photographs was 94%. The prevalence of severe AGA was 15.33% overall and varied significantly by geographical region. The risk of having severe AGA was increased by 1.092 for every year of age between 30 and 40 years. Severe AGA was more prevalent in subjects with higher body mass index. Photographs from the Internet can be used to evaluate severe AGA in epidemiological studies. The prevalence of severe AGA in young Caucasian men increases with age and varies by geographical region. Body mass index is an environmental risk factor for severe AGA.

  6. Study of the international epidemiology of androgenetic alopecia in young caucasian men using photographs from the internet

    Directory of Open Access Journals (Sweden)

    Yaniv Shalom Avital

    2015-01-01

    Full Text Available Background: The epidemiological evaluation of androgenetic alopecia (AGA is based mainly on direct observation and questionnaires. The international epidemiology and environmental risk factors of AGA in young Caucasian men remain unknown. Aim: To use photographs and data from the Internet to evaluate severe AGA and generate greater understanding of the international epidemiology of the disorder in young Caucasian men. Materials and Methods: A population-based cross-sectional study design was used. The sample included 26,340 Caucasian men aged 30 to 40 years who had uploaded profiles to two dating websites. Their photographs were evaluated for AGA and graded as follows: severe AGA (Norwood type VI-VII, non-severe AGA, and unknown. Epidemiological data were collected from the sites. Logistic regression was used to analyze the effect of risk factors on the prevalence of severe AGA. Results : The overall success rate for identifying severe AGA by indirect evaluation of Internet photographs was 94%. The prevalence of severe AGA was 15.33% overall and varied significantly by geographical region. The risk of having severe AGA was increased by 1.092 for every year of age between 30 and 40 years. Severe AGA was more prevalent in subjects with higher body mass index. Conclusions: Photographs from the Internet can be used to evaluate severe AGA in epidemiological studies. The prevalence of severe AGA in young Caucasian men increases with age and varies by geographical region. Body mass index is an environmental risk factor for severe AGA.

  7. Prodolzhenije sledujet / Fuad Rasulov

    Index Scriptorium Estoniae

    Rasulov, Fuad

    2007-01-01

    USA kompanii New Century Financial Corporation majandusraskustest alguse saanud krediidiasutuste kriisist, probleemidest USA riskantsemate hüpoteeklaenude ehk subprime-laenude turul, likviidsuse puudumise probleemidest

  8. Biochemical characterization and comparison of aspartylglucosaminidases secreted in venom of the parasitoid wasps Asobara tabida and Leptopilina heterotoma.

    Directory of Open Access Journals (Sweden)

    Quentin Coulette

    Full Text Available Aspartylglucosaminidase (AGA is a low-abundance intracellular enzyme that plays a key role in the last stage of glycoproteins degradation, and whose deficiency leads to human aspartylglucosaminuria, a lysosomal storage disease. Surprisingly, high amounts of AGA-like proteins are secreted in the venom of two phylogenetically distant hymenopteran parasitoid wasp species, Asobara tabida (Braconidae and Leptopilina heterotoma (Cynipidae. These venom AGAs have a similar domain organization as mammalian AGAs. They share with them key residues for autocatalysis and activity, and the mature α- and β-subunits also form an (αβ2 structure in solution. Interestingly, only one of these AGAs subunits (α for AtAGA and β for LhAGA is glycosylated instead of the two subunits for lysosomal human AGA (hAGA, and these glycosylations are partially resistant to PGNase F treatment. The two venom AGAs are secreted as fully activated enzymes, they have a similar aspartylglucosaminidase activity and are both also efficient asparaginases. Once AGAs are injected into the larvae of the Drosophila melanogaster host, the asparaginase activity may play a role in modulating their physiology. Altogether, our data provide new elements for a better understanding of the secretion and the role of venom AGAs as virulence factors in the parasitoid wasps' success.

  9. Riik on saatnud selge sõnumi / Ülle Talihärm

    Index Scriptorium Estoniae

    Talihärm, Ülle, 1964-

    2015-01-01

    Kultuuriministeeriumi toetustest rahvaraamatukogudele 2015. aastal. 2015. aasta alguses jõustus "Rahvaraamatukogude riigieelarvest finantseeritavate kulude jaotamise kord", millega vahetati välja vananenud rahastamispõhimõtted

  10. 21. sajandi linnavilla kvintessents / Risto Kozer

    Index Scriptorium Estoniae

    Kozer, Risto

    2008-01-01

    Nihkes korrustega linnavilla Tartus Jõekaare elamurajoonis Siili t. 6. Arhitektid: Thomas Pucher, Alfred Bramberger (Atelier Thomas Pucher & Bramberger Architects). Loetletud 8 kaasautorit. Ehituse algus 2007

  11. BIBLIOMETRICS ON ONE OF THE LARGEST TERMITE INVENTORIES IN THE CERRADO: "STUDIES ON TERMITES FROM THE MATO GROSSO STATE, BRAZIL BY AGA MATHEWS 1977"

    Directory of Open Access Journals (Sweden)

    HÉLIDA FERREIRA DA CUNHA

    2015-01-01

    Full Text Available ABSTRACT This paper consists on a bibliometric analysis of the international influences of the book "Studies on termites from the Mato Grosso State, Brazil", by AGA Mathews (1977. The number of citations has increased over the years after the first citation. Mathews book was cited in articles, reviews, theses, dissertations, books, book chapters, abstracts in conference proceedings, comments and scientific notes. Most these studies are empirical and descriptive. The studies were conducted in 35 countries of the Neotropical, Palearctic, Afrotropical, Nearctic, Australasia and Indomalaya regions. 55% of the studies were carried out in Brazil. The journals Sociobiology and Insectes Sociaux, have social insect studies within its scope, and the highest number of articles citing Mathews. Most of the 71 authors that cited Mathews more than twice are Brazilian. Constrictotermes cyphergaster was the most studied in over 80% of the studies addressing Isoptera. The most frequent keywords were termite, Isoptera and taxonomy, generalist terms indexed in most publications carried out in different countries. Most of the research studies were carried out in laboratories and native vegetation areas. Studies in agroecosystems were implemented predominantly in Brazil. This study shows the diversity of application (citations of Mathews' book, and that the number of citations will continue to increase due to the large amount of information presented by the author.

  12. The principle of state sovereignty in the Agreement on the Guarani Aquifer and legal problems specific to Argentina; El principio de la soberania estatal en el Acuerdo sobre el Acuifero Guarani. Problemas juridicos particulares de la Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Apesteguia, G. J.

    2012-11-01

    The Agreement on the Guarani Aquifer (AGA) devotes its first three articles specifically to the state sovereignty of the parties with regard to the Guarani Aquifer System (GAS). The AGA reveals its intention to establish two inherent points concerning dominion over the water resource in question: the first refers to the ownership of the GAS by the parties involved (without the Agreements expressly alluding in its Art. 1 to the territorial scope of this dominion, as it does in the following point), and the second refers to the implementation of the law, which, according to Art. 2, subordinates it to constitutional and legal requirements and pursuant to the rules of applicable international law, a passage which leaves us with two questions: Does it entail an order of regulatory precedence? is international law reduced to the observance of legal precedents? For Argentina, the ruling in Art. 2 of the AGA will require great efforts to reconcile its legislative and judicial criteria on the two points mentioned: ownership and the environmental aspects of the different activities allowed on the surface above the GAS. In my opinion, Argentina must tackle the following legal issues: a) To amend the Civil Code (resolving the matter of the extent of the private dominion belonging to the owner of the ground above the groundwater); b) To legislate on aquifers at the federal level, bearing in mind the existing state norms; c) To restrict the access to and use of the GAS to the local people, being as it is the only resource of water for many communities. (Author)

  13. Afganistan : õnnestumine on endiselt võimalik / Indrek Elling

    Index Scriptorium Estoniae

    Elling, Indrek, 1970-

    2007-01-01

    Tartus Balti Kaitsekolledzhis NATO Afganistani-missioonile keskenduva konverentsi alguse puhul kirjutab autor, kuidas peaks rahvusvaheline üldsus Afganistanis käituma, et lahendada riigi keeruline olukord

  14. Kodaniku Infoportaal lihtsustab inimese suhtlust riigiga

    Index Scriptorium Estoniae

    2002-01-01

    Aprilli alguses tutvustasid teede- ja sideminister Liina Tõnisson ning AS Baltic Computer Systems nõukogu esimees Ants Sild avalikkusele Kodaniku Infoportaali (KIT - kodaniku infotehnoloogiline keskkond) projekti

  15. Hirmu pildid : puuduvatest valdkondadest Eesti visuaalkultuuris / Peeter Linnap

    Index Scriptorium Estoniae

    Linnap, Peeter, 1960-

    2007-01-01

    Pildid, mis tekitavad hirmu. Kontroll informatsiooni üle ja selle filtreerimine. Eesti pildihirmu spetsiifikast. 19 sajand - algus visuaalsele peitemängule Eestis. Ühiskondliku ebavõrdsuse varjamisest ja kuvamisest Eestis. 1940. aastate õudused: eestlaste suurim diasporaa pildis. Karl Nikolai Hintzeri ja Donald Koppeli sõjafotodest. Sööst tundmatusse: Eric Soovere põgenemisfotod 1944-1949. Küüditamise fotod: Ants Leitmäe Siber 1949-1959. Metsavendade fotod. 1990. aastate algus - selge pilgu naasmine kujutamisse. Kollektiivse kaotuse trauma Peeter Toominga/Carl Sarapi projektis "55 aastat hiljem" (1937/1992). Jüri Liimi lõpukaadrid ENSVst (1990-1992). Hirmu pildid skoopilise kontrolli ajastul - pronksiöö paradoksaalseid kuvandeid 2007.a. Järgneb 2007, nr. 26, lk. 30-35

  16. Response to microneedling treatment in men with androgenetic alopecia who failed to respond to conventional therapy

    Directory of Open Access Journals (Sweden)

    Rachita Dhurat

    2015-01-01

    Full Text Available Introduction: The efficacy of conventional therapy viz. finasteride and minoxidil in androgenetic alopecia (AGA that is based on both preventing hair loss and promoting new hair growth, varies between 30% and 60%. This has led to a large number of patients unsatisfied who demand for a better cosmetic coverage over the scalp. Microneedling has recently been reported to be promising, effective and a safe treatment modality in the treatment of AGA. This augments the response of conventional therapy. Materials and Methods: Four men with AGA were on finasteride and 5% minoxidil solution since 2 to 5 years. Though there was no worsening in their respective AGA stages with the therapy, they showed no new hair growth. They were subjected to microneedling procedure over a period of 6 months along with their ongoing therapy. Patients were assessed with the use of the standardized 7-point evaluation scale and patients′ subjective hair growth assessment scale. The patients were followed up for 18 months post microneedling procedure to assess the sustainability of the response. Results: All patients showed a response of + 2 to + 3 on standardized 7-point evaluation scale. The response in the form of new hair growth started after 8-10 sessions. The patients′ satisfaction was more than 75% in three patients and more 50% in one patient, on patients′ subjective hair growth assessment scale. The obtained results were sustained post procedure during 18 months follow-up period. Conclusion : Treatment with microneedling showed an accelerated response with addition of microneedling procedure leading to significant scalp density. This is the first case series to report the boosting effect of microneedling with respect to new hair follicle stimulation in patients with androgenetic alopecia who were poor responders to conventional therapy.

  17. Management of Clostridium difficile Infection in Inflammatory Bowel Disease: Expert Review from the Clinical Practice Updates Committee of the AGA Institute.

    Science.gov (United States)

    Khanna, Sahil; Shin, Andrea; Kelly, Ciarán P

    2017-02-01

    The purpose of this expert review is to synthesize the existing evidence on the management of Clostridium difficile infection in patients with underlying inflammatory bowel disease. The evidence reviewed in this article is a summation of relevant scientific publications, expert opinion statements, and current practice guidelines. This review is a summary of expert opinion in the field without a formal systematic review of evidence. Best Practice Advice 1: Clinicians should test patients who present with a flare of underlying inflammatory bowel disease for Clostridium difficile infection. Best Practice Advice 2: Clinicians should screen for recurrent C difficile infection if diarrhea or other symptoms of colitis persist or return after antibiotic treatment for C difficile infection. Best Practice Advice 3: Clinicians should consider treating C difficile infection in inflammatory bowel disease patients with vancomycin instead of metronidazole. Best Practice Advice 4: Clinicians strongly should consider hospitalization for close monitoring and aggressive management for inflammatory bowel disease patients with C difficile infection who have profuse diarrhea, severe abdominal pain, a markedly increased peripheral blood leukocyte count, or other evidence of sepsis. Best Practice Advice 5: Clinicians may postpone escalation of steroids and other immunosuppression agents during acute C difficile infection until therapy for C difficile infection has been initiated. However, the decision to withhold or continue immunosuppression in inflammatory bowel disease patients with C difficile infection should be individualized because there is insufficient existing robust literature on which to develop firm recommendations. Best Practice Advice 6: Clinicians should offer a referral for fecal microbiota transplantation to inflammatory bowel disease patients with recurrent C difficile infection. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  18. How the Estonian communists lost their war against the Finnish television : the documents of the Estonian State Archive reveal the historical truth / Olga Zhurjari, Peeter Vares

    Index Scriptorium Estoniae

    Zhurjari, Olga

    2000-01-01

    EKP võitlusest soome televisiooniga, mis jõudis haripunkti 1980-ndate alguses, kui keelati avalikes kohtades soome televisiooni vaatamine, üritati kontrollida soome telekanalite vaatamist kodudes jne

  19. The Open-air Art Museum at Pedvĺe : the interrelations of contemporary art projects and the local environment / Ruta Caupova

    Index Scriptorium Estoniae

    Caupova, Ruta

    2008-01-01

    Pedvĺe Vabaõhumuuseumist, mille asutas Ojaŕs Feldbergs 1990. alguses ja muuseumi kui loovuse labori interdistsiplinaarsetest kunstiprojektidest, kus traditsioonilisse kultuurmaastikku on toodud kaasaegne visuaalne kunst

  20. Die Aussenhandelstätigkeit der Kaufmannschaft Narvas im 18. Jahrhundert / Viktor Zacharov

    Index Scriptorium Estoniae

    Zacharov, Viktor, 1951-

    2004-01-01

    Narva väliskaubanduse õitsengust 17. sajandi lõpus ja 18. sajandi alguses. Muutustest Narva kaubanduses 18. sajandil. Narva kaupmeeskonnast ja selle silmapaistvamatest esindajatest. Narvalaste tegevusest Peterburi kaubanduses

  1. "Ooperifantoomi" üks peaosatäitjatest valitud! / Sash Uusjärv

    Index Scriptorium Estoniae

    Uusjärv, Sash

    2008-01-01

    Detsembri alguses neljal õhtul Tallinnas Saku Suurhallis etenduva Ivan Jacobsi muusikali "The Phantom of the Opera" naispeaosalise Christine Daae rolli valiti sopran Toni Dolce. Muusikalist ja tema versioonidest

  2. Kto jest kto v mire sovremennoi modõ

    Index Scriptorium Estoniae

    2002-01-01

    Tutvustatakse kaasaja kuulsaid moekunstnikke: Stella McCartney (1972), Tom Ford Texasest, Tommy Hilfiger (1952), Vivienne Westwood (1941), Yves Saint-Laurent (1936). Algus ajalehes Molodjozh Estonii 4. juuni 2002

  3. Kunda puitmassitehase ehitus võib alata / Toivo Tänavsuu

    Index Scriptorium Estoniae

    Tänavsuu, Toivo

    2003-01-01

    Norra kapitalil põhineval firmal Estonian Cell on kõik load Kundasse haavapuitmassitehase rajamiseks. Ehitus algab 2004. aasta alguses, selle kestuseks on planeeritud poolteist aastat. Lisa: Estonian Cell

  4. Linn annab tublile Estonia koorilauljale ranitsatoetust / Ragne Jõerand

    Index Scriptorium Estoniae

    Jõerand, Ragne, 1970-

    2015-01-01

    Coca-Cola Plazas 13. augustil toimuvast Tallinna Linnavalitsuse ja Eesti Punase Risti kampaaniast Ranits 2015, kus vähekindlustatud perede lapsed saavad kooliaasta alguse puhul kingituseks koolitarvetega ranitsa

  5. Außergerichtliche Vollstreckung aus der Hypothek und Quasi-Datio in Solutum nach russischem Recht – Teil 2 / Tim Lassen

    Index Scriptorium Estoniae

    Lassen, Tim

    2014-01-01

    Hüpoteeklaenudega seotud vaidlustest Venemaal. Hüpoteekidega seotud õigusaktide rakendamise probleemidest ja vastavatest vahekohtu lahenditest. Järg. Algus Wirtschaft und Recht in Osteuropa 20014, nr. 5, lk. 136-140

  6. First years of the re-establishment of Estonia's naval defence / Reet Naber

    Index Scriptorium Estoniae

    Naber, Reet, 1952-

    2014-01-01

    Meremuuseumi rollist sõjalaevastiku ümberkorraldamise alguses. Alveelaevast Lembit, alustest Edgar, Ahti jt. Eesti Mereakadeemiast. Piirivalve ülevõtmisest.Eesti laevastiku taastamise kontseptsioonist. Ühtse juhtimise puudumisest Eesti laevastikus

  7. Norma aktsionäridel lootus erakorralisele dividendile / Annika Matson

    Index Scriptorium Estoniae

    Matson, Annika, 1976-

    2004-01-01

    Kolmandas kvartalis paremat kasumlikkust näidanud Norma juhtkond teeb aasta alguses nõukogule ettepaneku maksta erakorralisi dividende. Diagramm: Ettevõtetel olev vaba raha aktsia kohta. Kommenteerib Teet Kolts

  8. Düsseldorf - Estland : die Modernisierungsbewegung in der religiösen Kunst um 1900 / Mai Levin

    Index Scriptorium Estoniae

    Levin, Mai, 1942-

    2011-01-01

    Düsseldorfis õppinud maalikunstnikest. Eestiga seotud baltisaksa ja vene kunstnikest, nende religioosse sisuga maaliloomingust 19. saj. ja 20. saj. alguses. Pikemalt Eduard von Gebhardtist, Kristjan Rauast ja Paul Rauast

  9. Pärdi lavastamine Noblessneri valukojas / Evi Arujärv

    Index Scriptorium Estoniae

    Arujärv, Evi, 1953-

    2010-01-01

    Tõnu Kaljuste ja Peeter Jalaka lavastusest "Alguses oli", lavastuse aluseks Arvo Pärdi teosed "In Principio" ja "Miserere", 17. augustil Noblessneri tehase valukojas toimunud etendusest, muusikaline juht Tõnu Kaljuste

  10. Turule tuleb veel üks arvutipood / Kai Simson

    Index Scriptorium Estoniae

    Simson, Kai

    2004-01-01

    2004. a. detsembri alguses alustas tegevust jaekaubanduskett Enter IT-Market, mille eesmärk on pakkuda kõigis Eesti maakonnakeskustes kodukasutajatele suurimat valikut arvuti- ja digikaupu ühest kohast

  11. Pilet mustvalgesse paradiisi ehk sügismood / Tanel Veenre

    Index Scriptorium Estoniae

    Veenre, Tanel, 1977-

    2009-01-01

    2009. a. juuli alguses toimunud kõrgmoe nädalast Pariisis. Giorgio Armani, Karl Lagerfeldi (Chanel), Christian Lacroix', John Galliano (Dior), Riccardo Tisci (Givenchy) ja Jean Paul Gaultier' kollektsioonidest

  12. Tallinnas esinev Šveitsi kuulus tantsutrupp näitab looma inimeses / Tiiu Laks

    Index Scriptorium Estoniae

    Laks, Tiiu, 1984-

    2009-01-01

    Oktoobri alguses esineb Tallinnas ja Tartus Šveitsi tantsukompanii Drift, kes esitab lavastuse "Au bleu cochon". Lisaks etendustele annab trupi kunstiline juht Peter Schelling Eesti tantsijatele ja koreograafidele meistriklassi

  13. The persistence of the text: the concept of the work in copyright law - part 2 / Yin Harn Lee

    Index Scriptorium Estoniae

    Lee, Yin Harn

    2018-01-01

    Autoriõigusega kaitstava teose mõistest ja tähendusest Suurbritannia õigusajaloos. Teose materiaalsest ja abstraktsest olemusest. Järg. Algus Intellectual Property Quarterly, 2018, nr. 1, lk. 22-44

  14. The planes are back / Rokas M. Tracevskis

    Index Scriptorium Estoniae

    Tracevskis, Rokas M.

    2009-01-01

    2009. aasta alguses pankrotistus Leedu lennufirma FlyLAL, kuid novembris selgus, et Air Baltic ja Leedu lennukompanii Star1 Airlines alustavad uute regulaarlendudega Vilniusest. Leedus on 3 rahvusvahelist lennujaama

  15. Tagasi sünnimaale / Ago Ambre

    Index Scriptorium Estoniae

    Ambre, Ago

    2008-01-01

    Kohtumistest Eesti majandusteadlastega 1980ndatel ja 1990ndate alguses, elust Eestis Ühendriikide rahvusvahelise ettevõtluse abikorpuse direktorina. Eesti Ameerika Fondi (Estonian American Fund for Economic Education, Inc.) tegevusest

  16. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002678 gi|13475930 >1el5A 6 379 7 420 7e-42 ... ref|NP_107500.1| AgaE protein, conversion of agropini...c acid to mannopinic acid ... [Mesorhizobium loti MAFF303099] dbj|BAB53286.1| AgaE

  17. Amotz Zahavi - mees, kes leidis raiskamisele evolutsioonilise seletuse / Peeter Hõrak, Ivar Puuura

    Index Scriptorium Estoniae

    Hõrak, Peeter, 1963-

    2009-01-01

    Septembri alguses esineb Tartus loengutega Tel-Avivi ülikooli emeriitprofessor Amotz Zahavi. Ta on uurinud looduslikku valikut ning leidnud seal palju raiskamist ja pillamist, mis on omane inimühiskonnalegi

  18. Kunstiarmastusest sündinud kollektsioon / Enn Kunila

    Index Scriptorium Estoniae

    Kunila, Enn, 1950-

    2010-01-01

    Vestlus kunstikollektsionääri Enn Kunilaga maalikunsti kogumisest. Tallinna Kunstihoones aasta alguses üles pandud näitusest "Kölerist Subbini. 150 aastat eesti klassikalist maalikunsti Enn Kunila kogust"

  19. Aineüleste pädevuste koolitus Pestalozzi programmi raames / Tiia Pukk, Tiiu Vaher

    Index Scriptorium Estoniae

    Pukk, Tiia

    2011-01-01

    1969 alguse saanud Pestalozzi koolitusprogramm on suunatud Euroopa kultuurikonventsiooniga ühinenud 49 riigi haridustöötajatele. Seekordne üritus toimus Tartus, koolituse teemaks aineülesed pädevused

  20. Театр на Литейном привезет "Пышку"

    Index Scriptorium Estoniae

    2009-01-01

    Juuni alguses etendub Jõhvi kontserdimajas Guy de Maupassant'i novelli "Rasvarull" ainetel Peterburi Riiklikus Draamateateris Liteinõil lavastatud muusikal "Пышка". Muusika kirjutas noor helilooja Nikolai Orlovski

  1. The Finlandisation of Karelia and the Russification of Finland as Reflected in the Russian Press at the Beginning of the 20th Century / Maxim Pulkin

    Index Scriptorium Estoniae

    Pulkin, Maxim, 1968-

    2004-01-01

    Vene võimude ja vaimulikkonna võitlusest soome-meelsete ideede levitamise vastu Karjalas 20. sajandi alguses. Karjalaste assimileerimiseks kavandatud meetmetest. Nikolai II poolt 1914. aastal heaks kiidetud Soome venestamise plaanist

  2. Tänavuse Ervin Pütsepa mälestusfondi aastaauhinna...

    Index Scriptorium Estoniae

    2010-01-01

    Ervin Pütsepa preemia silmapaistva kunstiteadusliku monograafilise uurimuse, Tartu Ülikoolis kaitstud doktoritööga "Valgustusideede mõju Tartu arhitektuurikultuurile 19. sajandi alguses" (2009) pälvis Epi Tohvri

  3. Uues riigihangete seaduses peidus segaduste võimalus / Koit Brinkmann

    Index Scriptorium Estoniae

    Brinkmann, Koit

    2007-01-01

    Mai alguses kehtima hakkavast uuest riigihangete seaduses olevast sättest, mis muudab lihtsamaks riigi- ja munitsipaalosalusega ettevõtete tegutsemise. Lisatud advokaadibüroo Sorainen Law Offices vandeadvokaadi Carri Ginteri kommentaar

  4. Sesoonseid märkmeid metakriitikast = Seasonal notes on metacriticism / Andreas Trossek

    Index Scriptorium Estoniae

    Trossek, Andreas, 1980-

    2015-01-01

    Sissejuhatus käesoleva Kunst.ee numbri faksiimile rubriigile: kunstikriitika mõjust reaalsele kunstielule. Näited Kumu kunstimuuseumi 2015. a. neljast väljapanekust, mis on saanud alguse kunstiajakirjades ilmunud materjalidest

  5. Ühistu aruandlust ja infovahetust pidage internetis / Indrek Kald

    Index Scriptorium Estoniae

    Kald, Indrek, 1974-

    2004-01-01

    Autor tutvustab AS-i Spin TEK poolt loodud e-Reeni nimelist tarkvara korteriühistute raamatupidamise lihtsustamiseks. Kommenteerib Peka Ringo. Vt. samas: E-hooldusraamat jõudis Eesti turule juba aasta alguses

  6. Andmekaitse ohustab võitlust dopinguga

    Index Scriptorium Estoniae

    2009-01-01

    Aasta alguses kehtima hakanud Ülemaailmse Antidopingu Agentuuri (WADA) uued ettekirjutused pole kooskõlas Euroopa Liidu seadustega ning uue süsteemi kasutamine toob dopinguküttidele kaasa ohtralt õiguslikke probleeme

  7. DVD / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2007-01-01

    Kolme USA mängufilmi DVD-de lühitutvustused : Spike Lee "Keegi seestpoolt" ("Inside Man"), Jonathan Liebesmani "Texase mootorsaemõrvad: Algus" ("The Texas Chainsaw Massacre : The Beginning"), Allen Coulteri "Hollywoodland"

  8. Kas sul on see film juba nähtud? / Jaanus Noormets

    Index Scriptorium Estoniae

    Noormets, Jaanus

    2009-01-01

    Gavin Hoodi lavastatud uusim film "X-meeste" sarjast, "X-meeste algus : Wolverine", on enne esilinastust lekkinud internetti. Lühidalt ka teistest aegsalt internetti lekkinud filmidest ja kuidas see neile mõjus

  9. Kot v pogone za Dzherri poimal 7 "Oskarov" / Jekaterina Zhivova

    Index Scriptorium Estoniae

    Zhivova, Jekaterina

    2005-01-01

    Hollywoodi stuudio Metro-Goldwyn-Mayer populaarseim animasari "Tom & Jerry" sai alguse 65 aastat tagasi filmiga "Kass saab saapad" ("Puss Gets the Boots"), loojateks Joseph Barbera (1911) ja William Hanna (1910-2001)

  10. When a Student Enterprise Becomes a Real Company / Toivo Tänavsuu

    Index Scriptorium Estoniae

    Tänavsuu, Toivo

    2004-01-01

    1990-ndate lõpus toonase Pärnu õpilase Karoli Hindriksi loodud firmast, mille nimi on praegu Heatuju Maaletooja. Õpilasfirmast alguse saanud firmadest. Vt. samas: Ettevõtted on hakanud õpilasfirmasid toetama

  11. Kunstioksjonitest / Jaak Olep

    Index Scriptorium Estoniae

    Olep, Jaak, 1945-2000

    1998-01-01

    Sotheby ja Christie oksjonifirmadest. Kunstioksjonite korraldamisest Sotheby näitel. Venelaste ilmumisest oksjonitele 90ndate aastate alguses, Venemaa oma oksjonifirmadest. Hindadest maailmas. Šveitsi oksjonifirma Antiquorum oksjonist "Erootika ja seks kunstis".

  12. Skype saabub firmadesse / Kaido Einama

    Index Scriptorium Estoniae

    Einama, Kaido, 1971-

    2007-01-01

    Internetisuhtlusfirma Skype on 2006. aasta alguses toonud turule spetsiaalselt firmadele suunatud toote, mis peaks vähendama ettevõtete umbusku ning suurendama suhtlusprogrammi kasutatavust. Lisa: Skype'i peibutised firmadele; Veel internetitelefone

  13. Rõõmsama homse nimel...

    Index Scriptorium Estoniae

    2005-01-01

    2005. a. alguses Stockholm School of Economics in Riga, Eesti Õdede Liidu ja AS Resta Eesti poolt korraldatud Eesti õdede rahulolu-uuringust "Rõõmsama homse nimel...". Statistilised tabelid ja diagrammid

  14. Viru tänava rendihind 15 korda maailma tipust madalam / Andres Kärssin

    Index Scriptorium Estoniae

    Kärssin, Andres, 1971-

    2003-01-01

    Kinnisvaranõustaja Cushman & Wakefield Healey & Baker novembri alguses valminud iga-aastase maailma kallimate ostupiirkondade rendihindade analüüsi tulemustest. Tabel: Eesti ja Läti kauplusepinnad võrreldes muu maailmaga odavad

  15. Gruzam svetjat novõje perspektivõ / Andrei Akulistõi

    Index Scriptorium Estoniae

    Akulistõi, Andrei

    2003-01-01

    2004. aasta alguses peab Euroopa Komisjon otsustama piiriäärse Koidula raudteejaama ehituse finantseerimise, ehitus algaks 2005. a. ja lõpeks 2007. a., planeeritud kulutused ulatuvad 47,1 miljoni euroni

  16. Pekon palvonta René Girardin uskontoteorian valossa / Tuukka Sandström

    Index Scriptorium Estoniae

    Sandström, Tuukka

    2005-01-01

    Prantsuse filosoofi René Girardi ideedest primitiivse religiooni kohta. Setumaal veel 20. sajandi alguses levinud viljakusjumal Peko kultusest ja iga-aastasest uue Peko papi valimise rituaalist R. Girardi tõlgenduse valguses

  17. Mõrvarid jahtisid Riigi Kinnisvara juhti / Andris Tammela

    Index Scriptorium Estoniae

    Tammela, Andris

    2006-01-01

    Politsei pidas kinni kolm meest, keda kahtlustatakse oktoobri alguses Tallinna koolitüdruku Veronika Dari tapmises, väidetavalt oli meeste tegelik sihtmärk Riigi Kinnisvara aktsiaseltsi juht Tiit Ottis

  18. Eesti seireandmed näitavad : pestitsiidid jõuavad nii mulda, vette kui ka inimeste toidulauale / Elen Peetsmann

    Index Scriptorium Estoniae

    Peetsmann, Elen, 1984-

    2016-01-01

    Mai alguses toimunud seminaril "Elukeskkonna ja toidu kvaliteet" tutvustati Eesti seireandmeid mulla, vee ja toidu kvaliteedi kohta. Seminari ettekanded on leitavad http://mahekeskus.emu.ee/uudised/elukeskkonna-ja-toidu-kvaliteet-05052016/

  19. Varjete "Viru" vozvrashajetsja / Aleksandra Moorast

    Index Scriptorium Estoniae

    Moorast, Aleksandra, 1980-

    2005-01-01

    Viru Varietee ajaloost (algus 1972), selle sulgemisest 1995 ja taassünnist. 30. okt. 2005 alustab Viru Varietee uuesti oma tegevust. Direktor ja tantsutrupi Golden Lady kunstiline juht on I. Kruglova

  20. Modelliagentuurid toodavad Carmen Kassile tasemel järglasi / Kerli Nõu

    Index Scriptorium Estoniae

    Nõu, Kerli

    2006-01-01

    Eestis tegutsevatest modelliagentuuridest Beatrice Mass Modelnet, Baltic Models OÜ ja Eesti Modelliagentuuri OÜ. Kommentaarid: Tasane algus kulisside taga, Edukad Eesti modellid (Annika Vohta), Eesti uus Carmen Kass (Claudia Meriküla)

  1. Characterization of Streptomyces spp. isolated from the rhizosphere of oil palm and evaluation of their ability to suppress basal stem rot disease in oil palm seedlings when applied as powder formulations in a glasshouse trial.

    Science.gov (United States)

    Shariffah-Muzaimah, S A; Idris, A S; Madihah, A Z; Dzolkhifli, O; Kamaruzzaman, S; Maizatul-Suriza, M

    2017-12-18

    Ganoderma boninense, the main causal agent of oil palm (Elaeis guineensis) basal stem rot (BSR), severely reduces oil palm yields around the world. To reduce reliance on fungicide applications to control BSR, we are investigating the efficacy of alternative control methods, such as the application of biological control agents. In this study, we used four Streptomyces-like actinomycetes (isolates AGA43, AGA48, AGA347 and AGA506) that had been isolated from the oil palm rhizosphere and screened for antagonism towards G. boninense in a previous study. The aim of this study was to characterize these four isolates and then to assess their ability to suppress BSR in oil palm seedlings when applied individually to the soil in a vermiculite powder formulation. Analysis of partial 16S rRNA gene sequences (512 bp) revealed that the isolates exhibited a very high level of sequence similarity (> 98%) with GenBank reference sequences. Isolates AGA347 and AGA506 showed 99% similarity with Streptomyces hygroscopicus subsp. hygroscopicus and Streptomyces ahygroscopicus, respectively. Isolates AGA43 and AGA48 also belonged to the Streptomyces genus. The most effective formulation, AGA347, reduced BSR in seedlings by 73.1%. Formulations using the known antifungal producer Streptomyces noursei, AGA043, AGA048 or AGA506 reduced BSR by 47.4, 30.1, 54.8 and 44.1%, respectively. This glasshouse trial indicates that these Streptomyces spp. show promise as potential biological control agents against Ganoderma in oil palm. Further investigations are needed to determine the mechanism of antagonism and to increase the shelf life of Streptomyces formulations.

  2. Treatment of male androgenetic alopecia with topical products containing Serenoa repens extract.

    Science.gov (United States)

    Wessagowit, Vesarat; Tangjaturonrusamee, Chinmanat; Kootiratrakarn, Tanawatt; Bunnag, Thareena; Pimonrat, Tanatya; Muangdang, Nattaporn; Pichai, Pitchayasak

    2016-08-01

    Male androgenetic alopecia (AGA) is a common hair problem. Serenoa repens extract has been shown to inhibit both types of 5-α reductase and, when taken orally, has been shown to increase hair growth in AGA patients. The aim of this study was to assess the efficacy of topical products containing S. repens extract for the treatment of male AGA. This was a pilot, prospective, open, within-subject comparison limited to 24 weeks using no placebo controls. In all, 50 male volunteers aged between 20 and 50 years received topical S. repens products for 24 weeks. The primary end-point was a hair count in an area of 2.54 cm(2) at week 24. Secondary end-points included hair restoration, investigators' photographic assessment, patients' evaluation and discovering adverse events. The average hair count and terminal hair count increased at weeks 12 and 24 compared to baseline. Some of these positive results levelled off at week 24, presumably because the concentrated topical product containing S. repens extract was stopped after 4 weeks. The patients were satisfied with the products and the side-effects were limited. The topical application of S. repens extract could be an alternative treatment in male pattern baldness in male patients who do not want or cannot tolerate the side-effects of standard medications, but the use of a concentrated S. repens product beyond 4 weeks may be necessary for sustained efficacy. © 2015 The Australasian College of Dermatologists.

  3. Risto Rossar: umbes 90% äriideedest kukub läbi / Risto Rossar ; intervjueerinud Mikk Salu

    Index Scriptorium Estoniae

    Rossar, Risto

    2009-01-01

    IIZI Group AS-i juhatuse esimees vastab küsimustele, kuidas sai alguse IIZI Kindlustusmaaker, millised on turud, kus IIZI tegutseb, milliseid vigu on tehtud, kuhu võiks firma edasi laieneda. Diagrammid

  4. Ajalooteadus Tartu Ülikoolis 19. sajandi lõpul - 20. sajandi algul / Ljudmilla Dubjeva

    Index Scriptorium Estoniae

    Dubjeva, Ljudmila, 1954-

    2008-01-01

    Ajalooteaduse arengu üldtendentsidest vaadeldaval perioodil. Vene ajaloo õppetoolist Tartu Ülikoolis 19. sajandi lõpus ja 20. sajandi alguses. Vene ajaloo uurijatest teistes õppetoolides. Keskaja ajaloo õppetoolist ja uusaja ajaloo õppetoolist.

  5. Kas Baltic Talks on oma missiooni täitnud? / Tiit Meren

    Index Scriptorium Estoniae

    Meren, Tiit

    2006-01-01

    21.-24. septembril toimus Tapal Läänemere-äärsete riikide reservohvitseride traditsiooniline suurfoorum Baltic Talks 2006. 1931. aastal Norra ja Rootsi reservohvitseride algatatud Nording Meeting ning Baltic Talks'i algus

  6. EÜ/EL õiguse ülimuslikkus versus liikmesriikide põhiseaduste ülimuslikkus - vastuolud ja nende vältimise võimalused : [bakalaureusetöö] / Liis Lipre ; Tartu Ülikool, õigusteaduskond ; juhendaja: Kristi Land

    Index Scriptorium Estoniae

    Lipre, Liis

    2006-01-01

    Konstitutsiooniliste põrkumiste algus, Saksa konstitutsioonikohus Ühenduse õiguse ülimuslikkuse piirajana, Eesti õiguse ja ülimuslikkuse põhimõtte senised kokkupuuted, uuemad arengud, võimalikud lahendused kahe lähenemise lepitamiseks

  7. Dollariafääris otsustav kohus / Jaanus Piirsalu

    Index Scriptorium Estoniae

    Piirsalu, Jaanus, 1973-

    2001-01-01

    Ühispank loodab täna New Yorgis algaval kohtuprotsessil saavutada soodsa otsuse 10 milj. dollari tagasisaamiseks USA pangalt Bankers Trust Company. 1994.a. S. Kallase juhitud Eesti Palgast alguse saanud dollariskandaal

  8. "Kohtuniku ees seisab kaks jumalat, kaks õigust ja kibe tarvidus ühte kui teist ehk mõlemaid korraga teenida." / Olja Kivistik

    Index Scriptorium Estoniae

    Kivistik, Olja, 1989-

    2012-01-01

    20. saj. alguses kohaldatud kriminaalseadustikest Tsaari-Venemaal (ka Eestis), nendes sätestatud usuvastaste süütegude koosseisude rakendamisest. Tsaariaegse Tallinna Ringkonnakohtu lahenditest ajal, kui kehtisid samaaegselt vana ja uus nuhtlusseadustik

  9. Teadusseltside osa rahvuskultuuris ja Õpetatud Eesti Selts / Tiit Rosenberg

    Index Scriptorium Estoniae

    Rosenberg, Tiit, 1946-

    2005-01-01

    Seltsid said alguse 17. sajandil ja levisid Baltimaadesse 19. sajandiks. Ettekanne Eesti Teaduste Akadeemiaga assotsieerunud teadusseltside ühiskonverentsil (21.05.2003. a.) "Teadusseltside osa Eesti rahvusliku identiteedi kujunemisel ja säilimisel"

  10. Tsenõ na morskije perevozki poleteli vniz / Tanel Raig

    Index Scriptorium Estoniae

    Raig, Tanel, 1975-

    2008-01-01

    Puistekaupade meretranspordi hinnaindeks Baltic Dry Index (BDI) on mai lõpust langenud 13 korda ja jõudnud 2002. aasta alguse tasemele. Vt. samas: Stoimost morskihh perevozok v blizhaisheje vremja rasti ne budet

  11. Bunge sajand ja sajand Bungeta. II / Peeter Järvelaid

    Index Scriptorium Estoniae

    Järvelaid, Peeter, 1957-

    1998-01-01

    Tartu Ülikooli professorist, Balti eraõiguse uurimise alusepanijast ja baltisaksa professionaalse ajalooteaduse ühest rajajast Friedrich Georg von Bungest (1802-1897). Algus: Kleio : Ajaloo Ajakiri 1997, nr. 4, lk. 49-51

  12. Korobeiniku suurte plaanide algus / Jaanika Heinsoo

    Index Scriptorium Estoniae

    Heinsoo, Jaanika

    2005-01-01

    Tutvumis- ja suhtlemissait Rate.ee on Eesti enimkülastatud Internetisait, millel on üle 300 000 registreeritud kasutaja. Rate.ee omanik ning juht Andrei Korobeinik selgitab saidi fenomeni ning tutvustab selle kontseptsiooni ja laienemisplaane. Vt. samas Columbus IT juhatuse esimehe Ivo Suursoo ja Martinson Trigon Venture Partners'i tegevjuhi Allan Martinsoni kommentaare küsimusele "Mis on Rate.ee fenomen?"

  13. Põllumajanduse algus Eesti alal / Aivar Kriiska

    Index Scriptorium Estoniae

    Kriiska, Aivar, 1965-

    2007-01-01

    Varajase maaviljeluse uurimise allikatest. Esimesed terviljakasvatuse märgid korreleeruvad kammkeraamika kultuuridega. Põllumajandusest hilisneoliitikumis ja varajasel pronksiajal. Viljelev majandus tõi nöörkeraamika perioodil kaasa küla lagunemise väiksemateks asustusüksusteks - taludeks. Kiviaja lõpul toimus põllumajandusliku asustuse laienemine, kusjuures see hõlmas ka kõrgustike alasid

  14. Ooperiaasta võimas algus / Tarmo Virki

    Index Scriptorium Estoniae

    Virki, Tarmo

    2003-01-01

    Einojuhani Rautavaara uue ooperi "Rasputin" esietendusest Soome Rahvusooperis 19. sept. (dirigent Mikko Franck) ja etendustest 22., 24., 27. ja 30. sept. ning 3., 6., 9. ja 11. oktoobril. Giuseppe Verdi "Trubaduur" 11., 17. ja 20. sept ning 1. okt., dirigent Eri Klas. Leosh Janaceki "Katja Kabanova" esietendusest 12. detsembril

  15. Kak voznikajut superderzhavõ / Harold James ; tõlk. Jevgenija Unanjants

    Index Scriptorium Estoniae

    James, Harold

    2005-01-01

    Hiina kiire majandusliku arengu võrdlus protsessidega Saksamaal ja Jaapanis. Kui Hiina tahab vältida Saksamaa XX sajandi alguse saatust, peab ta toetama oma edukat majanduslikku moderniseerimist põhiseaduslike ja poliitiliste reformidega

  16. Kas tehnika on tähtis? / Ingrid Sahk

    Index Scriptorium Estoniae

    Sahk, Ingrid, 1976-

    2016-01-01

    Friedrich Ludwig von Maydelli Baltimaade ajaloopiltide graafikatehnilisest taustast: kas Maydell rakendas graafikaloomingus oforti või vasegravüüri, millised võimalused olid tal 19. sajandi alguses ja milline oli tema graafikaalane ettevalmistus

  17. Aasta algusest 24% plussi, veebruari lõpust 8% miinust

    Index Scriptorium Estoniae

    2005-01-01

    Ühispanga Varahalduse juhi Sven Kunsingu virtuaalportfelli seis aprilli alguses 2005. Tabel: Kunsingu virtuaalportfell 31.12.04-08.04.05. Vt. ka Profit nr. 2 lk. 42. Uued nopped Kesk- ja Ida-Euroopast

  18. Ehho kompjuternoi voinõ / Josef Kats

    Index Scriptorium Estoniae

    Kats, Josef, 1977-

    2007-01-01

    Justiitsminister Rein Lang ja peaminister Andrus Ansip on veendunud, et küberrünnakud Eesti riigi vastu aprilli lõpus ja mai alguses tulid muu hulgas ka Vene presidendi administratsiooni IP-aadressidelt

  19. Hõõguv konflikti / Urmas Kiil

    Index Scriptorium Estoniae

    Kiil, Urmas

    2007-01-01

    Aprilli alguses täitus 25 aastat päevast, mil algas relvastatud konflikt Argentina ja Suurbritannia vahel, põhjuseks Falklandi saared. Konflikt kestis 74 päeva. Kaart: Falklandi saared ehk Malviinid

  20. Vändra aabitsameistrid / Lembit Andresen

    Index Scriptorium Estoniae

    Andresen, Lembit, 1929-2016

    2009-01-01

    1880-ndate aastate alguses tõusis aabitsatootjate keskusena esile Vändra, kuhu oli kogunenud silmapaistvate võimetega koolimehi. Sealsete koolmeistrite Johannes Lüdimoisi, Jaan Kruusi ja Mats Tõnissoni poolt välja antud aabitsatest

  1. Versailles' park taasavatud

    Index Scriptorium Estoniae

    2000-01-01

    Osa Pariisi lähedase Versailles' lossi pargist avati jaanuari alguses uuesti publikule. 17.-18. sajandi prantsuse stiilis park suleti avalikkusele detsembris 1999 pärast parki laastanud hiigeltormi, mis murdis ligemale 10000 puud.

  2. Water Ser - areng läbi torude ja üle kraavide / Ain Alvela

    Index Scriptorium Estoniae

    Alvela, Ain, 1967-

    2007-01-01

    1992. aastal asutatud vee- ja kanalisatsioonitorustike paigaldamisele spetsialiseerunud perefirma AS Water Ser on kasvanud rahvusvaheliselt mainekaks kontserniks. Vt. samas: Perefirma arengu kronoloogia; Amet sai alguse teismelise eas kraavikaevamisest. Kommenteerivad Andrus Piir ja Toomas Kapp

  3. Baltoscandal algab kaugsõiduauto furgoonis

    Index Scriptorium Estoniae

    2008-01-01

    Rahvusvaheline teatrifestival juhatatakse sisse märtsi alguses Tallinnas. Kaheksal õhtul saab mööda Tallinna ringi sõitvas kaubaautos näha etendust Bulgaaria kaugsõiduautojuhtide teekonnast Sofiast Tallinna "Cargo Sofia-Tallinn"

  4. YES-liikumine annab endast värvikalt märku / Lilian-Hanna Taimla, Heiko Teern ; intervjueerinud Sirje Pärismaa

    Index Scriptorium Estoniae

    Taimla, Lilian-Hanna, 1961-

    2009-01-01

    Maaülikoolis alguse saanud YES-liikumise (Young Environmental Specialists) arhitektuurinäituse "Minu päris esimene enda projekteeritud unistuste kodu" uues spordihoones korraldasid maaülikooli kunsti- ja disainigrupp ning maaehituse osakond

  5. Draakon teritab küüniseid / Kaarel Kaas

    Index Scriptorium Estoniae

    Kaas, Kaarel, 1978-

    2005-01-01

    Hiina-USA viimaste aastakümnete tõsisem konflikt, mis sai alguse Hainani intsidendist. Hiina suhtes 1989. a. kehtestatud relvaemargo kaotamisest. USA julgeoleku- ja Euroopa Liidu majandushuvid. Tabel: Hiina sõjaliste kulutuste ametlikud andmed

  6. 3- ja 4-aastaste laste intellektuaalne areng erinevates kasvukeskkondades / Merit Laane, Kristina Nugin, Ingrid Tuisk, Marika Veisson

    Index Scriptorium Estoniae

    2001-01-01

    Uuringust, mille eesmärgiks oli selgitada, milline on 3- ja 4-aastaste laste intellektuaalne areng erinevates kasvukeskkondades. Uuringus osalesid longituuduurimuses osalenud lapsed, tavarühma lapsed ja Hea Alguse rühma lapsed

  7. Maksevõimelisuse põhimõte ja füüsilise isiku maksuvabastused kehtivas tulumaksuseaduses / Kaspar Lind

    Index Scriptorium Estoniae

    Lind, Kaspar, 1978-

    2008-01-01

    Maksevõimelisuse põhimõttest, füüsilise isiku maksuvabastusest ja nende maksuvabastuste kooskõlast maksevõimelisuse põhimõttega. Järg. Algus Juridica 2003 nr. 5, lk. 338-348, pealkirjaga Tulu mõiste

  8. Hotell "Santa Barbara" Roosikrantsi tänavas Tallinnas / Andres Alver, Tiit Trummal, Martinus Schuurman

    Index Scriptorium Estoniae

    Alver, Andres, 1953-

    1997-01-01

    projekteeritud sajandi alguses rajatud paemüüridele; projekteerija, sisekujunduse üldlahendus: Alver Trummal Arhitektid ; sisekujundus: M. Schuurman; 2 joon.: asendiplaan, I korruse plaan ; 3 välisvaadet, foto ; 5 sisevaadet, foto, värv.

  9. Joonised, tähendused ja unistused, ehk enklaavi eelised = From drawings to meanings and dreams: the advantage of remaining an enclave / Lilia del Rio

    Index Scriptorium Estoniae

    Rio, Lilia del

    2011-01-01

    Pirita tee alguse piirkonnast, mis oli vaatluse all 15. ja 16. juunil 2010. aastal toimunud Tallinna III linnafoorumil. Linnaruumi tegelikkusest ja Tallinna ruumilistest prioriteetidest. Rahvuspargist, rahvapargist, linnaparkidest. Plaanidest ja joonistest planeerimisprotsesside ja otstarveteni. Tallinna tulevikust

  10. Toidupoolis Säästumarketist, riided Kreisimarketist

    Index Scriptorium Estoniae

    2005-01-01

    2005. a. alguses tekkis Eestisse uus riiete säästukauplus, kus müüakse tuntud kaubamärkide nagu Puma, Nike, Adidas jt. tooteid umbes poole odavamalt kui tavakauplustes. Vt. samas: Hinnapommi juhtum

  11. 1. mail toimub taas Valge Roosi ball / Ingrid Rüütel ; intervjueerinud Gerli Ramler

    Index Scriptorium Estoniae

    Rüütel, Ingrid, 1935-

    2006-01-01

    Kaitseliidu eestvedamisel 1926. aastal alguse saanud Valge Roosi balli korraldajate eesmärgiks on heategevuse kaudu tuua üksteisele lähemale militaarstruktuure ja tsiviilühiskonda, väärtustada perekonda. Valge Roosi Fond

  12. Experimental determination of (p, ρ, T) data for binary mixtures of methane and helium

    International Nuclear Information System (INIS)

    Hernández-Gómez, R.; Tuma, D.; Segovia, J.J.; Chamorro, C.R.

    2016-01-01

    Highlights: • Accurate density data for two binary mixtures of methane and helium are presented. • Experimental data are compared with the densities calculated from different EOS. • Deviations from GERG-2008 exceeded the 3% for some points. • Deviations from AGA8-DC92 did not exceed the 0.3% at any experimental point. • The relative deviations are clearly higher for GERG-2008 than for AGA8-DC92. - Abstract: The basis for the development and evaluation of equations of state for mixtures is experimental data for several thermodynamic properties. The quality and the availability of experimental data limit the achievable accuracy of the equation. Referring to the fundamentals of GERG-2008 wide-range equation of state, no suitable data were available for many mixtures containing secondary natural gas components. This work provides accurate experimental (p, ρ, T) data for two binary mixtures of methane with helium (0.95 (amount-of-substance fraction) CH_4 + 0.05 He and 0.90 CH_4 + 0.10 He). Density measurements were performed at temperatures between (250 and 400) K and pressures up to 20 MPa by using a single-sinker densimeter with magnetic suspension coupling. Experimental data were compared with the corresponding densities calculated from the GERG-2008 and the AGA8-DC92 equations of state. Deviations from GERG-2008 were found within a 2% band for the (0.95 CH_4 + 0.05 He) mixture but exceeded the 3% limit for the (0.95 CH_4 + 0.05 He) mixture. The highest deviations were observed at T = 250 K and pressures between (17 and 19) MPa. Values calculated from AGA8-DC92, however, deviated from the experimental data by only 0.1% at high pressures and exceeded the 0.2% limit only at temperatures of 300 K and above, for the (0.90 CH_4 + 0.10 He) mixture.

  13. Osa kultuuripealinna jälle vastu taevast, aidaa linnahalli remondile! / Raimo Poom

    Index Scriptorium Estoniae

    Poom, Raimo

    2010-01-01

    Autor selgitab Tallinna ja linnahalli investeerida soovivaid USA ettevõtjaid koondava firma Tallinn Entertainment LLC vahel sõlmitud eellepingut ning leiab, et tõenäoliselt on välistatud linnahalli renoveerimise algus enne 2011. aastat

  14. Poliitbüroo Moskva välispoliitika kujundajana / Tõnu Tannberg

    Index Scriptorium Estoniae

    Tannberg, Tõnu, 1961-

    2001-01-01

    Rets.: Ken, O., Rupasov, A. Politbjuro TsK VKP(b) i otnoshenija SSSR s zapadnõmi sosednimi gosudarstvami. Sankt-Peterburg, 2000. NSV Liidu 1920. aastate lõpu ja 1930. aastate alguse välispoliitika alane uurimus

  15. Kunst eluetenduste inspireerijana / Raivo Kelomees

    Index Scriptorium Estoniae

    Kelomees, Raivo, 1960-

    2005-01-01

    Kunstnikuetenduste põhilised tundemärgid. Inglise kirjaniku John Fowlesi novellist "Eebenipuust torn" ja selle põhjal tehtud lavastusest. Novellile sarnaselt käitusid Valdur Ohakas ja tema kaks kaaslast 1980. aastate alguses Kütioru talus

  16. Antidepressandid tõusev trend / Monica Raud

    Index Scriptorium Estoniae

    Raud, Monica, 1981-

    2013-01-01

    Eesti inimesed neelavad praegu vähemalt kaks korda rohkem antidepressante kui aastatuhande alguses. Miks? selgitavad psühhiaatrid Peeter Jaanson, Andres Lehtmets,Viktooria Saat, perearstid Ingrid Alt ja Riina Raudsik ning mõju kommenteerivad patsiendid

  17. Kui otsime rahu, ei tohi karta tõe otsimist / Philippe Jourdan

    Index Scriptorium Estoniae

    Jourdan, Philippe, 1960-

    2009-01-01

    Autor selgitab paavst Benedictus XVI otsust tühistada nelja piiskopi ekskommunikatsioon. Prantsuse katoliku piiskopist Marcel Lefebvre'st, kelle allumatus Vatikanile 1970. aastate alguses viis tema teenistuskeelu alla panemiseni ja Püha Pius X vennaskonna moodustamiseni

  18. Higher body mass index is associated with greater severity of alopecia in men with male-pattern androgenetic alopecia in Taiwan: a cross-sectional study.

    Science.gov (United States)

    Yang, Chao-Chun; Hsieh, Fu-Nien; Lin, Li-Yu; Hsu, Chao-Kai; Sheu, Hamm-Ming; Chen, WenChieh

    2014-02-01

    Obesity is a risk factor for multiple health problems, but its association with androgenetic alopecia (AGA) remains controversial. We sought to determine the association between body mass index (BMI) and alopecia severity in men with AGA and early-onset AGA. A cross-sectional study was conducted. The medical charts and photographs of men with a clinical diagnosis of AGA were reviewed. In all, 189 men were enrolled with a mean age of 30.8 years. In male-pattern AGA (n = 142), men with severe alopecia (grade V-VII) had higher BMI than those with mild to moderate alopecia (grade I-IV) (25.1 vs 22.8 kg/m(2), P = .01). After multivariate adjustments, the risk for severe alopecia was higher in the overweight or obese (BMI ≥24 kg/m(2)) subjects with male-pattern AGA (odds ratio 3.52, P < .01). In early-onset male-pattern AGA (n = 46), the risk for having severe alopecia was also higher in the overweight or obese subjects (odds ratio 4.97, P = .03). Parameters used to evaluate obesity were limited because of the retrospective nature of the study. Higher BMI was significantly associated with greater severity of hair loss in men with male-pattern AGA, especially in those with early-onset AGA. Copyright © 2013 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  19. Deamidated gliadin peptide antibodies as a routine test for celiac disease: a prospective analysis.

    Science.gov (United States)

    Volta, Umberto; Granito, Alessandro; Parisi, Claudia; Fabbri, Angela; Fiorini, Erica; Piscaglia, Maria; Tovoli, Francesco; Grasso, Valentina; Muratori, Paolo; Pappas, Georgios; De Giorgio, Roberto

    2010-03-01

    This study was designed to establish whether deamidated gliadin peptide antibodies (DGP-AGA) could improve the serologic workup for celiac disease (CD). The best serologic approach for CD screening is currently based on the combined detection of tissue transglutaminase (tTGA), endomysial (EmA), and gliadin antibodies (AGA). One hundred forty-four consecutive patients with gastrointestinal and extraintestinal signs suggestive for CD were investigated using serologic tests, that is, IgG and IgA DGP-AGA, IgA tTGA, IgA EmA, and duodenal biopsy. Forty-eight out of 144 patients (33%) had CD with different severity of villous atrophy. IgA tTGA showed 93.7% sensitivity compared with 91.6% for IgA EmA, 84.3% for IgA DGP-AGA, and 82.3% for IgG DGP-AGA. Of the 3 cases negative for IgA tTGA, IgA EmA, and IgA DGP-AGA, 2 had total IgA deficiency, although both were positive for IgG DGP-AGA. IgG DGP-AGA showed a very high specificity for CD (98.9%), not only superior to IgA DGP-AGA (79.8%), but also to IgA tTGA (96.6%) and very close to IgA EmA (100%). Our prospective study shows that the combined search for IgA tTGA and IgG DGP-AGA provides the best diagnostic accuracy for CD, allowing the identification of all CD cases---except one---with a very high specificity. The serologic workup for CD screening could be significantly improved by the routine introduction of IgG DGP-AGA together with IgA tTGA, thus reducing the number of tests and with an obvious advantage in terms of cost-efficacy.

  20. Sinna, kus sinetavad Alpide lumised tipud / Juhan Maiste

    Index Scriptorium Estoniae

    Maiste, Juhan, 1952-

    2008-01-01

    Kuni 11. maini Tallinnas Kadrioru Kunstimuuseumis näitus "Igatsedes mägesid. Šveitsi maastikud Balti kunstis". Näitus vaatleb Balti kunstnike joonistusreise Šveitsi 18. sajandi teisel poolel ja 19. sajandi alguses. Kommenteerib Ants Juske

  1. Saatuslik Katõn / Mihhail Lotman

    Index Scriptorium Estoniae

    Lotman, Mihhail, 1952-

    2010-01-01

    10 aprillil lennuõnnetuses hukkunud Poola president Lech Kaczyński oma kaaskonnaga oli teel Katõni veresauna 70. aastapäevale pühendatud mälestustseremooniale, visiidist pidi saama uus algus Poola ja Venemaa suhetele

  2. Groundlab ehk maastikuurbanismi rakendamisest / Eva Castro

    Index Scriptorium Estoniae

    Castro, Eva

    2011-01-01

    Essee käsitleb rahvusvahelise maastikuurbanismiga tegeleva büroo Groundlab näitel maastikuurbanismi, mis sai alguse Londoni AA (Architectural Association) arhitektuurikooli kursusest MA Landscape Urbanism ning mille tegevusstrateegia on kujunenud läbi konkreetsete projektide

  3. Development of producing equipment of mixed butane-air with low dew point. Energy saving dewatering apparatus and 6A-Gas producing apparatus utilizing vaporization latent heat of butane and potential heat of air

    Energy Technology Data Exchange (ETDEWEB)

    Komine, Jin; Okada, Hiroto; Taniue, Nobuo; Tanoue, Keiju; Yamada, Tatsuhiko; Maekawa, Hisami; Murakami, Keiji

    1988-02-10

    A producing equipment of mixed butane-air with low dew point was developed. The dewatering was made during the period from the middle of May to the middle of October with high atmospheric humidity. The production capacity of the mixed gas is 3000 Nm/sup 3/ of 22% of butane and 78% of air per hour. The designed dew point is 18/sup 0/C or less under the pressure of 0.7 kg/cm/sup 2/G. The saturation temperature is 7.5/sup 0/C after the liquid butane is evacuated by a regulating valve. The air introduced into the dehumidifier through finned tubes is cooled to dewater based on those data. The partially vaporized butane is completely gasified by hot water in a vaporizer and mixed with the dewatered air by a venture mixer to produce the mixed butane-air. When the dewatering is incomplete, the spray nozzle must be just exchanged. The dew point of the produced gas was sufficiently below the designed value. The investment cost is low. The total operating cost is reduced by the remarkably decreased fuel cost though the power cost is increased. The noise level is low and the heat control is easy. (11 figs, 4 tabs, 1 photo)

  4. Maffia upitab petuskeemidega aktsiaid üles / Neeme Raud

    Index Scriptorium Estoniae

    Raud, Neeme, 1969-

    2003-01-01

    Tutvustades filmi "Boiler Room" ja Gary Weissi raamatut "Born To Steal" näitab autor sidet 1990. aastate alguses New Yorgi börsile imbunud organiseeritud kuritegevuse ja kümnendi teisel poolel suurtes investeeringufirmades toimunud pettuste vahel

  5. New York kuulutas sõja liigsuurele õgimisele / Neeme Raud

    Index Scriptorium Estoniae

    Raud, Neeme, 1969-

    2007-01-01

    Juuli alguses jõustusid New Yorgis uued reeglid kiirsöögikohtadele, mis peavad nüüdsest menüü kõrvale kirjutama ka teabe, kui palju kaloreid burgerid, friikartulid ja kokteilid tegelikult sisaldavad. Lisa: Uued toitlustusreeglid

  6. В ожидании мюзикла "Пышка" / Арно Рудис

    Index Scriptorium Estoniae

    Рудис, Арно

    2009-01-01

    Juuni alguses etendub Jõhvi kontserdimajas Guy de Maupassant'i novelli "Rasvarull" ainetel Peterburi Riiklikus Draamateateris Liteinõil lavastatud muusikal "Пышка". Muusika kirjutas noor helilooja Nikolai Orlovski. Etendust ja teatrit tutvustab teatri direktor Andrei Lobanov

  7. Käiguvahetuse kasulikkusest / Herbert Vainu

    Index Scriptorium Estoniae

    Vainu, Herbert, 1929-2011

    2004-01-01

    Autori arvates saavutas Eesti alguses küll kiire majandustõusu, kuid nüüd hakkab avalduma teistest endistest sotsialismimaadest ettejõudmise pahupool. Tema sõnul oleme ise löönud jalad alt edasiselt kiirelt majandusarengult

  8. Rein Pilli hobusel on hüppamine sisse kodeeritud / Maarja Värv

    Index Scriptorium Estoniae

    Värv, Maarja

    2008-01-01

    Tänavusest aastast A Big Boyga ratsutav takistussõitja Rein Pill võitis septembri alguses Venemaal kõrgetasemelise maailmakarikaetapi ning püüab saavutust korrata ka Tallinn International Horse Show'l. Lisa: Takistussõidu grand prix' rajaskeem

  9. Läänemerel ilmus Kinobussile kolleeg / J. R.

    Index Scriptorium Estoniae

    J. R.

    2008-01-01

    9. augustil algab Narva-Jõesuus filmi- ja keskkonnateemaline festival Moving Baltic Sea, mille eestvedajaks on Saksa rändfilmifestivali Moviemiento korraldajad. Festival sai 4. juulil alguse Rostockist ja liigub 100-aastasel purjekal Lovis. Eestis osaleb ka meie Kinobuss

  10. Läti kultuurileht ilmub siiski!

    Index Scriptorium Estoniae

    2002-01-01

    Pärast veebruari alguses Läti Kultuuriministeeriumi ja Kultuurkapitali Fondi tehtud otsust, mitte rahastada kultuurilehte Literatura un Maksla Latvija, puhkes väljaande ilmumist pooldav toetuste laine. 14. veebruari leht tänab toetuse eest ja teatab edasiilmumisest.

  11. Eesti kultuur XXI sajandi künnisel / Rein Veidemann

    Index Scriptorium Estoniae

    Veidemann, Rein, 1946-

    2006-01-01

    Eesti kultuuri käsitlemisest tekstina, eesti kultuurist üldisemalt 20. saj. lõpus ja 21. saj. alguses. Sisaldab Hando Runneli luuletust "Ei taha mina tagasi ei tea mis kuldseid aegu..." ja Paul-Eerik Rummo luuletust "Con affetto"

  12. Androgenetic alopecia as an indicator of metabolic syndrome and cardiovascular risk.

    Science.gov (United States)

    Ertas, Ragip; Orscelik, Ozcan; Kartal, Demet; Dogan, Ali; Ertas, Sule Ketenci; Aydogdu, Ebru Guler; Ascioglu, Ozcan; Borlu, Murat

    2016-06-01

    Numerous studies have investigated a probable association between androgenetic alopecia (AGA) and cardiovascular disease (CVD) by researching limited and dispersed parameters. We aimed to evaluate both traditional and non-traditional cardiovascular risk factors in male patients with early-onset AGA. This case-control study included 68 participants: 51 male patients with early-onset AGA and 17 healthy male controls. Patients with AGA were classified into three groups according to the Hamilton-Norwood scale and the presence of vertex hair loss. Traditional and non-traditional cardiovascular risk factors were examined in all study subjects. Metabolic syndrome was diagnosed in 25 patients with AGA and in two control subjects (p baldness and controls (p < 0.05). The pulse-wave velocity values were also found to be significantly higher in patients (p < 0.001). A limitation of this study was the small study population. In conclusion, vertex pattern AGA appears to be a marker for early atherosclerosis. This finding supports the hypothesis that early-onset AGA alone could be an independent risk factor for CVD and metabolic syndrome.

  13. Kõlblus ja kõlbavus / Jüri Hain

    Index Scriptorium Estoniae

    Hain, Jüri, 1941-

    1998-01-01

    20. saj. alguse eesti kunstist ja kirjandusest, mida on peetud moraalituks. Kunstis: A. Weizenbergi skulptuurid "Koit" ja "Hämarik", A. Vabbe akvarell "Daam boas" ja E. Wiiralti graafiline leht "Susanna". Kriitikute vastakatest seisukohtadest kõlbluse ja kõlbavuse kohta

  14. Õpetajad olid enam-vähem ühed-samad, kuigi koolis käinud olen kolmel ajal / Moja Konno ; üles kirjutanud Ülo Alo Võsar

    Index Scriptorium Estoniae

    Konno, Moja

    2008-01-01

    Ülo Alo Võsari poolt üles kirjutatud lugu Moja Konno õpingutest alguses Viljandi Eesti Haridusseltsi Tütarlastegümnaasiumis, mis riigikorra muutudes pärast 1940. aastat oli sunnitud vahetama nime Carl Robert Jakobsoni nim. Viljandi 1. Keskkooliks

  15. Maakonnas tähistati advendiaja algust / Maire Kõrver

    Index Scriptorium Estoniae

    Kõrver, Maire, 1961-

    2009-01-01

    Advendiaja alguse tähistamisest Raplas, Märjamaal, Kuimetsas ja Kaius. Rapla kirikusse olid kogunenud advendituld süütama Rapla kihelkonna valdade esindajad. Kontserdi andsid Rapla Muusikakooli õpilased. Kuimetsas ja Kaius laulis kogunenud rahvale Margus Mikomägi

  16. Euroopa kultuuripealinn Tallinn 2011 paneb PÖFF-ile õla alla

    Index Scriptorium Estoniae

    2011-01-01

    15. Pimedate Ööde Filmifestivali ja Euroopa Kultuuripealinna Tallinn 2011 koostöös alguse saanud noortele animavallas tegutsevatele professionaalidele mõeldud koolitussarjast AnimaCampus, rahvusvahelise filmituru Black Market ja programmi "60 sekundit üksindust aastal Null" toetamisest

  17. Verheugen soleerib taas : sedapuhku väikeriikide arvel / Ahto Lobjakas

    Index Scriptorium Estoniae

    Lobjakas, Ahto, 1970-

    2007-01-01

    Euroopa Komisjoni asepresident andis 2007. aasta alguse intervjuudes teada, et tulevikus pole väikeriikidele volinikukohti vaja. Samuti on ka Nizza lepingus sätestatud volinikukohtade vähendamist. Günter Verheugeniga seotus skandaalid. Vt. samas: Komisjonis revolutsiooniline seis?

  18. Akt valgel hobusel ja tütarlaps lillega / Tambet Kaugema

    Index Scriptorium Estoniae

    Kaugema, Tambet

    2000-01-01

    Riose kunstioksjonil müüdud piltidest ja nende müügihinnad. Indrek Hirve kommentaare müügilolnud tööde kohta. Detsembri alguses kuulutab galerii välja esimese online-kunstioksjoni, aadressil www.rios.ee

  19. White Paper AGA: An Episode-of-Care Framework for the Management of Obesity-Moving Toward High Value, High Quality Care: A Report From the American Gastroenterological Association Institute Obesity Episode of Care and Bundle Initiative Work Group.

    Science.gov (United States)

    Brill, Joel V; Ashmore, Jamile A; Brengman, Matthew L; Buffington, Daniel E; Feldshon, S David; Friedman, Kelli E; Margolis, Peter S; Markus, Danielle; Narramore, Leslie; Rastogi, Amita; Starpoli, Anthony A; Strople, Kenneth; White, Jane V; Streett, Sarah E

    2017-05-01

    The American Gastroenterological Association acknowledges the need for gastroenterologists to participate in and provide value-based care for both cognitive and procedural conditions. Episodes of care are designed to engage specialists in the movement toward fee for value, while facilitating improved outcomes and patient experience and a reduction in unnecessary services and overall costs. The episode of care model puts the patient at the center of all activity related to their particular diagnosis, procedure, or health care event, rather than on a physician's specific services. It encourages and incents communication, collaboration, and coordination across the full continuum of care and creates accountability for the patient's entire experience and outcome. This paper outlines a collaborative approach involving multiple stakeholders for gastrointestinal practices to assess their ability to participate in and implement an episode of care for obesity and understand the essentials of coding and billing for these services. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  20. Sõprus äratab! : Ärkamised ja karjed kino Sõpruse ajaloos / Laura Talvet

    Index Scriptorium Estoniae

    Talvet, Laura

    2010-01-01

    Kinos Sõprus näidati 1990ndate alguses punkansamblist Sex Pistols' valminud dokumentaalfilmi "The Great Rock'N'Roll Swindle" (Suurbritannia 1980), režissöör Julien Temple. Artiklis tsiteeritakse Juq-Kalle Raidi, Kojamehe, Erik Morna ja Tõnu Trubetsky muljeid

  1. Tšernobõl põhjustas NSV Liidu varisemise / Joel Haukka

    Index Scriptorium Estoniae

    Haukka, Joel

    2006-01-01

    Tšernõbli katastroof 20 aastat tagasi oli rohkem kui perestroika algus, see võis olla koguni NSV Liidu kokkuvarisemise tegelik põhjus viis aastat hiljem. Rootsi päevalehes Danges Nyheter ilmunud Mihhail Gorbatšovi artiklist katastroofi kohta

  2. Elu raamatute keskel : Kyra Roberti tegemisi meenutamas / Tiiu Reimo

    Index Scriptorium Estoniae

    Reimo, Tiiu, 1953-

    2011-01-01

    25. juulil 2011 möödus 95 aastat Kyra Roberti sünnist. Aprilli alguses Tallinna Ülikooli Akadeemilises Raamatukogus toimunud aastapäevakonverentsil meenutati selle maja kauaaegset töötajat ning avati mälestusnäitus

  3. Baltisakslase romaan : teos ja autor / Ljubov Kisseljova ; venekeelsest käsikirjast tõlkinud Mall Jõgi

    Index Scriptorium Estoniae

    Kisseljova, Ljubov, 1950-

    2016-01-01

    Analüüsitakse Eestist pärit parun Karl Georg Woldemar Friedrich von Roseni almanahhis "Altsiona" 1831. aastal ilmunud väikest romaani "Constantin Loeven. (Minu mälestustest)". Romaanis on oluline 19. sajandi alguse kreeklaste vabadusvõitluse kontekst

  4. Kuidas ma sain selleks, kes ma olen?

    Index Scriptorium Estoniae

    2013-01-01

    Kultuurikoja juurest alguse saanud töörühm on sel õppeaastal eesti koolides korraldanud Elamusaastat. Elamusaasta raames käivad eri loomevaldkondade esindajad kooliõpilastele rääkimas oma elu märgilistest sündmustest ja elamustest

  5. Hugo Bossi kunstiauhind / Maria-Kristiina Soomre

    Index Scriptorium Estoniae

    Soomre, Maria-Kristiina, 1978-

    2002-01-01

    Guggenheimi muuseum New Yorgis annab 2002. a. sügisel taas välja Hugo Bossi kunstiauhinna: 50000 dollarit ja isiknäitus Guggenheimis 2003. a. alguses. Kandidaadid: Francis Alys, Olafur Eliasson, Hachiya Kazuhiko, Koo Jeong-a, Pierre Huyghe, Anri Sala

  6. Kliimamuutus ajas ürginimese rändama / Kaarel Kressa

    Index Scriptorium Estoniae

    Kressa, Kaarel, 1983-

    2008-01-01

    DNA abil inimeste iidseid rändeteid uuriva projekti "Geneographic" teadlased kinnitasid seni teada olnud tõde, et kõik maailma rahvad on alguse saanud kunagi Aafrikast välja rännanud eellastest. Vastavasisulise loenguga esines Rahvusraamatukogus geeniteadlane Spencer Wells

  7. Põhjamaade suurima veepargi ehitus viibib

    Index Scriptorium Estoniae

    2005-01-01

    Kinnisvarafirma Arco Vara ja Soome firma Holiday Club Finland kavandatava veepargi ehituse algus Tallinnas Admiraliteedibasseini ääres lükkub 2006. a. I poolde. Linnaplaneerijate hinnangul ei sobi hoone pakutud arhitektuurne lahendus vanalinnalähedasse linnamiljöösse

  8. Sahharnaja tina / Valentin Voloshko

    Index Scriptorium Estoniae

    Voloshko, Valentin

    2005-01-01

    Agaraine tootmine merevetikast (Furcellaria Lumbricalis) sai Eestis alguse 1960-ndate aastate keskpaiku. Käesoleval ajal paralleelselt tootmisega tegeleb Est-Agar koostöös TTÜ Toiduainete Instituudiga tehnoloogia täiustamisega ja uute toodete väljatöötamisega

  9. Tuljakus on sarikapidu peetud, avamine juba suvel

    Index Scriptorium Estoniae

    2015-01-01

    Ettevõte Baltek Arendus restaureerib lillepaviljoni kõrval asuva söögikoha, mis 1990. aastate alguses kandis nime Carina, võimalikult algupärasel kujul, nii nagu selle kohviku Tuljak nime all kavandas 1965. aastal tunnustatud arhitekt Valve Pormeister

  10. Miks Milla? = Почему Милла? / Anna Fedina

    Index Scriptorium Estoniae

    Fedina, Anna

    2009-01-01

    Hollandi režissöör Paul Verhoeven valis filmi "Lumekuninganna" Amalia Bežetskaja rolli Milla Jovovichi. Film vändatakse Boriss Akunini romaani "Azazel" / "The Winter Queen" järgi. Filmivõtete algus on planeeritud juuliks 2009 Peterburis

  11. Pariisis armastatakse kunsti / Reet Varblane

    Index Scriptorium Estoniae

    Varblane, Reet, 1952-

    2011-01-01

    Ameerika päritolu 20. sajandi alguse kunstimetseenide Leo, Gertrude, Michael ja Sarah Steini kunstikogule pühendatud Grand Palais' väljapanekust "Matisse, Cézanne, Picasso... Steinide perekond". Jeu de Paume'i ameerika fotokunstniku Diane Arbusi retrospektiivnäitusest

  12. Zabõtõje imena

    Index Scriptorium Estoniae

    2002-01-01

    19. sajandi lõpu-20. sajandi alguse ehitistest Tallinnas väljaspool vanalinna. Tutvustatakse arhitekte Nikolai Thamm vanem ja noorem, F. Kordes, Ch. Gabler, R. Knüpffer, Erwin ja Rudolf Bernhard, K. Wilcken, J. Rosenbaum jt. ning nende projekteeritud hooneid

  13. Uussiiralt autoriteatrist, ajaloost ja vabadusest. Eesti näitekirjandus 2010 / Madis Kolk

    Index Scriptorium Estoniae

    Kolk, Madis, 1974-

    2011-01-01

    Postmodernismi taandumisest, ajaloodraamadest ja autoriteatrist. Viimasel ajal on teatriterminoloogiasse, just autoriteatris esinevat, ilmunud mõiste uussiirus, mis seostub eelkõige Jaan Tättega (ka Andres Noormetsa "Algus", Uku Uusberg "Jõud", Andri Luubi "Fööniks" ja "PIloot", Urmas Lennuki "Kadunud tsirkus")

  14. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002678 gi|13475854 >1el5A 4 378 18 430 4e-33 ... ref|NP_107424.1| agaE protein, conversion of agropini...c acid to mannopinic acid ... [Mesorhizobium loti MAFF303099] dbj|BAB53210.1| Aga

  15. ORF Alignment: NC_002679 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002679 gi|13488188 >1el5A 4 377 26 437 3e-36 ... ref|NP_085608.1| agaE(conversion of agropini...c acid to mannopinic acid) ... [Mesorhizobium loti MAFF303099] dbj|BAB54449.1| AgaE ...

  16. Understanding patient and physician perceptions of male androgenetic alopecia treatments in Asia-Pacific and Latin America.

    Science.gov (United States)

    Lulic, Zrinka; Inui, Shigeki; Sim, Woo-Young; Kang, Hoon; Choi, Gwang Seong; Hong, Woosung; Hatanaka, Toshiki; Wilson, Timothy; Manyak, Michael

    2017-08-01

    This survey aimed to explore patient and physician attitudes towards male androgenetic alopecia (AGA), satisfaction with currently available male AGA treatments and investigate the factors affecting treatment choice. The survey was carried out in five countries (Japan, South Korea, Taiwan, Mexico and Brazil) between November and December 2015 using a standard market research methodology. Questionnaires were completed by patients with male AGA or hair loss/thinning and practicing physicians who were responsible for prescribing AGA treatment. In total, 835 patients and 338 physicians completed the questionnaire. Overall, 37.6% of patients reported satisfaction with the treatments they had used. The highest patient satisfaction was reported for 5-alpha-reductase inhibitors (53.9% of patients satisfied). In all countries, physicians were more likely than patients to think that male AGA has a major impact on patient confidence (89.3% vs 70.4%, respectively). There was agreement by physicians and patients that male AGA patients who are involved in their treatment decisions have better outcomes. Patients who were satisfied with AGA treatments were more likely to have the level of involvement they desired in treatment decisions (69.1% of satisfied patients) than dissatisfied patients (56.4% of dissatisfied patients). This survey provides valuable insights into the attitudes of patients and physicians in Asia and Latin America about male AGA and its treatments. The survey identified areas of disconnect between physicians and patients regarding the impact of male AGA, treatment consultations and the importance of treatment attributes. It also highlights the need for physicians to spend sufficient time with patients discussing AGA treatment approaches. © 2017 GlaxoSmithKline. The Journal of Dermatology published by John Wiley & Sons Australia, Ltd on behalf of Japanese Dermatological Association.

  17. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  18. '1900 ئ kunst ristteedel' : Harry Liivrand soovitab / Harry Liivrand

    Index Scriptorium Estoniae

    Liivrand, Harry, 1961-

    2000-01-01

    19. sajandi lõpu ئ 20. sajandi alguse kunsti retrospektiivnäitus 3. apr.-ni Royal Academy of Arts'is Londonis. Ülevaade Euroopa, Ameerika ja Jaapani kunstist kogu oma stiililises ja hoiakulises vastuolulisuses: realism, postimpressionism, juugend, sümbolism, hilisromantism, akademism.

  19. Iraan - võimalus ja väljakutse USA järgmisele presidendile / Struan Stevenson

    Index Scriptorium Estoniae

    Stevenson, Struan

    2008-01-01

    Autor kritiseerib Euroopa Liidu järeleandmisi Iraani juhtivate mullade nõudmistele, Iraani opositsioonijõu PMOI kandmist terrorismi musta nimekirja ning on seisukohal, et USA uuel presidendil on võimalus oma ametiaja alguses näidata reaalseid tegusid olukorra lahendamiseks. Lisa: Iraan - taustafakte

  20. Noor Stirlitz seikleb Tallinnas / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2009-01-01

    Vene telekanalil Rossija alanud uuest seriaalist "Issajev" (režissöör Sergei Ursuljak, nimiosas Daniil Strahhov), mille esimeste osade tegevus toimub Tallinnas 1920-ndate aastate alguses. Võrdlus Grigori Kromanovi sama aega ja tegelasi hõlmava filmiga "Briljandid proletariaadi diktatuurile" (Tallinnfilm 1975)

  1. Kuhu kadus pensionäride kogutud 25 000 allkirja? / Jaanus Kõrv

    Index Scriptorium Estoniae

    Kõrv, Jaanus

    2005-01-01

    2003. aasta novembri alguses andsid Eesti Pensionäride Ühenduse esindajad ajalehe Videvik kaasabil üle Riigikogu spiikrile Ene Ergmale pöördumise 25 000 protestiallkirjaga, milles nõuti inimväärset pensioni. Valitsus pole pöördumisele reageerinud

  2. Professor Jacques Cortes prantsuse keele lektoraadis

    Index Scriptorium Estoniae

    2000-01-01

    Juuni alguses külastas filoloogiateaduskonna romaani-germaani filoloogia osakonda Roueni ülikooli professor Jacques Cortes (Prantsusmaa). Ta korraldas 4. õa üliõpilastele prantsuse keele intensiivkursuse ja võttis vastu eksami ning kohtus prantsuse keele lektoraadi õppejõududega : [täistekst

  3. Pre-Viking and early Viking Age sacrifical place at Viidumäe, west Saaremaa / Marika Mägi, Indrek Jets, Riina Riiel, Raili Allmäe

    Index Scriptorium Estoniae

    2015-01-01

    Viidumäe ohverduskoht on eriti märkimisväärne selle poolest, et kuulub perioodi,millest Saaremaal muistised peaaegu puuduvad. Leiukoht osutab, et Eesti rannikukultuuri skandinaavitumine, mis on jälgitav alates 10. sajandist, sai alguse juba hiljemalt 8. sajandil

  4. Der Wiederaufbau Narvas nach 1944 und die Utopie der "sozialistischen Stadt" / Karsten Brüggemann

    Index Scriptorium Estoniae

    Brüggemann, Karsten, 1965-

    2004-01-01

    Nõukoguliku arhitektuuripoliitika põhimõtetest, "sotsialistliku linna" teoreetilisest ideaalist ja selle ideaali praktilisest teostusest Narvas. Narva vanalinna saatusest. 1944. aastal asuti vana Narva kohale rajama sisuliselt uut linna, Narva ehitamist mõjutas eelkõige asjaolu, et seal sai alguse uraanitootmine NSV Liidus

  5. Meremaa võluriga päeva kallastele / Helle Leppik

    Index Scriptorium Estoniae

    Leppik, Helle

    1999-01-01

    29. apr. esietendub Ugalas "Meremaa võlur. Päeva kaldad", lavalugu Ursula K. Le Guini Meremaa-lugude alusel, lavastaja Andres Noormets, kunstnikud Silver Vahtre ja Airi Eras, peaosades Margus Vaher, Martin Algus, Aarne Soro, Leila Säälik, Gert Raudsepp, Silvia Sarrap

  6. Leading Estonian brands in the hands of foreign companies / Andreas Kaju

    Index Scriptorium Estoniae

    Kaju, Andreas

    2002-01-01

    Emori poolt 2002. aasta alguses läbi viidud uurimusest selgus, et Eesti top 10 kaubamärkide hulgas on Kalev ainus Eesti kapitalil põhineva ettevõtte kaubamärk. Tabel: Eesti ettevõtete ja kaubamärkide top 6. Lisa

  7. Иэна Макюэна обвинили в плагиате

    Index Scriptorium Estoniae

    2006-01-01

    Ian McEwanit süüdistatakse plagiaadis: 2006. a. surnud kirjaniku Lucilla Andrewsi agendid väidavad, et McEwan kasutas romaanis "Atonement" ("Lepitus") Andrewsi mälestusi töötamisest meditsiiniõena ühes Londoni haiglas Teise maailmasõja alguses

  8. Kõrgtehnoloogiliste toodete logistika - iga sekund on kulla hinnaga / Jochen Siegle ; ref. Kärt Blumberg

    Index Scriptorium Estoniae

    Siegle, Jochen

    2006-01-01

    Logistika tähtsusest kõrgtehnoloogiafirmadele. Lisa: Tahumatu algus, imetäpne lõppviimistlus; Kust sinu arvuti pärit on?. Vt. samas: Axel Novaki intervjuu Schenker Deutshland AG turundusdirektor Jochen Mülleriga. Kõrgtehnoloogiatööstus kui Ameerika mäed

  9. Igatsedes mägesid

    Index Scriptorium Estoniae

    2008-01-01

    Näitus "Igatsedes mägesid. Šveitsi maastikud Balti kunstis" Kadrioru Kunstimuuseumis. Vaadeldakse Balti kunstnike joonistusreise Šveitsi 18. sajandi teisel poolel ja 19. sajandi alguses. August Matthias Hageni (1794-1878), Carl Grassi (1767-1814), Wilhelm Krause (1757-1728) elust ja loomingust

  10. Kristjan Kasearu Kevadtormil. Leontjev esineb Tallinnas uue kavaga

    Index Scriptorium Estoniae

    2008-01-01

    Ajateenija Kristjan Kasearu ja bändi Paradise Crew kontserdist Kevadtorm 2008 lõpetamisel 24. mail Kukruse tuhamäel ning heliplaadi "Jääda endaks" esitluskontsertidest juuni alguses Tallinnas, Tartus, Pärnus ja Rakveres. Valeri Leontjevi kontserdist 26. mail Tallinna Linnahallis

  11. Saaremaal mäletati Louis Kahni ja August Komendanti / Laine Mets ; fotod: Laine Mets

    Index Scriptorium Estoniae

    Mets, Laine

    2007-01-01

    Eesti Arhitektide Liidu korraldusel toimunud kahepäevasest konverentsist Kuressaares oktoobrikuu alguses. Päevi läbivaks motoks oli: "Sa ei saa kunagi õppida midagi, mis pole osa sinust endast" Arhitekti ja inseneri viljakast koostööst. Kokkuvõtlik ülevaade toimunust

  12. Blondid mutandid vallutasid koopameeste südame / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2006-01-01

    Sel nädalal teadusajakirjas Evolution and Human Behaviour ilmunud uuringus tõdetakse, et blondiinide võidukäik sai alguse jääaja lõppedes. Ühtlasi on teadlased veendunud, et heledajuukselised inimesed ilmusid mingi geneetilise muundumise tagajärjel

  13. Androgenetic alopecia: An update

    Directory of Open Access Journals (Sweden)

    Feroze Kaliyadan

    2013-01-01

    Full Text Available Androgenetic alopecia (AGA is one of the commonest reasons for dermatological consultation. Over the last few years our understanding of the pathophysiology of AGA has improved and this has paved way for better diagnostic and therapeutic options. Recent research has dwelled on the role of stem cells in the pathophysiology of AGA and has also identified newer genetic basis for the condition. Dermoscopy/trichoscopy has emerged as a useful diagnostic tool for AGA. While the major treatment options continue to be topical minoxidil, systemic Finasteride and hair transplantations, newer modalities are under investigation. Specific diagnostic and treatment recommendations have also been developed on evidence based principles. This article reviews the recent concepts in relation to AGA. With regards to the pathophysiology we have tried to stress on recent knowledge of the molecular and genetic basis of AGA. We have emphasized on an evidence based approach for treatment and diagnosis.

  14. Aprilli lõpus ja mai alguses osales...

    Index Scriptorium Estoniae

    2005-01-01

    Rühmitus Avangard osales Chicagos toimunud eksperimentaalsel kunstifestivalil "Version", alapealkirjaga "Invincible Desire". Avangard näitas oma videosid ja fotoseeriat "The Bomb - back with vengeance"

  15. Õnnestumised saavad alguse teadmistest / Mihkel Kangur

    Index Scriptorium Estoniae

    Kangur, Mihkel

    2012-01-01

    Edu saavutamisest sporthobuste tõuaretuses Itaalia arhitekti ja riigiametniku ning Donatello hobusekasvatuse looja Federico Tesio ning Belgia veterinaari ja hobusekasvataja Joris de Brabander'i töö näitel

  16. Punane Veski ja plakatikunsti algus / Riina Robinson

    Index Scriptorium Estoniae

    Robinson, Riina

    2007-01-01

    Prantsuse plakatikunsti loojast Jules Cheret'st, ühest silmapaistvamast plakati- ja maalikunstnikust Henri Toulouse-Lautrecist, tema plakatite kangelannadest, kankaani tantsinud Louise Weberist ja Jane Avrilist ning Moulin Rouge'ist

  17. Uus silt turul - clean label / Gunnel Koba

    Index Scriptorium Estoniae

    Koba, Gunnel

    2013-01-01

    Suurbritanniast alguse saanud clean labeli toiduainete märgis annab tarbijale kindlustunde, et tegemist on võimalikult puhta lihtsa ja arusaadava koostisega tootega. Samas pole märgisel ametlikku definitsiooni ning pole välistatud, et toiduaine koostises ei ole ka mõni e-aine

  18. Tallinna linna- ja gümnaasiumi trükikoda ehk 380 aastat trükikunsti Tallinnas / Aija Sakova-Merivee

    Index Scriptorium Estoniae

    Sakova-Merivee, Aija, 1980-

    2015-01-01

    Alanud aasta alguses esitlesid Tallinna Ülikooli Akadeemiline Raamatukogu ja Tallinna Linnaarhiiv ühist trükist „Tallinna linna- ja gümnaasiumi trükikoda (1634–1828). Näituse kataloog”. Autor annab ülevaate nii näitusest kui selle kataloogist

  19. Disain+juhtimine : disainjuhtimise peaauhind Eestisse / Triin Ojari

    Index Scriptorium Estoniae

    Ojari, Triin, 1974-

    2012-01-01

    Ühe 2012. a. Euroopa disainjuhtimise auhinna DME peaauhindadest sai Tallinna Transpordiameti uuendusprotsess kommunikatsiooni ja teenuse parandamiseks. Võidu taga on EKA tudengid Kristi Rummel, Brit Pavelson, Norman Orro ja Ronald Pihlapson, kes tegid seda alguses graafilise disaini osakonna 3. kursuse semestritööna

  20. Pärnu täna : reekviem keisrlikult alanud savitööstusele / Tõnu Kann

    Index Scriptorium Estoniae

    Kann, Tõnu, 1957-

    2001-01-01

    Eliisabeti kiriku ehitamisega (algus 1744) koos tekkinud Pärnu savitööstusest (savitönkidest). Viimasest säilinud savitöngist Tallinna maanteel, mis on nüüdseks käsitöökodade arhitektuurunäidisena kaitse alla võetud

  1. Eesti võimalused Soome lahe kasvukolmnurgas / Aare-Maldus Uustalu

    Index Scriptorium Estoniae

    Uustalu, Aare-Maldus, 1935-

    2005-01-01

    Euroopa Komisjoni ekspert logistika, transpordi ja regionaalökonoomika alal, TTÜ Tallinna Kolledzhi dotsent 2002. aasta alguses käivitatud Soome lahe kasvukolmnurga projektist, Eesti majanduse arenguperspektiivist projekti raames ning Eesti riigiametnike ükskõiksusest projekti suhtes. Via Baltica lisakoridoride projekti Via Islands ideest

  2. Viva Franco! / Erkki Luuk

    Index Scriptorium Estoniae

    Luuk, Erkki, 1971-

    2002-01-01

    Tallinna Kinomajas ja Tartu kinos Illusioon toimunud prantsuskeelsete filmide nädala 4 mängufilmist : Christian Vincent'i "Diskreetne" ("La Discrete" ; 1990), Jean Vigo' "L'Atalante" (1934), Luis Buųeli "Belle de Jour" (1966) ja Bertrand Tavernier' "Uus algus" ("Coup de torchon"; 1981)

  3. Muusiku maja Tallinnas / Tomomi Hayashi

    Index Scriptorium Estoniae

    Hayashi, Tomomi, 1971-

    2011-01-01

    Tallinna südalinna lähedal miljööväärtuslikus piirkonnas asuva 1950. aastate alguses ehitatud kivihoone (kunagi limonaaditehas) renoveerimine ja kohandamine koos juurdeehitusega elamuks. Arhitektid Tomomi Hayashi, Liis Voksepp (HG Arhitektuur), sisearhitekt Galina Burnakova. Projekt ja ehitus: 2005-2010

  4. Tõeline spordisuvi eesti tõugu hobustele / Ingrid Randlaht

    Index Scriptorium Estoniae

    Randlaht, Ingrid

    2012-01-01

    Eesti tõugu hobustele korraldatavatest võistlustest ja võistlussarjadest 2012. aastal: Karikasari Eesti Hobune 2012, Noorhobuste tšempionaat, II eesti hobuse päev Carl Robert Jakobsoni talumuuseumis jne. Mai alguses käivitunud konkursist parima eesti tõugu hobuse tiitlile spordis

  5. Rahvarinde esimene suurvõit / Rein Ruutsoo

    Index Scriptorium Estoniae

    Ruutsoo, Rein, 1947-

    2008-01-01

    17. juuni 1988 kui poliitilise revolutsiooni algus, mis viis kommunistliku režiimi kokkukukkumiseni. 1988. aasta kronoloogiad vaadates jääb autorile mulje, et Eesti taasvabanemise sisuks oli Alo Mattiiseni laulude esitamise tähe all sinimustvalgete lehvides kulgemine ühest kooslaulmisest teise

  6. Teatriõpilane ja -uuendaja Mati Unt Vanemuises (1966 - 1972) / Ülo Tonts

    Index Scriptorium Estoniae

    Tonts, Ülo, 1931-2016

    2008-01-01

    Teatriloolisi meeldetuletusi ja ääremärkusi. Vaatluse all on Mati Undi tööd ja tegemised Vanemuise perioodil. Tööst lavastaja assistendi, instseneerija ja tõlkijana. Koostööst Kaarel Irdi ja Evald Hermakülaga. Algus eelmises TMKs

  7. Samuel Beckett vallutab kino

    Index Scriptorium Estoniae

    2000-01-01

    Dublini Gate Theatre, Blue Angel Films, RTE ja Channel 4 on jäädvustanud filmilindile kõik 19 Becketi näidendit, millest mõned on festivalil juba esitatud, kuid täispaketti saab näha 2001. aasta alguses. Allk. K. H.

  8. Питерской "Пышке" рукоплескали на родине Ги де Мопассана / Ирина Кивисельг ; комментировал Андрей Лобанов

    Index Scriptorium Estoniae

    Кивисельг, Ирина, 1961-

    2009-01-01

    Peterburi Riikliku Draamateatri Liteinõil direktor Andrei Lobanov räägib teatrist ja juuni alguses Jõhvis ning Tallinnas etenduvast Guy de Maupassant'i novelli "Rasvarull" ainetel lavastatud muusikalist "Пышка". Lavastaja Vladislav Pazi, muusika autor Nikolai Orlovski, peaosas Tatjana Tuzova

  9. AirBaltic grows but profits elusive

    Index Scriptorium Estoniae

    2011-01-01

    AirBalticu vähemusomanik Baltijas Aviacijas Sistemas tegi Läti transpordiministeeriumile ettepaneku ettevõttele kuuluvad aktsiad 130 miljoni euroga maha müüa. Valitsuse võimalikest edaspidistest plaanidest airBalticuga. Suve alguses kohtus peaminister Valdis Dombrovskis Läti lennundusest huvitatud Ukraina investoritega

  10. FINASTERIDE AS A TREATMENT FOR MALE ANDROGENETIC ALOPECIA

    Directory of Open Access Journals (Sweden)

    Ni Komang Tristiana Dewi

    2013-04-01

    Full Text Available Androgenetic alopecia (AGA is a type of alopecia non sikatrik that most often occur, especially in men. AGA is hereditary baldness and form distinctive patterns. Causes related to AGA estimated serum androgen levels, especially 5-?-dehydrotestosterone (DHT, which can lead to miniaturization of the hair follicle. Finasteride is one of drugs that proven effective in treating hair loss caused by AGA. Finasteride is a 4-azasteroid components that are competitive and specific inhibitor of the enzyme 5-?-reductase type II, an enzyme that converts testosteron into intracellular DHT. By inhibiting the enzyme 5-?-reductase type II, conversion of testosteron to DHT inhibited, thereby causing a significant decrease in serum and tissue DHT concentrations. The use of finasteride 1 mg per day proven to effectively treat AGA in men.  

  11. Blood Plasma-Derived Anti-Glycan Antibodies to Sialylated and Sulfated Glycans Identify Ovarian Cancer Patients.

    Science.gov (United States)

    Pochechueva, Tatiana; Chinarev, Alexander; Schoetzau, Andreas; Fedier, André; Bovin, Nicolai V; Hacker, Neville F; Jacob, Francis; Heinzelmann-Schwarz, Viola

    2016-01-01

    Altered levels of naturally occurring anti-glycan antibodies (AGA) circulating in human blood plasma are found in different pathologies including cancer. Here the levels of AGA directed against 22 negatively charged (sialylated and sulfated) glycans were assessed in high-grade serous ovarian cancer (HGSOC, n = 22) patients and benign controls (n = 31) using our previously developed suspension glycan array (SGA). Specifically, the ability of AGA to differentiate between controls and HGSOC, the most common and aggressive type of ovarian cancer with a poor outcome was determined. Results were compared to CA125, the commonly used ovarian cancer biomarker. AGA to seven glycans that significantly (P<0.05) differentiated between HGSOC and control were identified: AGA to top candidates SiaTn and 6-OSulfo-TF (both IgM) differentiated comparably to CA125. The area under the curve (AUC) of a panel of AGA to 5 glycans (SiaTn, 6-OSulfo-TF, 6-OSulfo-LN, SiaLea, and GM2) (0.878) was comparable to CA125 (0.864), but it markedly increased (0.985) when combined with CA125. AGA to SiaTn and 6-OSulfo-TF were also valuable predictors for HGSOC when CA125 values appeared inconclusive, i.e. were below a certain threshold. AGA-glycan binding was in some cases isotype-dependent and sensitive to glycosidic linkage switch (α2-6 vs. α2-3), to sialylation, and to sulfation of the glycans. In conclusion, plasma-derived AGA to sialylated and sulfated glycans including SiaTn and 6-OSulfo-TF detected by SGA present a valuable alternative to CA125 for differentiating controls from HGSOC patients and for predicting the likelihood of HGSOC, and may be potential HGSOC tumor markers.

  12. Rõve kuubis, aga... / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2006-01-01

    Dokumentaalfilm "Aristokraadid", kus ühte roppu habemega anekdooti jutustavad meelelahutustööstusest tuntud tegijad : režissöör Paul Provenza : Ameerika Ühendriigid 2006. Filmi näitab Tallinna Kinomaja

  13. Usalda, aga kontrolli / Manuela Pihlap

    Index Scriptorium Estoniae

    Pihlap, Manuela

    2008-01-01

    Uuest isikuandmete kaitse seadusest. Ilmunud ka Harju Ekspress 22. veeb. 2008, lk. 6 ; Meie Maa 26. veeb. 2008, lk. 2 ; Pärnu Postimees 28. veeb. 2008, lk. 15 ; LõunaLeht 28. veeb. 2008, lk. 4 ; Valgamaalane 28. veeb. 2008, lk. 2

  14. Siberisse sunnitööle 1 / Aadu Must

    Index Scriptorium Estoniae

    Must, Aadu, 1951-

    2008-01-01

    Eesti kurjategijatest saatmisest Siberisse sunnitööle või sundasumisele aastatel 1850-1910. Algus. Järgneb Maaleht 2008, 3. aprill, lk. 33 ; 10. aprill, lk. 35 ; 17. aprill, lk. 33 ; 24. aprill, lk. 31 ; 1. mai, lk. 29 ; 8. mai, lk. 33 ; 15. mai, lk. 33

  15. Saag käima! / Laurence Lumiere

    Index Scriptorium Estoniae

    Lumiere, Laurence

    2006-01-01

    Tallinnas on ekraanil õudusfilm "Texase mootorsaemõrvad : algus" ("The Texas Chainsaw Massacre : The Beginning") : režissöör Jonathan Liebesman : Ameerika Ühendriigid 2006. Ülevaade sama teema ja pealkirjaga rohketest eelkäijatest kuni esimeseni - 1974.a. valminud Tobe Hooperi filmini "Texase mootorsaemõrvad"

  16. Fossil fields of Ilmandu and Muraste north Estonia / Valter Lang, Helena Kaldre, Marge Konsa...[jt.

    Index Scriptorium Estoniae

    2004-01-01

    Imandu ja Muraste küla maadel on plaanistatud seni kõige suurem fossiilsete põldude jäänustega ala Eestis. Esindatud on eri tüüpi põllusüseemid. Maaharimise alguse neil aladel võib dateerida eelrooma rauaaega ning see kestis kuni uusajani

  17. Sotsialistid ja terroristid 1905. aasta revolutsioonis / Toomas Karjahärm

    Index Scriptorium Estoniae

    Karjahärm, Toomas, 1944-

    2015-01-01

    Terrorismi mõistest ja definitsioonidest. Maailmavaatelisest lõhest Eesti ühiskondlikus liikumises 20. sajandi alguses. Vene terrorismi historiograafiast. Terrorist Riias ja Moskvas. Massiterrorist ja individuaalterrorist. VSDTP neljandast kongressist. Relvastatud võitlusest. Kihutuskirjandusest. Lööksalkadest, relvadest. Ülestõusnute plaanidest. Vägivalla ohvritest. Parun Budbergi tapmisest

  18. [Öös on valgust...] / Karl Kello

    Index Scriptorium Estoniae

    Kello, Karl, 1950-

    2009-01-01

    Iirimaalt alguse saanud liikumise Libertas, millest on kujunemas esimene üleeuroopaline erakond, eesmärkidest muuta Euroopa paremini toimivaks. Esikohale on seatud demokraatia arendamine esmatasandil ning läbipaistvuse ja vastutuse suurendamine, samuti võitlus eurobürokraatia vastu. Libertas Eesti Erakonna esimees on Jaan Laas

  19. Tudengifilmid seavad fookusesse arhitektuuri / Karin Klaus

    Index Scriptorium Estoniae

    Klaus, Karin

    2015-01-01

    Pärnu keskraamatukogus näidatakse Balti Filmi- ja Meediakooli tudengite ühistööna valminud komplekti arhitektuuriteemalistest lühimängufilmidest. Filmid on Kairit Brassi "Lõunavalgus", Liva Vilnite "Sagedus", Marta Pulki "Õhk", Keidi Mäe "Uue alguse loon" ja Epp Kubu "Uustulnuk"

  20. Changes in the sebaceous gland in patients with male pattern hair loss (androgenic alopecia).

    Science.gov (United States)

    Kure, Katsuhiro; Isago, Tsukasa; Hirayama, Takeshi

    2015-09-01

    The sebaceous gland and the follicular bulge region have important role in biology of the hair. They initiate destruction of the hair follicle both in human and animal models in certain conditions. The morphometric feature of the sebaceous gland is not well understood so as the distribution of the bulge stem cells in pathological conditions of male pattern hair loss or androgenic alopecia (AGA). The authors perform morphometric analysis of the sebaceous gland in AGA patients and also study distribution of the follicular stem cells in the bulge region in these populations. Two hundred and fifty cases of glass slide specimen from Japanese patients with male pattern hair loss were reviewed. Among these, 23 cases of the longitudinal (vertical) sections of the scalp skin with diagnosis of AGA were found and analyzed for the morphometric characteristics. Each sebaceous gland area was measured using NIH imagej system and statistically analyzed. For the identification of the follicular bulge region, an immunohistochemistry using anticytokeratin 15 (C8/144B clone) was carried out in the cases of AGA. The sebaceous gland area of the AGA group was noticeably increased, while the size of each sebaceous gland remains unchanged. It has more lobules in the hair follicular unit in the AGA population. In the immunohistochemistry, the follicular stem cells are present in the bulge regions in cases of AGA. The overgrowth (multilobulation) of the sebaceous gland and relative preservation of the follicular stem cells suggest that the changes in the sebaceous gland could be an important factor in the pathology of AGA. © 2015 Wiley Periodicals, Inc.

  1. Тіе Modern treatment of androgenetic alopecia

    Directory of Open Access Journals (Sweden)

    V. K. Karnaukhov

    2017-01-01

    Full Text Available Androgenetic alopecia (AGA is the most common reason for hair loss. Its frequency in Caucasian population is up to 80% in men and 42% in women. Current gold standard for AGA treatment includes minoxidil and/or finasteride. Both drugs have moderate treatment efficacy and can cause significant side effects. Minoxidil is the only option for treatment of AGA in women since finasteride has no efficacy. This review considers actual concepts of molecular mechanisms of pathogenesis and current treatment options of AGA with their limitations and shortcomings. Current state and perspectives of novel approaches to AGA treatment, potentially more effective and safe than minoxidil and finasteride, are described. The review discusses growth factors and cytokines, topical 5-alpha-reductase inhibitors, androgen receptor antagonists, prostaglandin analogs and antagonists, Wnt signaling activators and platelet-rich plasma injections.

  2. Genetic variants at 20p11 confer risk to androgenetic alopecia in the Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Bo Liang

    Full Text Available BACKGROUND: Androgenetic alopecia (AGA is a well-characterized type of progressive hair loss commonly seen in men, with different prevalences in different ethnic populations. It is generally considered to be a polygenic heritable trait. Several susceptibility genes/loci, such as AR/EDA2R, HDAC9 and 20p11, have been identified as being involved in its development in European populations. In this study, we aim to validate whether these loci are also associated with AGA in the Chinese Han population. METHODS: We genotyped 16 previously reported single nucleotide polymorphisms (SNPs with 445 AGA cases and 546 healthy controls using the Sequenom iPlex platform. The trend test was used to evaluate the association between these loci and AGA in the Chinese Han population. Conservatively accounting for multiple testing by the Bonferroni correction, the threshold for statistical significance was P ≤ 3.13 × 10(-3. RESULTS: We identified that 5 SNPs at 20p11 were significantly associated with AGA in the Chinese Han population (1.84 × 10(-11 ≤ P ≤ 2.10 × 10(-6. CONCLUSIONS: This study validated, for the first time, that 20p11 also confers risk for AGA in the Chinese Han population and implicated the potential common genetic factors for AGA shared by both Chinese and European populations.

  3. Verine vihakolle Balkanil jahtus aastatega argiidülliks / Peeter Kuimet

    Index Scriptorium Estoniae

    Kuimet, Peeter

    2007-01-01

    Ilmunud ka: Postimees : na russkom jazõke 4. juuli lk. 4-5. Lõpeb Eesti kaitseväe pikim välismissioon Bosnia-Hertsegoviinas, mis kestis üksteist aastat. Vt. samas: Politseireform takistab Bosnia liikumist Euroopasse; Praeguseks lahenenud Bosnia konflikt sai alguse 1992. aastal ja põhines rahvustevahelisel vaenul

  4. Ilus Eesti riie / Britt Rosen, Kristel Kossar

    Index Scriptorium Estoniae

    Rosen, Britt, 1968-

    2006-01-01

    Huvist eesti rahvarõivaste ja rahvuslike motiividega rõivaste ja esemete vastu, nende hankimise võimalustest, rahvuslike elementide sobitamisest tänapäevase rõivastusega. Kommentaarid Anu Lensmendilt ja Aldo Järvsoolt, kes märtsi alguses näitab KUMUs oma uut kollektsiooni "Red passion: folkcouture"

  5. Kuidas Moskvas valmistati ette 1950. aasta märtsipleenumit : ÜK8b)P Keskkomitee otsus "puudustest ja vigadest" EK(b)P KK töös / Tõnu Tannberg

    Index Scriptorium Estoniae

    Tannberg, Tõnu, 1961-

    2010-01-01

    Pleenumiks valmistumine algas Moskva võimukoridorides 1949. aasta alguses ja järellainetus kestis 1952. aasta teise pooleni. Pikka aega ei olnud uurijatele kättesaadav alusdokument - ÜK(b)P KK otsus "Puudustest ja vigadest eestimaa Kommunistliku (bolševike) Paretis Keskkomitee töös". Dokumenti tekst

  6. Piitsa ja prääniku Venemaa-poliitika / Jeroen Bult

    Index Scriptorium Estoniae

    Bult, Jeroen

    2006-01-01

    Samal ajal kui USA on Venemaa suhtes võtmas kriitilisemat seisukohta, mida näitas ka USA asepresidendi Dick Cheney kõne mai alguses Musta mere ja Balti riikide konverentsil, välistavad Saksamaa majandushuvid ja tasakaalukas välispoliitika igasuguse toetuse USA karmistuvale hoiakule Venemaa suhtes. Lisa: Etteheited

  7. Robert Adrian X / Robert Adrian X ; interv. Tilman Baumgärtel

    Index Scriptorium Estoniae

    Adrian X, Robert

    2006-01-01

    1997. a. Ljubljanas tehtud intervjuu 1972. aastast Viinis elava kanada kunstniku Robert Adrian X-ga (sünd. 1935), kes töötas 1970-ndate lõpul ja 1980-ndate alguses telefoni, faksi ja varaste kirjakstisüsteemidega kunstiprojektide kallal, osales 1970-ndate ja 1980-ndate multimeediaprojektides

  8. Distsiplinaarsest, aporeetilisest ning mittedistsiplinaarsest mõtlemisest / Airi Liimets

    Index Scriptorium Estoniae

    Liimets, Airi, 1959-

    2009-01-01

    Lähtudes Michel Foucault’ mõtetest diskursuse, kõnelevate häälte, filosoofia ja selle alguse kohta, küsib autor, missugusel viisil oleks võimalik mõelda muusikast ja muusikapedagoogikast, ja toob esile kolm mõtlemisviisi ning vaatleb neid teaduse vaatepunktist rõhuasetusega muusikapedagoogikal ja muusikal

  9. New Baltic Drama 2011 võidunäidend jõuab Linnateatri lavale

    Index Scriptorium Estoniae

    2011-01-01

    Rahvusvahelisest näidendivõistlusest, mille võidunäidendid on Martin Alguse "Kontakt" (Eesti), Pipsa Lonkka "These Little Town Blues Are Melting Away" (Soome), Semjon Kirovi "Ilja päev" (Venemaa), Johanna Emanuelssoni "Vaata, ma kukun" ("Älfsborgi sild", Rootsi). Viimast hakkab Tallinna Linnateatris lavastama Diana Leesalu

  10. Muuseumid kaubamajadeks? / Maria-Kristiina Soomre

    Index Scriptorium Estoniae

    Soomre, Maria-Kristiina, 1978-

    2001-01-01

    Võib juhtuda, et Tate Gallery on sunnitud müüma teoseid oma kollektsioonist katmaks Tate Moderni loomisega kaasnenud kulusid. Sothebys tulevad 25. IV müügile 350 XX sajandi alguse Edward Steicheni, Walker Evansi, Alfred Stieglitzi, EugèneAtgeti, Man Ray fotot New Yorgi MOMA kogudest

  11. Harry Potter lendab internetis / Anu Mõttus

    Index Scriptorium Estoniae

    Mõttus, Anu

    2002-01-01

    2000/2001. õ.a.-l alguse saanud õpilaste interaktiivsest kirjandusprojektist "R-LIIT", mis sai hiljem nimeks "Lugeda on mõnus". Projekti käigus valiti üks raamat (2001.a. - J.K. Rowling "Harry Potter ja tarkade kivi") ning arutleti selle üle nii koolides kui Interneti vahendusel

  12. Ingli ja kuradi laps : moekollektsioon 'Est' sõidab Eestit esindama Berliini / Tiina Jõgeda

    Index Scriptorium Estoniae

    Jõgeda, Tiina, 1962-

    1998-01-01

    Moetudeng Aldo Järvsoost, kes on paar aastat võitnud moekonkursi 'IN-show'. Aasta alguses sai aasta moedisaineri tiitli ehk 'Kuldse nõela' omanikuks, võitis aprillis moetudengite konkursi Smirnoff Fashion Awardsi Eesti eelvooru ning sõidab juulis oma kollektsiooniga Berliini. A. Järvsoo endast, meie rõivapoodidest.

  13. Eesti NSV turistid Soomes aastail 1955-1980 / Oliver Pagel

    Index Scriptorium Estoniae

    Pagel, Oliver, 1984-

    2014-01-01

    Kui 1970. aastate alguses kujunes välja Soome massiturism ENSV-sse. Tallinnast sai välisturistide külastatavuselt kolmas linn NSVL-is. Massiturismi Eestist Soome ei lastud tekkida ning Eesti reisijate arvukust hoiti kontrolli all. Välistuusiku saamise kadalipust. Eesti turistide käitumisest Soomes ja julgeolekukaalutlustest

  14. Ghrelin and obestatin plasma levels and ghrelin/obestatin prepropeptide gene polymorphisms in small for gestational age infants.

    Science.gov (United States)

    Zhang, Shulian; Zhai, Guanpeng; Zhang, Jinping; Zhou, Jianguo; Chen, Chao

    2014-12-01

    To investigate plasma ghrelin and obestatin levels, and ghrelin/obestatin prepropeptide gene polymorphisms, in sequentially enrolled small for gestational age (SGA) infants. Neonates were sequentially enrolled into this study and were then subdivided into different groups, according to different study aims and availability of study materials. Consequently, plasma ghrelin and obestatin levels were measured in term SGA, term appropriate for gestational age (AGA), term large for gestational age (LGA), preterm SGA and preterm AGA neonates. Levels of both peptides were also measured in AGA infants of different gestational ages, and in term AGA neonates at different days following birth. Three ghrelin/obestatin prepropeptide gene single nucleotide polymorphisms (SNPs), Arg51Gln, Leu72Met, and Gln90Leu, were measured in neonates. The study involved a total cohort of 581 neonates. Out of 150 neonates (30 term AGA, 30 term SGA, 30 term LGA, 30 preterm AGA, and 30 preterm SGA), plasma obestatin levels were significantly higher in term SGA versus term LGA neonates (0.21 ± 0.02 ng/ml versus 0.17 ± 0.01 ng/ml, respectively). Out of a wider cohort, there were no significant differences in genotypes and allele frequencies of Arg51Gln, Leu72Met, and Gln90Leu SNPs between term SGA and AGA neonates, or between preterm SGA and AGA neonates. Ghrelin/obestatin prepropeptide polymorphisms were not found to be associated with SGA status in neonates; however, ghrelin and obestatin levels may be involved in growth and development. Further studies are required to understand the relationship between ghrelin, obestatin and prenatal development. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  15. Development of silver impregnated alumina for iodine separation from off-gas streams

    Energy Technology Data Exchange (ETDEWEB)

    Funabashi, Kiyomi; Fukasawa, Tetsuo; Kikuchi, Makoto [Energy Research Laboratory, Hitachi (Japan)] [and others

    1995-02-01

    An inorganic iodine adsorbent, silver impregnated alumina (AgA), has been developed to separate iodine effectively from off-gas streams of nuclear facilities and to decrease the volume of waste (spent adsorbent). Iodine removal efficiency was improved at relatively high humidity by using alumina carrier with two different pore diameters. Waste volume reduction was achieved by impregnating relatively large amounts of silver into the alumina pores. The developed adsorbent was tested first with simulated off-gas streams under various experimental conditions and finally with actual off-gas streams of the Karlsruhe reprocessing plant. The decontamination factor (DF) was about 100 with the AgA bed depth of 2cm at 70% relative humidity, which was a DF one order higher than that when AgA with one pore size was used. Iodine adsorption capacity was checked by passing excess iodine into the AgA bed. Values were about 0.12 and 0.35 g-I/cm`-AgA bed for 10 and 24wt% silver impregnated AgA, respectively. The results obtained in this study demonstrated the applicability of the developed AgA to the off-gas treatment system of nuclear facilities.

  16. A Comparison of Hybrid Approaches for Turbofan Engine Gas Path Fault Diagnosis

    Science.gov (United States)

    Lu, Feng; Wang, Yafan; Huang, Jinquan; Wang, Qihang

    2016-09-01

    A hybrid diagnostic method utilizing Extended Kalman Filter (EKF) and Adaptive Genetic Algorithm (AGA) is presented for performance degradation estimation and sensor anomaly detection of turbofan engine. The EKF is used to estimate engine component performance degradation for gas path fault diagnosis. The AGA is introduced in the integrated architecture and applied for sensor bias detection. The contributions of this work are the comparisons of Kalman Filters (KF)-AGA algorithms and Neural Networks (NN)-AGA algorithms with a unified framework for gas path fault diagnosis. The NN needs to be trained off-line with a large number of prior fault mode data. When new fault mode occurs, estimation accuracy by the NN evidently decreases. However, the application of the Linearized Kalman Filter (LKF) and EKF will not be restricted in such case. The crossover factor and the mutation factor are adapted to the fitness function at each generation in the AGA, and it consumes less time to search for the optimal sensor bias value compared to the Genetic Algorithm (GA). In a word, we conclude that the hybrid EKF-AGA algorithm is the best choice for gas path fault diagnosis of turbofan engine among the algorithms discussed.

  17. Serum androgens and prostate-specific antigen levels in androgenetic alopecia: is there a difference between frontal and vertex baldness?

    Science.gov (United States)

    Lis-Święty, A; Arasiewicz, H; Ranosz-Janicka, I; Brzezińska-Wcisło, L

    2017-12-13

    Androgenetic alopecia (AGA) seems to be a marker of increased risk of prostate cancer (PCa). We sought to investigate potential pathophysiological differences between frontal and vertex balding that might have the impact on the incidence of PCa. Serum concentrations of testosterone (T), dihydrotestosterone (DHT) and prostate-specific antigen (PSA) were measured in 88 subjects with AGA. We have examined sixty patients with frontal baldness and 28 patients with vertex baldness. The subgroups did not differ significantly in age, BMI and as regards age of AGA onset, duration of AGA and comorbidities. The mean value of DHT in serum of the men with vertex baldness was higher than those in the men with frontal baldness with statistical significance (P baldness may signal higher exposures to circulating DHT. Serum PSA level cannot serve as surrogate diagnostic marker of increased androgenic activity in men with AGA. © 2017 European Academy of Dermatology and Venereology.

  18. Geometry correction Algorithm for UAV Remote Sensing Image Based on Improved Neural Network

    Science.gov (United States)

    Liu, Ruian; Liu, Nan; Zeng, Beibei; Chen, Tingting; Yin, Ninghao

    2018-03-01

    Aiming at the disadvantage of current geometry correction algorithm for UAV remote sensing image, a new algorithm is proposed. Adaptive genetic algorithm (AGA) and RBF neural network are introduced into this algorithm. And combined with the geometry correction principle for UAV remote sensing image, the algorithm and solving steps of AGA-RBF are presented in order to realize geometry correction for UAV remote sensing. The correction accuracy and operational efficiency is improved through optimizing the structure and connection weight of RBF neural network separately with AGA and LMS algorithm. Finally, experiments show that AGA-RBF algorithm has the advantages of high correction accuracy, high running rate and strong generalization ability.

  19. Androgenic alopecia and dutasteride in hair mesotherapy: A short review

    Directory of Open Access Journals (Sweden)

    Estela B Busanello

    2018-02-01

    Full Text Available Androgenic alopecia (AGA is the most common cause of patterned hair loss in predisposed men and women. AGA is a multifactorial and polygenetic condition, affecting up to 80% of men and 40-50% of women during life. AGA is characterized by a gradual reduction of the anagen and increase in telagen phase, leading to a progressive follicle miniaturization. As a consequence, terminal hairs are converted into vellus hairs decreasing hair density. The pathophysiology of AGA is heterogeneous and highly complex. A diverse combination of genetical factors, endocrine abnormalities, circulating androgens, drugs, diet and microinflammation in hair follicles of each individual are related to this condition. However, it is well known that androgens are the major modulators of male AGA but their specific action on female AGA is still under debate. Circulating testosterone is converted by 5a-reductase in 5a-dihydrotestosterone (DHT in the periphery, a decrease of anagen phase occur, anticipating catagen phase in a complex process involving apoptosis as probably microinflammation. In AGA treatment, mesotherapy is being used with 5a-reductase inhibitors, especially dutasteride, injected directly on scalp. Thus, this updated review summarized the injectable use of dutasteride based on data available on PubMed until March 2017. Dutasteride, a second-generation inhibitor of 5a-reductase is more potent than finasteride due to the capability of inhibit types 1 and 2 of the enzyme. The efficacy and safety of hair mesotherapy with dutasteride were reported by distinct groups and the best results were achieved when this compound was used in combination with other substances, increasing hair growth. This result could be explained by the multifactorial pathophysiology of AGA, involving hair follicle sensitivity to DHT and microinflammation. Therefore, a multi-therapeutic approach seems to be more effective in AGA management. In conclusion, more studies are needed to

  20. Association of asthma therapy and Churg-Strauss syndrome: an analysis of postmarketing surveillance data.

    Science.gov (United States)

    DuMouchel, William; Smith, Eric T; Beasley, Richard; Nelson, Harold; Yang, Xionghu; Fram, David; Almenoff, June S

    2004-07-01

    Churg-Strauss syndrome (CSS), also known as allergic granulomatous angiitis (AGA), is a rare vasculitis that occurs in patients with bronchial asthma. The nature of the association of CSS with various asthma therapies is unclear. This study investigated the associations of different multidrug asthma therapy regimens and the reporting of AGA (the preferred code for CSS in the coding dictionary for the Adverse Event Reporting System [AERS]) by applying an iterative method of disproportionally analysis to th AERS database maintained by the US Food and Drug Administration. The public-release version of the AERS database was used to identify reports of AGA in patients receiving asthma therapy. Reporting of AGA was examined using iterative disproportionality methods in patients receiving > or =1 of the following drug classes: inhaled corticosteroid (ICS), leukotriene receptor antagonist (LTRA), short-acting beta(2)-agonist (SABA), or long-acting beta(2)-agonist (LABA). The Bayesian data-mining algorithm known as the multi-item gamma poisson shrinker was used to determine the relative reporting rates by calculation of the empirical Bayes geometric mean (EBGM) and its 90% CI (EB05 = lower limit and EB95 = upper limit) for each drug. Subset analyses were performed for each drug with different medication combinations to differentiate the relative reporting of AGA for each. A strong association was found between LTRA use and AGA (EBGM = 104.0, EB05 = 95.0, EB95 = 113.8) that persisted with all combinations of therapy studied. AGA was also associated with the ICS, SABA and LABA classes (EBGM values of 27.8, 14.6 and 40.4, respectively). However, the latter associations were mostly dependent on the presence of concurrent LTRA and, to a lesser extemt, oral corticosteroid therapy and became negligible (ie, EB05 < 2) for patients who were not receiving these concurrent treatments. Differences based on relative reporting were observed in the patterns of association of AGA with LTRA

  1. Nõrkushoogudes vaevelnud dollar hakkab kosuma / Lauri Matsulevitsh, Liis Kängsepp

    Index Scriptorium Estoniae

    Matsulevitsh, Lauri

    2005-01-01

    Viimastel aastatel langustrendis püsinud USA dollar on näitamas tugevnemise märke. Vt. samas: Euroopas jäävad intressid stabiilseks; Bensiin võib kallineda järgmise nädala alguses; Tekstiilitöösturid soovivad nõrka dollarit; Kalatööstused rõõmustavad

  2. Tranzitnõi interes / Aleksei Zhigulin

    Index Scriptorium Estoniae

    Zhigulin, Aleksei

    2005-01-01

    Aasta alguses on toimunud kaks suurt transpordialast konverentsi - TransBaltika ja TransRussia, Tallinnas on algamas TransEstonia, kus püütakse selgusele jõuda Eesti lähiaastate transiidipoliitikas ning sõlmida ärialaseid kokkuleppeid. Ülevaade Moskvas toimunud transpordi- ja logistika-alasest näitusest TransRussia

  3. Pirita tee trepp = Pirita road stairway / Villem Tomiste

    Index Scriptorium Estoniae

    Tomiste, Villem, 1975-

    2011-01-01

    Artikkel lähtub Tallinna III linnafoorumist, kus vaatluse all oli Pirita tee alguse piirkond. Lauluväljaku ja Maarjamäe memoriaali vahelisest alast. Ettepanek ehitada Pirita teelt klindile trepistik, mis linna poolt külgneks elamute alaga. Näitusehallid võiksid kolida klindi peale Narva maantee äärde

  4. A comparison of the metabolism of the abortifacient compounds from Ponderosa pine needles in conditioned versus naive cattle.

    Science.gov (United States)

    Welch, K D; Gardner, D R; Pfister, J A; Panter, K E; Zieglar, J; Hall, J O

    2012-12-01

    Isocupressic acid (ICA) is the abortifacient compound in ponderosa pine (Pinus ponderosa L.) needles, which can cause late-term abortions in cattle (Bos taurus). However, cattle rapidly metabolize ICA to agathic acid (AGA) and subsequent metabolites. When pine needles are dosed orally to cattle, no ICA is detected in their serum, whereas AGA is readily detected. Recent research has demonstrated that AGA is also an abortifacient compound in cattle. The observation has been made that when cattle are dosed with labdane acids for an extended time, the concentration of AGA in serum increases for 1 to 2 d but then decreases to baseline after 5 to 6 d even though they are still being dosed twice daily. Therefore, in this study we investigated whether cattle conditioned to pine needles metabolize ICA, and its metabolites, faster than naïve cattle. Agathic acid was readily detected in the serum of naïve cattle fed ponderosa pine needles, whereas very little AGA was detected in the serum of cattle conditioned to pine needles. We also compared the metabolism of ICA in vitro using rumen cultures from pine-needle-conditioned and naïve cattle. In the rumen cultures from conditioned cattle, AGA concentrations were dramatically less than rumen cultures from naïve cattle. Thus, an adaptation occurs to cattle conditioned to pine needles such that the metabolism AGA by the rumen microflora is altered.

  5. Study of gene expression alteration in male androgenetic alopecia: evidence of predominant molecular signalling pathways.

    Science.gov (United States)

    Michel, L; Reygagne, P; Benech, P; Jean-Louis, F; Scalvino, S; Ly Ka So, S; Hamidou, Z; Bianovici, S; Pouch, J; Ducos, B; Bonnet, M; Bensussan, A; Patatian, A; Lati, E; Wdzieczak-Bakala, J; Choulot, J-C; Loing, E; Hocquaux, M

    2017-11-01

    Male androgenetic alopecia (AGA) is the most common form of hair loss in men. It is characterized by a distinct pattern of progressive hair loss starting from the frontal area and the vertex of the scalp. Although several genetic risk loci have been identified, relevant genes for AGA remain to be defined. To identify biomarkers associated with AGA. Molecular biomarkers associated with premature AGA were identified through gene expression analysis using cDNA generated from scalp vertex biopsies of hairless or bald men with premature AGA, and healthy volunteers. This monocentric study reveals that genes encoding mast cell granule enzymes, inflammatory mediators and immunoglobulin-associated immune mediators were significantly overexpressed in AGA. In contrast, underexpressed genes appear to be associated with the Wnt/β-catenin and bone morphogenic protein/transforming growth factor-β signalling pathways. Although involvement of these pathways in hair follicle regeneration is well described, functional interpretation of the transcriptomic data highlights different events that account for their inhibition. In particular, one of these events depends on the dysregulated expression of proopiomelanocortin, as confirmed by polymerase chain reaction and immunohistochemistry. In addition, lower expression of CYP27B1 in patients with AGA supports the notion that changes in vitamin D metabolism contributes to hair loss. This study provides compelling evidence for distinct molecular events contributing to alopecia that may pave the way for new therapeutic approaches. © 2017 British Association of Dermatologists.

  6. Millisest kontekstist pärineb Tallinna Linnaarhiivi käsikiri Cm3? / Meelis Friedenthal

    Index Scriptorium Estoniae

    Friedenthal, Meelis, 1973-

    2008-01-01

    Käsikirja varasemast uurimisest. Cm3 lühikirjeldus. Cm3 dateerimisvõimalustest. Kopeeritud on tekstid tõenäoliselt 14. sajandi lõpus 15. sajandi alguses ja pärinevad Kesk-Euroopast või Skandinaaviast. Cm3 ja Cm4 võrdlus. Mõlemaid raamatuid kasutasid tõenäoliselt Tallinna dominiiklased

  7. Tänapäeva muinasjutt : [lühijutud] / Kris, Moor, pseud.

    Index Scriptorium Estoniae

    Kris Moor, pseud.

    2007-01-01

    Sisu: Imagine an actor saying following ; algus ; korralikud tüdrukud ; Provokatsioon ; absoluutselt täiuslik ; sigaret ; best friends ; probleem ; Tere Kris ; kirjutis ; armastus ; Elluastuja ; oeh ; klishee ; happy neverending story ; tungid ja tungisaatused ; noh ; lohe ; the art of noise ; latentsus ; Lühikokkuvõte tänapäeva muinasjutust: (ilma ilukirjandusliku liialduseta)

  8. Estonian household forms and motives for saving and borrowing / Marge Sults

    Index Scriptorium Estoniae

    Sults, Marge

    2003-01-01

    Kui 1990-ndate alguses mõjutas majapidamissektori säästmiskäitumist inflatsioon, siis nüüd on oluliseks saanud nii sissetulekute kasv, madalad laenuintressid kui ka uued laenutooted ja väiksemad laenupiirangud. Siia lisandub Eestis läbiviidav pensionireform, mis peaks säästmisele mõjuma positiivselt. Tabelid

  9. Mereline Foorum kutsub kulla ja karraga / Urmas Oja

    Index Scriptorium Estoniae

    Oja, Urmas, 1981-2012

    2007-01-01

    Elu- ja ärihoonest Narva mnt. 5 / Hobujaama 10H Tallinnas. Arhitektid: Hanno Grossschmidt ja Tomomi Hayashi, HG Arhitektuur. Siselahendus: Hannes Praks ja Margus Tammik, OÜ Kohvi. Ehitaja: AS KMG Ehitus. Ehituse algus: detsember 2004, valmimisaeg: 01.07. 2006 - 01. 09. 2007. 5 värv. välis- ja 2 sisevaadet

  10. Tamash Tot i logika imperii / Tamas Toth ; interv. Nikolai Karajev

    Index Scriptorium Estoniae

    Toth, Tamas

    2008-01-01

    Tallinna Kinomajas märtsikuu alguses toimunud Ungari kino päevade raames külastas Tallinna Moskva Kinematograafiainstituudi taustaga režissöör Tamas T̤th, kelle manside ja sürjakomide juures vändatud vändatud filmi ѕHuntأ päevadel näidati

  11. Herkki-Erich Merila teel tagasi klassikalise foto juurde / Herkki-Erich Merila ; intervjueerinud Tanel Veenre

    Index Scriptorium Estoniae

    Merila, Herkki-Erich, 1964-

    2009-01-01

    Fotograaf Herkki-Erich Merila endast, oma loomingust, huvist inimese pildistamise vastu, koostööst Peeter Lauritsaga, 1980-ndate lõpu ja 1990-ndate alguse eesti fotograafiast, moe-, reklaami- ja digitaalfotograafiast, heast modellist, viimastest kunstielamustest jm. Herkki-Erich Merila näitus "Objects of Timeless II" klubis "Shah", avatud oktoobri lõpuni

  12. Characteristics of Androgenetic Alopecia in Asian

    OpenAIRE

    Lee, Won-Soo; Lee, Hae-Jin

    2012-01-01

    Androgenetic alopecia (AGA), or pattern hair loss, is a common disorder in Asian men and women, with a reported incidence of up to 73% among general population. There are several descriptions regarding the characteristics of AGA in patients of European descent. Asian patients with AGA have different types of hair loss and family histories from Europeans, which may affect treatment response. Therefore, in this review, prevalence, hair loss patterns, familial factors, androgen receptor gene pol...

  13. Engineering Task Plan to Expand the Environmental Operational Envelope of Core Sampling

    International Nuclear Information System (INIS)

    BOGER, R.M.

    1999-01-01

    This Engineering Task Plan authorizes the development of an Alternative Generation and Analysis (AGA). The AGA will determine how to expand the environmental operating envelope during core sampling operations

  14. Rosemary oil vs minoxidil 2% for the treatment of androgenetic alopecia: a randomized comparative trial.

    Science.gov (United States)

    Panahi, Yunes; Taghizadeh, Mohsen; Marzony, Eisa Tahmasbpour; Sahebkar, Amirhossein

    2015-01-01

    Rosmarinus officinalis L. is a medicinal plant with diverse activities including enhancement microcapillary perfusion. The present study aimed to investigate the clinical efficacy of rosemary oil in the treatment of androgenetic alopecia (AGA) and compare its effects with minoxidil 2%. Patients with AGA were randomly assigned to rosemary oil (n = 50) or minoxidil 2% (n = 50) for a period of 6 months. After a baseline visit, patients returned to the clinic for efficacy and safety evaluations every 3 months. A standardized professional microphotographic assessment of each volunteer was taken at the initial interview and after 3 and 6 months of the trial. No significant change was observed in the mean hair count at the 3-month endpoint, neither in the rosemary nor in the minoxidil group (P > .05). In contrast, both groups experienced a significant increase in hair count at the 6-month endpoint compared with the baseline and 3-month endpoint (P .05). The frequencies of dry hair, greasy hair, and dandruff were not found to be significantly different from baseline at either month 3 or month 6 trial in the groups (P > .05). The frequency of scalp itching at the 3- and 6-month trial points was significantly higher compared with baseline in both groups (P minoxidil group at both assessed endpoints (P < .05). The findings of the present trial provided evidence with respect to the efficacy of rosemary oil in the treatment of AGA.

  15. Wrox SharePoint 2010 SharePoint911 three-pack

    CERN Document Server

    Klindt, Todd; Mason, Jennifer; Rogers, Laura; Drisgill, Randy; Ross, John; Riemann, Larry; Perran, Amanda; Perran, Shane; Sanford, Jacob J; Stubbs, Paul; Caravajal, Steve

    2012-01-01

    The Wrox SharePoint 2010 SharePoint911 Three-Pack combines the contents of three full e-books written by the experts from SharePoint911.  That's over 1800 pages of hands-on advice from Todd Klindt, Shane Young, Laura Rogers, Randy Drisgill, Jennifer Mason, John Ross, and Larry Riemann, among others. In Beginning SharePoint 2010: Building Business Solutions with SharePoint (ISBN 978-0-470-61789-2) by Amanda Perran, Shane Perran, Jennifer Mason, and Laura Rogers, readers learn the core concepts, terminology, and features of SharePoint 2010. In Professiona

  16. Ühe ajastu lõpu algus / Kalev Kask

    Index Scriptorium Estoniae

    Kask, Kalev

    2004-01-01

    Ilmunud ka: Meie Maa, 9. nov. 2004, lk. 7. Yasser Arafati tervislik seisund on halvenemas, seni pole ta ametlikult kedagi oma järeltulijaks määranud. Palestiinlased peaksid suutma valida talle kombekohase järglase, vastasel juhul satuvad nad keerulisse võimuvõitlusse, millest saab kasu eelkõige Iisrael, leiab autor

  17. Etenduse algus. Jaime Hay̤n / Ele Praks

    Index Scriptorium Estoniae

    Praks, Ele

    2006-01-01

    Luciano Benettoni juures töötanud hispaania disainerist, kes 2002. aastal kuulutati kõige paljutõotavamaks nooreks disaineriks Hispaanias ja kelle vannitoakollektsioon sai 2005. aastal Elle Deco rahvusvahelise auhinna

  18. Hea haridus saab alguse headest õpetajatest / Tõnis Lukas

    Index Scriptorium Estoniae

    Lukas, Tõnis, 1962-

    2008-01-01

    Ilmunud ka: Põhjarannik 2. veebr. 2008, lk. 4, Severnoje Poberezhje 2. veebr. 2008, lk. 4., Pärnu Postimees 2. veebr. lk 19, Meie Maa 4. veebr. lk. 2, Lääne Elu 5. veebr. 2008, lk. 2, Hiiu Leht 5. veebr. 2008, lk. 2, Nädaline 5. veebr. 2008, lk. 4., Võrumaa Teataja 5. veebr. lk. 2, Harju Elu 8. veebr. lk. 2, Koit 12. veebr. lk. 6, Järva Teataja 19. veebr. lk. 2, Sakala 20. veebr. lk. 2. Valitsus kiitis heaks haridusminister Tõnis Lukase poolt esitatud määruse eelnõu, mille kohaselt tõusevad õpetajate palkade alammäärad käesoleva aasta esimesest jaanuarist 22% võrra

  19. Metro Plaza tõi Viru väljakule LED-valguse hõõguva tuledemängu / Maris Meiessaar

    Index Scriptorium Estoniae

    Meiessaar, Maris

    2009-01-01

    2009. a. alguses Tallinnas Viru väljak 2 valmivast ärihoonest ja selle klaasfassaadide valgustusest. Ärihoone seisab 19. saj. ehitatud maja muinsuskaitse all oleva fassaadi taga. Autorid: büroo KOKO Arhitektid arhitektid Raivo Kotov ja Lembit-Kaur Stöör ning sisearhitektid Liis Lindvere ja Raili Paling. Ehitaja: Facio Ehitus

  20. Maria Ward : kogu elu võitleb nunn kirikumeestega, püüdes oma visiooni tõelisuseks muuta / Dieter Wunderlich

    Index Scriptorium Estoniae

    Wunderlich, Dieter

    2008-01-01

    Pikka aega ei tunnustanud katoliku kirik Maria Wardi (1585-1645). Alles 20. sajandi alguses võis teda nimetada naisordu rajajaks (Institutum Beatae Mariae Virginis ئ inglise preilid) ja alles pärast II Vatikani Kirikukogu sai ordu teostada algset kontseptsiooni: luua iseseisev jesuiitide ordu naistele, sama eluviisi, põhikirja ja apostelliku eesmärgiga.

  1. Conrad Martin Metzi ofordid

    Index Scriptorium Estoniae

    1998-01-01

    20. XI 1998-31. I 1999 Tartu Kunstimuuseumis saksa graafiku Conrad Martin Metzi (1749-1827) ofortide näitus, mis jätkab Tartu Kunstimuuseumi pedagoogilise suunitlusega näituste sarja. Näitusel 19. sajandi alguse saksa reproduktsioonigraafika ئ ofortide seeria, mis on teostatud Michelangelo Sixtuse kabeli fresko "Viimane kohtupäev" järgi

  2. Tööajamustrid = Working time patterns / Yngve Rosenblad

    Index Scriptorium Estoniae

    Rosenblad, Yngve

    2012-01-01

    Toetudes 2009.-2010. aastal tehtud ajakasutuse uuringule analüüsitakse Eesti inimeste tasulisele tööle kulutatud aega - tööpäeva pikkust, töötundide jagunemist ööpäevas, töötamise algus- ja lõpuaegu, ebatüüpilistel aegadel töötamist

  3. Kümme aastat R-klubi / Maria-Maren Sepper

    Index Scriptorium Estoniae

    Sepper, Maria-Maren

    2014-01-01

    R-klubi (aeg-ajalt Tallinnas kogunev klubi, mis pakub tagasisidet eesti keele alases uurimistöös, ennekõike väitekirjauurimuste tegemisel ja artiklite publitseerimisel) 10. aastapäeva puhul peetud seminarist Tallinna Ülikoolis 21.3.2014. R-klubi sai alguse Helle Metslangi juhendatavate TLÜ kraadiõppurite tööde ühisaruteludest

  4. Kehatehnika näitlemises III / Kadi Tudre

    Index Scriptorium Estoniae

    Tudre, Kadi

    2008-01-01

    Odini Teatreti näitlejate erinevatest treeningutest (harjutused, töö partneriga, Eugenio Barba lavastajana). Artikkel on kokkuvõte magistritööst, mis valmis mais 2007. aastal Eesti Muusika- ja Teatriakadeemias. Tegemist on pikema uurimusega erinevatest kehakasutamise võimalustest näitlemise juures. Algus TMK 2007 nr. 8-9, 12 (järgneb)

  5. Hiigeltehingust pudenes ka väikeinvestoritele / Hannes Sarv

    Index Scriptorium Estoniae

    Sarv, Hannes

    2009-01-01

    2008. aastal alguse saanud turvafirma G4S Baltics aktsiate müük jõudis lõpule pärast seda, kui oma osaluse müüsid rahvusavahelisele turvakontsernile G4S International Holdings Ltd allesjäänud väikeaktsionärid hinnaga 3106 krooni ühe aktsia eest. Diagrammid

  6. Vaimse tervise simuleerijate triloogia / Pille-Riin Purje

    Index Scriptorium Estoniae

    Purje, Pille-Riin, 1963-

    2008-01-01

    2. mail Endla teatris esietendunud Martin Alguse näidendist "Janu", lavastaja, kunstnik ja muusikaline kujundaja Andres Noormets. 3. mail Rakvere Teatris esietendunud vene kirjaniku Venedikt Jerofejevi "Moskva-Petuški" ainetel tehtud lavastusest "Üks joodik sõitis rongiga", lavastaja Toomas Suuman, dramatiseerija Meelis Lainvoo. Jevgeni Griškovetsi "Linn" Theatrumis, lavastaja Lembit Peterson

  7. Osta General Motorsi aktsiaid / Tõnis Oja

    Index Scriptorium Estoniae

    Oja,Tõnis, 1957-

    2008-01-01

    General Motorsi aktsia hind langes juuli alguses enam kui 50 aasta madalaimale tasemele, 9,38 dollarini. USA autotööstuse suurimaks probleemiks on võimetus konkureerida Jaapani ja Lõuna-Korea autotootjatega, ka Ford Motors on teatanud ajaloo suurimast kvartalikahjumist. Graafik: Aktsia hind kukkus kümnendike tagusele tasemele. Tabel: Viimaseid aastaid iseloomustavad hiigelkahjumid. Lisa

  8. Beginning SharePoint 2010 Administration Windows SharePoint Foundation 2010 and Microsoft SharePoint Server 2010

    CERN Document Server

    Husman, Göran

    2010-01-01

    Complete coverage on the latest advances in SharePoint 2010 administration. SharePoint 2010 comprises an abundance of new features, and this book shows you how to take advantage of all SharePoint 2010's many improvements. Written by a four-time SharePoint MVP, Beginning SharePoint 2010 Administration begins with a comparison of SharePoint 2010 compared to the previous version and then examines the differences between WSS 4.0 and MSS 2010. Packed with step-by-step instructions, tips and tricks, and real-world examples, this book dives into the basics of how to install, manage, and administrate

  9. Conventional and novel stem cell based therapies for androgenic alopecia.

    Science.gov (United States)

    Talavera-Adame, Dodanim; Newman, Daniella; Newman, Nathan

    2017-01-01

    The prevalence of androgenic alopecia (AGA) increases with age and it affects both men and women. Patients diagnosed with AGA may experience decreased quality of life, depression, and feel self-conscious. There are a variety of therapeutic options ranging from prescription drugs to non-prescription medications. Currently, AGA involves an annual global market revenue of US$4 billion and a growth rate of 1.8%, indicating a growing consumer market. Although natural and synthetic ingredients can promote hair growth and, therefore, be useful to treat AGA, some of them have important adverse effects and unknown mechanisms of action that limit their use and benefits. Biologic factors that include signaling from stem cells, dermal papilla cells, and platelet-rich plasma are some of the current therapeutic agents being studied for hair restoration with milder side effects. However, most of the mechanisms exerted by these factors in hair restoration are still being researched. In this review, we analyze the therapeutic agents that have been used for AGA and emphasize the potential of new therapies based on advances in stem cell technologies and regenerative medicine.

  10. May 2002 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs) from Dana Point to Point La...

  11. September 2002 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs) from Dana Point to Point La...

  12. Nii hull, nii hirmus, nii jabur - Eesti elu uutes näitemängudes / Raimu Hanson

    Index Scriptorium Estoniae

    Hanson, Raimu, 1957-

    2009-01-01

    Eesti Teatri Agentuuri korraldatud näidendivõistlusest. Peapreemia pälvis vabakutselise näitleja, tõlkija ja dramaturgi Martin Alguse näidend "Postmodernsed leibkonnad". Teise koha Siim Nurliku kirjatükk "Kas ma olen nüüd elus" ja kolmanda koha Loone Otsa töö "Libuhunt". Sisaldav lühiintervjuud Martin Algusega

  13. Kosovo - doominokivi, mis kohutab Venemaad ja teisi veriseid võime / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2008-01-01

    Autor analüüsib probleeme, mis on seotud Kosovo iseseisvumisega. Uue riigi teke 21. sajandi alguse Euroopas ei tohiks olla midagi erakordset, sest viimase poole sajandi jooksul on nähtud kümnete riikide sündi, arvab ta. Lisad: Doominokivid; Iseseisvunud riikide arv 1958-2006; Järjekorras ootavad; Millal algas uute riikide iseseisvumise doomino?

  14. Kormašovid Helsingis / Martti Soosaar

    Index Scriptorium Estoniae

    Soosaar, Martti, 1933-2017

    1998-01-01

    Helsingi Kanneltalos kunstinäitus "Dünastia" tsüklist "Paljukultuuriline Eesti". Eksponeeritud Kormašovide perekonna - maalijad Nikolai (1929), Orest (1964), keraamikud Luule (1935), Jaana (1966), graafik Andrei (1957) - loomingut. Kuraator Martti Soosaar. Eesti Instituudi väljaandel ilmub temaatiline kalender, mis tutvustab soomlastele sajandi alguse Eesti arhitektuuri. Aasta viimane näitus on Helsingi Malmitalos eesti klaasikunstnikelt

  15. Kremlin's OSCE Ministerial Council-related demarches / Rokas M. Tracevskis

    Index Scriptorium Estoniae

    Tracevskis, Rokas M.

    2011-01-01

    Detsembril alguses Vilniuses toimunud OSCE kohtumisel kritiseeris USA riigisekretär Hillary Clinton Venemaa parlamendivalimiste korraldamist. Venemaa peaminister Vladimir Putin ütles, et USA riigisekretäri kõne saatis Vene opositsioonile tegutsemissignaali. Venemaa välisministri Sergei Lavrovi ja Leedu välisministri Audronius Azubalise ebasõbralikust kohtumisest. Venemaa blokeeris OSCE-s internetivabaduse kaitsele suunatud deklaratsiooni

  16. Hillary Clinton / Judith Warner

    Index Scriptorium Estoniae

    Warner, Judith

    1994-01-01

    Kõige mõjuvõimsam naine maailmas - algus EA 22. veebruar 1994. May/4,11,18,25 lk. 22;22;22;21; Jun/1,8,15,22,29 lk. 21; Jul/6,13,20,27 21; Aug/3,10,17,24,31 lk. 21; Sep/7,14,21,28 lk. 21; Oct/5,12,19 lk. 21

  17. Sarri võttis Talleksiga taanlastelt Saksa Auto / Villy Paimets

    Index Scriptorium Estoniae

    Paimets, Villy, 1972-

    2005-01-01

    Andres Sarri poolt kontrollitav AS Talleks ostis Taani partnerilt Semler Holding välja 50-protsendilise osaluse AS-is Saksa Auto. Lisa: Viimastel aastatel eestlaste poolt välja ostetud ettevõtted. Diagramm: Saksa Auto tulemused paranesid mullu märgatavalt. Vt. samas: Sarri: me ei tee halbu tehinguid; Peeter Raidla. Tuleristsed 90ndate alguse võimuvõitlusest

  18. Kehatehnika näitlemises IV / Kadi Tudre

    Index Scriptorium Estoniae

    Tudre, Kadi

    2008-01-01

    Jaques Copeau näitlejaõppest. Erinevatest harjutustest, mida kasutas Decroux. Kehamiimi tehnika tagamaadest. Artikkel on kokkuvõte magistritööst, mis valmis mais 2007. aastal Eesti Muusika- ja Teatriakadeemias. Tegemist on pikema uurimusega erinevatest kehakasutamise võimalustest näitlemise juures. Algus TMK 2007 nr. 8-9, 12 ja 2008 nr. 2 (järgneb)

  19. "Kuldne kolmnurk" ja "punapõsine kornet" / Kaire Nurk

    Index Scriptorium Estoniae

    Nurk, Kaire, 1960-

    2000-01-01

    Tartu kunst XX sajandil: sajandi alguse pildina Kristjan Raua tööst "Puhkus rännakul", kokkuvõttena sajandile Ado Vabbe preemia saanud kunstnikest ئ Peeter Allik, Lola Liivat, Helle Vahersalu ئ ja nende loomingust. Sõjajärgse Tartu kunsti jõudmisest Tallinna ning selle kajastamisest S. Helme, J. Kangilaski "Lühikeses eesti kunsti ajaloos".

  20. Näidendivõistlusel selgus Eesti viis parimat mereäärset lugu / Teele Tammeorg

    Index Scriptorium Estoniae

    Tammeorg, Teele

    2010-01-01

    Eesti Teatri Agentuur ja SA Tallinn 2011 kuulutasid näidendikonkursi "Mereäärsed lood" võitjateks Martin Alguse "Kontakti", Christian Auni ja Mariann Tihase "Kastis!", Urmas Lennuki "Minu tänav", Katrin Maimiku "Metspardi" ja Mario Pulveri "Fluidumi". "Mereäärsed lood" on rahvusvahelise näidendivõistluse "New Baltic Drama 2011" esimene voor

  1. Luksus ja lust : Tallinna rae hõbe- ja tinanõud = Luxury and Leisure : Silver and Pewter Tableware of the Tallinn Magistracy / Aita Raik

    Index Scriptorium Estoniae

    Raik, Aita

    2004-01-01

    Tallinna kullassepakunsti meistriteostest. Kahest väiksemast (Andreas Losson, 1620-ndate algus) ja kahest suuremast (Jakob Lange, 1639) maksukannust, kahest hõbekannust (Stanislaus Schulze, 17. saj. keskpaik), kahest rae kaitseväeülema ametisauast (suurem: Friedrich Schlegel, 1604-1605), väiksem 1610). Säilinud tinanõudest (kannud, peekrid, vaagnad, taldrikud, küünlajalad)

  2. Kaitsealadest ja ehitatud keskkonna säilitamisest Euroopas / Sirli Naska

    Index Scriptorium Estoniae

    Naska, Sirli

    2013-01-01

    1960. aastate alguses algatas Euroopa Nõukogu Konsultatiivassamblee Kultuurikomitee ajaloolise väärtusega hoonete ja piirkondade kaitse ja arendamise kampaania. Enamikus Euroopa maades jõuti kaitsealade kontseptsioonini 1960.-1970. aastatel. Arhitektuuriliste väärtuste uuringu süsteem (Survey of Architectural Values in the Environment ehk SAVE) loodi 1987. aastal. Kaitsealade korraldusest erinevates Euroopa riikides ja Eestis

  3. Birth weight and long-term metabolic outcomes: does the definition of smallness matter?

    Science.gov (United States)

    Verkauskiene, R; Figueras, F; Deghmoun, S; Chevenne, D; Gardosi, J; Levy-Marchal, M

    2008-01-01

    To establish the role of individual definition of smallness at birth in the association between birth weight and long-term metabolic outcomes. Lipid profile and oral glucose tolerance test were performed in young adults (22 years) born either small (SGA) or appropriate for gestational age (AGA). AGA/SGA were defined by both population-based and customized methods adjusting for individual maternal/pregnancy characteristics. 825 individuals were classified as AGA and 575 as SGA by both methods, 131 were SGA by the population-based method only (SGA(pop)) and 22 were SGA by the customized method only (SGA(cust)). SGA(cust) subjects had higher total cholesterol and triglyceride levels and lower high-density lipoprotein cholesterol concentrations than SGA(pop) and AGA subjects, however, insignificantly when adjusted for age, gender and body mass index. The homeostasis model assessment for insulin resistance (HOMA-IR) index was higher in the SGA(cust) (p = 0.05) and SGA(pop) (p = 0.02) versus the AGA group. Controlling for the HOMA-IR index, the insulinogenic index was significantly lower in the SGA(cust) versus SGA(pop) (p = 0.001) and AGA (p = 0.003) groups. In SGA(cust) individuals, the HOMA-IR index was clearly shifted to higher, while the insulinogenic index to lower tertiles of AGA distribution; SGA(pop) subjects had the HOMA-IR and insulinogenic index predominantly in the highest tertiles. Individualized birth weight standards allow to better identify subjects who failed to reach their genetic potential of intrauterine growth and are at higher risk of metabolic disturbances and impaired insulin secretion later in life. Copyright 2008 S. Karger AG, Basel.

  4. Association between anti-endomysial antibody and total intestinal villous atrophy in children with coeliac disease.

    Directory of Open Access Journals (Sweden)

    Ozgenc F

    2003-01-01

    Full Text Available BACKGROUND: There is growing evidence to suggest that detection of anti-gliadin antibody (AGA and anti-endomysial antibody (EmA can serve as sensitive markers of the degree of histological abnormalities in patients with coeliac disease. AIM: To evaluate the association between the presence of AGA and EmA and villous atrophy in intestinal biopsies of children with suspected coeliac disease. SETTINGS AND DESIGN: Intestinal samples of 46 children with failure to thrive, chronic diarrhoea, malabsorption and short stature with either AGA and/or EmA positivity were evaluated, retrospectively. The diagnosis of coeliac disease was based on ESPGHAN criteria. METHODS AND MATERIAL: Patients with total villous atrophy who fulfilled the ESPGHAN criteria for the diagnosis of coeliac disease were diagnosed to have coeliac disease. Nine patients without villous atrophy were taken as negative controls for this study. AGA-IgA was measured both by immunoflourescence (IF and ELISA and EmA-IgA by IF while patients were on normal diet. Relationship between autoantibody positivity and intestinal total villous atrophy was evaluated. RESULTS: Overall positivity for AGA IgA was 85% (39/46 by IF+ELISA and EmA positivity was 85% (39/46 by IF within the study group. Histological examination revealed total villous atrophy with lymphocyte infiltration and crypt hyperplasia in 37 (80% patients. AGA IgA was positive in 14 (38% and 31 (84% of these children by ELISA and IF, respectively. EmA positivity was detected in 35/37 (95% cases with atrophy and 4/9 (44% without atrophy (p=0.002. Thirty out of 37 (81% patients with villous atrophy had both AGA IgA (IF and EmA positivity (p=0.186. All of the sixteen patients that had both positive AGA IgA (ELISA+IF and EmA had total villous atrophy (p=0.037. CONCLUSION: A significant association between total villous atrophy and EmA positivity has been documented in this study.

  5. Address Points - COUNTY_ADDRESS_POINTS_IDHS_IN: Address Points Maintained by County Agencies in Indiana (Indiana Department of Homeland Security, Point feature class)

    Data.gov (United States)

    NSGIC State | GIS Inventory — COUNTY_ADDRESS_POINTS_IDHS_IN is an ESRI Geodatabase point feature class that contains address points maintained by county agencies in Indiana, provided by personnel...

  6. Hiilgav, aga... / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Earth 2" (1994), "EZ Streets" (1996), "Profit" (1996), "Strange World" (1999), "The Inside" (2005), "Drive" (2007), "Aliens in America" (2007)

  7. Edasi loodusesse! Aga kuhu? / Riina Oruaas

    Index Scriptorium Estoniae

    Oruaas, Riina

    2007-01-01

    Tantsulavastustest: Oksana Titova, Päär Pärenson ja Juhan Ulfsak "Roots", Kaja Kanni sooloetendus "There are Laika dogs living in Estonia", Tiina Mölder, Kaja Kann ja Bush Hartshor "Naine ja Hunt"

  8. Beginning SharePoint 2010 Building Business Solutions with SharePoint

    CERN Document Server

    Perran, Amanda; Mason, Jennifer; Rogers, Laura

    2010-01-01

    Two SharePoint MVPs provide the ultimate introduction to SharePoint 2010Beginning SharePoint 2010: Building Team Solutions with SharePoint provides information workers and site managers with extensive knowledge and expert advice, empowering them to become SharePoint champions within their organizations.Provides expansive coverage of SharePoint topics, as well as specialty areas such as forms, excel services, records management, and web content managementDetails realistic usage scenarios, and includes practice examples that highlight best practices for configuration and customizationIncludes de

  9. Protsessijuhtimine suurendab kliendikesksust / Verner Mättas

    Index Scriptorium Estoniae

    Mättas, Verner

    2003-01-01

    Protsessijuhtimise ja funktsioonipõhise juhtimise võrdlus. Autor tutvustab protsessimudelit AGA tööstuslike gaaside ärivaldkonnas. Skeem: Erinevate huvigruppide ootuste ja rahulolu seosed (Eesti AGA näitel); Vt. samas: Protsessijuhtimine keskendub eri huvigruppide ootustele

  10. Tipping Point

    Medline Plus

    Full Text Available ... en español Blog About OnSafety CPSC Stands for Safety The Tipping Point Home > 60 Seconds of Safety (Videos) > The Tipping Point The Tipping Point by ... danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe ...

  11. [Hormones and hair growth].

    Science.gov (United States)

    Trüeb, R M

    2010-06-01

    With respect to the relationship between hormones and hair growth, the role of androgens for androgenetic alopecia (AGA) and hirsutism is best acknowledged. Accordingly, therapeutic strategies that intervene in androgen metabolism have been successfully developed for treatment of these conditions. Clinical observations of hair conditions involving hormones beyond the androgen horizon have determined their role in regulation of hair growth: estrogens, prolactin, thyroid hormone, cortisone, growth hormone (GH), and melatonin. Primary GH resistance is characterized by thin hair, while acromegaly may cause hypertrichosis. Hyperprolactinemia may cause hair loss and hirsutism. Partial synchronization of the hair cycle in anagen during late pregnancy points to an estrogen effect, while aromatase inhibitors cause hair loss. Hair loss in a causal relationship to thyroid disorders is well documented. In contrast to AGA, senescent alopecia affects the hair in a diffuse manner. The question arises, whether the hypothesis that a causal relationship exists between the age-related reduction of circulating hormones and organ function also applies to hair and the aging of hair.

  12. Androgenetic alopecia and risk of coronary artery disease

    Directory of Open Access Journals (Sweden)

    Lata Sharma

    2013-01-01

    Full Text Available Background: Androgenetic alopecia (AGA or male pattern baldness (MPB has been found to be associated with the risk of coronary artery disease (CAD. The well-known risk factors are family history of CAD, hypertension, increased body mass index (BMI, central obesity, hyperglycemia, and dyslipidemia. The newer risk factors are serum lipoprotein-a (SL-a, serum homocysteine (SH, and serum adiponectin (SA. Aim : Identifying individuals at risk of CAD at an early age might help in preventing CAD and save life. Hence, a comparative study of CAD risk factors was planned in 100 males of AGA between the age of 25 and 40 years with equal number of age- and sex-matched controls. Materials and Methods : Patients of AGA grade II or more of Hamilton and Norwood (HN Scale and controls were examined clinically and advised blood test. The reports were available for fasting blood sugar (FBS, serum total serum cholesterol (SC in 64 cases, 64 controls; lipoproteins (high, low, very low density, HDL, LDL, VLDL, serum triglycerides (ST in 63 cases, 63 controls; SL-a in 63 cases, 74 controls; SH in 56 cases, 74 controls; and SA in 62 cases, 74 controls. Results : In these cases family history (FH of AGA and CAD was significantly high. The blood pressure (BP was also found to be significantly high in the cases. The difference of mean serum HDL, LDL, VLDL, ST, SH, and SL-a in cases and controls were statistically significant and with increasing grade of AGA, the risk factors also increased. Conclusion : Patients with AGA appear to be at an increased risk of developing CAD, therefore, clinical evaluation of cases with AGA of grade II and above may be of help in preventing CAD in future.

  13. Sequence Classification: 378135 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB TMH TMB Non-TMB Non-TMB Non-TMB >gi|13475854|ref|NP_107424.1| agaE protein, conversion of agropini...c acid to mannopinic acid || http://www.ncbi.nlm.nih.gov/protein/13475854 ...

  14. Hunting the genes in male-pattern alopecia: how important are they, how close are we and what will they tell us?

    Science.gov (United States)

    Heilmann-Heimbach, Stefanie; Hochfeld, Lara M; Paus, Ralf; Nöthen, Markus M

    2016-04-01

    Androgenetic alopecia (AGA) is a highly heritable condition, and the most common form of hair loss in men. The phenotype is characterized by an androgen-dependent, progressive loss of hair from the scalp, which may commence during puberty. Up to 80% of European men experience some degree of androgen-dependent hair loss during their lifetime. Current treatment options for AGA have limited efficacy, and improved understanding of the underlying biological causes is required to facilitate novel therapeutic approaches. To date, molecular genetic studies have implicated 12 genomic regions in AGA and identified a number of candidate genes. The latter include those encoding the androgen receptor (AR), the histone deacetylases (HDAC) 4 and 9, and the WNT molecule WNT10A. However, the majority of contributing genetic risk factors still await identification. This review describes the current status of AGA genetic research. We discuss the strength of the genetic approach and anticipated developments in the field, and how these will facilitate the systematic unravelling of AGA pathobiology, a process which may lead to the identification of new therapeutic targets. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. AFJU OFC 18(3).indd

    African Journals Online (AJOL)

    imac-3

    a Department of Radiology, Aga Khan Medical University, Karachi, Pakistan b Rhode Island Hospital, Brown University, Providence, RI 02912, USA c Department of Surgery, Aga .... In defense of IVU, Saeed et al. [12] noted that the addition of ...

  16. Sequence Classification: 378211 [

    Lifescience Database Archive (English)

    Full Text Available nic acid to mannopinic acid || http://www.ncbi.nlm.nih.gov/protein/13475930 ... ...Non-TMB TMH Non-TMB Non-TMB Non-TMB Non-TMB >gi|13475930|ref|NP_107500.1| AgaE protein, conversion of agropi

  17. Annetustest Tartu linnale ja ülikoolile 19. sajandil / Sirje Tamul

    Index Scriptorium Estoniae

    Tamul, Sirje, 1951-

    2008-01-01

    1860. aastate alguses toetas Tartu teenijaskonda magistraadi juures registreeritud Pereiralegat. 1868. aasta annakud Wilhelmine Pereiralt olid määratud Tartu linnale ja ülikoolile. Wilhelmine von Pereira annetatud stipendiumikapital ja linna heakorrakapital toimisid kuni Esimese maailmasõja alguseni. Peter Šamajevi kinkeakt anti linnale üle 1865. aastal. Peter Šamajevi isikust ja tema annetusest ning sellest makstud stipendiumidest

  18. Vaikuse ääremail / Teet Veispak

    Index Scriptorium Estoniae

    Veispak, Teet, 1955-

    2006-01-01

    2006. a. Tallinnas Kaasaegse Kunsti Eesti Keskuselt ilmunud Andreas Trosseki toimetatud artiklikogumikust "Uue nimetaja otsinguid aastal 2000+n : lisandusi eesti kunstiloole", mis sisaldab 2005. a. novembris peetud ettekannete päeval "Roheline, toores ja lõikamata. Noor eesti kunst uue sajandi alguses" esitatud ettekandeid. Anneli Porri, Elin Kardi ja Kaido Ole artiklitest, kogumikus on veel Rael Arteli ja Kristjan Mändmaa artiklid

  19. Stelarc / Stelarc ; interv. Tilman Baumgärtel

    Index Scriptorium Estoniae

    Stelarc

    2006-01-01

    1997. a. Linzis tehtud intervjuu austraalia kunstniku Stelarc'iga, kes tegi oma kehast kunstitegemise koha. 1980-ndate alguses töötas ta kaugsidetehnoloogiaga, lasi endale panna mehaanilise kolmanda käe, mida liigutasid telefonisignaalid. 1990-ndatel ühendas ta end mitmel performance'il Internetti või laskis oma keha "telemaatiliselt" puldist juhtida. Performance'itest "Parasiidid", "Suspension events", "Fractal Flesh" ja muust

  20. Õun. Minu kõige mõttetum ost : [jutt] / Anna Hints

    Index Scriptorium Estoniae

    Hints, Anna

    2006-01-01

    Sisu: Juuli 2004 ; August 2004 ; September 2004 ; September 2004, kuskil keskel ; September 2004, lõpus ; Oktoober 2004, 1. nädal ; Oktoober 2004, 2. nädal ; Oktoober 2004, 3. nädala alguses ; Oktoober 2004, 3. nädala lõpupoole ; Oktoober 2004, 4. nädal ; November 2004, 1. nädal ; November 2004, lõpp ; Jaanuar 2005, täna

  1. Acrimony needs / Elin Kard

    Index Scriptorium Estoniae

    Kard, Elin

    2006-01-01

    "Acrimony needs" on Elin Kardi ühe maali pealkiri Tallinna Kunstihoones 8.04.-28.05.2006 eksponeeritud Elin Kardi, Marko Mäetamme, Marco Laimre ja Andres Tali ühisnäitusel "Vägivald ja propaganda". Töö viitab Taani riigilipu kaudu 2006. a. alguses lahvatanud nn. karikatuuriskandaalile, kui ajaleht Jyllands-Posten avaldas pilapildid prohvet Muhamedist, mis põhjustasid pahameeletormi moslemimaailmas

  2. Eile sai Eesti Kunstimuuseumi asutamisest 86 aastat ning Tartu Kunstimuuseumi asutamisest 65 aastat

    Index Scriptorium Estoniae

    2005-01-01

    Kumu ettekannetepäev "Roheline, toores ja lõikamata. Noor eesti kunst uue sajandi alguses" sarjast "Lisandusi eesti kunstiloole". Esinesid Karin Laansoo, Irit Rogoff, Kaido Ole, Kristjan Mändmaa, Rael Artel. Esitleti raamatut "22 + Noored eesti kunstnikud. Young Estonian Artists". 18. XI kirjutatakse alla Jaapani valitsuse kultuuritoetusleping, mis on suunatud Kumu varustamiseks kaasaegse audiogiidi süsteemiga, esitlustehnika ja maalikonserveerimislabori tehnikaga

  3. Juugendstiil / Mai Levin

    Index Scriptorium Estoniae

    Levin, Mai, 1942-

    2010-01-01

    Suurte metropolide mõju. Heimatkunst. Kristjan Raua naivism. Ants Laikmaa pastellid. Paul Raud ja juugend. Eestlased Peterburis. Nikolai Triigi ekspressionismigeenidega stiilsus. Konrad Mägi lõõmavad värvid. Aleksander Tassa minimalism. Roman Nyman ja teatridekoratsioon. August Jansen ja Peet Aren ning vene maalikool. Herbert Lukk. Laikmaa õpilased. Varaküps Erik Obermann. Balder Tomasberg. Eduard Wiiralt. Jaan Koorti juugendlik algus. Tarbekunst

  4. Point-to-point people with purpose—Exploring the possibility of a commercial traveler market for point-to-point suborbital space transportation

    Science.gov (United States)

    Webber, Derek

    2013-12-01

    An argument was made at the First Arcachon Conference on Private Human Access to Space in 2008 [1] that some systematic market research should be conducted into potential market segments for point-to-point suborbital space transportation (PtP), in order to understand whether a commercial market exists which might augment possible government use for such a vehicle. The cargo market potential was subsequently addressed via desk research, and the results, which resulted in a pessimistic business case outlook, were presented in [2]. The same desk research approach is now used in this paper to address the potential business and wealthy individual passenger traveler market segment ("point-to-point people with purpose"). The results, with the assumed ticket pricing, are not encouraging.

  5. Hardware-accelerated Point Generation and Rendering of Point-based Impostors

    DEFF Research Database (Denmark)

    Bærentzen, Jakob Andreas

    2005-01-01

    This paper presents a novel scheme for generating points from triangle models. The method is fast and lends itself well to implementation using graphics hardware. The triangle to point conversion is done by rendering the models, and the rendering may be performed procedurally or by a black box API....... I describe the technique in detail and discuss how the generated point sets can easily be used as impostors for the original triangle models used to create the points. Since the points reside solely in GPU memory, these impostors are fairly efficient. Source code is available online....

  6. Comparison of serum 25-hydroxy vitamin D levels between mothers with small for gestational age and appropriate for gestational age newborns in Kerman.

    Science.gov (United States)

    Mirzaei, Fatemeh; Amiri Moghadam, Tayebeh; Arasteh, Peyman

    2015-04-01

    Vitamin D deficiency during pregnancy is associated with some adverse pregnancy outcomes but its relationship with fetal growth is unknown. We compared the 25-hydroxy vitamin D levels between mothers and their small for gestational age (SGA) newborns with mothers and their appropriate for gestational age (AGA) newborns. The study population included pregnant women that referred to Afzalipour Hospital in Kerman from 2012 to 2013. The case and control group consisted of 40 pregnant mothers with SGA and AGA newborns, respectively. The maternal and infants 25-hydroxy vitamin D levels were measured in the two groups. 25-hydroxy vitamin D deficiency (mothers and infants in both the SGA group and the AGA group was significant. Our study reveals a high prevalence of vitamin D deficiency in women with SGA infants in comparison to women with AGA children. In addition, maternal vitamin D deficiency is associated with its deficiency in newborns.

  7. [Relationship of plasma ghrelin, IGF-1 and insulin with the growth and development of 2 -7 year-old children with small for gestational age at birth].

    Science.gov (United States)

    Cheng, Yaying; Song, Guangyao; Zhou, Lixia; Cai, Baoping; Zhao, Xiumian; Yin, Jianying

    2012-01-01

    To explore the relationship of Ghrelin, insulin-like growth factor-1 (IGF-1) and insulin with the growth and development of 2 -7 year-old children with small for gestational age (SGA) at birth. The levels of ghrelin, IGF-1, IGFBP-3, insulin and glucose were measured in the children with preterm SGA and term SGA and compared with the children with preterm appropriate for gestational age (AGA) and term AGA. The correlation of ghrelin with IGF-1, IGFBP-3 and insulin was analyzed. Plasma ghrelin in preterm SGA was higher than that in term SGA (P 0.05). Plasma ghrelin in preterm AGA and term SGA was higher than that in term AGA (P development of preterm and SGA children, regardless of the magnitude of their catch up growth. As a re-regulatory factor to insulin, ghrelin regulates the energy metabolism in a form of negative feedback.

  8. Androgenic alopecia is associated with less dietary soy, lower [corrected] blood vanadium and rs1160312 1 polymorphism in Taiwanese communities.

    Directory of Open Access Journals (Sweden)

    Ching-Huang Lai

    Full Text Available Although the genetic basis of androgenic alopecia has been clearly established, little is known about its non-genetic causes, such as environmental and lifestyle factors.This study investigated blood and urine heavy metals concentrations, environmental exposure factors, personal behaviors, dietary intakes and the genotypes of related susceptibility genes in patients with androgenic alopecia (AGA.Age, AGA level, residence area, work hours, sleep patterns, cigarette usage, alcohol consumption, betel nut usage, hair treatments, eating habits, body heavy metals concentrations and rs1998076, rs913063, rs1160312 and rs201571 SNP genotype data were collected from 354 men. Logistic regression analysis was performed to examine whether any of the factors displayed odds ratios (ORs indicating association with moderate to severe AGA (≥ IV. Subsequently, Hosmer-Lemeshow, Nagelkerke R(2 and accuracy tests were conducted to help establish an optimal model.Moderate to severe AGA was associated with the AA genotype of rs1160312 (22.50, 95% CI 3.99-126.83, blood vanadium concentration (0.02, 95% CI 0.01-0.04, and regular consumption of soy bean drinks (0.23, 95% CI 0.06-0.85, after adjustment for age. The results were corroborated by the Hosmer-Lemeshow test (P = 0.73, Nagelkerke R(2 (0.59, accuracy test (0.816 and area under the curve (AUC; 0.90, 0.847-0.951 analysis.Blood vanadium and frequent soy bean drink consumption may provide protect effects against AGA. Accordingly, blood vanadium concentrations, the AA genotype of rs1160312 and frequent consumption of soy bean drinks are associated with AGA.

  9. Androgenic alopecia is associated with less dietary soy, lower [corrected] blood vanadium and rs1160312 1 polymorphism in Taiwanese communities.

    Science.gov (United States)

    Lai, Ching-Huang; Chu, Nain-Feng; Chang, Chi-Wen; Wang, Shu-Li; Yang, Hsin-Chou; Chu, Chi-Ming; Chang, Chu-Ting; Lin, Ming-Huang; Chien, Wu-Chien; Su, Sui-Lung; Chou, Yu-Ching; Chen, Kang-Hua; Wang, Wei-Ming; Liou, Saou-Hsing

    2013-01-01

    Although the genetic basis of androgenic alopecia has been clearly established, little is known about its non-genetic causes, such as environmental and lifestyle factors. This study investigated blood and urine heavy metals concentrations, environmental exposure factors, personal behaviors, dietary intakes and the genotypes of related susceptibility genes in patients with androgenic alopecia (AGA). Age, AGA level, residence area, work hours, sleep patterns, cigarette usage, alcohol consumption, betel nut usage, hair treatments, eating habits, body heavy metals concentrations and rs1998076, rs913063, rs1160312 and rs201571 SNP genotype data were collected from 354 men. Logistic regression analysis was performed to examine whether any of the factors displayed odds ratios (ORs) indicating association with moderate to severe AGA (≥ IV). Subsequently, Hosmer-Lemeshow, Nagelkerke R(2) and accuracy tests were conducted to help establish an optimal model. Moderate to severe AGA was associated with the AA genotype of rs1160312 (22.50, 95% CI 3.99-126.83), blood vanadium concentration (0.02, 95% CI 0.01-0.04), and regular consumption of soy bean drinks (0.23, 95% CI 0.06-0.85), after adjustment for age. The results were corroborated by the Hosmer-Lemeshow test (P = 0.73), Nagelkerke R(2) (0.59), accuracy test (0.816) and area under the curve (AUC; 0.90, 0.847-0.951) analysis. Blood vanadium and frequent soy bean drink consumption may provide protect effects against AGA. Accordingly, blood vanadium concentrations, the AA genotype of rs1160312 and frequent consumption of soy bean drinks are associated with AGA.

  10. Topical adenosine increases thick hair ratio in Japanese men with androgenetic alopecia.

    Science.gov (United States)

    Watanabe, Y; Nagashima, T; Hanzawa, N; Ishino, A; Nakazawa, Y; Ogo, M; Iwabuchi, T; Tajima, M

    2015-12-01

    Hair thickness is more important than hair density in the appearance of baldness in male with androgenetic alopecia (AGA). Adenosine improves hair loss by stimulating hair growth and by thickening hair shafts in women. The objective of this study was to evaluate the hair growth efficacy and safety of topical adenosine in men with AGA. A lotion containing either adenosine or niacinamide was administered to the scalps of 102 Japanese men twice daily for 6 months in a double-blind, randomized study. Efficacy was evaluated by dermatologists who assessed the quality of the hair and by calculating the percentages of vellus-like and thick hairs among the vertex hairs, as well as hair density. Adenosine was significantly (P < 0.05) superior to niacinamide in terms of global improvement of AGA, increase in the percentage of thick hairs (at least 60 μm) and self-assessment of hair thickness by the study participants. No causal adverse event due to the adenosine lotion was observed. These data indicate that adenosine increases thick hair ratio in Japanese men with AGA, and this compound is useful for the improvement of AGA. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  11. Differential effect of assisted reproductive technology and small-for-gestational age on fetal cardiac remodeling.

    Science.gov (United States)

    Valenzuela-Alcaraz, B; Crispi, F; Cruz-Lemini, M; Bijnens, B; García-Otero, L; Sitges, M; Balasch, J; Gratacós, E

    2017-07-01

    Fetuses conceived by assisted reproductive technology (ART) and those that are small-for-gestational age (SGA) show cardiovascular remodeling in utero; however, these two conditions are often associated. We aimed to evaluate the differential effect of ART and SGA on fetal cardiac remodeling. This was a prospective cohort study of term singleton pregnancies seen at our department between April 2011 and September 2013. The cohort was divided according to fetal growth and mode of conception into the following four groups: 102 appropriate-for-gestational-age (AGA) fetuses conceived spontaneously (controls), 72 AGA fetuses conceived by ART (ART-AGA), 31 SGA fetuses conceived by ART (ART-SGA) and 28 SGA fetuses conceived naturally (Spont-SGA). SGA was defined as birth weight Fetal echocardiography was performed at 28-32 weeks to assess cardiac dimensions, geometry and function. ART fetuses had dilated atria (mean left atrium-to-heart area ratio: controls, 15 ± 2.7%; ART-AGA, 18 ± 4.1%; Spont-SGA, 14 ± 3.7%) and more globular ventricles (left ventricular sphericity index: controls, 1.77 ± 0.2; ART-AGA, 1.68 ± 0.2; Spont-SGA, 1.72 ± 0.2), with normally sized hearts. In contrast, SGA fetuses had enlarged hearts (cardiothoracic ratio: controls, 24 ± 3%; ART-AGA, 24 ± 4%; Spont-SGA, 29 ± 6%), preserved atrial size, more globular and concentric hypertrophic ventricles (left ventricle relative wall thickness: controls, 0.48 ± 0.17; ART-AGA, 0.54 ± 0.13; Spont-SGA, 0.63 ± 0.23). Both ART and SGA fetuses had decreased longitudinal motion (tricuspid annular ring displacement: controls, 6.5 ± 0.8 mm; ART-AGA, 5.5 ± 0.7 mm; Spont-SGA, 5.9 ± 0.6 mm) and impaired relaxation (left isovolumetric relaxation time: controls, 47.0 ± 7.3 ms; ART-AGA, 50.0 ± 7.9 ms; Spont-SGA, 49.5 ± 9.3 ms). ART-SGA fetuses presented a combination of features from both ART and SGA groups. SGA and conception with ART

  12. "Me kohal on sinine taevas ..." = "Nebo sineje nad nami ..." : [luuletused] / Anne Lasikov ; tlk. Gennadi Krasnikov

    Index Scriptorium Estoniae

    Lasikov, Anne

    2003-01-01

    Sisu: "Me kohal on sinine taevas ..." = "Nebo sinee nad nami ..." ; "Siin valsirütme keerutasid jalad..." = "Kogda-to ritmõ valsa zdes kruzhili nogi ..." ; Sügisetuju = Osenneje nastroenije ; Ma tahan tagasi ; Kevad ; Suve algus ; Ood Narva-Jõesuule ; "V golovu lezjot vsjakaja drjan..." ; "Kogda vsbessilas avtorutshka..." ; "Ja ukrala tvoi vzgljad..." ; Zatshem mne radost tehh notshei? ; Vzgljad ; Tshernushka o sudbe ; "Zatshem võ, tshaiki, tak kritshite... " ; Nasledstvo ; Ja skisla.

  13. Kui ei maksa nüüd, maksad hiljem rohkem / Villu Zirnask

    Index Scriptorium Estoniae

    Zirnask, Villu, 1966-

    2008-01-01

    Autor toob kohe maksmise näitena Rootsi pankade päästmise 1990. aastate alguses ning hiljem maksmise näitena Jaapani, kus lasti hädas olevatel pankadel edasi toimetada. IMF-i analüütikute Luc Laeveni ja Fabian Valencia analüüsi põhjal on kohe maksmise variant üldiselt parem. Graafikud: Maailma finantskriisid 1970-2007. Lisa: Ei aastatki ilma kriisita

  14. Uudised : Tõnso. Triibud. Björk. DVD

    Index Scriptorium Estoniae

    2005-01-01

    Juuli lõpus ja augusti alguses Leigo järvel etenduvale Shakespeare'i näidendile "Suveöö muusika" kirjutab originaalmuusika Aivar Tõnso. Detroidi duot White Stripes soojendab Tallinna kontserdil 29. juunil klubis Hollywood ansambel Röövel Ööbik. Islandi lauljatar Björk annab juulis välja soundtrack-plaadi Matthew Barney viimasele filmile "Drawing Restraint 9". Piraat-DVDde arestimisest Suurbritannias

  15. Üle ühe : Ugala külalisetendused Tallinnas / Valle-Sten Maiste

    Index Scriptorium Estoniae

    Maiste, Valle-Sten, 1972-

    1995-01-01

    J. Glowacki 'Antigone New Yorgis' (lav. P. Raudsepp); D. Goweri 'Issid' (lav. J. Allik); A. Christie' 'Lõpp on algus' (lav. P. Tammearu); 'La Traviata öö' (A. Dumas' 'Kameeliadaami' ja G. Verdi 'Traviata' ainetel. A. Noormetsa tekst ja lavastus); 'Kolm päeva parun von Münchhauseni elust' (G. Gorini stsenaariumi järgi Ü. Saaremäe ja A. Trallmanni tekst, Ü. Saaremäe lavastus)

  16. H. Hiibuse šarž Oskar Lutsust (1986) : [eriväljaanne Oskar Lutsust

    Index Scriptorium Estoniae

    1987-01-01

    Fotod ; O. Luts 1903.a. ; Eduard Jürgenson ja Oskar Lutsu sõjaväefarmatseutidena 1911.a. ; Valentina, Georg ja Oskar Luts 1923.a. ; O. Lutsu õhtu ÜENÜTO-s 1927.a. ; O. Luts, A. Leetva-Müür, A. Mering ja A. Johanson ning V. Vent ; O. Luts, J. Aavik ja M. Nurmik 1922.a. Haapsalus ; O. Luts ja J. Sisask 1930-ndate aastate alguses

  17. Viagens, tremores e conchas: aspectos da natureza da América em escritos de José Bonifácio de Andrada e Silva, José Hipólito Unanúe e Dámaso Antonio Larrañaga

    Directory of Open Access Journals (Sweden)

    Maria Margaret Lopes

    Full Text Available Este artigo apresenta aspectos da produção científica de três ilustrados que atuaram na América do Sul: José Bonifácio de Andrada e Silva (1763-1838, José Hipólito Unanúe (1755-1833 e Dámaso Antonio Larrañaga (1771-1848. Os três naturalistas - de trajetórias, territórios e crenças diferenciadas - construíram suas versões sobre aspectos da natureza da América. Em comum, contribuíram com seus trabalhos científicos para a construção da geohistória americana. Foram escolhidos para análise por critérios de dispersão territorial e por suas diferentes abordagens sobre aspectos específicos das Ciências da Terra - temas que ainda hoje têm merecido menor atenção, mesmo entre os historiadores latino-americanos das ciências. Este artigo argumenta que estes personagens não só construíram seus próprios conhecimentos sobre temperamentos (climas e territórios, como também utilizaram seu conhecimento científico no implemento de ações políticas para os seus respectivos países em conformação.

  18. Cord Blood Ischemia-Modified Albumin Levels in Normal and Intrauterine Growth Restricted Pregnancies

    Directory of Open Access Journals (Sweden)

    Nicoletta Iacovidou

    2008-01-01

    Full Text Available Ischemia-modified albumin (IMA is a sensitive biomarker of cardiac ischemia. Intrauterine growth restriction (IUGR may imply fetal hypoxia, resulting in blood flow centralization in favour of vital organs (brain, heart, adrenals—‘‘brain sparing effect’’. Based on the latter, we hypothesized that cord blood IMA levels should not differ between IUGR and appropriate-for-gestational-age (AGA full-term pregnancies. IMA was measured in blood samples from doubly-clamped umbilical cords of 110 AGA and 57 asymmetric IUGR pregnancies. No significant differences in IMA levels were documented between AGA and IUGR groups. IMA levels were elevated in cases of elective cesarean section (P = .035, and offspring of multigravidas (P = .021. In conclusion, ‘‘brain sparing effect’’ is possibly responsible for the lack of differences in cord blood IMA levels at term, between IUGR and AGA groups. Furthermore, higher oxidative stress could account for the elevated IMA levels in cases of elective cesarean section, and offspring of multigravidas.

  19. Silvano üllatas tugeva aasta alguse tulemusega / Silvia Viidik

    Index Scriptorium Estoniae

    Viidik, Silvia, 1972-

    2010-01-01

    Rahvusvahelise naistrerõivaste müügiketi Silvano Fashion Groupi käive kasvas 2009. a. I kvartaliga võrreldes veerandi võrra. Silvano tulud on suurenenud tänu nõudluse taastumisele Vene turul. Baltika kahjum I kvartalis oli 32 mln. krooni, mida on 50% vähem kui aasta tagasi. Graafik

  20. Mai alguses linastub dokfilm "Sinimäed" / Andris Feldmanis

    Index Scriptorium Estoniae

    Feldmanis, Andris, 1982-

    2006-01-01

    Valminud on 6-osalise ajaloodokumentaalide sarja "Kuum külm sõda" teine film "Sinimäed" : stsenaristid Kiur Aarma, Mart Laar, Eerik-Niiles Kross, Raimo Jõerand : režissöör Raimo Jõerand : Ruut Pictures

  1. Maian Kärmas teeb alguse Jõulujazzile Tartus / Lia Eller

    Index Scriptorium Estoniae

    Eller, Lia

    2003-01-01

    Jõulujazzi üritustest Tartus: Maian Kärmase kontserdist Sadamateatris "Tuigutuled", Arne Oidi 75. sünniaastapäeva tähistavast kontserdist Vanemuise kontserdisaalis 4. dets., ameerika ansambli Gold Company Sextet kontserdist 15. detsembril

  2. Nädalavahetusel saab alguse süvakultuuri festival "Ariel"

    Index Scriptorium Estoniae

    2008-01-01

    26.-27. okt. toimub Tallinnas V juudi süvakultuuri festival "Ariel", mille peaesinejaks on klarnetist David Krakauer ansambliga Klezmer Madness1 USAst. Lisaks annavad kontserdi solist Sofia Rubina ja ansambel Vox Clamantis

  3. Kõik sai alguse juhusest / Nicholas Sinclair ; interv. Marge Monko

    Index Scriptorium Estoniae

    Sinclair, Nicholas

    2007-01-01

    Inglise portreefotograaf ja 2003 a. Hasselbladi meister Nicholas Sinclair oma fotograafi karjäärist, ilmunud fotoalbumitest, näitustest, peamistest meelisteemadest ja töö- ning õpetamismeetoditest

  4. Risk of hearing loss in small for gestational age neonates

    Directory of Open Access Journals (Sweden)

    Melani Rakhmi Mantu

    2011-02-01

    Full Text Available Background Small for gestational age (SGA neonates often have intrauterine growth restriction due to placental insufficiency and chronic hypoxia. These conditions may cause developmental impairment, psychosocial disabilities, or metabolic dysfunction in later life. Previous studies have shown greater incidence of speech and language disabilities, learning impairment, and neuromotor dysfunction in term SGA infants compared to term appropriate for gestational age (AGA infants. Objective To compare hearing loss in SGA and AGA neonates using otoocoustic emission (OAE tests and to study correlations between maternal risk factors and hearing loss in SGA neonates. Methods A cross-sectional study was performed in St. Borromeus Hospital, Limijati Hospital, and Melinda Hospital in Bandung from February to May 2010. Study subjects consisted of full-term neonates born in these three hospitals. A retrospective medical record review was performed for this study. Statistical analysis was done by multivariable logistic-regression. Results There was a total of 4279 subjects in our study, including 100 SGA neonates and 4179 AGA neonates. We observed a greater percentage of OAE 'refer' (indicating abnormal OAE results in the SGA group compared to the AGA group (P<0.001, Z=13.247. For suhjects with OAE 'refer' results, we also analyzed the correlation to the following maternal risk factors: smoking, hypertension, diabetes mellitus and asthma. We also found significant differences between  those with and without each of the four maternal risk factors studied (P< 0.001. By using multivariant analysis to compare SGA and AGA neonates, we found the odds ratio (OR to he 4.34 (95% CI 2.52 to 7.49, P=0.001, meaning the SGA group had a 4.34 times higher risk of hearing loss than the AGA group. Conclusion SGA neonates had a higher risk of hearing loss than AGA neonates. In addition, maternal smoking, hypertension, diabetes mellitus and asthma significantly correlated to

  5. Controllable resonant tunnelling through single-point potentials: A point triode

    International Nuclear Information System (INIS)

    Zolotaryuk, A.V.; Zolotaryuk, Yaroslav

    2015-01-01

    A zero-thickness limit of three-layer heterostructures under two bias voltages applied externally, where one of which is supposed to be a gate parameter, is studied. As a result, an effect of controllable resonant tunnelling of electrons through single-point potentials is shown to exist. Therefore the limiting structure may be termed a “point triode” and considered in the theory of point interactions as a new object. The simple limiting analytical expressions adequately describe the resonant behaviour in the transistor with realistic parameter values and thus one can conclude that the zero-range limit of multi-layer structures may be used in fabricating nanodevices. The difference between the resonant tunnelling across single-point potentials and the Fabry–Pérot interference effect is also emphasized. - Highlights: • The zero-thickness limit of three-layer heterostructures is described in terms of point interactions. • The effect of resonant tunnelling through these single-point potentials is established. • The resonant tunnelling is shown to be controlled by a gate voltage

  6. Tipping Point

    Medline Plus

    Full Text Available ... OnSafety CPSC Stands for Safety The Tipping Point Home > 60 Seconds of Safety (Videos) > The Tipping Point ... 24 hours a day. For young children whose home is a playground, it’s the best way to ...

  7. Interesting Interest Points

    DEFF Research Database (Denmark)

    Aanæs, Henrik; Dahl, Anders Lindbjerg; Pedersen, Kim Steenstrup

    2012-01-01

    on spatial invariance of interest points under changing acquisition parameters by measuring the spatial recall rate. The scope of this paper is to investigate the performance of a number of existing well-established interest point detection methods. Automatic performance evaluation of interest points is hard......Not all interest points are equally interesting. The most valuable interest points lead to optimal performance of the computer vision method in which they are employed. But a measure of this kind will be dependent on the chosen vision application. We propose a more general performance measure based...... position. The LED illumination provides the option for artificially relighting the scene from a range of light directions. This data set has given us the ability to systematically evaluate the performance of a number of interest point detectors. The highlights of the conclusions are that the fixed scale...

  8. Comparison of the Efficacy of Homologous and Autologous Platelet-Rich Plasma (PRP) for Treating Androgenic Alopecia.

    Science.gov (United States)

    Ince, Bilsev; Yildirim, Mehmet Emin Cem; Dadaci, Mehmet; Avunduk, Mustafa Cihat; Savaci, Nedim

    2018-02-01

    Androgenetic alopecia (AGA), the most common cause of hair loss in both sexes, accounts for 95% of all cases of hair loss. Although the literature has suggested that both nonactivated (n-PRP) and activated autologous (a-PRP) PRP can be used to treat AGA, we did not find any study investigating the use of homologous PRP (h-PRP) for this purpose. Also, to the best of our knowledge, there are no studies comparing the efficacy of h-PRP, a-PRP, or n-PRP on AGA therapy. The aim of this study was to compare the increase in hair density, average number of platelets, complications, preparation, and duration of application in the treatment of AGA using a-PRP, n-PRP, and h-PRP. Between 2014 and 2015, we studied male patients who had experienced increased hair loss in the last year. Patients were divided into three groups: Group 1 received n-PRP, Group 2 received active PRP, and Group 3 received h-PRP. For Group 1, PRP was prepared by a single centrifugation prepared from the patient's own blood. For Group 2, the PRP was prepared from the patient's own blood, but a second centrifugation was applied for platelet activation with calcium chloride. For Group 3, the PRP was prepared from pooled platelets with the same blood group as the patient from the blood center. PRP was injected at 1, 2, and 6 months. The hair density (n/cm 2 ) of each patient before and after injection was calculated. Each patient was assigned a fixed evaluation point at the time of application to calculate hair density. At 2, 6, and 12 months after the first treatment, the increase in hair density was calculated as 11.2, 26.1, and 32.4%, respectively, in Group 1; 8.1, 12.5, and 20.8%, respectively, in Group 2; and 16.09, 36.41, and 41.76%, respectively, in Group 3. The increase in hair density was statistically significantly greater in Group 1 than in Group 2 and more so in Group 3 than in both groups among all controls (p PRP was greater than with autologous PRP groups. We believe that h-PRP therapy can

  9. Zero-point oscillations, zero-point fluctuations, and fluctuations of zero-point oscillations

    International Nuclear Information System (INIS)

    Khalili, Farit Ya

    2003-01-01

    Several physical effects and methodological issues relating to the ground state of an oscillator are considered. Even in the simplest case of an ideal lossless harmonic oscillator, its ground state exhibits properties that are unusual from the classical point of view. In particular, the mean value of the product of two non-negative observables, kinetic and potential energies, is negative in the ground state. It is shown that semiclassical and rigorous quantum approaches yield substantially different results for the ground state energy fluctuations of an oscillator with finite losses. The dependence of zero-point fluctuations on the boundary conditions is considered. Using this dependence, it is possible to transmit information without emitting electromagnetic quanta. Fluctuations of electromagnetic pressure of zero-point oscillations are analyzed, and the corresponding mechanical friction is considered. This friction can be viewed as the most fundamental mechanism limiting the quality factor of mechanical oscillators. Observation of these effects exceeds the possibilities of contemporary experimental physics but almost undoubtedly will be possible in the near future. (methodological notes)

  10. Point-point and point-line moving-window correlation spectroscopy and its applications

    Science.gov (United States)

    Zhou, Qun; Sun, Suqin; Zhan, Daqi; Yu, Zhiwu

    2008-07-01

    In this paper, we present a new extension of generalized two-dimensional (2D) correlation spectroscopy. Two new algorithms, namely point-point (P-P) correlation and point-line (P-L) correlation, have been introduced to do the moving-window 2D correlation (MW2D) analysis. The new method has been applied to a spectral model consisting of two different processes. The results indicate that P-P correlation spectroscopy can unveil the details and re-constitute the entire process, whilst the P-L can provide general feature of the concerned processes. Phase transition behavior of dimyristoylphosphotidylethanolamine (DMPE) has been studied using MW2D correlation spectroscopy. The newly proposed method verifies that the phase transition temperature is 56 °C, same as the result got from a differential scanning calorimeter. To illustrate the new method further, a lysine and lactose mixture has been studied under thermo perturbation. Using the P-P MW2D, the Maillard reaction of the mixture was clearly monitored, which has been very difficult using conventional display of FTIR spectra.

  11. Comparing American Gastroenterological Association Pancreatic Cyst Management Guidelines with Fukuoka Consensus Guidelines as Predictors of Advanced Neoplasia in Patients with Suspected Pancreatic Cystic Neoplasms.

    Science.gov (United States)

    Ma, Gene K; Goldberg, David S; Thiruvengadam, Nikhil; Chandrasekhara, Vinay; Kochman, Michael L; Ginsberg, Gregory G; Vollmer, Charles M; Ahmad, Nuzhat A

    2016-11-01

    In 2015, the American Gastroenterological Association (AGA) published guidelines to provide recommendations for management of suspected pancreatic cystic neoplasms (PCNs). The aim of this study was to compare efficacy of these with the Fukuoka consensus guidelines in predicting advanced neoplasia (AN) in patients with suspected PCNs. We performed a retrospective study of 239 patients who underwent surgical resection for suspected mucinous PCN at a tertiary care center from 2000 to 2014. Surgical pathology was the gold standard. The AGA and Fukuoka criteria were applied, and their performance in predicting AN, defined as invasive cancer or high-grade dysplasia (HGD), was assessed. Advanced neoplasia was found in 71 of 239 (29.7%) patients (28 invasive cancer, 43 HGD). The Fukuoka "high-risk" (FG-HR) and AGA "high-risk" (AGA-HR) criteria identified patients with AN with sensitivities of 28.2% and 35.2%, specificities of 95.8% and 94.0%, positive predictive values of 74.1% and 71.4%, and negative predictive values of 75.9% and 77.5%, respectively. Overall, there was no significant difference between the guidelines for prediction of AN. There were 7 and 6 cases with invasive cancer, and 23 and 24 cases with HGD missed by the FG-HR and AGA-HR guidelines, respectively. In a retrospective analysis, the AGA guidelines are not superior to the Fukuoka guidelines in identifying AN in suspected PCNs. Both sets of guidelines have fair PPV for detection of AN, which would lead to avoidable resections in patients without AN. Additionally, the high-risk features of both guidelines do not accurately identify all patients with AN. Copyright © 2016 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  12. Carboxyhemoglobin levels in umbilical cord blood of women with pre-eclampsia and intrauterine growth restriction.

    Science.gov (United States)

    Yusuf, Kamran; Kamaluddeen, Majeeda; Wilson, R Douglas; Akierman, Albert

    2012-11-01

    Pre-eclampsia (PE) and intrauterine growth restriction (IUGR) are associated with abnormal placentation. Heme oxygenase (HO) and carbon monoxide (CO) are involved in normal placental development and function and vasomotor control in the placenta. The objective of our study was to measure CO levels, as assessed by carboxyhemoglobin (COHb) levels in the umbilical cord arterial blood of women with PE, normotensive IUGR (<10th percentile for birth weight), and normotensive pregnancies with appropriate-for-gestational age (AGA) infants. We prospectively analyzed COHb levels in the umbilical arterial blood of women with PE, normotensive IUGR, and normotensive AGA pregnancies. Exclusion criteria included cigarette smoke exposure, hemolytic disorders, a positive direct anti-globulin test, chronic hypertension, fever, and any significant medical illness. COHb levels were measured using the ABL 725 blood gas analyzer. There were 41 women in the normotensive AGA group, 42 in the PE group, and 36 in the normotensive IUGR group. Maternal age, mode of delivery, gravidity, parity, and gender of the infants were similar in the three groups. Gestational age and birth weight were significantly higher in the normotensive AGA group compared with the other two groups. COHb levels were significantly lower in the PE group compared with the normotensive AGA group (0.38±0.06% vs. 0.77±0.11%, P<0.05). COHb levels, although lower in the normotensive IUGR group compared with the normotensive AGA group, did not reach statistical significance. Our data suggests the HO-CO system may have a role in the pathogenesis of PE. We also, for the first time, provide information on umbilical arterial COHb levels in normotensive IUGR pregnancies.

  13. Tipping Point

    Medline Plus

    Full Text Available ... 60 Seconds of Safety (Videos) > The Tipping Point The Tipping Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash ...

  14. Characterizing fixed points

    Directory of Open Access Journals (Sweden)

    Sanjo Zlobec

    2017-04-01

    Full Text Available A set of sufficient conditions which guarantee the existence of a point x⋆ such that f(x⋆ = x⋆ is called a "fixed point theorem". Many such theorems are named after well-known mathematicians and economists. Fixed point theorems are among most useful ones in applied mathematics, especially in economics and game theory. Particularly important theorem in these areas is Kakutani's fixed point theorem which ensures existence of fixed point for point-to-set mappings, e.g., [2, 3, 4]. John Nash developed and applied Kakutani's ideas to prove the existence of (what became known as "Nash equilibrium" for finite games with mixed strategies for any number of players. This work earned him a Nobel Prize in Economics that he shared with two mathematicians. Nash's life was dramatized in the movie "Beautiful Mind" in 2001. In this paper, we approach the system f(x = x differently. Instead of studying existence of its solutions our objective is to determine conditions which are both necessary and sufficient that an arbitrary point x⋆ is a fixed point, i.e., that it satisfies f(x⋆ = x⋆. The existence of solutions for continuous function f of the single variable is easy to establish using the Intermediate Value Theorem of Calculus. However, characterizing fixed points x⋆, i.e., providing answers to the question of finding both necessary and sufficient conditions for an arbitrary given x⋆ to satisfy f(x⋆ = x⋆, is not simple even for functions of the single variable. It is possible that constructive answers do not exist. Our objective is to find them. Our work may require some less familiar tools. One of these might be the "quadratic envelope characterization of zero-derivative point" recalled in the next section. The results are taken from the author's current research project "Studying the Essence of Fixed Points". They are believed to be original. The author has received several feedbacks on the preliminary report and on parts of the project

  15. Fixed Points

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 5; Issue 5. Fixed Points - From Russia with Love - A Primer of Fixed Point Theory. A K Vijaykumar. Book Review Volume 5 Issue 5 May 2000 pp 101-102. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Demerit points systems.

    NARCIS (Netherlands)

    2006-01-01

    In 2012, 21 of the 27 EU Member States had some form of demerit points system. In theory, demerit points systems contribute to road safety through three mechanisms: 1) prevention of unsafe behaviour through the risk of receiving penalty points, 2) selection and suspension of the most frequent

  17. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey

    1980-01-01

    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  18. Evaluation of hyperandrogenemia and metabolic risk profile in women with postadolescent acne

    Directory of Open Access Journals (Sweden)

    Leyla Baykal Selçuk

    2016-06-01

    Full Text Available Background and Design: Postadolescent acne is a disease with relapses frequently seen in women. Treatment is difficult. In our study, we aimed to investigate the clinical and biochemical characteristics of hyperandrogenism and the prevalence of metabolic disorders, such as metabolic syndrome (MS and dyslipidemia in women with postadolescent acne. Materials and Methods: This study was conducted on 50 women who attended our department with the complaint of postadolescent acne between July 2014 and December 2014. The presence of androgenetic alopecia (AGA, hirsutism, polycystic ovary syndrome (PCOS, MS, dyslipidemia, and obesity was evaluated. Results: Seborrhea was present in 56%, hirsutism in 40%, AGA in 26%, and PCOS in 24% of women with postadolescent acne. The prevalence of MS and dyslipidemia was 24% and 44%, respectively. The prevalence of MS was significantly higher in patients with AGA and hirsutism. There was no association of MS with menstrual irregularity and PCOS. There was no significant association of dyslipidemia with AGA, hirsutism, PCOS, and menstrual irregularity. Conclusion: Clinical symptoms of hyperandrogenism, such as hirsutism, AGA, and PCOS were more common in women with postadolescent acne but androgenic hormone profile abnormalities were minimal. As a result, postadolescent acne resistant to treatment may be considered as an early marker in the early diagnosis of PCOS in women to prevent the development of type 2 diabetes mellitus, MS and hypercholesterolemia.

  19. Conventional and novel stem cell based therapies for androgenic alopecia

    Directory of Open Access Journals (Sweden)

    Talavera-Adame D

    2017-08-01

    Full Text Available Dodanim Talavera-Adame,1 Daniella Newman,2 Nathan Newman1 1American Advanced Medical Corp. (Private Practice, Beverly Hills, CA, 2Western University of Health Sciences, Pomona, CA, USA Abstract: The prevalence of androgenic alopecia (AGA increases with age and it affects both men and women. Patients diagnosed with AGA may experience decreased quality of life, depression, and feel self-conscious. There are a variety of therapeutic options ranging from prescription drugs to non-prescription medications. Currently, AGA involves an annual global market revenue of US$4 billion and a growth rate of 1.8%, indicating a growing consumer market. Although natural and synthetic ingredients can promote hair growth and, therefore, be useful to treat AGA, some of them have important adverse effects and unknown mechanisms of action that limit their use and benefits. Biologic factors that include signaling from stem cells, dermal papilla cells, and platelet-rich plasma are some of the current therapeutic agents being studied for hair restoration with milder side effects. However, most of the mechanisms exerted by these factors in hair restoration are still being researched. In this review, we analyze the therapeutic agents that have been used for AGA and emphasize the potential of new therapies based on advances in stem cell technologies and regenerative medicine. Keywords: stem cells, stem cell therapies, hair follicle, dermal papilla, androgenic alopecia, laser, hair regeneration

  20. Edasi, selg ees : Stalini-järgsete aastate haritlaspoliitika kahest tahust / Väino Sirk

    Index Scriptorium Estoniae

    Sirk, Väino

    2004-01-01

    Tsiviliseerituma okupatsiooni algus, millega kaasnes kõrgkoolipoliitika ajakohastamine, kultuuri mõiste mõningane lahutamine ideoloogiast, võimu ja ühiskonna teatav konsolideerumine ning looduse, ajaloomälestiste ja eesti keele kaitsmine seostus eestluse kaitsmisega. Parteilaste arvu kasv haritlaskonna hulgas, intelligentsi kontrolli all hoidmise erinevad võimalused, ühiskonlik ja parteitöö. NLKP XXII kongressil vastuvõetud kolmandast programmist, mis andis juhtnöörid rahvuserinevuste sihipäraseks taandamiseks

  1. Dri:mid - katse tõlkida unistusi / Evelyn Reemann

    Index Scriptorium Estoniae

    Reemann, Evelyn

    2010-01-01

    Unistamisest ja unistustest Eesti keeleruumis ja folklooris, kus unistusi ei väljendata valjusti, kartes need ära sõnuda. Ja kuna selle käsitlemiseks uurimismeetodit pole, esitatakse noppeid erinevatest kultuurianalüütilistest kirjutistest, millele toetudes on autori arusaam ja seisukohad unistamise olemusest selgemaks saanud. Ka võrdlusi ameeriklaste unistustega. Praktilise tööna ilmutatakse kangastele inimeste unistused vanadelt, 19. sajandi lõpu ja 20. sajandi alguse fotodelt

  2. Keskendudes protsessile = Focus on Process

    Index Scriptorium Estoniae

    2004-01-01

    1996. a. arhitektide Juliet Bidgoodi ja Liza Fiori ning kunstnik Katherine Clarke'i loodud Inglise arhitektuuribüroo muf tutvustus ja intervjuu Liza Fioriga. Naistest koosnev büroo tegeleb avaliku sfääriga. muf-i töödest tutvustatakse muuseumipaviljoni St Albansis, 1997. a. alguse saanud Londoni Southwarki tänava ümberkujundamise projekti, ruumiinstallatsiooni "Purity and Tolerance", 2003. a. alustatud Londoni Tilbury linnaosa pargi projekti. 4 ill

  3. Ekspressi tellija saab rikkaliku kogumiku Eesti muusikat

    Index Scriptorium Estoniae

    2008-01-01

    Viimasel kaheksal nädalal on ajalehemüügikohtades Eesti Ekspressi vahel olnud Eesti artistide singelplaadid: Tõnis Mägi ja Noorkuu, Jana Kask, Metsatöll, HU?, Ithaka-Maria, Rainer Jancise muusika filmist "Mina olin siin", Toe Tag, Birgit Õigemeel. Selgunud on Eesti Ekspressi tellijatele jaanuari alguses saadetava singlikogumiku lisaartistid: Vaiko Eplik, Pedigree, Traffic, Slide-Fifty ja Lenna Kuurmaa, Smilers, Leslie Da Bass ja Singer-Vinger

  4. Karl Menningu (ja iseenese) päästmiseks / Ants Hein

    Index Scriptorium Estoniae

    Hein, Ants, 1952-

    2008-01-01

    Vastuseks Karin Hallas-Murula arvustusele "Maja, mis on sümbol" (Sirp, 2007, 5. X, lk. 13) ja Mait Väljase arvustusele "Iseolemise algus arhitektuuris" (Maja, 2008, nr. 1, lk. 86-87) oma 2007. a. ilmunud raamatust "Maja kui sümbol : Eesti Üliõpilaste Seltsi hoone Tartus" kohta. Georg Hellati ja Karl Menningu osalusest EÜS-i hoone sünniloos. Frank Lloyd Wrightist kui võimalikust eeskujuandjast

  5. Publication point indicators

    DEFF Research Database (Denmark)

    Elleby, Anita; Ingwersen, Peter

    2010-01-01

    ; the Cumulated Publication Point Indicator (CPPI), which graphically illustrates the cumulated gain of obtained vs. ideal points, both seen as vectors; and the normalized Cumulated Publication Point Index (nCPPI) that represents the cumulated gain of publication success as index values, either graphically......The paper presents comparative analyses of two publication point systems, The Norwegian and the in-house system from the interdisciplinary Danish Institute of International Studies (DIIS), used as case in the study for publications published 2006, and compares central citation-based indicators...... with novel publication point indicators (PPIs) that are formalized and exemplified. Two diachronic citation windows are applied: 2006-07 and 2006-08. Web of Science (WoS) as well as Google Scholar (GS) are applied to observe the cite delay and citedness for the different document types published by DIIS...

  6. A three-point Taylor algorithm for three-point boundary value problems

    NARCIS (Netherlands)

    J.L. López; E. Pérez Sinusía; N.M. Temme (Nico)

    2011-01-01

    textabstractWe consider second-order linear differential equations $\\varphi(x)y''+f(x)y'+g(x)y=h(x)$ in the interval $(-1,1)$ with Dirichlet, Neumann or mixed Dirichlet-Neumann boundary conditions given at three points of the interval: the two extreme points $x=\\pm 1$ and an interior point

  7. Georeferenced Point Clouds: A Survey of Features and Point Cloud Management

    Directory of Open Access Journals (Sweden)

    Johannes Otepka

    2013-10-01

    Full Text Available This paper presents a survey of georeferenced point clouds. Concentration is, on the one hand, put on features, which originate in the measurement process themselves, and features derived by processing the point cloud. On the other hand, approaches for the processing of georeferenced point clouds are reviewed. This includes the data structures, but also spatial processing concepts. We suggest a categorization of features into levels that reflect the amount of processing. Point clouds are found across many disciplines, which is reflected in the versatility of the literature suggesting specific features.

  8. Aga miks mitte panustada teraviljale? / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2007-01-01

    Üha populaarsust koguvate ETFide ehk börsil kaubeldavate fondide hulka on lisandunud ka viimaste variatsioonid ETCd ehk börsil kaubeldavad toorained, nende perspektiivikust tõstab tarbimise kasv maailmas. Tabel: Millistel börsidel tehakse tehinguid ETF-idega

  9. Pension tõuseb - aga edasi? / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2008-01-01

    Pensionide uuest indekseerimise korrast. Ilmunud ka Nädaline 20. märts 2008, lk. 4 ; Valgamaalane 20. märts 2008, lk. 2 ; LõunaLeht 20. märts 2008, lk. 4 ; Põhjarannik 20. märts 2008, lk. 4 ; Võrumaa Teataja 25. märts 2008, lk. 2 ; Vali Uudised 26. märts 2008, lk. 2 ; Sõnumitooja 26. märts 2008, lk. 6 ; Meie Maa 25. märts 2008, lk. 2 ; Lääne Elu 25. märts 2008, lk. 2 ; Kuulutaja 28. märts 2008, lk. 4 ; Türi Rahvaleht 28. märts 2008, lk. 4 ; Oma Saar 28. märts 2008, lk. 5 ; Vooremaa 22. märts 2008, lk. 2 ; Pärnu Postimees 27. märts 2008, lk. 15 ; Narva Postiljon 5. aprill 2008, lk. 2 ; Videvik 3. aprill 2008, lk. 2 ; Virumaa Teataja 8. aprill 2008, lk. 11 ; Nädalaleht 20. märts 2008, lk. 5

  10. Influence of the burning point on the dew point in a diesel engine

    Energy Technology Data Exchange (ETDEWEB)

    Teetz, C.

    1982-06-01

    A computation on the influence of the ignition point on the dew point in a cylinder of a diesel engine is presented. The cylinder-pressure diagrams are shown. The results of computation are given. A later ignition point diminishes the area with cylinder wall temperatures below the dew point. The endangering by cylinder wall temperatures below the dew point is illustrated.

  11. Lack of concordance and linkage disequilibrium among brothers for androgenetic alopecia and CAG/GGC haplotypes of the androgen receptor gene in Mexican families.

    Science.gov (United States)

    Arteaga-Vázquez, Jazmín; López-Hernández, María A; Svyryd, Yevgeniya; Mutchinick, Osvaldo M

    2015-12-01

    Androgenetic alopecia (AGA) or common baldness is the most prevalent form of hair loss in males. Familial predisposition has been recognized, and heritability estimated in monozygotic twins suggests an important genetic predisposition. Several studies indicate that the numbers of CAG/GGC repeats in exon 1 of the androgen receptor gene (AR) maybe associated with AGA susceptibility. To investigate a possible correlation between AR CAG/GGC haplotypes and the presence or not of alopecia in sibships with two or more brothers among them at least one of them has AGA. Thirty-two trios including an alopecic man, one brother alopecic or not, and their mother were enrolled. Sanger sequencing of the exon 1 of the AR gene was conducted to ascertain the number of CAG/GGC repeats in each individual. Heterozygous mother for the CAG/GGC haplotypes was an inclusion criterion to analyze the segregation haplotype patterns in the family. Concordance for the number of repeats and AGA among brothers was evaluated using kappa coefficient and the probability of association in the presence of genetic linkage between CAG and GGC repeats and AGA estimated by means of the family-based association test (FBAT). The median for the CAG and GGC repeats in the AR is similar to that reported in other populations. The CAG/GGC haplotypes were less polymorphic than that reported in other studies, especially due to the GGC number of repeats found. Kappa coefficient resulted in a concordance of 37.3% (IC 95%, 5.0-69.0%) for the AGA phenotype and identical CAG/GGC haplotypes. There was no evidence of linkage disequilibrium. Our results do not confirm a possible correlation or linkage disequilibrium between the CAG/GGC haplotypes of the AR gene and androgenetic alopecia in Mexican brothers. © 2015 Wiley Periodicals, Inc.

  12. Aminoglycoside antibiotics as a tool for the study of the biological role of calcium ions. Historical overview.

    Science.gov (United States)

    Corrado, A P; de Morais, I P; Prado, W A

    1989-01-01

    Beginning with the pioneering work of Vital-Brazil and Corrado (1957), which suggested a possible interaction between aminoglycoside antibiotics (AGA) and calcium ions at the neuromuscular junction, the authors review the studies that demonstrated the existence of a competitive antagonism between AGA and calcium ions. In view of the low liposolubility of AGA and their inability to cross biological membranes, this antagonism seems to occur exclusively at calcium-binding sites at the level of the outer opening of calcium channels of the N-subtype, which are also the sites of interaction of omega-conotoxin. Being highly water soluble, AGA are easily removed from their binding sites with a consequent rapid reversal of their effects, a factor of primary importance to explain their wide use as tools in the pharmacological analysis of the study of the biological role of calcium ion on the membrane's outer surface. This use has advantages over the use of inorganic di- and trivalent cations such as Mg2+, Mn2+, Cd2+, Ni2+, La3+, etc., since the latter, though they are considered to be the most specific competitive antagonists of calcium ions, may induce biphasic effects due to their ability to cross the membranes and replace calcium and/or increase intracellular calcium concentration. The performance of AGA is also superior when compared with the so-called "specific" organic calcium antagonists--verapamil and nifedipine derivatives--since the latter, in addition to inducing possible biphasic effects, antagonize calcium in a non-competitive manner. Finally, the authors remark that AGA-Ca2+ antagonism relevance is not limited only to basic aspects and that it may have therapeutic implications since it provides alternatives for reducing the toxic adverse effects of this important group of antibiotics.

  13. American Gastroenterological Association guidelines are inaccurate in detecting pancreatic cysts with advanced neoplasia: a clinicopathologic study of 225 patients with supporting molecular data.

    Science.gov (United States)

    Singhi, Aatur D; Zeh, Herbert J; Brand, Randall E; Nikiforova, Marina N; Chennat, Jennifer S; Fasanella, Kenneth E; Khalid, Asif; Papachristou, Georgios I; Slivka, Adam; Hogg, Melissa; Lee, Kenneth K; Tsung, Allan; Zureikat, Amer H; McGrath, Kevin

    2016-06-01

    The American Gastroenterological Association (AGA) recently reported evidence-based guidelines for the management of asymptomatic neoplastic pancreatic cysts. These guidelines advocate a higher threshold for surgical resection than prior guidelines and imaging surveillance for a considerable number of patients with pancreatic cysts. The aims of this study were to assess the accuracy of the AGA guidelines in detecting advanced neoplasia and present an alternative approach to pancreatic cysts. The study population consisted of 225 patients who underwent EUS-guided FNA for pancreatic cysts between January 2014 and May 2015. For each patient, clinical findings, EUS features, cytopathology results, carcinoembryonic antigen analysis, and molecular testing of pancreatic cyst fluid were reviewed. Molecular testing included the assessment of hotspot mutations and deletions for KRAS, GNAS, VHL, TP53, PIK3CA, and PTEN. Diagnostic pathology results were available for 41 patients (18%), with 13 (6%) harboring advanced neoplasia. Among these cases, the AGA guidelines identified advanced neoplasia with 62% sensitivity, 79% specificity, 57% positive predictive value, and 82% negative predictive value. Moreover, the AGA guidelines missed 45% of intraductal papillary mucinous neoplasms with adenocarcinoma or high-grade dysplasia. For cases without confirmatory pathology, 27 of 184 patients (15%) with serous cystadenomas (SCAs) based on EUS findings and/or VHL alterations would continue magnetic resonance imaging (MRI) surveillance. In comparison, a novel algorithmic pathway using molecular testing of pancreatic cyst fluid detected advanced neoplasias with 100% sensitivity, 90% specificity, 79% positive predictive value, and 100% negative predictive value. The AGA guidelines were inaccurate in detecting pancreatic cysts with advanced neoplasia. Furthermore, because the AGA guidelines manage all neoplastic cysts similarly, patients with SCAs will continue to undergo unnecessary MRI

  14. Point specificity in acupuncture

    Directory of Open Access Journals (Sweden)

    Choi Emma M

    2012-02-01

    Full Text Available Abstract The existence of point specificity in acupuncture is controversial, because many acupuncture studies using this principle to select control points have found that sham acupoints have similar effects to those of verum acupoints. Furthermore, the results of pain-related studies based on visual analogue scales have not supported the concept of point specificity. In contrast, hemodynamic, functional magnetic resonance imaging and neurophysiological studies evaluating the responses to stimulation of multiple points on the body surface have shown that point-specific actions are present. This review article focuses on clinical and laboratory studies supporting the existence of point specificity in acupuncture and also addresses studies that do not support this concept. Further research is needed to elucidate the point-specific actions of acupuncture.

  15. Lean body mass in small for gestational age and appropriate for gestational age infants

    International Nuclear Information System (INIS)

    Petersen, S.; Gotfredsen, A.; Knudsen, F.U.

    1988-01-01

    Dual photon absorptiometry using 153 Gd in a whole-body scanner was used to measure lean body mass (LBM) in 51 newborn infants. LBM% decreased exponentially with increasing gestational age in both small for gestational age (SGA) and appropriate for gestational age (AGA) infants. In preterm SGA and AGA infants LBM was 104% and 103%, respectively, indicating that no fat was detectable. In term SGA infants LBM was 98%, which corresponded to 48 gm fat on average, and in term AGA infants LBM was 87%, which corresponded to 452 gm fat on average. The LBM%, ponderal index, and skinfold thickness were significantly different between AGA and SGA infants. Infants with clinical signs of intrauterine wastage had significantly higher LBM% than did infants without signs of weight loss. Our results on LBM% by dual photon absorptiometry agree with earlier dissection data; the clinically applicable methods of (1) height combined with weight (i.e., ponderal index), (2) skinfold thickness, and (3) scoring by clinical observations are useful for the estimation of lack of fat as an indicator of intrauterine growth retardation

  16. Genetics and other factors in the aetiology of female pattern hair loss.

    Science.gov (United States)

    Redler, Silke; Messenger, Andrew G; Betz, Regina C

    2017-06-01

    Pattern hair loss is the most common form of hair loss in both women and men. Male pattern hair loss, also termed male androgenetic alopecia (M-AGA), is an androgen-dependent trait that is predominantly genetically determined. Androgen-mediated mechanisms are probably involved in female pattern hair loss (FPHL) in some women but the evidence is less strong than in M-AGA; other non-androgenic pathways, including environmental influences, may contribute to the aetiology. Genome-wide association studies have identified several genetic loci for M-AGA and have provided better insight into the underlying biology. However, the role of heritable factors in Female Pattern Hair Loss (FPHL) is largely unknown. Recently published studies have been restricted to candidate gene approaches and could not clearly identify any susceptibility locus/gene for FPHL but suggest that the aetiology differs substantially from that of M-AGA. Hypotheses about possible pathomechanisms of FPHL as well as the results of the genetic studies performed to date are summarized. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Evaluation of the relationship between androgenetic alopecia and demodex infestation

    Directory of Open Access Journals (Sweden)

    Zari Javidi

    2008-01-01

    Full Text Available Introduction: Androgenetic alopecia (AGA is one of the most common dermatologic disorders with a multifactorial etiology. Inflammatory activators such as Demodex infestation may play a role in the pathogenesis of some cases of androgenetic alopecia that do not respond to common treatments such as minoxidil and finasteride. The goal of this study is to evaluate the relationship between Demodex infestation and AGA. Materials and Methods: In this case-control study, 41 patients with AGA referred to the Dermatology Clinic of Imam Reza Hospital and 33 healthy individuals were evaluated as control. All of them were between 20 and 40 years old men. In order to identify Demodex infestation they were referred to the Parasitology laboratory. Results: Demodex was detected in 19.5% of patients and 15.2% of controls; therefore, there was no significant relationship between them statistically ( P = 0.0787. Most of patients (85.4% had greasy hair. The most common pattern of baldness was II degree in Hamilton scale. Conclusion: There is no relation between AGA and Demodex.

  18. X-ray induction of immortalization in primary rat embryo cells associated with and without tumorigenicity

    International Nuclear Information System (INIS)

    Sierra, E.; Oberley, L.W.; Guernsey, D.L.

    1985-01-01

    Cultures of primary rat embryo fibroblasts were irradiated with X-rays (3 Gy). After 14 days the majority of colonies in both irradiated and control plates had senesced. Surviving clones were ring isolated from irradiated and control plates and grown in culture. A phase of rapid proliferation after isolation was observed, followed by a decline (crisis) leading to senescence. Several clones from the irradiated plates were able to recover from this crisis and gave rise to continuous cell lines, while all colonies from control plates senesced. Three types of cells have been identified among the irradiated survivors: (1) immortal fully transformed, capable of growth in soft agar (Aga/sup +/) and tumor formation, (2) immortal normal, not able to grow in soft agar (Aga/sup -/) and nontumorigenic, and (3) immortal Aga/sup -/ cells which progressed to malignancy (Aga/sup +/, tumorigenicity) after further sub-culture. These data support the suggestion that X-rays can induce immortalization of mammalian cells in the absence of tumorigenicity, in addition to (and separate from) the fully tumorigenetic state

  19. Inflammatory markers in umbilical cord blood from small-for-gestational-age newborns

    DEFF Research Database (Denmark)

    Lausten-Thomsen, Ulrik; Olsen, Marianne; Greisen, Gorm

    2014-01-01

    This study investigates the role of inflammation in intrauterine growth retardation by exploring the levels of inflammatory markers in umbilical cord blood from neonates who were born small-for-gestational-age (SGA) and comparing them to neonates who were born appropriate-for-gestational-age (AGA...... of elevated inflammatory markers in the cord blood from SGA infants compared to AGA infants, and consequently the results suggest an inflammatory component in intrauterine growth restriction (IUGR).......This study investigates the role of inflammation in intrauterine growth retardation by exploring the levels of inflammatory markers in umbilical cord blood from neonates who were born small-for-gestational-age (SGA) and comparing them to neonates who were born appropriate-for-gestational-age (AGA...

  20. Critical-point nuclei

    International Nuclear Information System (INIS)

    Clark, R.M.

    2004-01-01

    It has been suggested that a change of nuclear shape may be described in terms of a phase transition and that specific nuclei may lie close to the critical point of the transition. Analytical descriptions of such critical-point nuclei have been introduced recently and they are described briefly. The results of extensive searches for possible examples of critical-point behavior are presented. Alternative pictures, such as describing bands in the candidate nuclei using simple ΔK = 0 and ΔK = 2 rotational-coupling models, are discussed, and the limitations of the different approaches highlighted. A possible critical-point description of the transition from a vibrational to rotational pairing phase is suggested

  1. The registration of non-cooperative moving targets laser point cloud in different view point

    Science.gov (United States)

    Wang, Shuai; Sun, Huayan; Guo, Huichao

    2018-01-01

    Non-cooperative moving target multi-view cloud registration is the key technology of 3D reconstruction of laser threedimension imaging. The main problem is that the density changes greatly and noise exists under different acquisition conditions of point cloud. In this paper, firstly, the feature descriptor is used to find the most similar point cloud, and then based on the registration algorithm of region segmentation, the geometric structure of the point is extracted by the geometric similarity between point and point, The point cloud is divided into regions based on spectral clustering, feature descriptors are created for each region, searching to find the most similar regions in the most similar point of view cloud, and then aligning the pair of point clouds by aligning their minimum bounding boxes. Repeat the above steps again until registration of all point clouds is completed. Experiments show that this method is insensitive to the density of point clouds and performs well on the noise of laser three-dimension imaging.

  2. Efficacy of a cosmetic phyto-caffeine shampoo in female androgenetic alopecia.

    Science.gov (United States)

    Bussoletti, Carolina; Tolaini, Maria V; Celleno, Leonardo

    2018-03-06

    Androgenetic alopecia (AGA) is the most common type of hair loss in both males as well as females, occurring in up to 57% of women by the age of 80 years. Androgenetic alopecia is associated with a high psychological burden and often results in substantially reduced quality of life, poor body image and low self-esteem, particularly in women. Caffeine-based products have shown promise, both in vitro and in vivo, as potential treatments for AGA. This study was performed to determine the efficacy of a phyto-caffeine- containing shampoo used over a 6-month period in female subjects with AGA. This was a single-centre, double-blind parallel trial in which female subjects with AGA were randomized to either a phyto-caffeine-containing shampoo or a control shampoo. The primary endpoint was the change from baseline in the number of hairs pulled in a hair pull test at 6 months. Hair loss intensity, hair strength, subject satisfaction and tolerability were also assessed. Subjects using the phyto-caffeine-containing shampoo had significantly fewer hairs pulled in a hair pull test at 6 months, compared with subjects using the control shampoo (-3.1 vs -0.5 hairs; pshampoo, compared with controls. Both products were very well tolerated. Compared with a control shampoo, a phyto-caffeine-containing shampoo was more efficacious, with respect to the number of hairs being pulled out at 6 months, hair loss intensity and hair strength in subjects with AGA.

  3. Quantitative Shear-Wave Elastography of the Liver in Preterm Neonates with Intra-Uterine Growth Restriction.

    Directory of Open Access Journals (Sweden)

    Marianne Alison

    Full Text Available The feasibility and reproducibility of liver stiffness measurements using Supersonic Shear-wave Imaging (SSI in preterm neonate have not been reported. Our aim was to determine if liver stiffness differs between intra-uterine growth restriction (IUGR and appropriate for gestational age (AGA preterm infants with/without cholestasis. We measured liver stiffness (in kPa in 45 AGA and 18 IUGR preterm infants, and assessed reproducibility in 26 preterms using Intraclass Correlation Coefficients (ICC and Bland-Altman tests. Liver stiffness values were compared between AGA and IUGR with and without cholestasis and correlated with birth weight. Measurements showed high reproducibility (ICC = 0.94-0.98 for intra-operator, 0.86 for inter-operator with good agreement (95% limits: -1.24 to 1.24 kPa. During the first postnatal week, liver stiffness was higher in IUGR (7.50 ±1.53 kPa than in AGA infants (5.11 ±0.80 kPa, p<0.001. After day 8, liver stiffness remained unchanged in AGA but increased progressively in IUGR infants (15.57 ±6.49 kPa after day 21. Liver stiffness was higher in IUGR neonates with cholestasis (19.35 ± 9.80 kPa than without cholestasis (7.72 ± 1.27 kPa, p<0.001. In conclusion, quantitative liver SSI in preterms is feasible and reproducible. IUGR preterms who will develop cholestasis present high liver stiffness even at birth, before biological cholestasis occurs.

  4. Overweight and Obesity Based on Four Reference Systems in 18,382 Paediatric Patients with Type 1 Diabetes from Germany and Austria

    Directory of Open Access Journals (Sweden)

    M. Flechtner-Mors

    2015-01-01

    Full Text Available Aim. To evaluate the prevalence of overweight and obesity in paediatric type 1 diabetes (T1D subjects, based on four commonly used reference populations. Methods. Using WHO, IOTF, AGA (German pediatric obesity, and KiGGS (German Health Interview and Examination Survey for Children and Adolescents reference populations, prevalence of overweight (≥90th percentile and obesity (≥97th percentile and time trend between 2000 (n = 9,461 and 2013 (n = 18,382 were determined in 2–18-year-old T1D patients documented in the German/Austrian DPV database. Results. In 2000, the overweight prevalence was the highest according to IOTF (22.3%, followed by WHO (20.8%, AGA (15.5%, and KiGGS (9.4%. The respective rates in 2013 were IOTF (24.8%, WHO (22.9%, AGA (18.2%, and KiGGS (11.7%. Obesity prevalence in 2000 was the highest according to WHO (7.9%, followed by AGA (4.5%, IOTF (3.1%, and KiGGS (1.8%. In 2013, the respective rates were WHO (9.6%, AGA (6.2%, IOTF (4.5%, and KiGGS (2.6%. Overall, the prevalence of overweight and obesity increased from 2000 to 2006 (p < 0.001 but showed stabilization thereafter in girls and overweight in boys. Conclusion. Overweight and obesity prevalence in T1D subjects differs significantly if it is assessed by four separate reference populations. More detailed assessment of each child is required to determine obesity-related risks.

  5. [Dancing with Pointe Shoes: Characteristics and Assessment Criteria for Pointe Readiness].

    Science.gov (United States)

    Wanke, Eileen M; Exner-Grave, Elisabeth

    2017-12-01

    Training with pointe shoes is an integral part of professional dance education and ambitious hobby dancing. Pointe shoes - developed more than hundred years ago and almost unaltered since then - are highly specific and strike a balance between aesthetics, function, protection, and health care. Therefore, pointe readiness should be tested prior to all dance training or career training. Medical specialists are often confronted with this issue. Specific anatomical dance technique-orientated general conditional and coordinative preconditions as well as dance-technical prerequisites must be met by pointe readiness tests in order to keep traumatic injuries or long-term damage at a minimum. In addition to a (training) history, medical counselling sessions have come to include various tests that enable a reliable decision for or against pointe work. This article suggests adequate testing procedures (STT TEST), taking account of professional dancing as well as hobby dancing. © Georg Thieme Verlag KG Stuttgart · New York.

  6. A Comparison of the Hormonal Profile of Early Androgenetic Alopecia in Men With the Phenotypic Equivalent of Polycystic Ovarian Syndrome in Women.

    Science.gov (United States)

    Sanke, Sarita; Chander, Ram; Jain, Anju; Garg, Taru; Yadav, Pravesh

    2016-09-01

    Early androgenetic alopecia (AGA) is patterned hair loss occurring before age 30 years. Early AGA in men is frequently reported as the phenotypic equivalent of polycystic ovarian syndrome (PCOS) in women, which carries the risk of developing obesity, metabolic syndrome, and cardiovascular diseases. Very few studies have been conducted to evaluate this. To study the hormonal profile of men with early AGA and to evaluate if early AGA in men can be considered as the phenotypic equivalent of PCOS, the associated risks of which are well known. This case-control study was conducted from January 1, 2014, to March 31, 2015, in a tertiary care government hospital. Fifty-seven men aged 19 to 30 years presenting with patterned hair loss were recruited as study participants. Thirty-two age-matched men with no evidence of hair loss were recruited as controls. Men who had any established endocrine disorder, diabetes mellitus, or cardiovascular disease and those who took any oral medication or hormonal treatment for hair loss were excluded from the study. The serum concentrations of total testosterone, sex hormone-binding globulin (SHBG), dehydroepiandrosterone sulfate (DHEAS), luteinizing hormone (LH), follicle-stimulating hormone (FSH), prolactin, fasting plasma glucose, and insulin levels were measured. Insulin resistance (IR) and free androgen index (FAI) were calculated and compared with age- and sex-matched controls. The primary outcome was to measure the clinico-endocrinological profiles (LH, FSH, SHBG, DHEAS, and testosterone levels) of men with early AGA and to compare it with the PCOS profile; the secondary outcome was to establish a relationship between this endocrinological profile and IR. Compared with the 32 controls, the 57 participants with AGA showed significantly increased mean (SD) levels of testosterone (24.61 [7.97] vs 20.57 [4.9] nmol/L; P = .04), DHEAS (3.63 [2.19] vs 2.64 [1.49] µg/mL; P = .02), LH (7.78 [3.19] vs 4.56 [2.01] mIU/mL; P PCOS. The

  7. Saaremaa XX sajandil

    Index Scriptorium Estoniae

    2001-01-01

    Algus: 6. jaanuar 2000. Järg Jan/12;16;26;30/Feb/9;13;22/Mar/6;13;16;27Apr/6;20;27/May/15;31/Jun/12;22/Jul/6;13;27Aug/1;3 Sep/11/Oct/9;16/Nov/6;9/Dec/11. Artiklite autorid: Külli Rikas, Helju Pärt, Garel Püüa, Endel Prooses, Raul Salumäe, Sirje Azarov, Endel Püüa, Maret Soorsk, Aare Laine

  8. Kuidas tähistame TÜ 375. aastapäeva? / Varje Sootak

    Index Scriptorium Estoniae

    Sootak, Varje, 1946-

    2007-01-01

    TÜ 375. aastapäeva tähistamise ürituste seas ka kontserdid: 5. okt. Vanemuise kontserdimajas "Kuningas Gustavi gala" (esinevad ülikoori esinduskoorid koos Vanemuise Sümfooniaorkestriga ja Viljandi Kultuuriakadeemia kultuurikollektiivid, sh. muusikud), 6. okt. AthenasTRÜ ansamblid Rajacas, Rentaablus, Meedium ja Fix, 3. sept. Raekoja platsil uue kooliaasta alguse kontsert, 5. okt. üliõpilasmajas heategevuskontsert, sept. lõpus esitavad ülikoolide koorid Tallinnas ja Pärnus Carl Orffi lavakantaadi "Carmina BUrana"

  9. Eesti lipu võib heisata iga päev / Kalev Uustalu

    Index Scriptorium Estoniae

    Uustalu, Kalev, 1951-

    2006-01-01

    Aasta alguses jõustunud Eesti lipu seaduses kehtestatud riigi- ja kohaliku omavalitsuse asutustele riigilipu kasutamise uutest reeglitest ning eraisikutele Eesti lipu kui rahvuslipu kasutamise vabadusest. Sama ka Hiiu Leht 3. veeb. 2006, lk. 8 ; Sakala 10. veeb. 2006, lk. 2 ; Lääne Elu 9. veeb. 2006, lk. 2 ; Järva Teataja 23. veeb. 2006, lk. 2 ; Pärnu Postimees 23. veeb. 2006, lk. 2 ; Linnaleht Tartu 24. veeb. 2006, lk. 6

  10. Comparison of Dose When Prescribed to Point A and Point H for Brachytherapy in Cervical Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Gang, Ji Hyeong; Gim, Il Hwan; Hwang, Seon Boong; Kim, Woong; Im, Hyeong Seo; Gang, Jin Mook; Gim, Gi Hwan; Lee, Ah Ram [Dept. of Radiation Oncology, Korea Institute of Radiological and Medical Sciences, Seou (Korea, Republic of)

    2012-09-15

    The purpose of this study is to compare plans prescribed to point A with these prescribed to point H recommended by ABS (American Brachytherapy Society) in high dose rate intracavitary brachytherapy for cervical carcinoma. This study selected 103 patients who received HDR (High Dose Rate) brachytherapy using tandem and ovoids from March 2010 to January 2012. Point A, bladder point, and rectal point conform with Manchester System. Point H conforms with ABS recommendation. Also Sigmoid colon point, and vagina point were established arbitrarily. We examined distance between point A and point H. The percent dose at point A was calculated when 100% dose was prescribed to point H. Additionally, the percent dose at each reference points when dose is prescribed to point H and point A were calculated. The relative dose at point A was lower when point H was located inferior to point A. The relative doses at bladder, rectal, sigmoid colon, and vagina points were higher when point H was located superior to point A, and lower when point H was located inferior to point A. This study found out that as point H got located much superior to point A, the absorbed dose of surrounding normal organs became higher, and as point H got located much inferior to point A, the absorbed dose of surrounding normal organs became lower. This differences dose not seem to affect the treatment. However, we suggest this new point is worth being considered for the treatment of HDR if dose distribution and absorbed dose at normal organs have large differences between prescribed to point A and H.

  11. C-point and V-point singularity lattice formation and index sign conversion methods

    Science.gov (United States)

    Kumar Pal, Sushanta; Ruchi; Senthilkumaran, P.

    2017-06-01

    The generic singularities in an ellipse field are C-points namely stars, lemons and monstars in a polarization distribution with C-point indices (-1/2), (+1/2) and (+1/2) respectively. Similar to C-point singularities, there are V-point singularities that occur in a vector field and are characterized by Poincare-Hopf index of integer values. In this paper we show that the superposition of three homogenously polarized beams in different linear states leads to the formation of polarization singularity lattice. Three point sources at the focal plane of the lens are used to create three interfering plane waves. A radial/azimuthal polarization converter (S-wave plate) placed near the focal plane modulates the polarization states of the three beams. The interference pattern is found to host C-points and V-points in a hexagonal lattice. The C-points occur at intensity maxima and V-points occur at intensity minima. Modulating the state of polarization (SOP) of three plane waves from radial to azimuthal does not essentially change the nature of polarization singularity lattice as the Poincare-Hopf index for both radial and azimuthal polarization distributions is (+1). Hence a transformation from a star to a lemon is not trivial, as such a transformation requires not a single SOP change, but a change in whole spatial SOP distribution. Further there is no change in the lattice structure and the C- and V-points appear at locations where they were present earlier. Hence to convert an interlacing star and V-point lattice into an interlacing lemon and V-point lattice, the interferometer requires modification. We show for the first time a method to change the polarity of C-point and V-point indices. This means that lemons can be converted into stars and stars can be converted into lemons. Similarly the positive V-point can be converted to negative V-point and vice versa. The intensity distribution in all these lattices is invariant as the SOPs of the three beams are changed in an

  12. PowerPoint 2010 Bible

    CERN Document Server

    Wempen, Faithe

    2010-01-01

    Master PowerPoint and improve your presentation skills-with one book!. It's no longer enough to have slide after slide of text, bullets, and charts. It's not even enough to have good speaking skills if your PowerPoint slides bore your audience. Get the very most out of all that PowerPoint 2010 has to offer while also learning priceless tips and techniques for making good presentations in this new PowerPoint 2010 Bible. Well-known PowerPoint expert and author Faithe Wempen provides formatting tips; shows you how to work with drawings, tables, and SmartArt; introduces new collaboration tools; wa

  13. [Cocoa (Theobroma cacao L.) hulls: a posible commercial source of pectins].

    Science.gov (United States)

    Barazarte, Humberto; Sangronis, Elba; Unai, Emaldi

    2008-03-01

    Commercial exploitation of cocoa (Theobroma cacao L.) generates a volume of hulls that could be used in the production of pectins on an industrial scale. Therefore, pectins from cocoa hulls were extracted at different pH and temperature conditions, and their main chemical characteristics were evaluated. EDTA at 0.5% was used for the extraction at pHs 3, 4 and 5 and temperatures of 60, 75 and 90 degrees C, under a 3 2 factorial design. The response variables were yield, content of anhydrous galacturonic acid (AGA), content of metoxil, degree of esterification and equivalent weight of the pectins extracted. The strength of the pectic gel was determined with a TA-XT2 texturometer. Strawberry jam was made with the pectin extracted, and its acceptability was determined using a 7-point hedonic scale. The results obtained were as follows: an extraction yield from 2.64 to 4.69 g/100 g; an AGA content between 49.8 and 64.06 g/100 g; a content of metoxil between 4.72 and 7.18 g/100 g; a degree of esterification between 37.94 and 52.20%; an equivalent weight from 385.47 to 464.61 g/equivalent of H+, and a degree of gelation between 28.64 and 806.03 g force. The pectin extracted at pH 4 and 90 degrees C showed a gelation power of 422.16 g force, purity 62.26 g/100 g of AGA, and a yield of extraction of 3.89 g/100 g and allowed to prepare ajam with an average level of liking of "like moderately". Pectins from cocoa hulls show potential application in the food industry, but it is necessary to optimize the extraction parameters to increase its yield.

  14. Euroopa netomaksjad tallavad Lissaboni sihil / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister, 1977-

    2005-01-01

    Kuus EL-i nn. netomaksjat on seisukohal, et EL-i ühiste kulutuste määr ei tohiks ületada 1% SKT-st. Euroopa Komisjon ja Euroopa Parlament aga leiavad, et rahaeraldised peavad olema suuremad, muidu satub ohtu ühiste eesmärkide saavutamine. Graafik: Eelarve järjest kahanenud. Vt. samas: Rohkem Euroopat, aga vähem raha selle jaoks?

  15. Critical points for finite Fibonacci chains of point delta-interactions and orthogonal polynomials

    International Nuclear Information System (INIS)

    De Prunele, E

    2011-01-01

    For a one-dimensional Schroedinger operator with a finite number n of point delta-interactions with a common intensity, the parameters are the intensity, the n - 1 intercenter distances and the mass. Critical points are points in the parameters space of the Hamiltonian where one bound state appears or disappears. The study of critical points for Hamiltonians with point delta-interactions arranged along a Fibonacci chain is shown to be closely related to the study of the so-called Fibonacci operator, a discrete one-dimensional Schroedinger-type operator, which occurs in the context of tight binding Hamiltonians. These critical points are the zeros of orthogonal polynomials previously studied in the context of special diatomic linear chains with elastic nearest-neighbor interaction. Properties of the zeros (location, asymptotic behavior, gaps, ...) are investigated. The perturbation series from the solvable periodic case is determined. The measure which yields orthogonality is investigated numerically from the zeros. It is shown that the transmission coefficient at zero energy can be expressed in terms of the orthogonal polynomials and their associated polynomials. In particular, it is shown that when the number of point delta-interactions is equal to a Fibonacci number minus 1, i.e. when the intervals between point delta-interactions form a palindrome, all the Fibonacci chains at critical points are completely transparent at zero energy. (paper)

  16. Poisson branching point processes

    International Nuclear Information System (INIS)

    Matsuo, K.; Teich, M.C.; Saleh, B.E.A.

    1984-01-01

    We investigate the statistical properties of a special branching point process. The initial process is assumed to be a homogeneous Poisson point process (HPP). The initiating events at each branching stage are carried forward to the following stage. In addition, each initiating event independently contributes a nonstationary Poisson point process (whose rate is a specified function) located at that point. The additional contributions from all points of a given stage constitute a doubly stochastic Poisson point process (DSPP) whose rate is a filtered version of the initiating point process at that stage. The process studied is a generalization of a Poisson branching process in which random time delays are permitted in the generation of events. Particular attention is given to the limit in which the number of branching stages is infinite while the average number of added events per event of the previous stage is infinitesimal. In the special case when the branching is instantaneous this limit of continuous branching corresponds to the well-known Yule--Furry process with an initial Poisson population. The Poisson branching point process provides a useful description for many problems in various scientific disciplines, such as the behavior of electron multipliers, neutron chain reactions, and cosmic ray showers

  17. Laser Dew-Point Hygrometer

    Science.gov (United States)

    Matsumoto, Shigeaki; Toyooka, Satoru

    1995-01-01

    A rough-surface-type automatic dew-point hygrometer was developed using a laser diode and an optical fiber cable. A gold plate with 0.8 µ m average surface roughness was used as a surface for deposition of dew to facilitate dew deposition and prevent supersaturation of water vapor at the dew point. It was shown experimentally that the quantity of dew deposited can be controlled to be constant at any predetermined level, and is independent of the dew point to be measured. The dew points were measured in the range from -15° C to 54° C in which the temperature ranged from 0° C to 60° C. The measurement error of the dew point was ±0.5° C which was equal to below ±2% in relative humidity in the above dew-point range.

  18. Study of relation between the onset age of type 1 diabetes and celiac disease in children andadole scents

    Directory of Open Access Journals (Sweden)

    robabe Ghergherehchi

    2010-02-01

    Full Text Available Celiac disease (CD is a chronic enteropathy caused by hypersensitivity to gluten. Most studies have showed more prevalence of CD in the patients with diabetes mellitus type 1. Both diseases are autoimmune and their incidence is related to inheritance and environmental factors. The aim of this research is the study of relation between CD prevalence and diabetic age onset. Materials and Methods: In this descriptive cross-sectional study, 135 children with diabetes mellitus type 1 referring to Tabriz children hospital endocrine department and clinic between 2006-2008 were selected. After filling individual identity of the patients and the measurement of weight and height, the serumic level of anti-tissue Trans glutaminase IgA antibody (A-tTG-A-IgA, anti endomisial IgA antibody (AEA-IgA and anti-gliadin IgG antibody (AGA-IgG were measured. In the case that A-tTG-A either AEA alone or with AGA was high, small intestinal biopsy was preformed. The data was analysed using SPSS ver 16 software. Results: 28 of 135 patients with diabetes mellitus type 1, were serologically positive for celiac. Confirmed celiac prevalence based on biopsy was 6. 8%. From diabetic age onset and celiac incidence point of view there was not any significant relation (P=0. 996. Conclusion: Celiac disease in type1 diabetic patients dose not have correlation with the onset age of type 1 diabetes and diabetic patients should be followed up from celiac point of view during treatment and prevention.

  19. Learning power point 2000 easily

    Energy Technology Data Exchange (ETDEWEB)

    Mon, In Su; Je, Jung Suk

    2000-05-15

    This book introduces power point 2000, which gives descriptions what power point is, what we can do with power point 2000, is it possible to install power point 2000 in my computer? Let's run power point, basic of power point such as new presentation, writing letter, using text box, changing font size, color and shape, catching power user, insertion of word art and creating of new file. It also deals with figure, chart, graph, making multimedia file, presentation, know-how of power point for teachers and company workers.

  20. From Contrapuntal Music to Polyphonic Novel: Aldous Huxley’s Point Counter Point

    Directory of Open Access Journals (Sweden)

    Mevlüde ZENGİN

    2015-06-01

    Full Text Available Taken at face value Point Counter Point (1928 written by Aldous Huxley seems to be a novel including many stories of various and sundry people and reflecting their points of view about the world in which they live and about the life they have been leading. However, it is this very quality of the novel that provides grounds for the study of the novel as a polyphonic one. The novel presents to its reader an aggregate of strikingly different characters and thus a broad spectrum of contemporary society. The characters in the novel are all characterized by and individualized with easily recognizable physical, intellectual, emotional, psychological and moral qualities. Each of them is well-contrived through their differences in social status, political views, wealth, etc. Thus, many different viewpoints, conflicting voices, contrasting insights and ideas are heard and seen synchronically in Point Counter Point, which makes it polyphonic. Polyphony is a musical motif referring to different notes and chords played at the same time to create a rhythm. It was first adopted by M. M. Bakhtin to analyze F. M. Dostoyevsky’s fiction. The aim of this study is firstly to elucidate, in Bakhtinian thought, polyphony and then dialogism and heteroglossia closely related to his concept of polyphony; and then to put the polyphonic qualities in Point Counter Point forth, studying the novel’s dialogism and heteroglot qualities

  1. Flow area optimization in point to area or area to point flows

    International Nuclear Information System (INIS)

    Ghodoossi, Lotfollah; Egrican, Niluefer

    2003-01-01

    This paper deals with the constructal theory of generation of shape and structure in flow systems connecting one point to a finite size area. The flow direction may be either from the point to the area or the area to the point. The formulation of the problem remains the same if the flow direction is reversed. Two models are used in optimization of the point to area or area to point flow problem: cost minimization and revenue maximization. The cost minimization model enables one to predict the shape of the optimized flow areas, but the geometric sizes of the flow areas are not predictable. That is, as an example, if the area of flow is a rectangle with a fixed area size, optimization of the point to area or area to point flow problem by using the cost minimization model will only predict the height/length ratio of the rectangle not the height and length itself. By using the revenue maximization model in optimization of the flow problems, all optimized geometric aspects of the interested flow areas will be derived as well. The aim of this paper is to optimize the point to area or area to point flow problems in various elemental flow area shapes and various structures of the flow system (various combinations of elemental flow areas) by using the revenue maximization model. The elemental flow area shapes used in this paper are either rectangular or triangular. The forms of the flow area structure, made up of an assembly of optimized elemental flow areas to obtain bigger flow areas, are rectangle-in-rectangle, rectangle-in-triangle, triangle-in-triangle and triangle-in-rectangle. The global maximum revenue, revenue collected per unit flow area and the shape and sizes of each flow area structure have been derived in optimized conditions. The results for each flow area structure have been compared with the results of the other structures to determine the structure that provides better performance. The conclusion is that the rectangle-in-triangle flow area structure

  2. The use of low-level light therapy in the treatment of androgenetic alopecia and female pattern hair loss.

    Science.gov (United States)

    Gupta, Aditya K; Daigle, Deanne

    2014-04-01

    Androgenetic alopecia (AGA) or female pattern hair loss (FPHL) is the most common form of hair loss in men and women. Despite its common occurrence, our understanding of the etiology of AGA and FPHL remains incomplete. As such, traditional therapies demonstrate modest efficacies and new therapies continue to be sought. Low-level light therapy (LLLT) is a relatively new technique used to promote hair growth in both men and women with AGA and FPHL. Currently, there exist several LLLT devices marketed for the treatment of alopecia, which claim to stimulate hair growth; yet marketing these devices only requires that safety, not efficacy, be established. A handful of studies have since investigated the efficacy of LLLT for alopecia with mixed results. These studies suffered from power, confounding and analysis issues which resulted in a high risk of bias in LLLT studies. Due to the paucity of well-conducted randomized controlled trials, the efficacy of LLLT devices remains unclear. Randomized controlled trials of LLLT conducted and reported according to the Consolidated Standards of Reporting Trials (CONSORT) statement would greatly increase the credibility of the evidence and clarify the ambiguity of the effectiveness of LLLT in the treatment of AGA and FPHL.

  3. Use of low-level laser therapy as monotherapy or concomitant therapy for male and female androgenetic alopecia.

    Science.gov (United States)

    Munck, Andréia; Gavazzoni, Maria Fernanda; Trüeb, Ralph M

    2014-04-01

    Androgenetic alopecia (AGA) is the most common form of hair loss in men and in women. Currently, minoxidil and finasteride are the treatments with the highest levels of medical evidence, but patients who exhibit intolerance or poor response to these treatments are in need of additional treatment modalities. The aim was to evaluate the efficacy and safety of low-level laser therapy (LLLT) for AGA, either as monotherapy or as concomitant therapy with minoxidil or finasteride, in an office-based setting. Retrospective observational study of male and female patients with AGA, treated with the 655 nm-HairMax Laser Comb(®), in an office-based setting. Efficacy was assessed with global photographic imaging. Of 32 patients (21 female, 11 male), 8 showed significant, 20 moderate, and 4 no improvement. Improvement was seen both with monotherapy and with concomitant therapy. Improvement was observed as early as 3 months and was sustained up to a maximum observation time of 24 months. No adverse reactions were reported. LLLT represents a potentially effective treatment for both male and female AGA, either as monotherapy or concomitant therapy. Combination treatments with minoxidil, finasteride, and LLLT may act synergistic to enhance hair growth.

  4. Professional SharePoint 2010 Development

    CERN Document Server

    Rizzo, Tom; Fried, Jeff

    2010-01-01

    Learn to leverage the features of the newest version of SharePoint, in this update to the bestseller. More than simply a portal, SharePoint is Microsoft's popular content management solution for building intranets and Web sites or hosting wikis and blogs. Offering broad coverage on all aspects of development for the SharePoint platform, this comprehensive book shows you exactly what SharePoint does, how to build solutions, and what features are accessible within SharePoint. Written by one of the most recognized names in SharePoint development, Professional SharePoint 2010 Development offers an

  5. The Lagrangian Points

    Science.gov (United States)

    Linton, J. Oliver

    2017-01-01

    There are five unique points in a star/planet system where a satellite can be placed whose orbital period is equal to that of the planet. Simple methods for calculating the positions of these points, or at least justifying their existence, are developed.

  6. The End of Points

    Science.gov (United States)

    Feldman, Jo

    2018-01-01

    Have teachers become too dependent on points? This article explores educators' dependency on their points systems, and the ways that points can distract teachers from really analyzing students' capabilities and achievements. Feldman argues that using a more subjective grading system can help illuminate crucial information about students and what…

  7. Multispectral Image Feature Points

    Directory of Open Access Journals (Sweden)

    Cristhian Aguilera

    2012-09-01

    Full Text Available This paper presents a novel feature point descriptor for the multispectral image case: Far-Infrared and Visible Spectrum images. It allows matching interest points on images of the same scene but acquired in different spectral bands. Initially, points of interest are detected on both images through a SIFT-like based scale space representation. Then, these points are characterized using an Edge Oriented Histogram (EOH descriptor. Finally, points of interest from multispectral images are matched by finding nearest couples using the information from the descriptor. The provided experimental results and comparisons with similar methods show both the validity of the proposed approach as well as the improvements it offers with respect to the current state-of-the-art.

  8. Milline on Eesti suhtekorraldusmaastik 2016. aasta alguses? / Kertu Kärk

    Index Scriptorium Estoniae

    Kärk, Kertu

    2016-01-01

    Eesti suhtekorraldusbüroode klientidest, töötajate arvust ja käibest, suhtekorraldusteenuse turuhinnast ning 2016. aasta trendidest PR-maastikul. Vestluses osalesid PR-ettevõtete esindajad Aleksandra Moorast, Heikki Sal-Saller, Ilona Leib, Inge Rumessen, Janek Mäggi, Kristi Jõesaar, Kristi Liiva, Mari-Liis Ahven ja Jaan Vare

  9. Comparison of bone age in small-for-gestationalage children vs appropriate-for-getational-age children

    Directory of Open Access Journals (Sweden)

    Lionardus Edward

    2010-04-01

    Full Text Available BackgroundAbout 10-15% small-for-gestational-age children are in higher risk for having linear growth retardation due to growth hormone-insulin like growth factor 1 axis defect (GH-IGF 1 which causes bone age delay.ObjectivesTo compare bone age in 24-36 month old children born small-for-gestational-age (SGA to that in children born appropriate-for-gestational-age (AGA.MethodsA cross-sectional study was conducted in Hasan Sadikin General Hospital, Bandung, from January to April 2009.Subjects consisted of50 healthy children of 24-36 months old (25 children born at term, SGA, 25 children born at term, AGA. We compared the appropriateness and delay of bone age between the two groups. ResultsMean bone age in the SGA group was 20.8 (SD 7.7 months, and in the AGA group was 25.7 (SD 7.1 months (P=0.022. Mean bone age deficit was -10.5 (6.5 months in the SGA group and -5.5 (SD 5.7 months in the AGA group (P=0.009. The prevalence ratio was 1.77 (95% CI: 1.19–2.62. Bone age delay was found to be higher in children born SGA than that in children of the other group (23 vs 13. On the contrary, appropriate bone age was found more in children born AGA (12 vs 2 (P=0.002.Conclusion Bone age delay in 24-36 months old children born small-for-gestational-age was found to be higher than in those born appropriate-for-gestational-age.

  10. Influences of impurities on iodine removal efficiency of silver alumina adsorbent

    Energy Technology Data Exchange (ETDEWEB)

    Fukasawa, Tetsuo; Funabashi, Kiyomi [Hitachi, Ltd., Ibaraki (Japan); Kondo, Yoshikazu [Hitachi, Ltd., Ibaraki (Japan)

    1997-08-01

    Silver impregnated alumina adsorbent (AgA), which was developed for iodine removal from off-gas of nuclear power and reprocessing plants has been tested laying emphasis on investigation of the influences gaseous impurities have on adsorbent chemical stability and iodine removal efficiency. The influences of the major impurities such as nitrogen oxides and water vapor were checked on the chemical state of impregnated silver compound (AgNO{sub 3}) and decontamination factor (DF) value. At 150{degrees}C, a forced air flow with 1.5% nitrogen oxide (NO/NO{sub 2}=1/1) reduced silver nitrate to metallic silver, whereas pure air and air with 1.5% NO{sub 2} had no effect on the chemical state of silver. Metallic silver showed a lower DF value for methyl iodide in pure air (without impurities) than silver nitrate and the lower DF of metallic silver was improved when impurities were added. At 40{degrees}C, a forced air flow with 1.5% nitrogen dioxide (NO{sub 2}) increased the AgA weight by about 20%, which was caused by the adsorption of nitric acid solution on the AgA surface. AgA with l0wt% silver showed higher weight increase than that with 24wt% silver which had lower porosity. Adsorption of acid solution lowered the DF value, which would be due to the hindrance of contact between methyl iodide and silver. The influences of other gaseous impurities were also investigated and AgA showed superior characteristics at high temperatures. 14 refs., 11 figs.

  11. 1961 / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2007-01-01

    Hollandis või Taanis oli 1961. aastal Teise maailmasõja lõpust möödas 16 aastat, Eestis aga aastal 2007. Eesti ühiskonnas pakitsevatest probleemidest: ühtede jaoks on tähtis otsustada, kummal pool rindejoont Teises maailmasõjas eestlased sõdisid, teistele aga näib möödapääsmatu ja vajalik välja vabandada okupatsiooniaja kaasajooksiklust

  12. "Sa, haavapuu, kesköösel valendad..." : [luuletused] / Paul Celan ; saksa k. tlk. [ja saatesõna]: Ain Kaalep

    Index Scriptorium Estoniae

    Celan, Paul, pseud., 1920-1970

    2001-01-01

    Autorist lk. 49-50. Sisu: "Sa, haavapuu, kesköösel valendad..." ; Mälestus Prantsusmaast ; Aastad sinust minuni ; Surmafuuga ; Aja silm ; Kõnevõre ; Silm, lahtine ; Zürich, "Toonekure" kohvik : Nelly Sachsile ; Psalm ; "Niitpäikesed..." ; "Maovankris, mööda..." ; "Maastik urnidega..." ; Prahas ; "Kõmin: see on..." ; "Üks hambajälg eikuskilpool..." ; "Kahinais, otsekui meie alguses..." ; Teine ; "Teie oma..." ; "See, mis meid..." ; "Lõika palvekäsi..." ; "Ma kuulen, et kirves lõi õitsema..." ; "Leht, mille puu küljest..."

  13. Kas transatlantilised liitlassuhted on tõesti madalseisus? / Tiit Meren

    Index Scriptorium Estoniae

    Meren, Tiit

    2005-01-01

    NATO Reservohvitseride Konföderatsiooni (CIOR) ja Konrad Adenaueri Fondi koostöös 30. jaanuarist kuni 3. veebruarini 2005 Saksamaal Wesselingis korraldatud rahvusvahelisest seminarist "NATO, the European Union and the Global war on terrorism. No go? - Routine? - New beginning?" (NATO, Euroopa Liit ja ülemaailmne sõda terrorismi vastu. Loobumine? - Rutiin? - Uus algus?). Eesti delegatsiooni kuulusid EROK president leitnant Heino Piirsalu ja EROK välistoimkonna esimees Tiit Meren. CIOR-i konverentsist Brüsselis

  14. Tartu Ülikooli füüsikahoone juurdeehitis on ohus / Mirko Ojakivi

    Index Scriptorium Estoniae

    Ojakivi, Mirko

    2009-01-01

    2009. a. novembri alguses valis žürii Tartu Ülikooli füüsikahoone juurdeehitise arhitektuurikonkursi võidutöödena välja tööd "Das Model" (arhitektid Juhan Rohtla, Koit Ojaliiv, Joel Kopli, Indrek Allmann), "Admiral" ja "Lükat" (mõlema töö arhitektid Ott Kadarik ja Villem Tomiste). Tartu linnavalitsus ei saa maavaidluste tõttu aadressile Riia mnt. 142 väljastada ehitusluba ja juurdeehitise asukoht võib muutuda

  15. Quantitative structure-property relationships for prediction of boiling point, vapor pressure, and melting point.

    Science.gov (United States)

    Dearden, John C

    2003-08-01

    Boiling point, vapor pressure, and melting point are important physicochemical properties in the modeling of the distribution and fate of chemicals in the environment. However, such data often are not available, and therefore must be estimated. Over the years, many attempts have been made to calculate boiling points, vapor pressures, and melting points by using quantitative structure-property relationships, and this review examines and discusses the work published in this area, and concentrates particularly on recent studies. A number of software programs are commercially available for the calculation of boiling point, vapor pressure, and melting point, and these have been tested for their predictive ability with a test set of 100 organic chemicals.

  16. A neonatal piglet model for investigating brain and cognitive development in small for gestational age human infants.

    Directory of Open Access Journals (Sweden)

    Emily C Radlowski

    Full Text Available The piglet was investigated as a potential model for studying brain and cognitive deficits associated with being born small for gestational age (SGA. Naturally farrowed SGA (0.7-1.0 kg BW and average for gestational age (AGA, 1.3-1.6 kg BW piglets were obtained on postnatal day (PD 2, placed in individual cages, and provided a nutritionally adequate milk replacer diet (285 ml/kg/d. Beginning at PD14, performance in a spatial T-maze task was assessed. At PD28, piglets were anesthetized for magnetic resonance (MR imaging to assess brain structure (voxel-based morphometry, connectivity (diffusion-tensor imaging and metabolites in the hippocampus and corpus callosum (proton MR spectroscopy. Piglets born SGA showed compensatory growth such that BW of SGA and AGA piglets was similar (P>0.05, by PD15. Birth weight affected maze performance, with SGA piglets taking longer to reach criterion than AGA piglets (p<0.01. Total brain volume of SGA and AGA piglets was similar (P<0.05, but overall, SGA piglets had less gray matter than AGA piglets (p<0.01 and tended to have a smaller internal capsule (p = 0.07. Group comparisons between SGA and AGA piglets defined 9 areas (≥ 20 clusters where SGA piglets had less white matter (p<0.01; 2 areas where SGA piglets had more white matter (p<0.01; and 3 areas where SGA piglets had more gray matter (p<0.01. The impact of being born SGA on white matter was supported by a lower (p<0.04 fractional anisotropy value for SGA piglets, suggesting reduced white matter development and connectivity. None of the metabolites measured were different between groups. Collectively, the results show that SGA piglets have spatial learning deficits and abnormal development of white matter. As learning deficits and abnormalities in white matter are common in SGA human infants, the piglet is a tractable translational model that can be used to investigate SGA-associated cognitive deficits and potential interventions.

  17. Risk of hearing loss in small for gestational age neonates

    Directory of Open Access Journals (Sweden)

    Melani Rakhmi Mantu

    2011-01-01

    Full Text Available Background Small for gestational age (SGA neonates often have intrauterine growth restriction due to placental insufficiency and chronic hypoxia. These conditions may cause developmental impairment, psychosocial disabilities, or metabolic dysfunction in later life. Previous studies have shown greater incidence of speech and language disabilities, learning impairment, and ncuromotor dysfunction in term SGA infants compared to term appropriate for gestational age (AGA infants. Objective To compare hearing loss in SGA and AGA neonates using otoacoustic emission (OAE tests and to study correlations between maternal risk factors and hearing loss in SGA neonates. Methods A cross-sectional study was performed in St. Borromeus Hospital, Limijati Hospital, and Melinda Hospital in Bandung from February to May 2010. Study subjects consisted of full-term neonates born in these three hospitals. A retrospective medical record review was performed for this Study. Statistical analysis was done by multivariable logistic-regression. Results There was a total of 4279 subjects in our study, including 100 SGA neonates and 4179 AGA neonates. We observed a greater percentage of OAE 'refer' (indicating abnormal OAE results in the SGA group compared to the AGA group (P<0.001, Z=1.3.247. For subjects with OAE ,refer' results, we also analyzed the correlation to the following maternal risk factors: smoking, hypertension, diabetes mellitus and asthma. We also found significant differences between those with and without each of the four maternal risk factors studied (P<0.001. By using multivariant analysis to compare SGA and AGA neonates, we found the odds ratio (OR to be 4.34 (95% CI 2.52 to'7.49, P = 0.001, meaning the SGA group had a 4.34 times higher risk of hearing loss than the AGA group. Conclusion SGA neonates had a higher risk of hearing loss than A(3A neonates. In addition, maternal smoking, hypertension, diabetes mellitus and asthma significantly correlated to

  18. Professional SharePoint 2010 Development

    CERN Document Server

    Rizzo, Tom; Fried, Jeff; Swider, Paul J; Hillier, Scot; Schaefer, Kenneth

    2012-01-01

    Updated guidance on how to take advantage of the newest features of SharePoint programmability More than simply a portal, SharePoint is Microsoft's popular content management solution for building intranets and websites or hosting wikis and blogs. Offering broad coverage on all aspects of development for the SharePoint platform, this comprehensive book shows you exactly what SharePoint does, how to build solutions, and what features are accessible within SharePoint. Written by a team of SharePoint experts, this new edition offers an extensive selection of field-tested best practices that shows

  19. SharePoint 2010 For Dummies

    CERN Document Server

    Williams, Vanessa L

    2012-01-01

    Here's the bestselling guide on SharePoint 2010, updated to cover Office 365 SharePoint Portal Server is an essential part of the enterprise infrastructure for many businesses. The Office 365 version includes significantly enhanced cloud capabilities. This second edition of the bestselling guide to SharePoint covers getting a SharePoint site up and running, branded, populated with content, and more. It explains ongoing site management and offers plenty of advice for administrators who want to leverage SharePoint and Office 365 in various ways.Many businesses today rely on SharePoint Portal Ser

  20. Throughput analysis of point-to-multi-point hybric FSO/RF network

    KAUST Repository

    Rakia, Tamer; Gebali, Fayez; Yang, Hong-Chuan; Alouini, Mohamed-Slim

    2017-01-01

    This paper presents and analyzes a point-to-multi-point (P2MP) network that uses a number of free-space optical (FSO) links for data transmission from the central node to the different remote nodes. A common backup radio-frequency (RF) link is used

  1. Pilot points method for conditioning multiple-point statistical facies simulation on flow data

    Science.gov (United States)

    Ma, Wei; Jafarpour, Behnam

    2018-05-01

    We propose a new pilot points method for conditioning discrete multiple-point statistical (MPS) facies simulation on dynamic flow data. While conditioning MPS simulation on static hard data is straightforward, their calibration against nonlinear flow data is nontrivial. The proposed method generates conditional models from a conceptual model of geologic connectivity, known as a training image (TI), by strategically placing and estimating pilot points. To place pilot points, a score map is generated based on three sources of information: (i) the uncertainty in facies distribution, (ii) the model response sensitivity information, and (iii) the observed flow data. Once the pilot points are placed, the facies values at these points are inferred from production data and then are used, along with available hard data at well locations, to simulate a new set of conditional facies realizations. While facies estimation at the pilot points can be performed using different inversion algorithms, in this study the ensemble smoother (ES) is adopted to update permeability maps from production data, which are then used to statistically infer facies types at the pilot point locations. The developed method combines the information in the flow data and the TI by using the former to infer facies values at selected locations away from the wells and the latter to ensure consistent facies structure and connectivity where away from measurement locations. Several numerical experiments are used to evaluate the performance of the developed method and to discuss its important properties.

  2. Digital microwave communication engineering point-to-point microwave systems

    CERN Document Server

    Kizer, George

    2013-01-01

    The first book to cover all engineering aspects of microwave communication path design for the digital age Fixed point-to-point microwave systems provide moderate-capacity digital transmission between well-defined locations. Most popular in situations where fiber optics or satellite communication is impractical, it is commonly used for cellular or PCS site interconnectivity where digital connectivity is needed but not economically available from other sources, and in private networks where reliability is most important. Until now, no book has adequately treated all en

  3. The goal of ape pointing.

    Science.gov (United States)

    Halina, Marta; Liebal, Katja; Tomasello, Michael

    2018-01-01

    Captive great apes regularly use pointing gestures in their interactions with humans. However, the precise function of this gesture is unknown. One possibility is that apes use pointing primarily to direct attention (as in "please look at that"); another is that they point mainly as an action request (such as "can you give that to me?"). We investigated these two possibilities here by examining how the looking behavior of recipients affects pointing in chimpanzees (Pan troglodytes) and bonobos (Pan paniscus). Upon pointing to food, subjects were faced with a recipient who either looked at the indicated object (successful-look) or failed to look at the indicated object (failed-look). We predicted that, if apes point primarily to direct attention, subjects would spend more time pointing in the failed-look condition because the goal of their gesture had not been met. Alternatively, we expected that, if apes point primarily to request an object, subjects would not differ in their pointing behavior between the successful-look and failed-look conditions because these conditions differed only in the looking behavior of the recipient. We found that subjects did differ in their pointing behavior across the successful-look and failed-look conditions, but contrary to our prediction subjects spent more time pointing in the successful-look condition. These results suggest that apes are sensitive to the attentional states of gestural recipients, but their adjustments are aimed at multiple goals. We also found a greater number of individuals with a strong right-hand than left-hand preference for pointing.

  4. Automatic markerless registration of point clouds with semantic-keypoint-based 4-points congruent sets

    Science.gov (United States)

    Ge, Xuming

    2017-08-01

    The coarse registration of point clouds from urban building scenes has become a key topic in applications of terrestrial laser scanning technology. Sampling-based algorithms in the random sample consensus (RANSAC) model have emerged as mainstream solutions to address coarse registration problems. In this paper, we propose a novel combined solution to automatically align two markerless point clouds from building scenes. Firstly, the method segments non-ground points from ground points. Secondly, the proposed method detects feature points from each cross section and then obtains semantic keypoints by connecting feature points with specific rules. Finally, the detected semantic keypoints from two point clouds act as inputs to a modified 4PCS algorithm. Examples are presented and the results compared with those of K-4PCS to demonstrate the main contributions of the proposed method, which are the extension of the original 4PCS to handle heavy datasets and the use of semantic keypoints to improve K-4PCS in relation to registration accuracy and computational efficiency.

  5. Point Cluster Analysis Using a 3D Voronoi Diagram with Applications in Point Cloud Segmentation

    Directory of Open Access Journals (Sweden)

    Shen Ying

    2015-08-01

    Full Text Available Three-dimensional (3D point analysis and visualization is one of the most effective methods of point cluster detection and segmentation in geospatial datasets. However, serious scattering and clotting characteristics interfere with the visual detection of 3D point clusters. To overcome this problem, this study proposes the use of 3D Voronoi diagrams to analyze and visualize 3D points instead of the original data item. The proposed algorithm computes the cluster of 3D points by applying a set of 3D Voronoi cells to describe and quantify 3D points. The decompositions of point cloud of 3D models are guided by the 3D Voronoi cell parameters. The parameter values are mapped from the Voronoi cells to 3D points to show the spatial pattern and relationships; thus, a 3D point cluster pattern can be highlighted and easily recognized. To capture different cluster patterns, continuous progressive clusters and segmentations are tested. The 3D spatial relationship is shown to facilitate cluster detection. Furthermore, the generated segmentations of real 3D data cases are exploited to demonstrate the feasibility of our approach in detecting different spatial clusters for continuous point cloud segmentation.

  6. SharePoint 2010 Field Guide

    CERN Document Server

    Mann, Steven; Gazmuri, Pablo; Caravajal, Steve; Wheeler, Christina

    2012-01-01

    Hands-on solutions for common SharePoint 2010 challenges Aimed at the more than 100 million licensed SharePoint 2010 users, this indispensable field guide addresses an abundance of common SharePoint 2010 problems and offers proven solutions. A team of authors encourages you to customize SharePoint beyond the out-of-the-box functionality so that you can build more complex solutions to these challenges. You?ll discover intricate details and specific full-scale solutions that you can then implement to your own SharePoint 2010 solutions.Tackles a variety of SharePoint 2010 problems ranging from si

  7. Professional SharePoint 2010 Administration

    CERN Document Server

    Klindt, Todd; Caravajal, Steve

    2010-01-01

    Thorough coverage of the improvements and changes to SharePoint 2010. SharePoint 2010 boasts a variety of incredible new features that will challenge even the most experienced administrator who is upgrading from SharePoint 2007. Written by a team of SharePoint experts, this book places a takes aim at showing you how to make these new features work right for you. Offering an in-depth look at SharePoint 2010, the authors focus on how SharePoint functionality has changed from its earliest version to its newest, and they provide you with detailed coverage of all the new features and capabilities.:

  8. Professional SharePoint 2013 administration

    CERN Document Server

    Young, Shane; Klindt, Todd

    2013-01-01

    SharePoint admin author gurus return to prepare you for working with the new features of SharePoint 2013! The new iteration of SharePoint boasts exciting new features. However, any new version also comes with its fair share of challenges and that's where this book comes in. The team of SharePoint admin gurus returns to presents a fully updated resource that prepares you for making all the new SharePoint 2013 features work right. They cover all of the administration components of SharePoint 2013 in detail, and present a clear understanding of how they affect the role of the adminis

  9. I See Your Point: Infants under 12 Months Understand that Pointing Is Communicative

    Science.gov (United States)

    Krehm, Madelaine; Onishi, Kristine H.; Vouloumanos, Athena

    2014-01-01

    Do young infants understand that pointing gestures allow the pointer to change the information state of a recipient? We used a third-party experimental scenario to examine whether 9- and 11-month-olds understand that a pointer's pointing gesture can inform a recipient about a target object. When the pointer pointed to a target, infants…

  10. Birth weight and postnatal growth in preterm born children are associated with cortisol in early infancy, but not at age 8 years.

    Science.gov (United States)

    Ruys, Charlotte A; van der Voorn, Bibian; Lafeber, Harrie N; van de Lagemaat, Monique; Rotteveel, Joost; Finken, Martijn J J

    2017-08-01

    Preterm birth has been associated with altered hypothalamic-pituitary-adrenal (HPA-) axis activity as well as cardiometabolic diseases and neurodevelopmental impairments later in life. We assessed cortisol from term age to age 8 y in children born preterm, to explore the development of HPA-axis activity in association with intrauterine and early-postnatal growth until 6 mo. corrected age. In 152 children born at a gestational age ≤32 wks. and/or with a birth weight ≤1,500g, random serum cortisol was assessed at term age (n=150), 3 mo. (n=145) and 6 mo. corrected age (n=144), and age 8 y (n=59). Salivary cortisol was assessed at age 8 y (n=75): prior to bedtime, at awakening, 15min after awakening, and before lunch. Cortisol was analyzed in association with birth weight-standard deviation score (SDS), being born small for gestational age (SGA), and combinations of intrauterine and postnatal growth: appropriate for gestational age (AGA) with or without growth restriction (AGA GR+ or AGA GR-) at 6 mo. corrected age, and SGA with or without catch-up growth (SGA CUG+ or SGA CUG-) at 6 mo. corrected age. Cross-sectional associations at all time points were analyzed using linear regression, and longitudinal associations were analyzed using generalized estimating equations. Longitudinally, birth weight-SDS was associated with cortisol (β [95%CI]): lower cortisol over time was seen in infants with a birth weight ≤-2 SDS (-50.69 [-94.27; -7.11], p=0.02), infants born SGA (-29.70 [-60.58; 1.19], p=0.06), AGA GR+ infants (-55.10 [-106.02; -4.17], p=0.03) and SGA CUG- infants (-61.91 [-104.73; -19.10], p=0.01). In cross-sectional analyses at age 8 y, no associations were found between either serum or salivary cortisol and birth weight-SDS, SGA-status, or growth from birth to 6 mo. corrected age. In children born preterm, poor intrauterine and postnatal growth were associated with lower cortisol in early infancy, but not at age 8 y. Even though HPA-axis activity no longer

  11. Bubble-point and dew-point equation for binary refrigerant mixture R22-R142b

    Energy Technology Data Exchange (ETDEWEB)

    Liancheng Tan; Zhongyou Zhao; Yonghong Duan (Xi' an Jiaotong Univ., Xi' an (China). Dept. of Power Machinery Engineering)

    1992-01-01

    A bubble-point and dew-point equation (in terms either of temperature or of pressure is suggested for the refrigerant mixture R22-R142b), which is regarded as one of the alternatives to R12. This equation has been examined with experimental data. A modified Rackett equation for the calculation of the bubble-point volume is also proposed. Compared with the experimental data, the rms errors in the calculated values of the bubble-point temperature, the dew-point temperature, and the bubble-point volume are 1.093%, 0.947%, and 1.120%, respectively. The calculation covers a wide range of temperatures and pressures, even near the critical point. It is shown how the equations are extrapolated to calculate other binary refrigerant mixtures. (author)

  12. Imaging study on acupuncture points

    Science.gov (United States)

    Yan, X. H.; Zhang, X. Y.; Liu, C. L.; Dang, R. S.; Ando, M.; Sugiyama, H.; Chen, H. S.; Ding, G. H.

    2009-09-01

    The topographic structures of acupuncture points were investigated by using the synchrotron radiation based Dark Field Image (DFI) method. Four following acupuncture points were studied: Sanyinjiao, Neiguan, Zusanli and Tianshu. We have found that at acupuncture point regions there exists the accumulation of micro-vessels. The images taken in the surrounding tissue out of the acupuncture points do not show such kind of structure. It is the first time to reveal directly the specific structure of acupuncture points by X-ray imaging.

  13. Imaging study on acupuncture points

    International Nuclear Information System (INIS)

    Yan, X H; Zhang, X Y; Liu, C L; Dang, R S; Ando, M; Sugiyama, H; Chen, H S; Ding, G H

    2009-01-01

    The topographic structures of acupuncture points were investigated by using the synchrotron radiation based Dark Field Image (DFI) method. Four following acupuncture points were studied: Sanyinjiao, Neiguan, Zusanli and Tianshu. We have found that at acupuncture point regions there exists the accumulation of micro-vessels. The images taken in the surrounding tissue out of the acupuncture points do not show such kind of structure. It is the first time to reveal directly the specific structure of acupuncture points by X-ray imaging.

  14. Magic Pointing for Eyewear Computers

    DEFF Research Database (Denmark)

    Jalaliniya, Shahram; Mardanbegi, Diako; Pederson, Thomas

    2015-01-01

    In this paper, we propose a combination of head and eye movements for touchlessly controlling the "mouse pointer" on eyewear devices, exploiting the speed of eye pointing and accuracy of head pointing. The method is a wearable computer-targeted variation of the original MAGIC pointing approach...... which combined gaze tracking with a classical mouse device. The result of our experiment shows that the combination of eye and head movements is faster than head pointing for far targets and more accurate than eye pointing....

  15. Effect of saddle-point anisotropy on point-defect drift-diffusion into straight dislocations

    International Nuclear Information System (INIS)

    Skinner, B.C.; Woo, C.H.

    1983-02-01

    Effects on point-defect drift-diffusion in the strain fields of edge or screw dislocations, due to the anisotropy of the point defect in its saddle-point configuration, are investigated. Expressions for sink strength and bias that include the saddle-point shape effect are derived, both in the absence and presence of an externally applied stress. These are found to depend on intrinsic parameters such as the relaxation volume and the saddle-point shape of the point defects, and extrinsic parameters such as temperature and the magnitude and direction of the externally applied stress with respect to the line direction and Burgers vector direction of the dislocation. The theory is applied to fcc copper and bcc iron. It is found that screw dislocations are biased sinks and that the stress-induced bias differential for the edge dislocations depends much more on the line direction than the Burgers vector direction. Comparison with the stress-induced bias differential due to the usual SIPA effect is made. It is found that the present effect causes a bias differential that is more than an order of magnitude larger

  16. Handbook of floating-point arithmetic

    CERN Document Server

    Muller, Jean-Michel; de Dinechin, Florent; Jeannerod, Claude-Pierre; Joldes, Mioara; Lefèvre, Vincent; Melquiond, Guillaume; Revol, Nathalie; Torres, Serge

    2018-01-01

    This handbook is a definitive guide to the effective use of modern floating-point arithmetic, which has considerably evolved, from the frequently inconsistent floating-point number systems of early computing to the recent IEEE 754-2008 standard. Most of computational mathematics depends on floating-point numbers, and understanding their various implementations will allow readers to develop programs specifically tailored for the standard’s technical features. Algorithms for floating-point arithmetic are presented throughout the book and illustrated where possible by example programs which show how these techniques appear in actual coding and design. The volume itself breaks its core topic into four parts: the basic concepts and history of floating-point arithmetic; methods of analyzing floating-point algorithms and optimizing them; implementations of IEEE 754-2008 in hardware and software; and useful extensions to the standard floating-point system, such as interval arithmetic, double- and triple-word arithm...

  17. Indexing Moving Points

    DEFF Research Database (Denmark)

    Agarwal, Pankaj K.; Arge, Lars Allan; Erickson, Jeff

    2003-01-01

    We propose three indexing schemes for storing a set S of N points in the plane, each moving along a linear trajectory, so that any query of the following form can be answered quickly: Given a rectangle R and a real value t, report all K points of S that lie inside R at time t. We first present an...

  18. Inhibition effect of calcium hydroxide point and chlorhexidine point on root canal bacteria of necrosis teeth

    Directory of Open Access Journals (Sweden)

    Andry Leonard Je

    2006-03-01

    Full Text Available Calcium Hydroxide point and Chlorhexidine point are new drugs for eliminating bacteria in the root canal. The points slowly and controly realease Calcium Hydroxide and Chlorhexidine into root canal. The purpose of the study was to determined the effectivity of Calcium hydroxide point (Calcium hydroxide plus point and Chlorhexidine point in eleminating the root canal bacteria of nescrosis teeth. In this study 14 subjects were divided into 2 groups. The first group was treated with Calcium hydroxide point and the second was treated with Chlorhexidine poin. The bacteriological sampling were measured with spectrofotometry. The Paired T Test analysis (before and after showed significant difference between the first and second group. The Independent T Test which analysed the effectivity of both groups had not showed significant difference. Although there was no significant difference in statistical test, the result of second group eliminate more bacteria than the first group. The present finding indicated that the use of Chlorhexidine point was better than Calcium hydroxide point in seven days period. The conclusion is Chlorhexidine point and Calcium hydroxide point as root canal medicament effectively eliminate root canal bacteria of necrosis teeth.

  19. Pro SharePoint 2013 administration

    CERN Document Server

    Garrett, Robert

    2013-01-01

    Pro SharePoint 2013 Administration is a practical guide to SharePoint 2013 for intermediate to advanced SharePoint administrators and power users, covering the out-of-the-box feature set and capabilities of Microsoft's collaboration and business productivity platform. SharePoint 2013 is an incredibly complex product, with many moving parts, new features, best practices, and 'gotchas.' Author Rob Garrett distills SharePoint's portfolio of features, capabilities, and utilities into an in-depth professional guide-with no fluff and copious advice-that is designed from scratch to be the manual Micr

  20. Geodetic Control Points - Multi-State Control Point Database

    Data.gov (United States)

    NSGIC State | GIS Inventory — The Multi-State Control Point Database (MCPD) is a database of geodetic and mapping control covering Idaho and Montana. The control were submitted by registered land...

  1. Prescribing Habits for Androgenic Alopecia Among Dermatologists in Spain in 2017: A Cross-Sectional Study.

    Science.gov (United States)

    Pindado-Ortega, C; Saceda-Corralo, D; Buendía-Castaño, D; Fernández-González, P; Moreno-Arrones, Ó M; Fonda-Pascual, P; Alegre-Sánchez, A; Rodrigues-Barata, A R; Vañó-Galván, S

    2018-04-12

    Topical minoxidil and oral finasteride are the only drugs approved for the treatment of androgenetic alopecia (AGA) in Spain. However, the management of this condition is highly variable because numerous treatments are used off-label. The main aim of this study was to describe the prescribing habits of dermatologists in Spain for male AGA (MAGA) and female AGA (FAGA). Descriptive cross-sectional study using online questionnaires completed by dermatologists working in Spain. The responses of 241 dermatologists were analyzed. The most common treatments prescribed for MAGA were minoxidil (98%), oral finasteride (96%), nutricosmetics (44%), topical finasteride (37%), oral dutasteride (33%), platelet-rich plasma (14%), and low-level laser therapy (8%). For premenopausal FAGA, the most common treatments were topical minoxidil (98%), oral contraceptives (81%), nutricosmetics (72%), cyproterone acetate (58%), oral finasteride (39%), topical finasteride (39%), spironolactone (27%), platelet-rich plasma (20%), oral dutasteride (20%), oral flutamide (18%), and low-level laser therapy (7%). Finally, for postmenopausal FAGA, the most common treatments prescribed were topical minoxidil (98%), oral finasteride (84%), nutricosmetics (68%), topical finasteride (50%), oral dutasteride (35%), platelet-rich plasma (21%), spironolactone (16%), cyproterone acetate (16%), oral flutamide (9%), and low-level laser therapy (9%). A limitation of our study is that we did not analyze novel AGA treatments such as oral minoxidil and dutasteride mesotherapy. The most common treatments prescribed for AGA by dermatologists in Spain are topical minoxidil, oral finasteride, and nutricosmetics for MAGA and postmenopausal FAGA and topical minoxidil, oral contraceptives, and nutricosmetics for premenopausal FAGA. Copyright © 2018 AEDV. Publicado por Elsevier España, S.L.U. All rights reserved.

  2. Prior-knowledge-independent equalization to improve battery uniformity with energy efficiency and time efficiency for lithium-ion battery

    International Nuclear Information System (INIS)

    Zhang, Shumei; Qiang, Jiaxi; Yang, Lin; Zhao, Xiaowei

    2016-01-01

    To improve battery uniformity as well as energy efficiency and time efficiency, a SOC (state of charge)-based equalization by AGA (adaptive genetic algorithm) is proposed on basis of two-stage DC/DC converters. The simulation results indicate that compared with FLC (fuzzy logic controller) equalization, the standard deviation of final SOC is improved by 78.7% while energy efficiency is improved by 6.01% and equalization time is decreased by 20% for AGA equalization of extreme dispersion. Additionally, AGA improves the battery uniformity by 30.77% with shortening equalization time by 16.29% and saving energy loss by 1.51% compared with FLC for equalization of regular dispersion. For further validation, the equalization optimization is verified by experiment based on the data-driven parameter identification method which is used to enhance the real-time capability of AGA. For AGA equalization of extreme dispersion, the standard deviation of final SOC is just 0.41% while equalization time prolongs only 14 min and energy efficiency is decreased by 0.81% compared with simulation results. Moreover, not only the standard deviation of final SOC is just 0.28% but also the energy efficiency is decreased by 0.69% and equalization time prolongs by 10.4 min compared with the simulation results for equalization of regular dispersion. - Highlights: • Issues of over equalization, time consumption and energy loss are addressed. • A SOC-based equalization is proposed based on adaptive genetic algorithm. • The equalization aims to improve battery uniformity, efficiency of energy and time. • Data-driven parameter identification is used to enhance the real-time capability.

  3. Early-Onset Thrombocytopenia in Small-For-Gestational-Age Neonates: A Retrospective Cohort Study.

    Directory of Open Access Journals (Sweden)

    S F Fustolo-Gunnink

    Full Text Available Thrombocytopenia is a common finding in small for gestational age (SGA neonates and is thought to result from a unique pathophysiologic mechanism related to chronic intrauterine hypoxia. Our objective was to estimate the incidence and severity of early-onset thrombocytopenia in SGA neonates, and to identify risk factors for thrombocytopenia. We performed a retrospective cohort study of all consecutive SGA neonates admitted to our ward and a control group of appropriate for gestational age (AGA neonates matched for gestational age at birth. Main outcome measures were incidence and severity of thrombocytopenia, hematological and clinical risk factors for thrombocytopenia, and bleeding. A total of 330 SGA and 330 AGA neonates were included, with a mean gestational age at birth of 32.9 ± 4 weeks. Thrombocytopenia (<150x109/L was found in 53% (176/329 of SGA neonates and 20% (66/330 of AGA neonates (relative risk (RR 2.7, 95% confidence interval (CI [2.1, 3.4]. Severe thrombocytopenia (21-50x109/L occurred in 25 neonates (8% in the SGA and 2 neonates (1% in the AGA group (RR 12.5, 95% CI [3.0, 52.5]. Platelet counts <20x109/L were not recorded. Within the SGA group, lower gestational age at birth (p = <0.01 and erythroblastosis (p<0.01 were independently associated with a decrease in platelet count. Platelet count was positively correlated with birth weight centiles. In conclusion, early-onset thrombocytopenia is present in over 50% of SGA neonates and occurs 2.7 times as often as in AGA neonates. Thrombocytopenia is seldom severe and is independently associated with lower gestational age at birth and erythroblastosis.

  4. The coeliac iceberg in Italy. A multicentre antigliadin antibodies screening for coeliac disease in school-age subjects.

    Science.gov (United States)

    Catassi, C; Fabiani, E; Rätsch, I M; Coppa, G V; Giorgi, P L; Pierdomenico, R; Alessandrini, S; Iwanejko, G; Domenici, R; Mei, E; Miano, A; Marani, M; Bottaro, G; Spina, M; Dotti, M; Montanelli, A; Barbato, M; Viola, F; Lazzari, R; Vallini, M; Guariso, G; Plebani, M; Cataldo, F; Traverso, G; Ventura, A

    1996-05-01

    Recent studies suggest that coeliac disease (CD) is one of the commonest, life-long disorders in Italy. The aims of this multicentre work were: (a) to establish the prevalence of CD on a nationwide basis; and (b) to characterize the CD clinical spectrum in Italy. Fifteen centres screened 17,201 students aged 6-15 years (68.6% of the eligible population) by the combined determination of serum IgG- and IgA-antigliadin antibody (AGA) test; 1289 (7.5%) were IgG and/or IgA-AGA positive and were recalled for the second-level investigation; 111 of them met the criteria for the intestinal biopsy: IgA-AGA positivity and/or AEA positivity or IgG-AGA positivity plus serum IgA deficiency. Intestinal biopsy was performed on 98 of the 111 subjects. CD was diagnosed in 82 subjects (75 biopsy proven, 7 not biopsied but with associated AGA and AEA positivity). Most of the screening-detected coeliac patients showed low-grade intensity illness often associated with decreased psychophysical well-being. There were two AEA negative cases with associated CD and IgA deficiency. The prevalence of undiagnosed CD was 4.77 x 1000 (95% CI 3.79-5.91), 1 in 210 subjects. The overall prevalence of CD, including known CD cases, was 5.44 x 1000 (95% CI 4.57-6.44), 1 in 184 subjects. The ratio of known to undiagnosed CD cases was 1 in 7. These findings confirm that, in Italy, CD is one of the most common chronic disorders showing a wide and heterogeneous clinical spectrum. Most CD cases remain undiagnosed unless actively searched.

  5. Puitu tahutud mõte : keskaegsed raepingid = Ideas Carved in Wood : Medieval Magistrates' Benches / Merike Koppel

    Index Scriptorium Estoniae

    Koppel, Merike

    2004-01-01

    Säilinud on ühe raepingi nikerdatud seljatugi ja käetugede otsalauad (14. saj. 2. pool), teise raepingi Simsoni võitlust lõviga ning Tristani ja Isolde armastuslugu kujutavad külgleenid (14. saj.), kolmanda pingi reljeefidega pingiküljed (Taaveti võitlus Koljatiga, karu ja lõvi ning Simson ja Delila, Aristoteles ja Phyllis) ja kaunistatud seljatugi (15. saj. algus) ning pingi juures olnud puuskulptuurid "Veronika rätt" (15. saj. keskpaik) ja Ristija Johannese pea (1460-ndad)

  6. Põhja-Ameerika Eesti Päevad kui eestlaste esimene suurkogunemine / Kaire Tensuda

    Index Scriptorium Estoniae

    Tensuda, Kaire

    2007-01-01

    tagasivaade Robert Kreemi raamatu "Uus algus" ning Mai Kreemi mälestuste ja materjalide põhjal ESTOde eelkäijale, esimesele eestlaste suurüritusele Ameerika mandril - I Põhja-Ameerika Eesti Päevadele, mis toimusid 30. maist 2. juunini 1957. a. Torontos ja millest tänavu möödus 50. aastat. Robert Kreemi tegevusest ürituse peakomitee esimehe ja suurorganiseerijana. Ülevaade ka II, III, IV Põhja-Ameerika Eesti Päevadest ja Rootsi Eesti Päevadest 1968. a.

  7. Erikontingendi filtreerimine ja töölerakendamine Eesti NSV-s kontroll-filterlaager nr. 0316 näitel / Peeter Kaasik

    Index Scriptorium Estoniae

    Kaasik, Peeter, 1974-

    2010-01-01

    1945. aasta alguses paigutati Paldiski lähedale Põllkülasse NKVD erilaager. Laager allus NSV Liidu NKVD kontroll-filterlaagrite osakonnale. Erikontingendi mõistest. Kontroll-filterlaagri nr. 0316 rajamisest ja struktuurist. Laagri Smerši osakonna tegevusest. Kontroll-laager nr. 0316 oli mõneti erandlik, sealt ei saadetud isikuid üldjuhul Eestist välja. Balti riikide kodanikest erikontingendi küsimus jäi täpselt määratlemata, NSV Liidu kui oma kodumaa reeturiteks ei saanud neid nimetada

  8. Molecular cloning, characterization and enzymatic properties of a novel βeta-agarase from a marine isolate Psudoalteromonas sp. AG52

    Directory of Open Access Journals (Sweden)

    Chulhong Oh

    2010-12-01

    Full Text Available An agar-degrading Pseudoalteromonas sp. AG52 bacterial strain was identified from the red seaweed Gelidium amansii collected from Jeju Island, Korea. A β-agarase gene which has 96.8% nucleotide identity to Aeromonas β-agarase was cloned from this strain, and was designated as agaA. The coding region is 870 bp, encoding 290 amino acids and possesses characteristic features of the glycoside hydrolase family (GHF-16. The predicted molecular mass of the mature protein was 32 kDa. The recombinant β-agarase (rAgaA was overexpressed in Escherichia coli and purified as a fusion protein. The optimal temperature and pH for activity were 55 ºC and 5.5, respectively. The enzyme had a specific activity of 105.1 and 79.5 unit/mg toward agar and agarose, respectively. The pattern of agar hydrolysis demonstrated that the enzyme is an endo-type β-agarase, producing neoagarohexaose and neoagarotetraose as the final main products. Since, Pseudoalteromonas sp. AG52 encodes an agaA gene, which has greater identity to Aeromonas β-agarase, the enzyme could be considered as novel, with its unique bio chemical characteristics. Altogether, the purified rAgaA has potential for use in industrial applications such as development of cosmetics and pharmaceuticals.

  9. Molecular cloning, characterization and enzymatic properties of a novel βeta-agarase from a marine isolate Psudoalteromonas SP. AG52

    Science.gov (United States)

    Oh, Chulhong; Nikapitiya, Chamilani; Lee, Youngdeuk; Whang, Ilson; Kang, Do-Hyung; Heo, Soo-Jin; Choi, Young-Ung; Lee, Jehee

    2010-01-01

    An agar-degrading Pseudoalteromonas sp. AG52 bacterial strain was identified from the red seaweed Gelidium amansii collected from Jeju Island, Korea. A β-agarase gene which has 96.8% nucleotide identity to Aeromonas β-agarase was cloned from this strain, and was designated as agaA. The coding region is 870 bp, encoding 290 amino acids and possesses characteristic features of the glycoside hydrolase family (GHF)-16. The predicted molecular mass of the mature protein was 32 kDa. The recombinant β-agarase (rAgaA) was overexpressed in Escherichia coli and purified as a fusion protein. The optimal temperature and pH for activity were 55 °C and 5.5, respectively. The enzyme had a specific activity of 105.1 and 79.5 unit/mg toward agar and agarose, respectively. The pattern of agar hydrolysis demonstrated that the enzyme is an endo-type β-agarase, producing neoagarohexaose and neoagarotetraose as the final main products. Since, Pseudoalteromonas sp. AG52 encodes an agaA gene, which has greater identity to Aeromonas β-agarase, the enzyme could be considered as novel, with its unique bio chemical characteristics. Altogether, the purified rAgaA has potential for use in industrial applications such as development of cosmetics and pharmaceuticals. PMID:24031567

  10. Study group 8.2 ''occupational health and safety in the gas industry''; Groupe d'etude 8.2 ''la sante et la securite au travail dans l'industrie du gaz''

    Energy Technology Data Exchange (ETDEWEB)

    Veenstra, T

    2000-07-01

    This report details the work undertaken on occupational health and safety in the natural gas industry by Study Group 9.2 in the triennium 1997-2000. The objectives of the study were to gather data on accidents and occupational ill health among workers in the natural gas industry, to analyse the results and draw conclusions. Questionnaires were used to gather data and 79 countries worldwide responded. We also obtained aggregated information on 96 companies from the American Gas Association (AGA). Data was collected for the period 1990-1997 so that, where possible, trends could be identified. A comparison of data received in response to our questionnaires with that provided by the AGA tended to show better safety performance among AGA companies. Our analysis shows an overall frequency rate (lost time accidents per million working hours) of 9.85 for IGU companies and 7.10 for AGA companies. The trend for IGU companies over the eight years studied shows a downward trend in most cases. Production and transmission companies experienced a 50% reduction in frequency rate. We recognize the limitations of our study and the need for more accurate and consistent data before meaningful trend analysis and conclusions can be made. (author)

  11. Reduced genetic influence on childhood obesity in small for gestational age children

    Directory of Open Access Journals (Sweden)

    Han Dug Yeo

    2013-01-01

    Full Text Available Abstract Background Children born small-for-gestational-age (SGA are at increased risk of developing obesity and metabolic diseases later in life, a risk which is magnified if followed by accelerated postnatal growth. We investigated whether common gene variants associated with adult obesity were associated with increased postnatal growth, as measured by BMI z-score, in children born SGA and appropriate for gestational age (AGA in the Auckland Birthweight Collaborative. Methods A total of 37 candidate SNPs were genotyped on 547 European children (228 SGA and 319 AGA. Repeated measures of BMI (z-score were used for assessing obesity status, and results were corrected for multiple testing using the false discovery rate. Results SGA children had a lower BMI z-score than non-SGA children at assessment age 3.5, 7 and 11 years. We confirmed 27 variants within 14 obesity risk genes to be individually associated with increasing early childhood BMI, predominantly in those born AGA. Conclusions Genetic risk variants are less important in influencing early childhood BMI in those born SGA than in those born AGA, suggesting that non-genetic or environmental factors may be more important in influencing childhood BMI in those born SGA.

  12. Foetal growth restriction is associated with poor reading and spelling skills at eight years to 10 years of age.

    Science.gov (United States)

    Partanen, Lea; Korkalainen, Noora; Mäkikallio, Kaarin; Olsén, Päivi; Laukkanen-Nevala, Päivi; Yliherva, Anneli

    2018-01-01

    Foetal growth restriction (FGR) is associated with communication problems, which might lead to poor literacy skills. The reading and spelling skills of eight- to 10-year-old FGR children born at 24-40 gestational weeks were compared with those of their gestational age-matched, appropriately grown (AGA) peers. A prospectively collected cohort of 37 FGR and 31 AGA children was recruited prenatally at a Finnish tertiary care centre during 1998-2001. The children's reading and spelling skills were assessed using standardised tests for Finnish-speaking second and third graders. Significantly more children performed below the 10th percentile normal values for reading and spelling skills in the FGR group than in the AGA group. At nine years of age, the FGR children had significantly poorer performance in word reading skills and reading fluency, reading accuracy and reading comprehension than the AGA controls. No between-group differences were detected at eight years of age. FGR is associated with poor performance in reading and spelling skills. A third of the FGR children performed below the 10th percentile normal values at nine years of age. These results indicate a need to continuously evaluate linguistic and literacy skills as FGR children age to ensure optimal support. ©2017 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  13. Study group 8.2 ''occupational health and safety in the gas industry''; Groupe d'etude 8.2 ''la sante et la securite au travail dans l'industrie du gaz''

    Energy Technology Data Exchange (ETDEWEB)

    Veenstra, T.

    2000-07-01

    This report details the work undertaken on occupational health and safety in the natural gas industry by Study Group 9.2 in the triennium 1997-2000. The objectives of the study were to gather data on accidents and occupational ill health among workers in the natural gas industry, to analyse the results and draw conclusions. Questionnaires were used to gather data and 79 countries worldwide responded. We also obtained aggregated information on 96 companies from the American Gas Association (AGA). Data was collected for the period 1990-1997 so that, where possible, trends could be identified. A comparison of data received in response to our questionnaires with that provided by the AGA tended to show better safety performance among AGA companies. Our analysis shows an overall frequency rate (lost time accidents per million working hours) of 9.85 for IGU companies and 7.10 for AGA companies. The trend for IGU companies over the eight years studied shows a downward trend in most cases. Production and transmission companies experienced a 50% reduction in frequency rate. We recognize the limitations of our study and the need for more accurate and consistent data before meaningful trend analysis and conclusions can be made. (author)

  14. Modelling point patterns with linear structures

    DEFF Research Database (Denmark)

    Møller, Jesper; Rasmussen, Jakob Gulddahl

    2009-01-01

    processes whose realizations contain such linear structures. Such a point process is constructed sequentially by placing one point at a time. The points are placed in such a way that new points are often placed close to previously placed points, and the points form roughly line shaped structures. We...... consider simulations of this model and compare with real data....

  15. Modelling point patterns with linear structures

    DEFF Research Database (Denmark)

    Møller, Jesper; Rasmussen, Jakob Gulddahl

    processes whose realizations contain such linear structures. Such a point process is constructed sequentially by placing one point at a time. The points are placed in such a way that new points are often placed close to previously placed points, and the points form roughly line shaped structures. We...... consider simulations of this model and compare with real data....

  16. [Drug treatment of alopecia].

    Science.gov (United States)

    Wolff, H

    2015-10-01

    Alopecia is the term used to describe hairless areas of the scalp. They can follow a specific pattern, be diffuse or circumscript. Androgenetic alopecia (AGA) follows a pattern: in men thinning of temples and vertex up to total baldness; in women thinning of the midline or parietal area. Lack of iron or cytostatic drugs cause diffuse alopecia, while in autoimmune diseases such as alopecia areata or lichen planus bizarre shapes of hairless areas are observed. For therapy, the following medications are used: topical minoxidil solution for AGA of men and women; systemic finasteride 1 mg for men with AGA; topical diphencyprone immunotherapy for alopecia areata; systemic antimycotic agents for tinea capitis; antibiotics such as clindamycin and rifampicin for folliculitis decalvans; systemic corticosteroids and isotretinoin for folliculitis et perifolliculitis capitis abscedens et suffodiens; topical corticosteroids for lichen planus and Kossard's frontal fibrosing alopecia.

  17. Decision analysis for the selection of tank waste retrieval technology

    International Nuclear Information System (INIS)

    DAVIS, FREDDIE J.; DEWEESE, GREGORY C.; PICKETT, WILLIAM W.

    2000-01-01

    The objective of this report is to supplement the C-104 Alternatives Generation and Analysis (AGA) by providing a decision analysis for the alternative technologies described therein. The decision analysis used the Multi-Attribute Utility Analysis (MUA) technique. To the extent possible information will come from the AGA. Where data are not available, elicitation of expert opinion or engineering judgment is used and reviewed by the authors of the AGA. A key element of this particular analysis is the consideration of varying perspectives of parties interested in or affected by the decision. The six alternatives discussed are: sluicing; sluicing with vehicle mounted transfer pump; borehole mining; vehicle with attached sluicing nozzle and pump; articulated arm with attached sluicing nozzle; and mechanical dry retrieval. These are evaluated using four attributes, namely: schedule, cost, environmental impact, and safety

  18. Beginning SharePoint Designer 2010

    CERN Document Server

    Windischman, Woodrow W; Rehmani, Asif

    2010-01-01

    Teaching Web designers, developers, and IT professionals how to use the new version of SharePoint Designer. Covering both the design and business applications of SharePoint Designer, this complete Wrox guide brings readers thoroughly up to speed on how to use SharePoint Designer in an enterprise. You'll learn to create and modify web pages, use CSS editing tools to modify themes, use Data View to create interactivity with SharePoint and other data, and much more. Coverage includes integration points with Visual Studio, Visio, and InfoPath.: Shows web designers, developers, and IT professionals

  19. SharePoint 2013 for dummies

    CERN Document Server

    Withee, Ken

    2013-01-01

    The bestselling guide on running SharePoint, now updated to cover all the new features of SharePoint 2013 SharePoint Portal Server is an essential part of the enterprise infrastructure for many businesses. Building on the success of previous versions of SharePoint For Dummies, this new edition covers all the latest features of SharePoint 2013 and provides you with an easy-to-understand resource for making the most of all that this version has to offer. You'll learn how to get a site up and running, branded, and populated with content, workflow, and management. In addition, t

  20. Pro SharePoint 2010 Search

    CERN Document Server

    Noble, J; Bakman-Mikalski, Dan

    2011-01-01

    Pro SharePoint 2010 Search gives you expert advice on planning, deploying and customizing searches in SharePoint 2010. Drawing on the authors' extensive experience of working with real-world SharePoint deployments, this book teaches everything you'll need to know to create well-designed SharePoint solutions that always keep the end-user's experience in mind. Increase your search efficiency with SharePoint 2010's search functionality: extend the search user interface using third-party tools, and utilize analytics to improve relevancy. This practical hands-on book is a must-have resource for any

  1. Evaluation of Perifollicular Inflammation of Donor Area during Hair Transplantation in Androgenetic Alopecia and its Comparison with Controls

    OpenAIRE

    Nirmal, Balakrishnan; Somiah, Savitha; Sacchidanand, Sarvajnamurthy A; Biligi, Dayananda S; Palo, Seetu

    2013-01-01

    Background: Mild perifollicular inflammation is seen in both androgenetic alopecia (AGA) cases and normal controls, whereas moderate or dense inflammation with concentric layers of collagen, is seen in AGA cases but only in very few normal controls, and may lessen the response to topical minoxidil. Moderate or dense lymphocytic inflammation and perifollicular fibrosis have poor hair growth following transplantation. Aim: The purpose of the study is to evaluate the perifollicular lymphocytic i...

  2. On Motion Planning for Point-to-Point Maneuvers for a Class of Sailing Vehicles

    DEFF Research Database (Denmark)

    Xiao, Lin; Jouffroy, Jerome

    2011-01-01

    Despite their interesting dynamic and controllability properties, sailing vehicles have not been much studied in the control community. In this paper, we investigate motion planning of such vehicles. Starting from a simple dynamic model of sailing vessels in one dimension, this paper first...... considers their associated controllability issues, with the so-called no-sailing zone as a starting point, and it links them with a motion planning strategy using two-point boundary value problems as the main mathematical tool. This perspective is then expanded to do point-to-point maneuvers of sailing...

  3. Making Sense of Boiling Points and Melting Points

    Indian Academy of Sciences (India)

    GENERAL | ARTICLE. The boiling and melting points of a pure substance are char- ... bonds, which involves high energy and hence high temperatures. Among the .... with zero intermolecular force at all temperatures and pressures, which ...

  4. Hiilgav, aga... vol.2 / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Action" (1999), "Now and Again" (1999), "Firefly" (2002), "Freaks and Geeks" (1999), "Undeclared" (2001)

  5. Mazda6 - moodne, aga kisub riidu / Taivo Paju

    Index Scriptorium Estoniae

    Paju, Taivo, 1968-

    2003-01-01

    Suur osa Mazda6 edus on kindlasti reklaamiagentuuri Rapp Collins turunduskampaanial, leiab autor. Artikli aluseks on Rapp Collins Eesti tegevdirektori Anu Brümmeli ettekanne turunduskonverentsil Password 2003.

  6. Octopuses use a human-like strategy to control precise point-to-point arm movements.

    Science.gov (United States)

    Sumbre, Germán; Fiorito, Graziano; Flash, Tamar; Hochner, Binyamin

    2006-04-18

    One of the key problems in motor control is mastering or reducing the number of degrees of freedom (DOFs) through coordination. This problem is especially prominent with hyper-redundant limbs such as the extremely flexible arm of the octopus. Several strategies for simplifying these control problems have been suggested for human point-to-point arm movements. Despite the evolutionary gap and morphological differences, humans and octopuses evolved similar strategies when fetching food to the mouth. To achieve this precise point-to-point-task, octopus arms generate a quasi-articulated structure based on three dynamic joints. A rotational movement around these joints brings the object to the mouth . Here, we describe a peripheral neural mechanism-two waves of muscle activation propagate toward each other, and their collision point sets the medial-joint location. This is a remarkably simple mechanism for adjusting the length of the segments according to where the object is grasped. Furthermore, similar to certain human arm movements, kinematic invariants were observed at the joint level rather than at the end-effector level, suggesting intrinsic control coordination. The evolutionary convergence to similar geometrical and kinematic features suggests that a kinematically constrained articulated limb controlled at the level of joint space is the optimal solution for precise point-to-point movements.

  7. A MARKED POINT PROCESS MODEL FOR VEHICLE DETECTION IN AERIAL LIDAR POINT CLOUDS

    Directory of Open Access Journals (Sweden)

    A. Börcs

    2012-07-01

    Full Text Available In this paper we present an automated method for vehicle detection in LiDAR point clouds of crowded urban areas collected from an aerial platform. We assume that the input cloud is unordered, but it contains additional intensity and return number information which are jointly exploited by the proposed solution. Firstly, the 3-D point set is segmented into ground, vehicle, building roof, vegetation and clutter classes. Then the points with the corresponding class labels and intensity values are projected to the ground plane, where the optimal vehicle configuration is described by a Marked Point Process (MPP model of 2-D rectangles. Finally, the Multiple Birth and Death algorithm is utilized to find the configuration with the highest confidence.

  8. Recent progress in fission at saddle point and scission point

    International Nuclear Information System (INIS)

    Blons, J.; Paya, D.; Signarbieux, C.

    High resolution measurements of 230 Th and 232 Th fission cross sections for neutrons exhibit a fine structure. Such a structure is interpreted as a superposition of two rotational bands in the third, asymmetric, well of the fission barrier. The fragment mass distribution in the thermal fission of 235 U and 233 U does not show any even-odd effect, even at the highest kinetic energies. This is the mark of a strong viscosity in the descent from saddle point to scission point [fr

  9. The algorithm to generate color point-cloud with the registration between panoramic image and laser point-cloud

    International Nuclear Information System (INIS)

    Zeng, Fanyang; Zhong, Ruofei

    2014-01-01

    Laser point cloud contains only intensity information and it is necessary for visual interpretation to obtain color information from other sensor. Cameras can provide texture, color, and other information of the corresponding object. Points with color information of corresponding pixels in digital images can be used to generate color point-cloud and is conducive to the visualization, classification and modeling of point-cloud. Different types of digital cameras are used in different Mobile Measurement Systems (MMS).the principles and processes for generating color point-cloud in different systems are not the same. The most prominent feature of the panoramic images is the field of 360 degrees view angle in the horizontal direction, to obtain the image information around the camera as much as possible. In this paper, we introduce a method to generate color point-cloud with panoramic image and laser point-cloud, and deduce the equation of the correspondence between points in panoramic images and laser point-clouds. The fusion of panoramic image and laser point-cloud is according to the collinear principle of three points (the center of the omnidirectional multi-camera system, the image point on the sphere, the object point). The experimental results show that the proposed algorithm and formulae in this paper are correct

  10. Publication point indicators

    DEFF Research Database (Denmark)

    Elleby, Anita; Ingwersen, Peter

    2010-01-01

    The paper presents comparative analyses of two publication point systems, The Norwegian and the in-house system from the interdiscplinary Danish Institute for International Studies (DIIS), used as case in the study for publications published 2006, and compares central citation-based indicators...... with novel publication point indicators (PPIs) that are formalized and exemplified. Two diachronic citation windows are applied: 2006-07 and 2006-08. Web of Science (WoS) as well as Google Scholar (GS) are applied to observe the cite delay and citedness for the different document types published by DIIS...... for all document types. Statistical significant correlations were only found between WoS and GS and the two publication point systems in between, respectively. The study demonstrates how the nCPPI can be applied to institutions as evaluation tools supplementary to JCI in various combinations...

  11. Do acupuncture points exist?

    International Nuclear Information System (INIS)

    Yan Xiaohui; Zhang Xinyi; Liu Chenglin; Dang, Ruishan; Huang Yuying; He Wei; Ding Guanghong

    2009-01-01

    We used synchrotron x-ray fluorescence analysis to probe the distribution of four chemical elements in and around acupuncture points, two located in the forearm and two in the lower leg. Three of the four acupuncture points showed significantly elevated concentrations of elements Ca, Fe, Cu and Zn in relation to levels in the surrounding tissue, with similar elevation ratios for Cu and Fe. The mapped distribution of these elements implies that each acupuncture point seems to be elliptical with the long axis along the meridian. (note)

  12. Do acupuncture points exist?

    Energy Technology Data Exchange (ETDEWEB)

    Yan Xiaohui; Zhang Xinyi [Department of Physics, Surface Physics Laboratory (State Key Laboratory), and Synchrotron Radiation Research Center of Fudan University, Shanghai 200433 (China); Liu Chenglin [Physics Department of Yancheng Teachers' College, Yancheng 224002 (China); Dang, Ruishan [Second Military Medical University, Shanghai 200433 (China); Huang Yuying; He Wei [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100039 (China); Ding Guanghong [Shanghai Research Center of Acupuncture and Meridian, Pudong, Shanghai 201203 (China)

    2009-05-07

    We used synchrotron x-ray fluorescence analysis to probe the distribution of four chemical elements in and around acupuncture points, two located in the forearm and two in the lower leg. Three of the four acupuncture points showed significantly elevated concentrations of elements Ca, Fe, Cu and Zn in relation to levels in the surrounding tissue, with similar elevation ratios for Cu and Fe. The mapped distribution of these elements implies that each acupuncture point seems to be elliptical with the long axis along the meridian. (note)

  13. Tipping Point

    Science.gov (United States)

    ... Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash ...

  14. Non-adaptive and adaptive hybrid approaches for enhancing water quality management

    Science.gov (United States)

    Kalwij, Ineke M.; Peralta, Richard C.

    2008-09-01

    SummaryUsing optimization to help solve groundwater management problems cost-effectively is becoming increasingly important. Hybrid optimization approaches, that combine two or more optimization algorithms, will become valuable and common tools for addressing complex nonlinear hydrologic problems. Hybrid heuristic optimizers have capabilities far beyond those of a simple genetic algorithm (SGA), and are continuously improving. SGAs having only parent selection, crossover, and mutation are inefficient and rarely used for optimizing contaminant transport management. Even an advanced genetic algorithm (AGA) that includes elitism (to emphasize using the best strategies as parents) and healing (to help assure optimal strategy feasibility) is undesirably inefficient. Much more efficient than an AGA is the presented hybrid (AGCT), which adds comprehensive tabu search (TS) features to an AGA. TS mechanisms (TS probability, tabu list size, search coarseness and solution space size, and a TS threshold value) force the optimizer to search portions of the solution space that yield superior pumping strategies, and to avoid reproducing similar or inferior strategies. An AGCT characteristic is that TS control parameters are unchanging during optimization. However, TS parameter values that are ideal for optimization commencement can be undesirable when nearing assumed global optimality. The second presented hybrid, termed global converger (GC), is significantly better than the AGCT. GC includes AGCT plus feedback-driven auto-adaptive control that dynamically changes TS parameters during run-time. Before comparing AGCT and GC, we empirically derived scaled dimensionless TS control parameter guidelines by evaluating 50 sets of parameter values for a hypothetical optimization problem. For the hypothetical area, AGCT optimized both well locations and pumping rates. The parameters are useful starting values because using trial-and-error to identify an ideal combination of control

  15. Pseudo-dynamic source modelling with 1-point and 2-point statistics of earthquake source parameters

    KAUST Repository

    Song, S. G.; Dalguer, L. A.; Mai, Paul Martin

    2013-01-01

    statistical framework that governs the finite-fault rupture process with 1-point and 2-point statistics of source parameters in order to quantify the variability of finite source models for future scenario events. We test this method by extracting 1-point

  16. PowerPoint 2013 bible

    CERN Document Server

    Wempen, Faithe

    2013-01-01

    Master PowerPoint and improve your presentation skills with one book! In today's business climate, you need to know PowerPoint inside and out, and that's not all. You also need to be able to make a presentation that makes an impact. From using sophisticated transitions and animation in your PowerPoint presentations to interfacing in person with your audience, this information-packed book helps you succeed. Start creating professional-quality slides that captivate audiences and discover essential tips and techniques for making first-rate presentations, whether you're at a podium or

  17. December 2002 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data (latitude and longitude) from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs)...

  18. April 2004 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data (Geodetic Coordinates) from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs) from...

  19. March 2003 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data (Geodetic Coordinates) from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs) from...

  20. Computing bubble-points of CO

    NARCIS (Netherlands)

    Ramdin, M.; Balaji, S.P.; Vicent Luna, J.M.; Torres-Knoop, A; Chen, Q.; Dubbeldam, D.; Calero, S; de Loos, T.W.; Vlugt, T.J.H.

    2016-01-01

    Computing bubble-points of multicomponent mixtures using Monte Carlo simulations is a non-trivial task. A new method is used to compute gas compositions from a known temperature, bubble-point pressure, and liquid composition. Monte Carlo simulations are used to calculate the bubble-points of

  1. Magnonic triply-degenerate nodal points

    Science.gov (United States)

    Owerre, S. A.

    2017-12-01

    We generalize the concept of triply-degenerate nodal points to non-collinear antiferromagnets. Here, we introduce this concept to insulating quantum antiferromagnets on the decorated honeycomb lattice, with spin-1 bosonic quasiparticle excitations known as magnons. We demonstrate the existence of magnonic surface states with constant energy contours that form pairs of magnonic arcs connecting the surface projection of the magnonic triple nodal points. The quasiparticle excitations near the triple nodal points represent three-component bosons beyond that of magnonic Dirac, Weyl, and nodal-line cases. They can be regarded as a direct reflection of the intrinsic spin carried by magnons. Furthermore, we show that the magnonic triple nodal points can split into magnonic Weyl points, as the system transits from a non-collinear spin structure to a non-coplanar one with a non-zero scalar spin chirality. Our results not only apply to insulating antiferromagnets, but also provide a platform to seek for triple nodal points in metallic antiferromagnets.

  2. Fermat's point from five perspectives

    Science.gov (United States)

    Park, Jungeun; Flores, Alfinio

    2015-04-01

    The Fermat point of a triangle is the point such that minimizes the sum of the distances from that point to the three vertices. Five approaches to study the Fermat point of a triangle are presented in this article. First, students use a mechanical device using masses, strings and pulleys to study the Fermat point as the one that minimizes the potential energy of the system. Second, students use soap films between parallel planes connecting three pegs. The tension on the film will be minimal when the sum of distances is minimal. Third, students use an empirical approach, measuring distances in an interactive GeoGebra page. Fourth, students use Euclidean geometry arguments for two proofs based on the Torricelli configuration, and one using Viviani's Theorem. And fifth, the kinematic method is used to gain additional insight on the size of the angles between the segments joining the Fermat point with the vertices.

  3. [Growth patterns of appropriate for gestational age infants of gestational diabetic mothers during the first year].

    Science.gov (United States)

    Zhao, Y L; Ma, R M; Zhang, Y; Mo, Y X; Chen, Z; Sun, Y H; Ding, Z B

    2016-08-02

    To explore the growth pattern of appropriate for gestational age (AGA) infants of mother with gestational diabetes mellitus (GDM). The objects of this study were offspring of women who delivered in our hospital from January to December 2011. The GDM group included 70 AGA infants (36 male cases and 34 female cases) of mother with GDM. The control group included 154 AGA infants (66 male cases and 88 female cases) of women with normal glucose tolerance. The data of demographic characteristics of mothers of two groups were collected. Body weight and length of infants in two groups were measured at 3, 6 and 12 months age respectively. Body mass index (BMI), weight and height gain during infancy (0-3 months, 3-6 months and 6-12 months) of infants in two groups were also calculated. Body weight, length and BMI of male AGA infants in GDM group were less than that of control group at 3 months and 6 months age, but more than that of control group at 12 months age, however, there were no significant differences between two group(P>0.05). The weight and height gain during infancy (0-3 months, 3-6 months) of male AGA infants in GDM group were lower than that of control group, but the difference was statistically significant only at 3-6 months[(1.1±0.4) vs (1.4±0.4) kg, P=0.040; (4.9±2.3) vs (6.3±1.2) cm, P=0.026]. The weight and height gain during infancy (6-12 months) of male AGA infants of gestational diabetic mothers were higher than that of control group, but the difference was not statistically significant[(2.1±0.5) vs (1.8±0.5) kg, P=0.361; (8.4±1.3) vs (7.8±1.4) cm, P=0.464]. Male infants of gestational diabetic mothers grew slowly during their infancy of 0-6 months, and then their growth became increasingly fast, which suggested that the influence of intrauterine hyperglycemia environment of GDM mothers on fetal growth might continue after birth.

  4. New Option in the Lives Saved Tool (LiST) Allows for the Conversion of Prevalence of Small-for-Gestational-Age and Preterm Births to Prevalence of Low Birth Weight.

    Science.gov (United States)

    Kozuki, Naoko; Katz, Joanne; Clermont, Adrienne; Walker, Neff

    2017-11-01

    Background: The Lives Saved Tool (LiST) is a software model that estimates the health impact of scaling up interventions on maternal and child health. One of the outputs of the model is an estimation of births by fetal size [appropriate-for-gestational-age (AGA) or small-for-gestational-age (SGA)] and by length of gestation (term or preterm), both of which influence birth weight. LiST uses prevalence estimates of births in these categories rather than of birth weight categories, because the causes and health consequences differ between SGA and preterm birth. The World Health Assembly nutrition plan, however, has set the prevalence of low birth weight (LBW) as a key indicator, with a specific goal of a 30% reduction in LBW prevalence by 2025. Objective: The objective of the study is to develop an algorithm that will allow LiST users to estimate changes in prevalence of LBW on the basis of changes in coverage of interventions and the resulting impact on prevalence estimates of SGA and preterm births. Methods: The study used 13 prospective cohort data sets from low- and middle-income countries (LMICs; 4 from sub-Saharan Africa, 5 from Asia, and 4 from Latin America), with reliable measures of gestational age and birth weight. By calculating the proportion of LBW births among SGA and preterm births in each data set and meta-analyzing those estimates, we calculated region-specific pooled rates of LBW among SGA and preterm births. Results: In Africa, 0.4% of term-AGA, 36.7% of term-SGA, 49.3% of preterm-AGA, and 100.0% of preterm-SGA births were LBW. In Asia, 1.0% of term-SGA, 47.0% of term-SGA, 36.7% of preterm-AGA, and 100.0% of preterm-SGA births were LBW. In Latin America, 0.4% of term-AGA, 34.4% of term-SGA, 32.3% of preterm-AGA, and 100.0% of preterm-SGA births were LBW. Conclusions: The simple conversion factor proposed here allows for the estimation of LBW within LiST for most LMICs. This will allow LiST users to approximate the impact of their health programs on

  5. Mortality and morbidity pattern in small-for gestational age and appropriate-for-gestational age very preterm babies: a hospital based study

    International Nuclear Information System (INIS)

    Muhammad, T.; Khattak, A.A.; Rehman, S.U.

    2009-01-01

    Very preterm babies are important group of paediatric babies who require special attention. These babies are known to have increased risk of morbidity and mortality. Studying the morbidity and mortality pattern for this important paediatric group can help in better understanding of their care in the hospital settings. Objective of the study was to compare the mortality and morbidity pattern in Small-for-gestational age and appropriate-for-gestational age very preterm babies. This hospital based prospective (cohort) study was conducted at the department of Paediatrics, Postgraduate Medical Institute, Lady Reading Hospital, Peshawar from March 2008 to April 2009. One hundred Small-for-gestational age (SGA) live born very preterm babies were compared with 100 appropriate-for-gestational age (AGA) very preterm babies having similar gestational ages. Information regarding gestational age, birth weight, mortality, and morbidity (in terms of various biochemical and clinical markers) were recorded on a pre-designed questionnaire. Data analysis was done using SPSS version 15. Results were interpreted in terms of descriptive (mean, proportions, standard deviation) and inferential statistical tests (with p-values). There was no difference between the two groups (SGA Vs AGA) with regards to gestational age and gender of the babies The mean weight of SGA babies was significantly lower as compared to AGA babies (1.1+-0.16 Kg Vs 1.5+-0.2 Kg; p=0.001). As compared to AGA babies, the SGA babies had a higher mortality (40% Vs 22%, p=0.006), and higher morbidity in terms of hyperbilirubinaemia (67% Vs 51%, p=0.02) and hypocalcaemia (24% Vs 10%, p=0.02). The difference in the mortality between the two groups was more prominent in babies with gestational age < 31 weeks (71.4% for SGA as compared to 39.3 % for AGA very preterm babies with gestational age < 31 weeks). Very preterm SGA infants have significantly higher mortality and morbidity in comparison to the AGA babies. In deciding

  6. Point card compatible automatic vending machine for canned drink; Point card taio kan jido hanbaiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-01-10

    A point card compatible automatic vending machine for canned drinks is developed, which provides drink manufacturers with a powerful tool to acquire selling sites and attract consumers. Since the machine is equipped with a device to handle point cards, regular customers have increased and sales have picked up. A point card issuing device is also installed, and the new machine issues a point card whenever a customer wants. The drink manufacturers are evaluating high of the vending machine because it will contribute to the diffusion of the point card system and because a sales promotion campaign may be conducted through the vending machine for instance by exchanging a fully marked card with a giveaway on the spot. In the future, a bill validator (paper money identifier) will be integrated even with small size machines for the diffusion of point card compatible machines. (translated by NEDO)

  7. SharePoint governance

    OpenAIRE

    Ali, Mudassar

    2013-01-01

    Masteroppgave i informasjons- og kommunikasjonsteknologi IKT590 2013 – Universitetet i Agder, Grimstad SharePoint is a web-based business collaboration platform from Microsoft which is very robust and dynamic in nature. The platform has been in the market for more than a decade and has been adapted by large number of organisations in the world. The platform has become larger in scale, richer in features and is improving consistently with every new version. However, SharePoint ...

  8. Solving discrete zero point problems

    NARCIS (Netherlands)

    van der Laan, G.; Talman, A.J.J.; Yang, Z.F.

    2004-01-01

    In this paper an algorithm is proposed to .nd a discrete zero point of a function on the collection of integral points in the n-dimensional Euclidean space IRn.Starting with a given integral point, the algorithm generates a .nite sequence of adjacent integral simplices of varying dimension and

  9. Error Mitigation of Point-to-Point Communication for Fault-Tolerant Computing

    Science.gov (United States)

    Akamine, Robert L.; Hodson, Robert F.; LaMeres, Brock J.; Ray, Robert E.

    2011-01-01

    Fault tolerant systems require the ability to detect and recover from physical damage caused by the hardware s environment, faulty connectors, and system degradation over time. This ability applies to military, space, and industrial computing applications. The integrity of Point-to-Point (P2P) communication, between two microcontrollers for example, is an essential part of fault tolerant computing systems. In this paper, different methods of fault detection and recovery are presented and analyzed.

  10. ID-pilet teeb Tallinnas võidukäiku / Anneli Lepp

    Index Scriptorium Estoniae

    Lepp, Anneli

    2006-01-01

    Vt. ka Postimees : na russkom jazõke 12. jaan. lk 3. Tallinna transpordiameti peaökonomisti Mart Moosuse sõnul moodustas ID-pilet 60,7% ühistranspordi piletituludest, Tartus oli vastav näitaja aga alla 1%. Tartut teenindava bussifirma AS Connex Eesti finantsjuht Tiina Telling peab suure erinevuse põhjuseks asjaolu, et Tallinnas on ID-pilet paberpiletist 40-88% soodsam, Tartus hinnavahe aga puudub või on lausa negatiivne ID-pileti kahjuks. Lisa: ID-pilet

  11. Detection of mesocarp oleoyl-thioesterase gene of the South ...

    African Journals Online (AJOL)

    Administrator

    TAT CCA ACT TGG GGT GAT GTT GTT GAG ATT GAA ACA TGG TGC CAA GGG 48. Y P T W G D V V E I E T W C G G 16. GAA GGA AGA ATA GGC ACC AGG CGT GAT TGG ATT ATC AAG GAT TTG GCT 96. E G R I G T R R D W I I K D L A 32. ACT GGT GAA GTT ATT GGT AGA GCC ...

  12. Dew point vs bubble point : a misunderstood constraint on gravity drainage processes

    Energy Technology Data Exchange (ETDEWEB)

    Nenninger, J. [N-Solv Corp., Calgary, AB (Canada); Gunnewiek, L. [Hatch Ltd., Mississauga, ON (Canada)

    2009-07-01

    This study demonstrated that gravity drainage processes that use blended fluids such as solvents have an inherently unstable material balance due to differences between dew point and bubble point compositions. The instability can lead to the accumulation of volatile components within the chamber, and impair mass and heat transfer processes. Case studies were used to demonstrate the large temperature gradients within the vapour chamber caused by temperature differences between the bubble point and dew point for blended fluids. A review of published data showed that many experiments on in-situ processes do not account for unstable material balances caused by a lack of steam trap control. A study of temperature profiles during steam assisted gravity drainage (SAGD) studies showed significant temperature depressions caused by methane accumulations at the outside perimeter of the steam chamber. It was demonstrated that the condensation of large volumes of purified solvents provided an efficient mechanism for the removal of methane from the chamber. It was concluded that gravity drainage processes can be optimized by using pure propane during the injection process. 22 refs., 1 tab., 18 figs.

  13. Dew Point

    OpenAIRE

    Goldsmith, Shelly

    1999-01-01

    Dew Point was a solo exhibition originating at PriceWaterhouseCoopers Headquarters Gallery, London, UK and toured to the Centre de Documentacio i Museu Textil, Terrassa, Spain and Gallery Aoyama, Tokyo, Japan.

  14. Tipping Point

    Medline Plus

    Full Text Available ... Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash ...

  15. Androgenetic alopecia: new insights into the pathogenesis and mechanism of hair loss [v1; ref status: indexed, http://f1000r.es/5ar

    Directory of Open Access Journals (Sweden)

    Rodney Sinclair

    2015-08-01

    Full Text Available The hair follicle is a complete mini-organ that lends itself as a model for investigation of a variety of complex biological phenomena, including stem cell biology, organ regeneration and cloning.  The arrector pili muscle inserts into the hair follicle at the level of the bulge- the epithelial stem cell niche.  The arrector pili muscle has been previously thought to be merely a bystander and not to have an active role in hair disease. Computer generated 3D reconstructions of the arrector pili muscle have helped explain why women with androgenetic alopecia (AGA experience diffuse hair loss rather than the patterned baldness seen in men.  Loss of attachment between the bulge stem cell population and the arrector pili muscle also explains why miniaturization is irreversible in AGA but not alopecia areata. A new model for the progression of AGA is presented.

  16. Androgenetic alopecia: new insights into the pathogenesis and mechanism of hair loss

    Science.gov (United States)

    Sinclair, Rodney; Torkamani, Niloufar; Jones, Leslie

    2015-01-01

    The hair follicle is a complete mini-organ that lends itself as a model for investigation of a variety of complex biological phenomena, including stem cell biology, organ regeneration and cloning.  The arrector pili muscle inserts into the hair follicle at the level of the bulge- the epithelial stem cell niche.  The arrector pili muscle has been previously thought to be merely a bystander and not to have an active role in hair disease. Computer generated 3D reconstructions of the arrector pili muscle have helped explain why women with androgenetic alopecia (AGA) experience diffuse hair loss rather than the patterned baldness seen in men.  Loss of attachment between the bulge stem cell population and the arrector pili muscle also explains why miniaturization is irreversible in AGA but not alopecia areata. A new model for the progression of AGA is presented. PMID:26339482

  17. Euroopa kultuuriruumis matkates / Peeter Järvelaid

    Index Scriptorium Estoniae

    Järvelaid, Peeter, 1957-

    2002-01-01

    Rektor Gustav Ewers 19. sajandi alguse Tartu kultuuriruumis, lk. 140-155 ; Mozartist ja akadeemilise biograafia kirjutamise metoodikast, lk. 155-157 ; Tegudemees Carl Gustav Jochmann (1789-1830), lk. 158-159 ; Professor Martensi tagasitulek, lk. 160-163 ; Hans-Georg Gadameri jõudmine eesti keelde, lk. 163-165 ; Unustatud geeniuse tagasitulek, lk. 166-168 ; Kannab Eestit südames: Boris Meissner 85, lk. 168-170 ; Professor Heikki Ylikangas, üks tõeline soomlane - 65, lk. 170-172 ; Ungari 1956 ühe hõimukaaslase saatuse kaudu, lk. 173-179

  18. Postnatal Growth Disadvantage of the Small for Gestational Age Preterm Twins

    Directory of Open Access Journals (Sweden)

    Iris Morag

    2018-04-01

    Full Text Available In this study, we examined early growth characteristics among small-for-gestational-age (SGA preterm twins compared to their appropriate-for-gestational-age (AGA counterparts. A retrospective study evaluated all consecutive twins born between 2008 and 2015 at a tertiary referral center whose gestational age ranged from 30.0 to 34.86 weeks. Included were twins in which one twin was AGA and the other SGA at birth. Changes of ≥2, 1–1.99, and 0–0.99 in z-score between births and 36 weeks post menstrual age (PMA were respectively defined as severe, moderate, and mild postnatal growth failure (PNGF in weight or head circumference (HC. Early neonatal morbidities were documented. Multiple logistic regression analysis was applied to determine conditions associated with PNGF and its severity. Out of 666 sets of twins, 83 met the inclusion criteria. Weight PNGF was similar and mild among the SGA and the AGA groups (0.9 ± 0.46 vs. 0.96 ± 0.44 z-score, respectively, p = 0.24. At 36 weeks PMA, a significantly larger proportion of SGAs were below −2 z-scores in weight (84.3% compared to birth (31.3% or to the AGAs (8.4%. In both groups, weight PNGF correlated with the time needed to regain birth weight. HC PNGF was mild among both groups, yet significantly more prominent among the AGAs (0.39 ± 0.72 z-score vs. SGAs (0.75 ± 0.65 z-score, p = 0.001. We suggest that among preterm SGA infants, the absolute z-score should be used to assess the severity of weight PNGF. Individual nutritional strategies to decrease time to regain birth weight may mitigate severe malnutrition among SGAs.

  19. PowerPoint 2007 for Dummies

    CERN Document Server

    Lowe, Doug

    2007-01-01

    New and inexperienced PowerPoint users will discover how to use the latest enhancements to PowerPoint 2007 quickly and efficiently so that they can produce unique and informative presentations PowerPoint continues to be the world's most popular presentation software This updated For Dummies guide shows users different ways to create powerful and effective slideshow presentations that incorporate data from other applications in the form of charts, clip art, sound, and video Shares the key features of PowerPoint 2007 including creating and editing slides, working with hyperlinks and action butt

  20. Beginning SharePoint 2010 Development

    CERN Document Server

    Fox, Steve

    2010-01-01

    Discover how to take advantage of the many new features in SharePoint 2010. SharePoint provides content management (enterprise content management, Web content management, records management, and more), workflow, and social media features, and the new version boasts enhanced capabilities. This introductory-level book walks you through the process of learning, developing, and deploying SharePoint 2010 solutions. You'll leverage your existing skills and tools to grasp the fundamental programming concepts and practices of SharePoint 2010. The author clearly explains how to develop your first appli