
Sample records for alguses point aga

  1. Alguses oli Piaf / Kaisa Karu

    Index Scriptorium Estoniae

    Karu, Kaisa


    Režissöör Christopher Nolani põnevusfilmis "Algus" (USA-Inglise 2010) teeb kaasa ka prantsuse näitleja Marion Cotillard. Tuntuks sai näitlejanna peaosaga režissöör Olivier Dahani filmis "Edith Piaf - elusse armunud"

  2. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  3. 21. sajandi alguse julgeolekudilemmadest / Ramon Loik

    Index Scriptorium Estoniae

    Loik, Ramon


    21. sajandi alguse julgeolekuküsimused: riikidevahelised asümmeetrilised konfliktid, rünnakuohud, tuumaterrori oht, rahvusvaheline terrorism, võitlus selle vastu, Euroopast lähtuv terrorioht. Euroopa Liidu riikide ja USA vaheliste erimeelsuste allikatest julgeoleku küsimustes


    Directory of Open Access Journals (Sweden)

    Kristiina Ross


    Full Text Available Eesti kirjakeele morfosüntaksi kujunemisel mängisid olulist osa 16.–18. sajandi vaimulikud tõlked, mille loomise käigus kohandati seni suulisena funktsioneerinud rahvakeel kirjalike kristlike tekstide nõuetele. Artiklis vaadeldakse ühe väikese morfosüntaktilise rühma arenguid sel perioodil. Analüüsitakse konstruktsioone, milles ütlemist, tajumist ja teadmist väljendavaid verbe laiendab infiniitne vorm. Kirjeldatakse niisuguseid konstruktsioone rahvalaulukeeles, eeskujukeeltes ja varases kirjakeeles ning jõutakse järeldusele, et vastavad rahvakeelsed mallid võeti kirjakeeles suhteliselt vara kasutusele tänu sellele, et eeskujukeeled pakkusid nende rakendamiseks soodsaid võimalusi. 17. sajandi alguse põhjaeesti kirjakeeles tarvitati neis konstruktsioonides läbisegi partitsiipi ja infinitiivi, sest eri murded pakkusidki eri võimalusi (tüdruk kuulis poissi laulVAT /laulMA. Partitsiipsete konstruktsioonide kirjakeelne kasutus põhjaeesti tekstides erines alguses rahvakeelsest ning selles võib oletada klassikaliste keelte eeskuju. 17. sajandi lõpus loobuti põhjaeesti kirjakeeles infinitiivsetest konstruktsioonidest partitsiipsete kasuks. Niisuguses valikus võib näha lõunaeesti mõju, aga ka soovi vältida võimalikke germanisme, millega infinitiivseid konstruktsioone võidi siduda.

  5. Eesti laevaehituse uus algus / Aldur Vunk

    Index Scriptorium Estoniae

    Vunk, Aldur, 1959-


    Varasemast laevaehitusest Läänemere ida- ja kirderannikul. Laevaehitusest Läänemere idaosas 1670. aastatest 1770. aastateni. Harderite laevatehasest Pärnus. Laevaehitusest Eestimaa kubermangus 18. sajandi lõpus ja 19. sajandi alguses. Christoph Friedrich Schmidti laevaehitusest Kuressaares. Majandusliku madalseisu ajal Pärnus ehitatud laevadest. Kuramaa mõjust laevaehituse kujunemisel tööstusharuks Liivimaa kubermangudes. Harderi laevatehase taastamisest Pärnus 1840. aastatel. 1840. ja 1850. aastate laevaehitusest Eestimaal ja Narvas. Saaremaa laevaehitusest 1840. ja 1850. aastatel. Eesti soost laevameistrite ja reederite läbimurdest

  6. President Toomas Hendrik Ilvese tervitus kooliaasta alguse puhul

    Index Scriptorium Estoniae

    Ilves, Toomas Hendrik, 1953-


    Ilmunud ka: Lääne Elu 2. sept. 2010, lk. 2, pealk.: Omakeelne haridus on privileeg; Nädaline 2. sept. 2010, lk. 2, pealk.: President Toomas Hendrik Ilvese tervitus kooliaasta alguse puhul; Eesti Elu 3. sept. 2010, lk. 2,3, pealk.: Vabariigi Presidendi tervitus kooliaasta alguse puhul; Meie Kodu 8. sept. 2010, lk. 2, pealk.: President kutsus mõtlema omakeelsele haridusele. Tsitaat kõnest ilmunud ka: Järva Teataja 2. sept. 2010, lk. 2; Hiiu Leht 3. sept. 2010, lk. 2

  7. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal


    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  8. Alguses oli: Arvo Pärdi juubelikuu algas etendusega Noblessi valukojas

    Index Scriptorium Estoniae


    Tõnu Kaljuste ja Peeter Jalaka lavastusest "Alguses oli", lavastuse aluseks Arvo Pärdi teosed "In Principio" ja "Miserere", 17. augustil Noblesse valukojas toimunud etendusest, muusikaline juht Tõnu Kaljuste

  9. Alguses oli Arvo Pärdi muusika ja siis tulid Jalakas ja videokunstnikud / Tiiu Laks

    Index Scriptorium Estoniae

    Laks, Tiiu, 1984-


    Tõnu Kaljuste ja Peeter Jalaka lavastusest "Alguses oli", lavastuse aluseks Arvo Pärdi teosed "In Principio" ja "Miserere", 17. augustil Noblesse valukojas toimunud etendusest, muusikaline juht Tõnu Kaljuste

  10. [Vene impeerium ja Baltikum. Venestus, rahvuslus ja moderniseerimine 19. sajandi teisel poolel ja 20. sajandi alguses] / Olaf Mertelsmann

    Index Scriptorium Estoniae

    Mertelsmann, Olaf, 1969-


    Arvustus: Vene impeerium ja Baltikum : venestus, rahvuslus ja moderniseerimine 19. sajandi teisel poolel ja 20. sajandi alguses. II / koostanud Tõnu Tannberg ja Bradley Woodworth. Tartu : Eesti Ajalooarhiiv, 2010

  11. Development of producing equipment of mixed butane-air with low dew point. Energy saving dewatering apparatus and 6A-Gas producing apparatus utilizing vaporization latent heat of butane and potential heat of air

    Energy Technology Data Exchange (ETDEWEB)

    Komine, Jin; Okada, Hiroto; Taniue, Nobuo; Tanoue, Keiju; Yamada, Tatsuhiko; Maekawa, Hisami; Murakami, Keiji


    A producing equipment of mixed butane-air with low dew point was developed. The dewatering was made during the period from the middle of May to the middle of October with high atmospheric humidity. The production capacity of the mixed gas is 3000 Nm/sup 3/ of 22% of butane and 78% of air per hour. The designed dew point is 18/sup 0/C or less under the pressure of 0.7 kg/cm/sup 2/G. The saturation temperature is 7.5/sup 0/C after the liquid butane is evacuated by a regulating valve. The air introduced into the dehumidifier through finned tubes is cooled to dewater based on those data. The partially vaporized butane is completely gasified by hot water in a vaporizer and mixed with the dewatered air by a venture mixer to produce the mixed butane-air. When the dewatering is incomplete, the spray nozzle must be just exchanged. The dew point of the produced gas was sufficiently below the designed value. The investment cost is low. The total operating cost is reduced by the remarkably decreased fuel cost though the power cost is increased. The noise level is low and the heat control is easy. (11 figs, 4 tabs, 1 photo)

  12. AGA answers complaints on burner tip prices

    International Nuclear Information System (INIS)



    This paper reports that the American Gas Association has rebutted complaints that natural gas prices have dropped at the wellhead but not at the burner tip. AGA Pres. Mike Baly the an association study of the issue found that all classes of customers paid less for gas in 1991 than they did in 1984, when gas prices were at their peak. He the, the study also shows that 100% of the wellhead price decline has been passed through to natural gas consumers in the form of lower retail prices. Baly the the average cost of gas delivered to all customers classes fell by $1.12/Mcf from 1984 to 1991, which exceeds the $1.10/Mcf decline in average wellhead prices during the same period

  13. Alguses oli HELI ja PÄRT, siis Jalaka LAVASTUS / Riina Luik

    Index Scriptorium Estoniae

    Luik, Riina, 1962-


    Tõnu Kaljuste ja Peeter Jalaka lavastusest "Alguses oli", lavastuse aluseks Arvo Pärdi teosed "In Principio" ja "Miserere", 17. augustil Noblesse valukojas toimunud etendusest, muusikaline juht Tõnu Kaljuste. Arvo Pärdi pidunädalate ürituste loetelu

  14. Näidendivõistlusel triumfeeris taas kord Martin Algus / Kaarel Kressa

    Index Scriptorium Estoniae

    Kressa, Kaarel, 1983-


    Eesti Teatri Agentuuri näidendivõistlusel sai esikoha Martin Algus näidendiga "Postmodernsed leibkonnad", teise koha Siim Nurliku kirjatükk "Kas ma olen nüüd elus" ja kolmanda koha Loone Otsa töö "Libuhunt"

  15. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)



    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  16. KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

    Directory of Open Access Journals (Sweden)

    Saprial Saprial


    Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

  17. AGA: Interactive pipeline for reproducible gene expression and DNA methylation data analyses [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael Considine


    Full Text Available Automated Genomics Analysis (AGA is an interactive program to analyze high-throughput genomic data sets on a variety of platforms. An easy to use, point and click, guided pipeline is implemented to combine, define, and compare datasets, and customize their outputs. In contrast to other automated programs, AGA enables flexible selection of sample groups for comparison from complex sample annotations. Batch correction techniques are also included to further enable the combination of datasets from diverse studies in this comparison. AGA also allows users to save plots, tables and data, and log files containing key portions of the R script run for reproducible analyses. The link between the interface and R supports collaborative research, enabling advanced R users to extend preliminary analyses generated from bioinformatics novices.

  18. Urinary tract infections at aga Khan University hospital nairobi - a ...

    African Journals Online (AJOL)


    Jun 11, 2013 ... (Uti) are normally treated empirically and urine culture is usual ordered for as a last ... symptomatic Uti in patients at aga Khan University hospital by looking at the trends of Uti ... in the context of pyelonephritis in pregnancy(9).

  19. Screening strategies for gestational diabetes mellitus at the Aga ...

    African Journals Online (AJOL)

    Background: Universal screening strategy for gestational diabetes mellitus offers biochemical screening to all women irrespective of risk factor status while selective strategy screens only those with risk factors. The Aga Khan University Hospital adopted a selective screening protocol by consensus. This study compares both ...

  20. Elu alguse kaitse läbi Euroopa Inimõiguste Kohtu lahendite : [magistritöö] / Ele-Liis Jõgi ; Tartu Ülikool, õigusteaduskond ; juhendaja: Ants Nõmper

    Index Scriptorium Estoniae

    Jõgi, Ele-Liis


    Elu alguse mõiste, loode kui inimolend, abordi mõiste, elu alguse kaitse kehtivas õiguses (rahvusvaheline regulatsioon, Euroopa võrrelduna teiste mandritega , Eesti, Prantsusmaa), Euroopa Inimõiguste Kohtu praktika

  1. Aga sellepärast, et on po... / Aleksandr Astrov

    Index Scriptorium Estoniae

    Astrov, Aleksandr


    Arutledes venekeelse valija hääletuskäitumise ümber juhib autor tähelepanu, et Eestis sätestab üks konkreetne seadus venelastele valimisõiguse, andes neile reaalse poliitilise jõu, teine aga piirab nende juurdepääsu ainult keele kaudu ligipääsetavatele eetikaressurssidele, mis võimaldaksid teha teadlikku valikut

  2. [Vene impeerium ja Baltikum: venestus, rahvuslus ja moderniseerimine 19. sajandi teisel poolel ja 20. sajandi alguses. 1] / Toomas Karjahärm

    Index Scriptorium Estoniae

    Karjahärm, Toomas, 1944-


    Arvustus: Vene impeerium ja Baltikum : venestus, rahvuslus ja moderniseerimine 19. sajandi teisel poolel ja 20. sajandi alguses. I / koostanud Tõnu Tannberg, Bradley Woodworth. Eesti Ajalooarhiivi toimetised ; 16 (23). (Tartu : Eesti Ajalooarhiiv, 2009)

  3. Esimesed läti naismaalikunstnikud 20. sajandi alguses = The first Latvian female painters in the early 20th century / Baiba Vanaga

    Index Scriptorium Estoniae

    Vanaga, Baiba, 1981-


    Läti kunstiharidusest ja kunstikoolidest 20. sajandi alguses. Naiste kunstihariduse kvaliteedist, nende mõjutajatest, kunstilisest stiilist, arenguteedest ning naiste tegelikust kohast oma aja kunstiväljal.

  4. Comparison of Patent Claim Construction between Netherlands and Germany on Basis of AGA v. Occlutech

    NARCIS (Netherlands)

    Tsoutsanis, A.; Kau, C.


    This article provides a brief overview on how the Dutch and German courts interpret the claims of a patent. It briefly compares each national approach on the basis of the recent AGA v Occlutech litigation in both countries. The dispute between AGA and Occlutech involved socalled ‘‘occluders’’, a

  5. Stapled hemorrhoidopexy: The Aga Khan University Hospital Experience

    International Nuclear Information System (INIS)

    Athar, Ali; Chawla, Tabish; Turab, Pishori


    Stapled hemorrhoidopexy for prolapsing hemorrhoids is conceptually different from excision hemorrhoidectomy. It does not accompany the pain that usually occurs after resection of the sensitive anoderm. This study was carried out to evaluate the clinical outcome of stapled hemorrhoidopexy at The Aga Khan University Hospital. A sample of 140 patients with symptomatic second-, third-, and fourth-degree hemorrhoids and circumferential mucosal prolapse underwent stapled hemorrhoidopexy from July 2002 to July 2007. They were evaluated for postoperative morbidity, analgesic requirement, and recurrence. Seventy-eight percent were males and the mean age was 45 (range 16-90) years. The mean operative time was 35 (15-78) min. The mean parenteral analgesic doses during the first 24 h were 2.1. All patients received oral analgesics alone after 24 h. No significant postoperative morbidity was observed. The mean in-patient hospital stay was 1.3 (0-5) days. Patients were followed-up for 24 (range, 2-48) months. Minor local recurrence of hemorrhoids was seen in four patients and was managed by band ligation. Stapled hemorrhoidopexy procedure was found safe, well tolerated by patients with minimal parenteral analgesic use and early discharge from the hospital. (author)

  6. The role of anthropometric, growth and maturity index (AGaMI) influencing youth soccer relative performance (United States)

    Bisyri Husin Musawi Maliki, Ahmad; Razali Abdullah, Mohamad; Juahir, Hafizan; Muhamad, Wan Siti Amalina Wan; Afiqah Mohamad Nasir, Nur; Muazu Musa, Rabiu; Musliha Mat-Rasid, Siti; Adnan, Aleesha; Azura Kosni, Norlaila; Abdullah, Farhana; Ain Shahirah Abdullah, Nurul


    The main purpose of this study was to develop Anthropometric, Growth and Maturity Index (AGaMI) in soccer and explore its differences to soccer player physical attributes, fitness, motivation and skills. A total 223 adolescent soccer athletes aged 12 to 18 years old were selected as respondent. AGaMI was develop based on anthropometric components (bicep, tricep, subscapular, suprailiac, calf circumference and muac) with growth and maturity component using tanner scale. Meanwhile, relative performance namely physical, fitness, motivation and skills attributes of soccer were measured as dependent variables. The Principal Component Analysis (PCA) and Analysis of Variance (ANOVA) are used to achieve the objective in this study. AGaMI had categorized players into three different groups namely; high (5 players), moderate (88 players) and low (91 players). PCA revealed a moderate to very strong dominant range of 0.69 to 0.90 of factor loading on AGaMI. Further analysis assigned AGaMI groups as treated as independent variables (IV) and physical, fitness, motivation and skills attributes were treated as dependent variables (DV). Finally, ANOVA showed that flexibility, leg power, age, weight, height, sitting height, short and long pass are the most significant parameters statistically differentiate by the groups of AGaMI (p<0.05). As a summary, body fat mass, growth and maturity are an essential component differentiating the output of the soccer players relative performance. In future, information of the AGaMI model are useful to the coach and players for identifying the suitable biological and physiological demand reflects more comprehensive means of youth soccer relative performance. This study further highlights the importance of assessing AGaMI when identifying soccer relative performance.

  7. "Vedes päi elo tulob..." = "Veest saab elu alguse..." : [luuletused] / Miikul Pahomov ; tlk. Jaan Õispuu

    Index Scriptorium Estoniae

    Pahomov, Miikul


    Sisu: "Vedes päi elo tulob..." = "Veest saab elu alguse..." ; "Ei skuup voi pajatada denguush..." = "Ei kooner rahast laulda või..." ; "Coma neicud lyydilaane..." = "Kaunis neiu, lüüdi neiu..." ; "Olizhbo purjeh..." = "Oleks puri mul..." ; "Mi om meiden lyhyd elo..." = "Mis on meie pisku elu..." ; "Sinizhed lindud..." = "Sinised linnud..." ; "Ole, kaivo, puhtaz..." = "Ole, allik, puhas..." ; "Pimedas..." = "Pimedas..." ; Ken miä olen? = Kes ma olen ; Lüüdiland = Lüüdiland ; "Sa kuna mäned, minun rahvaz..." = "Kuhu lähed sa, minu rahvas..." ; Minu kibu - minun mua = Minu valu on minu maa ; Lüüdikiel̀ = Lüüdi keel ; Dälgmäizhed = Viimased ; Kand da latv = Känd ja latv ; Kardàlaine külü = Karjala saun ; Petruskoi = Petruskoi ; "Tägä Suomen taivhan al..." = "Siinse soome taeva all..." ; Viiburin - Piiterin tiel = Viiburi - Piiteri teel

  8. Hassan Aga and his Government in Algiers. The Consolidation of a Mediterranean Myth

    Directory of Open Access Journals (Sweden)



    Full Text Available This work tries to describe graphically the consolidation of a social myth in the unsettled Mediterranean of the 16th century, through a personage: the Spanish convert to Islam Hassan Aga (Azan Aga, the Sardinian renegade who succeeded Hayreddin Barbarrosa at the helms of Algiers from 1533 till his death ten years later. This was a period of intense activity, with the climax that came with the expedition of Charles to Algiers in 1541, whose spectacular defeat can be considered as the principal nucleus of the myth of this popular personage who as a Sardinian slave came to defeat the Emperor. A myth of social ascension with maquiavelical profiles of a new prince of the frontiers.

  9. A novel base change leading to Hb Vanderbilt [β89(F5)Ser→Arg, AGT>AGA]. (United States)

    Goodyer, Matthew J; Elhassadi, Ezzat I; Percy, Melanie J; McMullin, Mary F


    We describe a high oxygen affinity hemoglobin (Hb) variant (Hb Vanderbilt) as a result of a heterozygous novel base change from T to A at codon 89 (AGT>AGA) leading to an amino acid change from serine to arginine.

  10. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    Energy Technology Data Exchange (ETDEWEB)

    Ermolayev, Vladimir [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Cohrs, Christian M. [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Mohajerani, Pouyan; Ale, Angelique [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Hrabé de Angelis, Martin [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Ntziachristos, Vasilis, E-mail: [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany)


    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1{sup Aga2/+}, animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing.

  11. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    International Nuclear Information System (INIS)

    Ermolayev, Vladimir; Cohrs, Christian M.; Mohajerani, Pouyan; Ale, Angelique; Hrabé de Angelis, Martin; Ntziachristos, Vasilis


    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1 Aga2/+ , animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing

  12. "Parim" on subjektiivne, aga kõhutundest ka ei piisa / Inga Kuusik

    Index Scriptorium Estoniae

    Kuusik, Inga, 1961-


    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 13 apr. lk. 6-7. Saku Õlletehase uus finantsjuht oma tööst tubakatootja Imperial Tobacco Grupi Kesk-Aasia regiooni finantsdirektorina Kõrgõzstanis, Saku Õlletehase kapitali struktuurist, finantsdirektori rollist ettevõttes ja tööjõu värbamisest Saku Õlletehases. Lisad: Saku Õlletehas 2006: mõõdukas käibe-, aga suur kasumikasv; Tabel: Saku Õlletehase dividendimaksed 1997-2007

  13. Nõrk või tugev raha? : mündireformid ja nende põhjused Euroopas 15. sajandi alguses / Ivar Leimus

    Index Scriptorium Estoniae

    Leimus, Ivar, 1953-


    Saksa Ordu majanduslikust pankrotist Tannenbergi lahingu järel. Katsetest olukorda lahendada. Danzigi veriselt maha surutud mündimässust, misjärel kõrgmeistril tuli siiski loobuda reformist algselt mõeldud kujul. Mündireform toimus 15. sajandi alguses ka Liivimaal. Küsimuseks jääb kuivõrd mõjutas seda kõrgmeistrile osutatud rahalinae abi. Suurem kriis Liivimaa mündinduses näib olevat alanud alles 1415. aastal. 15. sajandi algul halvenes raha peaaegu kõikjal Euroopas, kuid selle põhjused ja käik olid erinevad

  14. "Alguses oli tema üksinda, sest oli küll..." : [luuletused] / Kabir ; tlk. Doris Kareva

    Index Scriptorium Estoniae



    Sisu: "Alguses oli tema üksinda, sest oli küll..." ; "Kõik loodud on Kõiksuse poolt..." ; "Otsid Sa mind?..." ; "Kabir oma meele puhtaks..." ; "Pole pühades järvedes midagi muud peale vee..." ; "Otsisin kelme ja kõveraid..." ; "Ütle, vend, mida küll teha..." ; "Mis kurja on teinud su juuksed..." ; "Ära tõuse, et minna õue vaatama lilli..." ; "Sinu sünd inimesena on küps vili..." ; "Öö saatsid sa magades mööda..." ; "Pole ma hindu..." ; "Ma vaatan sind..." ; "Veskikivisid vaadeldes ; "Nähes aednikku lähenemas, õhkasid pungad..." ; "Tasa, tasa tõtta, mu meel..." ; "Ära kurvasta..." ; "Imetlusväärne on teemant..." ; "Kuula, sõber, see keha on Tema lüüra..." ; "Nagu seemnes varjul on õli..." ; "Olgugi ookean leekides..." ; "Tilka, mis lahustub meres..." ; "Jõgi ja lained on üks..." ; "Kes sa oled ja kust oled tulnud?..." ; "Kaovad kuningad, kauneimad kuningannad..." ; "Rohkem kui midagi muud..." ; "Lihalik, surelik tantsib selle ees..." ; "Väike rubiin, mida igaüks ihkab..." ; "Mine heade juurde, kus Armastatugi elab..." ; "Eksitus sulgeb väravad..." ; "Keelilt vallandub helisid..." ; "Kõik algab lahusoleku valust..." ; "Ärka, sõber! Miks ikka veel magad?..." ; "Kuu on mu kehas, kuid ise ma seda ei näe..." ; "Miks oled nii kärsitu, süda?..." ; "Kellele kuulub see flööt..." ; "Kui raske on Külalist kohata!..." ; "Kandetool toodi minule järgi mu isakoju..." ; "Siia ilma sündides nutsid..." ; "Oh mu süda! Ei jõudnud sa tundma õppida..." ; "Õige kulunud on sinu rüü..." ; "Õhkõrn on see õhuke rüü..." ; "Lipp, mida keegi ei näe..." ; "Oh otsija, lihtne liit lähim on südamele..." ; "Õhtu varjud on sügavaks saanud..." ; "Kuis saakski katkeda armastus me kahe vahel..." ; "Luik, tahaksin, et mulle räägiksid kõik oma loo..." ; "Kuhu ihaled küll, minu süda?..." ; "Ei lakka Lõpmatu flöödiheli..." ; "Mida näed, seda pole...". Autori kohta eluloolisi andmeid lk. 11

  15. An analysis of Canada-US natural gas trade using the AGAS energy model

    International Nuclear Information System (INIS)

    Quon, D.; Wong, S.


    The strength of AGAS is that it was structurally designed to address the primary issue of EMF9, namely the medium and long-term prospects for Canada-US natural gas trade. Consequently, it is one of the very few models with the following necessary features: (1) it treats all the regions of Canada and the United States as one continental entity, both with respect to demand and supply; (2) All regional supplies and demands are integrated. Hence, regional gas prices are endogenous; inter-regional gas flows, including Canadian-US gas exchanges, are endogenous. Models that do not have both of these features require that the answers that are being sought have to be specified exogenously. An iterative procedure can be used to reconcile unrealistic results but only with difficulty

  16. Cardiopulmonary dysfunction in the Osteogenesis imperfecta mouse model Aga2 and human patients are caused by bone-independent mechanisms. (United States)

    Thiele, Frank; Cohrs, Christian M; Flor, Armando; Lisse, Thomas S; Przemeck, Gerhard K H; Horsch, Marion; Schrewe, Anja; Gailus-Durner, Valerie; Ivandic, Boris; Katus, Hugo A; Wurst, Wolfgang; Reisenberg, Catherine; Chaney, Hollis; Fuchs, Helmut; Hans, Wolfgang; Beckers, Johannes; Marini, Joan C; Hrabé de Angelis, Martin


    Osteogenesis imperfecta (OI) is an inherited connective tissue disorder with skeletal dysplasia of varying severity, predominantly caused by mutations in the collagen I genes (COL1A1/COL1A2). Extraskeletal findings such as cardiac and pulmonary complications are generally considered to be significant secondary features. Aga2, a murine model for human OI, was systemically analyzed in the German Mouse Clinic by means of in vivo and in vitro examinations of the cardiopulmonary system, to identify novel mechanisms accounting for perinatal lethality. Pulmonary and, especially, cardiac fibroblast of perinatal lethal Aga2/+ animals display a strong down-regulation of Col1a1 transcripts in vivo and in vitro, resulting in a loss of extracellular matrix integrity. In addition, dysregulated gene expression of Nppa, different types of collagen and Agt in heart and lung tissue support a bone-independent vicious cycle of heart dysfunction, including hypertrophy, loss of myocardial matrix integrity, pulmonary hypertension, pneumonia and hypoxia leading to death in Aga2. These murine findings are corroborated by a pediatric OI cohort study, displaying significant progressive decline in pulmonary function and restrictive pulmonary disease independent of scoliosis. Most participants show mild cardiac valvular regurgitation, independent of pulmonary and skeletal findings. Data obtained from human OI patients and the mouse model Aga2 provide novel evidence for primary effects of type I collagen mutations on the heart and lung. The findings will have potential benefits of anticipatory clinical exams and early intervention in OI patients.

  17. A.G.A. program gives utilities a leg up on benchmarking

    International Nuclear Information System (INIS)

    Share, J.


    In this era of downsizing, distribution companies are banding together under the aegis of the American Gas Association to improve their performance, ultimately saving money and jobs. The Best Practice Benchmarking program began in 1990 when New Orleans Public Service coordinated an effort by several utilities wanting to compare practices and data. It is not benchmarking in the traditional sense. Best Practices stresses functional rather than competitive or numerical benchmarking by focusing on what utilities have done to improve their operations. In a report on Best Practices, John Bayko, Director of System Operations for Consumers Gas in Toronto, noted these success stories: Building odorant storage and transport facilities were found to save one company $17,500 annually because it could buy odorant in bulk as opposed to 55-gallon drums. Upgrading its cathodic protection system helped a company realize a 40 percent reduction in corrosion leaks over a two-year period, saving $200,000 a year. Another company began studying partnering with contractors which would eliminate the need of a pipeline inspector in each crew. Those potential savings are over $2 million. This paper describes three other Best Practices related to worker safety, system mapping, and activity-based accounting. A.G.A.'s role is briefly discussed

  18. Morbility, clinical data and proteomic analysis of IUGR and AGA newborns at different gestational ages

    Directory of Open Access Journals (Sweden)

    M.D. Ruiz-González


    Full Text Available The data are related to the proteomic analysis of 43 newborns with intrauterine growth retardation (IUGR and 45 newborns with appropriate weight for gestational age (AGA carried out by separation via 2DE and analyzed by MS–TOF/TOF. All newborns were separated into three gestational age groups, "Very Preterm" 29–32 weeks, "Moderate Preterm" 33–36 weeks, and, "Term" ≥37weeks. From each newborn, blood was drawn three times from birth to 1 month life. High-abundant serum proteins were depleted, and the minority ones were separated by 2DE and analyzed for significant expression differences. The data reflect analytic and clinic variables analyzed globally and categorized by gestational age in relation to IUGR and the optimization of conditions for 2-DE separation. The data from this study are related to the research article entitled "Alterations of Protein Expression in Serum of Infants with Intrauterine Growth Restriction and Different Gestational Ages" (M.D. Ruis-González, M.D. Cañete, J.L. Gómez-Chaparro, N. Abril, R. Cañete, J. López-Barea, 2015 [1]. The present dataset of serum IUGR newborn proteome can be used as a reference for any study involving intrauterine growth restriction during the first month of life.

  19. An Assessment of the AGA and CCFA Quality Indicators in a Sample of Patients Diagnosed with Inflammatory Bowel Disease. (United States)

    Tkacz, Joseph; Brady, Brenna L; Meyer, Roxanne; Lofland, Jennifer H; Ruetsch, Charles; Coelho-Prabhu, Nayantara


    Inflammatory bowel disease (IBD) is a chronic relapsing disease characterized by activation of the mucosal immune system and inflammation of the gastrointestinal tract. Management of IBD places a significant burden on the health care system because of the complexity of treatment, variability in patient outcomes, and chronic nature of the disease.  To investigate the American Gastroenterological Association (AGA) and Crohn's and Colitis Foundation of America's (CCFA) quality measurement sets in a sample of IBD patients. Fourteen quality measures were restated for application to a claims database and calculated using Optum Clinformatics DataMart database. Selected measures were calculated over calendar year 2011. Performance measures ranged from 0.4% for AGA measure 9, prophylaxis for venous thromboembolism, to 66.9% for AGA measure 8, testing for Clostridium difficile. CCFA outcome measures ranged from 0.6% qualifying for CCFA O10, report of fecal incontinence, to 32.9% for CCFA O1, prednisone usage. In addition to Clostridium difficile testing, the use of appropriate corticosteroid-sparing therapy (51.1%) and testing for latent tuberculosis before initiating anti-tumor necrosis factor therapy (45.0%) were the highest achieved measures. This is the first examination of IBD quality measures using administrative claims. Rates of achievement across measures were variable and likely affected by the ability to calculate certain measures with claims data. Future studies should further examine measurement of IBD quality indicators in claims data to assess the validity of claims-based analyses and to ascertain whether measure attainment translates into better overall health or IBD-related outcomes.

  20. Does gender affect career satisfaction and advancement in gastroenterology? Results of an AGA institute-sponsored survey. (United States)

    Gerson, Lauren B; Twomey, Kay; Hecht, Gail; Lee, Linda; McQuaid, Ken; Pizarro, Theresa T; Street, Sarah; Yoshida, Cynthia; Early, Dayna


    Women comprise 19% of the American Gastroenterological Association (AGA) membership. We performed a prospective study to determine whether female gastroenterologists were less likely to achieve career advancement and satisfaction. We administered an online survey to AGA members from 2004-2006. The survey contained questions regarding effects of gender on career advancement, satisfaction with career, promotional policies, and integration of family and career. A total of 457 individuals (response rate 9% after 2 major invitations) completed the survey, including 262 (57%) women (20% in private practice, 53% in academic careers, and 27% trainees) and 195 men (23% in private practice, 58% in academic careers, and 19% trainees). The male gastroenterologists were significantly older (P careers for significantly more years (P = .002). There were no significant differences with respect to marital status, number of children, or number of hours worked between the genders. Men were more likely to achieve the rank of full professor (P = .035), and significantly more women reported that gender affected their career advancement (47% vs 9%; P careers reported less satisfaction with their careers (P = .01) and perceived more difficulty in achieving promotion and tenure. Women were more likely to choose private practice careers because of part-time options (P = .025). Equal numbers of men and women in practice reported difficulty balancing work and family life. Significantly more female than male gastroenterologists perceive that gender has affected their career advancement. Female academic gastroenterologists reported less overall career satisfaction and promotion than male academic gastroenterologists.

  1. The German Working Group of Obesity in Childhood and Adolescence (AGA): improving the quality of care for overweight and obese children in Germany. (United States)

    Reinehr, Thomas; Holl, Reinhard W; Wabitsch, Martin


    The Working Group of Obesity in Childhood and Adolescence (AGA) comprises scientists, clinicians, and therapists dealing with obesity in children and adolescents. More than 250 pediatricians, psychiatrics, dieticians, psychologists and sports therapists are integrated. On an international level, the AGA cooperates with the European Childhood Obesity Group and the International Obesity Taskforce (IOTF) for Childhood Obesity. The aims of the AGA are to initiate clinical and scientific studies, to join diagnostic, therapeutic and scientific centers, to improve the education, to support self-help groups, and to standardize diagnostic and therapeutic procedures in the field of obesity in childhood and adolescence. The milestones in the history of the AGA are the consensus process to define overweight and obesity in Germany, the development of guidelines for diagnostic procedures and treatment of obesity in childhood and adolescence, the determination of all therapy centers for obese children and adolescents in Germany, the development of a PC software (APV) to document longitudinally diagnostic and therapeutic procedures as well as outcomes by a quality management program, the certification of therapeutic institutions, and the implementation of prevention and treatment studies. As effect of these initiatives, the quality of care in overweight children has been improved in the last years. For example, the APV quality program demonstrated an increase of diagnostic procedures such as blood pressure measurement in the last 4 years. Copyright 2008 S. Karger AG, Basel.

  2. Neoplasia yield and colonoscopic workload of surveillance regimes for colorectal cancer in colitis patients: a retrospective study comparing the performance of the updated AGA and BSG guidelines. (United States)

    Mooiweer, Erik; van der Meulen, Andrea E; van Bodegraven, Adriaan A; Jansen, Jeroen M; Mahmmod, Nofel; Nijsten, Joyce; van Oijen, Martijn G H; Siersema, Peter D; Oldenburg, Bas


    Due to the increased risk of colorectal cancer, colonoscopic surveillance is recommended for patients with ulcerative and Crohn's colitis. Because surveillance intervals differ considerably between the recently updated American Gastroenterological Association (AGA) and British Society of Gastroenterology (BSG) guidelines, we compared the neoplasia yield and colonoscopic workload of these guidelines. Patients with inflammatory bowel disease undergoing surveillance were identified using medical records. Patients were stratified according to the BSG and AGA guidelines, and corresponding colonoscopic workload was calculated based on the risk factors present during follow-up. The incidence of colitis-associated neoplasia (CAN), defined as a low-grade dysplasia in flat mucosa or a non-adenoma-like mass, high-grade dysplasia, or colorectal cancer was compared between the risk groups of either guidelines. In total, 1018 patients with inflammatory bowel disease who underwent surveillance were identified. Using the AGA surveillance intervals, 64 patients (6%) were assigned to annual and 954 patients (94%) to biannual surveillance, resulting in 541 colonoscopies per year. The yield of CAN was 5.3% and 20.3% in the low- and high-risk groups, respectively (P = 0.02). Using the BSG surveillance intervals, 204 patients received surveillance annually (20%), 393 patients every 3 years (39%), and 421 patients every 5 years (41%), resulting in 420 colonoscopies per year, which is 22% lower than the AGA guidelines. The yield of CAN was 3.6%, 6.9%, and 10.8%, for the low-, intermediate-, and high-risk groups, respectively (P = 0.26). Although the BSG surveillance intervals offer the advantage of a lower colonoscopic workload, the risk stratification of the AGA seems superior in distinguishing patients at higher risk of CAN.

  3. Alguses oli Henrik / Juhan Kreem

    Index Scriptorium Estoniae

    Kreem, Juhan, 1971-


    Arvustus: Crusading and chronicle writing on the medieval Baltic frontier : a companion to the Chronicle of Henry of Livonia / edited by Marek Tamm, Linda Kaljundi, Carsten Selch Jensen. Farnham ; Burlington : Ashgate, 2011

  4. The effect of a knowledge-based ergonomic intervention amongst administrators at Aga Khan University Hospital, Nairobi. (United States)

    Wanyonyi, Nancy; Frantz, Jose; Saidi, Hassan


    Low back pain (LBP) and neck pain are part of the common work-related musculoskeletal disorders with a large impact on the affected person. Despite having a multifactorial aetiology, ergonomic factors play a major role thus necessitating workers' education. To determine the prevalence of ergonomic-related LBP and neck pain, and describe the effect of a knowledge-based ergonomic intervention amongst administrators in Aga Khan University Hospital, Nairobi. This study applied a mixed method design utilizing a survey and two focus group discussions (FGD). A self-administered questionnaire was distributed to 208 participants through systematic sampling. A one hour knowledge-based ergonomic session founded on the survey results was thereafter administered to interested participants, followed by two FGDs a month later with purposive selection of eight participants to explore their experience of the ergonomic intervention. Quantitative data was captured and analyzed using SPSS by means of descriptive and inferential statistics, whereas thematic content analysis was used for qualitative data. Most participants were knowledgeable about ergonomic-related LBP and neck pain with a twelve month prevalence of 75.5% and 67.8% respectively. Continual ergonomic education is necessary for adherence to health-related behaviours that will preventwork-related LBP and neck pain.

  5. Mobile Sensor System AGaMon for Breath Control: Numerical Signal Analysis of Ternary Gas Mixtures and First Field Tests

    Directory of Open Access Journals (Sweden)

    Rolf Seifert


    Full Text Available An innovative mobile sensor system for breath control in the exhaled air is introduced. In this paper, the application of alcohol control in the exhaled air is considered. This sensor system operates semiconducting gas sensor elements with respect to the application in a thermo-cyclic operation mode. This operation mode leads to so-called conductance-over-time-profiles (CTPs, which are fingerprints of the gas mixture under consideration and can be used for substance identification and concentration determination. Especially for the alcohol control in the exhaled air, ethanol is the leading gas component to be investigated. But, there are also other interfering gas components in the exhaled air, like H2 and acetone, which may influence the measurement results. Therefore, a ternary ethanol-H2-acetone gas mixture was investigated. The establishing of the mathematical calibration model and the data analysis was performed with a newly developed innovative calibration and evaluation procedure called ProSens 3.0. The analysis of ternary ethanol-H2-acetone gas samples with ProSens 3.0 shows a very good substance identification performance and a very good concentration determination of the leading ethanol component. The relative analysis errors for the leading component ethanol were in all considered samples less than 9 %. First field test performed with the sensor system AGaMon shows very promising results.

  6. Enzymatic liquefaction of agarose above the sol-gel transition temperature using a thermostable endo-type β-agarase, Aga16B. (United States)

    Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon


    The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.

  7. Evaluation of lipid and glucose metabolism and cortisol and thyroid hormone levels in obese appropriate for gestational age (AGA) born and non-obese small for gestational age (SGA) born prepubertal Slovak children. (United States)

    Blusková, Zuzana; Koštálová, Ludmila; Celec, Peter; Vitáriušová, Eva; Pribilincová, Zuzana; Maršálková, Marianna; Šemberová, Jana; Kyselová, Tatiana; Hlavatá, Anna; Kovács, László


    Obesity is the major determinant of metabolic syndrome. Being born small for gestational age (SGA) may be co-responsible. We aimed at evaluating the association between 1. obesity and 2. being born SGA and the presence of endocrine-metabolic abnormalities in prepubertal Slovak children. The study included 98 children, aged 3-10.9 years: 36 AGA-born obese children (OB), 31 SGA-born children (SGA) and 31 appropriate for gestational age born non-obese children (AGA). Fasting serum levels of glucose, total cholesterol, LDL, HDL, triglycerides, fT4, TSH, cortisol and insulin were determined. HOMA-IR was calculated. Personal data about birth weight and length and family history were collected. Actual anthropometric measurement was done. In every group, high prevalence of positive family history of metabolic disorder was found. In comparison with AGA children, OB children were taller (plevels and homeostasis model assessment for insulin resistance (HOMA-IR) (pcortisol levels (p=0.069) was noted. SGA-born children were shorter (plevels (plevels (p=0.085) and increased fT4 levels (pobese children and twice more metabolic abnormalities were present in SGA-born children in comparison with AGA-born children. SGA-born children are more prone to developing endocrine-metabolic abnormalities than non-obese children born AGA, but they are at less risk than obese AGA-born children. We should provide specialized care for obese children already in prepubertal age and pay attention to SGA-born children.


    Directory of Open Access Journals (Sweden)



    Full Text Available ABSTRACT This paper consists on a bibliometric analysis of the international influences of the book "Studies on termites from the Mato Grosso State, Brazil", by AGA Mathews (1977. The number of citations has increased over the years after the first citation. Mathews book was cited in articles, reviews, theses, dissertations, books, book chapters, abstracts in conference proceedings, comments and scientific notes. Most these studies are empirical and descriptive. The studies were conducted in 35 countries of the Neotropical, Palearctic, Afrotropical, Nearctic, Australasia and Indomalaya regions. 55% of the studies were carried out in Brazil. The journals Sociobiology and Insectes Sociaux, have social insect studies within its scope, and the highest number of articles citing Mathews. Most of the 71 authors that cited Mathews more than twice are Brazilian. Constrictotermes cyphergaster was the most studied in over 80% of the studies addressing Isoptera. The most frequent keywords were termite, Isoptera and taxonomy, generalist terms indexed in most publications carried out in different countries. Most of the research studies were carried out in laboratories and native vegetation areas. Studies in agroecosystems were implemented predominantly in Brazil. This study shows the diversity of application (citations of Mathews' book, and that the number of citations will continue to increase due to the large amount of information presented by the author.

  9. Clinical Practice Update: The Use of Per-Oral Endoscopic Myotomy in Achalasia: Expert Review and Best Practice Advice From the AGA Institute. (United States)

    Kahrilas, Peter J; Katzka, David; Richter, Joel E


    The purpose of this review is to describe a place for per-oral endoscopic myotomy (POEM) among the currently available robust treatments for achalasia. The recommendations outlined in this review are based on expert opinion and on relevant publications from PubMed and EMbase. The Clinical Practice Updates Committee of the American Gastroenterological Association proposes the following recommendations: 1) in determining the need for achalasia therapy, patient-specific parameters (Chicago Classification subtype, comorbidities, early vs late disease, primary or secondary causes) should be considered along with published efficacy data; 2) given the complexity of this procedure, POEM should be performed by experienced physicians in high-volume centers because an estimated 20-40 procedures are needed to achieve competence; 3) if the expertise is available, POEM should be considered as primary therapy for type III achalasia; 4) if the expertise is available, POEM should be considered as treatment option comparable with laparoscopic Heller myotomy for any of the achalasia syndromes; and 5) post-POEM patients should be considered high risk to develop reflux esophagitis and advised of the management considerations (potential indefinite proton pump inhibitor therapy and/or surveillance endoscopy) of this before undergoing the procedure. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  10. Tipping Point

    Medline Plus

    Full Text Available ... en español Blog About OnSafety CPSC Stands for Safety The Tipping Point Home > 60 Seconds of Safety (Videos) > The Tipping Point The Tipping Point by ... danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe ...

  11. Management of Clostridium difficile Infection in Inflammatory Bowel Disease: Expert Review from the Clinical Practice Updates Committee of the AGA Institute. (United States)

    Khanna, Sahil; Shin, Andrea; Kelly, Ciarán P


    The purpose of this expert review is to synthesize the existing evidence on the management of Clostridium difficile infection in patients with underlying inflammatory bowel disease. The evidence reviewed in this article is a summation of relevant scientific publications, expert opinion statements, and current practice guidelines. This review is a summary of expert opinion in the field without a formal systematic review of evidence. Best Practice Advice 1: Clinicians should test patients who present with a flare of underlying inflammatory bowel disease for Clostridium difficile infection. Best Practice Advice 2: Clinicians should screen for recurrent C difficile infection if diarrhea or other symptoms of colitis persist or return after antibiotic treatment for C difficile infection. Best Practice Advice 3: Clinicians should consider treating C difficile infection in inflammatory bowel disease patients with vancomycin instead of metronidazole. Best Practice Advice 4: Clinicians strongly should consider hospitalization for close monitoring and aggressive management for inflammatory bowel disease patients with C difficile infection who have profuse diarrhea, severe abdominal pain, a markedly increased peripheral blood leukocyte count, or other evidence of sepsis. Best Practice Advice 5: Clinicians may postpone escalation of steroids and other immunosuppression agents during acute C difficile infection until therapy for C difficile infection has been initiated. However, the decision to withhold or continue immunosuppression in inflammatory bowel disease patients with C difficile infection should be individualized because there is insufficient existing robust literature on which to develop firm recommendations. Best Practice Advice 6: Clinicians should offer a referral for fecal microbiota transplantation to inflammatory bowel disease patients with recurrent C difficile infection. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  12. Isejuhtivate sõidukite ajastu algus

    Index Scriptorium Estoniae


    Riigikantselei strateegiabüroo tellimusel valminud isejuhtuvate sõidukite ekspertrühma raportist: isejuhtivate sõidukite sotsiaal-majanduslikud hüved ja mõjud, õigusruum, ühiskondlik omaksvõtt, eetika, ohud ja riskid

  13. Punane Veski ja plakatikunsti algus / Riina Robinson

    Index Scriptorium Estoniae

    Robinson, Riina


    Prantsuse plakatikunsti loojast Jules Cheret'st, ühest silmapaistvamast plakati- ja maalikunstnikust Henri Toulouse-Lautrecist, tema plakatite kangelannadest, kankaani tantsinud Louise Weberist ja Jane Avrilist ning Moulin Rouge'ist

  14. Põllumajanduse algus Eesti alal / Aivar Kriiska

    Index Scriptorium Estoniae

    Kriiska, Aivar, 1965-


    Varajase maaviljeluse uurimise allikatest. Esimesed terviljakasvatuse märgid korreleeruvad kammkeraamika kultuuridega. Põllumajandusest hilisneoliitikumis ja varajasel pronksiajal. Viljelev majandus tõi nöörkeraamika perioodil kaasa küla lagunemise väiksemateks asustusüksusteks - taludeks. Kiviaja lõpul toimus põllumajandusliku asustuse laienemine, kusjuures see hõlmas ka kõrgustike alasid

  15. Korobeiniku suurte plaanide algus / Jaanika Heinsoo

    Index Scriptorium Estoniae

    Heinsoo, Jaanika


    Tutvumis- ja suhtlemissait on Eesti enimkülastatud Internetisait, millel on üle 300 000 registreeritud kasutaja. omanik ning juht Andrei Korobeinik selgitab saidi fenomeni ning tutvustab selle kontseptsiooni ja laienemisplaane. Vt. samas Columbus IT juhatuse esimehe Ivo Suursoo ja Martinson Trigon Venture Partners'i tegevjuhi Allan Martinsoni kommentaare küsimusele "Mis on fenomen?"

  16. Ooperiaasta võimas algus / Tarmo Virki

    Index Scriptorium Estoniae

    Virki, Tarmo


    Einojuhani Rautavaara uue ooperi "Rasputin" esietendusest Soome Rahvusooperis 19. sept. (dirigent Mikko Franck) ja etendustest 22., 24., 27. ja 30. sept. ning 3., 6., 9. ja 11. oktoobril. Giuseppe Verdi "Trubaduur" 11., 17. ja 20. sept ning 1. okt., dirigent Eri Klas. Leosh Janaceki "Katja Kabanova" esietendusest 12. detsembril

  17. Süsinikuajastu alguses / Harry Alles

    Index Scriptorium Estoniae

    Alles, Harry, 1966-


    2010. aasta Nobeli keemiapreemia läks kolmele teenekale keemikule, Ühendriikide teadlasele Richard F. Heckile ning jaapanlastele Ei-ichi Negishile ja Akira Suzukile. Füüsikapreemia said Manchesteri ülikooli füüsikud, Venemaalt pärit Andre Geim ja Konstantin Novoselov

  18. Rõve kuubis, aga... / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-


    Dokumentaalfilm "Aristokraadid", kus ühte roppu habemega anekdooti jutustavad meelelahutustööstusest tuntud tegijad : režissöör Paul Provenza : Ameerika Ühendriigid 2006. Filmi näitab Tallinna Kinomaja

  19. Usalda, aga kontrolli / Manuela Pihlap

    Index Scriptorium Estoniae

    Pihlap, Manuela


    Uuest isikuandmete kaitse seadusest. Ilmunud ka Harju Ekspress 22. veeb. 2008, lk. 6 ; Meie Maa 26. veeb. 2008, lk. 2 ; Pärnu Postimees 28. veeb. 2008, lk. 15 ; LõunaLeht 28. veeb. 2008, lk. 4 ; Valgamaalane 28. veeb. 2008, lk. 2

  20. Fixed Points

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 5; Issue 5. Fixed Points - From Russia with Love - A Primer of Fixed Point Theory. A K Vijaykumar. Book Review Volume 5 Issue 5 May 2000 pp 101-102. Fulltext. Click here to view fulltext PDF. Permanent link:

  1. Tipping Point

    Medline Plus

    Full Text Available ... OnSafety CPSC Stands for Safety The Tipping Point Home > 60 Seconds of Safety (Videos) > The Tipping Point ... 24 hours a day. For young children whose home is a playground, it’s the best way to ...

  2. Tipping Point

    Medline Plus

    Full Text Available ... 60 Seconds of Safety (Videos) > The Tipping Point The Tipping Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash ...

  3. Dew Point


    Goldsmith, Shelly


    Dew Point was a solo exhibition originating at PriceWaterhouseCoopers Headquarters Gallery, London, UK and toured to the Centre de Documentacio i Museu Textil, Terrassa, Spain and Gallery Aoyama, Tokyo, Japan.

  4. Tipping Point

    Medline Plus

    Full Text Available ... Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash ...

  5. Tipping Point (United States)

    ... Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash ...

  6. Tipping Point

    Medline Plus

    Full Text Available ... Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head ... see news reports about horrible accidents involving young children and furniture, appliance and tv tip-overs. The ...

  7. Tipping Point

    Medline Plus

    Full Text Available ... Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head ... TV falls with about the same force as child falling from the third story of a building. ...

  8. Tipping Point

    Medline Plus

    Full Text Available ... Tipping Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture ... about horrible accidents involving young children and furniture, appliance and tv tip-overs. The force of a ...

  9. Quaternary selenostannates Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs) through rapid cooling of melts. Kinetics versus thermodynamics in the polymorphism of AGaSnSe{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S -J; Iyer, R G; Kanatzidis, M G


    The quaternary alkali-metal gallium selenostannates, Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs), were synthesized by reacting alkali-metal selenide, Ga, Sn, and Se with a flame melting-rapid cooling method. Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} crystallizes in the non-centrosymmetric space group C2 with cell constants a=13.308(3) A, b=7.594(2) A, c=13.842(3) A, {beta}=118.730(4) deg., V=1226.7(5) A{sup 3}. {alpha}-KGaSnSe{sub 4} crystallizes in the tetragonal space group I4/mcm with a=8.186(5) A and c=6.403(5) A, V=429.1(5) A{sup 3}. {beta}-KGaSnSe{sub 4} crystallizes in the space group P2{sub 1}/c with cell constants a=7.490(2) A, b=12.578(3) A, c=18.306(5) A, {beta}=98.653(5) deg., V=1705.0(8) A{sup 3}. The unit cell of isostructural RbGaSnSe{sub 4} is a=7.567(2) A, b=12.656(3) A, c=18.277(4) A, {beta}=95.924(4) deg., V=1741.1(7) A{sup 3}. CsGaSnSe{sub 4} crystallizes in the orthorhombic space group Pmcn with a=7.679(2) A, b=12.655(3) A, c=18.278(5) A, V=1776.1(8) A{sup 3}. The structure of Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} consists of a polar three-dimensional network of trimeric (Sn,Ga){sub 3}Se{sub 9} units with Na atoms located in tunnels. The AGaSnSe{sub 4} possess layered structures. The compounds show nearly the same Raman spectral features, except for Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6}. Optical band gaps, determined from UV-Vis spectroscopy, range from 1.50 eV in Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} to 1.97 eV in CsGaSnSe{sub 4}. Cooling of the melts of KGaSnSe{sub 4} and RbGaSnSe{sub 4} produces only kinetically stable products. The thermodynamically stable product is accessible under extended annealing, which leads to the so-called {gamma}-form (BaGa{sub 2}S{sub 4}-type) of these compounds.

  10. White Paper AGA: An Episode-of-Care Framework for the Management of Obesity-Moving Toward High Value, High Quality Care: A Report From the American Gastroenterological Association Institute Obesity Episode of Care and Bundle Initiative Work Group. (United States)

    Brill, Joel V; Ashmore, Jamile A; Brengman, Matthew L; Buffington, Daniel E; Feldshon, S David; Friedman, Kelli E; Margolis, Peter S; Markus, Danielle; Narramore, Leslie; Rastogi, Amita; Starpoli, Anthony A; Strople, Kenneth; White, Jane V; Streett, Sarah E


    The American Gastroenterological Association acknowledges the need for gastroenterologists to participate in and provide value-based care for both cognitive and procedural conditions. Episodes of care are designed to engage specialists in the movement toward fee for value, while facilitating improved outcomes and patient experience and a reduction in unnecessary services and overall costs. The episode of care model puts the patient at the center of all activity related to their particular diagnosis, procedure, or health care event, rather than on a physician's specific services. It encourages and incents communication, collaboration, and coordination across the full continuum of care and creates accountability for the patient's entire experience and outcome. This paper outlines a collaborative approach involving multiple stakeholders for gastrointestinal practices to assess their ability to participate in and implement an episode of care for obesity and understand the essentials of coding and billing for these services. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  11. Aga miks mitte panustada teraviljale? / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo


    Üha populaarsust koguvate ETFide ehk börsil kaubeldavate fondide hulka on lisandunud ka viimaste variatsioonid ETCd ehk börsil kaubeldavad toorained, nende perspektiivikust tõstab tarbimise kasv maailmas. Tabel: Millistel börsidel tehakse tehinguid ETF-idega

  12. Hiilgav, aga... / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar


    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Earth 2" (1994), "EZ Streets" (1996), "Profit" (1996), "Strange World" (1999), "The Inside" (2005), "Drive" (2007), "Aliens in America" (2007)

  13. Edasi loodusesse! Aga kuhu? / Riina Oruaas

    Index Scriptorium Estoniae

    Oruaas, Riina


    Tantsulavastustest: Oksana Titova, Päär Pärenson ja Juhan Ulfsak "Roots", Kaja Kanni sooloetendus "There are Laika dogs living in Estonia", Tiina Mölder, Kaja Kann ja Bush Hartshor "Naine ja Hunt"

  14. Nähtamatu näitleja / Yoshi Oida, Lorna Marshall ; tõlk. Peeter Raudsepp

    Index Scriptorium Estoniae

    Oida, Yoshi


    Jaapani näitlejaYoshi Oida näitlemisest erinevates traditsioonilistes jaapani teatristiilides, aga ka lääne stiili näidendites. Katkendid tema raamatust "Nähtamatu näitleja", mille kaasautor on Lorna Marshall. "The Invisible Actor", Methuen, 1997). Algus: TMK 2004, nr.12. Järg nr. 2, lk. 27-32

  15. Ühe ajastu lõpu algus / Kalev Kask

    Index Scriptorium Estoniae

    Kask, Kalev


    Ilmunud ka: Meie Maa, 9. nov. 2004, lk. 7. Yasser Arafati tervislik seisund on halvenemas, seni pole ta ametlikult kedagi oma järeltulijaks määranud. Palestiinlased peaksid suutma valida talle kombekohase järglase, vastasel juhul satuvad nad keerulisse võimuvõitlusse, millest saab kasu eelkõige Iisrael, leiab autor

  16. Mai alguses linastub dokfilm "Sinimäed" / Andris Feldmanis

    Index Scriptorium Estoniae

    Feldmanis, Andris, 1982-


    Valminud on 6-osalise ajaloodokumentaalide sarja "Kuum külm sõda" teine film "Sinimäed" : stsenaristid Kiur Aarma, Mart Laar, Eerik-Niiles Kross, Raimo Jõerand : režissöör Raimo Jõerand : Ruut Pictures

  17. Aprilli lõpus ja mai alguses osales...

    Index Scriptorium Estoniae


    Rühmitus Avangard osales Chicagos toimunud eksperimentaalsel kunstifestivalil "Version", alapealkirjaga "Invincible Desire". Avangard näitas oma videosid ja fotoseeriat "The Bomb - back with vengeance"

  18. Silvano üllatas tugeva aasta alguse tulemusega / Silvia Viidik

    Index Scriptorium Estoniae

    Viidik, Silvia, 1972-


    Rahvusvahelise naistrerõivaste müügiketi Silvano Fashion Groupi käive kasvas 2009. a. I kvartaliga võrreldes veerandi võrra. Silvano tulud on suurenenud tänu nõudluse taastumisele Vene turul. Baltika kahjum I kvartalis oli 32 mln. krooni, mida on 50% vähem kui aasta tagasi. Graafik

  19. Õnnestumised saavad alguse teadmistest / Mihkel Kangur

    Index Scriptorium Estoniae

    Kangur, Mihkel


    Edu saavutamisest sporthobuste tõuaretuses Itaalia arhitekti ja riigiametniku ning Donatello hobusekasvatuse looja Federico Tesio ning Belgia veterinaari ja hobusekasvataja Joris de Brabander'i töö näitel

  20. Etenduse algus. Jaime Hay̤n / Ele Praks

    Index Scriptorium Estoniae

    Praks, Ele


    Luciano Benettoni juures töötanud hispaania disainerist, kes 2002. aastal kuulutati kõige paljutõotavamaks nooreks disaineriks Hispaanias ja kelle vannitoakollektsioon sai 2005. aastal Elle Deco rahvusvahelise auhinna

  1. Maian Kärmas teeb alguse Jõulujazzile Tartus / Lia Eller

    Index Scriptorium Estoniae

    Eller, Lia


    Jõulujazzi üritustest Tartus: Maian Kärmase kontserdist Sadamateatris "Tuigutuled", Arne Oidi 75. sünniaastapäeva tähistavast kontserdist Vanemuise kontserdisaalis 4. dets., ameerika ansambli Gold Company Sextet kontserdist 15. detsembril

  2. Kõik sai alguse juhusest / Nicholas Sinclair ; interv. Marge Monko

    Index Scriptorium Estoniae

    Sinclair, Nicholas


    Inglise portreefotograaf ja 2003 a. Hasselbladi meister Nicholas Sinclair oma fotograafi karjäärist, ilmunud fotoalbumitest, näitustest, peamistest meelisteemadest ja töö- ning õpetamismeetoditest

  3. Hea haridus saab alguse headest õpetajatest / Tõnis Lukas

    Index Scriptorium Estoniae

    Lukas, Tõnis, 1962-


    Ilmunud ka: Põhjarannik 2. veebr. 2008, lk. 4, Severnoje Poberezhje 2. veebr. 2008, lk. 4., Pärnu Postimees 2. veebr. lk 19, Meie Maa 4. veebr. lk. 2, Lääne Elu 5. veebr. 2008, lk. 2, Hiiu Leht 5. veebr. 2008, lk. 2, Nädaline 5. veebr. 2008, lk. 4., Võrumaa Teataja 5. veebr. lk. 2, Harju Elu 8. veebr. lk. 2, Koit 12. veebr. lk. 6, Järva Teataja 19. veebr. lk. 2, Sakala 20. veebr. lk. 2. Valitsus kiitis heaks haridusminister Tõnis Lukase poolt esitatud määruse eelnõu, mille kohaselt tõusevad õpetajate palkade alammäärad käesoleva aasta esimesest jaanuarist 22% võrra

  4. The End of Points (United States)

    Feldman, Jo


    Have teachers become too dependent on points? This article explores educators' dependency on their points systems, and the ways that points can distract teachers from really analyzing students' capabilities and achievements. Feldman argues that using a more subjective grading system can help illuminate crucial information about students and what…

  5. Demerit points systems.

    NARCIS (Netherlands)


    In 2012, 21 of the 27 EU Member States had some form of demerit points system. In theory, demerit points systems contribute to road safety through three mechanisms: 1) prevention of unsafe behaviour through the risk of receiving penalty points, 2) selection and suspension of the most frequent

  6. Point specificity in acupuncture

    Directory of Open Access Journals (Sweden)

    Choi Emma M


    Full Text Available Abstract The existence of point specificity in acupuncture is controversial, because many acupuncture studies using this principle to select control points have found that sham acupoints have similar effects to those of verum acupoints. Furthermore, the results of pain-related studies based on visual analogue scales have not supported the concept of point specificity. In contrast, hemodynamic, functional magnetic resonance imaging and neurophysiological studies evaluating the responses to stimulation of multiple points on the body surface have shown that point-specific actions are present. This review article focuses on clinical and laboratory studies supporting the existence of point specificity in acupuncture and also addresses studies that do not support this concept. Further research is needed to elucidate the point-specific actions of acupuncture.

  7. Interesting Interest Points

    DEFF Research Database (Denmark)

    Aanæs, Henrik; Dahl, Anders Lindbjerg; Pedersen, Kim Steenstrup


    on spatial invariance of interest points under changing acquisition parameters by measuring the spatial recall rate. The scope of this paper is to investigate the performance of a number of existing well-established interest point detection methods. Automatic performance evaluation of interest points is hard......Not all interest points are equally interesting. The most valuable interest points lead to optimal performance of the computer vision method in which they are employed. But a measure of this kind will be dependent on the chosen vision application. We propose a more general performance measure based...... position. The LED illumination provides the option for artificially relighting the scene from a range of light directions. This data set has given us the ability to systematically evaluate the performance of a number of interest point detectors. The highlights of the conclusions are that the fixed scale...

  8. Point defects in solids

    International Nuclear Information System (INIS)



    The principal properties of point defects are studied: thermodynamics, electronic structure, interactions with etended defects, production by irradiation. Some measuring methods are presented: atomic diffusion, spectroscopic methods, diffuse scattering of neutron and X rays, positron annihilation, molecular dynamics. Then points defects in various materials are investigated: ionic crystals, oxides, semiconductor materials, metals, intermetallic compounds, carbides, nitrides [fr

  9. Indexing Moving Points

    DEFF Research Database (Denmark)

    Agarwal, Pankaj K.; Arge, Lars Allan; Erickson, Jeff


    We propose three indexing schemes for storing a set S of N points in the plane, each moving along a linear trajectory, so that any query of the following form can be answered quickly: Given a rectangle R and a real value t, report all K points of S that lie inside R at time t. We first present an...

  10. Generalized zero point anomaly

    International Nuclear Information System (INIS)

    Nogueira, Jose Alexandre; Maia Junior, Adolfo


    It is defined Zero point Anomaly (ZPA) as the difference between the Effective Potential (EP) and the Zero point Energy (ZPE). It is shown, for a massive and interacting scalar field that, in very general conditions, the renormalized ZPA vanishes and then the renormalized EP and ZPE coincide. (author). 3 refs

  11. Poisson branching point processes

    International Nuclear Information System (INIS)

    Matsuo, K.; Teich, M.C.; Saleh, B.E.A.


    We investigate the statistical properties of a special branching point process. The initial process is assumed to be a homogeneous Poisson point process (HPP). The initiating events at each branching stage are carried forward to the following stage. In addition, each initiating event independently contributes a nonstationary Poisson point process (whose rate is a specified function) located at that point. The additional contributions from all points of a given stage constitute a doubly stochastic Poisson point process (DSPP) whose rate is a filtered version of the initiating point process at that stage. The process studied is a generalization of a Poisson branching process in which random time delays are permitted in the generation of events. Particular attention is given to the limit in which the number of branching stages is infinite while the average number of added events per event of the previous stage is infinitesimal. In the special case when the branching is instantaneous this limit of continuous branching corresponds to the well-known Yule--Furry process with an initial Poisson population. The Poisson branching point process provides a useful description for many problems in various scientific disciplines, such as the behavior of electron multipliers, neutron chain reactions, and cosmic ray showers

  12. The Lagrangian Points (United States)

    Linton, J. Oliver


    There are five unique points in a star/planet system where a satellite can be placed whose orbital period is equal to that of the planet. Simple methods for calculating the positions of these points, or at least justifying their existence, are developed.

  13. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P


    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  14. Publication point indicators

    DEFF Research Database (Denmark)

    Elleby, Anita; Ingwersen, Peter


    ; the Cumulated Publication Point Indicator (CPPI), which graphically illustrates the cumulated gain of obtained vs. ideal points, both seen as vectors; and the normalized Cumulated Publication Point Index (nCPPI) that represents the cumulated gain of publication success as index values, either graphically......The paper presents comparative analyses of two publication point systems, The Norwegian and the in-house system from the interdisciplinary Danish Institute of International Studies (DIIS), used as case in the study for publications published 2006, and compares central citation-based indicators...... with novel publication point indicators (PPIs) that are formalized and exemplified. Two diachronic citation windows are applied: 2006-07 and 2006-08. Web of Science (WoS) as well as Google Scholar (GS) are applied to observe the cite delay and citedness for the different document types published by DIIS...

  15. Multispectral Image Feature Points

    Directory of Open Access Journals (Sweden)

    Cristhian Aguilera


    Full Text Available This paper presents a novel feature point descriptor for the multispectral image case: Far-Infrared and Visible Spectrum images. It allows matching interest points on images of the same scene but acquired in different spectral bands. Initially, points of interest are detected on both images through a SIFT-like based scale space representation. Then, these points are characterized using an Edge Oriented Histogram (EOH descriptor. Finally, points of interest from multispectral images are matched by finding nearest couples using the information from the descriptor. The provided experimental results and comparisons with similar methods show both the validity of the proposed approach as well as the improvements it offers with respect to the current state-of-the-art.

  16. Do acupuncture points exist?

    International Nuclear Information System (INIS)

    Yan Xiaohui; Zhang Xinyi; Liu Chenglin; Dang, Ruishan; Huang Yuying; He Wei; Ding Guanghong


    We used synchrotron x-ray fluorescence analysis to probe the distribution of four chemical elements in and around acupuncture points, two located in the forearm and two in the lower leg. Three of the four acupuncture points showed significantly elevated concentrations of elements Ca, Fe, Cu and Zn in relation to levels in the surrounding tissue, with similar elevation ratios for Cu and Fe. The mapped distribution of these elements implies that each acupuncture point seems to be elliptical with the long axis along the meridian. (note)

  17. Do acupuncture points exist?

    Energy Technology Data Exchange (ETDEWEB)

    Yan Xiaohui; Zhang Xinyi [Department of Physics, Surface Physics Laboratory (State Key Laboratory), and Synchrotron Radiation Research Center of Fudan University, Shanghai 200433 (China); Liu Chenglin [Physics Department of Yancheng Teachers' College, Yancheng 224002 (China); Dang, Ruishan [Second Military Medical University, Shanghai 200433 (China); Huang Yuying; He Wei [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100039 (China); Ding Guanghong [Shanghai Research Center of Acupuncture and Meridian, Pudong, Shanghai 201203 (China)


    We used synchrotron x-ray fluorescence analysis to probe the distribution of four chemical elements in and around acupuncture points, two located in the forearm and two in the lower leg. Three of the four acupuncture points showed significantly elevated concentrations of elements Ca, Fe, Cu and Zn in relation to levels in the surrounding tissue, with similar elevation ratios for Cu and Fe. The mapped distribution of these elements implies that each acupuncture point seems to be elliptical with the long axis along the meridian. (note)

  18. Marine Point Forecasts (United States)

    will link to the zone forecast and then allow further zooming to the point of interest whereas on the Honolulu, HI Chicago, IL Northern Indiana, IN Lake Charles, LA New Orleans, LA Boston, MA Caribou, ME

  19. Critical-point nuclei

    International Nuclear Information System (INIS)

    Clark, R.M.


    It has been suggested that a change of nuclear shape may be described in terms of a phase transition and that specific nuclei may lie close to the critical point of the transition. Analytical descriptions of such critical-point nuclei have been introduced recently and they are described briefly. The results of extensive searches for possible examples of critical-point behavior are presented. Alternative pictures, such as describing bands in the candidate nuclei using simple ΔK = 0 and ΔK = 2 rotational-coupling models, are discussed, and the limitations of the different approaches highlighted. A possible critical-point description of the transition from a vibrational to rotational pairing phase is suggested

  20. National Wetlands Inventory Points (United States)

    Minnesota Department of Natural Resources — Wetland point features (typically wetlands that are too small to be as area features at the data scale) mapped as part of the National Wetlands Inventory (NWI). The...

  1. Allegheny County Address Points (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — This dataset contains address points which represent physical address locations assigned by the Allegheny County addressing authority. Data is updated by County...

  2. Iowa Geologic Sampling Points (United States)

    Iowa State University GIS Support and Research Facility — Point locations of geologic samples/files in the IGS repository. Types of samples include well cuttings, outcrop samples, cores, drillers logs, measured sections,...

  3. Characterizing fixed points

    Directory of Open Access Journals (Sweden)

    Sanjo Zlobec


    Full Text Available A set of sufficient conditions which guarantee the existence of a point x⋆ such that f(x⋆ = x⋆ is called a "fixed point theorem". Many such theorems are named after well-known mathematicians and economists. Fixed point theorems are among most useful ones in applied mathematics, especially in economics and game theory. Particularly important theorem in these areas is Kakutani's fixed point theorem which ensures existence of fixed point for point-to-set mappings, e.g., [2, 3, 4]. John Nash developed and applied Kakutani's ideas to prove the existence of (what became known as "Nash equilibrium" for finite games with mixed strategies for any number of players. This work earned him a Nobel Prize in Economics that he shared with two mathematicians. Nash's life was dramatized in the movie "Beautiful Mind" in 2001. In this paper, we approach the system f(x = x differently. Instead of studying existence of its solutions our objective is to determine conditions which are both necessary and sufficient that an arbitrary point x⋆ is a fixed point, i.e., that it satisfies f(x⋆ = x⋆. The existence of solutions for continuous function f of the single variable is easy to establish using the Intermediate Value Theorem of Calculus. However, characterizing fixed points x⋆, i.e., providing answers to the question of finding both necessary and sufficient conditions for an arbitrary given x⋆ to satisfy f(x⋆ = x⋆, is not simple even for functions of the single variable. It is possible that constructive answers do not exist. Our objective is to find them. Our work may require some less familiar tools. One of these might be the "quadratic envelope characterization of zero-derivative point" recalled in the next section. The results are taken from the author's current research project "Studying the Essence of Fixed Points". They are believed to be original. The author has received several feedbacks on the preliminary report and on parts of the project

  4. Photoacoustic Point Source

    International Nuclear Information System (INIS)

    Calasso, Irio G.; Craig, Walter; Diebold, Gerald J.


    We investigate the photoacoustic effect generated by heat deposition at a point in space in an inviscid fluid. Delta-function and long Gaussian optical pulses are used as sources in the wave equation for the displacement potential to determine the fluid motion. The linear sound-generation mechanism gives bipolar photoacoustic waves, whereas the nonlinear mechanism produces asymmetric tripolar waves. The salient features of the photoacoustic point source are that rapid heat deposition and nonlinear thermal expansion dominate the production of ultrasound

  5. Unconventional Quantum Critical Points


    Xu, Cenke


    In this paper we review the theory of unconventional quantum critical points that are beyond the Landau's paradigm. Three types of unconventional quantum critical points will be discussed: (1). The transition between topological order and semiclassical spin ordered phase; (2). The transition between topological order and valence bond solid phase; (3). The direct second order transition between different competing orders. We focus on the field theory and universality class of these unconventio...

  6. SharePoint governance


    Ali, Mudassar


    Masteroppgave i informasjons- og kommunikasjonsteknologi IKT590 2013 – Universitetet i Agder, Grimstad SharePoint is a web-based business collaboration platform from Microsoft which is very robust and dynamic in nature. The platform has been in the market for more than a decade and has been adapted by large number of organisations in the world. The platform has become larger in scale, richer in features and is improving consistently with every new version. However, SharePoint ...

  7. Publication point indicators

    DEFF Research Database (Denmark)

    Elleby, Anita; Ingwersen, Peter


    The paper presents comparative analyses of two publication point systems, The Norwegian and the in-house system from the interdiscplinary Danish Institute for International Studies (DIIS), used as case in the study for publications published 2006, and compares central citation-based indicators...... with novel publication point indicators (PPIs) that are formalized and exemplified. Two diachronic citation windows are applied: 2006-07 and 2006-08. Web of Science (WoS) as well as Google Scholar (GS) are applied to observe the cite delay and citedness for the different document types published by DIIS...... for all document types. Statistical significant correlations were only found between WoS and GS and the two publication point systems in between, respectively. The study demonstrates how the nCPPI can be applied to institutions as evaluation tools supplementary to JCI in various combinations...

  8. New Novae snack point

    CERN Document Server


    Located next to the car park by the flag poles, a few metres from the Main CERN Reception (building 33), a new snack point catered by Novae will open to the public on Wednesday 8 August. More information will be available in the next issue of the Bulletin!

  9. [Clinical key points. Gonioscopy]. (United States)

    Hamard, P


    Gonioscopy should be performed in all patients with glaucoma or suspected of having glaucoma. Four points are systematically evaluated: the width of the angle, the degree of trabecular pigmentation, the iridotrabecular appositions or synechia, and the level of iris insertion and the shape of the peripheral iris profile.

  10. ACS Zero Point Verification (United States)

    Dolphin, Andrew


    The uncertainties in the photometric zero points create a fundamental limit to the accuracy of photometry. The current state of the ACS calibration is surprisingly poor, with zero point uncertainties of 0.03 magnitudes. The reason for this is that the ACS calibrations are based primarily on semi-emprical synthetic zero points and observations of fields too crowded for accurate ground-based photometry. I propose to remedy this problem by obtaining ACS images of the omega Cen standard field with all nine broadband ACS/WFC filters. This will permit the direct determination of the ACS zero points by comparison with excellent ground-based photometry, and should reduce their uncertainties to less than 0.01 magnitudes. A second benefit is that it will facilitate the comparison of the WFPC2 and ACS photometric systems, which will be important as WFPC2 is phased out and ACS becomes HST's primary imager. Finally, three of the filters will be repeated from my Cycle 12 observations, allowing for a measurement of any change in sensitivity.

  11. Point Lepreau generating station

    International Nuclear Information System (INIS)

    Ganong, G.H.D.; Strang, A.E.; Gunter, G.E.; Thompson, T.S.

    Point Lepreau-1 reactor is a 600 MWe generating station expected to be in service by October 1979. New Brunswick is suffering a 'catch up' phenomenon in load growth and needs to decrease dependence on foreign oil. The site is on salt water and extensive study has gone into corrosion control. Project management, financing and scheduling have unique aspects. (E.C.B.)

  12. Least fixed points revisited

    NARCIS (Netherlands)

    J.W. de Bakker (Jaco)


    textabstractParameter mechanisms for recursive procedures are investigated. Contrary to the view of Manna et al., it is argued that both call-by-value and call-by-name mechanisms yield the least fixed points of the functionals determined by the bodies of the procedures concerned. These functionals

  13. Point kinetics modeling

    International Nuclear Information System (INIS)

    Kimpland, R.H.


    A normalized form of the point kinetics equations, a prompt jump approximation, and the Nordheim-Fuchs model are used to model nuclear systems. Reactivity feedback mechanisms considered include volumetric expansion, thermal neutron temperature effect, Doppler effect and void formation. A sample problem of an excursion occurring in a plutonium solution accidentally formed in a glovebox is presented

  14. Melting point of yttria

    International Nuclear Information System (INIS)

    Skaggs, S.R.


    Fourteen samples of 99.999 percent Y 2 O 3 were melted near the focus of a 250-W CO 2 laser. The average value of the observed melting point along the solid-liquid interface was 2462 +- 19 0 C. Several of these same samples were then melted in ultrahigh-purity oxygen, nitrogen, helium, or argon and in water vapor. No change in the observed temperature was detected, with the exception of a 20 0 C increase in temperature from air to helium gas. Post test examination of the sample characteristics, clarity, sphericity, and density is presented, along with composition. It is suggested that yttria is superior to alumina as a secondary melting-point standard

  15. 'Saddle-point' ionization

    International Nuclear Information System (INIS)

    Gay, T.J.; Hale, E.B.; Irby, V.D.; Olson, R.E.; Missouri Univ., Rolla; Berry, H.G.


    We have studied the ionization of rare gases by protons at intermediate energies, i.e., energies at which the velocities of the proton and the target-gas valence electrons are comparable. A significant channel for electron production in the forward direction is shown to be 'saddle-point' ionization, in which electrons are stranded on or near the saddle-point of electric potential between the receding projectile and the ionized target. Such electrons yield characteristic energy spectra, and contribute significantly to forward-electron-production cross sections. Classical trajectory Monte Carlo calculations are found to provide qualitative agreement with our measurements and the earlier measurements of Rudd and coworkers, and reproduce, in detail, the features of the general ionization spectra. (orig.)

  16. High boiling point hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Pier, M


    A process is given for the production of hydrocarbons of high boiling point, such as lubricating oils, from bituminous substances, such as varieties of coal, shale, or other solid distillable carbonaceous materials. The process consists of treating the initial materials with organic solvents and then subjecting the products extracted from the initial materials, preferably directly, to a reducing treatment in respect to temperature, pressure, and time. The reduction treatment is performed by means of hydrogen under pressure.

  17. Critical point predication device

    International Nuclear Information System (INIS)

    Matsumura, Kazuhiko; Kariyama, Koji.


    An operation for predicting a critical point by using a existent reverse multiplication method has been complicated, and an effective multiplication factor could not be plotted directly to degrade the accuracy for the prediction. The present invention comprises a detector counting memory section for memorizing the counting sent from a power detector which monitors the reactor power, a reverse multiplication factor calculation section for calculating the reverse multiplication factor based on initial countings and current countings of the power detector, and a critical point prediction section for predicting the criticality by the reverse multiplication method relative to effective multiplication factors corresponding to the state of the reactor core previously determined depending on the cases. In addition, a reactor core characteristic calculation section is added for analyzing an effective multiplication factor depending on the state of the reactor core. Then, if the margin up to the criticality is reduced to lower than a predetermined value during critical operation, an alarm is generated to stop the critical operation when generation of a period of more than a predetermined value predicted by succeeding critical operation. With such procedures, forecasting for the critical point can be easily predicted upon critical operation to greatly mitigate an operator's burden and improve handling for the operation. (N.H.)

  18. At the Tipping Point

    Energy Technology Data Exchange (ETDEWEB)

    Wiley, H. S.


    There comes a time in every field of science when things suddenly change. While it might not be immediately apparent that things are different, a tipping point has occurred. Biology is now at such a point. The reason is the introduction of high-throughput genomics-based technologies. I am not talking about the consequences of the sequencing of the human genome (and every other genome within reach). The change is due to new technologies that generate an enormous amount of data about the molecular composition of cells. These include proteomics, transcriptional profiling by sequencing, and the ability to globally measure microRNAs and post-translational modifications of proteins. These mountains of digital data can be mapped to a common frame of reference: the organism’s genome. With the new high-throughput technologies, we can generate tens of thousands of data points from each sample. Data are now measured in terabytes and the time necessary to analyze data can now require years. Obviously, we can’t wait to interpret the data fully before the next experiment. In fact, we might never be able to even look at all of it, much less understand it. This volume of data requires sophisticated computational and statistical methods for its analysis and is forcing biologists to approach data interpretation as a collaborative venture.

  19. Maximum power point tracking

    International Nuclear Information System (INIS)

    Enslin, J.H.R.


    A well engineered renewable remote energy system, utilizing the principal of Maximum Power Point Tracking can be m ore cost effective, has a higher reliability and can improve the quality of life in remote areas. This paper reports that a high-efficient power electronic converter, for converting the output voltage of a solar panel, or wind generator, to the required DC battery bus voltage has been realized. The converter is controlled to track the maximum power point of the input source under varying input and output parameters. Maximum power point tracking for relative small systems is achieved by maximization of the output current in a battery charging regulator, using an optimized hill-climbing, inexpensive microprocessor based algorithm. Through practical field measurements it is shown that a minimum input source saving of 15% on 3-5 kWh/day systems can easily be achieved. A total cost saving of at least 10-15% on the capital cost of these systems are achievable for relative small rating Remote Area Power Supply systems. The advantages at larger temperature variations and larger power rated systems are much higher. Other advantages include optimal sizing and system monitor and control

  20. Vernal Point and Anthropocene (United States)

    Chavez-Campos, Teodosio; Chavez S, Nadia; Chavez-Sumarriva, Israel


    The time scale was based on the internationally recognized formal chronostratigraphical /geochronological subdivisions of time: The Phanerozoic Eonathem/Eon; the Cenozoic Erathem/Era; the Quaternary System/Period; the Pleistocene and Holocene Series/Epoch. The Quaternary was divided into: (1) The Pleistocene that was characterized by cycles of glaciations (intervals between 40,000 and 100,000 years). (2) The Holocene that was an interglacial period that began about 12,000 years ago. It was believed that the Milankovitch cycles (eccentricity, axial tilt and the precession of the equinoxes) were responsible for the glacial and interglacial Holocene periods. The magnetostratigraphic units have been widely used for global correlations valid for Quaternary. The gravitational influence of the sun and moon on the equatorial bulges of the mantle of the rotating earth causes the precession of the earth. The retrograde motion of the vernal point through the zodiacal band is 26,000 years. The Vernal point passes through each constellation in an average of 2000 years and this period of time was correlated to Bond events that were North Atlantic climate fluctuations occurring every ≡1,470 ± 500 years throughout the Holocene. The vernal point retrogrades one precessional degree approximately in 72 years (Gleissberg-cycle) and approximately enters into the Aquarius constellation on March 20, 1940. On earth this entry was verify through: a) stability of the magnetic equator in the south central zone of Peru and in the north zone of Bolivia, b) the greater intensity of equatorial electrojet (EEJ) in Peru and Bolivia since 1940. With the completion of the Holocene and the beginning of the Anthropocene (widely popularized by Paul Crutzen) it was proposed the date of March 20, 1940 as the beginning of the Anthropocene. The date proposed was correlated to the work presented in IUGG (Italy 2007) with the title "Cusco base meridian for the study of geophysical data"; Cusco was

  1. Point/Counterpoint

    DEFF Research Database (Denmark)

    Ungar, David; Ernst, Erik


    Point Argument: "Dynamic Languages (in Reactive Environments) Unleash Creativity," by David Ungar. For the sake of creativity, the profession needs to concentrate more on inventing new and better dynamic languages and environments and less on improving static languages. Counterpoint Argument......: "Explicitly Declared Static Types: The Missing Links," by Erik Ernst. How do we understand software? Using it is a powerful approach, but it provides examples of properties, not general truths. Some static knowledge is needed. This department is part of a special issue on dynamically typed languages....

  2. Mise au point

    African Journals Online (AJOL)

    tomie est replacé et fixé par des fils d'acier, krönlein lais- sait ce fragment pédiculé au fascia temporalis afin d'évi- ter la dépression de la fosse temporale due à la désinser- tion du muscle temporal [20] ; dans notre série, après reconstitution du cadre, le muscle temporal est suturé à son point d'insertion. pour les tumeurs ...

  3. Torsades de Pointes

    Directory of Open Access Journals (Sweden)

    Richard J Chen, MD


    Full Text Available History of present illness: 70-year-old male with a history ventricular arrhythmia, AICD (automated implantable cardioverter defibrillator, coronary artery disease and cardiac stents presented to the Emergency Department after three AICD discharges with dyspnea but no chest pain. During triage, he was found to have an irregular radial pulse and was placed on a cardiac monitor. Significant findings: The patient was found to be in a polymorphic ventricular tachycardia; he was alert, awake and asymptomatic. A rhythm strip showed a wide complex tachycardia with the QRS complex varying in amplitude around the isoelectric line consistent with Torsades de Pointes. Discussion: Torsades de Pointes (TdP is a specific type of polymorphic ventricular tachycardia. The arrhythmia’s characteristic morphology consists of the QRS complex “twisting” around the isoelectric line with gradual variation of the amplitude, reflecting its literal translation of “twisting of the points.”1 This arrhythmia occurs in the context of prolonged QT. The most common form of acquired QT prolongation is medication induced. Common causes include antiarrhythmics, antipsychotics, antiemetics, and antibiotics.2 Patient specific risk factors include female sex, bradycardia, hypokalemia, hypomagnesemia, hypocalcemia, hypothermia and heart disease.3 In the setting of prolonged QT, the repolarization phase is extended. TdP is initiated when a PVC (premature ventricular contraction occurs during this repolarization, known as an ‘R on T’ phenomenon. TdP is often asymptomatic and self-limited. The danger in TdP is its potential to deteriorate into ventricular fibrillation. A mainstay of management of TdP is prevention of risk factors when possible.4 Unstable patients should be treated with synchronized cardioversion. Magnesium sulfate should be administered in all cases of TdP.1 If a patient is not responsive to magnesium, consider isoproterenol, amiodarone, and overdrive

  4. Pointing control for LDR (United States)

    Yam, Y.; Briggs, C.


    One important aspect of the LDR control problem is the possible excitations of structural modes due to random disturbances, mirror chopping, and slewing maneuvers. An analysis was performed to yield a first order estimate of the effects of such dynamic excitations. The analysis involved a study of slewing jitters, chopping jitters, disturbance responses, and pointing errors, making use of a simplified planar LDR model which describes the LDR dynamics on a plane perpendicular to the primary reflector. Briefly, the results indicate that the command slewing profile plays an important role in minimizing the resultant jitter, even to a level acceptable without any control action. An optimal profile should therefore be studied.

  5. Point of Care Ultrasound

    DEFF Research Database (Denmark)

    Dietrich, Christoph F; Goudie, Adrian; Chiorean, Liliana


    Over the last decade, the use of portable ultrasound scanners has enhanced the concept of point of care ultrasound (PoC-US), namely, "ultrasound performed at the bedside and interpreted directly by the treating clinician." PoC-US is not a replacement for comprehensive ultrasound, but rather allows...... and critical care medicine, cardiology, anesthesiology, rheumatology, obstetrics, neonatology, gynecology, gastroenterology and many other applications. In the future, PoC-US will be more diverse than ever and be included in medical student training....

  6. The point on.

    International Nuclear Information System (INIS)


    In this last article, we find the point of view about the world petroleum activity, the reserves and the recent discoveries, the deep offshore, the technological developments in petroleum upstream. The petroleum situation in China is treated. The trends of world refining are described. The recent technological developments in the petroleum downstream are detailed. The prices of crude oil and the refining margins are the subject of a chapter. The investments of hydrocarbons area are given, the world trade and the lng projects, the gas availability in Western Europe have their place. The trends of European automobile industry and the fuels distribution are also discussed. (N.C.)

  7. Relative Critical Points

    Directory of Open Access Journals (Sweden)

    Debra Lewis


    Full Text Available Relative equilibria of Lagrangian and Hamiltonian systems with symmetry are critical points of appropriate scalar functions parametrized by the Lie algebra (or its dual of the symmetry group. Setting aside the structures – symplectic, Poisson, or variational – generating dynamical systems from such functions highlights the common features of their construction and analysis, and supports the construction of analogous functions in non-Hamiltonian settings. If the symmetry group is nonabelian, the functions are invariant only with respect to the isotropy subgroup of the given parameter value. Replacing the parametrized family of functions with a single function on the product manifold and extending the action using the (coadjoint action on the algebra or its dual yields a fully invariant function. An invariant map can be used to reverse the usual perspective: rather than selecting a parametrized family of functions and finding their critical points, conditions under which functions will be critical on specific orbits, typically distinguished by isotropy class, can be derived. This strategy is illustrated using several well-known mechanical systems – the Lagrange top, the double spherical pendulum, the free rigid body, and the Riemann ellipsoids – and generalizations of these systems.

  8. Reassessing Function Points

    Directory of Open Access Journals (Sweden)

    G.R. Finnie


    Full Text Available Accurate estimation of the size and development effort for software projects requires estimation models which can be used early enough in the development life cycle to be of practical value. Function Point Analysis (FPA has become possibly the most widely used estimation technique in practice. However the technique was developed in the data processing environment of the 1970's and, despite undergoing considerable reassessment and formalisation, still attracts criticism for the weighting scoring it employs and for the way in which the function point score is adapted for specific system characteristics. This paper reviews the validity of the weighting scheme and the value of adjusting for system characteristics by studying their effect in a sample of 299 software developments. In general the value adjustment scheme does not appear to cater for differences in productivity. The weighting scheme used to adjust system components in terms of being simple, average or complex also appears suspect and should be redesigned to provide a more realistic estimate of system functionality.

  9. Bright point study

    International Nuclear Information System (INIS)

    Tang, F.; Harvey, K.; Bruner, M.; Kent, B.; Antonucci, E.


    Transition region and coronal observations of bright points by instruments aboard the Solar Maximum Mission and high resolution photospheric magnetograph observations on September 11, 1980 are presented. A total of 31 bipolar ephemeral regions were found in the photosphere from birth in 9.3 hours of combined magnetograph observations from three observatories. Two of the three ephemeral regions present in the field of view of the Ultraviolet Spectrometer-Polarimeter were observed in the C IV 1548 line. The unobserved ephemeral region was determined to be the shortest-lived (2.5 hr) and lowest in magnetic flux density (13G) of the three regions. The Flat Crystal Spectrometer observed only low level signals in the O VIII 18.969 A line, which were not statistically significant to be positively identified with any of the 16 ephemeral regions detected in the photosphere. In addition, the data indicate that at any given time there lacked a one-to-one correspondence between observable bright points and photospheric ephemeral regions, while more ephemeral regions were observed than their counterparts in the transition region and the corona

  10. Referential Zero Point

    Directory of Open Access Journals (Sweden)

    Matjaž Potrč


    Full Text Available Perhaps the most important controversy in which ordinary language philosophy was involved is that of definite descriptions, presenting referential act as a community-involving communication-intention endeavor, thereby opposing the direct acquaintance-based and logical proper names inspired reference aimed at securing truth conditions of referential expression. The problem of reference is that of obtaining access to the matters in the world. This access may be forthcoming through the senses, or through descriptions. A review of how the problem of reference is handled shows though that one main practice is to indulge in relations of acquaintance supporting logical proper names, demonstratives, indexicals and causal or historical chains. This testifies that the problem of reference involves the zero point, and with it phenomenology of intentionality. Communication-intention is but one dimension of rich phenomenology that constitutes an agent’s experiential space, his experiential world. Zero point is another constitutive aspect of phenomenology involved in the referential relation. Realizing that the problem of reference is phenomenology based opens a new perspective upon the contribution of analytical philosophy in this area, reconciling it with continental approach, and demonstrating variations of the impossibility related to the real. Chromatic illumination from the cognitive background empowers the referential act, in the best tradition of ordinary language philosophy.

  11. Point Pollution Sources Dimensioning

    Directory of Open Access Journals (Sweden)

    Georgeta CUCULEANU


    Full Text Available In this paper a method for determining the main physical characteristics of the point pollution sources is presented. It can be used to find the main physical characteristics of them. The main physical characteristics of these sources are top inside source diameter and physical height. The top inside source diameter is calculated from gas flow-rate. For reckoning the physical height of the source one takes into account the relation given by the proportionality factor, defined as ratio between the plume rise and physical height of the source. The plume rise depends on the gas exit velocity and gas temperature. That relation is necessary for diminishing the environmental pollution when the production capacity of the plant varies, in comparison with the nominal one.

  12. Critical Points of Contact

    DEFF Research Database (Denmark)

    Jensen, Ole B.; Wind, Simon; Lanng, Ditte Bendix


    In this brief article, we shall illustrate the application of the analytical and interventionist concept of ‘Critical Points of Contact’ (CPC) through a number of urban design studios. The notion of CPC has been developed over a span of the last three to four years and is reported in more detail...... elsewhere (Jensen & Morelli 2011). In this article, we will only discuss the conceptual and theoretical framing superficially, since our real interest is to show and discuss the concept's application value to spatial design in a number of urban design studios. The 'data' or the projects presented are seven...... in urban design at Aalborg University, where urban design consists of both an analytical and an interventionist field of operation. Furthermore, the content of the CPC concept links to research in mobilities, the network city, and urban design. These are among the core pillars of both the masters programme...

  13. Point defects in platinum

    International Nuclear Information System (INIS)

    Piercy, G.R.


    An investigation was made of the mobility and types of point defect introduced in platinum by deformation in liquid nitrogen, quenching into water from 1600 o C, or reactor irradiation at 50 o C. In all cases the activation energy for motion of the defect was determined from measurements of electrical resistivity. Measurements of density, hardness, and x-ray line broadening were also made there applicable. These experiments indicated that the principal defects remaining in platinum after irradiation were single vacant lattice sites and after quenching were pairs of vacant lattice sites. Those present after deformation In liquid nitrogen were single vacant lattice sites and another type of defect, perhaps interstitial atoms. (author)

  14. Virtual turning points

    CERN Document Server

    Honda, Naofumi; Takei, Yoshitsugu


    The discovery of a virtual turning point truly is a breakthrough in WKB analysis of higher order differential equations. This monograph expounds the core part of its theory together with its application to the analysis of higher order Painlevé equations of the Noumi–Yamada type and to the analysis of non-adiabatic transition probability problems in three levels. As M.V. Fedoryuk once lamented, global asymptotic analysis of higher order differential equations had been thought to be impossible to construct. In 1982, however, H.L. Berk, W.M. Nevins, and K.V. Roberts published a remarkable paper in the Journal of Mathematical Physics indicating that the traditional Stokes geometry cannot globally describe the Stokes phenomena of solutions of higher order equations; a new Stokes curve is necessary.

  15. The Temporal Tipping Point

    DEFF Research Database (Denmark)

    Hermann, A. K.


    “Slow journalism” is a term anthropologist and sociologists sometimes use to describe their empirical work, ethnography. To journalists and media observers, meanwhile, “slow journalism” signifies a newfound dedication to serious long-form journalism. Not surprisingly, thus, “ethnographic journalism......”—a genre where reporters adopt research strategies from social science—takes “slow” to the extreme. Immersing themselves in communities for weeks, months and years, ethnographic journalists seek to gain what anthropologists call “the native's point of view”. Based on in-depth interviews with practitioners...... and analyses of their journalistic works, this paper offers a study of ethnographic journalism suggesting that slow time operates in at least three separate registers. First, in terms of regimentation, ethnographic journalism is mostly long-form pieces that demand time-consuming research and careful writing...

  16. The Point Mass Concept

    Directory of Open Access Journals (Sweden)

    Lehnert B.


    Full Text Available A point-mass concept has been elaborated from the equations of the gravitational field. One application of these deductions results in a black hole configuration of the Schwarzschild type, having no electric charge and no angular momentum. The critical mass of a gravitational collapse with respect to the nuclear binding energy is found to be in the range of 0.4 to 90 solar masses. A second application is connected with the spec- ulation about an extended symmetric law of gravitation, based on the options of positive and negative mass for a particle at given positive energy. This would make masses of equal polarity attract each other, while masses of opposite polarity repel each other. Matter and antimatter are further proposed to be associated with the states of positive and negative mass. Under fully symmetric conditions this could provide a mechanism for the separation of antimatter from matter at an early stage of the universe.

  17. The Point Mass Concept

    Directory of Open Access Journals (Sweden)

    Lehnert B.


    Full Text Available A point-mass concept has been elaborated from the equations of the gravitational field. One application of these deductions results in a black hole configuration of the Schwarzschild type, having no electric charge and no angular momentum. The critical mass of a gravitational collapse with respect to the nuclear binding energy is found to be in the range of 0.4 to 90 solar masses. A second application is connected with the speculation about an extended symmetric law of gravitation, based on the options of positive and negative mass for a particle at given positive energy. This would make masses of equal polarity attract each other, while masses of opposite polarity repel each other. Matter and antimatter are further proposed to be associated with the states of positive and negative mass. Under fully symmetric conditions this could provide a mechanism for the separation of antimatter from matter at an early stage of the universe.

  18. May 2002 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs) from Dana Point to Point La...

  19. September 2002 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs) from Dana Point to Point La...

  20. Learning power point 2000 easily

    Energy Technology Data Exchange (ETDEWEB)

    Mon, In Su; Je, Jung Suk


    This book introduces power point 2000, which gives descriptions what power point is, what we can do with power point 2000, is it possible to install power point 2000 in my computer? Let's run power point, basic of power point such as new presentation, writing letter, using text box, changing font size, color and shape, catching power user, insertion of word art and creating of new file. It also deals with figure, chart, graph, making multimedia file, presentation, know-how of power point for teachers and company workers.

  1. ATLAS Point 1 Construction

    CERN Multimedia

    Inigo-Golfin, J

    After 3 years of work in point 1, a number of surface buildings have already been completed and handed over to CERN (the control, the gas and the cooling and ventilation buildings) and, probably more appealing to the public, 60,000 m3 of earth have already been excavated from underground. At present, the technical cavern USA15 and its access shaft are almost finished, leaving only the main cavern and the liaison galleries to be completed in the coming year and a half. The main cavern has been excavated down to the radiation limit and its walls and vault will presently be concreted (see below the picture of the section of the vault with the impressive shell of 1.2 m thickness). The excavation of the bench (27 vertical metres to go yet!) will proceed from August, when some additional civil engineering work in the LHC tunnel will be undertaken. Needless to say many different services are necessary around the detector, both for its installation and future operation for physics. To that end much of the heavy...

  2. Point 1 Updates

    CERN Multimedia

    Inigo-Golfin, J.

    The ATLAS experimental area is located in Point 1, just across the main CERN entrance, in the commune of Meyrin. There people are ever so busy to finish the different infrastructures for ATLAS. Not only has Civil Engineering finished the construction of the USA15 technical cavern, but the excavation of the main UX15 cavern has resumed below the machine tunnel, after a brief halt to allow the construction of the UJ-caverns for the power converters of the LHC machine. The excavation work should end in August 2002. The UX15 hand-over to ATLAS is expected in April 2003. On the surface civil engineering is starting to complete the last two surface buildings (SDX1 and SH1), once the services (cooling pipes, ventilation ducts and the largest item, the lift modules and its lift of course) in the shaft PX15 have been completed. But the civil engineering is not all. A lot more is under way. The site installation of the steel structures in the caverns is to begin in Autumn, along with all the cooling pipes, airconditi...

  3. Rational points on varieties

    CERN Document Server

    Poonen, Bjorn


    This book is motivated by the problem of determining the set of rational points on a variety, but its true goal is to equip readers with a broad range of tools essential for current research in algebraic geometry and number theory. The book is unconventional in that it provides concise accounts of many topics instead of a comprehensive account of just one-this is intentionally designed to bring readers up to speed rapidly. Among the topics included are Brauer groups, faithfully flat descent, algebraic groups, torsors, étale and fppf cohomology, the Weil conjectures, and the Brauer-Manin and descent obstructions. A final chapter applies all these to study the arithmetic of surfaces. The down-to-earth explanations and the over 100 exercises make the book suitable for use as a graduate-level textbook, but even experts will appreciate having a single source covering many aspects of geometry over an unrestricted ground field and containing some material that cannot be found elsewhere. The origins of arithmetic (o...

  4. "Point de suspension"

    CERN Multimedia


    CERN - Globe of Science and Innovation 20 and 21 October Acrobatics, mime, a cappella singing, projections of images, a magical setting... a host of different tools of a grandeur matching that of the Universe they relate. A camera makes a massive zoom out to reveal the multiple dimensions of Nature. Freeze the frame: half way between the infinitesimally small and the infinitesimally large, a man suspends his everyday life (hence the title "Point de Suspension", which refers to the three dots at the end of an uncompleted sentence) to take a glimpse of the place he occupies in the great history of the Universe. An unusual perspective on what it means to be a human being... This wondrous show in the Globe of Science and Innovation, specially created by the Miméscope* company for the official ceremony marking CERN's fiftieth anniversary, is a gift from the Government of the Republic and Canton of Geneva, which also wishes to share this moment of wonder with the local population. There will be three perfo...

  5. "Point de suspension"

    CERN Multimedia

    2004-01-01 CERN - Globe of Science and Innovation 20 and 21 October Acrobatics, mime, a cappella singing, projections of images, a magical setting... a host of different tools of a grandeur matching that of the Universe they relate. A camera makes a massive zoom out to reveal the multiple dimensions of Nature. Freeze the frame: half way between the infinitesimally small and the infinitesimally large, a man suspends his everyday life (hence the title "Point de Suspension", which refers to the three dots at the end of an uncompleted sentence) to take a glimpse of the place he occupies in the great history of the Universe. An unusual perspective on what it means to be a human being... This wondrous show in the Globe of Science and Innovation, specially created by the Miméscope* company for the official ceremony marking CERN's fiftieth anniversary, is a gift from the Government of the Republic and Canton of Geneva, which also wishes to share this moment of wonder with the local pop...

  6. "Point de suspension"

    CERN Multimedia


    CERN - Globe of Science and Innovation 20 and 21 October Acrobatics, mime, a cappella singing, projections of images, a magical setting... a host of different tools of a grandeur matching that of the Universe they relate. A camera makes a massive zoom out to reveal the multiple dimensions of Nature. Freeze the frame: half way between the infinitesimally small and the infinitesimally large, a man suspends his everyday life (hence the title "Point de Suspension", which refers to the three dots at the end of an uncompleted sentence) to take a glimpse of the place he occupies in the great history of the Universe. An unusual perspective on what it means to be a human being... This spectacle in the Globe of Science and Innovation, specially created by the Miméscope* company for the official ceremony marking CERN's fiftieth anniversary, is a gift from the Government of the Republic and Canton of Geneva, which also wishes to share this moment of wonder with the local population. There will be three performances for...

  7. Solving discrete zero point problems

    NARCIS (Netherlands)

    van der Laan, G.; Talman, A.J.J.; Yang, Z.F.


    In this paper an algorithm is proposed to .nd a discrete zero point of a function on the collection of integral points in the n-dimensional Euclidean space IRn.Starting with a given integral point, the algorithm generates a .nite sequence of adjacent integral simplices of varying dimension and

  8. PowerPoint 2010 Bible

    CERN Document Server

    Wempen, Faithe


    Master PowerPoint and improve your presentation skills-with one book!. It's no longer enough to have slide after slide of text, bullets, and charts. It's not even enough to have good speaking skills if your PowerPoint slides bore your audience. Get the very most out of all that PowerPoint 2010 has to offer while also learning priceless tips and techniques for making good presentations in this new PowerPoint 2010 Bible. Well-known PowerPoint expert and author Faithe Wempen provides formatting tips; shows you how to work with drawings, tables, and SmartArt; introduces new collaboration tools; wa

  9. Imaging study on acupuncture points (United States)

    Yan, X. H.; Zhang, X. Y.; Liu, C. L.; Dang, R. S.; Ando, M.; Sugiyama, H.; Chen, H. S.; Ding, G. H.


    The topographic structures of acupuncture points were investigated by using the synchrotron radiation based Dark Field Image (DFI) method. Four following acupuncture points were studied: Sanyinjiao, Neiguan, Zusanli and Tianshu. We have found that at acupuncture point regions there exists the accumulation of micro-vessels. The images taken in the surrounding tissue out of the acupuncture points do not show such kind of structure. It is the first time to reveal directly the specific structure of acupuncture points by X-ray imaging.

  10. Imaging study on acupuncture points

    International Nuclear Information System (INIS)

    Yan, X H; Zhang, X Y; Liu, C L; Dang, R S; Ando, M; Sugiyama, H; Chen, H S; Ding, G H


    The topographic structures of acupuncture points were investigated by using the synchrotron radiation based Dark Field Image (DFI) method. Four following acupuncture points were studied: Sanyinjiao, Neiguan, Zusanli and Tianshu. We have found that at acupuncture point regions there exists the accumulation of micro-vessels. The images taken in the surrounding tissue out of the acupuncture points do not show such kind of structure. It is the first time to reveal directly the specific structure of acupuncture points by X-ray imaging.

  11. Magic Pointing for Eyewear Computers

    DEFF Research Database (Denmark)

    Jalaliniya, Shahram; Mardanbegi, Diako; Pederson, Thomas


    In this paper, we propose a combination of head and eye movements for touchlessly controlling the "mouse pointer" on eyewear devices, exploiting the speed of eye pointing and accuracy of head pointing. The method is a wearable computer-targeted variation of the original MAGIC pointing approach...... which combined gaze tracking with a classical mouse device. The result of our experiment shows that the combination of eye and head movements is faster than head pointing for far targets and more accurate than eye pointing....

  12. Laser Dew-Point Hygrometer (United States)

    Matsumoto, Shigeaki; Toyooka, Satoru


    A rough-surface-type automatic dew-point hygrometer was developed using a laser diode and an optical fiber cable. A gold plate with 0.8 µ m average surface roughness was used as a surface for deposition of dew to facilitate dew deposition and prevent supersaturation of water vapor at the dew point. It was shown experimentally that the quantity of dew deposited can be controlled to be constant at any predetermined level, and is independent of the dew point to be measured. The dew points were measured in the range from -15° C to 54° C in which the temperature ranged from 0° C to 60° C. The measurement error of the dew point was ±0.5° C which was equal to below ±2% in relative humidity in the above dew-point range.

  13. Fermat's point from five perspectives (United States)

    Park, Jungeun; Flores, Alfinio


    The Fermat point of a triangle is the point such that minimizes the sum of the distances from that point to the three vertices. Five approaches to study the Fermat point of a triangle are presented in this article. First, students use a mechanical device using masses, strings and pulleys to study the Fermat point as the one that minimizes the potential energy of the system. Second, students use soap films between parallel planes connecting three pegs. The tension on the film will be minimal when the sum of distances is minimal. Third, students use an empirical approach, measuring distances in an interactive GeoGebra page. Fourth, students use Euclidean geometry arguments for two proofs based on the Torricelli configuration, and one using Viviani's Theorem. And fifth, the kinematic method is used to gain additional insight on the size of the angles between the segments joining the Fermat point with the vertices.

  14. The goal of ape pointing. (United States)

    Halina, Marta; Liebal, Katja; Tomasello, Michael


    Captive great apes regularly use pointing gestures in their interactions with humans. However, the precise function of this gesture is unknown. One possibility is that apes use pointing primarily to direct attention (as in "please look at that"); another is that they point mainly as an action request (such as "can you give that to me?"). We investigated these two possibilities here by examining how the looking behavior of recipients affects pointing in chimpanzees (Pan troglodytes) and bonobos (Pan paniscus). Upon pointing to food, subjects were faced with a recipient who either looked at the indicated object (successful-look) or failed to look at the indicated object (failed-look). We predicted that, if apes point primarily to direct attention, subjects would spend more time pointing in the failed-look condition because the goal of their gesture had not been met. Alternatively, we expected that, if apes point primarily to request an object, subjects would not differ in their pointing behavior between the successful-look and failed-look conditions because these conditions differed only in the looking behavior of the recipient. We found that subjects did differ in their pointing behavior across the successful-look and failed-look conditions, but contrary to our prediction subjects spent more time pointing in the successful-look condition. These results suggest that apes are sensitive to the attentional states of gestural recipients, but their adjustments are aimed at multiple goals. We also found a greater number of individuals with a strong right-hand than left-hand preference for pointing.

  15. Mathematical points as didactical ideas

    DEFF Research Database (Denmark)

    Mogensen, Arne

    Mathematics teaching in Denmark was recently recommended better organized in sequences with clear mathematical pedagogical goals and a focus on mathematical points. In this paper I define a mathematical point and inform on coding of transcripts in a video based Danish research study on grade 8 te...

  16. Review of NJ point system. (United States)


    The purpose of this study is to investigate the comparative effectiveness of point-based versus incident-based : negligent driver monitoring systems and to explore how certain changes to the existing point-based system used in : New Jersey might impr...

  17. Heilbronn problem for five points

    International Nuclear Information System (INIS)

    Yang Lu; Zhang Jingzhong; Zeng Zhenbing


    Put 5 points in a unit square, then there must be at least one triangle, formed by three of these points, with an area not greater than √3/9. And the upper bound √3/9 is the best. Unexpectedly, this disproves an old conjecture posed twenty years ago. (author). 15 refs, 19 figs

  18. Model plant Key Measurement Points

    International Nuclear Information System (INIS)

    Schneider, R.A.


    For IAEA safeguards a Key Measurement Point is defined as the location where nuclear material appears in such a form that it may be measured to determine material flow or inventory. This presentation describes in an introductory manner the key measurement points and associated measurements for the model plant used in this training course

  19. Improved Dynamic Planar Point Location

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Arge, Lars; Georgiadis, Loukas


    We develop the first linear-space data structures for dynamic planar point location in general subdivisions that achieve logarithmic query time and poly-logarithmic update time.......We develop the first linear-space data structures for dynamic planar point location in general subdivisions that achieve logarithmic query time and poly-logarithmic update time....

  20. Cleaning Massive Sonar Point Clouds

    DEFF Research Database (Denmark)

    Arge, Lars Allan; Larsen, Kasper Green; Mølhave, Thomas


    We consider the problem of automatically cleaning massive sonar data point clouds, that is, the problem of automatically removing noisy points that for example appear as a result of scans of (shoals of) fish, multiple reflections, scanner self-reflections, refraction in gas bubbles, and so on. We...

  1. Endogenizing Prospect Theory's Reference Point


    Ulrich Schmidt; Horst Zank


    In previous models of (cumulative) prospect theory reference-dependence of preferences is imposed beforehand and the location of the reference point is exogenously determined. This note provides a foundation of prospect theory, where reference-dependence is derived from preference conditions and a unique reference point arises endogenously.

  2. The Philosophy of Turning Points

    DEFF Research Database (Denmark)

    Turcan, Romeo V.


    business and management field, the turning point is seen as a valuable unit of analysis within the research field. It is expected that this paper will encourage a dynamic scholarly conversation about the concept of turning point and how it can aid international business researchers in the development...

  3. Viagens, tremores e conchas: aspectos da natureza da América em escritos de José Bonifácio de Andrada e Silva, José Hipólito Unanúe e Dámaso Antonio Larrañaga

    Directory of Open Access Journals (Sweden)

    Maria Margaret Lopes

    Full Text Available Este artigo apresenta aspectos da produção científica de três ilustrados que atuaram na América do Sul: José Bonifácio de Andrada e Silva (1763-1838, José Hipólito Unanúe (1755-1833 e Dámaso Antonio Larrañaga (1771-1848. Os três naturalistas - de trajetórias, territórios e crenças diferenciadas - construíram suas versões sobre aspectos da natureza da América. Em comum, contribuíram com seus trabalhos científicos para a construção da geohistória americana. Foram escolhidos para análise por critérios de dispersão territorial e por suas diferentes abordagens sobre aspectos específicos das Ciências da Terra - temas que ainda hoje têm merecido menor atenção, mesmo entre os historiadores latino-americanos das ciências. Este artigo argumenta que estes personagens não só construíram seus próprios conhecimentos sobre temperamentos (climas e territórios, como também utilizaram seu conhecimento científico no implemento de ações políticas para os seus respectivos países em conformação.

  4. Geodetic Control Points - Multi-State Control Point Database (United States)

    NSGIC State | GIS Inventory — The Multi-State Control Point Database (MCPD) is a database of geodetic and mapping control covering Idaho and Montana. The control were submitted by registered land...

  5. Making Sense of Boiling Points and Melting Points

    Indian Academy of Sciences (India)

    GENERAL | ARTICLE. The boiling and melting points of a pure substance are char- ... bonds, which involves high energy and hence high temperatures. Among the .... with zero intermolecular force at all temperatures and pressures, which ...

  6. Bone marrow examination findings at Aga Khan University Hospital ...

    African Journals Online (AJOL)

    Nutritional anaemia as a group was the most common haematological disorder ... examination in our patients with megaloblastic anaemia predominating. ... indication for bone marrow examination was anaemia followed by diagnostic work up ...

  7. Pola Spasial Permukiman Tradisional Bali Aga di Desa Sekardadi, Kintamani

    Directory of Open Access Journals (Sweden)

    Ni Ketut Agusintadewi


    Full Text Available The Bayung Gede village has derived smaller traditional settlements around Kintamani. Sekardadi is one of these settlements that has an inherent consociates with the village of origin, or the Bayung Gede. Despite the fact that the Sekardadi has a uniqueness on spatial pattern and house lay out, this village has not been welldocumented as an old village in Bali. These uniqueness are interesting to be indepth explored. It is not only on the basic philosophy of the house pattern, but also how this pattern to be physical implemented. This study aims to describe some characteristics of the village, both physical and nonphysical aspects, through the way of descriptive exploratory qualitative approach. According to the theory housing pattern of Habraken (1978 and Turgut (2001, research variables are determined into three variables: 1 Cultural setting; 2 Behavioural setting; and 3 Spatial setting. The result shows that macro spatial pattern of the Sekardadi village is divided into three zones: 1 Utama Mandala locates in the north of the village; 2 Madya Mandala is in the middle of the village, and 3 Nista Mandala in the south. Spatial pattern follows the hulu-teben conception or linear pattern with the main road as a cardinal orientation. Higher land means a sacred area (parahyangan that is characterized by the existence of Pura Puseh. Meanwhile, the opposite is defined as a profane area (palemahan with the presence of graves; and in the middle is the settlement (pawongan. Keywords: spatial pattern; traditional settlement; Sekardadi village

  8. Elu on muinasjutuline, aga muinasjutt ei ole / Neeme Korv

    Index Scriptorium Estoniae

    Korv, Neeme, 1974-


    Koguperefilm "Lemony Snicket sari õnnetuid lugusid" ("Lemony Snicket's A Series of Unfortunate Events") : režissöör Brad Silberling : Ameerika Ühendriigid 2004. Lisatud kommentaarid kirjastaja Leelo Märjamaalt ja toimetaja Rein Põderilt

  9. Efektiivne, aga mitte väga innovatiivne / Villu Zirnask

    Index Scriptorium Estoniae

    Zirnask, Villu, 1966-


    World Economic Forumi (WEF) hinnangul kuulub Eesti nende üheksa riigi hulka, mis on teel efektiivsusel põhinevast arengustaadiumist innovatsioonil põhinevasse staadiumi. Eesti kohast WEF-i konkurentsivõime edetabelis. Lisad: Eesti innovatsiooninäitajad võrreldes Euroopa Liidu keskmise tasemega; Innovatsioon: Eesti 2014. aasta eesmärgid. Tabel

  10. Mazda6 - moodne, aga kisub riidu / Taivo Paju

    Index Scriptorium Estoniae

    Paju, Taivo, 1968-


    Suur osa Mazda6 edus on kindlasti reklaamiagentuuri Rapp Collins turunduskampaanial, leiab autor. Artikli aluseks on Rapp Collins Eesti tegevdirektori Anu Brümmeli ettekanne turunduskonverentsil Password 2003.

  11. Optimism kasvab, aga head ajad ei tule tagasi? / Stan Nahkor

    Index Scriptorium Estoniae

    Nahkor, Stan


    Heaoluühiskondadesse jõuab üha selgemini arusaamine, et eluiga pikeneb ja rahvastik vananeb, levib ka ebakindlus riiklike pensionide jätkusuutlikkuse suhtes. Seda ilmestab hoiuste mahu järjekindel kasv. Pankade probleemiks on peale vähenevate tulude ka suurenev valitsussektori sekkumine

  12. Hiilgav, aga... vol.2 / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar


    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Action" (1999), "Now and Again" (1999), "Firefly" (2002), "Freaks and Geeks" (1999), "Undeclared" (2001)

  13. Pension tõuseb - aga edasi? / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-


    Pensionide uuest indekseerimise korrast. Ilmunud ka Nädaline 20. märts 2008, lk. 4 ; Valgamaalane 20. märts 2008, lk. 2 ; LõunaLeht 20. märts 2008, lk. 4 ; Põhjarannik 20. märts 2008, lk. 4 ; Võrumaa Teataja 25. märts 2008, lk. 2 ; Vali Uudised 26. märts 2008, lk. 2 ; Sõnumitooja 26. märts 2008, lk. 6 ; Meie Maa 25. märts 2008, lk. 2 ; Lääne Elu 25. märts 2008, lk. 2 ; Kuulutaja 28. märts 2008, lk. 4 ; Türi Rahvaleht 28. märts 2008, lk. 4 ; Oma Saar 28. märts 2008, lk. 5 ; Vooremaa 22. märts 2008, lk. 2 ; Pärnu Postimees 27. märts 2008, lk. 15 ; Narva Postiljon 5. aprill 2008, lk. 2 ; Videvik 3. aprill 2008, lk. 2 ; Virumaa Teataja 8. aprill 2008, lk. 11 ; Nädalaleht 20. märts 2008, lk. 5

  14. Kõik, millest on raske loobuda (aga peab) / Mark Earls

    Index Scriptorium Estoniae

    Earls, Mark


    Katkend raamatust "Welcome to creative age. Bananas, Business and Death of Marketing", milles autor seab kahtluse alla mitmed turundusega seotud käibetõed, kutsub üles neist loobuma ja võtma suuna loovusele. Vt. ka: Sissejuhatuse asemel

  15. Õõvafilm on fun, aga mitte ainult / Tiina Lokk

    Index Scriptorium Estoniae

    Lokk, Tiina, 1955-


    PÖFF-i abiga toimub Haapsalus õudusfilmide festival. Selle sissejuhatuseks annab T. Lokk pikema sissevaate õudusfilmi kui žanri kujunemisse ja väärtustesse. Lisatud festivalil näidatavate filmide nimekiri

  16. NOTE: Do acupuncture points exist? (United States)

    Yan, Xiaohui; Zhang, Xinyi; Liu, Chenglin; Dang, Ruishan; Huang, Yuying; He, Wei; Ding, Guanghong


    We used synchrotron x-ray fluorescence analysis to probe the distribution of four chemical elements in and around acupuncture points, two located in the forearm and two in the lower leg. Three of the four acupuncture points showed significantly elevated concentrations of elements Ca, Fe, Cu and Zn in relation to levels in the surrounding tissue, with similar elevation ratios for Cu and Fe. The mapped distribution of these elements implies that each acupuncture point seems to be elliptical with the long axis along the meridian.

  17. PowerPoint 2013 bible

    CERN Document Server

    Wempen, Faithe


    Master PowerPoint and improve your presentation skills with one book! In today's business climate, you need to know PowerPoint inside and out, and that's not all. You also need to be able to make a presentation that makes an impact. From using sophisticated transitions and animation in your PowerPoint presentations to interfacing in person with your audience, this information-packed book helps you succeed. Start creating professional-quality slides that captivate audiences and discover essential tips and techniques for making first-rate presentations, whether you're at a podium or

  18. Calorimetry end-point predictions

    International Nuclear Information System (INIS)

    Fox, M.A.


    This paper describes a portion of the work presently in progress at Rocky Flats in the field of calorimetry. In particular, calorimetry end-point predictions are outlined. The problems associated with end-point predictions and the progress made in overcoming these obstacles are discussed. The two major problems, noise and an accurate description of the heat function, are dealt with to obtain the most accurate results. Data are taken from an actual calorimeter and are processed by means of three different noise reduction techniques. The processed data are then utilized by one to four algorithms, depending on the accuracy desired to determined the end-point

  19. Hawaii ESI: NESTS (Nest Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains sensitive biological resource data for seabird nesting colonies in coastal Hawaii. Vector points in this data set represent locations of...

  20. Parametric statistical change point analysis

    CERN Document Server

    Chen, Jie


    This work is an in-depth study of the change point problem from a general point of view and a further examination of change point analysis of the most commonly used statistical models Change point problems are encountered in such disciplines as economics, finance, medicine, psychology, signal processing, and geology, to mention only several The exposition is clear and systematic, with a great deal of introductory material included Different models are presented in each chapter, including gamma and exponential models, rarely examined thus far in the literature Other models covered in detail are the multivariate normal, univariate normal, regression, and discrete models Extensive examples throughout the text emphasize key concepts and different methodologies are used, namely the likelihood ratio criterion, and the Bayesian and information criterion approaches A comprehensive bibliography and two indices complete the study

  1. Control Point Generated PLS - lines (United States)

    Minnesota Department of Natural Resources — The Control Point Generated PLS layer contains line and polygon features to the 1/4 of 1/4 PLS section (approximately 40 acres) and government lot level. The layer...

  2. Detecting determinism from point processes. (United States)

    Andrzejak, Ralph G; Mormann, Florian; Kreuz, Thomas


    The detection of a nonrandom structure from experimental data can be crucial for the classification, understanding, and interpretation of the generating process. We here introduce a rank-based nonlinear predictability score to detect determinism from point process data. Thanks to its modular nature, this approach can be adapted to whatever signature in the data one considers indicative of deterministic structure. After validating our approach using point process signals from deterministic and stochastic model dynamics, we show an application to neuronal spike trains recorded in the brain of an epilepsy patient. While we illustrate our approach in the context of temporal point processes, it can be readily applied to spatial point processes as well.

  3. Allegheny County Cell Tower Points (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — This dataset portrays cell tower locations as points in Allegheny County. The dataset is based on outbuilding codes in the Property Assessment Parcel Database used...

  4. Virginia ESI: REPTPT (Reptile Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains sensitive biological resource data for sea turtles in Virginia. Vector points in this data set represent nesting sites. Species-specific...

  5. Maryland ESI: NESTS (Nest Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains sensitive biological resource data for raptors in Maryland. Vector points in this data set represent bird nesting sites. Species-specific...

  6. Processing Terrain Point Cloud Data

    KAUST Repository

    DeVore, Ronald; Petrova, Guergana; Hielsberg, Matthew; Owens, Luke; Clack, Billy; Sood, Alok


    Terrain point cloud data are typically acquired through some form of Light Detection And Ranging sensing. They form a rich resource that is important in a variety of applications including navigation, line of sight, and terrain visualization

  7. Control Point Generated PLS - polygons (United States)

    Minnesota Department of Natural Resources — The Control Point Generated PLS layer contains line and polygon features to the 1/4 of 1/4 PLS section (approximately 40 acres) and government lot level. The layer...

  8. Calcareous Fens - Source Feature Points (United States)

    Minnesota Department of Natural Resources — Pursuant to the provisions of Minnesota Statutes, section 103G.223, this database contains points that represent calcareous fens as defined in Minnesota Rules, part...

  9. Louisiana ESI: NESTS (Nest Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains sensitive biological resource data for seabird and wading bird nesting colonies in coastal Louisiana. Vector points in this data set represent...

  10. Some remarks on farthest points

    Czech Academy of Sciences Publication Activity Database

    Montesinos, V.; Zizler, P.; Zizler, Václav


    Roč. 105, č. 1 (2011), s. 119-131 ISSN 1578-7303 R&D Projects: GA AV ČR IAA100190901 Institutional research plan: CEZ:AV0Z10190503 Keywords : farthest points * strongly exposed points * generic differentiability * convex functions Subject RIV: BA - General Mathematics Impact factor: 0.340, year: 2011

  11. SharePoint User's Guide

    CERN Document Server

    Corporation, Infusion Development


    This straightforward guide shows SharePoint users how to create and use web sites for sharing and collaboration. Learn to use the document and picture libraries for adding and editing content, add discussion boards and surveys, receive alerts when documents and information have been added or changed, and enhance security. Designed to help you find answers quickly, the book shows how to make the most of SharePoint for productivity and collaboration.

  12. WHO Standard Acupuncture Point Locations

    Directory of Open Access Journals (Sweden)

    Sabina Lim


    Full Text Available ‘WHO Standard Acupuncture Point Locations in the Western Pacific Region (WHO Standard was released in 2008. Initially, there were 92/361 controversial acupuncture points (acupoints. Through seven informal consultations and four task force team meetings, 86 points were agreed upon among the 92 controversial acupoints, leaving 6 remaining controversial acupoints, demanding active research in the future. This will enhance the reproducibility and validity of acupuncture studies. It will also lead to a better understanding of acupuncture mechanisms in order to optimize its clinical efficacy for a range of diseases and syndromes. This book has two parts: General Guidelines for Acupuncture Point Locations and WHO Standard Acupuncture Point Locations. First of all, familiarity with the General Guidelines for Acupuncture Point Locations in this book can help the reader to understand and use the contents of this book in depth. I would like to thank all of the participating experts and scholars for this great work, who have overcome the limits of previous acupuncture references. I also appreciate the dedicated effort and harmonious leadership of Dr Choi Seung-hoon, former Regional Adviser in Traditional Medicine of Western Pacific Office, WHO.

  13. Critical points in magnetic systems

    International Nuclear Information System (INIS)

    Bongaarts, A.L.M.


    The magnetical phase transitions of CsCoCl 3 .2H 2 O and CsCoCl 3 .2D 2 O are investigated by neutron diffraction techniques with special attention to the critical points in the phase diagrams. CsCoCl 3 .2H 2 O turned out to be a one-dimentional magnetic antiferromagnet with ferromagnetic and antiferromagnetic interactions. In the vicinity of the Neel point, the critical behavior in zero magnetic field could be described as a three-dimentional long range ordering, while the fluctuations in the system are one-dimensional. In the presence of a magnetic field, the behavior of the system in the critical region of the magnetic phase diagram between the Neel temperature at zero field (3.3degK) and 1.85degK, was in good agreement with the theory. Below 1.85degK, the phase transition in a magnetic field changes into a line of triple points whose end point could be identified as a tricritical point, i.e., an intersection of three critical lines. The parameters derived from observations in the neighborhood of this tricritical point obey the scaling laws but are not in numerical agreement with theoretical predictions

  14. Recent progress in fission at saddle point and scission point

    International Nuclear Information System (INIS)

    Blons, J.; Paya, D.; Signarbieux, C.

    High resolution measurements of 230 Th and 232 Th fission cross sections for neutrons exhibit a fine structure. Such a structure is interpreted as a superposition of two rotational bands in the third, asymmetric, well of the fission barrier. The fragment mass distribution in the thermal fission of 235 U and 233 U does not show any even-odd effect, even at the highest kinetic energies. This is the mark of a strong viscosity in the descent from saddle point to scission point [fr

  15. Digital microwave communication engineering point-to-point microwave systems

    CERN Document Server

    Kizer, George


    The first book to cover all engineering aspects of microwave communication path design for the digital age Fixed point-to-point microwave systems provide moderate-capacity digital transmission between well-defined locations. Most popular in situations where fiber optics or satellite communication is impractical, it is commonly used for cellular or PCS site interconnectivity where digital connectivity is needed but not economically available from other sources, and in private networks where reliability is most important. Until now, no book has adequately treated all en

  16. March 2003 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data (Geodetic Coordinates) from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs) from...

  17. April 2004 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data (Geodetic Coordinates) from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs) from...

  18. December 2002 Lidar Point Data of Southern California Coastline: Dana Point to Point La Jolla (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains lidar point data (latitude and longitude) from a strip of Southern California coastline (including water, beach, cliffs, and top of cliffs)...

  19. Dynamic magnetic x-points

    International Nuclear Information System (INIS)

    Leboeuf, J.N.; Tajima, T.; Dawson, J.M.


    Two-and-one-half dimensional magnetostatic and electromagnetic particle simulations of time-varying magnetic x-points and the associated plasma response are reported. The stability and topology depend on the crossing angle of the field lines at the x-point, irrespective of the plasma β. The electrostatic field and finite Larmor radius effects play an important role in current penetration and shaping of the plasma flow. The snapping of the field lines, and dragging of the plasma into, and confinement of the plasma at, an o-point (magnetic island) is observed. Magnetic island coalescence with explosive growth of the coalescence mode occurs and is accompanied by a large increase of kinetic energy and temperature as well as the formation of hot tails on the distribution functions

  20. Fixed points of quantum operations

    International Nuclear Information System (INIS)

    Arias, A.; Gheondea, A.; Gudder, S.


    Quantum operations frequently occur in quantum measurement theory, quantum probability, quantum computation, and quantum information theory. If an operator A is invariant under a quantum operation φ, we call A a φ-fixed point. Physically, the φ-fixed points are the operators that are not disturbed by the action of φ. Our main purpose is to answer the following question. If A is a φ-fixed point, is A compatible with the operation elements of φ? We shall show in general that the answer is no and we shall give some sufficient conditions under which the answer is yes. Our results will follow from some general theorems concerning completely positive maps and injectivity of operator systems and von Neumann algebras

  1. Fixed-point signal processing

    CERN Document Server

    Padgett, Wayne T


    This book is intended to fill the gap between the ""ideal precision"" digital signal processing (DSP) that is widely taught, and the limited precision implementation skills that are commonly required in fixed-point processors and field programmable gate arrays (FPGAs). These skills are often neglected at the university level, particularly for undergraduates. We have attempted to create a resource both for a DSP elective course and for the practicing engineer with a need to understand fixed-point implementation. Although we assume a background in DSP, Chapter 2 contains a review of basic theory

  2. Implementing floating-point DSP

    Czech Academy of Sciences Publication Activity Database

    Kadlec, Jiří; Chappel, S.


    Roč. 2, č. 3 (2006), s. 12-14 R&D Projects: GA AV ČR 1ET400750406; GA MŠk 1M0567 EU Projects: European Commission(XE) 027611 - AETHER Program:FP6 Institutional research plan: CEZ:AV0Z10750506 Keywords : PicoBlaze * floating point * FPGA Subject RIV: JC - Computer Hardware ; Software magazines /emb_03/xc_pdf/p12-14_3emb-point.pdf

  3. Beyond the Point Ps Approximation


    Stepanov, Sergey V.; Zvezhinskiy, Dmitry S.; Byakov, Vsevolod M.


    In application to positron annihilation spectroscopy, Ps atom is considered not as a point particle, but as a finite size e+ e- pair localized in a bubble-state in a medium. Variation of the internal Coulombic e+ -e- attraction vs. the bubble radius is estimated.

  4. Smooth random change point models. (United States)

    van den Hout, Ardo; Muniz-Terrera, Graciela; Matthews, Fiona E


    Change point models are used to describe processes over time that show a change in direction. An example of such a process is cognitive ability, where a decline a few years before death is sometimes observed. A broken-stick model consists of two linear parts and a breakpoint where the two lines intersect. Alternatively, models can be formulated that imply a smooth change between the two linear parts. Change point models can be extended by adding random effects to account for variability between subjects. A new smooth change point model is introduced and examples are presented that show how change point models can be estimated using functions in R for mixed-effects models. The Bayesian inference using WinBUGS is also discussed. The methods are illustrated using data from a population-based longitudinal study of ageing, the Cambridge City over 75 Cohort Study. The aim is to identify how many years before death individuals experience a change in the rate of decline of their cognitive ability. Copyright © 2010 John Wiley & Sons, Ltd.

  5. The Mean as Balance Point (United States)

    O'Dell, Robin S.


    There are two primary interpretations of the mean: as a leveler of data (Uccellini 1996, pp. 113-114) and as a balance point of a data set. Typically, both interpretations of the mean are ignored in elementary school and middle school curricula. They are replaced with a rote emphasis on calculation using the standard algorithm. When students are…

  6. Equations for arithmetic pointed tori

    NARCIS (Netherlands)

    Sijsling, J.R.


    In 1983, Kisao Takeuchi enumerated all 71 arithmetic (1;e)-groups. This is a special set of discrete subgroups of SL(2,R) of finite covolume and signature (1;e). The corresponding quotients of the upper half plane (called (1;e)-curves) have genus equal to 1 and a single elliptic point of order e.

  7. Flat Coalgebraic Fixed Point Logics (United States)

    Schröder, Lutz; Venema, Yde

    Fixed point logics are widely used in computer science, in particular in artificial intelligence and concurrency. The most expressive logics of this type are the μ-calculus and its relatives. However, popular fixed point logics tend to trade expressivity for simplicity and readability, and in fact often live within the single variable fragment of the μ-calculus. The family of such flat fixed point logics includes, e.g., CTL, the *-nesting-free fragment of PDL, and the logic of common knowledge. Here, we extend this notion to the generic semantic framework of coalgebraic logic, thus covering a wide range of logics beyond the standard μ-calculus including, e.g., flat fragments of the graded μ-calculus and the alternating-time μ-calculus (such as ATL), as well as probabilistic and monotone fixed point logics. Our main results are completeness of the Kozen-Park axiomatization and a timed-out tableaux method that matches ExpTime upper bounds inherited from the coalgebraic μ-calculus but avoids using automata.

  8. Fixed points of quantum gravity


    Litim, D F


    Euclidean quantum gravity is studied with renormalisation group methods. Analytical results for a non-trivial ultraviolet fixed point are found for arbitrary dimensions and gauge fixing parameter in the Einstein-Hilbert truncation. Implications for quantum gravity in four dimensions are discussed.

  9. ACS Photometric Zero Point Verification (United States)

    Dolphin, Andrew


    The uncertainties in the photometric zero points create a fundamental limit to the accuracy of photometry. The current state of the ACS calibration is surprisingly poor, with zero point uncertainties of 0.03 magnitudes in the Johnson filters. The reason for this is that ACS observations of excellent ground-based standard fields, such as the omega Cen field used for WFPC2 calibrations, have not been obtained. Instead, the ACS photometric calibrations are based primarily on semi-emprical synthetic zero points and observations of fields too crowded for accurate ground-based photometry. I propose to remedy this problem by obtaining ACS broadband images of the omega Cen standard field with both the WFC and HRC. This will permit the direct determination of the ACS transformations, and is expected to double the accuracy to which the ACS zero points are known. A second benefit is that it will facilitate the comparison of the WFPC2 and ACS photometric systems, which will be important as WFPC2 is phased out and ACS becomes HST's primary imager.

  10. Determine point-to-point networking interactions using regular expressions

    Directory of Open Access Journals (Sweden)

    Konstantin S. Deev


    Full Text Available As Internet growth and becoming more popular, the number of concurrent data flows start to increasing, which makes sense in bandwidth requested. Providers and corporate customers need ability to identify point-to-point interactions. The best is to use special software and hardware implementations that distribute the load in the internals of the complex, using the principles and approaches, in particular, described in this paper. This paper represent the principles of building system, which searches for a regular expression match using computing on graphics adapter in server station. A significant computing power and capability to parallel execution on modern graphic processor allows inspection of large amounts of data through sets of rules. Using the specified characteristics can lead to increased computing power in 30…40 times compared to the same setups on the central processing unit. The potential increase in bandwidth capacity could be used in systems that provide packet analysis, firewalls and network anomaly detectors.

  11. Modelling point patterns with linear structures

    DEFF Research Database (Denmark)

    Møller, Jesper; Rasmussen, Jakob Gulddahl


    processes whose realizations contain such linear structures. Such a point process is constructed sequentially by placing one point at a time. The points are placed in such a way that new points are often placed close to previously placed points, and the points form roughly line shaped structures. We...... consider simulations of this model and compare with real data....

  12. Modelling point patterns with linear structures

    DEFF Research Database (Denmark)

    Møller, Jesper; Rasmussen, Jakob Gulddahl

    processes whose realizations contain such linear structures. Such a point process is constructed sequentially by placing one point at a time. The points are placed in such a way that new points are often placed close to previously placed points, and the points form roughly line shaped structures. We...... consider simulations of this model and compare with real data....

  13. Zero Point of Historical Time

    Directory of Open Access Journals (Sweden)

    R.S. Khakimov


    Full Text Available Historical studies are based on the assumption that there is a reference-starting point of the space-time – the Zero point of coordinate system. Due to the bifurcation in the Zero Point, the course of social processes changes sharply and the probabilistic causality replaces the deterministic one. For this reason, changes occur in the structure of social relations and statehood form as well as in the course of the ethnic processes. In such a way emerges a new discourse of the national behavior. With regard to the history of the Tatars and Tatarstan, such bifurcation points occurred in the periods of the formation: 1 of the Turkic Khaganate, which began to exist from the 6th century onward and became a qualitatively new State system that reformatted old elements in the new matrix introducing a new discourse of behavior; 2 of the Volga-Kama Bulgaria, where the rivers (Kama, Volga, Vyatka became the most important trade routes determining the singularity of this State. Here the nomadic culture was connected with the settled one and Islam became the official religion in 922; 3 and of the Golden Hordе, a powerful State with a remarkable system of communication, migration of huge human resources for thousands of kilometers, and extensive trade, that caused severe “mutations” in the ethnic terms and a huge mixing of ethnic groups. Given the dwelling space of Tatar population and its evolution within Russia, it can be argued that the Zero point of Tatar history, which conveyed the cultural invariants until today, begins in the Golden Horde. Neither in the Turkic khaganate nor in the Bulgar State, but namely in the Golden Horde. Despite the radical changes, the Russian Empire failed to transform the Tatars in the Russians. Therefore, contemporary Tatars preserved the Golden Horde tradition as a cultural invariant.

  14. Characterization of MIPAS elevation pointing

    Directory of Open Access Journals (Sweden)

    M. Kiefer


    Full Text Available Sufficient knowledge of the pointing is essential for analyses of limb emission measurements. The scientific retrieval processor for MIPAS on ENVISAT operated at IMK allows the retrieval of pointing information in terms of tangent altitudes along with temperature. The retrieved tangent altitudes are independent of systematic offsets in the engineering Line-Of-Sight (LOS information delivered with the ESA Level 1b product. The difference of pointing retrieved from the reprocessed high resolution MIPAS spectra and the engineering pointing information was examined with respect to spatial/temporal behaviour. Among others the following characteristics of MIPAS pointing could be identified: Generally the engineering tangent altitudes are too high by 0–1.8 km with conspicuous variations in this range over time. Prior to December of 2003 there was a drift of about 50–100 m/h, which was due to a slow change in the satellite attitude. A correction of this attitude is done twice a day, which leads to discontinuities in the order of 1–1.5 km in the tangent altitudes. Occasionally discontinuities up to 2.5 km are found, as already reported from MIPAS and SCIAMACHY observations. After an update of the orbit position software in December 2003 values of drift and jumps are much reduced. There is a systematic difference in the mispointing between the poles which amounts to 1.5–2 km, i.e. there is a conspicuous orbit-periodic feature. The analysis of the correlation between the instrument's viewing angle azimuth and differential mispointing supports the hypotheses that a major part of this latter phenomenon can be attributed to an error in the roll angle of the satellite/instrument system of approximately 42 mdeg. One conclusion is that ESA level 2 data should be compared to other data exclusively on tangent pressure levels. Complementary to IMK data, ESA operational LOS calibration results were used to characterize MIPAS pointing. For this purpose

  15. Femtosecond photoelectron point projection microscope

    International Nuclear Information System (INIS)

    Quinonez, Erik; Handali, Jonathan; Barwick, Brett


    By utilizing a nanometer ultrafast electron source in a point projection microscope we demonstrate that images of nanoparticles with spatial resolutions of the order of 100 nanometers can be obtained. The duration of the emission process of the photoemitted electrons used to make images is shown to be of the order of 100 fs using an autocorrelation technique. The compact geometry of this photoelectron point projection microscope does not preclude its use as a simple ultrafast electron microscope, and we use simple analytic models to estimate temporal resolutions that can be expected when using it as a pump-probe ultrafast electron microscope. These models show a significant increase in temporal resolution when comparing to ultrafast electron microscopes based on conventional designs. We also model the microscopes spectroscopic abilities to capture ultrafast phenomena such as the photon induced near field effect

  16. Sensing with Superconducting Point Contacts

    Directory of Open Access Journals (Sweden)

    Argo Nurbawono


    Full Text Available Superconducting point contacts have been used for measuring magnetic polarizations, identifying magnetic impurities, electronic structures, and even the vibrational modes of small molecules. Due to intrinsically small energy scale in the subgap structures of the supercurrent determined by the size of the superconducting energy gap, superconductors provide ultrahigh sensitivities for high resolution spectroscopies. The so-called Andreev reflection process between normal metal and superconductor carries complex and rich information which can be utilized as powerful sensor when fully exploited. In this review, we would discuss recent experimental and theoretical developments in the supercurrent transport through superconducting point contacts and their relevance to sensing applications, and we would highlight their current issues and potentials. A true utilization of the method based on Andreev reflection analysis opens up possibilities for a new class of ultrasensitive sensors.

  17. Leverage points for sustainability transformation. (United States)

    Abson, David J; Fischer, Joern; Leventon, Julia; Newig, Jens; Schomerus, Thomas; Vilsmaier, Ulli; von Wehrden, Henrik; Abernethy, Paivi; Ives, Christopher D; Jager, Nicolas W; Lang, Daniel J


    Despite substantial focus on sustainability issues in both science and politics, humanity remains on largely unsustainable development trajectories. Partly, this is due to the failure of sustainability science to engage with the root causes of unsustainability. Drawing on ideas by Donella Meadows, we argue that many sustainability interventions target highly tangible, but essentially weak, leverage points (i.e. using interventions that are easy, but have limited potential for transformational change). Thus, there is an urgent need to focus on less obvious but potentially far more powerful areas of intervention. We propose a research agenda inspired by systems thinking that focuses on transformational 'sustainability interventions', centred on three realms of leverage: reconnecting people to nature, restructuring institutions and rethinking how knowledge is created and used in pursuit of sustainability. The notion of leverage points has the potential to act as a boundary object for genuinely transformational sustainability science.

  18. EBTR design-point selection

    International Nuclear Information System (INIS)

    Krakowski, R.A.; Bathke, C.G.


    The procedure used to select the design point for the ELMO Bumpy Torus Reactor (EBTR) study is described. The models used in each phase of the selection process are described, with an emphasis placed on the parametric design curves produced by each model. The tradeoffs related to burn physics, stability/equilibrium, electron-ring physics, and magnetics design are discussed. The resulting design point indicates a plasma with a 35-m major radius and a 1-m minor radium operating at an average core-plasma beta of 0.17, which at approx. 30 keV produces an average neutron wall loading of 1.4 MW/m 2 while maintaining key magnet (< 10 T) and total power (less than or equal to 4000 MWt) constraints

  19. The point of 6 sigma

    International Nuclear Information System (INIS)

    An, Yeong Jin


    This book gives descriptions of the point of 6 sigma. These are the titles of this : what 6 sigma is, sigma conception, motor roller 3.4 ppm, centering error, 6 sigma purpose, 6 sigma principle, eight steps of innovation strategy, 6 sigma innovation strategy of easy system step, measurement standard of 6 sigma outcome, the main role of 6 sigma, acknowledgment and reword, 6 sigma characteristic, 6 sigma effect, 6 sigma application and problems which happen when 6 sigma introduces.

  20. Change point analysis and assessment

    DEFF Research Database (Denmark)

    Müller, Sabine; Neergaard, Helle; Ulhøi, John Parm


    The aim of this article is to develop an analytical framework for studying processes such as continuous innovation and business development in high-tech SME clusters that transcends the traditional qualitative-quantitative divide. It integrates four existing and well-recognized approaches...... to studying events, processes and change, mamely change-point analysis, event-history analysis, critical-incident technique and sequence analysis....

  1. Turning points in reactor design

    International Nuclear Information System (INIS)

    Beckjord, E.S.


    This article provides some historical aspects on nuclear reactor design, beginning with PWR development for Naval Propulsion and the first commercial application at Yankee Rowe. Five turning points in reactor design and some safety problems associated with them are reviewed: (1) stability of Dresden-1, (2) ECCS, (3) PRA, (4) TMI-2, and (5) advanced passive LWR designs. While the emphasis is on the thermal-hydraulic aspects, the discussion is also about reactor systems

  2. Turning points in reactor design

    Energy Technology Data Exchange (ETDEWEB)

    Beckjord, E.S.


    This article provides some historical aspects on nuclear reactor design, beginning with PWR development for Naval Propulsion and the first commercial application at Yankee Rowe. Five turning points in reactor design and some safety problems associated with them are reviewed: (1) stability of Dresden-1, (2) ECCS, (3) PRA, (4) TMI-2, and (5) advanced passive LWR designs. While the emphasis is on the thermal-hydraulic aspects, the discussion is also about reactor systems.

  3. Viviani Polytopes and Fermat Points (United States)

    Zhou, Li


    Given a set of oriented hyperplanes P = {p1, . . . , pk} in R[superscript n], define v : R[superscript n] [right arrow] R by v(X) = the sum of the signed distances from X to p[subscript 1], . . . , p[subscript k], for any point X [is a member of] R[superscript n]. We give a simple geometric characterization of P for which v is constant, leading to…

  4. A fixed-point farrago

    CERN Document Server

    Shapiro, Joel H


    This text provides an introduction to some of the best-known fixed-point theorems, with an emphasis on their interactions with topics in analysis. The level of exposition increases gradually throughout the book, building from a basic requirement of undergraduate proficiency to graduate-level sophistication. Appendices provide an introduction to (or refresher on) some of the prerequisite material and exercises are integrated into the text, contributing to the volume’s ability to be used as a self-contained text. Readers will find the presentation especially useful for independent study or as a supplement to a graduate course in fixed-point theory. The material is split into four parts: the first introduces the Banach Contraction-Mapping Principle and the Brouwer Fixed-Point Theorem, along with a selection of interesting applications; the second focuses on Brouwer’s theorem and its application to John Nash’s work; the third applies Brouwer’s theorem to spaces of infinite dimension; and the fourth rests ...

  5. Zero-point oscillations, zero-point fluctuations, and fluctuations of zero-point oscillations

    International Nuclear Information System (INIS)

    Khalili, Farit Ya


    Several physical effects and methodological issues relating to the ground state of an oscillator are considered. Even in the simplest case of an ideal lossless harmonic oscillator, its ground state exhibits properties that are unusual from the classical point of view. In particular, the mean value of the product of two non-negative observables, kinetic and potential energies, is negative in the ground state. It is shown that semiclassical and rigorous quantum approaches yield substantially different results for the ground state energy fluctuations of an oscillator with finite losses. The dependence of zero-point fluctuations on the boundary conditions is considered. Using this dependence, it is possible to transmit information without emitting electromagnetic quanta. Fluctuations of electromagnetic pressure of zero-point oscillations are analyzed, and the corresponding mechanical friction is considered. This friction can be viewed as the most fundamental mechanism limiting the quality factor of mechanical oscillators. Observation of these effects exceeds the possibilities of contemporary experimental physics but almost undoubtedly will be possible in the near future. (methodological notes)

  6. Point-point and point-line moving-window correlation spectroscopy and its applications (United States)

    Zhou, Qun; Sun, Suqin; Zhan, Daqi; Yu, Zhiwu


    In this paper, we present a new extension of generalized two-dimensional (2D) correlation spectroscopy. Two new algorithms, namely point-point (P-P) correlation and point-line (P-L) correlation, have been introduced to do the moving-window 2D correlation (MW2D) analysis. The new method has been applied to a spectral model consisting of two different processes. The results indicate that P-P correlation spectroscopy can unveil the details and re-constitute the entire process, whilst the P-L can provide general feature of the concerned processes. Phase transition behavior of dimyristoylphosphotidylethanolamine (DMPE) has been studied using MW2D correlation spectroscopy. The newly proposed method verifies that the phase transition temperature is 56 °C, same as the result got from a differential scanning calorimeter. To illustrate the new method further, a lysine and lactose mixture has been studied under thermo perturbation. Using the P-P MW2D, the Maillard reaction of the mixture was clearly monitored, which has been very difficult using conventional display of FTIR spectra.

  7. The Point Lepreau Desktop Simulator

    International Nuclear Information System (INIS)

    MacLean, M.; Hogg, J.; Newman, H.


    The Point Lepreau Desktop Simulator runs plant process modeling software on a 266 MHz single CPU DEC Alpha computer. This same Alpha also runs the plant control computer software on an SSCI 125 emulator. An adjacent Pentium PC runs the simulator's Instructor Facility software, and communicates with the Alpha through an Ethernet. The Point Lepreau Desktop simulator is constructed to be as similar as possible to the Point Lepreau full scope training simulator. This minimizes total maintenance costs and enhances the benefits of the desktop simulator. Both simulators have the same modeling running on a single CPU in the same schedule of calculations. Both simulators have the same Instructor Facility capable of developing and executing the same lesson plans, doing the same monitoring and control of simulations, inserting all the same malfunctions, performing all the same overrides, capable of making and restoring all the same storepoints. Both simulators run the same plant control computer software - the same assembly language control programs as the power plant uses for reactor control, heat transport control, annunciation, etc. This is a higher degree of similarity between a desktop simulator and a full scope training simulator than previously reported for a computer controlled nuclear plant. The large quantity of control room hardware missing from the desktop simulator is replaced by software. The Instructor Facility panel override software of the training simulator provides the means by which devices (switches, controllers, windows, etc.) on the control room panels can be controlled and monitored in the desktop simulator. The CRT of the Alpha provides a mouse operated DCC keyboard mimic for controlling the plant control computer emulation. Two emulated RAMTEK display channels appear as windows for monitoring anything of interest on plant DCC displays, including one channel for annunciation. (author)

  8. Growth points in nuclear physics

    CERN Document Server

    Hodgson, Peter Edward


    Growth Points in Nuclear Physics, Volume 2 covers the progress in the fields of nuclear structure and nuclear reactions. This book is composed of three chapters. The first chapter is devoted to nuclear forces and potentials, in particular the optical model potential that enables the elastic scattering of many particles by nuclei to be calculated in a very simple manner. This chapter also deals with the three-body forces and the spin dependence of the nuclear potential. The second chapter describes higher order processes involving two or more stages, specifically their intrinsic interest and th

  9. Processing Terrain Point Cloud Data

    KAUST Repository

    DeVore, Ronald


    Terrain point cloud data are typically acquired through some form of Light Detection And Ranging sensing. They form a rich resource that is important in a variety of applications including navigation, line of sight, and terrain visualization. Processing terrain data has not received the attention of other forms of surface reconstruction or of image processing. The goal of terrain data processing is to convert the point cloud into a succinct representation system that is amenable to the various application demands. The present paper presents a platform for terrain processing built on the following principles: (i) measuring distortion in the Hausdorff metric, which we argue is a good match for the application demands, (ii) a multiscale representation based on tree approximation using local polynomial fitting. The basic elements held in the nodes of the tree can be efficiently encoded, transmitted, visualized, and utilized for the various target applications. Several challenges emerge because of the variable resolution of the data, missing data, occlusions, and noise. Techniques for identifying and handling these challenges are developed. © 2013 Society for Industrial and Applied Mathematics.

  10. Address Points - COUNTY_ADDRESS_POINTS_IDHS_IN: Address Points Maintained by County Agencies in Indiana (Indiana Department of Homeland Security, Point feature class) (United States)

    NSGIC State | GIS Inventory — COUNTY_ADDRESS_POINTS_IDHS_IN is an ESRI Geodatabase point feature class that contains address points maintained by county agencies in Indiana, provided by personnel...

  11. Glacial Features (Point) - Quad 168 (EPPING, NH) (United States)

    University of New Hampshire — The Glacial Features (Point) layer describes point features associated with surficial geology. These glacial features include, but are not limited to, delta forsets,...

  12. Possible refurbishment of Point Lepreau

    International Nuclear Information System (INIS)

    White, R.M.; Groom, S.H.; Thompson, P.D.; Barclay, J.M.; Allen, P.J.


    In February 2000, the NB Power Board of Directors approved Phase one of a project to produce a business case including a detailed scope and estimate associated with the possible refurbishment of the Point Lepreau Generating Station (PLGS). The Preliminary plan for refurbishment projects an 18-month outage starting as early as the spring of 2006. If the station were to be refurbished, then it would be run for another 25 to 30 years. The decision on whether or not to refurbish PLGS has not been made and is not expected until the summer of 2002. The results of the first phase of the project will be used to prepare a detailed business case that will be presented to the NB Power board of directors in January of 2002. At that time a decision will be made as to whether to refurbish the unit, or obtain other means of replacing the energy produced by PLGS. The station currently produces about a third of the power generated within the province. If the business case is approved, all-380 Pressure Tubes and Calandria Tubes, along with their related End Fittings and Feeders would be replaced. This material would be stored in new storage vaults to be constructed at the existing on-site Waste Management Facility. Replacement of other station components will be performed as required, as determined from the results of a comprehensive Plant Condition Assessment. The condition assessments build on work done under the Plant Life Management Program. Point Lepreau Generating Station has operated well since start of commercial operation in early 1983. With a lifetime capacity factor of about 84% (up to the end of 2000), it has proven to be an economic and environmentally sound electricity provider. The station has also had a significant positive economic impact in Southern New Brunswick, employing over 600 people. However the Pressure Tubes and Feeders are nearing the point in time in which they will exceed their fitness for service criteria. Although tubes can be replaced on an

  13. Possible refurbishment of Point Lepreau

    International Nuclear Information System (INIS)

    White, R.M.; Groom, S.H.; Thompson, P.D.; Barclay, J.M.; Allen, P.J.


    In February 2000, the NB Power Board of Directors approved Phase one of a project to produce a business case including a detailed scope and estimate associated with the possible refurbishment of the Point Lepreau Generating Station (PLGS). The Preliminary plan for refurbishment projects an 18-month outage starting as early as the spring of 2006. If the station were to be refurbished, then it would be run for another 25 to 30 years. The decision on whether or not to refurbish PLGS has not been made and is not expected until the summer of 2002. The results of the first phase of the project will be used to prepare a detailed business case that will be presented to the NB Power board of directors in January of 2002. At that time a decision will be made as to whether to refurbish the unit, or obtain other means of replacing the energy produced by PLGS. The station currently produces about a third of the power generated within the province. If the business case is approved, all-380 Pressure Tubes and Calandria Tubes, along with their related End Fittings and Feeders would be replaced. This material would be stored in new storage vaults to be constructed at the existing on-site Waste Management Facility. Replacement of other station components will be performed as required, as determined from the results of a comprehensive Plant Condition Assessment. The condition assessments build on work done under the Plant Life Management Program. Point Lepreau Generating Station has operated well since start of commercial operation in early 1983. With a lifetime capacity factor of about 84% (up to the end of 2000), it has proven to be an economic and environmentally sound electricity provider. The station has also had a significant positive economic impact in Southern New Brunswick, employing over 600 people. However the Pressure Tubes and Feeders are nearing the point in time in which they will exceed their fitness for service criteria. Although tubes can be replaced on an

  14. Rational points on elliptic curves

    CERN Document Server

    Silverman, Joseph H


    The theory of elliptic curves involves a pleasing blend of algebra, geometry, analysis, and number theory. This book stresses this interplay as it develops the basic theory, thereby providing an opportunity for advanced undergraduates to appreciate the unity of modern mathematics. At the same time, every effort has been made to use only methods and results commonly included in the undergraduate curriculum. This accessibility, the informal writing style, and a wealth of exercises make Rational Points on Elliptic Curves an ideal introduction for students at all levels who are interested in learning about Diophantine equations and arithmetic geometry. Most concretely, an elliptic curve is the set of zeroes of a cubic polynomial in two variables. If the polynomial has rational coefficients, then one can ask for a description of those zeroes whose coordinates are either integers or rational numbers. It is this number theoretic question that is the main subject of this book. Topics covered include the geometry and ...

  15. The physics of exceptional points

    International Nuclear Information System (INIS)

    Heiss, W D


    A short résumé is given about the nature of exceptional points (EPs) followed by discussions about their ubiquitous occurrence in a great variety of physical problems. EPs feature in classical as well as in quantum mechanical problems. They are associated with symmetry breaking for PT-symmetric Hamiltonians, where a great number of experiments has been performed, in particular in optics, and to an increasing extent in atomic and molecular physics. EPs are involved in quantum phase transition and quantum chaos; they produce dramatic effects in multichannel scattering, specific time dependence and more. In nuclear physics, they are associated with instabilities and continuum problems. Being spectral singularities they also affect approximation schemes. This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Quantum physics with non-Hermitian operators’. (paper)

  16. Photovoltaics at Point Pelee Park

    Energy Technology Data Exchange (ETDEWEB)



    Case study of an Ontario Hydro-installed photovoltaic system at Point Pelee Park, a bird sanctuary located on Lake Erie, is described. The system consists of a 1080 W photovoltaic array used to supply electricity to one of the washrooms. The cost for installing the system was $30,000 which was considerably cheaper than the $100,000 estimate for an underground power line. The independent system is the only source of energy for the washroom, therefore it was necessary to reduce the total electrical demand required by the facility. Electricity was used for the water pump, chlorinator and lighting. Motion sensors were installed to further reduce electrical demand. Washroom heaters were converted to propane. 2 figs.

  17. Preferred design of transfer points

    Energy Technology Data Exchange (ETDEWEB)

    Firstbrook, J


    The paper reports the results of a study carried out at MRDE on the performance of transfer points. These sites still require a considerable deployment of manpower. The investigations were divided into 3 main sections: mineral handling; chute design; belt cleaning and spillage conveying. In order to achieve a sufficient level of reliability of a transfer system, it is considered that the coal size should not be greater than 250 mm. Different designs of gravity transfer chute were studied and 3 basic designs emerged as being effective : dump chute, curved site entry, and asymmetric side entry. Selection is dependent on conveyor sizes, speeds, and mineral throughput. Individual belt cleaners are not sufficient to clean belts carrying typical run-of-mine material: two cleaners followed by a set of squeeze rollers are recommended. Several designs of spillage conveyor were investigated; at the present time the electro/hydraulic type appears to be the most satisfactory.

  18. Point-source inversion techniques (United States)

    Langston, Charles A.; Barker, Jeffrey S.; Pavlin, Gregory B.


    A variety of approaches for obtaining source parameters from waveform data using moment-tensor or dislocation point source models have been investigated and applied to long-period body and surface waves from several earthquakes. Generalized inversion techniques have been applied to data for long-period teleseismic body waves to obtain the orientation, time function and depth of the 1978 Thessaloniki, Greece, event, of the 1971 San Fernando event, and of several events associated with the 1963 induced seismicity sequence at Kariba, Africa. The generalized inversion technique and a systematic grid testing technique have also been used to place meaningful constraints on mechanisms determined from very sparse data sets; a single station with high-quality three-component waveform data is often sufficient to discriminate faulting type (e.g., strike-slip, etc.). Sparse data sets for several recent California earthquakes, for a small regional event associated with the Koyna, India, reservoir, and for several events at the Kariba reservoir have been investigated in this way. Although linearized inversion techniques using the moment-tensor model are often robust, even for sparse data sets, there are instances where the simplifying assumption of a single point source is inadequate to model the data successfully. Numerical experiments utilizing synthetic data and actual data for the 1971 San Fernando earthquake graphically demonstrate that severe problems may be encountered if source finiteness effects are ignored. These techniques are generally applicable to on-line processing of high-quality digital data, but source complexity and inadequacy of the assumed Green's functions are major problems which are yet to be fully addressed.

  19. Point to point multispectral light projection applied to cultural heritage (United States)

    Vázquez, D.; Alvarez, A.; Canabal, H.; Garcia, A.; Mayorga, S.; Muro, C.; Galan, T.


    Use of new of light sources based on LED technology should allow the develop of systems that combine conservation and exhibition requirements and allow to make these art goods available to the next generations according to sustainability principles. The goal of this work is to develop light systems and sources with an optimized spectral distribution for each specific point of the art piece. This optimization process implies to maximize the color fidelity reproduction and the same time to minimize the photochemical damage. Perceived color under these sources will be similar (metameric) to technical requirements given by the restoration team uncharged of the conservation and exhibition of the goods of art. Depending of the fragility of the exposed art objects (i.e. spectral responsivity of the material) the irradiance must be kept under a critical level. Therefore, it is necessary to develop a mathematical model that simulates with enough accuracy both the visual effect of the illumination and the photochemical impact of the radiation. Spectral reflectance of a reference painting The mathematical model is based on a merit function that optimized the individual intensity of the LED-light sources taking into account the damage function of the material and color space coordinates. Moreover the algorithm used weights for damage and color fidelity in order to adapt the model to a specific museal application. In this work we show a sample of this technology applied to a picture of Sorolla (1863-1923) an important Spanish painter title "woman walking at the beach".

  20. Finantskriisi algus kärpis pisut töötuskassa reserve / Mirko Ojakivi

    Index Scriptorium Estoniae

    Ojakivi, Mirko


    Töötukassa on juulikuust septembrini kaotanud oma investeeringutelt 7,5 mln. krooni, töötukassa finantsnõuniku Ago Lauri hinnangul peaksid viimases kvartalis töötukassa investeeringud veidi kasvama ja kassale raha juurde teenima. Diagramm, graafik: Tulusus püsib miinustes

  1. Paradigmamuutusest Rooma keisririigi religiooni uurimises 20. sajandi lõpus ja 21. sajandi alguses / Jaan Lahe

    Index Scriptorium Estoniae

    Lahe, Jaan, 1971-


    1960-ndatel 1970-ndatel aastatel kujunenud rooma religiooni käsitlusest. Rooma religiooni olemusest. Mõistest "idamaised usundid". Idamaistest kultustest kui müsteeriumiusunditest. Müsteeriumiusunditest kui sünkretistlikest usunditest. Monoteismist kreeka-rooma usundis. Müsteeriumiusunditest ja varasest kristlusest

  2. Milline on Eesti suhtekorraldusmaastik 2016. aasta alguses? / Kertu Kärk

    Index Scriptorium Estoniae

    Kärk, Kertu


    Eesti suhtekorraldusbüroode klientidest, töötajate arvust ja käibest, suhtekorraldusteenuse turuhinnast ning 2016. aasta trendidest PR-maastikul. Vestluses osalesid PR-ettevõtete esindajad Aleksandra Moorast, Heikki Sal-Saller, Ilona Leib, Inge Rumessen, Janek Mäggi, Kristi Jõesaar, Kristi Liiva, Mari-Liis Ahven ja Jaan Vare

  3. Tööde algus Palukülas põhjustas tormi / Matis Song

    Index Scriptorium Estoniae

    Song, Matis, 1978-


    Paluküla Hiiemäe Hoiu Seltsingu eesvõttel kogunes mõnikümmend inimest Paluküla Reevimäe poolsele küljele, et takistada puhke- ja spordikeskuse tarvis rajatava suusatõstuki ehitustööde algust. Vt. ka artiklit "Paluküla mäel käis tants ümber püstkoja" lk. 7

  4. USA välispoliitiliste hoiakute muutumine XXI sajandi alguses / Aap Neljas

    Index Scriptorium Estoniae

    Neljas, Aap, 1967-


    USA poliitikas on olnud ilmne tendents jagada "rahulikes piirkondades" korrahoidmise koormat teiste suurriikidega ja säilitada vabad käed suuremate kriiside lahendamiseks, kus kaalul on otseselt USA rahvuslikud huvid (nt ligipääs naftale või juhtroll maailmas)

  5. Nädalavahetusel saab alguse süvakultuuri festival "Ariel"

    Index Scriptorium Estoniae


    26.-27. okt. toimub Tallinnas V juudi süvakultuuri festival "Ariel", mille peaesinejaks on klarnetist David Krakauer ansambliga Klezmer Madness1 USAst. Lisaks annavad kontserdi solist Sofia Rubina ja ansambel Vox Clamantis

  6. Estlinki merekaabli konverterjaama ehitustööde alguse tähistamine

    Index Scriptorium Estoniae


    5. aprillil 2006. a. asetasid majandus- ja kommunikatsiooniminister, Balti riikide ning Soome energiafirmade juhid, projektiga seotud riikide suursaadikud, kaabli ehitaja ABB esindajad pidulikult nurgakivi Estlinki merekaabli konverterjaamale

  7. Acid dew point measurement in flue gases

    Energy Technology Data Exchange (ETDEWEB)

    Struschka, M.; Baumbach, G.


    The operation of modern boiler plants requires the continuous measurement of the acid dew point in flue gases. An existing measuring instrument was modified in such a way that it can determine acid dew points reliably, reproduceably and continuously. The authors present the mechanisms of the dew point formation, the dew point measuring principle, the modification and the operational results.

  8. 18 CFR 157.211 - Delivery points. (United States)


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Delivery points. 157... for Certain Transactions and Abandonment § 157.211 Delivery points. (a) Construction and operation—(1... delivery point, excluding the construction of certain delivery points subject to the prior notice...

  9. Professional SharePoint 2010 Development

    CERN Document Server

    Rizzo, Tom; Fried, Jeff


    Learn to leverage the features of the newest version of SharePoint, in this update to the bestseller. More than simply a portal, SharePoint is Microsoft's popular content management solution for building intranets and Web sites or hosting wikis and blogs. Offering broad coverage on all aspects of development for the SharePoint platform, this comprehensive book shows you exactly what SharePoint does, how to build solutions, and what features are accessible within SharePoint. Written by one of the most recognized names in SharePoint development, Professional SharePoint 2010 Development offers an


    Directory of Open Access Journals (Sweden)

    G. Sithole


    Full Text Available As lidar point clouds become larger streamed processing becomes more attractive. This paper presents a framework for the streamed segmentation of point clouds with the intention of segmenting unstructured point clouds in real-time. The framework is composed of two main components. The first component segments points within a window shifting over the point cloud. The second component stitches the segments within the windows together. In this fashion a point cloud can be streamed through these two components in sequence, thus producing a segmentation. The algorithm has been tested on airborne lidar point cloud and some results of the performance of the framework are presented.

  11. Yield point of metallic glass

    International Nuclear Information System (INIS)

    Shimizu, Futoshi; Ogata, Shigenobu; Li, Ju


    Shear bands form in most bulk metallic glasses (BMGs) within a narrow range of uniaxial strain ε y ≅ 2%. We propose this critical condition corresponds to embryonic shear band (ESB) propagation, not its nucleation. To propagate an ESB, the far-field shear stress τ ∞ ∼ Eε y /2 must exceed the quasi-steady-state glue traction τ glue of shear-alienated glass until the glass transition temperature is approached internally due to frictional heating, at which point ESB matures as a runaway shear crack. The incubation length scale l inc necessary for this maturation is estimated to be ∼10 2 nm for Zr-based BMGs, below which sample size-scale shear localization does not happen. In shear-alienated glass, the last resistance against localized shearing comes from extremely fast downhill dissipative dynamics of timescale comparable to atomic vibrations, allowing molecular dynamics (MD) simulations to capture this recovery process which governs τ glue . We model four metallic glasses: a binary Lennard-Jones system, two binary embedded atom potential systems and a quinternary embedded atom system. Despite vast differences in the structure and interatomic interactions, the four MD calculations give ε y predictions of 2.4%, 2.1%, 2.6% and 2.9%, respectively

  12. Anesthesiology Point of Care project. (United States)

    McDonald, John S; Noback, Carl R; Cheng, Drew; Lee, T K; Nenov, Val


    We are developing a dynamic prototype visual communication system for the operating room environs. This has classically been viewed as an isolated and impenetrable workplace. All medical experiences and all teaching remain in a one to one closed loop with no recall or subsequent sharing for the training and education of other colleagues. The "Anesthesia Point of Care" (APOC) concept embraces the sharing of, recording of, and presentation of various physiological and pharmacological events so that real time memory can be shared at a later time for the edification of other colleagues who were not present at the time of the primary learning event. In addition it also provides a remarkably rapid tool for fellow faculty to respond to obvious stress and crisis events that can be broadcast instantly at the time of happening. Finally, it also serves as an efficient and effective means of paging and general communication throughout the daily routines among various healthcare providers in anesthesiology who work as a team unit; these include the staff, residents, CRNAs, physician assistants, and technicians. This system offers a unique opportunity to eventually develop future advanced ideas that can include training exercises, presurgical evaluations, surgical scheduling and improvements in efficiency based upon earlier than expected case completion or conversely later than expected case completion and even as a unique window to development of improved billing itemization and coordination.

  13. Decision Point 1 Topical Report

    Energy Technology Data Exchange (ETDEWEB)

    Yablonsky, Al; Barsoumian, Shant; Legere, David


    This Topical Report addresses accomplishments achieved during Phase 2a of the SkyMine® Carbon Mineralization Pilot Project. The primary objectives of this project are to design, construct, and operate a system to capture CO2 from a slipstream of flue gas from a commercial coal-fired cement kiln, convert that CO2 to products having commercial value (i.e., beneficial use), show the economic viability of the CO2 capture and conversion process, and thereby advance the technology to the point of readiness for commercial scale demonstration and proliferation. The overall process is carbon negative, resulting in mineralization of CO2 that would otherwise be released into the atmosphere. The project will also substantiate market opportunities for the technology by sales of chemicals into existing markets, and identify opportunities to improve technology performance and reduce costs at the commercial scale. The project is being conducted in two phases. The primary objectives of Phase 1 were to elaborate proven SkyMine® process chemistry to commercial pilot-scale operation and complete the preliminary design for the pilot plant to be built and operated in Phase 2, complete a NEPA evaluation, and develop a comprehensive carbon life cycle analysis. The objective of the current Phase (2a) is to complete the detailed design of the pilot plant to be built in Phase 2b.

  14. Gravity and Zero Point Energy (United States)

    Massie, U. W.

    When Planck introduced the 1/2 hv term to his 1911 black body equation he showed that there is a residual energy remaining at zero degree K after all thermal energy ceased. Other investigators, including Lamb, Casimir, and Dirac added to this information. Today zero point energy (ZPE) is accepted as an established condition. The purpose of this paper is to demonstrate that the density of the ZPE is given by the gravity constant (G) and the characteristics of its particles are revealed by the cosmic microwave background (CMB). Eddies of ZPE particles created by flow around mass bodies reduce the pressure normal to the eddy flow and are responsible for the force of gravity. Helium atoms resonate with ZPE particles at low temperature to produce superfluid helium. High velocity micro vortices of ZPE particles about a basic particle or particles are responsible for electromagnetic forces. The speed of light is the speed of the wave front in the ZPE and its value is a function of the temperature and density of the ZPE.

  15. Tipping Points, Great and Small (United States)

    Morrison, Foster


    The Forum by Jordan et al. [2010] addressed environmental problems of various scales in great detail, but getting the critical message through to the formulators of public policies requires going back to basics, namely, that exponential growth (of a population, an economy, or most anything else) is not sustainable. When have you heard any politician or economist from anywhere across the ideological spectrum say anything other than that more growth is essential? There is no need for computer models to demonstrate “limits to growth,” as was done in the 1960s. Of course, as one seeks more details, the complexity of modeling will rapidly outstrip the capabilities of both observation and computing. This is common with nonlinear systems, even simple ones. Thus, identifying all possible “tipping points,” as suggested by Jordan et al. [2010], and then stopping just short of them, is impractical if not impossible. The main thing needed to avoid environmental disasters is a bit of common sense.

  16. Turkey Point tritium. Progress report

    International Nuclear Information System (INIS)

    Ostlund, H.G.; Dorsey, H.G.


    In 1972-73 the Florida Power and Light Company (FPL) began operation of two nuclear reactors at Turkey Point on lower Biscayne Bay. One radioactive by-product resulting from the operation of the nuclear reactors, tritium, provides a unique opportunity to study transport and exchange processes on a local scale. Since the isotope in the form of water is not removed from the liquid effluent, it is discharged to the cooling canal system. By studying its residence time in the canal and the pathways by which it leaves the canals, knowledge of evaporative process, groundwater movement, and bay exchange with the ocean can be obtained. Preliminary results obtained from measurement of tritium levels, both in the canal system and in the surrounding environment are discussed. Waters in lower Biscayne Bay and Card and Barnes Sounds receive only a small portion of the total tritium produced by the nuclear plant. The dominating tritium loss most likely is through evaporation from the canals. The capability of measuring extremely low HTO levels allows the determination of the evaporation rate experimentally by measuring the tritium levels of air after having passed over the canals

  17. Beginning SharePoint 2010 Administration Windows SharePoint Foundation 2010 and Microsoft SharePoint Server 2010

    CERN Document Server

    Husman, Göran


    Complete coverage on the latest advances in SharePoint 2010 administration. SharePoint 2010 comprises an abundance of new features, and this book shows you how to take advantage of all SharePoint 2010's many improvements. Written by a four-time SharePoint MVP, Beginning SharePoint 2010 Administration begins with a comparison of SharePoint 2010 compared to the previous version and then examines the differences between WSS 4.0 and MSS 2010. Packed with step-by-step instructions, tips and tricks, and real-world examples, this book dives into the basics of how to install, manage, and administrate

  18. Comparison of Dose When Prescribed to Point A and Point H for Brachytherapy in Cervical Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Gang, Ji Hyeong; Gim, Il Hwan; Hwang, Seon Boong; Kim, Woong; Im, Hyeong Seo; Gang, Jin Mook; Gim, Gi Hwan; Lee, Ah Ram [Dept. of Radiation Oncology, Korea Institute of Radiological and Medical Sciences, Seou (Korea, Republic of)


    The purpose of this study is to compare plans prescribed to point A with these prescribed to point H recommended by ABS (American Brachytherapy Society) in high dose rate intracavitary brachytherapy for cervical carcinoma. This study selected 103 patients who received HDR (High Dose Rate) brachytherapy using tandem and ovoids from March 2010 to January 2012. Point A, bladder point, and rectal point conform with Manchester System. Point H conforms with ABS recommendation. Also Sigmoid colon point, and vagina point were established arbitrarily. We examined distance between point A and point H. The percent dose at point A was calculated when 100% dose was prescribed to point H. Additionally, the percent dose at each reference points when dose is prescribed to point H and point A were calculated. The relative dose at point A was lower when point H was located inferior to point A. The relative doses at bladder, rectal, sigmoid colon, and vagina points were higher when point H was located superior to point A, and lower when point H was located inferior to point A. This study found out that as point H got located much superior to point A, the absorbed dose of surrounding normal organs became higher, and as point H got located much inferior to point A, the absorbed dose of surrounding normal organs became lower. This differences dose not seem to affect the treatment. However, we suggest this new point is worth being considered for the treatment of HDR if dose distribution and absorbed dose at normal organs have large differences between prescribed to point A and H.

  19. Point Lepreau refurbishment - update 5

    International Nuclear Information System (INIS)

    White, R.M.; Eagles, E.R.; Hickman, C.N.; Baker, R.; Thompson, P.D.; Howieson, J.Q.; Ichiyen, N.


    NB Power Nuclear is planning to conduct a 18-month maintenance outage of the Point Lepreau Generating Station (PLGS) beginning in April 2008. The major activity would be the replacement of all 380 Fuel Channel and Calandria Tube assemblies and connecting feeder pipes. This activity is referred to as Retube. NB Power Nuclear would also take advantage of this outage to conduct a number of repairs, replacements, inspection and upgrades (such as rewinding or replacing the generator, replacement of shutdown system trip computers, replacement of certain valves and expansion joints, inspection of systems not normally accessible, etc.). These collective activities are referred to as Refurbishment. This would allow the station to operate for an additional 25 to 30 years. The scope or the project was determined [mm the outcome of a two year study involving a detailed condition assessment of the station which examined Issues relating to ageing and obsolescence, along with a detailed review or Safety and Licensing issues associated with extended operation. The Refurbishment outage would be preceded by a detailed Engineering Project Phase that would: Finalize details of the Retube process including modeling, tooling development, site facilities and training of personnel. Perform necessary engineering activities related to design modifications. Construct the new waste storage structures to house Retube Waste and other additional waste storage structures for the extended life of the station. Setup necessary temporary construction facilities (offices, storage areas, change moms, decontamination an maintenance areas) to support Retube. Procure equipment and components. Perform detailed outage planning. Initiate development of detailed commissioning as well as lay-up, monitoring and return to service procedures. At the present time, the NB Power Nuclear Board of Directors and the New Brunswick Provincial government are reviewing a proposal for a lease arrangement from Bruce Power

  20. Professional SharePoint 2010 Administration

    CERN Document Server

    Klindt, Todd; Caravajal, Steve


    Thorough coverage of the improvements and changes to SharePoint 2010. SharePoint 2010 boasts a variety of incredible new features that will challenge even the most experienced administrator who is upgrading from SharePoint 2007. Written by a team of SharePoint experts, this book places a takes aim at showing you how to make these new features work right for you. Offering an in-depth look at SharePoint 2010, the authors focus on how SharePoint functionality has changed from its earliest version to its newest, and they provide you with detailed coverage of all the new features and capabilities.:

  1. SharePoint 2010 Field Guide

    CERN Document Server

    Mann, Steven; Gazmuri, Pablo; Caravajal, Steve; Wheeler, Christina


    Hands-on solutions for common SharePoint 2010 challenges Aimed at the more than 100 million licensed SharePoint 2010 users, this indispensable field guide addresses an abundance of common SharePoint 2010 problems and offers proven solutions. A team of authors encourages you to customize SharePoint beyond the out-of-the-box functionality so that you can build more complex solutions to these challenges. You?ll discover intricate details and specific full-scale solutions that you can then implement to your own SharePoint 2010 solutions.Tackles a variety of SharePoint 2010 problems ranging from si

  2. Professional SharePoint 2010 Development

    CERN Document Server

    Rizzo, Tom; Fried, Jeff; Swider, Paul J; Hillier, Scot; Schaefer, Kenneth


    Updated guidance on how to take advantage of the newest features of SharePoint programmability More than simply a portal, SharePoint is Microsoft's popular content management solution for building intranets and websites or hosting wikis and blogs. Offering broad coverage on all aspects of development for the SharePoint platform, this comprehensive book shows you exactly what SharePoint does, how to build solutions, and what features are accessible within SharePoint. Written by a team of SharePoint experts, this new edition offers an extensive selection of field-tested best practices that shows

  3. Professional SharePoint 2013 administration

    CERN Document Server

    Young, Shane; Klindt, Todd


    SharePoint admin author gurus return to prepare you for working with the new features of SharePoint 2013! The new iteration of SharePoint boasts exciting new features. However, any new version also comes with its fair share of challenges and that's where this book comes in. The team of SharePoint admin gurus returns to presents a fully updated resource that prepares you for making all the new SharePoint 2013 features work right. They cover all of the administration components of SharePoint 2013 in detail, and present a clear understanding of how they affect the role of the adminis

  4. SharePoint 2010 For Dummies

    CERN Document Server

    Williams, Vanessa L


    Here's the bestselling guide on SharePoint 2010, updated to cover Office 365 SharePoint Portal Server is an essential part of the enterprise infrastructure for many businesses. The Office 365 version includes significantly enhanced cloud capabilities. This second edition of the bestselling guide to SharePoint covers getting a SharePoint site up and running, branded, populated with content, and more. It explains ongoing site management and offers plenty of advice for administrators who want to leverage SharePoint and Office 365 in various ways.Many businesses today rely on SharePoint Portal Ser

  5. Testing Local Independence between Two Point Processes

    DEFF Research Database (Denmark)

    Allard, Denis; Brix, Anders; Chadæuf, Joël


    Independence test, Inhomogeneous point processes, Local test, Monte Carlo, Nonstationary, Rotations, Spatial pattern, Tiger bush......Independence test, Inhomogeneous point processes, Local test, Monte Carlo, Nonstationary, Rotations, Spatial pattern, Tiger bush...

  6. State Wildlife Management Area Public Facilities - points (United States)

    Minnesota Department of Natural Resources — This point theme contains facilities and features for WMAs that are best represented as points. WMAs are part of the Minnesota state recreation system created to...

  7. Implementation of Steiner point of fuzzy set. (United States)

    Liang, Jiuzhen; Wang, Dejiang


    This paper deals with the implementation of Steiner point of fuzzy set. Some definitions and properties of Steiner point are investigated and extended to fuzzy set. This paper focuses on establishing efficient methods to compute Steiner point of fuzzy set. Two strategies of computing Steiner point of fuzzy set are proposed. One is called linear combination of Steiner points computed by a series of crisp α-cut sets of the fuzzy set. The other is an approximate method, which is trying to find the optimal α-cut set approaching the fuzzy set. Stability analysis of Steiner point of fuzzy set is also studied. Some experiments on image processing are given, in which the two methods are applied for implementing Steiner point of fuzzy image, and both strategies show their own advantages in computing Steiner point of fuzzy set.

  8. The Science of Drug Use: Discussion Points (United States)

    ... The Science of Drug Use: Discussion Points The Science of Drug Use: Discussion Points Email Facebook Twitter ... was last updated February 2017 Related Topics Addiction Science Adolescent Brain Comorbidity College-Age & Young Adults Criminal ...

  9. Zero Point Energy of Renormalized Wilson Loops


    Hidaka, Yoshimasa; Pisarski, Robert D.


    The quark antiquark potential, and its associated zero point energy, can be extracted from lattice measurements of the Wilson loop. We discuss a unique prescription to renormalize the Wilson loop, for which the perturbative contribution to the zero point energy vanishes identically. A zero point energy can arise nonperturbatively, which we illustrate by considering effective string models. The nonperturbative contribution to the zero point energy vanishes in the Nambu model, but is nonzero wh...

  10. Residual analysis for spatial point processes

    DEFF Research Database (Denmark)

    Baddeley, A.; Turner, R.; Møller, Jesper

    We define residuals for point process models fitted to spatial point pattern data, and propose diagnostic plots based on these residuals. The techniques apply to any Gibbs point process model, which may exhibit spatial heterogeneity, interpoint interaction and dependence on spatial covariates. Ou...... or covariate effects. Q-Q plots of the residuals are effective in diagnosing interpoint interaction. Some existing ad hoc statistics of point patterns (quadrat counts, scan statistic, kernel smoothed intensity, Berman's diagnostic) are recovered as special cases....

  11. Influence of the burning point on the dew point in a diesel engine

    Energy Technology Data Exchange (ETDEWEB)

    Teetz, C.


    A computation on the influence of the ignition point on the dew point in a cylinder of a diesel engine is presented. The cylinder-pressure diagrams are shown. The results of computation are given. A later ignition point diminishes the area with cylinder wall temperatures below the dew point. The endangering by cylinder wall temperatures below the dew point is illustrated.

  12. Towards extending IFC with point cloud data

    NARCIS (Netherlands)

    Krijnen, T.F.; Beetz, J.; Ochmann, S.; Vock, R.; Wessel, R.


    In this paper we suggest an extension to the Industry Foundation Classes model to integrate point cloud datasets. The proposal includes a schema extension to the core model allowing the storage of points either as Cartesian coordinates, points in parametric space of a surface associated with a

  13. Moving window segmentation framework for point clouds

    NARCIS (Netherlands)

    Sithole, G.; Gorte, B.G.H.


    As lidar point clouds become larger streamed processing becomes more attractive. This paper presents a framework for the streamed segmentation of point clouds with the intention of segmenting unstructured point clouds in real-time. The framework is composed of two main components. The first

  14. Computing bubble-points of CO

    NARCIS (Netherlands)

    Ramdin, M.; Balaji, S.P.; Vicent Luna, J.M.; Torres-Knoop, A; Chen, Q.; Dubbeldam, D.; Calero, S; de Loos, T.W.; Vlugt, T.J.H.


    Computing bubble-points of multicomponent mixtures using Monte Carlo simulations is a non-trivial task. A new method is used to compute gas compositions from a known temperature, bubble-point pressure, and liquid composition. Monte Carlo simulations are used to calculate the bubble-points of

  15. Inhomogeneous Markov point processes by transformation

    DEFF Research Database (Denmark)

    Jensen, Eva B. Vedel; Nielsen, Linda Stougaard


    We construct parametrized models for point processes, allowing for both inhomogeneity and interaction. The inhomogeneity is obtained by applying parametrized transformations to homogeneous Markov point processes. An interesting model class, which can be constructed by this transformation approach......, is that of exponential inhomogeneous Markov point processes. Statistical inference For such processes is discussed in some detail....


    African Journals Online (AJOL)

    B. S. Chandravanshi

    Miscellaneous binary blends containing solvent neutral-150 (SN-150), ... viscosity, the flash point test has always been a standard part of a lubricant's specification. ... between structure and flash points of organic compounds [5-12] and fuels [13, 14]. ... in binary mixtures, the gaps between flash points would be high enough.

  17. How PowerPoint Is Killing Education (United States)

    Isseks, Marc


    Although it is essential to incorporate new technologies into the classroom, says Isseks, one trend has negatively affected instruction--the misuse of PowerPoint presentations. The author describes how poorly designed PowerPoint presentations reduce complex thoughts to bullet points and reduce the act of learning to transferring text from slide to…

  18. Characterization of finite spaces having dispersion points

    International Nuclear Information System (INIS)

    Al-Bsoul, A. T


    In this paper we shall characterize the finite spaces having dispersion points. Also, we prove that the dispersion point of a finite space with a dispersion points fixed under all non constant continuous functions which answers the question raised by J. C obb and W. Voxman in 1980 affirmatively for finite space. Some open problems are given. (author). 16 refs

  19. The Fermat point for a taxicab triangle (United States)

    Hanson, J. R.


    The Fermat point P for a triangle ABC is the point P the sum of whose distances from the vertices A, B and C is a minimum. This note will show how to find the Fermat point for any triangle using the taxicab metric.

  20. SharePoint 2013 for dummies

    CERN Document Server

    Withee, Ken


    The bestselling guide on running SharePoint, now updated to cover all the new features of SharePoint 2013 SharePoint Portal Server is an essential part of the enterprise infrastructure for many businesses. Building on the success of previous versions of SharePoint For Dummies, this new edition covers all the latest features of SharePoint 2013 and provides you with an easy-to-understand resource for making the most of all that this version has to offer. You'll learn how to get a site up and running, branded, and populated with content, workflow, and management. In addition, t

  1. Pro SharePoint 2013 administration

    CERN Document Server

    Garrett, Robert


    Pro SharePoint 2013 Administration is a practical guide to SharePoint 2013 for intermediate to advanced SharePoint administrators and power users, covering the out-of-the-box feature set and capabilities of Microsoft's collaboration and business productivity platform. SharePoint 2013 is an incredibly complex product, with many moving parts, new features, best practices, and 'gotchas.' Author Rob Garrett distills SharePoint's portfolio of features, capabilities, and utilities into an in-depth professional guide-with no fluff and copious advice-that is designed from scratch to be the manual Micr

  2. Equipartitioning and balancing points of polygons

    Directory of Open Access Journals (Sweden)

    Shunmugam Pillay


    Full Text Available The centre of mass G of a triangle has the property that the rays to the vertices from G sweep out triangles having equal areas. We show that such points, termed equipartitioning points in this paper, need not exist in other polygons. A necessary and sufficient condition for a quadrilateral to have an equipartitioning point is that one of its diagonals bisects the other. The general theorem, namely, necessary and sufficient conditions for equipartitioning points for arbitrary polygons to exist, is also stated and proved. When this happens, they are in general, distinct from the centre of mass. In parallelograms, and only in them, do the two points coincide.

  3. Beginning SharePoint Designer 2010

    CERN Document Server

    Windischman, Woodrow W; Rehmani, Asif


    Teaching Web designers, developers, and IT professionals how to use the new version of SharePoint Designer. Covering both the design and business applications of SharePoint Designer, this complete Wrox guide brings readers thoroughly up to speed on how to use SharePoint Designer in an enterprise. You'll learn to create and modify web pages, use CSS editing tools to modify themes, use Data View to create interactivity with SharePoint and other data, and much more. Coverage includes integration points with Visual Studio, Visio, and InfoPath.: Shows web designers, developers, and IT professionals

  4. Zero point energy of renormalized Wilson loops

    International Nuclear Information System (INIS)

    Hidaka, Yoshimasa; Pisarski, Robert D.


    The quark-antiquark potential, and its associated zero point energy, can be extracted from lattice measurements of the Wilson loop. We discuss a unique prescription to renormalize the Wilson loop, for which the perturbative contribution to the zero point energy vanishes identically. A zero point energy can arise nonperturbatively, which we illustrate by considering effective string models. The nonperturbative contribution to the zero point energy vanishes in the Nambu model, but is nonzero when terms for extrinsic curvature are included. At one loop order, the nonperturbative contribution to the zero point energy is negative, regardless of the sign of the extrinsic curvature term.

  5. Pro SharePoint 2010 Search

    CERN Document Server

    Noble, J; Bakman-Mikalski, Dan


    Pro SharePoint 2010 Search gives you expert advice on planning, deploying and customizing searches in SharePoint 2010. Drawing on the authors' extensive experience of working with real-world SharePoint deployments, this book teaches everything you'll need to know to create well-designed SharePoint solutions that always keep the end-user's experience in mind. Increase your search efficiency with SharePoint 2010's search functionality: extend the search user interface using third-party tools, and utilize analytics to improve relevancy. This practical hands-on book is a must-have resource for any

  6. X-point effect on edge stability

    International Nuclear Information System (INIS)

    Saarelma, S; Kirk, A; Kwon, O J


    We study the effects of the X-point configuration on edge localized mode (ELM) triggering peeling and ballooning modes using fixed boundary equilibria and modifying the plasma shape to approach the limit of a true X-point. The current driven pure peeling modes are asymptotically stabilized by the X-point while the stabilizing effect on ballooning modes depends on the poloidal location of the X-point. The coupled peeling-ballooning modes experience the elimination of the peeling component as the X-point is introduced. This can significantly affect the edge stability diagrams used to analyse the ELM triggering mechanisms.

  7. Critical point analysis of phase envelope diagram

    Energy Technology Data Exchange (ETDEWEB)

    Soetikno, Darmadi; Siagian, Ucok W. R. [Department of Petroleum Engineering, Institut Teknologi Bandung, Jl. Ganesha 10, Bandung 40132 (Indonesia); Kusdiantara, Rudy, E-mail:; Puspita, Dila, E-mail:; Sidarto, Kuntjoro A., E-mail:; Soewono, Edy; Gunawan, Agus Y. [Department of Mathematics, Institut Teknologi Bandung, Jl. Ganesha 10, Bandung 40132 (Indonesia)


    Phase diagram or phase envelope is a relation between temperature and pressure that shows the condition of equilibria between the different phases of chemical compounds, mixture of compounds, and solutions. Phase diagram is an important issue in chemical thermodynamics and hydrocarbon reservoir. It is very useful for process simulation, hydrocarbon reactor design, and petroleum engineering studies. It is constructed from the bubble line, dew line, and critical point. Bubble line and dew line are composed of bubble points and dew points, respectively. Bubble point is the first point at which the gas is formed when a liquid is heated. Meanwhile, dew point is the first point where the liquid is formed when the gas is cooled. Critical point is the point where all of the properties of gases and liquids are equal, such as temperature, pressure, amount of substance, and others. Critical point is very useful in fuel processing and dissolution of certain chemicals. Here in this paper, we will show the critical point analytically. Then, it will be compared with numerical calculations of Peng-Robinson equation by using Newton-Raphson method. As case studies, several hydrocarbon mixtures are simulated using by Matlab.

  8. Critical point analysis of phase envelope diagram

    International Nuclear Information System (INIS)

    Soetikno, Darmadi; Siagian, Ucok W. R.; Kusdiantara, Rudy; Puspita, Dila; Sidarto, Kuntjoro A.; Soewono, Edy; Gunawan, Agus Y.


    Phase diagram or phase envelope is a relation between temperature and pressure that shows the condition of equilibria between the different phases of chemical compounds, mixture of compounds, and solutions. Phase diagram is an important issue in chemical thermodynamics and hydrocarbon reservoir. It is very useful for process simulation, hydrocarbon reactor design, and petroleum engineering studies. It is constructed from the bubble line, dew line, and critical point. Bubble line and dew line are composed of bubble points and dew points, respectively. Bubble point is the first point at which the gas is formed when a liquid is heated. Meanwhile, dew point is the first point where the liquid is formed when the gas is cooled. Critical point is the point where all of the properties of gases and liquids are equal, such as temperature, pressure, amount of substance, and others. Critical point is very useful in fuel processing and dissolution of certain chemicals. Here in this paper, we will show the critical point analytically. Then, it will be compared with numerical calculations of Peng-Robinson equation by using Newton-Raphson method. As case studies, several hydrocarbon mixtures are simulated using by Matlab

  9. Handbook of floating-point arithmetic

    CERN Document Server

    Muller, Jean-Michel; de Dinechin, Florent; Jeannerod, Claude-Pierre; Joldes, Mioara; Lefèvre, Vincent; Melquiond, Guillaume; Revol, Nathalie; Torres, Serge


    This handbook is a definitive guide to the effective use of modern floating-point arithmetic, which has considerably evolved, from the frequently inconsistent floating-point number systems of early computing to the recent IEEE 754-2008 standard. Most of computational mathematics depends on floating-point numbers, and understanding their various implementations will allow readers to develop programs specifically tailored for the standard’s technical features. Algorithms for floating-point arithmetic are presented throughout the book and illustrated where possible by example programs which show how these techniques appear in actual coding and design. The volume itself breaks its core topic into four parts: the basic concepts and history of floating-point arithmetic; methods of analyzing floating-point algorithms and optimizing them; implementations of IEEE 754-2008 in hardware and software; and useful extensions to the standard floating-point system, such as interval arithmetic, double- and triple-word arithm...

  10. Interval Mathematics Applied to Critical Point Transitions

    Directory of Open Access Journals (Sweden)

    Benito A. Stradi


    Full Text Available The determination of critical points of mixtures is important for both practical and theoretical reasons in the modeling of phase behavior, especially at high pressure. The equations that describe the behavior of complex mixtures near critical points are highly nonlinear and with multiplicity of solutions to the critical point equations. Interval arithmetic can be used to reliably locate all the critical points of a given mixture. The method also verifies the nonexistence of a critical point if a mixture of a given composition does not have one. This study uses an interval Newton/Generalized Bisection algorithm that provides a mathematical and computational guarantee that all mixture critical points are located. The technique is illustrated using several example problems. These problems involve cubic equation of state models; however, the technique is general purpose and can be applied in connection with other nonlinear problems.

  11. SharePoint 2007 Collaboration For Dummies

    CERN Document Server

    Harvey, Greg


    If you're looking for a way to help your teams access what they need to know, work together, and get the job done, SharePoint can do just that. SharePoint 2007 Collaboration For Dummies shows you the easiest way to set up and customize SharePoint, manage your data, interact using SharePoint blogs and wikis, integrate Office programs, and make your office more productive. You'll learn what SharePoint can do and how to make it work for your business, understand the technical terms, and enable your people to collaborate on documents and spreadsheets. You'll even discover how to get SharePoint hel

  12. Describing chaotic attractors: Regular and perpetual points (United States)

    Dudkowski, Dawid; Prasad, Awadhesh; Kapitaniak, Tomasz


    We study the concepts of regular and perpetual points for describing the behavior of chaotic attractors in dynamical systems. The idea of these points, which have been recently introduced to theoretical investigations, is thoroughly discussed and extended into new types of models. We analyze the correlation between regular and perpetual points, as well as their relation with phase space, showing the potential usefulness of both types of points in the qualitative description of co-existing states. The ability of perpetual points in finding attractors is indicated, along with its potential cause. The location of chaotic trajectories and sets of considered points is investigated and the study on the stability of systems is shown. The statistical analysis of the observing desired states is performed. We focus on various types of dynamical systems, i.e., chaotic flows with self-excited and hidden attractors, forced mechanical models, and semiconductor superlattices, exhibiting the universality of appearance of the observed patterns and relations.

  13. Algorithms for solving common fixed point problems

    CERN Document Server

    Zaslavski, Alexander J


    This book details approximate solutions to common fixed point problems and convex feasibility problems in the presence of perturbations. Convex feasibility problems search for a common point of a finite collection of subsets in a Hilbert space; common fixed point problems pursue a common fixed point of a finite collection of self-mappings in a Hilbert space. A variety of algorithms are considered in this book for solving both types of problems, the study of which has fueled a rapidly growing area of research. This monograph is timely and highlights the numerous applications to engineering, computed tomography, and radiation therapy planning. Totaling eight chapters, this book begins with an introduction to foundational material and moves on to examine iterative methods in metric spaces. The dynamic string-averaging methods for common fixed point problems in normed space are analyzed in Chapter 3. Dynamic string methods, for common fixed point problems in a metric space are introduced and discussed in Chapter ...

  14. Kantian Turning Point in Gadamer's Philosophical Hermeneutics

    Directory of Open Access Journals (Sweden)

    Kristína Bosáková


    Full Text Available The paper is treating the theme of a Kantian turning-point in the philosophical hermeneutics of H.- G. Gadamer based on of the harmonic relationship between metaphysics and science in Kantian philosophy from the point of view of the philosophical hermeneutics of Gadamer. The philosophical work of Kant had such an influence on Gadamer that without exaggerating we can talk about the Kantian turning-point in Gadamerian hermeneutics. Grondin, a former student of Gadamer, is talking about Kantian turning-point on the field of aesthetics, but in reality Kantian turning-point means much more than a mere change in the reception of the concept of judgement. It is a discovery of harmonical relationship between the beauty and the moral, between the reason and the sensitivity, between the modern sciences and the metaphysical tradition in the Kantian philosophy, made by Gadamer. This is what we call the Kantian turning-point in Gadamerian hermeneutics.

  15. Fixed points of occasionally weakly biased mappings


    Y. Mahendra Singh, M. R. Singh


    Common fixed point results due to Pant et al. [Pant et al., Weak reciprocal continuity and fixed point theorems, Ann Univ Ferrara, 57(1), 181-190 (2011)] are extended to a class of non commuting operators called occasionally weakly biased pair[ N. Hussain, M. A. Khamsi A. Latif, Commonfixed points for JH-operators and occasionally weakly biased pairs under relaxed conditions, Nonlinear Analysis, 74, 2133-2140 (2011)]. We also provideillustrative examples to justify the improvements. Abstract....

  16. Common fixed points for weakly compatible maps

    Indian Academy of Sciences (India)

    Springer Verlag Heidelberg #4 2048 1996 Dec 15 10:16:45

    In 1976, Jungck [4] proved a common fixed point theorem for commuting maps generalizing the Banach's fixed point theorem, which states that, 'let (X, d) be a complete metric space. If T satisfies d(Tx,Ty) ≤ kd(x,y) for each x,y ∈ X where 0 ≤ k < 1, then T has a unique fixed point in X'. This theorem has many applications, ...

  17. Infra-red fixed points in supersymmetry

    Indian Academy of Sciences (India)

    ¾c /font>, and c stands for the color quadratic Casimir of the field. Fixed points arise when R* ¼ or when R*. /nobr>. ´S-½. µ ´r ·b¿µ. The stability of the solutions may be tested by linearizing the system about the fixed points. For the non-trivial fixed points we need to consider the eigenvalues of the stability matrix whose ...

  18. Bayesian analysis of Markov point processes

    DEFF Research Database (Denmark)

    Berthelsen, Kasper Klitgaard; Møller, Jesper


    Recently Møller, Pettitt, Berthelsen and Reeves introduced a new MCMC methodology for drawing samples from a posterior distribution when the likelihood function is only specified up to a normalising constant. We illustrate the method in the setting of Bayesian inference for Markov point processes...... a partially ordered Markov point process as the auxiliary variable. As the method requires simulation from the "unknown" likelihood, perfect simulation algorithms for spatial point processes become useful....

  19. Professional SharePoint 2013 development

    CERN Document Server

    Alirezaei, Reza; Ranlett, Matt; Hillier, Scot; Wilson, Brian; Fried, Jeff; Swider, Paul


    Thorough coverage of development in SharePoint 2013 A team of well-known Microsoft MVPs joins forces in this fully updated resource, providing you with in-depth coverage of development tools in the latest iteration of the immensely popular SharePoint. From building solutions to building custom workflow and content management applications, this book shares field-tested best practices on all aspect of SharePoint 2013 development. Offers a thorough look at Windows Azure and SharePoint 2013Includes new chapters on Application Life Cycle Management, developing apps in ShareP

  20. Calculation of melting points of oxides

    International Nuclear Information System (INIS)

    Bobkova, O.S.; Voskobojnikov, V.G.; Kozin, A.I.


    The correlation between the melting point and thermodynamic parameters characterizing the strength of oxides and compounds is given. Such thermodynamic paramters include the energy and antropy of atomization

  1. Beginning SharePoint 2010 Development

    CERN Document Server

    Fox, Steve


    Discover how to take advantage of the many new features in SharePoint 2010. SharePoint provides content management (enterprise content management, Web content management, records management, and more), workflow, and social media features, and the new version boasts enhanced capabilities. This introductory-level book walks you through the process of learning, developing, and deploying SharePoint 2010 solutions. You'll leverage your existing skills and tools to grasp the fundamental programming concepts and practices of SharePoint 2010. The author clearly explains how to develop your first appli

  2. EPA Region 1 Environmentally Sensitive Areas (Points) (United States)

    U.S. Environmental Protection Agency — This coverage represents point equivalents of environmentally sensitive areas in EPA New England. This coverage represents polygon equivalents of environmentally...

  3. PowerPoint 2007 for Dummies

    CERN Document Server

    Lowe, Doug


    New and inexperienced PowerPoint users will discover how to use the latest enhancements to PowerPoint 2007 quickly and efficiently so that they can produce unique and informative presentations PowerPoint continues to be the world's most popular presentation software This updated For Dummies guide shows users different ways to create powerful and effective slideshow presentations that incorporate data from other applications in the form of charts, clip art, sound, and video Shares the key features of PowerPoint 2007 including creating and editing slides, working with hyperlinks and action butt

  4. Blossom Point Satellite Tracking and Command Station (United States)

    Federal Laboratory Consortium — FUNCTION: The Blossom Point Satellite Command and Tracking Facility (BP) provides engineering and operational support to several complex space systems for the Navy...

  5. Track length estimation applied to point detectors

    International Nuclear Information System (INIS)

    Rief, H.; Dubi, A.; Elperin, T.


    The concept of the track length estimator is applied to the uncollided point flux estimator (UCF) leading to a new algorithm of calculating fluxes at a point. It consists essentially of a line integral of the UCF, and although its variance is unbounded, the convergence rate is that of a bounded variance estimator. In certain applications, involving detector points in the vicinity of collimated beam sources, it has a lower variance than the once-more-collided point flux estimator, and its application is more straightforward

  6. Mastering Microsoft SharePoint Foundation 2010

    CERN Document Server

    Callahan, C A


    Everything IT professionals need to create collaborative solutions. SharePoint Foundation 2010 is the newest version of a powerful collaboration tool used in many Exchange-enabled organizations. This book gets network professionals and business application administrators up to speed on the updates, features, and installation procedures, preparing them to create powerful collaboration structures for their companies.: Microsoft SharePoint Foundation 2010 is the successor to Windows SharePoint Services 3.0 and is used with Microsoft Office SharePoint Server to enable collaboration; this guide pre

  7. Teach yourself visually PowerPoint 2013

    CERN Document Server

    Wood, William


    A straightforward, visual approach to learning the new PowerPoint 2013! PowerPoint 2013 boasts updated features and new possibilities; this highly visual tutorial provides step-by-step instructions to help you learn all the capabilities of PowerPoint 2013. It covers the basics, as well as all the exciting new changes and additions in a series of easy-to-follow, full-color, two-page tutorials. Learn how to create slides, dress them up using templates and graphics, add sound and animation, and more. This book is the ideal ""show me, don't tell me"" guide to PowerPoint 2013.De

  8. Wolf Point Substation, Roosevelt County, Montana

    International Nuclear Information System (INIS)


    The Western Area Power Administration (Western), an agency of the United States Department of Energy, is proposing to construct the 115-kV Wolf Point Substation near Wolf Point in Roosevelt County, Montana (Figure 1). As part of the construction project, Western's existing Wolf Point Substation would be taken out of service. The existing 115-kV Wolf Point Substation is located approximately 3 miles west of Wolf Point, Montana (Figure 2). The substation was constructed in 1949. The existing Wolf Point Substation serves as a ''Switching Station'' for the 115-kV transmission in the region. The need for substation improvements is based on operational and reliability issues. For this environmental assessment (EA), the environmental review of the proposed project took into account the removal of the old Wolf Point Substation, rerouting of the five Western lines and four lines from the Cooperatives and Montana-Dakota Utilities Company, and the new road into the proposed substation. Reference to the new proposed Wolf Point Substation in the EA includes these facilities as well as the old substation site. The environmental review looked at the impacts to all resource areas in the Wolf Point area. 7 refs., 6 figs

  9. Parametric Architectural Design with Point-clouds

    DEFF Research Database (Denmark)

    Zwierzycki, Mateusz; Evers, Henrik Leander; Tamke, Martin


    This paper investigates the efforts and benefits of the implementation of point clouds into architectural design processes and tools. Based on a study on the principal work processes of designers with point clouds the prototypical plugin/library - Volvox - was developed for the parametric modelling...

  10. Point cloud data management (extended abstract)

    NARCIS (Netherlands)

    Van Oosterom, P.J.M.; Ravada, S.; Horhammer, M.; Martinez Rubi, O.; Ivanova, M.; Kodde, M.; Tijssen, T.P.M.


    Point cloud data are important sources for 3D geo-information. The point cloud data sets are growing in popularity and in size. Modern Big Data acquisition and processing technologies, such as laser scanning from airborne, mobile, or static platforms, dense image matching from photos, multi-beam

  11. The Psychic Organ Point of Autistic Syntax (United States)

    Amir, Dana


    This paper deals with autistic syntax and its expressions both in the fully fledged autistic structure and in the autistic zones of other personality structures. The musical notion of the organ point serves as a point of departure in an attempt to describe how autistic syntax transforms what was meant to constitute the substrate for linguistic…

  12. Finite Elements on Point Based Surfaces

    NARCIS (Netherlands)

    Clarenz, U.; Rumpf, M.; Telea, A.


    We present a framework for processing point-based surfaces via partial differential equations (PDEs). Our framework efficiently and effectively brings well-known PDE-based processing techniques to the field of point-based surfaces. Our method is based on the construction of local tangent planes and

  13. Magnetic Fixed Points and Emergent Supersymmetry

    DEFF Research Database (Denmark)

    Antipin, Oleg; Mojaza, Matin; Pica, Claudio


    We establish in perturbation theory the existence of fixed points along the renormalization group flow for QCD with an adjoint Weyl fermion and scalar matter reminiscent of magnetic duals of QCD [1-3]. We classify the fixed points by analyzing their basin of attraction. We discover that among...

  14. The improbability of Harris interest points

    DEFF Research Database (Denmark)

    Loog, Marco; Lauze, Francois Bernard


    An elementary characterization of the map underlying Harris corners, also known as Harris interest points or key points, is provided. Two principal and basic assumptions made are: 1) Local image structure is captured in an uncommitted way, simply using weighted raw image values around every image...

  15. Gravitational Zero Point Energy induces Physical Observables


    Garattini, Remo


    We consider the contribution of Zero Point Energy on the induced Cosmological Constant and on the induced Electric/Magnetic charge in absence of matter fields. The method is applicable to every spherically symmetric background. Extensions to a generic $f(R) $ theory are also allowed. Only the graviton appears to be fundamental to the determination of Zero Point Energy.

  16. Zero-point energy in spheroidal geometries


    Kitson, A. R.; Signal, A. I.


    We study the zero-point energy of a massless scalar field subject to spheroidal boundary conditions. Using the zeta-function method, the zero-point energy is evaluated for small ellipticity. Axially symmetric vector fields are also considered. The results are interpreted within the context of QCD flux tubes and the MIT bag model.

  17. State estimation for temporal point processes

    NARCIS (Netherlands)

    van Lieshout, Maria Nicolette Margaretha


    This paper is concerned with combined inference for point processes on the real line observed in a broken interval. For such processes, the classic history-based approach cannot be used. Instead, we adapt tools from sequential spatial point processes. For a range of models, the marginal and

  18. Metallic and antiferromagnetic fixed points from gravity (United States)

    Paul, Chandrima


    We consider SU(2) × U(1) gauge theory coupled to matter field in adjoints and study RG group flow. We constructed Callan-Symanzik equation and subsequent β functions and study the fixed points. We find there are two fixed points, showing metallic and antiferromagnetic behavior. We have shown that metallic phase develops an instability if certain parametric conditions are satisfied.

  19. Developing a Teachable Point of View (United States)

    Cameron, Kim


    As professors of management and organizational behavior mature in their teaching, they should begin to develop a teachable point of view. In this article, the author describes several attributes of a teachable point of view. Based on his own teaching experience, the author outlines five criteria for the content of the material taught--the what of…

  20. The Improbability of Harris Interest Points

    NARCIS (Netherlands)

    Loog, M.; Lauze, F.B.


    An elementary characterization of the map underlying Harris corners, also known as Harris interest points or key points, is provided. Two principal and basic assumptions made are: 1) Local image structure is captured in an uncommitted way, simply using weighted raw image values around every image

  1. Impedance analysis of acupuncture points and pathways

    International Nuclear Information System (INIS)

    Teplan, Michal; Kukucka, Marek; Ondrejkovicová, Alena


    Investigation of impedance characteristics of acupuncture points from acoustic to radio frequency range is addressed. Discernment and localization of acupuncture points in initial single subject study was unsuccessfully attempted by impedance map technique. Vector impedance analyses determined possible resonant zones in MHz region.


    Indian Academy of Sciences (India)

    Balls grow at unit rate centred at the points of the point cloud/ process. ... Idea of persistence : Keep track of births and deaths of topological features. ..... holes, Betti numbers, etc., one will be more interested in the distribution of such objects on ...

  3. Fixed points in a group of isometries

    NARCIS (Netherlands)

    Voorneveld, M.


    The Bruhat-Tits xed point theorem states that a group of isometries on a complete metric space with negative curvature possesses a xed point if it has a bounded orbit. This theorem is extended by a relaxation of the negative curvature condition in terms of the w-distance functions introduced by Kada

  4. Determinants of College Grade Point Averages (United States)

    Bailey, Paul Dean


    Chapter 2: The Role of Class Difficulty in College Grade Point Averages. Grade Point Averages (GPAs) are widely used as a measure of college students' ability. Low GPAs can remove a students from eligibility for scholarships, and even continued enrollment at a university. However, GPAs are determined not only by student ability but also by the…

  5. NIM Realization of the Gallium Triple Point (United States)

    Xiaoke, Yan; Ping, Qiu; Yuning, Duan; Yongmei, Qu


    In the last three years (1999 to 2001), the gallium triple-point cell has been successfully developed, and much corresponding research has been carried out at the National Institute of Metrology (NIM), Beijing, China. This paper presents the cell design, apparatus and procedure for realizing the gallium triple point, and presents studies on the different freezing methods. The reproducibility is 0.03 mK, and the expanded uncertainty of realization of the gallium triple point is evaluated to be 0.17 mK (p=0.99, k=2.9). Also, the reproducibility of the gallium triple point was compared with that of the triple point of water.


    Directory of Open Access Journals (Sweden)

    F. Poux


    Full Text Available This paper proposes an interoperable model for managing high dimensional point clouds while integrating semantics. Point clouds from sensors are a direct source of information physically describing a 3D state of the recorded environment. As such, they are an exhaustive representation of the real world at every scale: 3D reality-based spatial data. Their generation is increasingly fast but processing routines and data models lack of knowledge to reason from information extraction rather than interpretation. The enhanced smart point cloud developed model allows to bring intelligence to point clouds via 3 connected meta-models while linking available knowledge and classification procedures that permits semantic injection. Interoperability drives the model adaptation to potentially many applications through specialized domain ontologies. A first prototype is implemented in Python and PostgreSQL database and allows to combine semantic and spatial concepts for basic hybrid queries on different point clouds.

  7. Model for Semantically Rich Point Cloud Data (United States)

    Poux, F.; Neuville, R.; Hallot, P.; Billen, R.


    This paper proposes an interoperable model for managing high dimensional point clouds while integrating semantics. Point clouds from sensors are a direct source of information physically describing a 3D state of the recorded environment. As such, they are an exhaustive representation of the real world at every scale: 3D reality-based spatial data. Their generation is increasingly fast but processing routines and data models lack of knowledge to reason from information extraction rather than interpretation. The enhanced smart point cloud developed model allows to bring intelligence to point clouds via 3 connected meta-models while linking available knowledge and classification procedures that permits semantic injection. Interoperability drives the model adaptation to potentially many applications through specialized domain ontologies. A first prototype is implemented in Python and PostgreSQL database and allows to combine semantic and spatial concepts for basic hybrid queries on different point clouds.

  8. Thinning spatial point processes into Poisson processes

    DEFF Research Database (Denmark)

    Møller, Jesper; Schoenberg, Frederic Paik


    are identified, and where we simulate backwards and forwards in order to obtain the thinned process. In the case of a Cox process, a simple independent thinning technique is proposed. In both cases, the thinning results in a Poisson process if and only if the true Papangelou conditional intensity is used, and......In this paper we describe methods for randomly thinning certain classes of spatial point processes. In the case of a Markov point process, the proposed method involves a dependent thinning of a spatial birth-and-death process, where clans of ancestors associated with the original points......, thus, can be used as a graphical exploratory tool for inspecting the goodness-of-fit of a spatial point process model. Several examples, including clustered and inhibitive point processes, are considered....

  9. Thinning spatial point processes into Poisson processes

    DEFF Research Database (Denmark)

    Møller, Jesper; Schoenberg, Frederic Paik

    , and where one simulates backwards and forwards in order to obtain the thinned process. In the case of a Cox process, a simple independent thinning technique is proposed. In both cases, the thinning results in a Poisson process if and only if the true Papangelou conditional intensity is used, and thus can......This paper describes methods for randomly thinning certain classes of spatial point processes. In the case of a Markov point process, the proposed method involves a dependent thinning of a spatial birth-and-death process, where clans of ancestors associated with the original points are identified...... be used as a diagnostic for assessing the goodness-of-fit of a spatial point process model. Several examples, including clustered and inhibitive point processes, are considered....

  10. SharePoint 2010 Development For Dummies

    CERN Document Server

    Withee, Ken


    A much-needed guide that shows you how to leverage SharePoint tools without writing a line of code!. The great news about SharePoint is…you don't need to be a seasoned .NET developer to develop custom functions for it. This book shows you how to use SharePoint Designer, Report Builder, Dashboard Designer, InfoPath, Excel, Word, Visio, and the SharePoint web-based UI to design and develop—without ever writing a line of code! Learn how to customize your site, build SharePoint apps, start social networking, or add Web parts.  This straightforward guide makes everything easier.: Introduces you to

  11. Wrox SharePoint 2010 SharePoint911 three-pack

    CERN Document Server

    Klindt, Todd; Mason, Jennifer; Rogers, Laura; Drisgill, Randy; Ross, John; Riemann, Larry; Perran, Amanda; Perran, Shane; Sanford, Jacob J; Stubbs, Paul; Caravajal, Steve


    The Wrox SharePoint 2010 SharePoint911 Three-Pack combines the contents of three full e-books written by the experts from SharePoint911.  That's over 1800 pages of hands-on advice from Todd Klindt, Shane Young, Laura Rogers, Randy Drisgill, Jennifer Mason, John Ross, and Larry Riemann, among others. In Beginning SharePoint 2010: Building Business Solutions with SharePoint (ISBN 978-0-470-61789-2) by Amanda Perran, Shane Perran, Jennifer Mason, and Laura Rogers, readers learn the core concepts, terminology, and features of SharePoint 2010. In Professiona

  12. Beginning SharePoint 2010 Building Business Solutions with SharePoint

    CERN Document Server

    Perran, Amanda; Mason, Jennifer; Rogers, Laura


    Two SharePoint MVPs provide the ultimate introduction to SharePoint 2010Beginning SharePoint 2010: Building Team Solutions with SharePoint provides information workers and site managers with extensive knowledge and expert advice, empowering them to become SharePoint champions within their organizations.Provides expansive coverage of SharePoint topics, as well as specialty areas such as forms, excel services, records management, and web content managementDetails realistic usage scenarios, and includes practice examples that highlight best practices for configuration and customizationIncludes de

  13. The power of PowerPoint. (United States)

    Niamtu , J


    Carousel slide presentations have been used for academic and clinical presentations since the late 1950s. However, advances in computer technology have caused a paradigm shift, and digital presentations are quickly becoming standard for clinical presentations. The advantages of digital presentations include cost savings; portability; easy updating capability; Internet access; multimedia functions, such as animation, pictures, video, and sound; and customization to augment audience interest and attention. Microsoft PowerPoint has emerged as the most popular digital presentation software and is currently used by many practitioners with and without significant computer expertise. The user-friendly platform of PowerPoint enables even the novice presenter to incorporate digital presentations into his or her profession. PowerPoint offers many advanced options that, with a minimal investment of time, can be used to create more interactive and professional presentations for lectures, patient education, and marketing. Examples of advanced PowerPoint applications are presented in a stepwise manner to unveil the full power of PowerPoint. By incorporating these techniques, medical practitioners can easily personalize, customize, and enhance their PowerPoint presentations. Complications, pitfalls, and caveats are discussed to detour and prevent misadventures in digital presentations. Relevant Web sites are listed to further update, customize, and communicate PowerPoint techniques.

  14. Detecting Change-Point via Saddlepoint Approximations

    Institute of Scientific and Technical Information of China (English)

    Zhaoyuan LI; Maozai TIAN


    It's well-known that change-point problem is an important part of model statistical analysis.Most of the existing methods are not robust to criteria of the evaluation of change-point problem.In this article,we consider "mean-shift" problem in change-point studies.A quantile test of single quantile is proposed based on saddlepoint approximation method.In order to utilize the information at different quantile of the sequence,we further construct a "composite quantile test" to calculate the probability of every location of the sequence to be a change-point.The location of change-point can be pinpointed rather than estimated within a interval.The proposed tests make no assumptions about the functional forms of the sequence distribution and work sensitively on both large and small size samples,the case of change-point in the tails,and multiple change-points situation.The good performances of the tests are confirmed by simulations and real data analysis.The saddlepoint approximation based distribution of the test statistic that is developed in the paper is of independent interest and appealing.This finding may be of independent interest to the readers in this research area.

  15. Interest point detection for hyperspectral imagery (United States)

    Dorado-Muñoz, Leidy P.; Vélez-Reyes, Miguel; Roysam, Badrinath; Mukherjee, Amit


    This paper presents an algorithm for automated extraction of interest points (IPs)in multispectral and hyperspectral images. Interest points are features of the image that capture information from its neighbours and they are distinctive and stable under transformations such as translation and rotation. Interest-point operators for monochromatic images were proposed more than a decade ago and have since been studied extensively. IPs have been applied to diverse problems in computer vision, including image matching, recognition, registration, 3D reconstruction, change detection, and content-based image retrieval. Interest points are helpful in data reduction, and reduce the computational burden of various algorithms (like registration, object detection, 3D reconstruction etc) by replacing an exhaustive search over the entire image domain by a probe into a concise set of highly informative points. An interest operator seeks out points in an image that are structurally distinct, invariant to imaging conditions, stable under geometric transformation, and interpretable which are good candidates for interest points. Our approach extends ideas from Lowe's keypoint operator that uses local extrema of Difference of Gaussian (DoG) operator at multiple scales to detect interest point in gray level images. The proposed approach extends Lowe's method by direct conversion of scalar operations such as scale-space generation, and extreme point detection into operations that take the vector nature of the image into consideration. Experimental results with RGB and hyperspectral images which demonstrate the potential of the method for this application and the potential improvements of a fully vectorial approach over band-by-band approaches described in the literature.

  16. Point Information Gain and Multidimensional Data Analysis

    Directory of Open Access Journals (Sweden)

    Renata Rychtáriková


    Full Text Available We generalize the point information gain (PIG and derived quantities, i.e., point information gain entropy (PIE and point information gain entropy density (PIED, for the case of the Rényi entropy and simulate the behavior of PIG for typical distributions. We also use these methods for the analysis of multidimensional datasets. We demonstrate the main properties of PIE/PIED spectra for the real data with the examples of several images and discuss further possible utilizations in other fields of data processing.

  17. Dynamics and mission design near libration points

    CERN Document Server

    Gómez, G; Llibre, J; Martínez, R


    It is well known that the restricted three-body problem has triangular equilibrium points. These points are linearly stable for values of the mass parameter, µ , below Routh's critical value, µ 1 . It is also known that in the spatial case they are nonlinearly stable, not for all the initial conditions in a neighborhood of the equilibrium points L 4 , L 5 but for a set of relatively large measures. This follows from the celebrated Kolmogorov-Arnold-Moser theorem. In fact there are neighborhoods of computable size for which one obtains "practical stability" in the sense that the massless partic

  18. PowerPoint 2013 for dummies

    CERN Document Server

    Lowe, Doug


    Get up and running with this full-color guide to PowerPoint 2013! PowerPoint, the number one presentation software, has been revised and improved with the introduction of Microsoft Office 2013. With this all-new, full-color book by your side, you will learn how to take full advantage of all of PowerPoint's powerful and dynamic capabilities. Bestselling veteran For Dummies, author Doug Lowe breaks it all down so that you can create a powerful and effective slideshow presentation with the new wide-screen theme and variant that incorporates videos, pictures, and shapes, and all

  19. The Antitriangular Factorization of Saddle Point Matrices

    KAUST Repository

    Pestana, J.


    Mastronardi and Van Dooren [SIAM J. Matrix Anal. Appl., 34 (2013), pp. 173-196] recently introduced the block antitriangular ("Batman") decomposition for symmetric indefinite matrices. Here we show the simplification of this factorization for saddle point matrices and demonstrate how it represents the common nullspace method. We show that rank-1 updates to the saddle point matrix can be easily incorporated into the factorization and give bounds on the eigenvalues of matrices important in saddle point theory. We show the relation of this factorization to constraint preconditioning and how it transforms but preserves the structure of block diagonal and block triangular preconditioners. © 2014 Society for Industrial and Applied Mathematics.

  20. The universal cardinal ordering of fixed points

    International Nuclear Information System (INIS)

    San Martin, Jesus; Moscoso, Ma Jose; Gonzalez Gomez, A.


    We present the theorem which determines, by a permutation, the cardinal ordering of fixed points for any orbit of a period doubling cascade. The inverse permutation generates the orbit and the symbolic sequence of the orbit is obtained as a corollary. Interestingly enough, it is important to point that this theorem needs no previous information about any other orbit; also the cardinal ordering is achieved automatically with no need to compare numerical values associated with every point of the orbit (as would be the case if kneading theory were used).

  1. About Applications of the Fixed Point Theory

    Directory of Open Access Journals (Sweden)

    Bucur Amelia


    Full Text Available The fixed point theory is essential to various theoretical and applied fields, such as variational and linear inequalities, the approximation theory, nonlinear analysis, integral and differential equations and inclusions, the dynamic systems theory, mathematics of fractals, mathematical economics (game theory, equilibrium problems, and optimisation problems and mathematical modelling. This paper presents a few benchmarks regarding the applications of the fixed point theory. This paper also debates if the results of the fixed point theory can be applied to the mathematical modelling of quality.

  2. Hybrid fixed point in CAT(0 spaces

    Directory of Open Access Journals (Sweden)

    Hemant Kumar Pathak


    Full Text Available In this paper, we introduce an ultrapower approach to prove fixed point theorems for $H^{+}$-nonexpansive multi-valued mappings in the setting of CAT(0 spaces and prove several hybrid fixed point results in CAT(0 spaces for families of single-valued nonexpansive or quasinonexpansive mappings and multi-valued upper semicontinuous, almost lower semicontinuous or $H^{+}$-nonexpansive mappings which are weakly commuting. We also establish a result about structure of the set of fixed points of $H^{+}$-quasinonexpansive mapping on a CAT(0 space.

  3. SharePoint 2010 Enterprise Architect's Guidebook

    CERN Document Server

    Wilson, Brian; Baer, Bill; Kearn, Martin; Shah, Arpan; Adams, Jim; Bridport, Nigel; Esperanca, Huge; Gideon, Chris; Hassani, Sam; Hodgkinson, Neil; Juvonen, Vesa; Kleven, Scott; Morrish, Ian; Olenick, Paul; Ranlett, Matt; Voskresenskaya, Natalya; Walker, Simon; Whitehead, Chris


    Tips and techniques for becoming a successful SharePoint architect If you're eager to design and architect a successful deployment of SharePoint 2010, then this is the book for you. Packed with real-world experiences and solid processes, this guidebook provides you with everything you need to perform for designing and architecting enterprise portal services. Helpful examples examine the common design issues affecting SharePoint 2010 environments that can cause deployments to fail so you can learn what to avoid. Plus, key development and deployment issues are covered from an architecture perspe

  4. Quantum entanglement and fixed-point bifurcations

    International Nuclear Information System (INIS)

    Hines, Andrew P.; McKenzie, Ross H.; Milburn, G.J.


    How does the classical phase-space structure for a composite system relate to the entanglement characteristics of the corresponding quantum system? We demonstrate how the entanglement in nonlinear bipartite systems can be associated with a fixed-point bifurcation in the classical dynamics. Using the example of coupled giant spins we show that when a fixed point undergoes a supercritical pitchfork bifurcation, the corresponding quantum state--the ground state--achieves its maximum amount of entanglement near the critical point. We conjecture that this will be a generic feature of systems whose classical limit exhibits such a bifurcation

  5. Lévy based Cox point processes

    DEFF Research Database (Denmark)

    Hellmund, Gunnar; Prokesová, Michaela; Jensen, Eva Bjørn Vedel


    In this paper we introduce Lévy-driven Cox point processes (LCPs) as Cox point processes with driving intensity function Λ defined by a kernel smoothing of a Lévy basis (an independently scattered, infinitely divisible random measure). We also consider log Lévy-driven Cox point processes (LLCPs......) with Λ equal to the exponential of such a kernel smoothing. Special cases are shot noise Cox processes, log Gaussian Cox processes, and log shot noise Cox processes. We study the theoretical properties of Lévy-based Cox processes, including moment properties described by nth-order product densities...

  6. Power point 2002 for successful presentation

    International Nuclear Information System (INIS)

    Moon, Insoo


    This book mentions power point 2002 for successful presentation, which deals with power point and presentation, all guide, the latest gear, for presentation, basic of power point 2002 such as slide, text compile, insertion of picture, figure and application of office guide, setting up new year plan using text like insertion text with various methods, compile effective text, and 200% application of tab, and addiction of pretty shape of characters, finishing of conversion of chinese character, and elimination of typographical error with spell checker.

  7. Fixed point theorems in spaces and -trees

    Directory of Open Access Journals (Sweden)

    Kirk WA


    Full Text Available We show that if is a bounded open set in a complete space , and if is nonexpansive, then always has a fixed point if there exists such that for all . It is also shown that if is a geodesically bounded closed convex subset of a complete -tree with , and if is a continuous mapping for which for some and all , then has a fixed point. It is also noted that a geodesically bounded complete -tree has the fixed point property for continuous mappings. These latter results are used to obtain variants of the classical fixed edge theorem in graph theory.

  8. Point-of-Purchase Advertising. Learning Activity. (United States)

    Shackelford, Ray


    In this technology education activity, students learn the importance of advertising, conduct a day-long survey of advertising strategies, and design and produce a tabletop point-of-purchase advertisement. (JOW)

  9. Columbia River ESI: NESTS (Nest Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains sensitive biological resource data for bird nesting sites in the Columbia River area. Vector points in this data set represent locations of...

  10. Detecting change-points in extremes

    KAUST Repository

    Dupuis, D. J.


    Even though most work on change-point estimation focuses on changes in the mean, changes in the variance or in the tail distribution can lead to more extreme events. In this paper, we develop a new method of detecting and estimating the change-points in the tail of multiple time series data. In addition, we adapt existing tail change-point detection methods to our specific problem and conduct a thorough comparison of different methods in terms of performance on the estimation of change-points and computational time. We also examine three locations on the U.S. northeast coast and demonstrate that the methods are useful for identifying changes in seasonally extreme warm temperatures.

  11. Exact Identification of a Quantum Change Point (United States)

    Sentís, Gael; Calsamiglia, John; Muñoz-Tapia, Ramon


    The detection of change points is a pivotal task in statistical analysis. In the quantum realm, it is a new primitive where one aims at identifying the point where a source that supposedly prepares a sequence of particles in identical quantum states starts preparing a mutated one. We obtain the optimal procedure to identify the change point with certainty—naturally at the price of having a certain probability of getting an inconclusive answer. We obtain the analytical form of the optimal probability of successful identification for any length of the particle sequence. We show that the conditional success probabilities of identifying each possible change point show an unexpected oscillatory behavior. We also discuss local (online) protocols and compare them with the optimal procedure.

  12. Airports and Airfields - Volusia County Airports (Points) (United States)

    NSGIC Local Govt | GIS Inventory — The Public Use Airports database is a geographic point database of aircraft landing facilities in the United States and U.S. Territories. This database has been...

  13. Inventory classification based on decoupling points

    Directory of Open Access Journals (Sweden)

    Joakim Wikner


    Full Text Available The ideal state of continuous one-piece flow may never be achieved. Still the logistics manager can improve the flow by carefully positioning inventory to buffer against variations. Strategies such as lean, postponement, mass customization, and outsourcing all rely on strategic positioning of decoupling points to separate forecast-driven from customer-order-driven flows. Planning and scheduling of the flow are also based on classification of decoupling points as master scheduled or not. A comprehensive classification scheme for these types of decoupling points is introduced. The approach rests on identification of flows as being either demand based or supply based. The demand or supply is then combined with exogenous factors, classified as independent, or endogenous factors, classified as dependent. As a result, eight types of strategic as well as tactical decoupling points are identified resulting in a process-based framework for inventory classification that can be used for flow design.

  14. The existence of trajectories joining critical points

    International Nuclear Information System (INIS)

    Yu Shuxiang.


    In this paper, using the notion of an isolating block and the concept of canonical regions, three existence criteria of trajectories connecting a pair of critical points of planar differential equations are given. (author)

  15. Neutrosophic Crisp Points & Neutrosophic Crisp Ideals

    Directory of Open Access Journals (Sweden)

    A. A. Salama


    Full Text Available The purpose of this paper is to define the so called "neutrosophic crisp points" and "neutrosophic crisp ideals", and obtain their fundamental properties. Possible application to GIS topology rules are touched upon.

  16. Water Sample Points, Navajo Nation, 2000, USACE (United States)

    U.S. Environmental Protection Agency — This point shapefile presents the locations and results for water samples collected on the Navajo Nation by the US Army Corps of Engineers (USACE) for the US...

  17. Point-to-point people with purpose—Exploring the possibility of a commercial traveler market for point-to-point suborbital space transportation (United States)

    Webber, Derek


    An argument was made at the First Arcachon Conference on Private Human Access to Space in 2008 [1] that some systematic market research should be conducted into potential market segments for point-to-point suborbital space transportation (PtP), in order to understand whether a commercial market exists which might augment possible government use for such a vehicle. The cargo market potential was subsequently addressed via desk research, and the results, which resulted in a pessimistic business case outlook, were presented in [2]. The same desk research approach is now used in this paper to address the potential business and wealthy individual passenger traveler market segment ("point-to-point people with purpose"). The results, with the assumed ticket pricing, are not encouraging.

  18. Fixed-Point Configurable Hardware Components

    Directory of Open Access Journals (Sweden)

    Rocher Romuald


    Full Text Available To reduce the gap between the VLSI technology capability and the designer productivity, design reuse based on IP (intellectual properties is commonly used. In terms of arithmetic accuracy, the generated architecture can generally only be configured through the input and output word lengths. In this paper, a new kind of method to optimize fixed-point arithmetic IP has been proposed. The architecture cost is minimized under accuracy constraints defined by the user. Our approach allows exploring the fixed-point search space and the algorithm-level search space to select the optimized structure and fixed-point specification. To significantly reduce the optimization and design times, analytical models are used for the fixed-point optimization process.

  19. On Recall Rate of Interest Point Detectors

    DEFF Research Database (Denmark)

    Aanæs, Henrik; Dahl, Anders Lindbjerg; Pedersen, Kim Steenstrup


    in relation to the number of interest points, the recall rate as a function of camera position and light variation, and the sensitivity relative to model parameter change. The overall conclusion is that the Harris corner detector has a very high recall rate, but is sensitive to change in scale. The Hessian......In this paper we provide a method for evaluating interest point detectors independently of image descriptors. This is possible because we have compiled a unique data set enabling us to determine if common interest points are found. The data contains 60 scenes of a wide range of object types......, and for each scene we have 119 precisely located camera positions obtained from a camera mounted on an industrial robot arm. The scene surfaces have been scanned using structured light, providing precise 3D ground truth. We have investigated a number of the most popular interest point detectors. This is done...

  20. Poisson point processes imaging, tracking, and sensing

    CERN Document Server

    Streit, Roy L


    This overview of non-homogeneous and multidimensional Poisson point processes and their applications features mathematical tools and applications from emission- and transmission-computed tomography to multiple target tracking and distributed sensor detection.

  1. [Sociological aspects of health service access points]. (United States)

    Lecarpentier, Mariana

    The work of health service access points highlights the process of exclusion through marginalisation, the phenomenon of precarity and anthropological tensions between hospitality and inhospitality or between the desirable and undesirable. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. Statistical aspects of determinantal point processes

    DEFF Research Database (Denmark)

    Lavancier, Frédéric; Møller, Jesper; Rubak, Ege

    The statistical aspects of determinantal point processes (DPPs) seem largely unexplored. We review the appealing properties of DDPs, demonstrate that they are useful models for repulsiveness, detail a simulation procedure, and provide freely available software for simulation and statistical infer...

  3. Anderson Acceleration for Fixed-Point Iterations

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Homer F. [Worcester Polytechnic Institute, MA (United States)


    The purpose of this grant was to support research on acceleration methods for fixed-point iterations, with applications to computational frameworks and simulation problems that are of interest to DOE.

  4. VT E911 ESITE geocoder - address points (United States)

    Vermont Center for Geographic Information — VT E911 ESITE geocoder - address points. VCGI, in collaboration with the VT E911 Board, has created a suite of geocoding services that can be used to batch geocode...

  5. Southeast Alaska ESI: FISHPT (Fish Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains biological resource data for anadromous fish streams in Southeast Alaska. Vector points in this data set represent locations of fish streams....

  6. Hudson River Sub-Bottom Profile Points (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Hudson River Estuary Shallow Water Surveys. Subbottom Profile Points. Subbottom data was collected November 5 to December 15, 2009, in the estuary north from...

  7. VT US EPA Regulated Facilities Point Locations (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The EnvironPollution_ENVPTS2001 data layer is based on the U.S. EPA's Envirofacts point shapefile. The data was provided to VCGI by the Vermont...

  8. Louisiana ESI: SOCECON (Socioeconomic Resource Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains human-use resource data for airport, heliport, marina, and boat ramp locations in Louisiana. Vector points in this data set represent the...

  9. North Slope, Alaska ESI: FACILITY (Facility Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains data for oil field facilities for the North Slope of Alaska. Vector points in this data set represent oil field facility locations. This data...

  10. Pressure Points: Preventing and Controlling Hypertension (United States)

    ... Issue Past Issues Pressure Points: Preventing and Controlling Hypertension Past Issues / Summer 2006 Table of Contents For ... diagnosed with high blood pressure." Aditional Information On Hypertension MedlinePlus: High blood pressure: http://www.nlm.nih. ...

  11. Southeast Alaska ESI: NESTS (Nest Points) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains biological resource data for alcids, shorebirds, waterfowl, diving birds, pelagic birds, gulls, and terns in Southeast Alaska. Points in this...

  12. Topological fixed point theory of multivalued mappings

    CERN Document Server

    Górniewicz, Lech


    This volume presents a broad introduction to the topological fixed point theory of multivalued (set-valued) mappings, treating both classical concepts as well as modern techniques. A variety of up-to-date results is described within a unified framework. Topics covered include the basic theory of set-valued mappings with both convex and nonconvex values, approximation and homological methods in the fixed point theory together with a thorough discussion of various index theories for mappings with a topologically complex structure of values, applications to many fields of mathematics, mathematical economics and related subjects, and the fixed point approach to the theory of ordinary differential inclusions. The work emphasises the topological aspect of the theory, and gives special attention to the Lefschetz and Nielsen fixed point theory for acyclic valued mappings with diverse compactness assumptions via graph approximation and the homological approach. Audience: This work will be of interest to researchers an...

  13. Diffuse scattering from crystals with point defects

    International Nuclear Information System (INIS)

    Andrushevsky, N.M.; Shchedrin, B.M.; Simonov, V.I.; Malakhova, L.F.


    The analytical expressions for calculating the intensities of X-ray diffuse scattering from a crystal of finite dimensions and monatomic substitutional, interstitial, or vacancy-type point defects have been derived. The method for the determination of the three-dimensional structure by experimental diffuse-scattering data from crystals with point defects having various concentrations is discussed and corresponding numerical algorithms are suggested

  14. New generation of gas infrared point heaters

    Energy Technology Data Exchange (ETDEWEB)

    Schink, Damian [Pintsch Aben B.V., Dinslaken (Germany)


    It is more than thirty years since gas infrared heating for points was introduced on the railway network of what is now Deutsche Bahn. These installations have remained in service right through to the present, with virtually no modifications. More stringent requirements as regards availability, maintainability and remote monitoring have, however, led to the development of a new system of gas infrared heating for points - truly a new generation. (orig.)

  15. Matching fields and lattice points of simplices


    Loho, Georg; Smith, Ben


    We show that the Chow covectors of a linkage matching field define a bijection of lattice points and we demonstrate how one can recover the linkage matching field from this bijection. This resolves two open questions from Sturmfels & Zelevinsky (1993) on linkage matching fields. For this, we give an explicit construction that associates a bipartite incidence graph of an ordered partition of a common set to all lattice points in a dilated simplex. Given a triangulation of a product of two simp...

  16. Γ-source Neutral Point Clamped Inverter

    DEFF Research Database (Denmark)

    Mo, Wei; Loh, Poh Chiang; Blaabjerg, Frede

    Transformer based Z-source inverters are recently proposed to achieve promising buck-boost capability. They have improved higher buck-boost capability, smaller size and less components count over Z-source inverters. On the other hand, neutral point clamped inverters have less switching stress...... and better output performance comparing with traditional two-level inverters. Integrating these two types of configurations can help neutral point inverters achieve enhanced votlage buck-boost capability....

  17. Characterizations of fixed points of quantum operations

    International Nuclear Information System (INIS)

    Li Yuan


    Let φ A be a general quantum operation. An operator B is said to be a fixed point of φ A , if φ A (B)=B. In this note, we shall show conditions under which B, a fixed point φ A , implies that B is compatible with the operation element of φ A . In particular, we offer an extension of the generalized Lueders theorem.

  18. SIFT based algorithm for point feature tracking

    Directory of Open Access Journals (Sweden)

    Adrian BURLACU


    Full Text Available In this paper a tracking algorithm for SIFT features in image sequences is developed. For each point feature extracted using SIFT algorithm a descriptor is computed using information from its neighborhood. Using an algorithm based on minimizing the distance between two descriptors tracking point features throughout image sequences is engaged. Experimental results, obtained from image sequences that capture scaling of different geometrical type object, reveal the performances of the tracking algorithm.

  19. I See Your Point: Infants under 12 Months Understand that Pointing Is Communicative (United States)

    Krehm, Madelaine; Onishi, Kristine H.; Vouloumanos, Athena


    Do young infants understand that pointing gestures allow the pointer to change the information state of a recipient? We used a third-party experimental scenario to examine whether 9- and 11-month-olds understand that a pointer's pointing gesture can inform a recipient about a target object. When the pointer pointed to a target, infants…

  20. A three-point Taylor algorithm for three-point boundary value problems

    NARCIS (Netherlands)

    J.L. López; E. Pérez Sinusía; N.M. Temme (Nico)


    textabstractWe consider second-order linear differential equations $\\varphi(x)y''+f(x)y'+g(x)y=h(x)$ in the interval $(-1,1)$ with Dirichlet, Neumann or mixed Dirichlet-Neumann boundary conditions given at three points of the interval: the two extreme points $x=\\pm 1$ and an interior point

  1. Pseudo-dynamic source modelling with 1-point and 2-point statistics of earthquake source parameters

    KAUST Repository

    Song, S. G.; Dalguer, L. A.; Mai, Paul Martin


    statistical framework that governs the finite-fault rupture process with 1-point and 2-point statistics of source parameters in order to quantify the variability of finite source models for future scenario events. We test this method by extracting 1-point

  2. Point of sale tobacco advertisements in India. (United States)

    Chaudhry, S; Chaudhry, S; Chaudhry, K


    The effect of any legislation depends on its implementation. Limited studies indicate that tobacco companies may tend to use such provision for surrogate advertising. The point of sale advertisement provision has been placed in the Indian Tobacco Control legislation. The study was undertaken to assess the Indian scenario in this regard. To assess if there are any violations related to provision of point of tobacco sale advertisements under India's comprehensive tobacco Control legislation in different parts of India. Boards over various shops showing advertisements of tobacco products were observed in the cities of Delhi, Mumbai, Kolkata, Trivandrum and Jaipur, between September 2005 and March 2006. The point of sale advertisements mushroomed after the implementation of 2004 tobacco control legislation. Tobacco advertisement boards fully satisfying the point of sale provision were practically non-existent. The most common violation of point of sale advertisements was the larger size of the board but with tobacco advertisement equal to the size indicated in the legislation and remaining area often showing a picture. Invariably two boards were placed together to provide the impression of a large single repetitive advertisement. More than two boards was not common. Tobacco advertisement boards were also observed on closed shops/ warehouses, shops not selling tobacco products and on several adjacent shops. The purpose of the point of sale advertisements seems to be surrogate advertisement of tobacco products, mainly cigarettes.

  3. The Tipping Points of Technology Development

    Directory of Open Access Journals (Sweden)

    Tauno Kekäle


    Full Text Available The tipping point, the decisive point in time in the competition between old and new, is an interesting phenomenon in physics of today. This aspect in technology acceptance is connected to many business decisions such as technology investments, product releases, resource allocation, sales forecasts and, ultimately, affects the profitability and even survival of a company. The tipping point itself is based on many stochastic and dynamic variables, and the process may at least partly be described as path-dependent. This paper analyses the tipping point from three aspects: (1 product performance, (2 features of the market and infrastructure (including related technologies and human network externalities, and (3 actions of the incumbents (including customer lock-in, systems lock-in, and sustaining innovation. The paper is based on the Bass s-curve idea and the technology trajectory concept proposed by Dosi. Three illustrative cases are presented to make the point of the multiple factors affecting technology acceptance and, thus, the tipping point. The paper also suggests outlines for further research in field of computer simulation.

  4. Modeling fixation locations using spatial point processes. (United States)

    Barthelmé, Simon; Trukenbrod, Hans; Engbert, Ralf; Wichmann, Felix


    Whenever eye movements are measured, a central part of the analysis has to do with where subjects fixate and why they fixated where they fixated. To a first approximation, a set of fixations can be viewed as a set of points in space; this implies that fixations are spatial data and that the analysis of fixation locations can be beneficially thought of as a spatial statistics problem. We argue that thinking of fixation locations as arising from point processes is a very fruitful framework for eye-movement data, helping turn qualitative questions into quantitative ones. We provide a tutorial introduction to some of the main ideas of the field of spatial statistics, focusing especially on spatial Poisson processes. We show how point processes help relate image properties to fixation locations. In particular we show how point processes naturally express the idea that image features' predictability for fixations may vary from one image to another. We review other methods of analysis used in the literature, show how they relate to point process theory, and argue that thinking in terms of point processes substantially extends the range of analyses that can be performed and clarify their interpretation.

  5. Fermion-induced quantum critical points. (United States)

    Li, Zi-Xiang; Jiang, Yi-Fan; Jian, Shao-Kai; Yao, Hong


    A unified theory of quantum critical points beyond the conventional Landau-Ginzburg-Wilson paradigm remains unknown. According to Landau cubic criterion, phase transitions should be first-order when cubic terms of order parameters are allowed by symmetry in the Landau-Ginzburg free energy. Here, from renormalization group analysis, we show that second-order quantum phase transitions can occur at such putatively first-order transitions in interacting two-dimensional Dirac semimetals. As such type of Landau-forbidden quantum critical points are induced by gapless fermions, we call them fermion-induced quantum critical points. We further introduce a microscopic model of SU(N) fermions on the honeycomb lattice featuring a transition between Dirac semimetals and Kekule valence bond solids. Remarkably, our large-scale sign-problem-free Majorana quantum Monte Carlo simulations show convincing evidences of a fermion-induced quantum critical points for N = 2, 3, 4, 5 and 6, consistent with the renormalization group analysis. We finally discuss possible experimental realizations of the fermion-induced quantum critical points in graphene and graphene-like materials.Quantum phase transitions are governed by Landau-Ginzburg theory and the exceptions are rare. Here, Li et al. propose a type of Landau-forbidden quantum critical points induced by gapless fermions in two-dimensional Dirac semimetals.

  6. Finding a single point of truth

    Energy Technology Data Exchange (ETDEWEB)

    Sokolov, S.; Thijssen, H. [Autodesk Inc, Toronto, ON (Canada); Laslo, D.; Martin, J. [Autodesk Inc., San Rafael, CA (United States)


    Electric utilities collect large volumes of data at every level of their business, including SCADA, Smart Metering and Smart Grid initiatives, LIDAR and other 3D imagery surveys. Different types of database systems are used to store the information, rendering data flow within the utility business process extremely complicated. The industry trend has been to endure redundancy of data input and maintenance of multiple copies of the same data across different solution data sets. Efforts have been made to improve the situation with point to point interfaces, but with the tools and solutions available today, a single point of truth can be achieved. Consolidated and validated data can be published into a data warehouse at the right point in the process, making the information available to all other enterprise systems and solutions. This paper explained how the single point of truth spatial data warehouse and process automation services can be configured to streamline the flow of data within the utility business process using the initiate-plan-execute-close (IPEC) utility workflow model. The paper first discussed geospatial challenges faced by utilities and then presented the approach and technology aspects. It was concluded that adoption of systems and solutions that can function with and be controlled by the IPEC workflow can provide significant improvement for utility operations, particularly if those systems are coupled with the spatial data warehouse that reflects a single point of truth. 6 refs., 3 figs.

  7. Variational estimates of point-kinetics parameters

    International Nuclear Information System (INIS)

    Favorite, J.A.; Stacey, W.M. Jr.


    Variational estimates of the effect of flux shifts on the integral reactivity parameter of the point-kinetics equations and on regional power fractions were calculated for a variety of localized perturbations in two light water reactor (LWR) model problems representing a small, tightly coupled core and a large, loosely coupled core. For the small core, the flux shifts resulting from even relatively large localized reactivity changes (∼600 pcm) were small, and the standard point-kinetics approximation estimates of reactivity were in error by only ∼10% or less, while the variational estimates were accurate to within ∼1%. For the larger core, significant (>50%) flux shifts occurred in response to local perturbations, leading to errors of the same magnitude in the standard point-kinetics approximation of the reactivity worth. For positive reactivity, the error in the variational estimate of reactivity was only a few percent in the larger core, and the resulting transient power prediction was 1 to 2 orders of magnitude more accurate than with the standard point-kinetics approximation. For a large, local negative reactivity insertion resulting in a large flux shift, the accuracy of the variational estimate broke down. The variational estimate of the effect of flux shifts on reactivity in point-kinetics calculations of transients in LWR cores was found to generally result in greatly improved accuracy, relative to the standard point-kinetics approximation, the exception being for large negative reactivity insertions with large flux shifts in large, loosely coupled cores

  8. Magnonic triply-degenerate nodal points (United States)

    Owerre, S. A.


    We generalize the concept of triply-degenerate nodal points to non-collinear antiferromagnets. Here, we introduce this concept to insulating quantum antiferromagnets on the decorated honeycomb lattice, with spin-1 bosonic quasiparticle excitations known as magnons. We demonstrate the existence of magnonic surface states with constant energy contours that form pairs of magnonic arcs connecting the surface projection of the magnonic triple nodal points. The quasiparticle excitations near the triple nodal points represent three-component bosons beyond that of magnonic Dirac, Weyl, and nodal-line cases. They can be regarded as a direct reflection of the intrinsic spin carried by magnons. Furthermore, we show that the magnonic triple nodal points can split into magnonic Weyl points, as the system transits from a non-collinear spin structure to a non-coplanar one with a non-zero scalar spin chirality. Our results not only apply to insulating antiferromagnets, but also provide a platform to seek for triple nodal points in metallic antiferromagnets.

  9. Making SharePoint® Chemically Aware™. (United States)

    Tallapragada, Kartik; Chewning, Joseph; Kombo, David; Ludwick, Beverly


    The use of SharePoint® collaboration software for content management has become a critical part of today's drug discovery process. SharePoint 2010 software has laid a foundation which enables researchers to collaborate and search on various contents. The amount of data generated during a transition of a single compound from preclinical discovery to commercialization can easily range in terabytes, thus there is a greater demand of a chemically aware search algorithm that supplements SharePoint which enables researchers to query for information in a more intuitive and effective way. Thus by supplementing SharePoint with Chemically Aware™ features provides a great value to the pharmaceutical and biotech companies and makes drug discovery more efficient. Using several tools we have integrated SharePoint with chemical, compound, and reaction databases, thereby improving the traditional search engine capability and enhancing the user experience. This paper describes the implementation of a Chemically Aware™ system to supplement SharePoint. A Chemically Aware SharePoint (CASP) allows users to tag documents by drawing a structure and associating it with the related content. It also allows the user to search SharePoint software content and internal/external databases by carrying out substructure, similarity, SMILES, and IUPAC name searches. Building on traditional search, CASP takes SharePoint one step further by providing a intuitive GUI to the researchers to base their search on their knowledge of chemistry than textual search. CASP also provides a way to integrate with other systems, for example a researcher can perform a sub-structure search on pdf documents with embedded molecular entities. A Chemically Aware™ system supplementing SharePoint is a step towards making drug discovery process more efficient and also helps researchers to search for information in a more intuitive way. It also helps the researchers to find information which was once difficult to find

  10. Making SharePoint® Chemically Aware™

    Directory of Open Access Journals (Sweden)

    Tallapragada Kartik


    Full Text Available Abstract Background The use of SharePoint® collaboration software for content management has become a critical part of today's drug discovery process. SharePoint 2010 software has laid a foundation which enables researchers to collaborate and search on various contents. The amount of data generated during a transition of a single compound from preclinical discovery to commercialization can easily range in terabytes, thus there is a greater demand of a chemically aware search algorithm that supplements SharePoint which enables researchers to query for information in a more intuitive and effective way. Thus by supplementing SharePoint with Chemically Aware™ features provides a great value to the pharmaceutical and biotech companies and makes drug discovery more efficient. Using several tools we have integrated SharePoint with chemical, compound, and reaction databases, thereby improving the traditional search engine capability and enhancing the user experience. Results This paper describes the implementation of a Chemically Aware™ system to supplement SharePoint. A Chemically Aware SharePoint (CASP allows users to tag documents by drawing a structure and associating it with the related content. It also allows the user to search SharePoint software content and internal/external databases by carrying out substructure, similarity, SMILES, and IUPAC name searches. Building on traditional search, CASP takes SharePoint one step further by providing a intuitive GUI to the researchers to base their search on their knowledge of chemistry than textual search. CASP also provides a way to integrate with other systems, for example a researcher can perform a sub-structure search on pdf documents with embedded molecular entities. Conclusion A Chemically Aware™ system supplementing SharePoint is a step towards making drug discovery process more efficient and also helps researchers to search for information in a more intuitive way. It also helps the

  11. Role of Erosion in Shaping Point Bars (United States)

    Moody, J.; Meade, R.


    A powerful metaphor in fluvial geomorphology has been that depositional features such as point bars (and other floodplain features) constitute the river's historical memory in the form of uniformly thick sedimentary deposits waiting for the geomorphologist to dissect and interpret the past. For the past three decades, along the channel of Powder River (Montana USA) we have documented (with annual cross-sectional surveys and pit trenches) the evolution of the shape of three point bars that were created when an extreme flood in 1978 cut new channels across the necks of two former meander bends and radically shifted the location of a third bend. Subsequent erosion has substantially reshaped, at different time scales, the relic sediment deposits of varying age. At the weekly to monthly time scale (i.e., floods from snowmelt or floods from convective or cyclonic storms), the maximum scour depth was computed (by using a numerical model) at locations spaced 1 m apart across the entire point bar for a couple of the largest floods. The maximum predicted scour is about 0.22 m. At the annual time scale, repeated cross-section topographic surveys (25 during 32 years) indicate that net annual erosion at a single location can be as great as 0.5 m, and that the net erosion is greater than net deposition during 8, 16, and 32% of the years for the three point bars. On average, the median annual net erosion was 21, 36, and 51% of the net deposition. At the decadal time scale, an index of point bar preservation often referred to as completeness was defined for each cross section as the percentage of the initial deposit (older than 10 years) that was still remaining in 2011; computations indicate that 19, 41, and 36% of the initial deposits of sediment were eroded. Initial deposits were not uniform in thickness and often represented thicker pods of sediment connected by thin layers of sediment or even isolated pods at different elevations across the point bar in response to multiple

  12. Hardware-accelerated Point Generation and Rendering of Point-based Impostors

    DEFF Research Database (Denmark)

    Bærentzen, Jakob Andreas


    This paper presents a novel scheme for generating points from triangle models. The method is fast and lends itself well to implementation using graphics hardware. The triangle to point conversion is done by rendering the models, and the rendering may be performed procedurally or by a black box API....... I describe the technique in detail and discuss how the generated point sets can easily be used as impostors for the original triangle models used to create the points. Since the points reside solely in GPU memory, these impostors are fairly efficient. Source code is available online....

  13. Inhibition effect of calcium hydroxide point and chlorhexidine point on root canal bacteria of necrosis teeth

    Directory of Open Access Journals (Sweden)

    Andry Leonard Je


    Full Text Available Calcium Hydroxide point and Chlorhexidine point are new drugs for eliminating bacteria in the root canal. The points slowly and controly realease Calcium Hydroxide and Chlorhexidine into root canal. The purpose of the study was to determined the effectivity of Calcium hydroxide point (Calcium hydroxide plus point and Chlorhexidine point in eleminating the root canal bacteria of nescrosis teeth. In this study 14 subjects were divided into 2 groups. The first group was treated with Calcium hydroxide point and the second was treated with Chlorhexidine poin. The bacteriological sampling were measured with spectrofotometry. The Paired T Test analysis (before and after showed significant difference between the first and second group. The Independent T Test which analysed the effectivity of both groups had not showed significant difference. Although there was no significant difference in statistical test, the result of second group eliminate more bacteria than the first group. The present finding indicated that the use of Chlorhexidine point was better than Calcium hydroxide point in seven days period. The conclusion is Chlorhexidine point and Calcium hydroxide point as root canal medicament effectively eliminate root canal bacteria of necrosis teeth.

  14. The computation of fixed points and applications

    CERN Document Server

    Todd, Michael J


    Fixed-point algorithms have diverse applications in economics, optimization, game theory and the numerical solution of boundary-value problems. Since Scarf's pioneering work [56,57] on obtaining approximate fixed points of continuous mappings, a great deal of research has been done in extending the applicability and improving the efficiency of fixed-point methods. Much of this work is available only in research papers, although Scarf's book [58] gives a remarkably clear exposition of the power of fixed-point methods. However, the algorithms described by Scarf have been super~eded by the more sophisticated restart and homotopy techniques of Merrill [~8,~9] and Eaves and Saigal [1~,16]. To understand the more efficient algorithms one must become familiar with the notions of triangulation and simplicial approxi- tion, whereas Scarf stresses the concept of primitive set. These notes are intended to introduce to a wider audience the most recent fixed-point methods and their applications. Our approach is therefore ...

  15. An X-point ergodic divertor

    International Nuclear Information System (INIS)

    Chu, M.S.; Jensen, T.H.; La Haye, R.J.; Taylor, T.S.; Evans, T.E.


    A new ergodic divertor is proposed. It utilizes a system of external (n = 3) coils arranged to generate overlapping magnetic islands in the edge region of a diverted tokamak and connect the randomized field lines to the external (cold) divertor plate. The novel feature in the configuration is the placement of the external coils close to the X-point. A realistic design of the external coil set is studied by using the field line tracing method for a low aspect ratio (A ≅ 3) tokamak. Two types of effects are observed. First, by placing the coils close to the X-point, where the poloidal magnetic field is weak and the rational surfaces are closely packed only a moderate amount of current in the external coils is needed to ergodize the edge region. This ergodized edge enhances the edge transport in the X-point region and leads to the potential of edge profile control and the avoidance of edge localized modes (ELMs). Furthermore, the trajectories of the field lines close to the X-point are modified by the external coil set, causing the hit points on the external divertor plates to be randomized and spread out in the major radius direction. A time-dependent modulation of the currents in the external (n = 3) coils can potentially spread the heat flux more uniformly on the divertor plate avoiding high concentration of the heat flux. 10 refs., 9 figs

  16. Critical Points in Distance Learning System

    Directory of Open Access Journals (Sweden)

    Airina Savickaitė


    Full Text Available Purpose – This article presents the results of distance learning system analysis, i.e. the critical elements of the distance learning system. The critical points of distance learning are a part of distance education online environment interactivity/community process model. The most important is the fact that the critical point is associated with distance learning participants. Design/methodology/approach – Comparative review of articles and analysis of distance learning module. Findings – A modern man is a lifelong learner and distance learning is a way to be a modern person. The focus on a learner and feedback is the most important thing of learning distance system. Also, attention should be paid to the lecture-appropriate knowledge and ability to convey information. Distance system adaptation is the way to improve the learner’s learning outcomes. Research limitations/implications – Different learning disciplines and learning methods may have different critical points. Practical implications – The information of analysis could be important for both lecturers and students, who studies distance education systems. There are familiar critical points which may deteriorate the quality of learning. Originality/value – The study sought to develop remote systems for applications in order to improve the quality of knowledge. Keywords: distance learning, process model, critical points. Research type: review of literature and general overview.

  17. Geometric Spanners for Weighted Point Sets

    DEFF Research Database (Denmark)

    Abam, Mohammad; de Berg, Mark; Farshi, Mohammad


    Let (S,d) be a finite metric space, where each element p ∈ S has a non-negative weight w(p). We study spanners for the set S with respect to weighted distance function d w , where d w (p,q) is w(p) + d(p,q) + wq if p ≠ q and 0 otherwise. We present a general method for turning spanners with respect...... to the d-metric into spanners with respect to the d w -metric. For any given ε> 0, we can apply our method to obtain (5 + ε)-spanners with a linear number of edges for three cases: points in Euclidean space ℝ d , points in spaces of bounded doubling dimension, and points on the boundary of a convex body...... in ℝ d where d is the geodesic distance function. We also describe an alternative method that leads to (2 + ε)-spanners for points in ℝ d and for points on the boundary of a convex body in ℝ d . The number of edges in these spanners is O(nlogn). This bound on the stretch factor is nearly optimal...


    Directory of Open Access Journals (Sweden)

    F. Poux


    Full Text Available Dealing with coloured point cloud acquired from terrestrial laser scanner, this paper identifies remaining challenges for a new data structure: the smart point cloud. This concept arises with the statement that massive and discretized spatial information from active remote sensing technology is often underused due to data mining limitations. The generalisation of point cloud data associated with the heterogeneity and temporality of such datasets is the main issue regarding structure, segmentation, classification, and interaction for an immediate understanding. We propose to use both point cloud properties and human knowledge through machine learning to rapidly extract pertinent information, using user-centered information (smart data rather than raw data. A review of feature detection, machine learning frameworks and database systems indexed both for mining queries and data visualisation is studied. Based on existing approaches, we propose a new 3-block flexible framework around device expertise, analytic expertise and domain base reflexion. This contribution serves as the first step for the realisation of a comprehensive smart point cloud data structure.

  19. Fixed point theory in metric type spaces

    CERN Document Server

    Agarwal, Ravi P; O’Regan, Donal; Roldán-López-de-Hierro, Antonio Francisco


    Written by a team of leading experts in the field, this volume presents a self-contained account of the theory, techniques and results in metric type spaces (in particular in G-metric spaces); that is, the text approaches this important area of fixed point analysis beginning from the basic ideas of metric space topology. The text is structured so that it leads the reader from preliminaries and historical notes on metric spaces (in particular G-metric spaces) and on mappings, to Banach type contraction theorems in metric type spaces, fixed point theory in partially ordered G-metric spaces, fixed point theory for expansive mappings in metric type spaces, generalizations, present results and techniques in a very general abstract setting and framework. Fixed point theory is one of the major research areas in nonlinear analysis. This is partly due to the fact that in many real world problems fixed point theory is the basic mathematical tool used to establish the existence of solutions to problems which arise natur...

  20. Controlling superconductivity by tunable quantum critical points. (United States)

    Seo, S; Park, E; Bauer, E D; Ronning, F; Kim, J N; Shim, J-H; Thompson, J D; Park, Tuson


    The heavy fermion compound CeRhIn5 is a rare example where a quantum critical point, hidden by a dome of superconductivity, has been explicitly revealed and found to have a local nature. The lack of additional examples of local types of quantum critical points associated with superconductivity, however, has made it difficult to unravel the role of quantum fluctuations in forming Cooper pairs. Here, we show the precise control of superconductivity by tunable quantum critical points in CeRhIn5. Slight tin-substitution for indium in CeRhIn5 shifts its antiferromagnetic quantum critical point from 2.3 GPa to 1.3 GPa and induces a residual impurity scattering 300 times larger than that of pure CeRhIn5, which should be sufficient to preclude superconductivity. Nevertheless, superconductivity occurs at the quantum critical point of the tin-doped metal. These results underline that fluctuations from the antiferromagnetic quantum criticality promote unconventional superconductivity in CeRhIn5.


    Directory of Open Access Journals (Sweden)

    C. T. Liao


    Full Text Available Remote sensing images are generally recorded in two-dimensional format containing multispectral information. Also, the semantic information is clearly visualized, which ground features can be better recognized and classified via supervised or unsupervised classification methods easily. Nevertheless, the shortcomings of multispectral images are highly depending on light conditions, and classification results lack of three-dimensional semantic information. On the other hand, LiDAR has become a main technology for acquiring high accuracy point cloud data. The advantages of LiDAR are high data acquisition rate, independent of light conditions and can directly produce three-dimensional coordinates. However, comparing with multispectral images, the disadvantage is multispectral information shortage, which remains a challenge in ground feature classification through massive point cloud data. Consequently, by combining the advantages of both LiDAR and multispectral images, point cloud data with three-dimensional coordinates and multispectral information can produce a integrate solution for point cloud classification. Therefore, this research acquires visible light and near infrared images, via close range photogrammetry, by matching images automatically through free online service for multispectral point cloud generation. Then, one can use three-dimensional affine coordinate transformation to compare the data increment. At last, the given threshold of height and color information is set as threshold in classification.

  2. Classification by Using Multispectral Point Cloud Data (United States)

    Liao, C. T.; Huang, H. H.


    Remote sensing images are generally recorded in two-dimensional format containing multispectral information. Also, the semantic information is clearly visualized, which ground features can be better recognized and classified via supervised or unsupervised classification methods easily. Nevertheless, the shortcomings of multispectral images are highly depending on light conditions, and classification results lack of three-dimensional semantic information. On the other hand, LiDAR has become a main technology for acquiring high accuracy point cloud data. The advantages of LiDAR are high data acquisition rate, independent of light conditions and can directly produce three-dimensional coordinates. However, comparing with multispectral images, the disadvantage is multispectral information shortage, which remains a challenge in ground feature classification through massive point cloud data. Consequently, by combining the advantages of both LiDAR and multispectral images, point cloud data with three-dimensional coordinates and multispectral information can produce a integrate solution for point cloud classification. Therefore, this research acquires visible light and near infrared images, via close range photogrammetry, by matching images automatically through free online service for multispectral point cloud generation. Then, one can use three-dimensional affine coordinate transformation to compare the data increment. At last, the given threshold of height and color information is set as threshold in classification.

  3. Turning points in the history of mathematics

    CERN Document Server

    Grant, Hardy


    This book explores some of the major turning points in the history of mathematics, ranging from ancient Greece to the present, demonstrating the drama that has often been a part of its evolution. Studying these breakthroughs, transitions, and revolutions, their stumbling-blocks and their triumphs, can help illuminate the importance of the history of mathematics for its teaching, learning, and appreciation. Some of the turning points considered are the rise of the axiomatic method (most famously in Euclid), and the subsequent major changes in it (for example, by David Hilbert); the “wedding,” via analytic geometry, of algebra and geometry; the “taming” of the infinitely small and the infinitely large; the passages from algebra to algebras, from geometry to geometries, and from arithmetic to arithmetics; and the revolutions in the late nineteenth and early twentieth centuries that resulted from Georg Cantor’s creation of transfinite set theory. The origin of each turning point is discussed, along with...

  4. Generalized Attractor Points in Gauged Supergravity

    Energy Technology Data Exchange (ETDEWEB)

    Kachru, Shamit; /Stanford U., Phys. Dept. /SLAC; Kallosh, Renata; /Stanford U., Phys. Dept.; Shmakova, Marina; /KIPAC, Menlo Park /SLAC /Stanford U., Phys. Dept.


    The attractor mechanism governs the near-horizon geometry of extremal black holes in ungauged 4D N=2 supergravity theories and in Calabi-Yau compactifications of string theory. In this paper, we study a natural generalization of this mechanism to solutions of arbitrary 4D N=2 gauged supergravities. We define generalized attractor points as solutions of an ansatz which reduces the Einstein, gauge field, and scalar equations of motion to algebraic equations. The simplest generalized attractor geometries are characterized by non-vanishing constant anholonomy coefficients in an orthonormal frame. Basic examples include Lifshitz and Schroedinger solutions, as well as AdS and dS vacua. There is a generalized attractor potential whose critical points are the attractor points, and its extremization explains the algebraic nature of the equations governing both supersymmetric and non-supersymmetric attractors.

  5. The Pervasive Power of PowerPoint

    DEFF Research Database (Denmark)

    Schoeneborn, Dennis


    This paper examines the pervasive role of Microsoft’s presentation software PowerPoint as a genre of professional and organizational communication. Frequently, PowerPoint is not only used for the primary function it was initially designed for, i.e., facilitating live presentations, but also...... for alternative purposes such as project documentation. Its application in a neighboring domain, however, poses a functional dilemma: does the PowerPoint genre preserve the features of its primary function, i.e., presentation, or rather adapt to the new function, i.e., documentation? By drawing on a communication......-centered perspective, this paper examines PowerPoint’s role in the domain of project documentation as a clash between the constitutive affordances of professional and of organizational communication. To investigate this issue empirically, I conducted a case study at a multinational business consulting firm. The study...

  6. Automatic dew-point temperature sensor. (United States)

    Graichen, H; Rascati, R; Gonzalez, R R


    A device is described for measuring dew-point temperature and water vapor pressure in small confined areas. The method is based on the deposition of water on a cooled surface when at dew-point temperature. A small Peltier module lowers the temperature of two electrically conductive plates. At dew point the insulating gap separating the plates becomes conductive as water vapor condenses. Sensors based on this principle can be made small and rugged and can be used for measuring directly the local water vapor pressure. They may be installed within a conventional ventilated sweat capsule used for measuring water vapor loss from the skin surface. A novel application is the measurement of the water vapor pressure gradients across layers of clothing worn by an exercising subject.

  7. Early warning of climate tipping points (United States)

    Lenton, Timothy M.


    A climate 'tipping point' occurs when a small change in forcing triggers a strongly nonlinear response in the internal dynamics of part of the climate system, qualitatively changing its future state. Human-induced climate change could push several large-scale 'tipping elements' past a tipping point. Candidates include irreversible melt of the Greenland ice sheet, dieback of the Amazon rainforest and shift of the West African monsoon. Recent assessments give an increased probability of future tipping events, and the corresponding impacts are estimated to be large, making them significant risks. Recent work shows that early warning of an approaching climate tipping point is possible in principle, and could have considerable value in reducing the risk that they pose.

  8. QCD and the chiral critical point

    International Nuclear Information System (INIS)

    Gavin, S.; Gocksch, A.; Pisarski, R.D.


    As an extension of QCD, consider a theory with ''2+1'' flavors, where the current quark masses are held in a fixed ratio as the overall scale of the quark masses is varied. At nonzero temperature and baryon density it is expected that in the chiral limit the chiral phase transition is of first order. Increasing the quark mass from zero, the chiral transition becomes more weakly first order, and can end in a chiral critical point. We show that the only massless field at the chiral critical point is a σ meson, with the universality class that of the Ising model. Present day lattice simulations indicate that QCD is (relatively) near to the chiral critical point

  9. Fixed point algebras for easy quantum groups

    DEFF Research Database (Denmark)

    Gabriel, Olivier; Weber, Moritz


    Compact matrix quantum groups act naturally on Cuntz algebras. The first author isolated certain conditions under which the fixed point algebras under this action are Kirchberg algebras. Hence they are completely determined by their K-groups. Building on prior work by the second author,we prove...... that free easy quantum groups satisfy these conditions and we compute the K-groups of their fixed point algebras in a general form. We then turn to examples such as the quantum permutation group S+ n,the free orthogonal quantum group O+ n and the quantum reflection groups Hs+ n. Our fixed point......-algebra construction provides concrete examples of free actions of free orthogonal easy quantum groups,which are related to Hopf-Galois extensions....

  10. Zero-point field in curved spaces

    International Nuclear Information System (INIS)

    Hacyan, S.; Sarmiento, A.; Cocho, G.; Soto, F.


    Boyer's conjecture that the thermal effects of acceleration are manifestations of the zero-point field is further investigated within the context of quantum field theory in curved spaces. The energy-momentum current for a spinless field is defined rigorously and used as the basis for investigating the energy density observed in a noninertial frame. The following examples are considered: (i) uniformly accelerated observers, (ii) two-dimensional Schwarzschild black holes, (iii) the Einstein universe. The energy spectra which have been previously calculated appear in the present formalism as an additional contribution to the energy of the zero-point field, but particle creation does not occur. It is suggested that the radiation produced by gravitational fields or by acceleration is a manifestation of the zero-point field and of the same nature (whether real or virtual)

  11. Point defects and atomic transport in crystals

    International Nuclear Information System (INIS)

    Lidiard, A.B.


    There are two principle aspects to the theory of atomic transport in crystals as caused by the action of point defects, namely (1) the calculation of relevant properties of the point defects (energies and other thermodynamic characteristics of the different possible defects, activation energies and other mobility parameters) and (2) the statistical mechanics of assemblies of defects, both equilibrium and non-equilibrium assemblies. In the five lectures given here both these aspects are touched on. The first two lectures are concerned with the calculation of relevant point defect properties, particularly in ionic crystals. The first lecture is more general, the second is concerned particularly with some recent calculations of the free volumes of formation of defects in various ionic solids; these solve a rather long-standing problem in this area. The remaining three lectures are concerned with the kinetic theory of defects mainly in relaxation, drift and diffusion situations

  12. Nanotexturing of surfaces to reduce melting point.

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Ernest J.; Zubia, David (University of Texas at El Paso El Paso, TX); Mireles, Jose (Universidad Aut%C3%94onoma de Ciudad Ju%C3%94arez Ciudad Ju%C3%94arez, Mexico); Marquez, Noel (University of Texas at El Paso El Paso, TX); Quinones, Stella (University of Texas at El Paso El Paso, TX)


    This investigation examined the use of nano-patterned structures on Silicon-on-Insulator (SOI) material to reduce the bulk material melting point (1414 C). It has been found that sharp-tipped and other similar structures have a propensity to move to the lower energy states of spherical structures and as a result exhibit lower melting points than the bulk material. Such a reduction of the melting point would offer a number of interesting opportunities for bonding in microsystems packaging applications. Nano patterning process capabilities were developed to create the required structures for the investigation. One of the technical challenges of the project was understanding and creating the specialized conditions required to observe the melting and reshaping phenomena. Through systematic experimentation and review of the literature these conditions were determined and used to conduct phase change experiments. Melting temperatures as low as 1030 C were observed.

  13. End-point sharpness in thermometric titrimetry. (United States)

    Tyrrell, H J


    It is shown that the sharpness of an end-point in a thermometric titration where the simple reaction A + B right harpoon over left harpoon AB takes place, depends on Kc(A') where K is the equilibrium constant for the reaction, and c(A') is the total concentration of the titrand (A) in the reaction mixture. The end-point is sharp if, (i) the enthalpy change in the reaction is not negligible, and (ii) Kc(A') > 10(3). This shows that it should, for example, be possible to titrate 0.1 M acid, pK(A) = 10, using a thennometric end-point. Some aspects of thermometric titrimetry when Kc(A') < 10(3) are also considered.

  14. Visibility of noisy point cloud data

    KAUST Repository

    Mehra, Ravish


    We present a robust algorithm for estimating visibility from a given viewpoint for a point set containing concavities, non-uniformly spaced samples, and possibly corrupted with noise. Instead of performing an explicit surface reconstruction for the points set, visibility is computed based on a construction involving convex hull in a dual space, an idea inspired by the work of Katz et al. [26]. We derive theoretical bounds on the behavior of the method in the presence of noise and concavities, and use the derivations to develop a robust visibility estimation algorithm. In addition, computing visibility from a set of adaptively placed viewpoints allows us to generate locally consistent partial reconstructions. Using a graph based approximation algorithm we couple such reconstructions to extract globally consistent reconstructions. We test our method on a variety of 2D and 3D point sets of varying complexity and noise content. © 2010 Elsevier Ltd. All rights reserved.

  15. Optimizing Probability of Detection Point Estimate Demonstration (United States)

    Koshti, Ajay M.


    Probability of detection (POD) analysis is used in assessing reliably detectable flaw size in nondestructive evaluation (NDE). MIL-HDBK-18231and associated mh18232POD software gives most common methods of POD analysis. Real flaws such as cracks and crack-like flaws are desired to be detected using these NDE methods. A reliably detectable crack size is required for safe life analysis of fracture critical parts. The paper provides discussion on optimizing probability of detection (POD) demonstration experiments using Point Estimate Method. POD Point estimate method is used by NASA for qualifying special NDE procedures. The point estimate method uses binomial distribution for probability density. Normally, a set of 29 flaws of same size within some tolerance are used in the demonstration. The optimization is performed to provide acceptable value for probability of passing demonstration (PPD) and achieving acceptable value for probability of false (POF) calls while keeping the flaw sizes in the set as small as possible.


    Directory of Open Access Journals (Sweden)

    Telis-Romero J.


    Full Text Available The rise in boiling point of coffee extract was experimentally measured at soluble solids concentrations in the range of 9.2 to 52.4ºBrix and pressures between 5.8 × 10³ and 9.4 × 10(4 Pa (abs.. Different approaches to representing experimental data, including the Dühring's rule, the Antoine equation and empirical models proposed in the literature were tested. In the range of 9.2 to 16.2ºBrix, the rise in boiling point was nearly independent of pressure, varying only with extract concentration. Considerable deviations of this behavior began to occur at concentrations higher than 16.2ºBrix. Experimental data could best be predicted by adjusting an empirical model which consists of a single equation that takes into account the dependence of rise in boiling point on pressure and concentration.

  17. Theory of Single Point Incremental Forming

    DEFF Research Database (Denmark)

    Martins, P.A.F.; Bay, Niels; Skjødt, Martin


    This paper presents a closed-form theoretical analysis modelling the fundamentals of single point incremental forming and explaining the experimental and numerical results available in the literature for the past couple of years. The model is based on membrane analysis with bi-directional in-plan......-plane contact friction and is focused on the extreme modes of deformation that are likely to be found in single point incremental forming processes. The overall investigation is supported by experimental work performed by the authors and data retrieved from the literature.......This paper presents a closed-form theoretical analysis modelling the fundamentals of single point incremental forming and explaining the experimental and numerical results available in the literature for the past couple of years. The model is based on membrane analysis with bi-directional in...

  18. Problems in the theory of point explosions (United States)

    Korobeinikov, V. P.

    The book is concerned with the development of the theory of point explosions, which is relevant to the study of such phenomena as the initiation of detonation, high-power explosions, electric discharges, cosmic explosions, laser blasts, and hypersonic aerodynamics. The discussion covers the principal equations and the statement of problems; linearized non-self-similar one-dimensional problems; spherical, cylindrical, and plane explosions with allowance for counterpressure under conditions of constant initial density; explosions in a combustible mixture of gases; and point explosions in inhomogeneous media with nonsymmetric energy release. Attention is also given to point explosions in an electrically conducting gas with allowance for the effect of the magnetic field and to the propagation of perturbations from solar flares.

  19. Life satisfaction set point: stability and change. (United States)

    Fujita, Frank; Diener, Ed


    Using data from 17 years of a large and nationally representative panel study from Germany, the authors examined whether there is a set point for life satisfaction (LS)--stability across time, even though it can be perturbed for short periods by life events. The authors found that 24% of respondents changed significantly in LS from the first 5 years to the last 5 years and that stability declined as the period between measurements increased. Average LS in the first 5 years correlated .51 with the 5-year average of LS during the last 5 years. Height, weight, body mass index, systolic and diastolic blood pressure, and personality traits were all more stable than LS, whereas income was about as stable as LS. Almost 9% of the sample changed an average of 3 or more points on a 10-point scale from the first 5 to last 5 years of the study.

  20. Reactor coolant flow measurements at Point Lepreau

    International Nuclear Information System (INIS)

    Brenciaglia, G.; Gurevich, Y.; Liu, G.


    The CROSSFLOW ultrasonic flow measurement system manufactured by AMAG is fully proven as reliable and accurate when applied to large piping in defined geometries for such applications as feedwater flows measurement. Its application to direct reactor coolant flow (RCF) measurements - both individual channel flows and bulk flows such as pump suction flow - has been well established through recent work by AMAG at Point Lepreau, with application to other reactor types (eg. PWR) imminent. At Point Lepreau, Measurements have been demonstrated at full power; improvements to consistently meet ±1% accuracy are in progress. The development and recent customization of CROSSFLOW to RCF measurement at Point Lepreau are described in this paper; typical measurement results are included. (author)

  1. The registration of non-cooperative moving targets laser point cloud in different view point (United States)

    Wang, Shuai; Sun, Huayan; Guo, Huichao


    Non-cooperative moving target multi-view cloud registration is the key technology of 3D reconstruction of laser threedimension imaging. The main problem is that the density changes greatly and noise exists under different acquisition conditions of point cloud. In this paper, firstly, the feature descriptor is used to find the most similar point cloud, and then based on the registration algorithm of region segmentation, the geometric structure of the point is extracted by the geometric similarity between point and point, The point cloud is divided into regions based on spectral clustering, feature descriptors are created for each region, searching to find the most similar regions in the most similar point of view cloud, and then aligning the pair of point clouds by aligning their minimum bounding boxes. Repeat the above steps again until registration of all point clouds is completed. Experiments show that this method is insensitive to the density of point clouds and performs well on the noise of laser three-dimension imaging.

  2. Point Cluster Analysis Using a 3D Voronoi Diagram with Applications in Point Cloud Segmentation

    Directory of Open Access Journals (Sweden)

    Shen Ying


    Full Text Available Three-dimensional (3D point analysis and visualization is one of the most effective methods of point cluster detection and segmentation in geospatial datasets. However, serious scattering and clotting characteristics interfere with the visual detection of 3D point clusters. To overcome this problem, this study proposes the use of 3D Voronoi diagrams to analyze and visualize 3D points instead of the original data item. The proposed algorithm computes the cluster of 3D points by applying a set of 3D Voronoi cells to describe and quantify 3D points. The decompositions of point cloud of 3D models are guided by the 3D Voronoi cell parameters. The parameter values are mapped from the Voronoi cells to 3D points to show the spatial pattern and relationships; thus, a 3D point cluster pattern can be highlighted and easily recognized. To capture different cluster patterns, continuous progressive clusters and segmentations are tested. The 3D spatial relationship is shown to facilitate cluster detection. Furthermore, the generated segmentations of real 3D data cases are exploited to demonstrate the feasibility of our approach in detecting different spatial clusters for continuous point cloud segmentation.

  3. Point cloud processing for smart systems

    Directory of Open Access Journals (Sweden)

    Jaromír Landa


    Full Text Available High population as well as the economical tension emphasises the necessity of effective city management – from land use planning to urban green maintenance. The management effectiveness is based on precise knowledge of the city environment. Point clouds generated by mobile and terrestrial laser scanners provide precise data about objects in the scanner vicinity. From these data pieces the state of the roads, buildings, trees and other objects important for this decision-making process can be obtained. Generally, they can support the idea of “smart” or at least “smarter” cities.Unfortunately the point clouds do not provide this type of information automatically. It has to be extracted. This extraction is done by expert personnel or by object recognition software. As the point clouds can represent large areas (streets or even cities, usage of expert personnel to identify the required objects can be very time-consuming, therefore cost ineffective. Object recognition software allows us to detect and identify required objects semi-automatically or automatically.The first part of the article reviews and analyses the state of current art point cloud object recognition techniques. The following part presents common formats used for point cloud storage and frequently used software tools for point cloud processing. Further, a method for extraction of geospatial information about detected objects is proposed. Therefore, the method can be used not only to recognize the existence and shape of certain objects, but also to retrieve their geospatial properties. These objects can be later directly used in various GIS systems for further analyses.

  4. Interior point algorithms theory and analysis

    CERN Document Server

    Ye, Yinyu


    The first comprehensive review of the theory and practice of one of today's most powerful optimization techniques. The explosive growth of research into and development of interior point algorithms over the past two decades has significantly improved the complexity of linear programming and yielded some of today's most sophisticated computing techniques. This book offers a comprehensive and thorough treatment of the theory, analysis, and implementation of this powerful computational tool. Interior Point Algorithms provides detailed coverage of all basic and advanced aspects of the subject.

  5. LIDAR, Point Clouds, and their Archaeological Applications

    Energy Technology Data Exchange (ETDEWEB)

    White, Devin A [ORNL


    It is common in contemporary archaeological literature, in papers at archaeological conferences, and in grant proposals to see heritage professionals use the term LIDAR to refer to high spatial resolution digital elevation models and the technology used to produce them. The goal of this chapter is to break that association and introduce archaeologists to the world of point clouds, in which LIDAR is only one member of a larger family of techniques to obtain, visualize, and analyze three-dimensional measurements of archaeological features. After describing how point clouds are constructed, there is a brief discussion on the currently available software and analytical techniques designed to make sense of them.

  6. SharePoint 2010 Administration Instant Reference

    CERN Document Server

    Williams, Randy


    Fast, accurate answers on SharePoint 2010 administration-in an instant If you're a SharePoint administrator and are looking for fast, accurate, easy-to-understand answers and solutions, then this reference is for you. Thumb tabs, secondary and tertiary tables of contents, and special heading treatments ensure quick and easy ways to find practical solutions on the spot. In addition, quick-reference tables, lists, and step-by-step instruction provide even more helpful information on the day-to-day administration of Microsoft's newest collaboration solution.Features invaluable answers and solutio

  7. The QCD Critical Point and Related Observables

    Energy Technology Data Exchange (ETDEWEB)

    Nahrgang, Marlene


    The search for the critical point of QCD in heavy-ion collision experiments has sparked enormous interest with the completion of phase I of the RHIC beam energy scan. Here, I review the basics of the thermodynamics of the QCD phase transition and its implications for experimental multiplicity fluctuations in heavy-ion collisions. Several sources of noncritical fluctuations impact the observables and need to be understood in addition to the critical phenomena. Recent progress has been made in dynamical modeling of critical fluctuations, which ultimately is indispensable to understand potential signals of the QCD critical point in heavy-ion collision.

  8. Twisted vector bundles on pointed nodal curves

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    by identifying the points p1 and p2. If m ≥ 2, let R1,...,Rm−1 be m − 1 copies of the projective line P1 and let xi,yi be two distinct points in Ri. Let R be the nodal curve which arises from the union. R0 ⊔ R1 ⊔···⊔ Rm−1 ⊔ Rm by identifying p1 ∈ R0 and p2 ∈ Rm with x1 ∈ R1 and ym−1 ∈ Rm−1 respectively and by identifying ...

  9. Critical point inequalities and scaling limits

    International Nuclear Information System (INIS)

    Newman, C.M.


    A refined and extended version of the Buckingham-Gunton inequality relating various pairs of critical exponents is shown to be valid for a large class of statistical mechanical models. If this inequality is an equality (in the refined sense) and one of the critical exponents has a non-Gaussian value, then any scaling limit must be non-Gaussian. This result clarifies the relationships between the nontriviality of triviality of the scaling limit for ordinary critical points in four dimensions (or tricritical points in three dimensions) and the existence of logarithmic factors in the asymptotics which define the two critical exponents. (orig.) [de

  10. SharePoint 2010 for Project Management

    CERN Document Server

    Sy, Dux


    If you were to analyze your team's performance on a typical project, you'd be surprised how much time is wasted on non-productive tasks. This hands-on guide shows you how to work more efficiently by organizing and managing projects with SharePoint 2010. You'll learn how to build a Project Management Information System (PMIS), customized to your project, that can effectively coordinate communication and collaboration among team members. Written by a certified Project Management Professional (PMP) and Microsoft SharePoint MVP with 15 years of IT project management experience, each chapter incl

  11. Supporting Multiple Pointing Devices in Microsoft Windows

    DEFF Research Database (Denmark)

    Westergaard, Michael


    In this paper the implementation of a Microsoft Windows driver including APIs supporting multiple pointing devices is presented. Microsoft Windows does not natively support multiple pointing devices controlling independent cursors, and a number of solutions to this have been implemented by us and...... and others. Here we motivate and describe a general solution, and how user applications can use it by means of a framework. The device driver and the supporting APIs will be made available free of charge. Interested parties can contact the author for more information....

  12. Dynamics and mission design near libration points

    CERN Document Server

    Gómez, G; Simo, C; Masdemont, J


    This book studies several problems related to the analysis of planned or possible spacecraft missions. It is divided into four chapters. The first chapter is devoted to the computation of quasiperiodic solutions for the motion of a spacecraft near the equilateral points of the Earth-Moon system. The second chapter gives a complete description of the orbits near the collinear point, L 1 , between the Earth and the Sun in the restricted three-body problem (RTBP) model. In the third chapter, methods are developed to compute the nominal orbit and to design and test the control strategy for the qua

  13. Dynamics and mission design near libration points

    CERN Document Server

    Gómez, G; Jorba, A; Masdemont, J


    The aim of this book is to explain, analyze and compute the kinds of motions that appear in an extended vicinity of the geometrically defined equilateral points of the Earth-Moon system, as a source of possible nominal orbits for future space missions. The methodology developed here is not specific to astrodynamics problems. The techniques are developed in such a way that they can be used to study problems that can be modeled by dynamical systems. Contents: Global Stability Zones Around the Triangular Libration Points; The Normal Form Around L 5 in the Three-dimensional RTBP; Normal Form of th

  14. Duan's fixed point theorem: Proof and generalization

    Directory of Open Access Journals (Sweden)

    Arkowitz Martin


    Full Text Available Let be an H-space of the homotopy type of a connected, finite CW-complex, any map and the th power map. Duan proved that has a fixed point if . We give a new, short and elementary proof of this. We then use rational homotopy to generalize to spaces whose rational cohomology is the tensor product of an exterior algebra on odd dimensional generators with the tensor product of truncated polynomial algebras on even dimensional generators. The role of the power map is played by a -structure as defined by Hemmi-Morisugi-Ooshima. The conclusion is that and each has a fixed point.

  15. UHE point source survey at Cygnus experiment

    International Nuclear Information System (INIS)

    Lu, X.; Yodh, G.B.; Alexandreas, D.E.; Allen, R.C.; Berley, D.; Biller, S.D.; Burman, R.L.; Cady, R.; Chang, C.Y.; Dingus, B.L.; Dion, G.M.; Ellsworth, R.W.; Gilra, M.K.; Goodman, J.A.; Haines, T.J.; Hoffman, C.M.; Kwok, P.; Lloyd-Evans, J.; Nagle, D.E.; Potter, M.E.; Sandberg, V.D.; Stark, M.J.; Talaga, R.L.; Vishwanath, P.R.; Zhang, W.


    A new method of searching for UHE point source has been developed. With a data sample of 150 million events, we have surveyed the sky for point sources over 3314 locations (1.4 degree <δ<70.4 degree). It was found that their distribution is consistent with a random fluctuation. In addition, fifty two known potential sources, including pulsars and binary x-ray sources, were studied. The source with the largest positive excess is the Crab Nebula. An excess of 2.5 sigma above the background is observed in a bin of 2.3 degree by 2.5 degree in declination and right ascension respectively

  16. Detecting corner points from digital curves

    International Nuclear Information System (INIS)

    Sarfraz, M.


    Corners in digital images give important clues for shape representation, recognition, and analysis. Since dominant information regarding shape is usually available at the corners, they provide important features for various real life applications in the disciplines like computer vision, pattern recognition, computer graphics. Corners are the robust features in the sense that they provide important information regarding objects under translation, rotation and scale change. They are also important from the view point of understanding human perception of objects. They play crucial role in decomposing or describing the digital curves. They are also used in scale space theory, image representation, stereo vision, motion tracking, image matching, building mosaics and font designing systems. If the corner points are identified properly, a shape can be represented in an efficient and compact way with sufficient accuracy. Corner detection schemes, based on their applications, can be broadly divided into two categories: binary (suitable for binary images) and gray level (suitable for gray level images). Corner detection approaches for binary images usually involve segmenting the image into regions and extracting boundaries from those regions that contain them. The techniques for gray level images can be categorized into two classes: (a) Template based and (b) gradient based. The template based techniques utilize correlation between a sub-image and a template of a given angle. A corner point is selected by finding the maximum of the correlation output. Gradient based techniques require computing curvature of an edge that passes through a neighborhood in a gray level image. Many corner detection algorithms have been proposed in the literature which can be broadly divided into two parts. One is to detect corner points from grayscale images and other relates to boundary based corner detection. This contribution mainly deals with techniques adopted for later approach

  17. Zero-point energy of confined fermions

    International Nuclear Information System (INIS)

    Milton, K.A.


    A closed form for the reduced Green's function of massless fermions in the interior of a spherical bag is obtained. In terms of this Green's function, the corresponding zero-point or Casimir energy is computed. It is proposed that a resulting quadratic divergence can be absorbed by renormalizing a suitable parameter in the bag model (that is, absorbed by a contact term). The residual Casimir stress is attractive, but smaller than the repulsive Casimir stress of gluons in the model. The result for the total zero-point energy is in substantial disagreement with bag model phenomenological values

  18. The myth of the boiling point. (United States)

    Chang, Hasok


    Around 1800, many reputable scientists reported significant variations in the temperature of pure water boiling under normal atmospheric pressure. The reported variations included a difference of over 1 degree C between boiling in metallic and glass vessels (Gay-Lussac), and "superheating" up to 112 degrees C on extracting dissolved air out of water (De Luc). I have confirmed most of these observations in my own experiments, many of which are described in this paper. Water boils at the "boiling point" only under very particular circumstances. Our common-sense intuition about the fixedness of the boiling point is only sustained by our limited experience.

  19. Boiling point measurements on liquid UO2

    International Nuclear Information System (INIS)

    Bober, M.; Singer, J.; Trapp, M.


    In analogy to the classic boiling point method, a quasi-stationary millisecond laser-heating technique was applied to measure the saturated-vapour pressure curve of liquid UO 2 in the temperature range of 3500 to 4500 K. The result is represented by log p(MPa) 5.049 -23042/T(K) according to an average heat of vaporization of 441 kJ/mol and a normal boiling point of 3808 K. Besides, spectral emissivities of liquid UO 2 were measured at the pyrometer wavelengths of 752 and 1064 nm. (author)

  20. The boiling point of stratospheric aerosols. (United States)

    Rosen, J. M.


    A photoelectric particle counter was used for the measurement of aerosol boiling points. The operational principle involves raising the temperature of the aerosol by vigorously heating a portion of the intake tube. At or above the boiling point, the particles disintegrate rather quickly, and a noticeable effect on the size distribution and concentration is observed. Stratospheric aerosols appear to have the same volatility as a solution of 75% sulfuric acid. Chemical analysis of the aerosols indicates that there are other substances present, but that the sulfate radical is apparently the major constituent.

  1. Microsoft SharePoint 2010 development cookbook

    CERN Document Server

    Musters, Ed


    The plan of the book is to build a relationship with the Author as your personal guide through the most common "pattern" of SharePoint development. In cookbook style, you will be led carefully step by step through a comprehensive set of recipes. The practical example starts quickly and builds logically throughout the chapters to create a common theme. You will be developing coding techniques that you will be able to apply to the real world. In fact, this book will train you for the first SharePoint development project you will join. This book is written for the ASP.NET developer who wants to g

  2. Dynamics and mission design near libration points

    CERN Document Server

    Gómez, G; Simo, C; Martínez, R


    In this book the problem of station keeping is studied for orbits near libration points in the solar system. The main focus is on orbits near halo ones in the (Earth+Moon)-Sun system. Taking as starting point the restricted three-body problem, the motion in the full solar system is considered as a perturbation of this simplified model. All the study is done with enough generality to allow easy application to other primary-secondary systems as a simple extension of the analytical and numerical computations. Contents: Bibliographical Survey; Halo Orbits. Analytical and Numerical Study; The Neigh

  3. Point defect relaxation volumes for copper

    International Nuclear Information System (INIS)

    Miller, K.M.


    The methods used for the determination of point defect relaxation volumes are discussed and it is shown that a previous interatomic potential derived for copper is inaccurate and results obtained using it are invalid. A new interatomic potential has been produced for copper and a computer simulation of point and planar defects carried out. A vacancy relaxation volume of -0.33 atomic volumes has been found with interstitial values in the range 1.7 to 2.0 atomic volumes. It is shown that these values in current theories of irradiation induced swelling lead to an anomalously high value for dislocation bias compared with that determined experimentally. (author)

  4. Point card compatible automatic vending machine for canned drink; Point card taio kan jido hanbaiki

    Energy Technology Data Exchange (ETDEWEB)



    A point card compatible automatic vending machine for canned drinks is developed, which provides drink manufacturers with a powerful tool to acquire selling sites and attract consumers. Since the machine is equipped with a device to handle point cards, regular customers have increased and sales have picked up. A point card issuing device is also installed, and the new machine issues a point card whenever a customer wants. The drink manufacturers are evaluating high of the vending machine because it will contribute to the diffusion of the point card system and because a sales promotion campaign may be conducted through the vending machine for instance by exchanging a fully marked card with a giveaway on the spot. In the future, a bill validator (paper money identifier) will be integrated even with small size machines for the diffusion of point card compatible machines. (translated by NEDO)

  5. Quantitative structure-property relationships for prediction of boiling point, vapor pressure, and melting point. (United States)

    Dearden, John C


    Boiling point, vapor pressure, and melting point are important physicochemical properties in the modeling of the distribution and fate of chemicals in the environment. However, such data often are not available, and therefore must be estimated. Over the years, many attempts have been made to calculate boiling points, vapor pressures, and melting points by using quantitative structure-property relationships, and this review examines and discusses the work published in this area, and concentrates particularly on recent studies. A number of software programs are commercially available for the calculation of boiling point, vapor pressure, and melting point, and these have been tested for their predictive ability with a test set of 100 organic chemicals.

  6. Obesity prevention at the point of purchase. (United States)

    Cohen, D A; Lesser, L I


    The point of purchase is when people may make poor and impulsive decisions about what and how much to buy and consume. Because point of purchase strategies frequently work through non-cognitive processes, people are often unable to recognize and resist them. Because people lack insight into how marketing practices interfere with their ability to routinely eat healthy, balanced diets, public health entities should protect consumers from potentially harmful point of purchase strategies. We describe four point of purchase policy options including standardized portion sizes; standards for meals that are sold as a bundle, e.g. 'combo meals'; placement and marketing restrictions on highly processed low-nutrient foods; and explicit warning labels. Adoption of such policies could contribute significantly to the prevention of obesity and diet-related chronic diseases. We also discuss how the policies could be implemented, along with who might favour or oppose them. Many of the policies can be implemented locally, while preserving consumer choice. © 2016 World Obesity.

  7. ASIC For Complex Fixed-Point Arithmetic (United States)

    Petilli, Stephen G.; Grimm, Michael J.; Olson, Erlend M.


    Application-specific integrated circuit (ASIC) performs 24-bit, fixed-point arithmetic operations on arrays of complex-valued input data. High-performance, wide-band arithmetic logic unit (ALU) designed for use in computing fast Fourier transforms (FFTs) and for performing ditigal filtering functions. Other applications include general computations involved in analysis of spectra and digital signal processing.

  8. OH masers associated with IRAS point sources

    NARCIS (Netherlands)

    Masheder, MRW; Cohen, RJ; Martin-Hernandez, NL; Migenes,; Reid, MJ


    We report a search for masers from the Lambda-doublet of the ground-state of OH at 18cm, carried out with the Jodrell Bank Lovell Telescope and with the 25m Dwingeloo telescope. All objects north of delta = -20degrees which appear in the IRAS Point Source Catalog with fluxes > 1000 Jy at 60mum and

  9. Some genus 3 curves with many points

    NARCIS (Netherlands)

    Auer, R; Top, J; Fieker, C; Kohel, DR


    We explain a naive approach towards the problem of finding genus 3 curves C over any given finite field F-q of odd characteristic, with a number of rational points close to the Hasse-Weil-Serre upper bound q+1+3[2rootq]. The method turns out to be successful at least in characteristic 3.

  10. Common Fixed Points for Weakly Compatible Maps

    Indian Academy of Sciences (India)

    The purpose of this paper is to prove a common fixed point theorem, from the class of compatible continuous maps to a larger class of maps having weakly compatible maps without appeal to continuity, which generalized the results of Jungck [3], Fisher [1], Kang and Kim [8], Jachymski [2], and Rhoades [9].

  11. Diagnosing patients at point of care

    CSIR Research Space (South Africa)

    Vilakazi, CB


    Full Text Available of pregnant women, the Cellnostics portable blood analyser and paper-based diagnostic solutions. Umbiflow is a Doppler ultrasound device that can determine at the primary point of care, such as a clinic, whether a fetus that is small for gestational age...

  12. Visibility of noisy point cloud data

    KAUST Repository

    Mehra, Ravish; Tripathi, Pushkar; Sheffer, Alla; Mitra, Niloy J.


    for the points set, visibility is computed based on a construction involving convex hull in a dual space, an idea inspired by the work of Katz et al. [26]. We derive theoretical bounds on the behavior of the method in the presence of noise and concavities

  13. Quench dynamics across quantum critical points

    International Nuclear Information System (INIS)

    Sengupta, K.; Powell, Stephen; Sachdev, Subir


    We study the quantum dynamics of a number of model systems as their coupling constants are changed rapidly across a quantum critical point. The primary motivation is provided by the recent experiments of Greiner et al. [Nature (London) 415, 39 (2002)] who studied the response of a Mott insulator of ultracold atoms in an optical lattice to a strong potential gradient. In a previous work, it had been argued that the resonant response observed at a critical potential gradient could be understood by proximity to an Ising quantum critical point describing the onset of density wave order. Here we obtain numerical results on the evolution of the density wave order as the potential gradient is scanned across the quantum critical point. This is supplemented by studies of the integrable quantum Ising spin chain in a transverse field, where we obtain exact results for the evolution of the Ising order correlations under a time-dependent transverse field. We also study the evolution of transverse superfluid order in the three-dimensional case. In all cases, the order parameter is best enhanced in the vicinity of the quantum critical point

  14. Detecting change-points in extremes

    KAUST Repository

    Dupuis, D. J.; Sun, Ying; Wang, Huixia Judy


    Even though most work on change-point estimation focuses on changes in the mean, changes in the variance or in the tail distribution can lead to more extreme events. In this paper, we develop a new method of detecting and estimating the change

  15. Modelling occupants’ heating set-point prefferences

    DEFF Research Database (Denmark)

    Andersen, Rune Vinther; Olesen, Bjarne W.; Toftum, Jørn


    consumption. Simultaneous measurement of the set-point of thermostatic radiator valves (trv), and indoor and outdoor environment characteristics was carried out in 15 dwellings in Denmark in 2008. Linear regression was used to infer a model of occupants’ interactions with trvs. This model could easily...... be implemented in most simulation software packages to increase the validity of the simulation outcomes....

  16. Kelp diagrams : Point set membership visualization

    NARCIS (Netherlands)

    Dinkla, K.; Kreveld, van M.J.; Speckmann, B.; Westenberg, M.A.


    We present Kelp Diagrams, a novel method to depict set relations over points, i.e., elements with predefined positions. Our method creates schematic drawings and has been designed to take aesthetic quality, efficiency, and effectiveness into account. This is achieved by a routing algorithm, which

  17. Lipoprotein lipase isoelectric point isoforms in humans

    DEFF Research Database (Denmark)

    Badia-Villanueva, M.; Carulla, P.; Carrascal, M.


    -heparin plasma (PHP), LPL consists of a pattern of more than 8 forms of the same apparent molecular weight, but different isoelectric point (pI). In the present study we describe, for the first time, the existence of at least nine LPL pI isoforms in human PHP, with apparent pI between 6.8 and 8.6. Separation...

  18. SharePoint Office Pocket Guide

    CERN Document Server

    Webb, Jeff


    With this handy reference as your guide, you can reap all the benefits of SharePoint--Microsoft's amazing information-sharing tool. It shows you, in plain language, how to construct a web site where individuals from all over can capture and share ideas. Learn how to upload documents, edit content, send alerts, track work items, add new team members, and much more.

  19. The Tipping Point and the Adventure Advantage. (United States)

    Prouty, Dick


    Insights from chaos theory--the interconnectedness of everything, nonlinear cause and effect, leverage and the "tipping point," and the importance of aligning interventions within a system--are applied to social action and illustrated via the role of adventure education in school and community interventions in the Brattleboro (Vermont) Leadership…

  20. Lane Determination with GPS Precise Point Positioning

    NARCIS (Netherlands)

    Knoop, V.L.; de Bakker, P.F.; Tiberius, C.C.J.M.; van Arem, B.


    Modern intelligent transport solutions can achieve an improvement of traffic flow on motorways. With lane-specific measurements and lane-specific control, more measures are possible. Single frequency precise point positioning (PPP) is a newly developed and affordable technique to achieve an

  1. PCX, Interior-Point Linear Programming Solver

    International Nuclear Information System (INIS)

    Czyzyk, J.


    1 - Description of program or function: PCX solves linear programming problems using the Mehrota predictor-corrector interior-point algorithm. PCX can be called as a subroutine or used in stand-alone mode, with data supplied from an MPS file. The software incorporates modules that can be used separately from the linear programming solver, including a pre-solve routine and data structure definitions. 2 - Methods: The Mehrota predictor-corrector method is a primal-dual interior-point method for linear programming. The starting point is determined from a modified least squares heuristic. Linear systems of equations are solved at each interior-point iteration via a sparse Cholesky algorithm native to the code. A pre-solver is incorporated in the code to eliminate inefficiencies in the user's formulation of the problem. 3 - Restriction on the complexity of the problem: There are no size limitations built into the program. The size of problem solved is limited by RAM and swap space on the user's computer

  2. Some Generalizations of Jungck's Fixed Point Theorem

    Directory of Open Access Journals (Sweden)

    J. R. Morales


    Full Text Available We are going to generalize the Jungck's fixed point theorem for commuting mappings by mean of the concepts of altering distance functions and compatible pair of mappings, as well as, by using contractive inequalities of integral type and contractive inequalities depending on another function.

  3. Fixed points and self-reference

    Directory of Open Access Journals (Sweden)

    Raymond M. Smullyan


    Full Text Available It is shown how Gödel's famous diagonal argument and a generalization of the recursion theorem are derivable from a common construation. The abstract fixed point theorem of this article is independent of both metamathematics and recursion theory and is perfectly comprehensible to the non-specialist.

  4. Fingerprint Analysis with Marked Point Processes

    DEFF Research Database (Denmark)

    Forbes, Peter G. M.; Lauritzen, Steffen; Møller, Jesper

    We present a framework for fingerprint matching based on marked point process models. An efficient Monte Carlo algorithm is developed to calculate the marginal likelihood ratio for the hypothesis that two observed prints originate from the same finger against the hypothesis that they originate from...... different fingers. Our model achieves good performance on an NIST-FBI fingerprint database of 258 matched fingerprint pairs....

  5. IEEE Standard for Floating Point Numbers

    Indian Academy of Sciences (India)

    IAS Admin

    Floating point numbers are an important data type in compu- tation which is used ... quite large! Integers are ... exp, the value of the exponent will be taken as (exp –127). The ..... bit which is truncated is 1, add 1 to the least significant bit, else.

  6. Modern Statistics for Spatial Point Processes

    DEFF Research Database (Denmark)

    Møller, Jesper; Waagepetersen, Rasmus


    We summarize and discuss the current state of spatial point process theory and directions for future research, making an analogy with generalized linear models and random effect models, and illustrating the theory with various examples of applications. In particular, we consider Poisson, Gibbs...

  7. Modern statistics for spatial point processes

    DEFF Research Database (Denmark)

    Møller, Jesper; Waagepetersen, Rasmus

    We summarize and discuss the current state of spatial point process theory and directions for future research, making an analogy with generalized linear models and random effect models, and illustrating the theory with various examples of applications. In particular, we consider Poisson, Gibbs...

  8. Exceptional points in open quantum systems

    International Nuclear Information System (INIS)

    Mueller, Markus; Rotter, Ingrid


    Open quantum systems are embedded in the continuum of scattering wavefunctions and are naturally described by non-Hermitian Hamilton operators. In the complex energy plane, exceptional points appear at which two (or more) eigenvalues of the Hamilton operator coalesce. Although they are a countable set of single points in the complex energy plane and therefore of measure zero, they determine decisively the dynamics of open quantum systems. A powerful method for the description of open quantum systems is the Feshbach projection operator formalism. It is used in the present paper as a basic tool for the study of exceptional points and of the role they play for the dynamics of open quantum systems. Among others, the topological structure of the exceptional points, the rigidity of the phases of the eigenfunctions in their vicinity, the enhancement of observable values due to the reduced phase rigidity and the appearance of phase transitions are considered. The results are compared with existing experimental data on microwave cavities. In the last section, some questions being still unsolved, are considered

  9. Isotropic irradiation of detectors from point sources

    DEFF Research Database (Denmark)

    Aage, Helle Karina


    NaI(Tl) scintillator detectors have been exposed to gamma rays from 8 different point sources from different directions. Background and backscatter of gamma-rays from the surroundings have been subtracted in order to produce clean spectra. By adding spectra obtained from exposures from different ...

  10. Lap belts and three-point belts.

    NARCIS (Netherlands)

    Kampen, L.T.B. van & Edelman, A.


    Results of the swov-accident investigation prove that if there are any differences in the effectiveness of lap belts and three-point belts, these are so small that they cannot form a basis for giving preference to one type over the other. Furthermore, in spite of the results of this investigation

  11. Zero-point length from string fluctuations

    International Nuclear Information System (INIS)

    Fontanini, Michele; Spallucci, Euro; Padmanabhan, T.


    One of the leading candidates for quantum gravity, viz. string theory, has the following features incorporated in it. (i) The full spacetime is higher-dimensional, with (possibly) compact extra-dimensions; (ii) there is a natural minimal length below which the concept of continuum spacetime needs to be modified by some deeper concept. On the other hand, the existence of a minimal length (zero-point length) in four-dimensional spacetime, with obvious implications as UV regulator, has been often conjectured as a natural aftermath of any correct quantum theory of gravity. We show that one can incorporate the apparently unrelated pieces of information-zero-point length, extra-dimensions, string T-duality-in a consistent framework. This is done in terms of a modified Kaluza-Klein theory that interpolates between (high-energy) string theory and (low-energy) quantum field theory. In this model, the zero-point length in four dimensions is a 'virtual memory' of the length scale of compact extra-dimensions. Such a scale turns out to be determined by T-duality inherited from the underlying fundamental string theory. From a low energy perspective short distance infinities are cutoff by a minimal length which is proportional to the square root of the string slope, i.e., α ' . Thus, we bridge the gap between the string theory domain and the low energy arena of point-particle quantum field theory

  12. Comparison of sparse point distribution models

    DEFF Research Database (Denmark)

    Erbou, Søren Gylling Hemmingsen; Vester-Christensen, Martin; Larsen, Rasmus


    This paper compares several methods for obtaining sparse and compact point distribution models suited for data sets containing many variables. These are evaluated on a database consisting of 3D surfaces of a section of the pelvic bone obtained from CT scans of 33 porcine carcasses. The superior m...

  13. Naïve Point Estimation (United States)

    Lindskog, Marcus; Winman, Anders; Juslin, Peter


    The capacity of short-term memory is a key constraint when people make online judgments requiring them to rely on samples retrieved from memory (e.g., Dougherty & Hunter, 2003). In this article, the authors compare 2 accounts of how people use knowledge of statistical distributions to make point estimates: either by retrieving precomputed…

  14. Fixed Point Approach to Bagley Torvik Problem

    Directory of Open Access Journals (Sweden)

    Lale CONA


    Full Text Available In the present paper, a sufficient condition for existence and uniqueness of Bagley Torvik problem is obtained. The theorem on existence and uniqueness is established. This approach permits us to use fixed point iteration method to solve problem for differential equation involving derivatives of nonlinear order.

  15. Tunable Magnon Weyl Points in Ferromagnetic Pyrochlores. (United States)

    Mook, Alexander; Henk, Jürgen; Mertig, Ingrid


    The dispersion relations of magnons in ferromagnetic pyrochlores with Dzyaloshinskii-Moriya interaction are shown to possess Weyl points, i. e., pairs of topologically nontrivial crossings of two magnon branches with opposite topological charge. As a consequence of their topological nature, their projections onto a surface are connected by magnon arcs, thereby resembling closely Fermi arcs of electronic Weyl semimetals. On top of this, the positions of the Weyl points in reciprocal space can be tuned widely by an external magnetic field: rotated within the surface plane, the Weyl points and magnon arcs are rotated as well; tilting the magnetic field out of plane shifts the Weyl points toward the center Γ[over ¯] of the surface Brillouin zone. The theory is valid for the class of ferromagnetic pyrochlores, i. e., three-dimensional extensions of topological magnon insulators on kagome lattices. In this Letter, we focus on the (111) surface, identify candidates of established ferromagnetic pyrochlores which apply to the considered spin model, and suggest experiments for the detection of the topological features.

  16. Patron Preference in Reference Service Points. (United States)

    Morgan, Linda


    Behavior of patrons choosing between a person sitting at a counter and one sitting at a desk at each of two reference points was observed at the reference department during remodeling at the M. D. Anderson Library of the University of Houston. Results showed a statistically relevant preference for the counter. (Author/JD)


    Energy Technology Data Exchange (ETDEWEB)

    Deddens, J. C.; Batch, M. L.


    The testing program for the Indian Point Reactor is discussed. The thermal and hydraulic evaluation of the primary coolant system is discussed. Analyses of fuel loading and initial criticality, measurement of operating coefficients of reactivity, control rod group reactivity worths, and xenon evaluation are presented. (R.E.U.)

  18. An Alternative Starting Point for Fraction Instruction (United States)

    Cortina, José Luis; Višnovská, Jana; Zúñiga, Claudia


    We analyze the results of a study conducted for the purpose of assessing the viability of an alternative starting point for teaching fractions. The alternative is based on Freudenthal's insights about fraction as comparison. It involves portraying the entities that unit fractions quantify as always being apart from the reference unit, instead of…

  19. Point contact to single-crystalline diamond

    Czech Academy of Sciences Publication Activity Database

    Mareš, Jiří J.; Hubík, Pavel; Uxa, Štěpán; Krištofik, Jozef; Kozak, Halyna


    Roč. 27, č. 6 (2012), 1-4 ISSN 0268-1242 R&D Projects: GA ČR GAP204/10/0212 Institutional research plan: CEZ:AV0Z10100521 Keywords : point-contact * diamond * space-charge–limited transport Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.921, year: 2012

  20. Misuse the Power, Miss the Point (United States)

    Lonergan, David


    In this article, the author addresses a problem that plagues virtually all academics, as well as most people in business, K-12 education, and many other walks of life. At one time or another most members of post-millennial western society have suffered through that most hideous of well-intentioned experiences, the botched PowerPoint presentation.…

  1. Surface Charging and Points of Zero Charge

    CERN Document Server

    Kosmulski, Marek


    Presents Points of Zero Charge data on well-defined specimen of materials sorted by trademark, manufacturer, and location. This text emphasizes the comparison between particular results obtained for different portions of the same or very similar material and synthesizes the information published in research reports over the past few decades

  2. Semi-Dirac points in phononic crystals

    KAUST Repository

    Zhang, Xiujuan; Wu, Ying


    of rubber, in which the acoustic wave velocity is lower than that in water, the semi-Dirac dispersion can be characterized by an effective medium theory. The effective medium parameters link the semi-Dirac point to a topological transition in the iso

  3. Critical point of view: a Wikipedia reader

    NARCIS (Netherlands)

    Lovink, G.; Tkacz, N.


    For millions of internet users around the globe, the search for new knowledge begins with Wikipedia. The encyclopedia’s rapid rise, novel organization, and freely offered content have been marveled at and denounced by a host of commentators. Critical Point of View moves beyond unflagging praise,

  4. Ecological association between HIV and concurrency point ...

    African Journals Online (AJOL)

    Ecological association between HIV and concurrency point-prevalence in South Africa's ethnic groups. Chris Kenyon. Abstract. HIV prevalence between different ethnic groups within South Africa exhibits considerable variation. Numerous authors believe that elevated sexual partner concurrency rates are important in the ...

  5. Space Telescope Pointing Control System software (United States)

    Dougherty, H.; Rodoni, C.; Rossini, R.; Tompetrini, K.; Nakashima, A.; Bradley, A.


    The Space Telescope Pointing Control System software is in the advanced development stage, having been tested on both the airbearing and the static simulator. The overall structure of the software is discussed, along with timing and sizing evaluations. The interaction between the controls analysts and software designer is described.

  6. The Lambda Point Experiment in Microgravity (United States)

    Lipa, J. A.; Swanson, D. R.; Nissen, J. A.; Chui, T. C. P.


    In October 1992 a low temperature experiment was flown on the Space Shuttle in low earth orbit, using the JPL low temperature research facility. The objective of the mission was to measure the heat capacity and thermal relaxation of helium very close to the lambda point with the smearing effect of gravity removed.

  7. The ViewPoint radioprotection supervision workstation

    International Nuclear Information System (INIS)

    Gaultier, E.


    The author briefly presents the ViewPoint supervision global solution which incorporates audio and video advanced technologies to manage radioprotection operational measurements. Data can be transmitted by-wire or wireless. It can integrate a large number of radioprotection measurement instruments, such as a belt for the monitoring of physiological parameters (body temperature, breathing rhythm, body posture)

  8. Unidentified point sources in the IRAS minisurvey (United States)

    Houck, J. R.; Soifer, B. T.; Neugebauer, G.; Beichman, C. A.; Aumann, H. H.; Clegg, P. E.; Gillett, F. C.; Habing, H. J.; Hauser, M. G.; Low, F. J.


    Nine bright, point-like 60 micron sources have been selected from the sample of 8709 sources in the IRAS minisurvey. These sources have no counterparts in a variety of catalogs of nonstellar objects. Four objects have no visible counterparts, while five have faint stellar objects visible in the error ellipse. These sources do not resemble objects previously known to be bright infrared sources.

  9. Translating Deming's 14 Points for Education. (United States)

    Melvin, Charles A., III


    A consortium of four Wisconsin school districts has decided to stop tinkering with the educational system and apply W. Edward Deming's 14 management points to total system improvement. The rewritten precepts involve creating and adopting a fitting purpose, infusing quality into the educational "product," and working toward zero defects…

  10. N ecklaces~ Periodic Points and Permutation Representations

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 11. Necklaces, Periodic Points and Permutation Representations - Fermat's Little Theorem. Somnath Basu Anindita Bose Sumit Kumar Sinha Pankaj Vishe. General Article Volume 6 Issue 11 November 2001 pp 18-26 ...

  11. Reliability Estimates for Undergraduate Grade Point Average (United States)

    Westrick, Paul A.


    Undergraduate grade point average (GPA) is a commonly employed measure in educational research, serving as a criterion or as a predictor depending on the research question. Over the decades, researchers have used a variety of reliability coefficients to estimate the reliability of undergraduate GPA, which suggests that there has been no consensus…

  12. On Motion Planning for Point-to-Point Maneuvers for a Class of Sailing Vehicles

    DEFF Research Database (Denmark)

    Xiao, Lin; Jouffroy, Jerome


    Despite their interesting dynamic and controllability properties, sailing vehicles have not been much studied in the control community. In this paper, we investigate motion planning of such vehicles. Starting from a simple dynamic model of sailing vessels in one dimension, this paper first...... considers their associated controllability issues, with the so-called no-sailing zone as a starting point, and it links them with a motion planning strategy using two-point boundary value problems as the main mathematical tool. This perspective is then expanded to do point-to-point maneuvers of sailing...

  13. Critical points for finite Fibonacci chains of point delta-interactions and orthogonal polynomials

    International Nuclear Information System (INIS)

    De Prunele, E


    For a one-dimensional Schroedinger operator with a finite number n of point delta-interactions with a common intensity, the parameters are the intensity, the n - 1 intercenter distances and the mass. Critical points are points in the parameters space of the Hamiltonian where one bound state appears or disappears. The study of critical points for Hamiltonians with point delta-interactions arranged along a Fibonacci chain is shown to be closely related to the study of the so-called Fibonacci operator, a discrete one-dimensional Schroedinger-type operator, which occurs in the context of tight binding Hamiltonians. These critical points are the zeros of orthogonal polynomials previously studied in the context of special diatomic linear chains with elastic nearest-neighbor interaction. Properties of the zeros (location, asymptotic behavior, gaps, ...) are investigated. The perturbation series from the solvable periodic case is determined. The measure which yields orthogonality is investigated numerically from the zeros. It is shown that the transmission coefficient at zero energy can be expressed in terms of the orthogonal polynomials and their associated polynomials. In particular, it is shown that when the number of point delta-interactions is equal to a Fibonacci number minus 1, i.e. when the intervals between point delta-interactions form a palindrome, all the Fibonacci chains at critical points are completely transparent at zero energy. (paper)

  14. Georeferenced Point Clouds: A Survey of Features and Point Cloud Management

    Directory of Open Access Journals (Sweden)

    Johannes Otepka


    Full Text Available This paper presents a survey of georeferenced point clouds. Concentration is, on the one hand, put on features, which originate in the measurement process themselves, and features derived by processing the point cloud. On the other hand, approaches for the processing of georeferenced point clouds are reviewed. This includes the data structures, but also spatial processing concepts. We suggest a categorization of features into levels that reflect the amount of processing. Point clouds are found across many disciplines, which is reflected in the versatility of the literature suggesting specific features.

  15. C-point and V-point singularity lattice formation and index sign conversion methods (United States)

    Kumar Pal, Sushanta; Ruchi; Senthilkumaran, P.


    The generic singularities in an ellipse field are C-points namely stars, lemons and monstars in a polarization distribution with C-point indices (-1/2), (+1/2) and (+1/2) respectively. Similar to C-point singularities, there are V-point singularities that occur in a vector field and are characterized by Poincare-Hopf index of integer values. In this paper we show that the superposition of three homogenously polarized beams in different linear states leads to the formation of polarization singularity lattice. Three point sources at the focal plane of the lens are used to create three interfering plane waves. A radial/azimuthal polarization converter (S-wave plate) placed near the focal plane modulates the polarization states of the three beams. The interference pattern is found to host C-points and V-points in a hexagonal lattice. The C-points occur at intensity maxima and V-points occur at intensity minima. Modulating the state of polarization (SOP) of three plane waves from radial to azimuthal does not essentially change the nature of polarization singularity lattice as the Poincare-Hopf index for both radial and azimuthal polarization distributions is (+1). Hence a transformation from a star to a lemon is not trivial, as such a transformation requires not a single SOP change, but a change in whole spatial SOP distribution. Further there is no change in the lattice structure and the C- and V-points appear at locations where they were present earlier. Hence to convert an interlacing star and V-point lattice into an interlacing lemon and V-point lattice, the interferometer requires modification. We show for the first time a method to change the polarity of C-point and V-point indices. This means that lemons can be converted into stars and stars can be converted into lemons. Similarly the positive V-point can be converted to negative V-point and vice versa. The intensity distribution in all these lattices is invariant as the SOPs of the three beams are changed in an

  16. Dosimetric adaptive IMRT driven by fiducial points

    International Nuclear Information System (INIS)

    Crijns, Wouter; Van Herck, Hans; Defraene, Gilles; Van den Bergh, Laura; Haustermans, Karin; Slagmolen, Pieter; Maes, Frederik; Van den Heuvel, Frank


    Purpose: Intensity modulated radiotherapy (IMRT) and volumetric modulated arc therapy have become standard treatments but are more sensitive to anatomical variations than 3D conformal techniques. To correct for inter- and intrafraction anatomical variations, fast and easy to implement methods are needed. Here, the authors propose a full dosimetric IMRT correction that finds a compromise in-between basic repositioning (the current clinical practice) and full replanning. It simplifies replanning by avoiding a recontouring step and a full dose calculation. It surpasses repositioning by updating the preoptimized fluence and monitor units (MU) using a limited number of fiducial points and a pretreatment (CB)CT. To adapt the fluence the fiducial points were projected in the beam's eye view (BEV). To adapt the MUs, point dose calculation towards the same fiducial points were performed. The proposed method is intrinsically fast and robust, and simple to understand for operators, because of the use of only four fiducial points and the beam data based point dose calculations. Methods: To perform our dosimetric adaptation, two fluence corrections in the BEV are combined with two MU correction steps along the beam's path. (1) A transformation of the fluence map such that it is realigned with the current target geometry. (2) A correction for an unintended scaling of the penumbra margin when the treatment beams scale to the current target size. (3) A correction for the target depth relative to the body contour and (4) a correction for the target distance to the source. The impact of the correction strategy and its individual components was evaluated by simulations on a virtual prostate phantom. This heterogeneous reference phantom was systematically subjected to population based prostate transformations to simulate interfraction variations. Additionally, a patient example illustrated the clinical practice. The correction strategy was evaluated using both dosimetric

  17. Dosimetric adaptive IMRT driven by fiducial points

    Energy Technology Data Exchange (ETDEWEB)

    Crijns, Wouter, E-mail: [Department of Oncology, Laboratory of Experimental Radiotherapy, KU Leuven, Herestraat 49, 3000 Leuven, Belgium and Medical Imaging Research Center, KU Leuven, Herestraat 49, 3000 Leuven (Belgium); Van Herck, Hans [Medical Imaging Research Center, KU Leuven, Herestraat 49, 3000 Leuven, Belgium and Department of Electrical Engineering (ESAT) – PSI, Center for the Processing of Speech and Images, KU Leuven, 3000 Leuven (Belgium); Defraene, Gilles; Van den Bergh, Laura; Haustermans, Karin [Department of Oncology, Laboratory of Experimental Radiotherapy, KU Leuven, Herestraat 49, 3000 Leuven (Belgium); Slagmolen, Pieter [Medical Imaging Research Center, KU Leuven, Herestraat 49, 3000 Leuven (Belgium); Department of Electrical Engineering (ESAT) – PSI, Center for the Processing of Speech and Images, KU Leuven, 3000 Leuven (Belgium); iMinds-KU Leuven Medical IT Department, KU Leuven, 3000 Leuven (Belgium); Maes, Frederik [Medical Imaging Research Center, KU Leuven, Herestraat 49, 3000 Leuven (Belgium); Department of Electrical Engineering (ESAT) – PSI, Center for the Processing of Speech and Images, KU Leuven and iMinds, 3000 Leuven (Belgium); Van den Heuvel, Frank [Department of Oncology, Laboratory of Experimental Radiotherapy, KU Leuven, Herestraat 49, 3000 Leuven, Belgium and Department of Oncology, MRC-CR-UK Gray Institute of Radiation Oncology and Biology, University of Oxford, Oxford OX1 2JD (United Kingdom)


    Purpose: Intensity modulated radiotherapy (IMRT) and volumetric modulated arc therapy have become standard treatments but are more sensitive to anatomical variations than 3D conformal techniques. To correct for inter- and intrafraction anatomical variations, fast and easy to implement methods are needed. Here, the authors propose a full dosimetric IMRT correction that finds a compromise in-between basic repositioning (the current clinical practice) and full replanning. It simplifies replanning by avoiding a recontouring step and a full dose calculation. It surpasses repositioning by updating the preoptimized fluence and monitor units (MU) using a limited number of fiducial points and a pretreatment (CB)CT. To adapt the fluence the fiducial points were projected in the beam's eye view (BEV). To adapt the MUs, point dose calculation towards the same fiducial points were performed. The proposed method is intrinsically fast and robust, and simple to understand for operators, because of the use of only four fiducial points and the beam data based point dose calculations. Methods: To perform our dosimetric adaptation, two fluence corrections in the BEV are combined with two MU correction steps along the beam's path. (1) A transformation of the fluence map such that it is realigned with the current target geometry. (2) A correction for an unintended scaling of the penumbra margin when the treatment beams scale to the current target size. (3) A correction for the target depth relative to the body contour and (4) a correction for the target distance to the source. The impact of the correction strategy and its individual components was evaluated by simulations on a virtual prostate phantom. This heterogeneous reference phantom was systematically subjected to population based prostate transformations to simulate interfraction variations. Additionally, a patient example illustrated the clinical practice. The correction strategy was evaluated using both dosimetric

  18. Estimating Function Approaches for Spatial Point Processes (United States)

    Deng, Chong

    Spatial point pattern data consist of locations of events that are often of interest in biological and ecological studies. Such data are commonly viewed as a realization from a stochastic process called spatial point process. To fit a parametric spatial point process model to such data, likelihood-based methods have been widely studied. However, while maximum likelihood estimation is often too computationally intensive for Cox and cluster processes, pairwise likelihood methods such as composite likelihood, Palm likelihood usually suffer from the loss of information due to the ignorance of correlation among pairs. For many types of correlated data other than spatial point processes, when likelihood-based approaches are not desirable, estimating functions have been widely used for model fitting. In this dissertation, we explore the estimating function approaches for fitting spatial point process models. These approaches, which are based on the asymptotic optimal estimating function theories, can be used to incorporate the correlation among data and yield more efficient estimators. We conducted a series of studies to demonstrate that these estmating function approaches are good alternatives to balance the trade-off between computation complexity and estimating efficiency. First, we propose a new estimating procedure that improves the efficiency of pairwise composite likelihood method in estimating clustering parameters. Our approach combines estimating functions derived from pairwise composite likeli-hood estimation and estimating functions that account for correlations among the pairwise contributions. Our method can be used to fit a variety of parametric spatial point process models and can yield more efficient estimators for the clustering parameters than pairwise composite likelihood estimation. We demonstrate its efficacy through a simulation study and an application to the longleaf pine data. Second, we further explore the quasi-likelihood approach on fitting

  19. Pilot points method for conditioning multiple-point statistical facies simulation on flow data (United States)

    Ma, Wei; Jafarpour, Behnam


    We propose a new pilot points method for conditioning discrete multiple-point statistical (MPS) facies simulation on dynamic flow data. While conditioning MPS simulation on static hard data is straightforward, their calibration against nonlinear flow data is nontrivial. The proposed method generates conditional models from a conceptual model of geologic connectivity, known as a training image (TI), by strategically placing and estimating pilot points. To place pilot points, a score map is generated based on three sources of information: (i) the uncertainty in facies distribution, (ii) the model response sensitivity information, and (iii) the observed flow data. Once the pilot points are placed, the facies values at these points are inferred from production data and then are used, along with available hard data at well locations, to simulate a new set of conditional facies realizations. While facies estimation at the pilot points can be performed using different inversion algorithms, in this study the ensemble smoother (ES) is adopted to update permeability maps from production data, which are then used to statistically infer facies types at the pilot point locations. The developed method combines the information in the flow data and the TI by using the former to infer facies values at selected locations away from the wells and the latter to ensure consistent facies structure and connectivity where away from measurement locations. Several numerical experiments are used to evaluate the performance of the developed method and to discuss its important properties.

  20. Uncertainty analysis of point by point sampling complex surfaces using touch probe CMMs

    DEFF Research Database (Denmark)

    Barini, Emanuele; Tosello, Guido; De Chiffre, Leonardo


    The paper describes a study concerning point by point scanning of complex surfaces using tactile CMMs. A four factors-two level full factorial experiment was carried out, involving measurements on a complex surface configuration item comprising a sphere, a cylinder and a cone, combined in a singl...