WorldWideScience

Sample records for aldo-keto reductase superfamily

  1. Aldo-keto reductase (AKR) superfamily: Genomics and annotation

    OpenAIRE

    Mindnich Rebekka D; Penning Trevor M

    2009-01-01

    Abstract Aldo-keto reductases (AKRs) are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate) (NAD(P)H)-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglan-dins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions). Although functionally diverse, AK...

  2. Aldo-keto reductase (AKR) superfamily: genomics and annotation.

    Science.gov (United States)

    Mindnich, Rebekka D; Penning, Trevor M

    2009-07-01

    Aldo-keto reductases (AKRs) are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate) (NAD(P)H)-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglandins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions). Although functionally diverse, AKRs form a protein superfamily based on their high sequence identity and common protein fold, the (alpha/beta) 8 -barrel structure. Well over 150 AKR enzymes, from diverse organisms, have been annotated so far and given systematic names according to a nomenclature that is based on multiple protein sequence alignment and degree of identity. Annotation of non-vertebrate AKRs at the National Center for Biotechnology Information or Vertebrate Genome Annotation (vega) database does not often include the systematic nomenclature name, so the most comprehensive overview of all annotated AKRs is found on the AKR website (http://www.med.upenn.edu/akr/). This site also hosts links to more detailed and specialised information (eg on crystal structures, gene expression and single nucleotide polymorphisms [SNPs]). The protein-based AKR nomenclature allows unambiguous identification of a given enzyme but does not reflect the wealth of genomic and transcriptomic variation that exists in the various databases. In this context, identification of putative new AKRs and their distinction from pseudogenes are challenging. This review provides a short summary of the characteristic features of AKR biochemistry and structure that have been reviewed in great detail elsewhere, and focuses mainly on nomenclature and database entries of human AKRs that so far have not been subject to systematic annotation. Recent developments in the annotation of SNP and transcript variance in AKRs are also summarised. PMID:19706366

  3. Aldo-keto reductase (AKR superfamily: Genomics and annotation

    Directory of Open Access Journals (Sweden)

    Mindnich Rebekka D

    2009-07-01

    Full Text Available Abstract Aldo-keto reductases (AKRs are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate (NAD(PH-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglan-dins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions. Although functionally diverse, AKRs form a protein superfamily based on their high sequence identity and common protein fold, the (α/(β8-barrel structure. Well over 150 AKR enzymes, from diverse organisms, have been annotated so far and given systematic names according to a nomenclature that is based on multiple protein sequence alignment and degree of identity. Annotation of non-vertebrate AKRs at the National Center for Biotechnology Information or Vertebrate Genome Annotation (vega database does not often include the systematic nomenclature name, so the most comprehensive overview of all annotated AKRs is found on the AKR website (http://www.med.upenn.edu/akr/. This site also hosts links to more detailed and specialised information (eg on crystal structures, gene expression and single nucleotide polymorphisms [SNPs]. The protein-based AKR nomenclature allows unambiguous identification of a given enzyme but does not reflect the wealth of genomic and transcriptomic variation that exists in the various databases. In this context, identification of putative new AKRs and their distinction from pseudogenes are challenging. This review provides a short summary of the characteristic features of AKR biochemistry and structure that have been reviewed in great detail elsewhere, and focuses mainly on nomenclature and database entries of human AKRs that so far have not been subject to systematic annotation. Recent developments in the annotation of SNP and transcript variance in AKRs are also summarised.

  4. Expression, purification, crystallization and preliminary X-ray analysis of perakine reductase, a new member of the aldo-keto reductase enzyme superfamily from higher plants

    International Nuclear Information System (INIS)

    Perakine reductase, a novel member of the aldo-keto reductase enzyme superfamily of higher plants, is involved in the biosynthesis of monoterpenoid indole alkaloids in the Indian medicinal plant Rauvolfia serpentina. The enzyme has been crystallized in C-centered orthorhombic space group and diffracts to 2.0 Å resolution. Perakine reductase (PR) is a novel member of the aldo-keto reductase enzyme superfamily from higher plants. PR from the plant Rauvolfia serpentina is involved in the biosynthesis of monoterpenoid indole alkaloids by performing NADPH-dependent reduction of perakine, yielding raucaffrinoline. However, PR can also reduce cinnamic aldehyde and some of its derivatives. After heterologous expression of a triple mutant of PR in Escherichia coli, crystals of the purified and methylated enzyme were obtained by the hanging-drop vapour-diffusion technique at 293 K with 100 mM sodium citrate pH 5.6 and 27% PEG 4000 as precipitant. Crystals belong to space group C2221 and diffract to 2.0 Å, with unit-cell parameters a = 58.9, b = 93.0, c = 143.4 Å

  5. cDNA cloning, expression and activity of a second human aflatoxin B1-metabolizing member of the aldo-keto reductase superfamily, AKR7A3.

    Science.gov (United States)

    Knight, L P; Primiano, T; Groopman, J D; Kensler, T W; Sutter, T R

    1999-07-01

    The aflatoxin B1 (AFB1) aldehyde metabolite of AFB1 may contribute to the cytotoxicity of this hepatocarcinogen via protein adduction. Aflatoxin B1 aldehyde reductases, specifically the NADPH-dependent aldo-keto reductases of rat (AKR7A1) and human (AKR7A2), are known to metabolize the AFB1 dihydrodiol by forming AFB1 dialcohol. Using a rat AKR7A1 cDNA, we isolated and characterized a distinct aldo-keto reductase (AKR7A3) from an adult human liver cDNA library. The deduced amino acid sequence of AKR7A3 shares 80 and 88% identity with rat AKR7A1 and human AKR7A2, respectively. Recombinant rat AKR7A1 and human AKR7A3 were expressed and purified from Escherichia coli as hexa-histidine tagged fusion proteins. These proteins catalyzed the reduction of several model carbonyl-containing substrates. The NADPH-dependent formation of AFB1 dialcohol by recombinant human AKR7A3 was confirmed by liquid chromatography coupled to electrospray ionization mass spectrometry. Rabbit polyclonal antibodies produced using recombinant rat AKR7A1 protein were shown to detect nanogram amounts of rat and human AKR7A protein. The amount of AKR7A-related protein in hepatic cytosols of 1, 2-dithiole-3-thione-treated rats was 18-fold greater than in cytosols from untreated animals. These antibodies detected AKR7A-related protein in normal human liver samples ranging from 0.3 to 0.8 microg/mg cytosolic protein. Northern blot analysis showed varying levels of expression of AKR7A RNA in human liver and in several extrahepatic tissues, with relatively high levels in the stomach, pancreas, kidney and liver. Based on the kinetic parameters determined using recombinant human AKR7A3 and AFB1 dihydrodiol at pH 7.4, the catalytic efficiency of this reaction (k2/K, per M/s) equals or exceeds those reported for other enzymes, for example cytochrome P450s and glutathione S-transferases, known to metabolize AFB1 in vivo. These findings indicate that, depending on the extent of AFB1 dihydrodiol formation, AKR

  6. Aldo keto reductases 1B in endocrinology and metabolism

    Directory of Open Access Journals (Sweden)

    AntoineMartinez

    2012-08-01

    Full Text Available The aldose reductase (human AKR1B1/mouse Akr1b3 has been the focus of many research because of its role in diabetic complications. The starting point of these alterations is the massive entry of glucose in polyol pathway where it is converted into sorbitol by this enzyme. However, the issue of aldose reductase function in non-diabetic condition remains unresolved. Aldose reductase-like enzymes (AKR1B10, Akr1b7 and Akr1b8 are highly related isoforms often co-expressed with bona fide aldose reductase, making functional analysis of one or the other isoform a challenging task. AKR1B/Akr1b members share at least 65% protein identity and the general ability to reduce many redundant substrates such as aldehydes provided from lipid peroxidation, steroids and their by-products and xenobiotics in vitro. Based on these properties, AKR1B/Akr1b are generally considered as detoxifying enzymes. Considering that divergences should be more informative than similarities to help understanding their physiological functions, we chose to review specific hallmarks of each human/mouse isoforms by focusing on tissue distribution and specific mechanisms of gene regulation. Indeed, although the aldose reductase shows ubiquitous expression, aldose reductase-like proteins exhibit tissue-specific patterns of expression. We focused on 3 organs where certain isoforms are enriched, the adrenal gland, enterohepatic and adipose tissues and tried to connect recent enzymatic and regulation data with endocrine and metabolic functions of these organs. We presented recent mouse models showing unsuspected physiological functions in the regulation of glucido-lipidic metabolism and adipose tissue homeostasis. Beyond the widely accepted idea that AKR1B/Akr1b are detoxification enzymes, these recent reports provide growing evidences that they are able to modify or generate signal molecules. This conceptually shifts this class of enzymes from unenviable status of scavenger to upper class of

  7. The Aldo-Keto Reductase Akr1b7 Gene Is a Common Transcriptional Target of Xenobiotic Receptors Pregnane X Receptor and Constitutive Androstane Receptor

    OpenAIRE

    Liu, Ming-Jie; Takahashi, Yuki; Wada, Taira; He, Jinhan; Gao, Jie; Tian, Yanan; Li, Song; Xie, Wen

    2009-01-01

    Aldo-keto reductase (AKR) family 1, member 7 (AKR1B7), a member of the AKR superfamily, has been suggested to play an important role in the detoxification of lipid peroxidation by-products. The nuclear receptors pregnane X receptor (PXR) and constitutive androstane receptor (CAR) are xenosensors postulated to alleviate xeno- and endobiotic chemical insults. In this study, we show that the mouse Akr1b7 is a shared transcriptional target of PXR and CAR in the liver and i...

  8. Berberine inhibits androgen synthesis by interaction with aldo-keto reductase 1C3 in 22Rv1 prostate cancer cells.

    Science.gov (United States)

    Tian, Yuantong; Zhao, Lijing; Wang, Ye; Zhang, Haitao; Xu, Duo; Zhao, Xuejian; Li, Yi; Li, Jing

    2016-01-01

    Aldo-keto reductase family 1 member C3 has recently been regarded as a potential therapeutic target in castrate-resistant prostate cancer. Herein, we investigated whether berberine delayed the progression of castrate-resistant prostate cancer by reducing androgen synthesis through the inhibition of Aldo-keto reductase family 1 member C3. Cell viability and cellular testosterone content were measured in prostate cancer cells. Aldo-keto reductase family 1 member C3 mRNA and protein level were detected by RT-PCR and Western bolt analyses, respectively. Computer analysis with AutoDock Tools explored the molecular interaction of berberine with Aldo-keto reductase family 1 member C3. We found that berberine inhibited 22Rv1 cells proliferation and decreased cellular testosterone formation in a dose-dependent manner. Berberine inhibited Aldo-keto reductase family 1 member C3 enzyme activity, rather than influenced mRNA and protein expressions. Molecular docking study demonstrated that berberine could enter the active center of Aldo-keto reductase family 1 member C3 and form p-p interaction with the amino-acid residue Phe306 and Phe311. In conclusion, the structural interaction of berberine with Aldo-keto reductase family 1 member C3 is attributed to the suppression of Aldo-keto reductase family 1 member C3 enzyme activity and the inhibition of 22Rv1 prostate cancer cell growth by decreasing the intracellular androgen synthesis. Our result provides the experimental basis for the design, research, and development of AKR1C3 inhibitors using berberine as the lead compound. PMID:26698234

  9. Characterization of the aldo-keto reductase 1C gene cluster on pig chromosome 10: possible associations with reproductive traits

    OpenAIRE

    Nonneman Dan J; Wise Tommy H; Ford J Joe; Kuehn Larry A; Rohrer Gary A

    2006-01-01

    Abstract Background The rate of pubertal development and weaning to estrus interval are correlated and affect reproductive efficiency of swine. Quantitative trait loci (QTL) for age of puberty, nipple number and ovulation rate have been identified in Meishan crosses on pig chromosome 10q (SSC10) near the telomere, which is homologous to human chromosome 10p15 and contains an aldo-keto reductase (AKR) gene cluster with at least six family members. AKRs are tissue-specific hydroxysteroid dehydr...

  10. BIOLOGICAL ROLE OF ALDO-KETO REDUCTASES IN RETINOIC ACID BIOSYNTHESIS AND SIGNALING

    Directory of Open Access Journals (Sweden)

    F. Xavier eRuiz

    2012-04-01

    Full Text Available Several aldo-keto reductase (AKR enzymes from subfamilies 1B and 1C show retinaldehyde reductase activity, having low Km and kcat values. Only AKR1B10 and 1B12, with all-trans-retinaldehyde, and AKR1C3, with 9-cis-retinaldehyde, display high catalytic efficiency. Major structural determinants for retinaldehyde isomer specificity are located in the external loops (A and C for AKR1B10, and B for AKR1C3, as assessed by site-directed mutagenesis and molecular dynamics. Cellular models have shown that AKR1B and 1C enzymes are well suited to work in vivo as retinaldehyde reductases and to regulate retinoic acid (RA biosynthesis at hormone pre-receptor level. An additional physiological role for the retinaldehyde reductase activity of these enzymes, consistent with their tissue localization, is their participation in β-carotene absorption. Retinaldehyde metabolism may be subjected to subcellular compartmentalization, based on enzyme localization. While retinaldehyde oxidation to RA takes place in the cytosol, reduction to retinol could take place in the cytosol by AKRs or in the membranes of endoplasmic reticulum by microsomal retinaldehyde reductases. Upregulation of some AKR1 enzymes in different cancer types may be linked to their induction by oxidative stress and to their participation in different signaling pathways related to cell proliferation. AKR1B10 and AKR1C3, through their retinaldehyde reductase activity, trigger a decrease in the RA biosynthesis flow, resulting in RA deprivation and consequently lower differentiation, with an increased cancer risk in target tissues. Rational design of selective AKR inhibitors could lead to development of novel drugs for cancer treatment as well as reduction of chemotherapeutic drug resistance.

  11. Putative Role of the Aldo-Keto Reductase from Trypanosoma cruzi in Benznidazole Metabolism.

    Science.gov (United States)

    Garavaglia, Patricia Andrea; Laverrière, Marc; Cannata, Joaquín J B; García, Gabriela Andrea

    2016-05-01

    Benznidazole (Bz), the drug used for treatment of Chagas' disease (caused by the protozoan Trypanosoma cruzi), is activated by a parasitic NADH-dependent type I nitroreductase (NTR I). However, several studies have shown that other enzymes are involved. The aim of this study was to evaluate whether the aldo-keto reductase from T. cruzi (TcAKR), a NADPH-dependent oxido-reductase previously described by our group, uses Bz as the substrate. We demonstrated that both recombinant and native TcAKR enzymes reduce Bz by using NADPH, but not NADH, as a cofactor. TcAKR-overexpressing epimastigotes showed higher NADPH-dependent Bz reductase activity and a 50% inhibitory concentration (IC50) value for Bz 1.8-fold higher than that of the controls, suggesting that TcAKR is involved in Bz detoxification instead of activation. To understand the role of TcAKR in Bz metabolism, we studied TcAKR expression and NADPH/NADH-dependent Bz reductase activities in two T. cruzi strains with differential susceptibility to Bz: CL Brener and Nicaragua. Taking into account the results obtained with TcAKR-overexpressing epimastigotes, we expected the more resistant strain, Nicaragua, to have higher TcAKR levels than CL Brener. However, the results were the opposite. CL Brener showed 2-fold higher TcAKR expression and 5.7-fold higher NADPH-Bz reduction than the Nicaragua strain. In addition, NADH-dependent Bz reductase activity, characteristic of NTR I, was also higher in CL Brener than in Nicaragua. We conclude that although TcAKR uses Bz as the substrate, TcAKR activity is not a determinant of Bz resistance in wild-type strains and may be overcome by other enzymes involved in Bz activation, such as NADPH- and NADH-dependent reductases. PMID:26856844

  12. Pyrithione-based ruthenium complexes as inhibitors of aldo-keto reductase 1C enzymes and anticancer agents.

    Science.gov (United States)

    Kljun, Jakob; Anko, Maja; Traven, Katja; Sinreih, Maša; Pavlič, Renata; Peršič, Špela; Ude, Žiga; Codina, Elisa Esteve; Stojan, Jure; Lanišnik Rižner, Tea; Turel, Iztok

    2016-08-01

    Four ruthenium complexes of clinically used zinc ionophore pyrithione and its oxygen analog 2-hydroxypyridine N-oxide were prepared and evaluated as inhibitors of enzymes of the aldo-keto reductase subfamily 1C (AKR1C). A kinetic study assisted with docking simulations showed a mixed type of inhibition consisting of a fast reversible and a slow irreversible step in the case of both organometallic compounds 1A and 1B. Both compounds also showed a remarkable selectivity towards AKR1C1 and AKR1C3 which are targets for breast cancer drug design. The organoruthenium complex of ligand pyrithione as well as pyrithione itself also displayed toxicity on the hormone-dependent MCF-7 breast cancer cell line with EC50 values in the low micromolar range. PMID:27357845

  13. Aldo-keto reductase 1B10 and its role in proliferation capacity of drug-resistant cancers

    Directory of Open Access Journals (Sweden)

    Toshiyuki eMatsunaga

    2012-01-01

    Full Text Available The human aldo-keto reductase AKR1B10, originally identified as an aldose reductase-like protein and human small intestine aldose reductase, is a cytosolic NADPH-dependent reductase that metabolizes a variety of endogenous compounds, such as aromatic and aliphatic aldehydes and dicarbonyl compounds, and some drug ketones. The enzyme is highly expressed in solid tumors of several tissues including lung and liver, and as such has received considerable interest as a relevant biomarker for the development of those tumors. In addition, AKR1B10 has been recently reported to be significantly up-regulated in some cancer cell lines (medulloblastoma D341 and colon cancer HT29 acquiring resistance towards chemotherapeutic agents (cyclophosphamide and mitomycin c, suggesting the validity of the enzyme as a chemoresistance marker. Although the detailed information on the AKR1B10-mediated mechanisms leading to the drug resistance process is not well understood so far, the enzyme has been proposed to be involved in functional regulations of cell proliferation and metabolism of drugs and endogenous lipids during the development of chemoresistance. This article reviews the current literature focusing mainly on expression profile and roles of AKR1B10 in the drug resistance of cancer cells. Recent developments of AKR1B10 inhibitors and their usefulness in restoring sensitivity to anticancer drugs are also reviewed.

  14. Gene expression and promoter analysis of a novel tomato aldo-keto reductase in response to environmental stresses.

    Science.gov (United States)

    Suekawa, Marina; Fujikawa, Yukichi; Inada, Shuhei; Murano, Asako; Esaka, Muneharu

    2016-08-01

    The functional role of an uncharacterized tomato (Solanum lycopersicum) aldo-keto reductase 4B, denoted as SlAKR4B, was investigated. The gene expression of tomato SlAKR4B was detected at a high level in the senescent leaves and the ripening fruits of tomato. Although d-galacturonic acid reductase activities tended to be higher in tomato SlAKR4B-overexpressing transgenic tobacco BY-2 cell lines than those in control cell lines, SlAKR4B gene expression was not well correlated with l-ascorbic acid content among the cell lines. The analysis of the transgenic cell lines showed that tomato SlAKR4B has enzyme activities toward d-galacturonic acid as well as glyceraldehyde and glyoxal, suggesting that the SlAKR4B gene encodes a functional enzyme in tomato. Gene expression of SlAKR4B was induced by NaCl, H2O2, and plant hormones such as salicylic acid and jasmonic acid, suggesting that SlAKR4B is involved in the stress response. The transient expression assay using protoplasts showed the promoter activity of the SlAKR4B gene was as high as that of the cauliflower mosaic virus 35S promoter. Also, the promoter region of the SlAKR4B gene was suggested to contain cis-element(s) for abiotic stress-inducible expression. PMID:27337067

  15. Overexpression of Aldo-Keto-Reductase in Azole-resistant Clinical Isolates of Candida Glabrata Determined by cDNA-AFLP

    Directory of Open Access Journals (Sweden)

    Mansour Heidari

    2013-01-01

    Full Text Available Background: Candida glabrata causes significant medical problems in immunocompromised patients. Many strains of this yeast are intrinsically resistant to azole antifungal agents, and treatment is problematic, leading to high morbidity and mortality rates in immunosuppressed individuals. The primary goal of this study was to investigate the genes involved in the drug resistance of clinical isolates of C. glabrata.Methods: The clinical isolates of C. glabrata were collected in an epidemiological survey of candidal infection inimmunocompromised patients and consisted of four fluconazole and itraconazole resistant isolates, two fluconazoleand itraconazole sensitive isolates, and C. glabrata CBS 138 as reference strain. Antifungal susceptibility patterns ofthe organisms were determined beforehand by the Clinical and Laboratory Standards Institute (CLSI. The potentialgene(s implicated in antifungal resistance were investigated using complementary DNA- Amplified Fragment Length Polymorphism (cDNA-AFLP. Semi-quantitative RT-PCR was carried out to evaluate the expression of gene(s in resistant isolates as compared to sensitive and reference strains.Results and conclusions: The aldo-keto-reductase superfamily (AKR gene was upregulated in the resistant clinicalisolates as assessed by cDNA-AFLP. Semi-quantitative RT-PCR revealed AKR mRNA expression approximately twice that seen in the sensitive isolates. Overexpression of the AKR gene was associated with increased fluconazole and itraconazole resistance in C. glabrata. The data suggest that upregulation of the AKR gene might give a new insight into the mechanism of azole resistance.

  16. Overexpression of aldo-keto-reductase in azole-resistant clinical isolates of Candida glabrata determined by cDNA-AFLP

    Directory of Open Access Journals (Sweden)

    Farahyar Shirin

    2013-01-01

    Full Text Available Abstract Background Candida glabrata causes significant medical problems in immunocompromised patients. Many strains of this yeast are intrinsically resistant to azole antifungal agents, and treatment is problematic, leading to high morbidity and mortality rates in immunosuppressed individuals. The primary goal of this study was to investigate the genes involved in the drug resistance of clinical isolates of C. glabrata. Methods The clinical isolates of C. glabrata were collected in an epidemiological survey of candidal infection in immunocompromised patients and consisted of four fluconazole and itraconazole resistant isolates, two fluconazole and itraconazole sensitive isolates, and C. glabrata CBS 138 as reference strain. Antifungal susceptibility patterns of the organisms were determined beforehand by the Clinical and Laboratory Standards Institute (CLSI. The potential gene(s implicated in antifungal resistance were investigated using complementary DNA- Amplified Fragment Length Polymorphism (cDNA-AFLP. Semi-quantitative RT-PCR was carried out to evaluate the expression of gene(s in resistant isolates as compared to sensitive and reference strains. Results and conclusions The aldo-keto-reductase superfamily (AKR gene was upregulated in the resistant clinical isolates as assessed by cDNA-AFLP. Semi-quantitative RT-PCR revealed AKR mRNA expression approximately twice that seen in the sensitive isolates. Overexpression of the AKR gene was associated with increased fluconazole and itraconazole resistance in C. glabrata. The data suggest that upregulation of the AKR gene might give a new insight into the mechanism of azole resistance.

  17. A pathogenesis related-10 protein CaARP functions as aldo/keto reductase to scavenge cytotoxic aldehydes.

    Science.gov (United States)

    Jain, Deepti; Khandal, Hitaishi; Khurana, Jitendra Paul; Chattopadhyay, Debasis

    2016-01-01

    Pathogenesis related-10 (PR-10) proteins are present as multigene family in most of the higher plants. The role of PR-10 proteins in plant is poorly understood. A sequence analysis revealed that a large number of PR-10 proteins possess conserved motifs found in aldo/keto reductases (AKRs) of yeast and fungi. We took three PR-10 proteins, CaARP from chickpea, ABR17 from pea and the major pollen allergen Bet v1 from silver birch as examples and showed that these purified recombinant proteins possessed AKR activity using various cytotoxic aldehydes including methylglyoxal and malondialdehyde as substrates and the reduced form of nicotinamide adenine dinucleotide phosphate (NADPH) as co-factor. Essential amino acids for this catalytic activity were identified by substitution with other amino acids. CaARP was able to discriminate between the reduced and oxidized forms of NADP independently of its catalytic activity and underwent structural change upon binding with NADPH. CaARP protein was preferentially localized in cytosol. When expressed in bacteria, yeast or plant, catalytically active variants of CaARP conferred tolerance to salinity, oxidative stress or cytotoxic aldehydes. CaARP-expressing plants showed lower lipid peroxidation product content in presence or absence of stress suggesting that the protein functions as a scavenger of cytotoxic aldehydes produced by metabolism and lipid peroxidation. Our result proposes a new biochemical property of a PR-10 protein. PMID:26577640

  18. Expression of the Aldo-Keto Reductases AKR1B1 and AKR1B10 in Human Cancers.

    Directory of Open Access Journals (Sweden)

    BrianLaffin

    2012-06-01

    Full Text Available The American Cancer Society estimates that there will be more than 1.5 million new cases of cancer in 2011, underscoring the need for identification of new therapeutic targets and development of novel cancer therapies. Previous studies have implicated the human aldo-keto reductases AKR1B1 and AKR1B10 in cancer, and therefore we examined AKR1B1 and AKR1B10 expression across all major human cancer types using the Oncomine cancer gene expression database (Compendia Biosciences, www.oncomine.com. Using this database, we found that expression of of AKR1B1 and AKR1B10 varies greatly by cancer type and tissue of origin, including agreement with previous reports that AKR1B10 is significantly over-expressed in cancers of the lungs and liver. AKR1B1 is more broadly over-expressed in human cancers than AKR1B10, albeit at a generally lower magnitude. AKR1B1 over-expression was found to be associated with shortened patient survival in acute myelogenous leukemias and multiple myelomas. High AKR1B10 expression tends to predict less aggressive clinical course generally, notably within lung cancers, where it tends to be highly over-expressed compared to normal tissue. These findings suggest that AKR1B1 inhibitors in particular hold great potential as novel cancer therapeutics.

  19. Characterization of hamster NAD+-dependent 3(17)β-hydroxysteroid dehydrogenase belonging to the aldo-keto reductase 1C subfamily.

    Science.gov (United States)

    Endo, Satoshi; Noda, Misato; Ikari, Akira; Tatematsu, Kenjiro; El-Kabbani, Ossama; Hara, Akira; Kitade, Yukio; Matsunaga, Toshiyuki

    2015-11-01

    The cDNAs for morphine 6-dehydrogenase (AKR1C34) and its homologous aldo-keto reductase (AKR1C35) were cloned from golden hamster liver, and their enzymatic properties and tissue distribution were compared. AKR1C34 and AKR1C35 similarly oxidized various xenobiotic alicyclic alcohols using NAD(+), but differed in their substrate specificity for hydroxysteroids and inhibitor sensitivity. While AKR1C34 showed 3α/17β/20α-hydroxysteroid dehydrogenase activities, AKR1C35 efficiently oxidized various 3β- and 17β-hydroxysteroids, including biologically active 3β-hydroxy-5α/β-dihydro-C19/C21-steroids, dehydroepiandrosterone and 17β-estradiol. AKR1C35 also differed from AKR1C34 in its high sensitivity to flavonoids, which inhibited competitively with respect to 17β-estradiol (Ki 0.11-0.69 μM). The mRNA for AKR1C35 was expressed liver-specific in male hamsters and ubiquitously in female hamsters, whereas the expression of the mRNA for AKR1C34 displayed opposite sexual dimorphism. Because AKR1C35 is the first 317Β-HYDROXYSTEROID DEHYDROGENASE IN THE AKR SUPERFAMILY: , we also investigated the molecular determinants for the 3β-hydroxysteroid dehydrogenase activity by replacement of Val54 and Cys310 in AKR1C35 with the corresponding residues in AKR1C34, Ala and Phe, respectively. The mutation of Val54Ala, but not Cys310Phe, significantly impaired this activity, suggesting that Val54 plays a critical role in recognition of the steroidal substrate. PMID:26002966

  20. Anthracycline resistance mediated by reductive metabolism in cancer cells: The role of aldo-keto reductase 1C3

    Energy Technology Data Exchange (ETDEWEB)

    Hofman, Jakub; Malcekova, Beata; Skarka, Adam; Novotna, Eva; Wsol, Vladimir, E-mail: wsol@faf.cuni.cz

    2014-08-01

    Pharmacokinetic drug resistance is a serious obstacle that emerges during cancer chemotherapy. In this study, we investigated the possible role of aldo-keto reductase 1C3 (AKR1C3) in the resistance of cancer cells to anthracyclines. First, the reducing activity of AKR1C3 toward anthracyclines was tested using incubations with a purified recombinant enzyme. Furthermore, the intracellular reduction of daunorubicin and idarubicin was examined by employing the transfection of A549, HeLa, MCF7 and HCT 116 cancer cells with an AKR1C3 encoding vector. To investigate the participation of AKR1C3 in anthracycline resistance, we conducted MTT cytotoxicity assays with these cells, and observed that AKR1C3 significantly contributes to the resistance of cancer cells to daunorubicin and idarubicin, whereas this resistance was reversible by the simultaneous administration of 2′-hydroxyflavanone, a specific AKR1C3 inhibitor. In the final part of our work, we tracked the changes in AKR1C3 expression after anthracycline exposure. Interestingly, a reciprocal correlation between the extent of induction and endogenous levels of AKR1C3 was recorded in particular cell lines. Therefore, we suggest that the induction of AKR1C3 following exposure to daunorubicin and idarubicin, which seems to be dependent on endogenous AKR1C3 expression, eventually might potentiate an intrinsic resistance given by the normal expression of AKR1C3. In conclusion, our data suggest a substantial impact of AKR1C3 on the metabolism of daunorubicin and idarubicin, which affects their pharmacokinetic and pharmacodynamic behavior. In addition, we demonstrate that the reduction of daunorubicin and idarubicin, which is catalyzed by AKR1C3, contributes to the resistance of cancer cells to anthracycline treatment. - Highlights: • Metabolism of anthracyclines by AKR1C3 was studied at enzyme and cellular levels. • Anthracycline resistance mediated by AKR1C3 was demonstrated in cancer cells. • Induction of AKR1C3

  1. Role of aldo-keto reductases and other doxorubicin pharmacokinetic genes in doxorubicin resistance, DNA binding, and subcellular localization

    International Nuclear Information System (INIS)

    Since proteins involved in chemotherapy drug pharmacokinetics and pharmacodynamics have a strong impact on the uptake, metabolism, and efflux of such drugs, they likely play critical roles in resistance to chemotherapy drugs in cancer patients. To investigate this hypothesis, we conducted a whole genome microarray study to identify difference in the expression of genes between isogenic doxorubicin-sensitive and doxorubicin-resistant MCF-7 breast tumour cells. We then assessed the degree of over-representation of doxorubicin pharmacokinetic and pharmacodynamic genes in the dataset of doxorubicin resistance genes. Of 27,958 Entrez genes on the array, 7.4 per cent or 2,063 genes were differentially expressed by ≥ 2-fold between wildtype and doxorubicin-resistant cells. The false discovery rate was set at 0.01 and the minimum p value for significance for any gene within the “hit list” was 0.01. Seventeen and 43 per cent of doxorubicin pharmacokinetic genes were over-represented in the hit list, depending upon whether the gene name was identical or within the same gene family, respectively. The most over-represented genes were within the 1C and 1B families of aldo-keto reductases (AKRs), which convert doxorubicin to doxorubicinol. Other genes convert doxorubicin to other metabolites or affect the influx, efflux, or cytotoxicity of the drug. In further support of the role of AKRs in doxorubicin resistance, we observed that, in comparison to doxorubicin, doxorubincol exhibited dramatically reduced cytotoxicity, reduced DNA-binding activity, and strong localization to extra nuclear lysosomes. Pharmacologic inhibition of the above AKRs in doxorubicin-resistant cells increased cellular doxorubicin levels, restored doxorubicin cytotoxicity and re-established doxorubicin localization to the nucleus. The properties of doxorubicinol were unaffected. These findings demonstrate the utility of using curated pharmacokinetic and pharmacodynamic knowledge bases to identify

  2. Anthracycline resistance mediated by reductive metabolism in cancer cells: The role of aldo-keto reductase 1C3

    International Nuclear Information System (INIS)

    Pharmacokinetic drug resistance is a serious obstacle that emerges during cancer chemotherapy. In this study, we investigated the possible role of aldo-keto reductase 1C3 (AKR1C3) in the resistance of cancer cells to anthracyclines. First, the reducing activity of AKR1C3 toward anthracyclines was tested using incubations with a purified recombinant enzyme. Furthermore, the intracellular reduction of daunorubicin and idarubicin was examined by employing the transfection of A549, HeLa, MCF7 and HCT 116 cancer cells with an AKR1C3 encoding vector. To investigate the participation of AKR1C3 in anthracycline resistance, we conducted MTT cytotoxicity assays with these cells, and observed that AKR1C3 significantly contributes to the resistance of cancer cells to daunorubicin and idarubicin, whereas this resistance was reversible by the simultaneous administration of 2′-hydroxyflavanone, a specific AKR1C3 inhibitor. In the final part of our work, we tracked the changes in AKR1C3 expression after anthracycline exposure. Interestingly, a reciprocal correlation between the extent of induction and endogenous levels of AKR1C3 was recorded in particular cell lines. Therefore, we suggest that the induction of AKR1C3 following exposure to daunorubicin and idarubicin, which seems to be dependent on endogenous AKR1C3 expression, eventually might potentiate an intrinsic resistance given by the normal expression of AKR1C3. In conclusion, our data suggest a substantial impact of AKR1C3 on the metabolism of daunorubicin and idarubicin, which affects their pharmacokinetic and pharmacodynamic behavior. In addition, we demonstrate that the reduction of daunorubicin and idarubicin, which is catalyzed by AKR1C3, contributes to the resistance of cancer cells to anthracycline treatment. - Highlights: • Metabolism of anthracyclines by AKR1C3 was studied at enzyme and cellular levels. • Anthracycline resistance mediated by AKR1C3 was demonstrated in cancer cells. • Induction of AKR1C3

  3. Expression of aldo-keto reductase family 1 member C1 (AKR1C1 gene in porcine ovary and uterine endometrium during the estrous cycle and pregnancy

    Directory of Open Access Journals (Sweden)

    Hwang Sue-Yun

    2011-10-01

    Full Text Available Abstract Background The aldo-keto reductase family 1 member C1 (AKR1C1 belongs to a superfamily of NADPH-dependent reductases that convert a wide range of substrates, including carbohydrates, steroid hormones, and endogenous prostaglandins. The 20alpha-hydroxysteroid dehydrogenase (20alpha-HSD is a member of AKR family. The aims of this study were to determine its expression in the ovary and uterus endometrium during the estrous cycle and pregnancy. Methods Rapid amplification of cDNA ends (RACE experiments were performed to obtain the 5' and 3' ends of the porcine 20alpha-HSD cDNA. Reverse-transcriptase-PCR (RT-PCR, real-time PCR, northern blot analysis, and western blot analysis were performed to examine the expression of porcine 20alpha-HSD. Immunohistochemical analysis was also performed to determine the localization in the ovary. Results The porcine 20alpha-HSD cDNA is 957 bp in length and encodes a protein of 319 amino acids. The cloned cDNA was virtually the same as the porcine AKR1C1 gene (337 amino acids reported recently, and only differed in the C-terminal region (the AKR1C1 gene has a longer C-terminal region than our sequence. The 20alpha-HSD gene (from now on referred to as AKR1C1 cloned in this paper encodes a deletion of 4 amino acids, compared with the C-terminal region of AKR1C1 genes from other animals. Porcine AKR1C1 mRNA was expressed on day 5, 10, 12, 15 of the cycle and 0-60 of pregnancy in the ovary. The mRNA was also specifically detected in the uterine endometrium on day 30 of pregnancy. Western blot analysis indicated that the pattern of AKR1C1 protein in the ovary during the estrous cycle and uterus during early pregnancy was similar to that of AKR1C1 mRNA expression. The recombinant protein produced in CHO cells was detected at approximately 37 kDa. Immunohistochemical analysis also revealed that pig AKR1C1 protein was localized in the large luteal cells in the early stages of the estrous cycle and before parturition

  4. Characterization of the aldo-keto reductase 1C gene cluster on pig chromosome 10: possible associations with reproductive traits

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-09-01

    Full Text Available Abstract Background The rate of pubertal development and weaning to estrus interval are correlated and affect reproductive efficiency of swine. Quantitative trait loci (QTL for age of puberty, nipple number and ovulation rate have been identified in Meishan crosses on pig chromosome 10q (SSC10 near the telomere, which is homologous to human chromosome 10p15 and contains an aldo-keto reductase (AKR gene cluster with at least six family members. AKRs are tissue-specific hydroxysteroid dehydrogenases that interconvert weak steroid hormones to their more potent counterparts and regulate processes involved in development, homeostasis and reproduction. Because of their location in the swine genome and their implication in reproductive physiology, this gene cluster was characterized and evaluated for effects on reproductive traits in swine. Results Screening the porcine CHORI-242 BAC library with a full-length AKR1C4 cDNA identified 7 positive clones and sample sequencing of 5 BAC clones revealed 5 distinct AKR1C genes (AKR1CL2 and AKR1C1 through 4, which mapped to 126–128 cM on SSC10. Using the IMpRH7000rad and IMNpRH212000rad radiation hybrid panels, these 5 genes mapped between microsatellite markers SWR67 and SW2067. Comparison of sequence data with the porcine BAC fingerprint map show that the cluster of genes resides in a 300 kb region. Twelve SNPs were genotyped in gilts observed for age at first estrus and ovulation rate from the F8 and F10 generations of one-quarter Meishan descendants of the USMARC resource population. Age at puberty, nipple number and ovulation rate data were analyzed for association with genotypes by MTDFREML using an animal model. One SNP, a phenylalanine to isoleucine substitution in AKR1C2, was associated with age of puberty (p = 0.07 and possibly ovulation rate (p = 0.102. Two SNP in AKR1C4 were significantly associated with nipple number (p ≤ 0.03 and another possibly associated with age at puberty (p = 0

  5. A novel aldo-keto reductase from Jatropha curcas L. (JcAKR) plays a crucial role in the detoxification of methylglyoxal, a potent electrophile.

    Science.gov (United States)

    Mudalkar, Shalini; Sreeharsha, Rachapudi Venkata; Reddy, Attipalli Ramachandra

    2016-05-20

    Abiotic stress leads to the generation of reactive oxygen species (ROS) which further results in the production of reactive carbonyls (RCs) including methylglyoxal (MG). MG, an α, β-dicarbonyl aldehyde, is highly toxic to plants and the mechanism behind its detoxification is not well understood. Aldo-keto reductases (AKRs) play a role in detoxification of reactive aldehydes and ketones. In the present study, we cloned and characterised a putative AKR from Jatropha curcas (JcAKR). Phylogenetically, it forms a small clade with AKRs of Glycine max and Rauwolfia serpentina. JcAKR was heterologously expressed in Escherichia coli BL-21(DE3) cells and the identity of the purified protein was confirmed through MALDI-TOF analysis. The recombinant protein had high enzyme activity and catalytic efficiency in assays containing MG as the substrate. Protein modelling and docking studies revealed MG was efficiently bound to JcAKR. Under progressive drought and salinity stress, the enzyme and transcript levels of JcAKR were higher in leaves compared to roots. Further, the bacterial and yeast cells expressing JcAKR showed more tolerance towards PEG (5%), NaCl (200mM) and MG (5mM) treatments compared to controls. In conclusion, our results project JcAKR as a possible and potential target in crop improvement for abiotic stress tolerance. PMID:26995646

  6. The Aldo-Keto Reductase AKR1B10 Is Up-Regulated in Keloid Epidermis, Implicating Retinoic Acid Pathway Dysregulation in the Pathogenesis of Keloid Disease.

    Science.gov (United States)

    Jumper, Natalie; Hodgkinson, Tom; Arscott, Guyan; Har-Shai, Yaron; Paus, Ralf; Bayat, Ardeshir

    2016-07-01

    Keloid disease is a recurrent fibroproliferative cutaneous tumor of unknown pathogenesis for which clinical management remains unsatisfactory. To obtain new insights into hitherto underappreciated aspects of keloid pathobiology, we took a laser capture microdissection-based, whole-genome microarray analysis approach to identify distinct keloid disease-associated gene expression patterns within defined keloid regions. Identification of the aldo-keto reductase enzyme AKR1B10 as highly up-regulated in keloid epidermis suggested that an imbalance of retinoic acid metabolism is likely associated with keloid disease. Here, we show that AKR1B10 transfection into normal human keratinocytes reproduced the abnormal retinoic acid pathway expression pattern we had identified in keloid epidermis. Cotransfection of AKR1B10 with a luciferase reporter plasmid showed reduced retinoic acid response element activity, supporting the hypothesis of retinoic acid synthesis deficiency in keloid epidermis. Paracrine signals released by AKR1B10-overexpressing keratinocytes into conditioned medium resulted in up-regulation of transforming growth factor-β1, transforming growth factor-β2, and collagens I and III in both keloid and normal skin fibroblasts, mimicking the typical profibrotic keloid profile. Our study results suggest that insufficient retinoic acid synthesis by keloid epidermal keratinocytes may contribute to the pathogenesis of keloid disease. We refocus attention on the role of injured epithelium in keloid disease and identify AKR1B10 as a potential new target in future management of keloid disease. PMID:27025872

  7. Aldo-keto reductase family 1 B10 protein detoxifies dietary and lipid-derived alpha, beta-unsaturated carbonyls at physiological levels

    International Nuclear Information System (INIS)

    Alpha, beta-unsaturated carbonyls are highly reactive mutagens and carcinogens to which humans are exposed on a daily basis. This study demonstrates that aldo-keto reductase family 1 member B10 (AKR1B10) is a critical protein in detoxifying dietary and lipid-derived unsaturated carbonyls. Purified AKR1B10 recombinant protein efficiently catalyzed the reduction to less toxic alcohol forms of crotonaldehyde at 0.90 μM, 4-hydroxynonenal (HNE) at 0.10 μM, trans-2-hexanal at 0.10 μM, and trans-2,4-hexadienal at 0.05 μM, the concentrations at or lower than physiological exposures. Ectopically expressed AKR1B10 in 293T cells eliminated immediately HNE at 1 (subtoxic) or 5 μM (toxic) by converting to 1,4-dihydroxynonene, protecting the cells from HNE toxicity. AKR1B10 protein also showed strong enzymatic activity toward glutathione-conjugated carbonyls. Taken together, our study results suggest that AKR1B10 specifically expressed in the intestine is physiologically important in protecting the host cell against dietary and lipid-derived cytotoxic carbonyls.

  8. Exposure to 9,10-phenanthrenequinone accelerates malignant progression of lung cancer cells through up-regulation of aldo-keto reductase 1B10

    International Nuclear Information System (INIS)

    Inhalation of 9,10-phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust, exerts fatal damage against a variety of cells involved in respiratory function. Here, we show that treatment with high concentrations of 9,10-PQ evokes apoptosis of lung cancer A549 cells through production of reactive oxygen species (ROS). In contrast, 9,10-PQ at its concentrations of 2 and 5 μM elevated the potentials for proliferation, invasion, metastasis and tumorigenesis, all of which were almost completely inhibited by addition of an antioxidant N-acetyl-L-cysteine, inferring a crucial role of ROS in the overgrowth and malignant progression of lung cancer cells. Comparison of mRNA expression levels of six aldo-keto reductases (AKRs) in the 9,10-PQ-treated cells advocated up-regulation of AKR1B10 as a major cause contributing to the lung cancer malignancy. In support of this, the elevation of invasive, metastatic and tumorigenic activities in the 9,10-PQ-treated cells was significantly abolished by the addition of a selective AKR1B10 inhibitor oleanolic acid. Intriguingly, zymographic and real-time PCR analyses revealed remarkable increases in secretion and expression, respectively, of matrix metalloproteinase 2 during the 9,10-PQ treatment, and suggested that the AKR1B10 up-regulation and resultant activation of mitogen-activated protein kinase cascade are predominant mechanisms underlying the metalloproteinase induction. In addition, HPLC analysis and cytochrome c reduction assay in in vitro 9,10-PQ reduction by AKR1B10 demonstrated that the enzyme catalyzes redox-cycling of this quinone, by which ROS are produced. Collectively, these results suggest that AKR1B10 is a key regulator involved in overgrowth and malignant progression of the lung cancer cells through ROS production due to 9,10-PQ redox-cycling. - Highlights: • 9,10-PQ promotes invasion, metastasis and tumorigenicity in lung cancer cells. • The 9,10-PQ-elicited promotion is possibly due to AKR1B10 up

  9. Exposure to 9,10-phenanthrenequinone accelerates malignant progression of lung cancer cells through up-regulation of aldo-keto reductase 1B10

    Energy Technology Data Exchange (ETDEWEB)

    Matsunaga, Toshiyuki, E-mail: matsunagat@gifu-pu.ac.jp [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Morikawa, Yoshifumi; Haga, Mariko; Endo, Satoshi [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Soda, Midori; Yamamura, Keiko [Laboratory of Clinical Pharmacy, School of Pharmacy, Aichi Gakuin University, Nagoya 464-8650 (Japan); El-Kabbani, Ossama [Monash Institute of Pharmaceutical Sciences, Monash University, Victoria 3052 (Australia); Tajima, Kazuo [Faculty of Pharmaceutical Sciences, Hokuriku University, Kanazawa 920-1181 (Japan); Ikari, Akira [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Hara, Akira [Faculty of Engineering, Gifu University, Gifu 501-1193 (Japan)

    2014-07-15

    Inhalation of 9,10-phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust, exerts fatal damage against a variety of cells involved in respiratory function. Here, we show that treatment with high concentrations of 9,10-PQ evokes apoptosis of lung cancer A549 cells through production of reactive oxygen species (ROS). In contrast, 9,10-PQ at its concentrations of 2 and 5 μM elevated the potentials for proliferation, invasion, metastasis and tumorigenesis, all of which were almost completely inhibited by addition of an antioxidant N-acetyl-L-cysteine, inferring a crucial role of ROS in the overgrowth and malignant progression of lung cancer cells. Comparison of mRNA expression levels of six aldo-keto reductases (AKRs) in the 9,10-PQ-treated cells advocated up-regulation of AKR1B10 as a major cause contributing to the lung cancer malignancy. In support of this, the elevation of invasive, metastatic and tumorigenic activities in the 9,10-PQ-treated cells was significantly abolished by the addition of a selective AKR1B10 inhibitor oleanolic acid. Intriguingly, zymographic and real-time PCR analyses revealed remarkable increases in secretion and expression, respectively, of matrix metalloproteinase 2 during the 9,10-PQ treatment, and suggested that the AKR1B10 up-regulation and resultant activation of mitogen-activated protein kinase cascade are predominant mechanisms underlying the metalloproteinase induction. In addition, HPLC analysis and cytochrome c reduction assay in in vitro 9,10-PQ reduction by AKR1B10 demonstrated that the enzyme catalyzes redox-cycling of this quinone, by which ROS are produced. Collectively, these results suggest that AKR1B10 is a key regulator involved in overgrowth and malignant progression of the lung cancer cells through ROS production due to 9,10-PQ redox-cycling. - Highlights: • 9,10-PQ promotes invasion, metastasis and tumorigenicity in lung cancer cells. • The 9,10-PQ-elicited promotion is possibly due to AKR1B10 up

  10. The Role of Human Aldo-Keto Reductases (AKRs in the Metabolic Activation and Detoxication of Polycyclic Aromatic Hydrocarbons: Interconversion of PAH-catechols and PAH o-Quinones

    Directory of Open Access Journals (Sweden)

    LiZhang

    2012-11-01

    Full Text Available Polycyclic aromatic hydrocarbons (PAH are ubiquitous environmental pollutants. They are procarcinogens requiring metabolic activation to elicit their deleterious effects. Aldo-keto reductases (AKR catalyze the oxidation of proximate carcinogenic PAH trans-dihydrodiols to yield electrophilic and redox-active PAH o-quiniones. AKRs are also found to be capable of reducing PAH o-quinones to form PAH catechols. The interconversion of o-quinones and catechols results in the redox cycling of PAH o-quinones to give rise to the generation of reactive oxygen species and subsequent oxidative DNA damage. On the other hand, PAH catechols can be intercepted through phase II metabolism by which PAH o-quinones could be detoxified and eliminated. The aim of the present review is to summarize the role of human AKRs in the metabolic activation/detoxication of PAH and the relevance of phase II conjugation reactions to human lung carcinogenesis.

  11. Aldo-keto reductase 1B10 promotes development of cisplatin resistance in gastrointestinal cancer cells through down-regulating peroxisome proliferator-activated receptor-γ-dependent mechanism.

    Science.gov (United States)

    Matsunaga, Toshiyuki; Suzuki, Ayaka; Kezuka, Chihiro; Okumura, Naoko; Iguchi, Kazuhiro; Inoue, Ikuo; Soda, Midori; Endo, Satoshi; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-08-25

    Cisplatin (cis-diamminedichloroplatinum, CDDP) is one of the most effective chemotherapeutic drugs that are used for treatment of patients with gastrointestinal cancer cells, but its continuous administration often evokes the development of chemoresistance. In this study, we investigated alterations in antioxidant molecules and functions using a newly established CDDP-resistant variant of gastric cancer MKN45 cells, and found that aldo-keto reductase 1B10 (AKR1B10) is significantly up-regulated with acquisition of the CDDP resistance. In the nonresistant MKN45 cells, the sensitivity to cytotoxic effect of CDDP was decreased and increased by overexpression and silencing of AKR1B10, respectively. In addition, the AKR1B10 overexpression markedly suppressed accumulation and cytotoxicity of 4-hydroxy-2-nonenal that is produced during lipid peroxidation by CDDP treatment, suggesting that the enzyme acts as a crucial factor for facilitation of the CDDP resistance through inhibiting induction of oxidative stress by the drug. Transient exposure to CDDP and induction of the CDDP resistance decreased expression of peroxisome proliferator-activated receptor-γ (PPARγ) in MKN45 and colon cancer LoVo cells. Additionally, overexpression of PPARγ in the cells elevated the sensitivity to the CDDP toxicity, which was further augmented by concomitant treatment with a PPARγ ligand rosiglitazone. Intriguingly, overexpression of AKR1B10 in the cells resulted in a decrease in PPARγ expression, which was recovered by addition of an AKR1B10 inhibitor oleanolic acid, inferring that PPARγ is a downstream target of AKR1B10-dependent mechanism underlying the CDDP resistance. Combined treatment with the AKR1B10 inhibitor and PPARγ ligand elevated the CDDP sensitivity, which was almost the same level as that in the parental cells. These results suggest that combined treatment with the AKR1B10 inhibitor and PPARγ ligand is an effective adjuvant therapy for overcoming CDDP resistance of

  12. Aldo-keto synthesis effect on Eu3+fluorescence in YBO3 compared with solid state diffusion

    Institute of Scientific and Technical Information of China (English)

    K.A. Koparkar; N.S. Bajaj; S.K. Omanwar

    2015-01-01

    The red-orange emitting phosphor YBO3:Eu3+was prepared by aldo-keto method and solid state diffusion. Aldo-keto method implied to decrease the processing time and heating temperature. The red-orange emitting phosphor was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), as well as emission and excitation photoluminescence spectra re-corded at room temperature. The result of aldo-keto method showed that the phosphor YBO3:Eu3+could be obtained at 900 °C in less time~60%as compared to solid state diffusion (SSD). The material showed that the strongest emission peak at 595 nm under excitation at 233 nm was only due to forced magnetic dipole 5D0→7F1 transition of Eu3+ions. Significantly, the emission inten-sity of YBO3:Eu3+phosphor prepared by aldo-keto method was relatively higher as compared to that obtained by the solid state diffusion.

  13. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    Energy Technology Data Exchange (ETDEWEB)

    Kiyota, Eduardo [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Sousa, Sylvia Morais de [Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Santos, Marcelo Leite dos; Costa Lima, Aline da [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Menossi, Marcelo [Departamento de Genética e Evolução, Instituto de Biologia, Universidade Estadual de Campinas, Campinas-SP (Brazil); Yunes, José Andrés [Laboratório de Biologia Molecular, Centro Infantil Boldrini, Campinas-SP (Brazil); Aparicio, Ricardo, E-mail: aparicio@iqm.unicamp.br [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil)

    2007-11-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.

  14. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    International Nuclear Information System (INIS)

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P212121, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR

  15. Substrate Specificity, Inhibitor Selectivity and Structure-Function Relationships of Aldo-Keto Reductase 1B15: A Novel Human Retinaldehyde Reductase

    Czech Academy of Sciences Publication Activity Database

    Giménez-Dejoz, J.; Kolář, Michal H.; Ruiz, F. X.; Crespo, I.; Cousido-Siah, A.; Podjarny, A.; Barski, O. A.; Fanfrlík, Jindřich; Parés, X.; Farrés, J.; Porté, S.

    2015-01-01

    Roč. 10, č. 7 (2015), e0134506/1-e0134506/19. E-ISSN 1932-6203 Institutional support: RVO:61388963 Keywords : retinoic acid biosynthesis * site-directed mutagenesis * tumor marker AKR1B15 Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.234, year: 2014 http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0134506

  16. ClEST cluster :Cl_singleton0763 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0763 aldo-keto reductase Cimex lectularius nuclear gene 591 CACCGGGTAGG...GTGAATAAAGGCTTAGTTAGGTCAATCGGACTATCCAATTTCAACAAAAGACAGATCGAAGATGTTT fs09012 1 aldo-keto reductase [Gl

  17. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

    International Nuclear Information System (INIS)

    Conjugated polyketone reductase C2 from C. parapsilosis IFO 0708 was expressed, purified and crystallized by the sitting-drop vapour-diffusion method. The crystal belonged to space group P212121 and diffracted X-rays to 1.7 Å resolution. Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (VM = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit

  18. Classification and nomenclature of the superfamily of short-chain dehydrogenases/reductases (SDRs).

    Science.gov (United States)

    Persson, Bengt; Kallberg, Yvonne

    2013-02-25

    The short-chain dehydrogenases/reductases (SDRs) constitute one of the largest protein superfamilies known today. The members are distantly related with typically 20-30% residue identity in pair-wise comparisons. Still, all hitherto structurally known SDRs present a common three-dimensional structure consisting of a Rossmann fold with a parallel beta sheet flanked by three helices on each side. Using hidden Markov models (HMMs), we have developed a semi-automated subclassification system for this huge family. Currently, 75% of all SDR forms have been assigned to one of the 464 families totalling 122,940 proteins. There are 47 human SDR families, corresponding to 75 genes. Most human SDR families (35 families) have only one gene, while 12 have between 2 and 8 genes. For more than half of the human SDR families, the three-dimensional fold is known. The number of SDR members increases considerably every year, but the number of SDR families now starts to converge. The classification method has paved the ground for a sustainable and expandable nomenclature system. Information on the SDR superfamily is continuously updated at http://sdr-enzymes.org/. PMID:23200746

  19. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas;

    2008-01-01

    AFAR genes play a key role in the detoxification of the carcinogen Aflatoxin B(1) (AFB(1)). In the rat, Afar1 induction can prevent AFB(1)-induced liver cancer. It has been proposed that AFAR enzymes can metabolise endogenous diketones and dialdehydes that may be cytotoxic and/or genotoxic. Furth...... many aldo-keto reductases. This polarity change may have an effect on the proposed substrate binding amino acids nearby (Met(47), Tyr(48), Asp(50)). Further population analyses and functional studies of the nine variants detected may show if these variants are disease-related....

  20. Subdivision of the MDR superfamily of medium-chain dehydrogenases/reductases through iterative hidden Markov model refinement

    Directory of Open Access Journals (Sweden)

    Persson Bengt

    2010-10-01

    Full Text Available Abstract Background The Medium-chain Dehydrogenases/Reductases (MDR form a protein superfamily whose size and complexity defeats traditional means of subclassification; it currently has over 15000 members in the databases, the pairwise sequence identity is typically around 25%, there are members from all kingdoms of life, the chain-lengths vary as does the oligomericity, and the members are partaking in a multitude of biological processes. There are profile hidden Markov models (HMMs available for detecting MDR superfamily members, but none for determining which MDR family each protein belongs to. The current torrential influx of new sequence data enables elucidation of more and more protein families, and at an increasingly fine granularity. However, gathering good quality training data usually requires manual attention by experts and has therefore been the rate limiting step for expanding the number of available models. Results We have developed an automated algorithm for HMM refinement that produces stable and reliable models for protein families. This algorithm uses relationships found in data to generate confident seed sets. Using this algorithm we have produced HMMs for 86 distinct MDR families and 34 of their subfamilies which can be used in automated annotation of new sequences. We find that MDR forms with 2 Zn2+ ions in general are dehydrogenases, while MDR forms with no Zn2+ in general are reductases. Furthermore, in Bacteria MDRs without Zn2+ are more frequent than those with Zn2+, while the opposite is true for eukaryotic MDRs, indicating that Zn2+ has been recruited into the MDR superfamily after the initial life kingdom separations. We have also developed a web site http://mdr-enzymes.org that provides textual and numeric search against various characterised MDR family properties, as well as sequence scan functions for reliable classification of novel MDR sequences. Conclusions Our method of refinement can be readily applied to

  1. Role of conserved glycine in zinc-dependent medium chain dehydrogenase/reductase superfamily

    DEFF Research Database (Denmark)

    Tiwari, Manish Kumar; Singh, Raushan Kumar; Singh, Ranjitha;

    2012-01-01

    yet have been adequately investigated. Using a density functional theory-based screening strategy, we have identified a strictly conserved glycine residue (Gly) in the zinc-dependent MDR superfamily. To elucidate the role of this conserved Gly in MDR, we carried out a comprehensive structural...

  2. Dimerization and enzymatic activity of fungal 17β-hydroxysteroid dehydrogenase from the short-chain dehydrogenase/reductase superfamily

    Directory of Open Access Journals (Sweden)

    Kristan Katja

    2005-12-01

    Full Text Available Abstract Background 17β-hydroxysteroid dehydrogenase from the fungus Cochliobolus lunatus (17β-HSDcl is a member of the short-chain dehydrogenase/reductase (SDR superfamily. SDR proteins usually function as dimers or tetramers and 17β-HSDcl is also a homodimer under native conditions. Results We have investigated here which secondary structure elements are involved in the dimerization of 17β-HSDcl and examined the importance of dimerization for the enzyme activity. Sequence similarity with trihydroxynaphthalene reductase from Magnaporthe grisea indicated that Arg129 and His111 from the αE-helices interact with the Asp121, Glu117 and Asp187 residues from the αE and αF-helices of the neighbouring subunit. The Arg129Asp and His111Leu mutations both rendered 17β-HSDcl monomeric, while the mutant 17β-HSDcl-His111Ala was dimeric. Circular dichroism spectroscopy analysis confirmed the conservation of the secondary structure in both monomers. The three mutant proteins all bound coenzyme, as shown by fluorescence quenching in the presence of NADP+, but both monomers showed no enzymatic activity. Conclusion We have shown by site-directed mutagenesis and structure/function analysis that 17β-HSDcl dimerization involves the αE and αF helices of both subunits. Neighbouring subunits are connected through hydrophobic interactions, H-bonds and salt bridges involving amino acid residues His111 and Arg129. Since the substitutions of these two amino acid residues lead to inactive monomers with conserved secondary structure, we suggest dimerization is a prerequisite for catalysis. A detailed understanding of this dimerization could lead to the development of compounds that will specifically prevent dimerization, thereby serving as a new type of inhibitor.

  3. Long-term In Vitro Treatment of Human Glioblastoma Cells with Temozolomide Increases Resistance In Vivo through Up-regulation of GLUT Transporter and Aldo-Keto Reductase Enzyme AKR1C Expression

    Directory of Open Access Journals (Sweden)

    Benjamin Le Calvé

    2010-09-01

    Full Text Available Glioblastoma (GBM is the most frequent malignant glioma. Treatment of GBM patients is multimodal with maximum surgical resection, followed by concurrent radiation and chemotherapy with the alkylating drug temozolomide (TMZ. The present study aims to identify genes implicated in the acquired resistance of two human GBM cells of astrocytic origin, T98G and U373, to TMZ. Resistance to TMZ was induced by culturing these cells in vitro for months with incremental TMZ concentrations up to 1 mM. Only partial resistance to TMZ has been achieved and was demonstrated in vivo in immunocompromised mice bearing orthotopic U373 and T98G xenografts. Our data show that long-term treatment of human astroglioma cells with TMZ induces increased expression of facilitative glucose transporter/solute carrier GLUT/SLC2A family members, mainly GLUT-3, and of the AKR1C family of proteins. The latter proteins are phase 1 drug-metabolizing enzymes involved in the maintenance of steroid homeostasis, prostaglandin metabolism, and metabolic activation of polycyclic aromatic hydrocarbons. GLUT-3 has been previously suggested to exert roles in GBM neovascularization processes, and TMZ was found to exert antiangiogenic effects in experimental gliomas. AKR1C1 was previously shown to be associated with oncogenic potential, with proproliferative effects similar to AKR1C3 in the latter case. Both AKR1C1 and AKR1C2 proteins are involved in cancer pro-proliferative cell chemoresistance. Selective targeting of GLUT-3 in GBM and/or AKR1C proteins (by means of jasmonates, for example could thus delay the acquisition of resistance to TMZ of astroglioma cells in the context of prolonged treatment with this drug.

  4. Induction and inhibition of NAD(P)H: quinone reductase in murine and human skin.

    Science.gov (United States)

    Merk, H; Jugert, F; Bonnekoh, B; Mahrle, G

    1991-01-01

    The purpose of this study was to characterize the human cutaneous NAD(P)H: quinone reductase (NQR) activity by known inhibitors of different reductases and to compare it with the murine skin and liver NQR activity. This enzyme plays a major role in the defence of cells against oxygen stress because it inhibits the 1-electron reduction of quinones to semiquinones and their subsequent oxidation to quinones termed as quinone redox cycle. It belongs to the aromatic hydrocarbon-responsive (Ah) battery. This gene battery includes Cyp1a1 (cytochrome P-450 IA1), Cyp1a2 (cytochrome P-450 IA2) and Nmo-1 [NAD(P)H: quinone reductase]. In the skin cytochrome P-450 IA1-dependent activity is about 1-5% compared to the corresponding activity in the liver, whereas NQR has the same activity in skin and liver. NQR was determined in the cytoplasm of murine skin, liver, and human keratinocytes using 2,6-dichlorophenolindophenol as the substrate. The Ah-receptor binding compounds, such as coal tar constituents, or 3-methylcholanthrene induce cytochrome P-450-dependent activities such as aryl hydrocarbon hydroxylase or 7-ethoxyresorufin-O-de-ethylase and NQR, whereas butyl hydroxytoluol, which does not bind to the Ah receptor, induces only NQR. For inhibition studies several known inhibitors of dihydrodiol dehydrogenase, aldo-keto and carbonyl reductase activities were used. There was a similar pattern of inhibition of the basal and induced activity in all tissues investigated. Pyrazole, progesterone and phenobarbital did not inhibit, whereas dicoumarol, rutin and indomethacin inhibited NQR activity in murine skin and liver as well as in human keratinocytes.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1768430

  5. High-resolution neutron protein crystallography with radically small crystal volumes: Application of perdeuteration to human aldose reductase

    International Nuclear Information System (INIS)

    Neutron diffraction data have been collected to 2.2 (angstrom) resolution from a small (0.15 mm3) crystal of perdeuterated human aldose reductase (h-AR; MW = 36 kDa) in order to help to determine the protonation state of the enzyme. h-AR belongs to the aldo-keto reductase family and is implicated in diabetic complications. Its ternary complexes (h-AR-coenzyme NADPH-selected inhibitor) provide a good model to study both the enzymatic mechanism and inhibition. Here, the successful production of fully deuterated human aldose reductase (h-AR(D)), subsequent crystallization of the ternary complex h-AR(D)-NADPH-IDD594 and neutron Laue data collection at the LADI instrument at ILL using a crystal volume of just 0.15 mm3 are reported. Neutron data were recorded to 2 (angstrom) resolution, with subsequent data analysis using data to 2.2 (angstrom). This is the first fully deuterated enzyme of this size (36 kDa) to be solved by neutron diffraction and represents a milestone in the field, as the crystal volume is at least one order of magnitude smaller than those usually required for other high-resolution neutron structures determined to date. This illustrates the significant increase in the signal-to-noise ratio of data collected from perdeuterated crystals and demonstrates that good-quality neutron data can now be collected from more typical protein crystal volumes. Indeed, the signal-to-noise ratio is then dominated by other sources of instrument background, the nature of which is under investigation. This is important for the design of future instruments, which should take maximum advantage of the reduction in the intrinsic diffraction pattern background from fully deuterated samples.

  6. EST data: 8680 [RED

    Lifescience Database Archive (English)

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  7. EST data: 8002 [RED

    Lifescience Database Archive (English)

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  8. EST data: 8329 [RED

    Lifescience Database Archive (English)

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  9. Probe data: 5652 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  10. Conversion of Human Steroid 5[beta]-Reductase (AKR1D1) into 3[beta]-Hydroxysteroid Dehydrogenase by Single Point Mutation E120H: Example of Perfect Enzyme Engineering

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Mo; Drury, Jason E.; Christianson, David W.; Penning, Trevor M. (UPENN)

    2012-10-10

    Human aldo-keto reductase 1D1 (AKR1D1) and AKR1C enzymes are essential for bile acid biosynthesis and steroid hormone metabolism. AKR1D1 catalyzes the 5{beta}-reduction of {Delta}{sup 4}-3-ketosteroids, whereas AKR1C enzymes are hydroxysteroid dehydrogenases (HSDs). These enzymes share high sequence identity and catalyze 4-pro-(R)-hydride transfer from NADPH to an electrophilic carbon but differ in that one residue in the conserved AKR catalytic tetrad, His120 (AKR1D1 numbering), is substituted by a glutamate in AKR1D1. We find that the AKR1D1 E120H mutant abolishes 5{beta}-reductase activity and introduces HSD activity. However, the E120H mutant unexpectedly favors dihydrosteroids with the 5{alpha}-configuration and, unlike most of the AKR1C enzymes, shows a dominant stereochemical preference to act as a 3{beta}-HSD as opposed to a 3{alpha}-HSD. The catalytic efficiency achieved for 3{beta}-HSD activity is higher than that observed for any AKR to date. High resolution crystal structures of the E120H mutant in complex with epiandrosterone, 5{beta}-dihydrotestosterone, and {Delta}{sup 4}-androstene-3,17-dione elucidated the structural basis for this functional change. The glutamate-histidine substitution prevents a 3-ketosteroid from penetrating the active site so that hydride transfer is directed toward the C3 carbonyl group rather than the {Delta}{sup 4}-double bond and confers 3{beta}-HSD activity on the 5{beta}-reductase. Structures indicate that stereospecificity of HSD activity is achieved because the steroid flips over to present its {alpha}-face to the A-face of NADPH. This is in contrast to the AKR1C enzymes, which can invert stereochemistry when the steroid swings across the binding pocket. These studies show how a single point mutation in AKR1D1 can introduce HSD activity with unexpected configurational and stereochemical preference.

  11. The role of aryl hydrocarbon receptor in regulation of enzymes involved in metabolic activation of polycyclic aromatic hydrocarbons in a model of rat liver progenitor cells

    Czech Academy of Sciences Publication Activity Database

    Vondráček, Jan; Krčmář, P.; Procházková, Jiřina; Trilecová, L.; Gavelová, M.; Skálová, L.; Szotáková, B.; Bunček, M.; Radilová, H.; Kozubík, Alois; Machala, M.

    2009-01-01

    Roč. 180, č. 2 (2009), s. 226-237. ISSN 0009-2797 R&D Projects: GA ČR(CZ) GA524/06/0517 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cytochromes P450 * PAHs * aldo-keto reductases Subject RIV: BO - Biophysics Impact factor: 2.457, year: 2009

  12. Direct enzyme assay evidence confirms aldehyde reductase function of Ydr541cp and Ygl039wp from Saccharomyces cerevisiae

    Science.gov (United States)

    Aldehyde reductase gene ARI1 is a recently characterized member of intermediate subfamily under SDR (short-chain dehydrogenase/reductase) superfamily that revealed mechanisms of in situ detoxification of furfural and HMF for tolerance of Saccharomyces cerevisiae. Uncharacterized open reading frames ...

  13. Identification of the bchP gene, encoding geranylgeranyl reductase in Chlorobaculum tepidum

    DEFF Research Database (Denmark)

    Gomez Maqueo Chew, Aline; Frigaard, Niels-Ulrik; Bryant, Donald A

    2008-01-01

    The Chlorobaculum tepidum genome contains two paralogous genes, CT2256 and CT1232, whose products are members of the FixC dehydrogenase superfamily and have sequence similarity to geranylgeranyl reductases. Each gene was insertionally inactivated, and the resulting mutants were characterized. CT2......2256 encodes geranylgeranyl reductase (BchP); CT1232 is not involved in bacteriochlorophyll or chlorophyll biosynthesis....

  14. Probe data: 3426 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED C26646 AU108627 C12762 CB2762 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. Probe data: 779 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D48175 AU032804 S14252 SS4252 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  16. Probe data: 3773 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED AU163183 AU163184 S00625 ST0625 >AGU83687_1(U83687|pid:g1835701) Apium graveo ... lens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  17. EST data: 731 [RED

    Lifescience Database Archive (English)

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  18. High-resolution structure of AKR1a4 in the apo form and its interaction with ligands

    International Nuclear Information System (INIS)

    Despite its high affinity for NADPH, AKR1a4 crystallized in the apo form, which is very rare for aldo-keto reductase enzymes. Aldo-keto reductase 1a4 (AKR1a4; EC 1.1.1.2) is the mouse orthologue of human aldehyde reductase (AKR1a1), the founding member of the AKR family. As an NADPH-dependent enzyme, AKR1a4 catalyses the conversion of d-glucuronate to l-gulonate. AKR1a4 is involved in ascorbate biosynthesis in mice, but has also recently been found to interact with SMAR1, providing a novel mechanism of ROS regulation by ATM. Here, the crystal structure of AKR1a4 in its apo form at 1.64 Å resolution as well as the characterization of the binding of AKR1a4 to NADPH and P44, a peptide derived from SMAR1, is presented

  19. Multiple abiotic stress tolerance in Vigna mungo is altered by overexpression of ALDRXV4 gene via reactive carbonyl detoxification.

    Science.gov (United States)

    Singh, Preeti; Kumar, Deepak; Sarin, Neera Bhalla

    2016-06-01

    Vigna mungo (blackgram) is an important leguminous pulse crop, which is grown for its protein rich edible seeds. Drought and salinity are the major abiotic stresses which adversely affect the growth and productivity of crop plants including blackgram. The ALDRXV4 belongs to the aldo-keto reductase superfamily of enzymes that catalyze the reduction of carbonyl metabolites in the cells and plays an important role in the osmoprotection and detoxification of the reactive carbonyl species. In the present study, we developed transgenic plants of V. mungo using Agrobacterium mediated transformation. The transgene integration was confirmed by Southern blot analysis whereas the expression was confirmed by RT-PCR, Western blot and enzyme activity. The T1 generation transgenic plants displayed improved tolerance to various environmental stresses, including drought, salt, methyl viologen and H2O2 induced oxidative stress. The increased aldose reductase activity, higher sorbitol content and less accumulation of the toxic metabolite, methylglyoxal in the transgenic lines under non-stress and stress (drought and salinity) conditions resulted in increased protection through maintenance of better photosynthetic efficiency, higher relative water content and less photooxidative damage. The accumulation of reactive oxygen species was remarkably decreased in the transgenic lines as compared with the wild type plants. This study of engineering multiple stress tolerance in blackgram, is the first report to date and this strategy for trait improvement is proposed to provide a novel germplasm for blackgram production on marginal lands. PMID:26956699

  20. Superfamilies of Evolved and Designed Networks

    Science.gov (United States)

    Milo, Ron; Itzkovitz, Shalev; Kashtan, Nadav; Levitt, Reuven; Shen-Orr, Shai; Ayzenshtat, Inbal; Sheffer, Michal; Alon, Uri

    2004-03-01

    Complex biological, technological, and sociological networks can be of very different sizes and connectivities, making it difficult to compare their structures. Here we present an approach to systematically study similarity in the local structure of networks, based on the significance profile (SP) of small subgraphs in the network compared to randomized networks. We find several superfamilies of previously unrelated networks with very similar SPs. One superfamily, including transcription networks of microorganisms, represents ``rate-limited'' information-processing networks strongly constrained by the response time of their components. A distinct superfamily includes protein signaling, developmental genetic networks, and neuronal wiring. Additional superfamilies include power grids, protein-structure networks and geometric networks, World Wide Web links and social networks, and word-adjacency networks from different languages.

  1. Structure and mechanism of dimethylsulfoxide reductase, a molybdopterin-containing enzyme of DMSO reductase family

    International Nuclear Information System (INIS)

    Full text: Apart from nitrogenase, enzymes containing molybdenum are members of a superfamily, the molybdopterin-containing enzymes. Most of these enzymes catalyse an oxygen atom transfer and two electron transfer reaction. During catalysis the Mo at the active site cycles between the Mo(VI) and Mo(IV) states. The DMSO reductase family of molybdopterin-containing enzymes all contain a bis(molybdopterin guanine dinucleotide)Mo cofactor and over thirty examples have now been described. Over the last five years crystal structures of dimethylsulfoxide (DMSO) reductase and four other enzymes of the DMSO reductase family have revealed that enzymes of this family have a similar tertiary structure. The Mo atom at the active site is coordinated by four thiolate ligands provided by the dithiolene side chains of the two MGD molecules of the bis(MGD)Mo cofactor as well as a ligand provided by an amino acid side chain. In addition, an oxygen atom in the form of an oxo, hydroxo or aqua group is also coordinated to the Mo atom. In the case of dimethylsulfoxide reductase X-ray crystallography of the product-reduced species and Raman spectroscopy has demonstrated that the enzyme contains a single exchangeable oxo group that is H-bonded to W116

  2. Depressed Levels of Prostaglandin F2α in Mice Lacking Akr1b7 Increase Basal Adiposity and Predispose to Diet-Induced Obesity

    OpenAIRE

    Volat, Fanny E.; Pointud, Jean-Christophe; Pastel, Emilie; Morio, Béatrice; Sion, Benoit; Hamard, Ghislaine; Guichardant, Michel; Colas, Romain; Lefrançois-Martinez, Anne-Marie; Martinez, Antoine

    2012-01-01

    Negative regulators of white adipose tissue (WAT) expansion are poorly documented in vivo. Prostaglandin F2α (PGF2α) is a potent antiadipogenic factor in cultured preadipocytes, but evidence for its involvement in physiological context is lacking. We previously reported that Akr1b7, an aldo-keto reductase enriched in adipose stromal vascular fraction but absent from mature adipocytes, has antiadipogenic properties possibly supported by PGF2α synthase activity. To test whether lack of Akr1b7 c...

  3. A Superfamily of Arabidopsis Thaliana Retrotransposons

    OpenAIRE

    Konieczny, A; Voytas, D. F.; Cummings, M. P.; Ausubel, F M

    1991-01-01

    We describe a superfamily of Arabidopsis thaliana retrotransposable elements that consists of at least ten related families designated Ta1-Ta10. The Ta1 family has been described previously. Two genomic clones representing the Ta2 and Ta3 elements were isolated from an A. thaliana (race Landsberg erecta) λ library using sequences derived from the reverse transcriptase region of Ta1 as hybridization probes. Nucleotide sequence analysis showed that the Ta1, Ta2 and Ta3 families share >75% amino...

  4. Precambrian origins of the TNFR superfamily.

    Science.gov (United States)

    Quistad, S D; Traylor-Knowles, N

    2016-01-01

    The evolution of the tumor necrosis factor/tumor necrosis factor receptor superfamily (TNF/TNFR) is complicated and not well understood. To date, most TNFR studies have focused on vertebrate models leaving the role of TNFRs in invertebrates largely unexplored. The evolution of important cellular processes including stress response, apoptosis, development, and inflammation will be better understood by examining the TNF/TNFR superfamily in ancient invertebrate phyla. How widespread is this gene family within the evolutionary tree of life and is there evidence for similar function in invertebrates? A first step is to identify the presence or absence of these genes within basal metazoan taxa using the signature cysteine-rich domain (CRD) of the TNFR superfamily. In this perspective, we will start by examining what is currently known about the function of TNFRs in invertebrates. Then, we will assess the role of TNFRs in apoptosis and explore the origins of the domains found in TNFRs including the death domain (DD) and CRD. Finally, we will examine the phylogenetic relationship between TNFRs containing DDs identified to date. From these data, we propose a model for a Precambrian origin of TNFRs and their functional role in apoptosis. PMID:27551546

  5. Designer TGFβ superfamily ligands with diversified functionality.

    Directory of Open Access Journals (Sweden)

    George P Allendorph

    Full Text Available Transforming Growth Factor--beta (TGFβ superfamily ligands, including Activins, Growth and Differentiation Factors (GDFs, and Bone Morphogenetic Proteins (BMPs, are excellent targets for protein-based therapeutics because of their pervasiveness in numerous developmental and cellular processes. We developed a strategy termed RASCH (Random Assembly of Segmental Chimera and Heteromer, to engineer chemically-refoldable TGFβ superfamily ligands with unique signaling properties. One of these engineered ligands, AB208, created from Activin-βA and BMP-2 sequences, exhibits the refolding characteristics of BMP-2 while possessing Activin-like signaling attributes. Further, we find several additional ligands, AB204, AB211, and AB215, which initiate the intracellular Smad1-mediated signaling pathways more strongly than BMP-2 but show no sensitivity to the natural BMP antagonist Noggin unlike natural BMP-2. In another design, incorporation of a short N-terminal segment from BMP-2 was sufficient to enable chemical refolding of BMP-9, without which was never produced nor refolded. Our studies show that the RASCH strategy enables us to expand the functional repertoire of TGFβ superfamily ligands through development of novel chimeric TGFβ ligands with diverse biological and clinical values.

  6. Structure-function of human 3 alpha-hydroxysteroid dehydrogenases: genes and proteins.

    Science.gov (United States)

    Penning, T M; Jin, Y; Steckelbroeck, S; Lanisnik Rizner, T; Lewis, M

    2004-02-27

    Four soluble human 3 alpha-hydroxysteroid dehydrogenase (HSD) isoforms exist which are aldo-keto reductase (AKR) superfamily members. They share 86% sequence identity and correspond to: AKR1C1 (20 alpha(3 alpha)-HSD); AKR1C2 (type 3 3 alpha-HSD and bile-acid binding protein); AKR1C3 (type 2 3 alpha-HSD and type 5 17 beta-HSD); and AKR1C4 (type 1 3 alpha-HSD). Each of the homogeneous recombinant enzymes are plastic and display 3-, 17- and 20-ketosteroid reductase and 3 alpha- 17 beta- and 20 alpha-hydroxysteroid oxidase activities with different k(cat)/K(m) ratios in vitro. The crystal structure of the AKR1C2.NADP(+).ursodeoxycholate complex provides an explanation for this functional plasticity. Ursodeoxycholate is bound backwards (D-ring in the A-ring position) and upside down (beta-face of steroid inverted) relative to the position of 3-ketosteroids in the related rat liver 3 alpha-HSD (AKR1C9) structure. Transient transfection indicates that in COS-1 cells, AKR1C enzymes function as ketosteroid reductases due to potent inhibition of their oxidase activity by NADPH. By acting as ketosteroid reductases they may regulate the occupancy of the androgen, estrogen and progesterone receptors. RT-PCR showed that AKRs are discretely localized. AKR1C4 is virtually liver specific, while AKR1C2 and AKR1C3 are dominantly expressed in prostate and mammary gland. AKR1C genes are highly conserved in structure and may be transcriptionally regulated by steroid hormones and stress. PMID:15026176

  7. Hydroxysteroid dehydrogenases (HSDs) in bacteria: a bioinformatic perspective.

    Science.gov (United States)

    Kisiela, Michael; Skarka, Adam; Ebert, Bettina; Maser, Edmund

    2012-03-01

    Steroidal compounds including cholesterol, bile acids and steroid hormones play a central role in various physiological processes such as cell signaling, growth, reproduction, and energy homeostasis. Hydroxysteroid dehydrogenases (HSDs), which belong to the superfamily of short-chain dehydrogenases/reductases (SDR) or aldo-keto reductases (AKR), are important enzymes involved in the steroid hormone metabolism. HSDs function as an enzymatic switch that controls the access of receptor-active steroids to nuclear hormone receptors and thereby mediate a fine-tuning of the steroid response. The aim of this study was the identification of classified functional HSDs and the bioinformatic annotation of these proteins in all complete sequenced bacterial genomes followed by a phylogenetic analysis. For the bioinformatic annotation we constructed specific hidden Markov models in an iterative approach to provide a reliable identification for the specific catalytic groups of HSDs. Here, we show a detailed phylogenetic analysis of 3α-, 7α-, 12α-HSDs and two further functional related enzymes (3-ketosteroid-Δ(1)-dehydrogenase, 3-ketosteroid-Δ(4)(5α)-dehydrogenase) from the superfamily of SDRs. For some bacteria that have been previously reported to posses a specific HSD activity, we could annotate the corresponding HSD protein. The dominating phyla that were identified to express HSDs were that of Actinobacteria, Proteobacteria, and Firmicutes. Moreover, some evolutionarily more ancient microorganisms (e.g., Cyanobacteria and Euryachaeota) were found as well. A large number of HSD-expressing bacteria constitute the normal human gastro-intestinal flora. Another group of bacteria were originally isolated from natural habitats like seawater, soil, marine and permafrost sediments. These bacteria include polycyclic aromatic hydrocarbons-degrading species such as Pseudomonas, Burkholderia and Rhodococcus. In conclusion, HSDs are found in a wide variety of microorganisms including

  8. The P450 gene superfamily: recommended nomenclature.

    Science.gov (United States)

    Nebert, D W; Adesnik, M; Coon, M J; Estabrook, R W; Gonzalez, F J; Guengerich, F P; Gunsalus, I C; Johnson, E F; Kemper, B; Levin, W

    1987-02-01

    A nomenclature for the P450 gene superfamily is proposed based on evolution. Recommendations include Roman numerals for distinct gene families, capital letters for subfamilies, and Arabic numerals for individual genes. An updating of this list, which presently includes 65 entries, will be required every 1-2 years. Assignment of orthologous genes is presently uncertain in some cases--between widely diverged species and especially in the P450II family due to the large number of genes. As more is known, it might become necessary to change some gene assignments that are based on our present knowledge. PMID:3829886

  9. Main trends of karyotype evolution in the superfamily Chalcidoidea (Hymenoptera)

    OpenAIRE

    Vladimir Gokhman; Alex Gumovsky

    2009-01-01

    An overview of karyotype evolution in the superfamily Chalcidoidea is given. Structural types of chromosome sets in the superfamily are listed. Main pathways of karyotypic change in the Chalcidoidea are outlined. The chromosome set containing eleven subtelo- or acrocentrics is considered as an ancestral karyotype for the superfamily. Multiple independent reductions in n values through chromosomal fusions presumably occurred in various groups of chalcid families.

  10. Comparative analysis of cystatin superfamily in platyhelminths.

    Directory of Open Access Journals (Sweden)

    Aijiang Guo

    Full Text Available The cystatin superfamily is comprised of cysteine proteinase inhibitors and encompasses at least 3 subfamilies: stefins, cystatins and kininogens. In this study, the platyhelminth cystatin superfamily was identified and grouped into stefin and cystatin subfamilies. The conserved domain of stefins (G, QxVxG was observed in all members of platyhelminth stefins. The three characteristics of cystatins, the cystatin-like domain (G, QxVxG, PW, a signal peptide, and one or two conserved disulfide bonds, were observed in platyhelminths, with the exception of cestodes, which lacked the conserved disulfide bond. However, it is noteworthy that cestode cystatins had two tandem repeated domains, although the second tandem repeated domain did not contain a cystatin-like domain, which has not been previously reported. Tertiary structure analysis of Taenia solium cystatin, one of the cestode cystatins, demonstrated that the N-terminus of T. solium cystatin formed a five turn α-helix, a five stranded β-pleated sheet and a hydrophobic edge, similar to the structure of chicken cystatin. Although no conserved disulfide bond was found in T. solium cystatin, the models of T. solium cystatin and chicken cystatin corresponded at the site of the first disulfide bridge of the chicken cystatin. However, the two models were not similar regarding the location of the second disulfide bridge of chicken cystatin. These results showed that T. solium cystatin and chicken cystatin had similarities and differences, suggesting that the biochemistry of T. solium cystatin could be similar to chicken cystatin in its inhibitory function and that it may have further functional roles. The same results were obtained for other cestode cystatins. Phylogenetic analysis showed that cestode cystatins constituted an independent clade and implied that cestode cystatins should be considered to have formed a new clade during evolution.

  11. Perchlorate Reductase Is Distinguished by Active Site Aromatic Gate Residues.

    Science.gov (United States)

    Youngblut, Matthew D; Tsai, Chi-Lin; Clark, Iain C; Carlson, Hans K; Maglaqui, Adrian P; Gau-Pan, Phonchien S; Redford, Steven A; Wong, Alan; Tainer, John A; Coates, John D

    2016-04-22

    Perchlorate is an important ion on both Earth and Mars. Perchlorate reductase (PcrAB), a specialized member of the dimethylsulfoxide reductase superfamily, catalyzes the first step of microbial perchlorate respiration, but little is known about the biochemistry, specificity, structure, and mechanism of PcrAB. Here we characterize the biophysics and phylogeny of this enzyme and report the 1.86-Å resolution PcrAB complex crystal structure. Biochemical analysis revealed a relatively high perchlorate affinity (Km = 6 μm) and a characteristic substrate inhibition compared with the highly similar respiratory nitrate reductase NarGHI, which has a relatively much lower affinity for perchlorate (Km = 1.1 mm) and no substrate inhibition. Structural analysis of oxidized and reduced PcrAB with and without the substrate analog SeO3 (2-) bound to the active site identified key residues in the positively charged and funnel-shaped substrate access tunnel that gated substrate entrance and product release while trapping transiently produced chlorate. The structures suggest gating was associated with shifts of a Phe residue between open and closed conformations plus an Asp residue carboxylate shift between monodentate and bidentate coordination to the active site molybdenum atom. Taken together, structural and mutational analyses of gate residues suggest key roles of these gate residues for substrate entrance and product release. Our combined results provide the first detailed structural insight into the mechanism of biological perchlorate reduction, a critical component of the chlorine redox cycle on Earth. PMID:26940877

  12. Aldehyde dehydrogenase protein superfamily in maize.

    Science.gov (United States)

    Zhou, Mei-Liang; Zhang, Qian; Zhou, Ming; Qi, Lei-Peng; Yang, Xiong-Bang; Zhang, Kai-Xuan; Pang, Jun-Feng; Zhu, Xue-Mei; Shao, Ji-Rong; Tang, Yi-Xiong; Wu, Yan-Min

    2012-11-01

    Maize (Zea mays ssp. mays L.) is an important model organism for fundamental research in the agro-biotechnology field. Aldehydes were generated in response to a suite of environmental stresses that perturb metabolism including salinity, dehydration, desiccation, and cold and heat shock. Many biologically important aldehydes are metabolized by the superfamily of NAD(P)(+)-dependent aldehyde dehydrogenases. Here, starting from the database of Z. mays, we identified 28 aldehyde dehydrogenase (ALDH) genes and 48 transcripts by the in silico cloning method using the ALDH-conserved domain amino acid sequence of Arabidopsis and rice as a probe. Phylogenetic analysis shows that all 28 members of the ALDH gene families were classified to ten distinct subfamilies. Microarray data and quantitative real-time PCR analysis reveal that ZmALDH9, ZmALDH13, and ZmALDH17 genes involve the function of drought stress, acid tolerance, and pathogens infection. These results suggested that these three ZmALDH genes might be potentially useful in maize genetic improvement. PMID:22983498

  13. Human brain aldehyde reductases: relationship to succinic semialdehyde reductase and aldose reductase.

    Science.gov (United States)

    Hoffman, P L; Wermuth, B; von Wartburg, J P

    1980-08-01

    Human brain contains multiple forms of aldehyde-reducing enzymes. One major form (AR3), as previously shown, has properties that indicate its identity with NADPH-dependent aldehyde reductase isolated from brain and other organs of various species; i.e., low molecular weight, use of NADPH as the preferred cofactor, and sensitivity to inhibition by barbiturates. A second form of aldehyde reductase ("SSA reductase") specifically reduces succinic semialdehyde (SSA) to produce gamma-hydroxybutyrate. This enzyme form has a higher molecular weight than AR3, and uses NADH as well as NADPH as cofactor. SSA reductase was not inhibited by pyrazole, oxalate, or barbiturates, and the only effective inhibitor found was the flavonoid quercetine. Although AR3 can also reduce SSA, the relative specificity of SSA reductase may enhance its in vivo role. A third form of human brain aldehyde reductase, AR2, appears to be comparable to aldose reductases characterized in several species, on the basis of its activity pattern with various sugar aldehydes and its response to characteristic inhibitors and activators, as well as kinetic parameters. This enzyme is also the most active in reducing the aldehyde derivatives of biogenic amines. These studies suggest that the various forms of human brain aldehyde reductases may have specific physiological functions. PMID:6778961

  14. Update on the olfactory receptor (OR gene superfamily

    Directory of Open Access Journals (Sweden)

    Olender Tsviya

    2008-09-01

    Full Text Available Abstract The olfactory receptor gene (OR superfamily is the largest in the human genome. The superfamily contains 390 putatively functional genes and 465 pseudogenes arranged into 18 gene families and 300 subfamilies. Even members within the same subfamily are often located on different chromosomes. OR genes are located on all autosomes except chromosome 20, plus the X chromosome but not the Y chromosome. The gene:pseudogene ratio is lowest in human, higher in chimpanzee and highest in rat and mouse -- most likely reflecting the greater need of olfaction for survival in the rodent than in the human. The OR genes undergo allelic exclusion, each sensory neurone expressing usually only one odourant receptor allele; the mechanism by which this phenomenon is regulated is not yet understood. The nomenclature system (based on evolutionary divergence of genes into families and subfamilies of the OR gene superfamily has been designed similarly to that originally used for the CYP gene superfamily.

  15. Tumor Necrosis Factor Superfamily in Innate Immunity and Inflammation

    OpenAIRE

    Šedý, John; Bekiaris, Vasileios; Ware, Carl F.

    2014-01-01

    The tumor necrosis factor superfamily (TNFSF) and its corresponding receptor superfamily (TNFRSF) form communication pathways required for developmental, homeostatic, and stimulus-responsive processes in vivo. Although this receptor–ligand system operates between many different cell types and organ systems, many of these proteins play specific roles in immune system function. The TNFSF and TNFRSF proteins lymphotoxins, LIGHT (homologous to lymphotoxins, exhibits inducible expression, and comp...

  16. Evolutionary and functional relationships within the DJ1 superfamily

    OpenAIRE

    Cookson Mark R; Bandyopadhyay Sourav

    2004-01-01

    Abstract Background Inferences about protein function are often made based on sequence homology to other gene products of known activities. This approach is valuable for small families of conserved proteins but can be difficult to apply to large superfamilies of proteins with diverse function. In this study we looked at sequence homology between members of the DJ-1/ThiJ/PfpI superfamily, which includes a human protein of unclear function, DJ-1, associated with inherited Parkinson's disease. R...

  17. Evolution of the extended LHC protein superfamily in photosynthesis

    OpenAIRE

    Engelken, Johannes

    2010-01-01

    In photosynthesis, sunlight interacts with colorful photosynthetic pigments like the chlorophylls, carotenoids and phycobilines. The first two of these pigments can be bound by members of the extended light-harvesting complex (LHC) protein superfamily and are organised in order to take on functions in the collection of or in the defense against sunlight. The extended LHC superfamily comprises several protein families, like the LHCs, the photosystem II subunit S (PSBS), the red algal lineage c...

  18. The Plant Short-Chain Dehydrogenase (SDR superfamily: genome-wide inventory and diversification patterns

    Directory of Open Access Journals (Sweden)

    Moummou Hanane

    2012-11-01

    Full Text Available Abstract Background Short-chain dehydrogenases/reductases (SDRs form one of the largest and oldest NAD(P(H dependent oxidoreductase families. Despite a conserved ‘Rossmann-fold’ structure, members of the SDR superfamily exhibit low sequence similarities, which constituted a bottleneck in terms of identification. Recent classification methods, relying on hidden-Markov models (HMMs, improved identification and enabled the construction of a nomenclature. However, functional annotations of plant SDRs remain scarce. Results Wide-scale analyses were performed on ten plant genomes. The combination of hidden Markov model (HMM based analyses and similarity searches led to the construction of an exhaustive inventory of plant SDR. With 68 to 315 members found in each analysed genome, the inventory confirmed the over-representation of SDRs in plants compared to animals, fungi and prokaryotes. The plant SDRs were first classified into three major types — ‘classical’, ‘extended’ and ‘divergent’ — but a minority (10% of the predicted SDRs could not be classified into these general types (‘unknown’ or ‘atypical’ types. In a second step, we could categorize the vast majority of land plant SDRs into a set of 49 families. Out of these 49 families, 35 appeared early during evolution since they are commonly found through all the Green Lineage. Yet, some SDR families — tropinone reductase-like proteins (SDR65C, ‘ABA2-like’-NAD dehydrogenase (SDR110C, ‘salutaridine/menthone-reductase-like’ proteins (SDR114C, ‘dihydroflavonol 4-reductase’-like proteins (SDR108E and ‘isoflavone-reductase-like’ (SDR460A proteins — have undergone significant functional diversification within vascular plants since they diverged from Bryophytes. Interestingly, these diversified families are either involved in the secondary metabolism routes (terpenoids, alkaloids, phenolics or participate in developmental processes (hormone biosynthesis or

  19. Identification of imine reductase-specific sequence motifs.

    Science.gov (United States)

    Fademrecht, Silvia; Scheller, Philipp N; Nestl, Bettina M; Hauer, Bernhard; Pleiss, Jürgen

    2016-05-01

    Chiral amines are valuable building blocks for the production of a variety of pharmaceuticals, agrochemicals and other specialty chemicals. Only recently, imine reductases (IREDs) were discovered which catalyze the stereoselective reduction of imines to chiral amines. Although several IREDs were biochemically characterized in the last few years, knowledge of the reaction mechanism and the molecular basis of substrate specificity and stereoselectivity is limited. To gain further insights into the sequence-function relationships, the Imine Reductase Engineering Database (www.IRED.BioCatNet.de) was established and a systematic analysis of 530 putative IREDs was performed. A standard numbering scheme based on R-IRED-Sk was introduced to facilitate the identification and communication of structurally equivalent positions in different proteins. A conservation analysis revealed a highly conserved cofactor binding region and a predominantly hydrophobic substrate binding cleft. Two IRED-specific motifs were identified, the cofactor binding motif GLGxMGx5 [ATS]x4 Gx4 [VIL]WNR[TS]x2 [KR] and the active site motif Gx[DE]x[GDA]x[APS]x3 {K}x[ASL]x[LMVIAG]. Our results indicate a preference toward NADPH for all IREDs and explain why, despite their sequence similarity to β-hydroxyacid dehydrogenases (β-HADs), no conversion of β-hydroxyacids has been observed. Superfamily-specific conservations were investigated to explore the molecular basis of their stereopreference. Based on our analysis and previous experimental results on IRED mutants, an exclusive role of standard position 187 for stereoselectivity is excluded. Alternatively, two standard positions 139 and 194 were identified which are superfamily-specifically conserved and differ in R- and S-selective enzymes. Proteins 2016; 84:600-610. © 2016 Wiley Periodicals, Inc. PMID:26857686

  20. The RNase H-like superfamily: new members, comparative structural analysis and evolutionary classification

    OpenAIRE

    Majorek, Karolina A; Dunin-Horkawicz, Stanislaw; Steczkiewicz, Kamil; Muszewska, Anna; Nowotny, Marcin; Ginalski, Krzysztof; Bujnicki, Janusz M.

    2014-01-01

    Ribonuclease H-like (RNHL) superfamily, also called the retroviral integrase superfamily, groups together numerous enzymes involved in nucleic acid metabolism and implicated in many biological processes, including replication, homologous recombination, DNA repair, transposition and RNA interference. The RNHL superfamily proteins show extensive divergence of sequences and structures. We conducted database searches to identify members of the RNHL superfamily (including those previously unknown)...

  1. Phylogenomic analysis of the cystatin superfamily in eukaryotes and prokaryotes

    Directory of Open Access Journals (Sweden)

    Turk Vito

    2009-11-01

    Full Text Available Abstract Background The cystatin superfamily comprises cysteine protease inhibitors that play key regulatory roles in protein degradation processes. Although they have been the subject of many studies, little is known about their genesis, evolution and functional diversification. Our aim has been to obtain a comprehensive insight into their origin, distribution, diversity, evolution and classification in Eukaryota, Bacteria and Archaea. Results We have identified in silico the full complement of the cystatin superfamily in more than 2100 prokaryotic and eukaryotic genomes. The analysis of numerous eukaryotic genomes has provided strong evidence for the emergence of this superfamily in the ancestor of eukaryotes. The progenitor of this superfamily was most probably intracellular and lacked a signal peptide and disulfide bridges, much like the extant Giardia cystatin. A primordial gene duplication produced two ancestral eukaryotic lineages, cystatins and stefins. While stefins remain encoded by a single or a small number of genes throughout the eukaryotes, the cystatins have undergone a more complex and dynamic evolution through numerous gene and domain duplications. In the cystatin superfamily we discovered twenty vertebrate-specific and three angiosperm-specific orthologous families, indicating that functional diversification has occurred only in multicellular eukaryotes. In vertebrate orthologous families, the prevailing trends were loss of the ancestral inhibitory activity and acquisition of novel functions in innate immunity. Bacterial cystatins and stefins may be emergency inhibitors that enable survival of bacteria in the host, defending them from the host's proteolytic activity. Conclusion This study challenges the current view on the classification, origin and evolution of the cystatin superfamily and provides valuable insights into their functional diversification. The findings of this comprehensive study provide guides for future

  2. Structure and Function of the LmbE-like Superfamily

    Directory of Open Access Journals (Sweden)

    Shane Viars

    2014-05-01

    Full Text Available The LmbE-like superfamily is comprised of a series of enzymes that use a single catalytic metal ion to catalyze the hydrolysis of various substrates. These substrates are often key metabolites for eukaryotes and prokaryotes, which makes the LmbE-like enzymes important targets for drug development. Herein we review the structure and function of the LmbE-like proteins identified to date. While this is the newest superfamily of metallohydrolases, a growing number of functionally interesting proteins from this superfamily have been characterized. Available crystal structures of LmbE-like proteins reveal a Rossmann fold similar to lactate dehydrogenase, which represented a novel fold for (zinc metallohydrolases at the time the initial structure was solved. The structural diversity of the N-acetylglucosamine containing substrates affords functional diversity for the LmbE-like enzyme superfamily. The majority of enzymes identified to date are metal-dependent deacetylases that catalyze the hydrolysis of a N-acetylglucosamine moiety on substrate using a combination of amino acid side chains and a single bound metal ion, predominantly zinc. The catalytic zinc is coordinated to proteins via His2-Asp-solvent binding site. Additionally, studies indicate that protein dynamics play important roles in regulating access to the active site and facilitating catalysis for at least two members of this protein superfamily.

  3. Cloning, expression and antigenicity of the L. donovani reductase

    DEFF Research Database (Denmark)

    Jensen, A T; Kemp, K; Theander, T G;

    2001-01-01

    The protozoan parasite Leishmania undergoes a morphological and biochemical transformation from the promastigote to the amastigote form during its life cycle, which is reflected in the expression of stage-specific proteins. One of these proteins shows homology to a superfamily of reductase proteins......, or not at all. The results indicate the presence of cross-reacting CD45R0 memory T-cells in individuals not exposed to Leishmania. Several previous studies have shown that T-cells from nonexposed individuals often respond to crude Leishmania antigen preparations. The present study suggests that this reactivity...

  4. Luteinizing hormone induces mouse vas deferens protein expression in the murine ovary.

    Science.gov (United States)

    Brockstedt, E; Peters-Kottig, M; Badock, V; Hegele-Hartung, C; Lessl, M

    2000-07-01

    The aim of our study was to isolate and identify novel proteins that are involved in the process of ovulation. To achieve this goal we used the technique of proteome analysis. Comparison of ovary protein patterns, obtained by high resolution two-dimensional gel electrophoresis from recombinant FSH (rFSH)- and rFSH + human CG (hCG)-treated mice, showed significant differences in protein spot positions and intensities. Subsequent analysis of one of these proteins was performed by mass spectrometry, resulting in the identification of the mouse vas deferens protein (MVDP). MVDP, which was absent in the two-dimensional gel electrophoresis protein pattern of rFSH-primed mice and appeared 3 h after the hCG surge, is a member of the aldo-keto reductase superfamily and was originally identified in the mouse vas deferens. This is the first study describing MVDP expression and regulation by LH in the ovary. Northern blot analysis of female mice tissues showed that mvdp messenger RNA (mRNA) was only present in adrenal glands and in hCG-treated ovaries. In situ hybridization studies localized the mvdp mRNA unequivocally to ovarian thecal and interstitial cells with an expression profile starting already 1.5 h, and decreasing 24 h, after LH treatment. In the adrenal glands, mvdp mRNA was not regulated by LH and localized in the cells of the zona fasciculata. In murine adrenocortical cells, a recent study proposed a detoxifying role of MVDP. MVDP might fulfill the same function in the ovary; however, because of its strong and early transcriptional induction by LH, it is also possible that MVDP catalyses another important step during the cascade of events occurring at the time of ovulation. PMID:10875260

  5. The Villin/Gelsolin/Fragmin Superfamily Proteins in Plants

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The villin/gelsolin/fragmin superfamily is a conserved Ca2+ -dependent family of actin-regulating proteins that is widely present both in mammalian and non-mammalian organisms. They have traditionally been characterized by the same core of three or six tandem gelsolin subdomains. The study in vertebrates and lower eukaryotic cells has revealed that the villinlgelsolin/fragmin superfamily of proteins has versatile functions including severing, capping, nucleating or bundling actin filaments. In plants, encouraging progress has been made in this field of research in recent years. This review will summarize the identified plant homologs of villin/gelsolin/fragmin superfamily, thus providing a basis for reflection on their biochemical activities and functions in plants.

  6. Hepatitis B Virus X Protein Up-Regulates AKR1C1 Expression Through Nuclear Factor-Y in Human Hepatocarcinoma Cells

    OpenAIRE

    Kai LI; Ding, Shijia; Chen, Ke; Qin, Dongdong; Qu, Jialin; Wang, Sen; Sheng, Yanrui; Zou, Chengcheng; Chen, Limin; Tang, Hua

    2013-01-01

    Background The hepatitis B virus X (HBx) protein has long been recognized as an important transcriptional transactivator of several genes. Human aldo-keto reductase family 1, member C1 (AKR1C1), a member of the family of AKR1CS, is significantly increased in HBx-expressed cells. Objectives This study aimed to investigate the possible mechanism of HBx in regulating AKR1C1 expression in HepG2.2.15 cells and the role of AKR1C1 for HBV-induced HCC. Materials and Methods RT-PCR was performed to de...

  7. Drug interaction of boceprevir and amlodipine in a patient with hepatitis C: A cardiovascular follow-up

    Directory of Open Access Journals (Sweden)

    Çiğdem Kader

    2015-03-01

    Full Text Available Boceprevir is a NS3/4A hepatitis C virus (HCV protease inhibitor, used in combination with peginterferon and ribavirin to treat HCV. Boceprevir undergoes extensive metabolism via cytochrome P450-mediated oxidation and ketoreduction by cytosolic aldo-keto reductases. Amlodipine has been used for the treatment of patients with hypertension and also metabolised through cytochrome P450 pathway. Here, we presented a case of boceprevir and amlodipine interaction in a patient with chronic HCV and her echocardiography and electrocardiographic follow-up results. J Microbiol Infect Dis 2015;5(1: 32-35

  8. Modulation of cell metabolic pathways and oxidative stress signaling contribute to acquired melphalan resistance in multiple myeloma cells

    DEFF Research Database (Denmark)

    Zub, Kamila Anna; Sousa, Mirta Mittelstedt Leal de; Sarno, Antonio;

    2015-01-01

    of the AKR1C family involved in prostaglandin synthesis contribute to the resistant phenotype. Finally, selected metabolic and oxidative stress response enzymes were targeted by inhibitors, several of which displayed a selective cytotoxicity against the melphalan-resistant cells and should be further...... and pathways not previously associated with melphalan resistance in multiple myeloma cells, including a metabolic switch conforming to the Warburg effect (aerobic glycolysis), and an elevated oxidative stress response mediated by VEGF/IL8-signaling. In addition, up-regulated aldo-keto reductase levels...

  9. Ancestry and diversity of the HMG box superfamily

    OpenAIRE

    Laudet, V; Stehelin, D.; Clevers, J.C.

    1993-01-01

    The HMG box is a novel type of DNA-binding domain found in a diverse group of proteins. The HMG box superfamily comprises a.o. the High Mobility Group proteins HMG1 and HMG2, the nucleolar transcription factor UBF, the lymphoid transcription factors TCF-1 and LEF-1, the fungal mating-type genes mat-Mc and MATA1, and the mammalian sex-determining gene SRY. The superfamily dates back to at least 1,000 million years ago, as its members appear in animals, plants and yeast. Alignment of all known ...

  10. Genetics Home Reference: sepiapterin reductase deficiency

    Science.gov (United States)

    Skip to main content Your Guide to Understanding Genetic Conditions Enable Javascript for addthis links to activate. ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions sepiapterin reductase deficiency sepiapterin reductase ...

  11. SUPERFAMILY--sophisticated comparative genomics, data mining, visualization and phylogeny.

    Science.gov (United States)

    Wilson, Derek; Pethica, Ralph; Zhou, Yiduo; Talbot, Charles; Vogel, Christine; Madera, Martin; Chothia, Cyrus; Gough, Julian

    2009-01-01

    SUPERFAMILY provides structural, functional and evolutionary information for proteins from all completely sequenced genomes, and large sequence collections such as UniProt. Protein domain assignments for over 900 genomes are included in the database, which can be accessed at http://supfam.org/. Hidden Markov models based on Structural Classification of Proteins (SCOP) domain definitions at the superfamily level are used to provide structural annotation. We recently produced a new model library based on SCOP 1.73. Family level assignments are also available. From the web site users can submit sequences for SCOP domain classification; search for keywords such as superfamilies, families, organism names, models and sequence identifiers; find over- and underrepresented families or superfamilies within a genome relative to other genomes or groups of genomes; compare domain architectures across selections of genomes and finally build multiple sequence alignments between Protein Data Bank (PDB), genomic and custom sequences. Recent extensions to the database include InterPro abstracts and Gene Ontology terms for superfamiles, taxonomic visualization of the distribution of families across the tree of life, searches for functionally similar domain architectures and phylogenetic trees. The database, models and associated scripts are available for download from the ftp site. PMID:19036790

  12. CREST - a large and diverse superfamily of putative transmembrane hydrolases

    Directory of Open Access Journals (Sweden)

    Olson Eric N

    2011-07-01

    Full Text Available Abstract Background A number of membrane-spanning proteins possess enzymatic activity and catalyze important reactions involving proteins, lipids or other substrates located within or near lipid bilayers. Alkaline ceramidases are seven-transmembrane proteins that hydrolyze the amide bond in ceramide to form sphingosine. Recently, a group of putative transmembrane receptors called progestin and adipoQ receptors (PAQRs were found to be distantly related to alkaline ceramidases, raising the possibility that they may also function as membrane enzymes. Results Using sensitive similarity search methods, we identified statistically significant sequence similarities among several transmembrane protein families including alkaline ceramidases and PAQRs. They were unified into a large and diverse superfamily of putative membrane-bound hydrolases called CREST (alkaline ceramidase, PAQR receptor, Per1, SID-1 and TMEM8. The CREST superfamily embraces a plethora of cellular functions and biochemical activities, including putative lipid-modifying enzymes such as ceramidases and the Per1 family of putative phospholipases involved in lipid remodeling of GPI-anchored proteins, putative hormone receptors, bacterial hemolysins, the TMEM8 family of putative tumor suppressors, and the SID-1 family of putative double-stranded RNA transporters involved in RNA interference. Extensive similarity searches and clustering analysis also revealed several groups of proteins with unknown function in the CREST superfamily. Members of the CREST superfamily share seven predicted core transmembrane segments with several conserved sequence motifs. Conclusions Universal conservation of a set of histidine and aspartate residues across all groups in the CREST superfamily, coupled with independent discoveries of hydrolase activities in alkaline ceramidases and the Per1 family as well as results from previous mutational studies of Per1, suggests that the majority of CREST members are

  13. Evolutionary and functional relationships within the DJ1 superfamily

    Directory of Open Access Journals (Sweden)

    Cookson Mark R

    2004-02-01

    Full Text Available Abstract Background Inferences about protein function are often made based on sequence homology to other gene products of known activities. This approach is valuable for small families of conserved proteins but can be difficult to apply to large superfamilies of proteins with diverse function. In this study we looked at sequence homology between members of the DJ-1/ThiJ/PfpI superfamily, which includes a human protein of unclear function, DJ-1, associated with inherited Parkinson's disease. Results DJ-1 orthologs in a variety of eukaryotic species cluster together in a single group. The most closely related group is the bacterial ThiJ genes. These are kinases involved in the biosynthesis of thiamine, a function that has been dispensed with evolutionarily in most eukaryotes where thiamine is an essential nutrient. The similarity with other characterized members of the superfamily, including proteases, is more remote. This is congruent with the recently solved crystal structures that fail to demonstrate the presence of a catalytic triad required for protease activity. Conclusion DJ-1 may have evolved from the bacterial gene encoding ThiJ kinase. However, as this function has been dispensed with in eukaryotes it appears that the gene has been co-opted for another function.

  14. Structural Evolution of the Protein Kinase-Like Superfamily.

    Directory of Open Access Journals (Sweden)

    2005-10-01

    Full Text Available The protein kinase family is large and important, but it is only one family in a larger superfamily of homologous kinases that phosphorylate a variety of substrates and play important roles in all three superkingdoms of life. We used a carefully constructed structural alignment of selected kinases as the basis for a study of the structural evolution of the protein kinase-like superfamily. The comparison of structures revealed a "universal core" domain consisting only of regions required for ATP binding and the phosphotransfer reaction. Remarkably, even within the universal core some kinase structures display notable changes, while still retaining essential activity. Hence, the protein kinase-like superfamily has undergone substantial structural and sequence revision over long evolutionary timescales. We constructed a phylogenetic tree for the superfamily using a novel approach that allowed for the combination of sequence and structure information into a unified quantitative analysis. When considered against the backdrop of species distribution and other metrics, our tree provides a compelling scenario for the development of the various kinase families from a shared common ancestor. We propose that most of the so-called "atypical kinases" are not intermittently derived from protein kinases, but rather diverged early in evolution to form a distinct phyletic group. Within the atypical kinases, the aminoglycoside and choline kinase families appear to share the closest relationship. These two families in turn appear to be the most closely related to the protein kinase family. In addition, our analysis suggests that the actin-fragmin kinase, an atypical protein kinase, is more closely related to the phosphoinositide-3 kinase family than to the protein kinase family. The two most divergent families, alpha-kinases and phosphatidylinositol phosphate kinases (PIPKs, appear to have distinct evolutionary histories. While the PIPKs probably have an

  15. Phylogenetic Characterization of Transport Protein Superfamilies: Superiority of SuperfamilyTree Programs over Those Based on Multiple Alignments

    OpenAIRE

    Chen, Jonathan S.; Reddy, Vamsee; Chen, Joshua H.; Shlykov, Maksim A; Zheng, Wei Hao; Cho, Jaehoon; Yen, Ming Ren; Saier, Milton H.

    2012-01-01

    Transport proteins function in the translocation of ions, solutes and macromolecules across cellular and organellar membranes. These integral membrane proteins fall into >600 families as tabulated in the Transporter Classification Database (www.tcdb.org). Recent studies, some of which are reported here, define distant phylogenetic relationships between families with the creation of superfamilies. Several of these are analyzed using a novel set of programs designed to allow reliable prediction...

  16. Fatty acyl-CoA reductase

    Energy Technology Data Exchange (ETDEWEB)

    Reiser, Steven E.; Somerville, Chris R.

    1998-12-01

    The present invention relates to bacterial enzymes, in particular to an acyl-CoA reductase and a gene encoding an acyl-CoA reductase, the amino acid and nucleic acid sequences corresponding to the reductase polypeptide and gene, respectively, and to methods of obtaining such enzymes, amino acid sequences and nucleic acid sequences. The invention also relates to the use of such sequences to provide transgenic host cells capable of producing fatty alcohols and fatty aldehydes.

  17. Identification of protein superfamily from structure- based sequence motif

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The structure-based sequence motif of the distant proteins in evolution, protein tyrosine phosphatases (PTP) Ⅰ and Ⅱ superfamilies, as an example, has been defined by the structural comparison, structure-based sequence alignment and analyses on substitution patterns of residues in common sequence conserved regions. And the phosphatases Ⅰ and Ⅱ can be correctly identified together by the structure-based PTP sequence motif from SWISS-PROT and TrEBML databases. The results show that the correct rates of identification are over 98%. This is the first time to identify PTP Ⅰ and Ⅱ together by this motif.

  18. New Family of Deamination Repair Enzymes in Uracil-DNA Glycosylase Superfamily*

    OpenAIRE

    Lee, Hyun-Wook; Dominy, Brian N.; Cao, Weiguo

    2011-01-01

    DNA glycosylases play a major role in the repair of deaminated DNA damage. Previous investigations identified five families within the uracil-DNA glycosylase (UDG) superfamily. All enzymes within the superfamily studied thus far exhibit uracil-DNA glycosylase activity. Here we identify a new class of DNA glycosylases in the UDG superfamily that lacks UDG activity. Instead, these enzymes act as hypoxanthine-DNA glycosylases in vitro and in vivo. Molecular modeling and structure-guided mutation...

  19. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily.

    Science.gov (United States)

    Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael

    2015-01-01

    The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer. PMID:26512702

  20. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily

    Directory of Open Access Journals (Sweden)

    Marc Lenoir

    2015-10-01

    Full Text Available The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH and Tec homology (TH domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

  1. The Defensins Consist of Two Independent, Convergent Protein Superfamilies.

    Science.gov (United States)

    Shafee, Thomas M A; Lay, Fung T; Hulett, Mark D; Anderson, Marilyn A

    2016-09-01

    The defensin and defensin-like proteins are an extensive group of small, cationic, disulfide-rich proteins found in animals, plants, and fungi and mostly perform roles in host defense. The term defensin was originally used for small mammalian proteins found in neutrophils and was subsequently applied to insect proteins and plant γ-thionins based on their perceived sequence and structural similarity. Defensins are often described as ancient innate immunity molecules and classified as a single superfamily and both sequence alignments and phylogenies have been constructed. Here, we present evidence that the defensins have not all evolved from a single ancestor. Instead, they consist of two analogous superfamilies, and extensive convergent evolution is the source of their similarities. Evidence of common origin necessarily gets weaker for distantly related genes, as is the case for defensins, which are both divergent and small. We show that similarities that have been used as evidence for common origin are all expected by chance in short, constrained, disulfide-rich proteins. Differences in tertiary structure, secondary structure order, and disulfide bond connectivity indicate convergence as the likely source of the similarity. We refer to the two evolutionarily independent groups as the cis-defensins and trans-defensins based on the orientation of the most conserved pair of disulfides. PMID:27297472

  2. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan

    2011-01-01

    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  3. Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

    International Nuclear Information System (INIS)

    Crystallization of the proposed FAD-containing ferri-siderophore reductase protein YqjH from E. coli has been performed and the structure has been determined to 3.0 Å resolution. The structure shows similarity to another proposed siderophore-interacting protein from S. putrefaciens and weak similarity to members of the NAD(P)H:flavin oxidoreductase superfamily. YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 Å resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily

  4. Coenzyme A disulfide reductase, the primary low molecular weight disulfide reductase from Staphylococcus aureus. Purification and characterization of the native enzyme.

    Science.gov (United States)

    delCardayre, S B; Stock, K P; Newton, G L; Fahey, R C; Davies, J E

    1998-03-01

    The human pathogen Staphylococcus aureus does not utilize the glutathione thiol/disulfide redox system employed by eukaryotes and many bacteria. Instead, this organism produces CoA as its major low molecular weight thiol. We report the identification and purification of the disulfide reductase component of this thiol/disulfide redox system. Coenzyme A disulfide reductase (CoADR) catalyzes the specific reduction of CoA disulfide by NADPH. CoADR has a pH optimum of 7.5-8.0 and is a dimer of identical subunits of Mr 49,000 each. The visible absorbance spectrum is indicative of a flavoprotein with a lambdamax = 452 nm. The liberated flavin from thermally denatured enzyme was identified as flavin adenine dinucleotide. Steady-state kinetic analysis revealed that CoADR catalyzes the reduction of CoA disulfide by NADPH at pH 7.8 with a Km for NADPH of 2 muM and for CoA disulfide of 11 muM. In addition to CoA disulfide CoADR reduces 4,4'-diphosphopantethine but has no measurable ability to reduce oxidized glutathione, cystine, pantethine, or H2O2. CoADR demonstrates a sequential kinetic mechanism and employs a single active site cysteine residue that forms a stable mixed disulfide with CoA during catalysis. These data suggest that S. aureus employs a thiol/disulfide redox system based on CoA/CoA-disulfide and CoADR, an unorthodox new member of the pyridine nucleotide-disulfide reductase superfamily. PMID:9488707

  5. Promiscuity and electrostatic flexibility in the alkaline phosphatase superfamily.

    Science.gov (United States)

    Pabis, Anna; Kamerlin, Shina Caroline Lynn

    2016-04-01

    Catalytic promiscuity, that is, the ability of single enzymes to facilitate the turnover of multiple, chemically distinct substrates, is a widespread phenomenon that plays an important role in the evolution of enzyme function. Additionally, such pre-existing multifunctionality can be harnessed in artificial enzyme design. The members of the alkaline phosphatase superfamily have served extensively as both experimental and computational model systems for enhancing our understanding of catalytic promiscuity. In this Opinion, we present key recent computational studies into the catalytic activity of these highly promiscuous enzymes, highlighting the valuable insight they have provided into both the molecular basis for catalytic promiscuity in general, and its implications for the evolution of phosphatase activity. PMID:26716576

  6. TGF-β superfamily: how does it regulate testis development.

    Science.gov (United States)

    Fan, Yun-Shu; Hu, Yan-Jun; Yang, Wan-Xi

    2012-04-01

    Testis development is a highly regulated sequence of developmental process that spans from the establishment of germ cell lineage during embryonic development to the periodic wave of spermatogenesis in adulthood. The normal development of testes and the fertility of male animals require specific cell types to respond correctly at a specific time point, the process of which is precisely regulated by various factors. Several members of the transforming growth factor-β superfamily are shown to be the key mediators. They act as the extracellular ligand of signaling transduction that regulates the proliferation, differentiation, apoptosis and other cell behaviors to help coordinate the physiology of the cells to the overall development of the testis and the organism. This paper reviews the current understanding of some of TGF-βs' major regulatory roles in the overall process of testis development, analyzes the current studies and their limitations and points out the research areas that need further investigation. PMID:21947950

  7. The accidental assignment of function in the tautomerase superfamily

    Directory of Open Access Journals (Sweden)

    Jamison P. Huddleston

    2015-03-01

    Full Text Available Cg10062 from Corynebacterium glutamicum is a tautomerase superfamily member with the characteristic β−α−β fold and catalytic Pro-1. It is a cis-3-chloroacrylic acid dehalogenase (cis-CaaD homologue with high sequence similarity (53% that includes the six critical active site residues (Pro-1, His-28, Arg-70, Arg-73, Tyr-103, and Glu-114. However, Cg10062 is a poor cis-CaaD: it has much lower catalytic efficiency and lacks isomer specificity. Two acetylene compounds (propiolate and 2-butynoate and an allene (2,3-butadienote were investigated as potential substrates for Cg10062. Cg10062 is a hydratase/decarboxylase using propiolate and cis-3-chloro- and 3-bromoacrylates, where malonate semialdehyde is the product of hydration and acetaldehyde is the product of decarboxylation. The two activities occur consecutively using the initial substrate. In contrast, 2-butynoate and 2,3-butadienote only undergo a hydration reaction with Cg10062 to afford acetoacetate. cis-CaaD does not function as a hydratase/decarboxylase using any of these substrates, yielding only the products of hydration. Cg10062 proceeds by direct hydration or covalent catalysis (using Pro-1 depending on the substrate. Direct hydration yields the hydration products and covalent catalysis yields the hydration and decarboxylation products. Cg10062 mutants shift the reaction toward one or the other mechanism. The observation that propiolate is the best substrate suggests that Cg10062 could be a hydratase/decarboxylase in a pathway that transforms an unknown acetylene compound to acetaldehyde via propiolate. The bifunctional activity of Cg10062 might also have implications for the evolution of the dehalogenase and decarboxylase activities in the tautomerase superfamily.

  8. Genome-level and biochemical diversity of the acyl-activating enzyme superfamily in plants

    Science.gov (United States)

    In higher plants, the superfamily of carboxyl-CoA ligases and related proteins, collectively called acyl activating enzymes (AAEs), has evolved to provide enzymes for many pathways of primary and secondary metabolism and for the conjugation of hormones to amino acids. Across the superfamily there is...

  9. Phylogenetic relationships among superfamilies of Cicadomorpha (Hemiptera: Auchenorrhyncha) inferred from the wing base structure

    OpenAIRE

    Yoshizawa, Kazunori; Wagatsuma, Mutsumi

    2012-01-01

    The infraorder Cicadomorpha is a monophyletic group of the order Hemiptera, suborder Auchenorrhyncha, and is composed of three superfamilies: Cercopoidea (spittle bugs), Cicadoidea (cicadas) and Membracoidea (leafhoppers and treehoppers). Phylogenetic relationships among the superfamilies have been highly controversial morphologically and molecularly, but recent molecular phylogenetic analyses provided support for Cercopoidea + Cicadoidea. In this study, we examined morphology of the wing bas...

  10. Identification, Characterization, and Classification of Genes Encoding Perchlorate Reductase

    OpenAIRE

    Bender, Kelly S.; Shang, Ching; Chakraborty, Romy; Belchik, Sara M.; Coates, John D.; Achenbach, Laurie A.

    2005-01-01

    The reduction of perchlorate to chlorite, the first enzymatic step in the bacterial reduction of perchlorate, is catalyzed by perchlorate reductase. The genes encoding perchlorate reductase (pcrABCD) in two Dechloromonas species were characterized. Sequence analysis of the pcrAB gene products revealed similarity to α- and β-subunits of microbial nitrate reductase, selenate reductase, dimethyl sulfide dehydrogenase, ethylbenzene dehydrogenase, and chlorate reductase, all of which are type II m...

  11. Sepiapterin Reductase Deficiency: Mimic of Cerebral Palsy

    OpenAIRE

    J Gordon Millichap

    2012-01-01

    Researchers at University of California at San Diego, and 22 other US national and international centers studied the clinical, biochemical, and molecular findings in a cohort of 38 patients with sepiapterin reductase deficiency (SRD).

  12. Enzymes of the AKR1B and AKR1C subfamilies and uterine diseases

    Directory of Open Access Journals (Sweden)

    Tea eLanisnik Rizner

    2012-03-01

    Full Text Available Endometrial and cervical cancers, uterine myoma, and endometriosis are very common uterine diseases. Worldwide, more than 800,000 women are affected annually by gynecological cancers, as a result of which, more than 360,000 die. During their reproductive age, about 70% of women develop uterine myomas, 10% to 15% suffer from endometriosis, and 35% to 50% from infertility associated with endometriosis. Uterine diseases are associated with aberrant inflammatory responses and concomitant increased production of prostaglandins (PG. They are also related to decreased differentiation, due to low levels of protective progesterone and retinoic acid, and to enhanced proliferation, due to high local concentrations of estrogens. The pathogenesis of these diseases can thus be attributed to disturbed PG, estrogen and retinoid metabolism and actions. Five human members of the aldo-keto reductase 1B (AKR1B and 1C (AKR1C superfamilies, i.e., AKR1B1, AKR1B10, AKR1C1, AKR1C2 and AKR1C3, have roles in these processes and can thus be implicated in uterine diseases. AKR1B1 and AKR1C3 catalyze the formation of PGF2alpha which stimulates cell proliferation. AKR1C3 converts PGD2 to 9alpha,11beta-PGF2, and thus counteracts the formation of 15deoxy-PGJ2, which can activate pro-apoptotic peroxisome-proliferator-activated receptor beta. AKR1B10 catalyzes the reduction of retinal to retinol, and in thus lessens the formation of retinoic acid, with potential pro-differentiating actions. The AKR1C1-AKR1C3 enzymes also act as 17-keto- and 20-ketosteroid reductases to varying extents, and are implicated in increased estradiol and decreased progesterone levels. This review comprises a short introduction to uterine diseases, followed by an overview of the current literature on the AKR1B and AKR1C expression in the uterus and in uterine diseases. The potential implications of the AKR1B and AKR1C enzymes and their pathophysiologies are then discussed, followed by conclusions and

  13. Multiple aldehyde reductases of human brain.

    Science.gov (United States)

    Hoffman, P L; Wermuth, B; von Wartburg, J P

    1980-01-01

    Human brain contains four forms of aldehyde reducing enzymes. One major activity, designated AR3, has properties indicating its identity with the NADPH-dependent aldehyde reductase, EC 1.1.1.2. The other major form of human brain enzyme, AR1, which is also NADPH-dependent, reduces both aldehyde and ketone-containing substrates, including vitamin K3 (menadione) and daunorubicin, a cancer chemotherapeutic agent. This enzyme is very sensitive to inhibition by the flavonoids quercitrin and quercetine, and may be analogous to a daunorubicin reductase previously described in liver of other species. One minor form of human brain aldehyde reductase, AR2, demonstrates substrate specificity and inhibitor sensitivity which suggest its similarity to aldose reductases found in lens and other tissues of many species. This enzyme, which can also use NADH as cofactor to some extent, is the most active in reducing the aldehyde derivatives of the biogenic amines. The fourth human brain enzyme ("SSA reductase") differs from the other forms in its ability to use NADH as well as or better than NADPH as cofactor, and in its molecular weight, which is nearly twice that of the other forms. It is quite specific for succinic semialdehyde (SSA) as substrate, and was found to be significantly inhibited only by quercetine and quercitrin. AR3 can also reduce SSA, and both enzymes may contribute to the production of gamma-hydroxybutyric acid in vivo. These results indicate that the human brain aldehyde reductases can play relatively specific physiologic roles. PMID:7424738

  14. Short-chain dehydrogenases/reductases in cyanobacteria.

    Science.gov (United States)

    Kramm, Anneke; Kisiela, Michael; Schulz, Rüdiger; Maser, Edmund

    2012-03-01

    The short-chain dehydrogenases/reductases (SDRs) represent a large superfamily of enzymes, most of which are NAD(H)-dependent or NADP(H)-dependent oxidoreductases. They display a wide substrate spectrum, including steroids, alcohols, sugars, aromatic compounds, and xenobiotics. On the basis of characteristic sequence motifs, the SDRs are subdivided into two main (classical and extended) and three smaller (divergent, intermediate, and complex) families. Despite low residue identities in pairwise comparisons, the three-dimensional structure among the SDRs is conserved and shows a typical Rossmann fold. Here, we used a bioinformatics approach to determine whether and which SDRs are present in cyanobacteria, microorganisms that played an important role in our ecosystem as the first oxygen producers. Cyanobacterial SDRs could indeed be identified, and were clustered according to the SDR classification system. Furthermore, because of the early availability of its genome sequence and the easy application of transformation methods, Synechocystis sp. PCC 6803, one of the most important cyanobacterial strains, was chosen as the model organism for this phylum. Synechocystis sp. SDRs were further analysed with bioinformatics tools, such as hidden Markov models (HMMs). It became evident that several cyanobacterial SDRs show remarkable sequence identities with SDRs in other organisms. These so-called 'homologous' proteins exist in plants, model organisms such as Drosophila melanogaster and Caenorhabditis  elegans, and even in humans. As sequence identities of up to 60% were found between Synechocystis and humans, it was concluded that SDRs seemed to have been well conserved during evolution, even after dramatic terrestrial changes such as the conversion of the early reducing atmosphere to an oxidizing one by cyanobacteria. PMID:22251568

  15. Sequence and nitrate regulation of the Arabidopsis thaliana mRNA encoding nitrate reductase, a metalloflavoprotein with three functional domains

    International Nuclear Information System (INIS)

    The sequence of nitrate reductase mRNA from the plant Arabidopsis thaliana has been determined. A 3.0-kilobase-long cDNA was isolated from a λgt10 cDNA library of Arabidopsis leaf poly(A)+ RNA. The cDNA hybridized to a 3.2-kilobase mRNA whose level increased 15-fold in response to treatment of the plant with nitrate. An open reading frame encoding a 917 amino acid protein was found in the sequence. This protein is very similar to tobacco nitrate reductase, being >80% identical within a section of 450 amino acids. By comparing the Arabidopsis protein sequence with other protein sequences, three functional domains were deduced: (i) a molybdenum-pterin-binding domain that is similar to the molybdenum-pterin-binding domain of rat liver sulfite oxidase, (ii) a heme-binding domain that is similar to proteins in the cytochrome b5 superfamily, and (iii) an FAD-binding domain that is similar to NADH-cytochrome b5 reductase

  16. Sequence and structural analyses of interleukin-8-like chemokine superfamily.

    Science.gov (United States)

    Kanagarajadurai, Karuppiah; Sowdhamini, Ramanathan

    2008-01-01

    Interleukin-8 and related chemokines are small proteins that bind to receptors belonging to the large family of G-protein-coupled receptors. They can cause migration of cells like neutrophils and eosinophils and some of them are implicated in angiogenic diseases. More than 40 subfamilies of these ligands are known that share poor sequence similarity and display receptor specificity. There is very little structural information about the mode of binding between ligands and the receptors. We have employed multi-fold sensitive sequence search methods to provide a repertoire of 252 putative interleukin-8 proteins and homologues, which are shared across humans, aves and fish. The sequences can be organized into five major known clusters. The propensity of occurrence of certain amino acid alphabets is found to be specific in different locations of the polypeptide fold. The sequence dispersion is also observed to be cluster-specific when examined by Evolutionary Trace procedure. Amino acid alphabet analysis and Evolutionary Trace procedure reveal cluster-specific amino acid distribution that provide clues about how the small fold of the ligand could display remarkable receptor specificity. We notice regions, like the beta1-beta2 loop of the fold, that are potentially involved in receptor recognition and specificity that could be potential sites for residue mutations. Systematic studies of the distribution patterns enable better understanding of the evolution and molecular recognition of this important and diverse protein superfamily. PMID:19032164

  17. Structural and mechanistic insights on nitrate reductases.

    Science.gov (United States)

    Coelho, Catarina; Romão, Maria João

    2015-12-01

    Nitrate reductases (NR) belong to the DMSO reductase family of Mo-containing enzymes and perform key roles in the metabolism of the nitrogen cycle, reducing nitrate to nitrite. Due to variable cell location, structure and function, they have been divided into periplasmic (Nap), cytoplasmic, and membrane-bound (Nar) nitrate reductases. The first crystal structure obtained for a NR was that of the monomeric NapA from Desulfovibrio desulfuricans in 1999. Since then several new crystal structures were solved providing novel insights that led to the revision of the commonly accepted reaction mechanism for periplasmic nitrate reductases. The two crystal structures available for the NarGHI protein are from the same organism (Escherichia coli) and the combination with electrochemical and spectroscopic studies also lead to the proposal of a reaction mechanism for this group of enzymes. Here we present an overview on the current advances in structural and functional aspects of bacterial nitrate reductases, focusing on the mechanistic implications drawn from the crystallographic data. PMID:26362109

  18. Cadherins: The Superfamily Critically Involved in Breast Cancer.

    Science.gov (United States)

    Ashaie, Maeirah Afzal; Chowdhury, Ezharul Hoque

    2016-01-01

    Breast cancer, one of the leading causes of mortality and morbidity among females, is regulated in part by diverse classes of adhesion molecules one of which is known as cadherins. Located at adherens junctions, the members of this superfamily are responsible for upholding proper cell-cell adhesion. Cadherins possess diverse structures and functions and any alteration in their structures or functions causes impeding of normal mammary cells development and maintenance, thus leading to breast malignancy. E-, N-, P-, VE-, Proto-, desmosomal and FAT cadherins have been found to regulate breast cancer in positive as well as negative fashion, whereby both Ecadherin (CDH1) and N-cadherin (CDH2) contribute significantly towards transitioning from epithelial state to mesenchymal state (EMT) and enacting the abnormal cells to invade and metastasize nearby and distant tissues. Aberration in gene expression of cadherins can be either due to somatic or epigenetic silencing or via transcriptional factors. Besides other cadherins, E-cadherin which serves as hallmark of EMT is associated with several regulatory factors such as Snail, Slug, Twist, Zeb, KLF4, NFI, TBX2, SIX, b-Myb, COX-2, Arf6, FOXA2, GATA3 and SMAR1, which modulate E-cadherin gene transcription to promote or represses tumor invasion and colonization. Signaling molecules such as Notch, TGF-β, estrogen receptors, EGF and Wnt initiate numerous signaling cascades via these vital factors of cell programming, controlling expression of E-cadherin at transcriptional (mRNA) and protein level. Thus, interactions of cadherins with their roles in tumor suppression and oncogenic transformation can be beneficial in providing valuable insights for breast cancer diagnosis and therapeutics development. PMID:26825466

  19. Respiratory arsenate reductase as a bidirectional enzyme

    International Nuclear Information System (INIS)

    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe-S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  20. Respiratory arsenate reductase as a bidirectional enzyme

    Science.gov (United States)

    Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

    2009-01-01

    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  1. 21 CFR 864.7375 - Glutathione reductase assay.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Glutathione reductase assay. 864.7375 Section 864... reductase assay. (a) Identification. A glutathione reductase assay is a device used to determine the... fluorescence and photometry. The results of this assay are used in the diagnosis of liver disease,...

  2. Characterization of the chlorate reductase from Pseudomonas chloritidismutans

    NARCIS (Netherlands)

    Wolterink, A.F.W.M.; Schiltz, E.; Hagedoorn, P.L.; Hagen, W.R.; Kengen, S.W.M.; Stams, A.J.M.

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were al

  3. Utility of the Amborella trichopoda expansin superfamily in elucidating the history of angiosperm expansins.

    Science.gov (United States)

    Seader, Victoria H; Thornsberry, Jennifer M; Carey, Robert E

    2016-03-01

    Expansins form a superfamily of plant proteins that assist in cell wall loosening during growth and development. The superfamily is divided into four families: EXPA, EXPB, EXLA, and EXLB (Sampedro and Cosgrove in Genome Biol 6:242, 2005. doi: 10.1186/gb-2005-6-12-242 ). Previous studies on Arabidopsis, rice, and Populus trichocarpa have clarified the evolutionary history of expansins in angiosperms (Sampedro et al. in Plant J 44:409-419, 2005. doi: 10.1111/j.1365-313X.2005.02540.x ). Amborella trichopoda is a flowering plant that diverged very early. Thus, it is a sister lineage to all other extant angiosperms (Amborella Genome Project in 342:1241089, 2013. doi: 10.1126/science.1241089 ). Because of this relationship, comparing the A. trichopoda expansin superfamily with those of other flowering plants may indicate which expansin genes were present in the last common ancestor of all angiosperms. The A. trichopoda expansin superfamily was assembled using BLAST searches with angiosperm expansin queries. The search results were analyzed and annotated to isolate the complete A. trichopoda expansin superfamily. This superfamily is similar to other angiosperm expansin superfamilies, but is somewhat smaller. This is likely because of a lack of genome duplication events (Amborella Genome Project 2013). Phylogenetic and syntenic analyses of A. trichopoda expansins have improved our understanding of the evolutionary history of expansins in angiosperms. Nearly all of the A. trichopoda expansins were placed into an existing Arabidopsis-rice expansin clade. Based on the results of phylogenetic and syntenic analyses, we estimate there were 12-13 EXPA genes, 2 EXPB genes, 1 EXLA gene, and 2 EXLB genes in the last common ancestor of all angiosperms. PMID:26646380

  4. Human dehydrogenase/reductase (SDR family) member 8 (DHRS8): a description and evaluation of its biochemical properties.

    Science.gov (United States)

    Lundová, Tereza; Štambergová, Hana; Zemanová, Lucie; Svobodová, Markéta; Havránková, Jana; Šafr, Miroslav; Wsól, Vladimír

    2016-01-01

    Dehydrogenase/reductase (SDR family) member 8 (DHRS8, SDR16C2) belongs to the short-chain dehydrogenase/reductase (SDR) superfamily, one of the largest enzyme groups. In addition to the well-known members which participate in the metabolism of important eobiotics and xenobiotics, this superfamily contains many poorly characterized proteins. DHRS8 is a member of the Multisubstrate NADP(H)-dependent SDR16C family, which generally contains insufficiently described enzymes. Despite the limited knowledge about DHRS8, preliminary indicators have emerged regarding its significant function in the modulation of steroidal activity, at least in the case of 3α-adiol, lipid metabolism and detoxification. The aim of this study was to describe additional biochemical properties of DHRS8 and to unify knowledge about this enzyme. The DHRS8 was prepared in recombinant form and its membrane topology in the endoplasmic reticulum as an integral protein with cytosolic orientation was demonstrated. The enzyme participates in the NAD(+)-dependent oxidation of steroid hormones as β-estradiol and testosterone in vitro; apparent K m and V max values were 39.86 µM and 0.80 nmol × mg(-1) × min(-1) for β-estradiol and 1207.29 µM and 3.45 nmol × mg(-1) × min(-1) for testosterone. Moreover, synthetic steroids (methyltestosterone and nandrolone) used as anabolics as well as all-trans-retinol were for the first time identified as substrates of DHRS8. This knowledge of its in vitro activity together with a newly described expression pattern at the protein level in tissues involved in steroidogenesis (adrenal gland and testis) and detoxification (liver, lung, kidney and small intestine) could suggest a potential role of DHRS8 in vivo. PMID:26472732

  5. Detailed Analysis of Function Divergence in a Large and Diverse Domain Superfamily: Towards a Refined Protocol of Function Classification

    OpenAIRE

    Dessailly, Benoit H.; Redfern, Oliver C.; Cuff, Alison L.; Orengo, Christine A.

    2010-01-01

    Some superfamilies contain large numbers of protein domains with very different functions. The ability to refine the functional classification of domains within these superfamilies is necessary for better understanding the evolution of functions and to guide function prediction of new relatives. To achieve this, a suitable starting point is the detailed analysis of functional divisions and mechanisms of functional divergence in a single superfamily. Here we present such a detailed analysis in...

  6. A new method of research on molecular evolution of pro-teinase superfamily

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The molecular evolutionary tree, also known as a phylogenetic tree, of the serine proteinase superfamily was constructed by means of structural alignment. Three-dimensional structures of proteins were aligned by the SSAP program of Orengo and Taylor to obtain evolutionary dis-tances. The resulting evolutionary tree provides a topology graph that can reflect the evolution of structure and function of homology proteinase. Moreover, study on evolution of the serine proteinase superfamily can lead to better under-standing of the relationship and evolutionary difference among proteins of the superfamily, and is of significance to protein engineering, molecular design and protein structure prediction. Structure alignment is one of the useful methods of research on molecular evolution of protein.

  7. Keanekaragaman Jenis Kupu-Kupu Superfamili Papilionoidae di Banyuwindu, Limbangan Kendal

    Directory of Open Access Journals (Sweden)

    Ratna Oqtafiana

    2013-03-01

    Full Text Available Kupu-kupu turut memberi andil dalam mempertahankan keseimbangan ekosistem dan memperkaya keanekaragaman hayati. Tujuan dari penelitian ini adalah untuk mengetahui keanekaragaman jenis kupu-kupu superfamili Papilionoidae di Dukuh Banyuwindu Desa Limbangan Kecamatan Limbangan Kabupaten Kendal khususnya di habitat hutan sekunder, permukiman, Daerah Aliran Sungai (DAS dan persawahan.Populasi dalam penelitian ini adalah semua jenis kupu-kupu superfamili Papilionoidae yang ada di Banyuwindu, Limbangan Kendal. Sampel penelitian ini adalah jenis kupu-kupu superfamili Papilionoidae yang teramati di Banyuwindu Limbangan Kendal khususnya di habitat hutan sekunder, permukiman, DAS dan persawahan. Penelitian dilakukan dengan metode Indeks Point Abudance (IPA atau metode titik hitung.Hasil penelitian ditemukan sebanyak 62 jenis kupu-kupu superfamili Papilionoidae yang terdiri dari 737 individu yang tergolong kedalam empat famili yaitu Papilionidae, Pieridae, Lycaenidae dan Nymphalidae. Hasil analisis indeks keanekaragaman jenis berkisar antara 2,74-3,09, indeks kemerataan jenis berkisar antara 0,86-0,87 dan memiliki dominansi berkisar antara 0,07-0,09. Indeks keanekaragaman jenis dan indeks kemerataan jenis tertinggi tercatat pada habitat permukiman yaitu 3,09 dan 0,87 dan memiliki dominansi 0,07 sedangkan terendah tercatat pada habitat persawahan yaitu 2,74 dan 0,86 dan memiliki dominansi 0,07.Butterfly also contribute in maintaining the ecological balance and enrich biodiversity. The aim of this research was to determine the diversity of butterflies’ superfamily Papilionoidae in Banyuwindu Hamlet Limbangan Sub district Kendal Regency, especially in the secondary forest habitat, settlements, river flow area (RFA and rice field. The population in this research were all kinds of butterflies’ Papilionoidae superfamily in Banyuwindu, Limbangan Kendal. The sample was kind of butterfly superfamily Papilionoidae that observed in Banyuwindu Limbangan Kendal

  8. Structural studies of cinnamoyl-CoA reductase and cinnamyl-alcohol dehydrogenase, key enzymes of monolignol biosynthesis.

    Science.gov (United States)

    Pan, Haiyun; Zhou, Rui; Louie, Gordon V; Mühlemann, Joëlle K; Bomati, Erin K; Bowman, Marianne E; Dudareva, Natalia; Dixon, Richard A; Noel, Joseph P; Wang, Xiaoqiang

    2014-09-01

    The enzymes cinnamoyl-CoA reductase (CCR) and cinnamyl alcohol dehydrogenase (CAD) catalyze the two key reduction reactions in the conversion of cinnamic acid derivatives into monolignol building blocks for lignin polymers in plant cell walls. Here, we describe detailed functional and structural analyses of CCRs from Medicago truncatula and Petunia hybrida and of an atypical CAD (CAD2) from M. truncatula. These enzymes are closely related members of the short-chain dehydrogenase/reductase (SDR) superfamily. Our structural studies support a reaction mechanism involving a canonical SDR catalytic triad in both CCR and CAD2 and an important role for an auxiliary cysteine unique to CCR. Site-directed mutants of CAD2 (Phe226Ala and Tyr136Phe) that enlarge the phenolic binding site result in a 4- to 10-fold increase in activity with sinapaldehyde, which in comparison to the smaller coumaraldehyde and coniferaldehyde substrates is disfavored by wild-type CAD2. This finding demonstrates the potential exploitation of rationally engineered forms of CCR and CAD2 for the targeted modification of monolignol composition in transgenic plants. Thermal denaturation measurements and structural comparisons of various liganded and unliganded forms of CCR and CAD2 highlight substantial conformational flexibility of these SDR enzymes, which plays an important role in the establishment of catalytically productive complexes of the enzymes with their NADPH and phenolic substrates. PMID:25217505

  9. Dicty_cDB: Contig-U15201-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available . 117 4e-52 BT038384_1( BT038384 |pid:none) Zea mays full-length cDNA clone ZM... 110 5e-52 BC095647_1( BC095647 |pid:none) Danio...dium phytofermentans ISD... 100 9e-40 CP000764_2653( CP000764 |pid:none) Bacillus cer...ne) Pediococcus pentosaceus ATCC 2574... 103 7e-33 AB014493_1( AB014493 |pid:none) Gibberella zeae gen...base: CSM 8402 sequences; 8,075,542 total letters Score E Sequences producing significant al...e 2 ... 114 2e-53 BC092808_1( BC092808 |pid:none) Danio rerio aldo-keto reductase

  10. Fundamental roles of reactive oxygen species and protective mechanisms in the female reproductive system

    Directory of Open Access Journals (Sweden)

    Okada Futoshi

    2005-09-01

    Full Text Available Abstract Controlled oxidation, such as disulfide bond formation in sperm nuclei and during ovulation, plays a fundamental role in mammalian reproduction. Excess oxidation, however, causes oxidative stress, resulting in the dysfunction of the reproductive process. Antioxidation reactions that reduce the levels of reactive oxygen species are of prime importance in reproductive systems in maintaining the quality of gametes and support reproduction. While anti-oxidative enzymes, such as superoxide dismutase and peroxidase, play a central role in eliminating oxidative stress, reduction-oxidation (redox systems, comprised of mainly glutathione and thioredoxin, function to reduce the levels of oxidized molecules. Aldo-keto reductase, using NADPH as an electron donor, detoxifies carbonyl compounds resulting from the oxidation of lipids and proteins. Thus, many antioxidative and redox enzyme genes are expressed and aggressively protect gametes and embryos in reproductive systems.

  11. SCREENING OF HMG CO A REDUCTASE INHIBITOR PRODUCING MARINE ACTINOMYCETES

    OpenAIRE

    SRINU, PHANI BHUSHAN,MOGES, SRILAKSHMI, SANKAR, PRABHAKAR,LAKSHMINARAYANA

    2013-01-01

    The objective of the present study was screening of 3-hydroxy-3- methyl glutaryl Co A (HMG CoA) reductase inhibitor producing marine actinomycetes. A total of 65 morphologically different actinomycetes were screened for HMG CoA reductase inhibitor production in a two stage submerged fermentation and evaluated for HMG CoA reductase inhibitor activity by agar diffusion and thin layer chromatography technique using lovostatin as a control. Among 65 marine Actinomycete strains, only one strain pr...

  12. Characterization of the chlorate reductase from Pseudomonas chloritidismutans

    OpenAIRE

    Wolterink, A.F.W.M.; Schiltz, E; Hagedoorn, P.L.; Hagen, W.R.; Kengen, S.W.M.; Stams, A.J.M.

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were also found in N-terminal sequences, molecular weight, and subunit composition. Metal analysis and electron paramagnetic resonance measurements showed the presence of iron and molybdenum, which are al...

  13. Characterization of the Chlorate Reductase from Pseudomonas chloritidismutans

    OpenAIRE

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were also found in N-terminal sequences, molecular weight, and subunit composition. Metal analysis and electron paramagnetic resonance measurements showed the presence of iron and molybdenum, which are al...

  14. Modulation of Bacterial Multidrug Resistance Efflux Pumps of the Major Facilitator Superfamily

    OpenAIRE

    Sanath Kumar; Mun Mun Mukherjee; Varela, Manuel F.

    2013-01-01

    Bacterial infections pose a serious public health concern, especially when an infectious disease has a multidrug resistant causative agent. Such multidrug resistant bacteria can compromise the clinical utility of major chemotherapeutic antimicrobial agents. Drug and multidrug resistant bacteria harbor several distinct molecular mechanisms for resistance. Bacterial antimicrobial agent efflux pumps represent a major mechanism of clinical resistance. The major facilitator superfamily (MFS) is on...

  15. Fetal antigen 1 (FA1), a circulating member of the epidermal growth factor (EGF) superfamily

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, T N; Støving, René Klinkby;

    1997-01-01

    We describe an ELISA technique for quantification of fetal antigen 1 (FA1), a glycoprotein belonging to the EGF-superfamily. The ELISA is based on immunospecifically purified polyclonal antibodies and has a dynamic range of 0.7-5.3 ng/ml, intra- and inter-assay C.V.s of less than 3.2% and an...

  16. Structure and function of NADPH-cytochrome P450 reductase and nitric oxide synthase reductase domain

    International Nuclear Information System (INIS)

    NADPH-cytochrome P450 reductase (CPR) and the nitric oxide synthase (NOS) reductase domains are members of the FAD-FMN family of proteins. The FAD accepts two reducing equivalents from NADPH (dehydrogenase flavin) and FMN acts as a one-electron carrier (flavodoxin-type flavin) for the transfer from NADPH to the heme protein, in which the FMNH ·/FMNH2 couple donates electrons to cytochrome P450 at constant oxidation-reduction potential. Although the interflavin electron transfer between FAD and FMN is not strictly regulated in CPR, electron transfer is activated in neuronal NOS reductase domain upon binding calmodulin (CaM), in which the CaM-bound activated form can function by a similar mechanism to that of CPR. The oxygenated form and spin state of substrate-bound cytochrome P450 in perfused rat liver are also discussed in terms of stepwise one-electron transfer from CPR. This review provides a historical perspective of the microsomal mixed-function oxidases including CPR and P450. In addition, a new model for the redox-linked conformational changes during the catalytic cycle for both CPR and NOS reductase domain is also discussed

  17. Xylose reductase from the thermophilic fungus Talaromyces emersonii: cloning and heterologous expression of the native gene (Texr) and a double mutant (TexrK271R+N273D) with altered coenzyme specificity

    Indian Academy of Sciences (India)

    Sara Fernandes; Maria G Tuohy; Patrick G Murray

    2009-12-01

    Xylose reductase is involved in the first step of the fungal pentose catabolic pathway. The gene encoding xylose reductase (Texr) was isolated from the thermophilic fungus Talaromyces emersonii, expressed in Escherichia coli and purified to homogeneity. Texr encodes a 320 amino acid protein with a molecular weight of 36 kDa, which exhibited high sequence identity with other xylose reductase sequences and was shown to be a member of the aldoketoreductase (AKR) superfamily with a preference for reduced nicotinamide adenine dinucleotide phosphate (NADPH) as coenzyme. Given the potential application of xylose reductase enzymes that preferentially utilize the reduced form of nicotinamide adenine dinucleotide (NADH) rather than NADPH in the fermentation of five carbon sugars by genetically engineered microorganisms, the coenzyme selectivity of TeXR was altered by site-directed mutagenesis. The TeXRK271R+N273D double mutant displayed an altered coenzyme preference with a 16-fold improvement in NADH utilization relative to the wild type and therefore has the potential to reduce redox imbalance of xylose fermentation in recombinant S. cerevisiae strains. Expression of Texr was shown to be inducible by the same carbon sources responsible for the induction of genes encoding enzymes relevant to lignocellulose hydrolysis, suggesting a coordinated expression of intracellular and extracellular enzymes relevant to hydrolysis and metabolism of pentose sugars in T. emersonii in adaptation to its natural habitat. This indicates a potential advantage in survival and response to a nutrient-poor environment.

  18. Genetic identification of a respiratory arsenate reductase

    OpenAIRE

    Saltikov, Chad W.; Newman, Dianne K.

    2003-01-01

    For more than a decade, it has been recognized that arsenate [H2AsO41-; As(V)] can be used by microorganisms as a terminal electron acceptor in anaerobic respiration. Given the toxicity of arsenic, the mechanistic basis of this process is intriguing, as is its evolutionary origin. Here we show that a two-gene cluster (arrAB; arsenate respiratory reduction) in the bacterium Shewanella sp. strain ANA-3 specifically confers respiratory As(V) reductase activity. Mutants with in-frame deletions of...

  19. Membrane-associated chromate reductase activity from Enterobacter cloacae.

    OpenAIRE

    P. C. Wang; Mori, T.; Toda, K.; Ohtake, H

    1990-01-01

    Washed cells of Enterobacter cloacae HO1 reduced hexavalent chromium (chromate: CrO4(2-) anaerobically. Chromate reductase activity was preferentially associated with the membrane fraction of the cells. Right-side-out membrane vesicles prepared from E. cloacae cells showed high chromate reductase activities when ascorbate-reduced phenazine methosulfate was added as an electron donor.

  20. Canopy and seasonal profiles of nitrate reductase in soybeans

    Energy Technology Data Exchange (ETDEWEB)

    Harper, J.E.; Hageman, R.H.

    1972-01-01

    Nitrate reductase activity of soybeans (Glycine max L. Merr.) was evaluated in soil plots and outdoor hydroponic gravel culture systems throughout the growing season. Nitrate reductase profiles within the plant canopy were also established. Mean activity per gram fresh weight per hour of the entire plant canopy was highest in the seedling stage while total activity (activity per gram fresh weight per hour times the total leaf weight) reached a maximum when plants were in the full bloom to midpod fill stage. Nitrate reductase activity per gram fresh weight per hour was highest in the uppermost leaf just prior to full expansion and declined with leaf positions lower in the canopy. Total nitrate reductase activity per leaf was also highest in the uppermost fully expanded leaf during early growth stages. Maximum total activity shifted to leaf positions lower in the plant canopy with later growth stages. Nitrate reductase activity of soybeans grown in hydroponic systems was significantly higher than activity of adjacent soil grown plants at later growth stages, which suggested that under normal field conditions the potential for nitrate utilization may not be realized. Nitrate reductase activity per gram fresh weight per hour and nitrate content were positively correlated over the growing season with plants grown in either soil or solution culture. Computations based upon the nitrate reductase assay of plants grown in hydroponics indicated that from 1.7 to 1.8 grams N could have been supplied to the plant via the nitrate reductase process. 11 references, 9 figures, 3 tables.

  1. Identification of a 4-Deoxy-l-erythro-5-hexoseulose Uronic Acid Reductase, FlRed, in an Alginolytic Bacterium Flavobacterium sp. Strain UMI-01

    Directory of Open Access Journals (Sweden)

    Akira Inoue

    2015-01-01

    Full Text Available In alginate-assimilating bacteria, alginate is depolymerized to unsaturated monosaccharide by the actions of endolytic and exolytic alginate lyases (EC 4.2.2.3 and EC 4.2.2.11. The monosaccharide is non-enzymatically converted to 4-deoxy-l-ery thro-5-hexoseulose uronic acid (DEH, then reduced to 2-keto-3-deoxy-d-gluconate (KDG by a specific reductase, and metabolized through the Entner–Doudoroff pathway. Recently, the NADPH-dependent reductase A1-R that belongs to short-chain dehydrogenases/reductases (SDR superfamily was identified as the DEH-reductase in Sphingomonas sp. A1. We have subsequently noticed that an SDR-like enzyme gene, flred, occurred in the genome of an alginolytic bacterium Flavobacterium sp. strain UMI-01. In the present study, we report on the deduced amino-acid sequence of flred and DEH-reducing activity of recombinant FlRed. The deduced amino-acid sequence of flred comprised 254 residues and showed 34% amino-acid identities to that of A1-R from Sphingomonas sp. A1 and 80%–88% to those of SDR-like enzymes from several alginolytic bacteria. Common sequence motifs of SDR-superfamily enzymes, e.g., the catalytic tetrad Asn-Lys-Tyr-Ser and the cofactor-binding sequence Thr-Gly-x-x-x-Gly-x-Gly in Rossmann fold, were completely conserved in FlRed. On the other hand, an Arg residue that determined the NADPH-specificity of Sphingomonas A1-R was replaced by Glu in FlRed. Thus, we investigated cofactor-preference of FlRed using a recombinant enzyme. As a result, the recombinant FlRed (recFlRed was found to show high specificity to NADH. recFlRed exhibited practically no activity toward variety of aldehyde, ketone, keto ester, keto acid and aldose substrates except for DEH. On the basis of these results, we conclude that FlRed is the NADH-dependent DEH-specific SDR of Flavobacterium sp. strain UMI-01.

  2. Structural relationships in the lysozyme superfamily: significant evidence for glycoside hydrolase signature motifs.

    Directory of Open Access Journals (Sweden)

    Alexandre Wohlkönig

    Full Text Available BACKGROUND: Chitin is a polysaccharide that forms the hard, outer shell of arthropods and the cell walls of fungi and some algae. Peptidoglycan is a polymer of sugars and amino acids constituting the cell walls of most bacteria. Enzymes that are able to hydrolyze these cell membrane polymers generally play important roles for protecting plants and animals against infection with insects and pathogens. A particular group of such glycoside hydrolase enzymes share some common features in their three-dimensional structure and in their molecular mechanism, forming the lysozyme superfamily. RESULTS: Besides having a similar fold, all known catalytic domains of glycoside hydrolase proteins of lysozyme superfamily (families and subfamilies GH19, GH22, GH23, GH24 and GH46 share in common two structural elements: the central helix of the all-α domain, which invariably contains the catalytic glutamate residue acting as general-acid catalyst, and a β-hairpin pointed towards the substrate binding cleft. The invariant β-hairpin structure is interestingly found to display the highest amino acid conservation in aligned sequences of a given family, thereby allowing to define signature motifs for each GH family. Most of such signature motifs are found to have promising performances for searching sequence databases. Our structural analysis further indicates that the GH motifs participate in enzymatic catalysis essentially by containing the catalytic water positioning residue of inverting mechanism. CONCLUSIONS: The seven families and subfamilies of the lysozyme superfamily all have in common a β-hairpin structure which displays a family-specific sequence motif. These GH β-hairpin motifs contain potentially important residues for the catalytic activity, thereby suggesting the participation of the GH motif to catalysis and also revealing a common catalytic scheme utilized by enzymes of the lysozyme superfamily.

  3. Structural conservation in the major facilitator superfamily as revealed by comparative modeling

    OpenAIRE

    Vardy, Eyal; Arkin, Isaiah T.; Gottschalk, Kay E.; Kaback, H. Ronald; Schuldiner, Shimon

    2004-01-01

    The structures of membrane transporters are still mostly unsolved. Only recently, the first two high-resolution structures of transporters of the major facilitator superfamily (MFS) were published. Despite the low sequence similarity of the two proteins involved, lactose permease and glycerol-3-phosphate transporter, the reported structures are highly similar. This leads to the hypothesis that all members of the MFS share a similar structure, regardless of their low sequence identity. To test...

  4. Germ-line transgenesis of the Tc1/mariner superfamily transposon Minos in Ciona intestinalis

    OpenAIRE

    Sasakura, Yasunori; Awazu, Satoko; Chiba, Shota; Satoh, Nori

    2003-01-01

    The tadpole larva of the basal chordate Ciona intestinalis has the most simplified, basic body-plan of chordates. Because it has a compact genome with a complete draft sequence, a large quantity of EST/cDNA information, and a short generation time, Ciona is a suitable model for future genetics. We establish here a transgenic technique in Ciona that uses the Tc1/mariner superfamily transposon Minos. Minos was integrated efficiently into the genome of germ cells and transmitted stably to ...

  5. CYP51: A Major Drug Target in the Cytochrome P450 Superfamily

    OpenAIRE

    Lepesheva, Galina I.; Hargrove, Tatyana Y.; Kleshchenko, Yuliya; Nes, W. David; Villalta, Fernando; Waterman, Michael R.

    2008-01-01

    The cytochrome P540 (CYP) superfamily currently includes about 9,000 proteins forming more than 800 families. The enzymes catalyze monooxygenation of a vast array of compounds and play essentially two roles. They provide biodefense (detoxification of xenobiotics, antibiotic production) and participate in biosynthesis of important endogenous molecules, particularly steroids. Based on these two roles, sterol 14|*alpha*|-demethylases (CYP51) belong to the second group of P450s. The CYP51 family,...

  6. Taxonomic distribution and origins of the extended LHC (light-harvesting complex antenna protein superfamily

    Directory of Open Access Journals (Sweden)

    Brinkmann Henner

    2010-07-01

    Full Text Available Abstract Background The extended light-harvesting complex (LHC protein superfamily is a centerpiece of eukaryotic photosynthesis, comprising the LHC family and several families involved in photoprotection, like the LHC-like and the photosystem II subunit S (PSBS. The evolution of this complex superfamily has long remained elusive, partially due to previously missing families. Results In this study we present a meticulous search for LHC-like sequences in public genome and expressed sequence tag databases covering twelve representative photosynthetic eukaryotes from the three primary lineages of plants (Plantae: glaucophytes, red algae and green plants (Viridiplantae. By introducing a coherent classification of the different protein families based on both, hidden Markov model analyses and structural predictions, numerous new LHC-like sequences were identified and several new families were described, including the red lineage chlorophyll a/b-binding-like protein (RedCAP family from red algae and diatoms. The test of alternative topologies of sequences of the highly conserved chlorophyll-binding core structure of LHC and PSBS proteins significantly supports the independent origins of LHC and PSBS families via two unrelated internal gene duplication events. This result was confirmed by the application of cluster likelihood mapping. Conclusions The independent evolution of LHC and PSBS families is supported by strong phylogenetic evidence. In addition, a possible origin of LHC and PSBS families from different homologous members of the stress-enhanced protein subfamily, a diverse and anciently paralogous group of two-helix proteins, seems likely. The new hypothesis for the evolution of the extended LHC protein superfamily proposed here is in agreement with the character evolution analysis that incorporates the distribution of families and subfamilies across taxonomic lineages. Intriguingly, stress-enhanced proteins, which are universally found in the

  7. FLORA: A Novel Method to Predict Protein Function from Structure in Diverse Superfamilies

    OpenAIRE

    Redfern, O. C.; Dessailly, B. H.; Dallman, T. J.; Sillitoe, I.; Orengo, C A

    2009-01-01

    Predicting protein function from structure remains an active area of interest, particularly for the structural genomics initiatives where a substantial number of structures are initially solved with little or no functional characterisation. Although global structure comparison methods can be used to transfer functional annotations, the relationship between fold and function is complex, particularly in functionally diverse superfamilies that have evolved through different secondary structure e...

  8. Directed Evolution of a Thermostable Quorum-quenching Lactonase from the Amidohydrolase Superfamily*

    OpenAIRE

    Chow, Jeng Yeong; Xue, Bo; Lee, Kang Hao; Tung, Alvin; Wu, Long; Robinson, Robert C.; Yew, Wen Shan

    2010-01-01

    A thermostable quorum-quenching lactonase from Geobacillus kaustophilus HTA426 (GI: 56420041) was used as an initial template for in vitro directed evolution experiments. This enzyme belongs to the phosphotriesterase-like lactonase (PLL) group of enzymes within the amidohydrolase superfamily that hydrolyze N-acylhomoserine lactones (AHLs) that are involved in virulence pathways of quorum-sensing pathogenic bacteria. Here we have determined the N-butyryl-l-homoserine lactone-liganded structure...

  9. Exploring fold space preferences of new-born and ancient protein superfamilies.

    Directory of Open Access Journals (Sweden)

    Hannah Edwards

    Full Text Available The evolution of proteins is one of the fundamental processes that has delivered the diversity and complexity of life we see around ourselves today. While we tend to define protein evolution in terms of sequence level mutations, insertions and deletions, it is hard to translate these processes to a more complete picture incorporating a polypeptide's structure and function. By considering how protein structures change over time we can gain an entirely new appreciation of their long-term evolutionary dynamics. In this work we seek to identify how populations of proteins at different stages of evolution explore their possible structure space. We use an annotation of superfamily age to this space and explore the relationship between these ages and a diverse set of properties pertaining to a superfamily's sequence, structure and function. We note several marked differences between the populations of newly evolved and ancient structures, such as in their length distributions, secondary structure content and tertiary packing arrangements. In particular, many of these differences suggest a less elaborate structure for newly evolved superfamilies when compared with their ancient counterparts. We show that the structural preferences we report are not a residual effect of a more fundamental relationship with function. Furthermore, we demonstrate the robustness of our results, using significant variation in the algorithm used to estimate the ages. We present these age estimates as a useful tool to analyse protein populations. In particularly, we apply this in a comparison of domains containing greek key or jelly roll motifs.

  10. TNF and TNF Receptor Superfamily Members in HIV infection: New Cellular Targets for Therapy?

    Directory of Open Access Journals (Sweden)

    Amit Kumar

    2013-01-01

    Full Text Available Tumor necrosis factor (TNF and TNF receptors (TNFR superfamily members are engaged in diverse cellular phenomena such as cellular proliferation, morphogenesis, apoptosis, inflammation, and immune regulation. Their role in regulating viral infections has been well documented. Viruses have evolved with numerous strategies to interfere with TNF-mediated signaling indicating the importance of TNF and TNFR superfamily in viral pathogenesis. Recent research reports suggest that TNF and TNFRs play an important role in the pathogenesis of HIV. TNFR signaling modulates HIV replication and HIV proteins interfere with TNF/TNFR pathways. Since immune activation and inflammation are the hallmark of HIV infection, the use of TNF inhibitors can have significant impact on HIV disease progression. In this review, we will describe how HIV infection is modulated by signaling mediated through members of TNF and TNFR superfamily and in turn how these latter could be targeted by HIV proteins. Finally, we will discuss the emerging therapeutics options based on modulation of TNF activity that could ultimately lead to the cure of HIV-infected patients.

  11. Origination, Expansion, Evolutionary Trajectory, and Expression Bias of AP2/ERF Superfamily in Brassica napus.

    Science.gov (United States)

    Song, Xiaoming; Wang, Jinpeng; Ma, Xiao; Li, Yuxian; Lei, Tianyu; Wang, Li; Ge, Weina; Guo, Di; Wang, Zhenyi; Li, Chunjin; Zhao, Jianjun; Wang, Xiyin

    2016-01-01

    The AP2/ERF superfamily, one of the most important transcription factor families, plays crucial roles in response to biotic and abiotic stresses. So far, a comprehensive evolutionary inference of its origination and expansion has not been available. Here, we identified 515 AP2/ERF genes in B. napus, a neo-tetraploid forming ~7500 years ago, and found that 82.14% of them were duplicated in the tetraploidization. A prominent subgenome bias was revealed in gene expression, tissue-specific, and gene conversion. Moreover, a large-scale analysis across plants and alga suggested that this superfamily could have been originated from AP2 family, expanding to form other families (ERF, and RAV). This process was accompanied by duplicating and/or alternative deleting AP2 domain, intragenic domain sequence conversion, and/or by acquiring other domains, resulting in copy number variations, alternatively contributing to functional innovation. We found that significant positive selection occurred at certain critical nodes during the evolution of land plants, possibly responding to changing environment. In conclusion, the present research revealed origination, functional innovation, and evolutionary trajectory of the AP2/ERF superfamily, contributing to understanding their roles in plant stress tolerance. PMID:27570529

  12. fastSCOP: a fast web server for recognizing protein structural domains and SCOP superfamilies.

    Science.gov (United States)

    Tung, Chi-Hua; Yang, Jinn-Moon

    2007-07-01

    The fastSCOP is a web server that rapidly identifies the structural domains and determines the evolutionary superfamilies of a query protein structure. This server uses 3D-BLAST to scan quickly a large structural classification database (SCOP1.71 with structural alignment tool, is adopted to align these top 10 structures to refine domain boundaries and to identify evolutionary superfamilies. Our previous works demonstrated that 3D-BLAST is as fast as BLAST, and has the characteristics of BLAST (e.g. a robust statistical basis, effective search and reliable database search capabilities) in large structural database searches based on a structural alphabet database and a structural alphabet substitution matrix. The classification accuracy of this server is approximately 98% for 586 query structures and the average execution time is approximately 5. This server was also evaluated on 8700 structures, which have no annotations in the SCOP; the server can automatically assign 7311 (84%) proteins (9420 domains) to the SCOP superfamilies in 9.6 h. These results suggest that the fastSCOP is robust and can be a useful server for recognizing the evolutionary classifications and the protein functions of novel structures. The server is accessible at http://fastSCOP.life.nctu.edu.tw. PMID:17485476

  13. A Comparative Analysis of Synonymous Codon Usage Bias Pattern in Human Albumin Superfamily

    Directory of Open Access Journals (Sweden)

    Hoda Mirsafian

    2014-01-01

    Full Text Available Synonymous codon usage bias is an inevitable phenomenon in organismic taxa across the three domains of life. Though the frequency of codon usage is not equal across species and within genome in the same species, the phenomenon is non random and is tissue-specific. Several factors such as GC content, nucleotide distribution, protein hydropathy, protein secondary structure, and translational selection are reported to contribute to codon usage preference. The synonymous codon usage patterns can be helpful in revealing the expression pattern of genes as well as the evolutionary relationship between the sequences. In this study, synonymous codon usage bias patterns were determined for the evolutionarily close proteins of albumin superfamily, namely, albumin, α-fetoprotein, afamin, and vitamin D-binding protein. Our study demonstrated that the genes of the four albumin superfamily members have low GC content and high values of effective number of codons (ENC suggesting high expressivity of these genes and less bias in codon usage preferences. This study also provided evidence that the albumin superfamily members are not subjected to mutational selection pressure.

  14. Molecular modeling of the reductase domain to elucidate the reaction mechanism of reduction of peptidyl thioester into its corresponding alcohol in non-ribosomal peptide synthetases

    Directory of Open Access Journals (Sweden)

    Lee Gwang

    2010-01-01

    Full Text Available Abstract Background Nonribosomal peptide synthetases (NRPSs are multienzymatic, multidomain megasynthases involved in the biosynthesis of pharmaceutically important nonribosomal peptides. The peptaibol synthetase from Trichoderma virens (TPS is an important member of the NRPS family that exhibits antifungal properties. The majority of the NRPSs terminate peptide synthesis with the thioesterase (TE domain, which either hydrolyzes the thioester linkage, releasing the free peptic acid, or catalyzes the intramolecular macrocyclization to produce a macrolactone product. TPS is an important NRPS that does not encompass a TE domain, but rather a reductase domain (R domain to release the mature peptide product reductively with the aid of a NADPH cofactor. However, the catalytic mechanism of the reductase domain has not yet been elucidated. Results We present here a three-dimensional (3D model of the reductase domain based on the crystal structure of vestitone reductase (VR. VR belongs to the short-chain dehydrogenase/reductase (SDR superfamily and is responsible for the nicotinamide dinucleotide phosphate (NADPH-dependent reduction of the substrate into its corresponding secondary alcohol product. The binding sites of the probable linear substrates, alamethicin, trichotoxin, antiamoebin I, chrysopermin C and gramicidin, were identified within the modeled R domain using multiple docking approaches. The docking results of the ligand in the active site of the R domain showed that reductase side chains have a high affinity towards ligand binding, while the thioester oxygen of each substrate forms a hydrogen bond with the OH group of Tyr176 and the thiol group of the substrate is closer to the Glu220. The modeling and docking studies revealed the reaction mechanism of reduction of thioester into a primary alcohol. Conclusion Peptaibol biosynthesis incorporates a single R domain, which appears to catalyze the four-electron reduction reaction of a peptidyl

  15. Structure of Human B12 Trafficking Protein CblD Reveals Molecular Mimicry and Identifies a New Subfamily of Nitro-FMN Reductases.

    Science.gov (United States)

    Yamada, Kazuhiro; Gherasim, Carmen; Banerjee, Ruma; Koutmos, Markos

    2015-12-01

    In mammals, B12 (or cobalamin) is an essential cofactor required by methionine synthase and methylmalonyl-CoA mutase. A complex intracellular pathway supports the assimilation of cobalamin into its active cofactor forms and delivery to its target enzymes. MMADHC (the methylmalonic aciduria and homocystinuria type D protein), commonly referred to as CblD, is a key chaperone involved in intracellular cobalamin trafficking, and mutations in CblD cause methylmalonic aciduria and/or homocystinuria. Herein, we report the first crystal structure of the globular C-terminal domain of human CblD, which is sufficient for its interaction with MMADHC (the methylmalonic aciduria and homocystinuria type C protein), or CblC, and for supporting the cytoplasmic cobalamin trafficking pathway. CblD contains an α+β fold that is structurally reminiscent of the nitro-FMN reductase superfamily. Two of the closest structural relatives of CblD are CblC, a multifunctional enzyme important for cobalamin trafficking, and the activation domain of methionine synthase. CblD, CblC, and the activation domain of methionine synthase share several distinguishing features and, together with two recently described corrinoid-dependent reductive dehalogenases, constitute a new subclass within the nitro-FMN reductase superfamily. We demonstrate that CblD enhances oxidation of cob(II)alamin bound to CblC and that disease-causing mutations in CblD impair the kinetics of this reaction. The striking structural similarity of CblD to CblC, believed to be contiguous in the cobalamin trafficking pathway, suggests the co-option of molecular mimicry as a strategy for achieving its function. PMID:26364851

  16. Structure and expression of human dihydropteridine reductase

    International Nuclear Information System (INIS)

    Dihydropteridine reductase catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin and is an essential component of the pterindependent aromatic amino acid hydroxylating systems. A cDNA for human DHPR was isolated from a human liver cDNA library in the vector λgt11 using a monospecific antibody against sheep DHPR. The nucleic acid sequence and amino acid sequence of human DHPR were determined from a full-length clone. A 112 amino acid sequence of sheep DHPR was obtained by sequencing purified sheep DHPR. This sequence is highly homologous to the predicted amino acid sequence of the human protein. Gene transfer of the recombinant human DHPR into COS cells leads to expression of DHPR enzymatic activity. These results indicate that the cDNA clone identified by antibody screening is an authentic and full-length cDNA for human DHPR

  17. Nitrite Reductase Activity in Engineered Azurin Variants.

    Science.gov (United States)

    Berry, Steven M; Strange, Jacob N; Bladholm, Erika L; Khatiwada, Balabhadra; Hedstrom, Christine G; Sauer, Alexandra M

    2016-05-01

    Nitrite reductase (NiR) activity was examined in a series of dicopper P.a. azurin variants in which a surface binding copper site was added through site-directed mutagenesis. Four variants were synthesized with copper binding motifs inspired by the catalytic type 2 copper binding sites found in the native noncoupled dinuclear copper enzymes nitrite reductase and peptidylglycine α-hydroxylating monooxygenase. The four azurin variants, denoted Az-NiR, Az-NiR3His, Az-PHM, and Az-PHM3His, maintained the azurin electron transfer copper center, with the second designed copper site located over 13 Å away and consisting of mutations Asn10His,Gln14Asp,Asn16His-azurin, Asn10His,Gln14His,Asn16His-azurin, Gln8Met,Gln14His,Asn16His-azurin, and Gln8His,Gln14His,Asn16His-azurin, respectively. UV-visible absorption spectroscopy, EPR spectroscopy, and electrochemistry of the sites demonstrate copper binding as well as interaction with small exogenous ligands. The nitrite reduction activity of the variants was determined, including the catalytic Michaelis-Menten parameters. The variants showed activity (0.34-0.59 min(-1)) that was slower than that of native NiRs but comparable to that of other model systems. There were small variations in activity of the four variants that correlated with the number of histidines in the added copper site. Catalysis was found to be reversible, with nitrite produced from NO. Reactions starting with reduced azurin variants demonstrated that electrons from both copper centers were used to reduce nitrite, although steady-state catalysis required the T2 copper center and did not require the T1 center. Finally, experiments separating rates of enzyme reduction from rates of reoxidation by nitrite demonstrated that the reaction with nitrite was rate limiting during catalysis. PMID:27055058

  18. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases

    OpenAIRE

    Patrizia Cesaro; Chiara Cattaneo; Elisa Bona; Graziella Berta; Maria Cavaletto

    2015-01-01

    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5–8 were prepared in Escherichia coli...

  19. Nitrite-reductase and peroxynitrite isomerization activities of Methanosarcina acetivorans protoglobin.

    Directory of Open Access Journals (Sweden)

    Paolo Ascenzi

    Full Text Available Within the globin superfamily, protoglobins (Pgb belong phylogenetically to the same cluster of two-domain globin-coupled sensors and single-domain sensor globins. Multiple functional roles have been postulated for Methanosarcina acetivorans Pgb (Ma-Pgb, since the detoxification of reactive nitrogen and oxygen species might co-exist with enzymatic activity(ies to facilitate the conversion of CO to methane. Here, the nitrite-reductase and peroxynitrite isomerization activities of the CysE20Ser mutant of Ma-Pgb (Ma-Pgb* are reported and analyzed in parallel with those of related heme-proteins. Kinetics of nitrite-reductase activity of ferrous Ma-Pgb* (Ma-Pgb*-Fe(II is biphasic and values of the second-order rate constant for the reduction of NO2- to NO and the concomitant formation of nitrosylated Ma-Pgb*-Fe(II (Ma-Pgb*-Fe(II-NO are k(app1= 9.6 ± 0.2 M(-1 s(-1 and k(app2 = 1.2 ± 0.1 M(-1 s(-1 (at pH 7.4 and 20 °C. The k(app1 and k(app2 values increase by about one order of magnitude for each pH unit decrease, between pH 8.3 and 6.2, indicating that the reaction requires one proton. On the other hand, kinetics of peroxynitrite isomerization catalyzed by ferric Ma-Pgb* (Ma-Pgb*-Fe(III is monophasic and values of the second order rate constant for peroxynitrite isomerization by Ma-Pgb*-Fe(III and of the first order rate constant for the spontaneous conversion of peroxynitrite to nitrate are h(app = 3.8 × 10(4 M(-1 s(-1 and h0 = 2.8 × 10(-1 s(-1 (at pH 7.4 and 20 °C. The pH-dependence of hon and h0 values reflects the acid-base equilibrium of peroxynitrite (pKa = 6.7 and 6.9, respectively; at 20 °C, indicating that HOONO is the species that reacts preferentially with the heme-Fe(III atom. These results highlight the potential role of Pgbs in the biosynthesis and scavenging of reactive nitrogen and oxygen species.

  20. Investigating the Proton Donor in the NO Reductase from Paracoccus denitrificans

    Science.gov (United States)

    ter Beek, Josy; Krause, Nils; Ädelroth, Pia

    2016-01-01

    Variant nomenclature: the variants were made in the NorB subunit if not indicated by the superscript c, which are variants in the NorC subunit (e.g. E122A = exchange of Glu-122 in NorB for an Ala, E71cD; exchange of Glu-71 in NorC for an Asp). Bacterial NO reductases (NORs) are integral membrane proteins from the heme-copper oxidase superfamily. Most heme-copper oxidases are proton-pumping enzymes that reduce O2 as the last step in the respiratory chain. With electrons from cytochrome c, NO reductase (cNOR) from Paracoccus (P.) denitrificans reduces NO to N2O via the following reaction: 2NO+2e-+2H+→N2O+H2O. Although this reaction is as exergonic as O2-reduction, cNOR does not contribute to the electrochemical gradient over the membrane. This means that cNOR does not pump protons and that the protons needed for the reaction are taken from the periplasmic side of the membrane (since the electrons are donated from this side). We previously showed that the P. denitrificans cNOR uses a single defined proton pathway with residues Glu-58 and Lys-54 from the NorC subunit at the entrance. Here we further strengthened the evidence in support of this pathway. Our further aim was to define the continuation of the pathway and the immediate proton donor for the active site. To this end, we investigated the region around the calcium-binding site and both propionates of heme b3 by site directed mutagenesis. Changing single amino acids in these areas often had severe effects on cNOR function, with many variants having a perturbed active site, making detailed analysis of proton transfer properties difficult. Our data does however indicate that the calcium ligation sphere and the region around the heme b3 propionates are important for proton transfer and presumably contain the proton donor. The possible evolutionary link between the area for the immediate donor in cNOR and the proton loading site (PLS) for pumped protons in oxygen-reducing heme-copper oxidases is discussed. PMID

  1. Regulation of ribonucleotide reductase by Spd1 involves multiple mechanisms

    DEFF Research Database (Denmark)

    Nestoras, Konstantinos; Mohammed, Asma Hadi; Schreurs, Ann-Sofie; Fleck, Oliver; Watson, Adam T; Poitelea, Marius; O'Shea, Charlotte; Chahwan, Charly; Holmberg, Christian; Kragelund, Birthe B; Nielsen, Olaf; Osborne, Mark; Carr, Antony M; Liu, Cong

    2010-01-01

    The correct levels of deoxyribonucleotide triphosphates and their relative abundance are important to maintain genomic integrity. Ribonucleotide reductase (RNR) regulation is complex and multifaceted. RNR is regulated allosterically by two nucleotide-binding sites, by transcriptional control, and...

  2. Structural features of the ribonucleotide reductase of Aujeszky's disease virus.

    Science.gov (United States)

    Kaliman, A V; Boldogköi, Z; Fodor, I

    1994-01-01

    A gene construct of the Aujeszky's disease virus (ADV) genome was prepared and the DNA fragment encoding the ribonucleotide reductase was structurally characterized. We determined the entire DNA sequence of two adjacent open reading frames of the ribonucleotide reductase genes with the intergenic sequence of nine base pairs. From the sequence analysis we predict that Aujeszky's disease virus encodes a ribonucleotide reductase which comprises two polypeptides--large and small subunits, with sizes of 835 and 303 amino acids, respectively. Nucleotide and amino acid sequences of the large and small subunits of the Aujeszky's disease virus ribonucleotide reductase have been compared with that of other herpesviruses, and structural features of both proteins have been characterized. PMID:7810419

  3. Aldose reductase inhibitory activity and antioxidant capacity of pomegranate extracts

    OpenAIRE

    Karasu, Çimen; CUMAOĞLU, Ahmet; Gürpinar, Ali Rifat; Kartal, Murat; Kovacikova, Lucia; Milackova, Ivana; Stefek, Milan

    2012-01-01

    The pomegranate, Punica granatum L., has been the subject of current interest as a medicinal agent with wide-ranging therapeutic indications. In the present study, pomegranate ethanolic seed and hull extracts were tested, in comparison with a commercial sample, for the inhibition of aldose reductase, an enzyme involved in the etiology of diabetic complications. In vitro inhibition of rat lens aldose reductase was determined by a conventional method. Pomegranate ethanolic hull extract and comm...

  4. GRE2 from Scheffersomyces stipitis as an aldehyde reductase contributes tolerance to aldehyde inhibitors derived from lignocellulosic biomass.

    Science.gov (United States)

    Wang, Xu; Ma, Menggen; Liu, Z Lewis; Xiang, Quanju; Li, Xi; Liu, Na; Zhang, Xiaoping

    2016-08-01

    Scheffersomyces (Pichia) stipitis is one of the most promising yeasts for industrial bioethanol production from lignocellulosic biomass. S. stipitis is able to in situ detoxify aldehyde inhibitors (such as furfural and 5-hydroxymethylfurfural (HMF)) to less toxic corresponding alcohols. However, the reduction enzymes involved in this reaction remain largely unknown. In this study, we reported that an uncharacterized open reading frame PICST_72153 (putative GRE2) from S. stipitis was highly induced in response to furfural and HMF stresses. Overexpression of this gene in Saccharomyces cerevisiae improved yeast tolerance to furfural and HMF. GRE2 was identified as an aldehyde reductase which can reduce furfural to FM with either NADH or NADPH as the co-factor and reduce HMF to FDM with NADPH as the co-factor. This enzyme can also reduce multiple aldehydes to their corresponding alcohols. Amino acid sequence analysis indicated that it is a member of the subclass "intermediate" of the short-chain dehydrogenase/reductase (SDR) superfamily. Although GRE2 from S. stipitis is similar to GRE2 from S. cerevisiae in a three-dimensional structure, some differences were predicted. GRE2 from S. stipitis forms loops at D133-E137 and T143-N145 locations with two α-helices at E154-K157 and E252-A254 locations, different GRE2 from S. cerevisiae with an α-helix at D133-E137 and a β-sheet at T143-N145 locations, and two loops at E154-K157 and E252-A254 locations. This research provided guidelines for the study of other SDR enzymes from S. stipitis and other yeasts on tolerant mechanisms to aldehyde inhibitors derived from lignocellulosic biomass. PMID:27003269

  5. An overview on 5alpha-reductase inhibitors.

    Science.gov (United States)

    Aggarwal, Saurabh; Thareja, Suresh; Verma, Abhilasha; Bhardwaj, Tilak Raj; Kumar, Manoj

    2010-02-01

    Benign prostatic hyperplasia (BPH) is the noncancerous proliferation of the prostate gland associated with benign prostatic obstruction and lower urinary tract symptoms (LUTS) such as frequency, hesitancy, urgency, etc. Its prevalence increases with age affecting around 70% by the age of 70 years. High activity of 5alpha-reductase enzyme in humans results in excessive dihydrotestosterone levels in peripheral tissues and hence suppression of androgen action by 5alpha-reductase inhibitors is a logical treatment for BPH as they inhibit the conversion of testosterone to dihydrotestosterone. Finasteride (13) was the first steroidal 5alpha-reductase inhibitor approved by U.S. Food and Drug Administration (USFDA). In human it decreases the prostatic DHT level by 70-90% and reduces the prostatic size. Dutasteride (27) another related analogue has been approved in 2002. Unlike Finasteride, Dutasteride is a competitive inhibitor of both 5alpha-reductase type I and type II isozymes, reduced DHT levels >90% following 1 year of oral administration. A number of classes of non-steroidal inhibitors of 5alpha-reductase have also been synthesized generally by removing one or more rings from the azasteroidal structure or by an early non-steroidal lead (ONO-3805) (261). In this review all categories of inhibitors of 5alpha-reductase have been covered. PMID:19879888

  6. Electron/proton coupling in bacterial nitric oxide reductase during reduction of oxygen.

    Science.gov (United States)

    Flock, Ulrika; Watmough, Nicholas J; Adelroth, Pia

    2005-08-01

    The respiratory nitric oxide reductase (NOR) from Paracoccus denitrificans catalyzes the two-electron reduction of NO to N(2)O (2NO + 2H(+) + 2e(-) --> N(2)O + H(2)O), which is an obligatory step in the sequential reduction of nitrate to dinitrogen known as denitrification. NOR has four redox-active cofactors, namely, two low-spin hemes c and b, one high-spin heme b(3), and a non-heme iron Fe(B), and belongs to same superfamily as the oxygen-reducing heme-copper oxidases. NOR can also use oxygen as an electron acceptor; this catalytic activity was investigated in this study. We show that the product in the steady-state reduction of oxygen is water. A single turnover of the fully reduced NOR with oxygen was initiated using the flow-flash technique, and the progress of the reaction monitored by time-resolved optical absorption spectroscopy. Two major phases with time constants of 40 micros and 25 ms (pH 7.5, 1 mM O(2)) were observed. The rate constant for the faster process was dependent on the O(2) concentration and is assigned to O(2) binding to heme b(3) at a bimolecular rate constant of 2 x 10(7) M(-)(1) s(-)(1). The second phase (tau = 25 ms) involves oxidation of the low-spin hemes b and c, and is coupled to the uptake of protons from the bulk solution. The rate constant for this phase shows a pH dependence consistent with rate limitation by proton transfer from an internal group with a pK(a) = 6.6. This group is presumably an amino acid residue that is crucial for proton transfer to the catalytic site also during NO reduction. PMID:16060680

  7. Multiple gains of spliceosomal introns in a superfamily of vertebrate protease inhibitor genes

    Directory of Open Access Journals (Sweden)

    Frese Marc-André

    2009-08-01

    Full Text Available Abstract Background Intron gains reportedly are very rare during evolution of vertebrates, and the mechanisms underlying their creation are largely unknown. Previous investigations have shown that, during metazoan radiation, the exon-intron patterns of serpin superfamily genes were subject to massive changes, in contrast to many other genes. Results Here we investigated intron dynamics in the serpin superfamily in lineages pre- and postdating the split of vertebrates. Multiple intron gains were detected in a group of ray-finned fishes, once the canonical groups of vertebrate serpins had been established. In two genes, co-occurrence of non-standard introns was observed, implying that intron gains in vertebrates may even happen concomitantly or in a rapidly consecutive manner. DNA breakage/repair processes associated with genome compaction are introduced as a novel factor potentially favoring intron gain, since all non-canonical introns were found in a lineage of ray-finned fishes that experienced genomic downsizing. Conclusion Multiple intron acquisitions were identified in serpin genes of a lineage of ray-finned fishes, but not in any other vertebrates, suggesting that insertion rates for introns may be episodically increased. The co-occurrence of non-standard introns within the same gene discloses the possibility that introns may be gained simultaneously. The sequences flanking the intron insertion points correspond to the proto-splice site consensus sequence MAG↑N, previously proposed to serve as intron insertion site. The association of intron gains in the serpin superfamily with a group of fishes that underwent genome compaction may indicate that DNA breakage/repair processes might foster intron birth.

  8. FLORA: a novel method to predict protein function from structure in diverse superfamilies.

    Directory of Open Access Journals (Sweden)

    Oliver C Redfern

    2009-08-01

    Full Text Available Predicting protein function from structure remains an active area of interest, particularly for the structural genomics initiatives where a substantial number of structures are initially solved with little or no functional characterisation. Although global structure comparison methods can be used to transfer functional annotations, the relationship between fold and function is complex, particularly in functionally diverse superfamilies that have evolved through different secondary structure embellishments to a common structural core. The majority of prediction algorithms employ local templates built on known or predicted functional residues. Here, we present a novel method (FLORA that automatically generates structural motifs associated with different functional sub-families (FSGs within functionally diverse domain superfamilies. Templates are created purely on the basis of their specificity for a given FSG, and the method makes no prior prediction of functional sites, nor assumes specific physico-chemical properties of residues. FLORA is able to accurately discriminate between homologous domains with different functions and substantially outperforms (a 2-3 fold increase in coverage at low error rates popular structure comparison methods and a leading function prediction method. We benchmark FLORA on a large data set of enzyme superfamilies from all three major protein classes (alpha, beta, alphabeta and demonstrate the functional relevance of the motifs it identifies. We also provide novel predictions of enzymatic activity for a large number of structures solved by the Protein Structure Initiative. Overall, we show that FLORA is able to effectively detect functionally similar protein domain structures by purely using patterns of structural conservation of all residues.

  9. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Directory of Open Access Journals (Sweden)

    Feng-Xia Tian

    Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  10. Expanding the nitrogen regulatory protein superfamily: Homology detection at below random sequence identity.

    Science.gov (United States)

    Kinch, Lisa N; Grishin, Nick V

    2002-07-01

    Nitrogen regulatory (PII) proteins are signal transduction molecules involved in controlling nitrogen metabolism in prokaryots. PII proteins integrate the signals of intracellular nitrogen and carbon status into the control of enzymes involved in nitrogen assimilation. Using elaborate sequence similarity detection schemes, we show that five clusters of orthologs (COGs) and several small divergent protein groups belong to the PII superfamily and predict their structure to be a (betaalphabeta)(2) ferredoxin-like fold. Proteins from the newly emerged PII superfamily are present in all major phylogenetic lineages. The PII homologs are quite diverse, with below random (as low as 1%) pairwise sequence identities between some members of distant groups. Despite this sequence diversity, evidence suggests that the different subfamilies retain the PII trimeric structure important for ligand-binding site formation and maintain a conservation of conservations at residue positions important for PII function. Because most of the orthologous groups within the PII superfamily are composed entirely of hypothetical proteins, our remote homology-based structure prediction provides the only information about them. Analogous to structural genomics efforts, such prediction gives clues to the biological roles of these proteins and allows us to hypothesize about locations of functional sites on model structures or rationalize about available experimental information. For instance, conserved residues in one of the families map in close proximity to each other on PII structure, allowing for a possible metal-binding site in the proteins coded by the locus known to affect sensitivity to divalent metal ions. Presented analysis pushes the limits of sequence similarity searches and exemplifies one of the extreme cases of reliable sequence-based structure prediction. In conjunction with structural genomics efforts to shed light on protein function, our strategies make it possible to detect

  11. Structure of the periplasmic adaptor protein from a major facilitator superfamily (MFS) multidrug efflux pump

    OpenAIRE

    Hinchliffe, Philip; Greene, Nicholas P.; Paterson, Neil G.; Crow, Allister; Hughes, Colin; Koronakis, Vassilis

    2014-01-01

    Periplasmic adaptor proteins are key components of bacterial tripartite efflux pumps. The 2.85 Å resolution structure of an MFS (major facilitator superfamily) pump adaptor, Aquifex aeolicus EmrA, shows linearly arranged α-helical coiled-coil, lipoyl, and β-barrel domains, but lacks the fourth membrane-proximal domain shown in other pumps to interact with the inner membrane transporter. The adaptor α-hairpin, which binds outer membrane TolC, is exceptionally long at 127 Å, and the β-barrel co...

  12. Polymorphic Variants of LIGHT (TNF Superfamily-14) Alter Receptor Avidity and Bioavailability1

    OpenAIRE

    Cheung, Timothy C.; Coppieters, Ken; Sanjo, Hideki; Oborne, Lisa M.; Norris, Paula S.; Coddington, Amy; Granger, Steven W.; Elewaut, Dirk; Ware, Carl F.

    2010-01-01

    The TNF superfamily member, LIGHT (TNFSF14) is a key cytokine that activates T cells and dendritic cells, and is implicated as a mediator of inflammatory, metabolic and malignant diseases. LIGHT engages the Lymphotoxin-β receptor (LTβR) and herpesvirus entry mediator (HVEM, TNFRSF14), but is competitively limited in activating these receptors by soluble decoy receptor-3 (DcR3, TNFRSF6B). Two variants in the human LIGHT alter the protein at E214K (rs344560) in the receptor-binding domain and S...

  13. General survey of hAT transposon superfamily with highlight on hobo element in Drosophila.

    Science.gov (United States)

    Ladevèze, Véronique; Chaminade, Nicole; Lemeunier, Françoise; Periquet, Georges; Aulard, Sylvie

    2012-09-01

    The hAT transposons, very abundant in all kingdoms, have a common evolutionary origin probably predating the plant-fungi-animal divergence. In this paper we present their general characteristics. Members of this superfamily belong to Class II transposable elements. hAT elements share transposase, short terminal inverted repeats and eight base-pairs duplication of genomic target. We focus on hAT elements in Drosophila, especially hobo. Its distribution, dynamics and impact on genome restructuring in laboratory strains as well as in natural populations are reported. Finally, the evolutionary history of hAT elements, their domestication and use as transgenic tools are discussed. PMID:23111927

  14. Giant mini-clusters as possible origin of halo phenomena observed in super-families

    Science.gov (United States)

    1985-01-01

    Among 91 mini-clusters from 30 high energy Chiron-type families in Chacaltaya emulsion chambers, there were observed several extremely large multiplicity clusters in the highest energy range, far beyond the average of ordinary type clusters. Some details of microscopic observation of those giant mini-clusters in nuclear emulsion plates and some phenomenological regularity found in common among them are described. Such giant mini-clusters are possible candidates for the origin of narrow symmetric single halo phenomena in X-ray films which are frequently observed in super-families of visible energy greater than 1,000 TeV.

  15. Binding of Fidarestat Stereoisomers with Aldose Reductase

    Directory of Open Access Journals (Sweden)

    Dae-Sil Lee

    2006-11-01

    Full Text Available The stereospecificity in binding to aldose reductase (ALR2 of two fidarestat {6-fluoro-2',5'-dioxospiro[chroman-4,4'-imidazolidine]-2-carboxamide} stereoisomers [(2S,4Sand (2R,4S] has been investigated by means of molecular dynamics simulations using freeenergy integration techniques. The difference in the free energy of binding was found to be2.0 ± 1.7 kJ/mol in favour of the (2S,4S-form, in agreement with the experimentalinhibition data. The relative mobilities of the fidarestats complexed with ALR2 indicate alarger entropic penalty for hydrophobic binding of (2R,4S-fidarestat compared to (2S,4S-fidarestat, partially explaining its lower binding affinity. The two stereoisomers differmainly in the orientation of the carbamoyl moiety with respect to the active site and rotationof the bond joining the carbamoyl substituent to the ring. The detailed structural andenergetic insights obtained from out simulations allow for a better understanding of thefactors determining stereospecific inhibitor-ALR2 binding in the EPF charges model.

  16. Aldose reductase inhibitory compounds from Xanthium strumarium.

    Science.gov (United States)

    Yoon, Ha Na; Lee, Min Young; Kim, Jin-Kyu; Suh, Hong-Won; Lim, Soon Sung

    2013-09-01

    As part of our ongoing search for natural sources of therapeutic and preventive agents for diabetic complications, we evaluated the inhibitory effects of components of the fruit of Xanthium strumarium (X. strumarium) on aldose reductase (AR) and galactitol formation in rat lenses with high levels of glucose. To identify the bioactive components of X. strumarium, 7 caffeoylquinic acids and 3 phenolic compounds were isolated and their chemical structures were elucidated on the basis of spectroscopic evidence and comparison with published data. The abilities of 10 X. strumarium-derived components to counteract diabetic complications were investigated by means of inhibitory assays with rat lens AR (rAR) and recombinant human AR (rhAR). From the 10 isolated compounds, methyl-3,5-di-O-caffeoylquinate showed the most potent inhibition, with IC₅₀ values of 0.30 and 0.67 μM for rAR and rhAR, respectively. In the kinetic analyses using Lineweaver-Burk plots of 1/velocity and 1/substrate, methyl-3,5-di-O-caffeoylquinate showed competitive inhibition of rhAR. Furthermore, methyl-3,5-di-O-caffeoylquinate inhibited galactitol formation in the rat lens and in erythrocytes incubated with a high concentration of glucose, indicating that this compound may be effective in preventing diabetic complications. PMID:23604720

  17. Aldose reductase mediates retinal microglia activation.

    Science.gov (United States)

    Chang, Kun-Che; Shieh, Biehuoy; Petrash, J Mark

    2016-04-29

    Retinal microglia (RMG) are one of the major immune cells in charge of surveillance of inflammatory responses in the eye. In the absence of an inflammatory stimulus, RMG reside predominately in the ganglion layer and inner or outer plexiform layers. However, under stress RMG become activated and migrate into the inner nuclear layer (INL) or outer nuclear layer (ONL). Activated RMG in cell culture secrete pro-inflammatory cytokines in a manner sensitive to downregulation by aldose reductase inhibitors. In this study, we utilized CX3CR1(GFP) mice carrying AR mutant alleles to evaluate the role of AR on RMG activation and migration in vivo. When tested on an AR(WT) background, IP injection of LPS induced RMG activation and migration into the INL and ONL. However, this phenomenon was largely prevented by AR inhibitors or in AR null mice, or was exacerbated in transgenic mice that over-express AR. LPS-induced increases in ocular levels of TNF-α and CX3CL-1 in WT mice were substantially lower in AR null mice or were reduced by AR inhibitor treatment. These studies demonstrate that AR expression in RMG may contribute to the proinflammatory phenotypes common to various eye diseases such as uveitis and diabetic retinopathy. PMID:27033597

  18. Biochemical and structural characterization of Pseudomonas aeruginosa Bfd and FPR: ferredoxin NADP+ reductase and not ferredoxin is the redox partner of heme oxygenase under iron-starvation conditions.

    Science.gov (United States)

    Wang, An; Zeng, Yuhong; Han, Huijong; Weeratunga, Saroja; Morgan, Bailey N; Moënne-Loccoz, Pierre; Schönbrunn, Ernst; Rivera, Mario

    2007-10-30

    Among the 118 genes upregulated by Pseudomonas aeruginosa in response to iron starvation [Ochsner, U. A., Wilderman, P. J., Vasil, A. I., and Vasil, M. L. (2002) Mol. Microbiol. 45, 1277-1287], we focused on the products of the two genes encoding electron transfer proteins, as a means of identifying the redox partners of the heme oxygenase (pa-HO) expressed under low-iron stress conditions. Biochemical and spectroscopic investigations demonstrated that the bfd gene encodes a 73-amino acid protein (pa-Bfd) that incorporates a [2Fe-2S]2+/+ center, whereas the fpr gene encodes a 258-residue NADPH-dependent ferredoxin reductase (pa-FPR) that utilizes FAD as a cofactor. In vitro reconstitution of pa-HO catalytic activity with the newly characterized proteins led to the surprising observation that pa-FPR efficiently supports the catalytic cycle of pa-HO, without the need of a ferredoxin. In comparison, electron transfer from pa-Bfd to pa-HO is sluggish, which strongly argues against the possibility that the seven electrons needed by pa-HO to degrade biliverdin are transferred from NADPH to pa-HO in a ferredoxin (Bfd)-dependent manner. Given that pa-HO functions to release iron from exogenous heme acquired under iron-starvation conditions, the use of a flavoenzyme rather than an iron-sulfur center-containing protein to support heme degradation is an efficient use of resources in the cell. The crystal structure of pa-FPR (1.6 A resolution) showed that its fold is comparable that of the superfamily of ferredoxin reductases and most similar to the structure of Azotobacter vinelandii FPR and Escherichia coli flavodoxin reductase. The latter two enzymes interact with distinct redox partners, a ferredoxin and a flavodoxin, respectively. Hence, findings reported herein extend the range of redox partners recognized by the fold of pa-FPR to include a heme oxygenase (pa-HO). PMID:17915950

  19. Transcripts of Anthocyanidin Reductase and Leucoanthocyanidin Reductase and Measurement of Catechin and Epicatechin in Tartary Buckwheat

    Directory of Open Access Journals (Sweden)

    Yeon Bok Kim

    2014-01-01

    Full Text Available Anthocyanidin reductase (ANR and leucoanthocyanidin reductase (LAR play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions.

  20. Equine 5α-reductase activity and expression in epididymis.

    Science.gov (United States)

    Corbin, C J; Legacki, E L; Ball, B A; Scoggin, K E; Stanley, S D; Conley, A J

    2016-10-01

    The 5α-reductase enzymes play an important role during male sexual differentiation, and in pregnant females, especially equine species where maintenance relies on 5α-reduced progesterone, 5α-dihydroprogesterone (DHP). Epididymis expresses 5α-reductases but was not studied elaborately in horses. Epididymis from younger and older postpubertal stallions was divided into caput, corpus and cauda and examined for 5α-reductase activity and expression of type 1 and 2 isoforms by quantitative real-time polymerase chain reaction (qPCR). Metabolism of progesterone and testosterone to DHP and dihydrotestosterone (DHT), respectively, by epididymal microsomal protein was examined by thin-layer chromatography and verified by liquid chromatography tandem mass spectrometry (LC-MS/MS). Relative inhibitory potencies of finasteride and dutasteride toward equine 5α-reductase activity were investigated. Pregnenolone was investigated as an additional potential substrate for 5α-reductase, suggested previously from in vivo studies in mares but never directly examined. No regional gradient of 5α-reductase expression was observed by either enzyme activity or transcript analysis. Results of PCR experiments suggested that type 1 isoform predominates in equine epididymis. Primers for the type 2 isoform were unable to amplify product from any samples examined. Progesterone and testosterone were readily reduced to DHP and DHT, and activity was effectively inhibited by both inhibitors. Using epididymis as an enzyme source, no experimental evidence was obtained supporting the notion that pregnenolone could be directly metabolized by equine 5α-reductases as has been suggested by previous investigators speculating on alternative metabolic pathways leading to DHP synthesis in placenta during equine pregnancies. PMID:27466384

  1. The Anabaena sensory rhodopsin transducer defines a novel superfamily of prokaryotic small-molecule binding domains

    Directory of Open Access Journals (Sweden)

    De Souza Robson F

    2009-08-01

    Full Text Available Abstract The Anabaena sensory rhodopsin transducer (ASRT is a small protein that has been claimed to function as a signaling molecule downstream of the cyanobacterial sensory rhodopsin. However, orthologs of ASRT have been detected in several bacteria that lack rhodopsin, raising questions about the generality of this function. Using sequence profile searches we show that ASRT defines a novel superfamily of β-sandwich fold domains. Through contextual inference based on domain architectures and predicted operons and structural analysis we present strong evidence that these domains bind small molecules, most probably sugars. We propose that the intracellular versions like ASRT probably participate as sensors that regulate a diverse range of sugar metabolism operons or even the light sensory behavior in Anabaena by binding sugars or related metabolites. We also show that one of the extracellular versions define a predicted sugar-binding structure in a novel cell-surface lipoprotein found across actinobacteria, including several pathogens such as Tropheryma, Actinomyces and Thermobifida. The analysis of this superfamily also provides new data to investigate the evolution of carbohydrate binding modes in β-sandwich domains with very different topologies. Reviewers: This article was reviewed by M. Madan Babu and Mark A. Ragan.

  2. Characterizations of Two Bacterial Persulfide Dioxygenases of the Metallo-β-lactamase Superfamily.

    Science.gov (United States)

    Sattler, Steven A; Wang, Xia; Lewis, Kevin M; DeHan, Preston J; Park, Chung-Min; Xin, Yufeng; Liu, Honglei; Xian, Ming; Xun, Luying; Kang, ChulHee

    2015-07-31

    Persulfide dioxygenases (PDOs), also known as sulfur dioxygenases (SDOs), oxidize glutathione persulfide (GSSH) to sulfite and GSH. PDOs belong to the metallo-β-lactamase superfamily and play critical roles in animals, plants, and microorganisms, including sulfide detoxification. The structures of two PDOs from human and Arabidopsis thaliana have been reported; however, little is known about the substrate binding and catalytic mechanism. The crystal structures of two bacterial PDOs from Pseudomonas putida and Myxococcus xanthus were determined at 1.5- and 2.5-Å resolution, respectively. The structures of both PDOs were homodimers, and their metal centers and β-lactamase folds were superimposable with those of related enzymes, especially the glyoxalases II. The PDOs share similar Fe(II) coordination and a secondary coordination sphere-based hydrogen bond network that is absent in glyoxalases II, in which the corresponding residues are involved instead in coordinating a second metal ion. The crystal structure of the complex between the Pseudomonas PDO and GSH also reveals the similarity of substrate binding between it and glyoxalases II. Further analysis implicates an identical mode of substrate binding by known PDOs. Thus, the data not only reveal the differences in metal binding and coordination between the dioxygenases and the hydrolytic enzymes in the metallo-β-lactamase superfamily, but also provide detailed information on substrate binding by PDOs. PMID:26082492

  3. Structural basis for amino acid export by DMT superfamily transporter YddG.

    Science.gov (United States)

    Tsuchiya, Hirotoshi; Doki, Shintaro; Takemoto, Mizuki; Ikuta, Tatsuya; Higuchi, Takashi; Fukui, Keita; Usuda, Yoshihiro; Tabuchi, Eri; Nagatoishi, Satoru; Tsumoto, Kouhei; Nishizawa, Tomohiro; Ito, Koichi; Dohmae, Naoshi; Ishitani, Ryuichiro; Nureki, Osamu

    2016-06-16

    The drug/metabolite transporter (DMT) superfamily is a large group of membrane transporters ubiquitously found in eukaryotes, bacteria and archaea, and includes exporters for a remarkably wide range of substrates, such as toxic compounds and metabolites. YddG is a bacterial DMT protein that expels aromatic amino acids and exogenous toxic compounds, thereby contributing to cellular homeostasis. Here we present structural and functional analyses of YddG. Using liposome-based analyses, we show that Escherichia coli and Starkeya novella YddG export various amino acids. The crystal structure of S. novella YddG at 2.4 Å resolution reveals a new membrane transporter topology, with ten transmembrane segments in an outward-facing state. The overall structure is basket-shaped, with a large substrate-binding cavity at the centre of the molecule, and is composed of inverted structural repeats related by two-fold pseudo-symmetry. On the basis of this intramolecular symmetry, we propose a structural model for the inward-facing state and a mechanism of the conformational change for substrate transport, which we confirmed by biochemical analyses. These findings provide a structural basis for the mechanism of transport of DMT superfamily proteins. PMID:27281193

  4. Evolutionary Pattern of N-Glycosylation Sequon Numbers  in Eukaryotic ABC Protein Superfamilies

    Directory of Open Access Journals (Sweden)

    R. Shyama Prasad Rao

    2010-02-01

    Full Text Available Many proteins contain a large number of NXS/T sequences (where X is any amino acid except proline which are the potential sites of asparagine (N linked glycosylation. However, the patterns of occurrence of these N-glycosylation sequons in related proteins or groups of proteins and their underlying causes have largely been unexplored. We computed the actual and probabilistic occurrence of NXS/T sequons in ABC protein superfamilies from eight diverse eukaryotic organisms. The ABC proteins contained significantly higher NXS/T sequon numbers compared to respective genome-wide average, but the sequon density was significantly lower owing to the increase in protein size and decrease in sequon specific amino acids. However, mammalian ABC proteins have significantly higher sequon density, and both serine and threonine containing sequons (NXS and NXT have been positively selected—against the recent findings of only threonine specific Darwinian selection of sequons in proteins. The occurrence of sequons was positively correlated with the frequency of sequon specific amino acids and negatively correlated with proline and the NPS/T sequences. Further, the NPS/T sequences were significantly higher than expected in plant ABC proteins which have the lowest number of NXS/T sequons. Accord- ingly, compared to overall proteins, N-glycosylation sequons in ABC protein superfamilies have a distinct pattern of occurrence, and the results are discussed in an evolutionary perspective.

  5. Novel insights into the function of the conserved domain of the CAP superfamily of proteins

    Directory of Open Access Journals (Sweden)

    Nick K. Olrichs

    2016-04-01

    Full Text Available Members of the Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 proteins (CAP superfamily are found in a remarkable variety of biological species. The presence of a highly conserved CAP domain defines the CAP family members, which in many cases is linked to other functional protein domains. As a result, this superfamily of proteins is involved in a large variety of biological processes such as reproduction, tumor suppression, and immune regulation. The role of the CAP domain and its conserved structure throughout evolution in relation to the diverse functions of CAP proteins is, however, poorly understood. Recent studies on the mammalian Golgi-Associated plant Pathogenesis Related protein 1 (GAPR-1, which consists almost exclusively of a CAP domain, may shed new light on the function of the CAP domain. GAPR-1 was shown to form amyloid fibrils but also to possess anti-amyloidogenic properties against other amyloid forming peptides. Amyloid prediction analysis reveals the presence of potentially amyloidogenic sequences within the highly conserved sequence motifs of the CAP domain. This review will address the structural properties of GAPR-1 in combination with existing knowledge on CAP protein structure-function relationships. We propose that the CAP domain is a structural domain, which can regulate protein-protein interactions of CAP family members using its amyloidogenic properties.

  6. Invited review: Mechanisms of GTP hydrolysis and conformational transitions in the dynamin superfamily.

    Science.gov (United States)

    Daumke, Oliver; Praefcke, Gerrit J K

    2016-08-01

    Dynamin superfamily proteins are multidomain mechano-chemical GTPases which are implicated in nucleotide-dependent membrane remodeling events. A prominent feature of these proteins is their assembly- stimulated mechanism of GTP hydrolysis. The molecular basis for this reaction has been initially clarified for the dynamin-related guanylate binding protein 1 (GBP1) and involves the transient dimerization of the GTPase domains in a parallel head-to-head fashion. A catalytic arginine finger from the phosphate binding (P-) loop is repositioned toward the nucleotide of the same molecule to stabilize the transition state of GTP hydrolysis. Dynamin uses a related dimerization-dependent mechanism, but instead of the catalytic arginine, a monovalent cation is involved in catalysis. Still another variation of the GTP hydrolysis mechanism has been revealed for the dynamin-like Irga6 which bears a glycine at the corresponding position in the P-loop. Here, we highlight conserved and divergent features of GTP hydrolysis in dynamin superfamily proteins and show how nucleotide binding and hydrolysis are converted into mechano-chemical movements. We also describe models how the energy of GTP hydrolysis can be harnessed for diverse membrane remodeling events, such as membrane fission or fusion. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 580-593, 2016. PMID:27062152

  7. Insights into ascorbate regeneration in plants: investigating the redox and structural properties of dehydroascorbate reductases from Populus trichocarpa.

    Science.gov (United States)

    Lallement, Pierre-Alexandre; Roret, Thomas; Tsan, Pascale; Gualberto, José M; Girardet, Jean-Michel; Didierjean, Claude; Rouhier, Nicolas; Hecker, Arnaud

    2016-03-15

    Dehydroascorbate reductases (DHARs), enzymes belonging to the GST superfamily, catalyse the GSH-dependent reduction of dehydroascorbate into ascorbate in plants. By maintaining a reduced ascorbate pool, they notably participate to H2O2 detoxification catalysed by ascorbate peroxidases (APXs). Despite this central role, the catalytic mechanism used by DHARs is still not well understood and there is no supportive 3D structure. In this context, we have performed a thorough biochemical and structural analysis of the three poplar DHARs and coupled this to the analysis of their transcript expression patterns and subcellular localizations. The transcripts for these genes are mainly detected in reproductive and green organs and the corresponding proteins are expressed in plastids, in the cytosol and in the nucleus, but not in mitochondria and peroxisomes where ascorbate regeneration is obviously necessary. Comparing the kinetic properties and the sensitivity to GSSG-mediated oxidation of DHAR2 and DHAR3A, exhibiting 1 or 3 cysteinyl residues respectively, we observed that the presence of additional cysteines in DHAR3A modifies the regeneration mechanism of the catalytic cysteine by forming different redox states. Finally, from the 3D structure of DHAR3A solved by NMR, we were able to map the residues important for the binding of both substrates (GSH and DHA), showing that DHAR active site is very selective for DHA recognition and providing further insights into the catalytic mechanism and the roles of the additional cysteines found in some DHARs. PMID:26699905

  8. The role of biliverdin reductase in colorectal cancer

    International Nuclear Information System (INIS)

    In recent years, the effects of biliverdin and bilirubin have been studied extensively, and an inhibitory effect of bile pigments in cancer progression has been proposed. In this study we focused on the effects of biliverdin reductase, the enzyme that converts biliverdin to bilirubin, in colorectal cancer. For in vitro experiments we used a human colorectal carcinoma cell line and transfected it with an expression construct of shRNA specific for biliverdin reductase, to create cells with stable knock-down of enzyme expression. Cell proliferation was analyzed using the CASY model TT cell counting device. Western blot protein analysis was performed to study intracellular signaling cascades. Samples of human colorectal cancer were analyzed using immunohistochemistry. We were able to confirm the antiproliferative effects of bile pigments on cancer cells in vitro. However, this effect was attenuated in biliverdin reductase knock down cells. ERK and Akt activation seen under biliverdin and bilirubin treatment was also reduced in biliverdin reductase deficient cells. Immunohistochemical analysis of tumor samples from patients with colorectal cancer showed elevated biliverdin reductase levels. High enzyme expression was associated with lower overall and disease free patient survival. We conclude that BVR is required for bile pigment mediated effects regarding cancer cell proliferation and modulation of intracellular signaling cascades. The role of BVR overexpression in vivo and its exact influence on cancer progression and patient survival need to be further investigated. (author)

  9. CD177: A member of the Ly-6 gene superfamily involved with neutrophil proliferation and polycythemia vera

    OpenAIRE

    Bettinotti Maria; Caruccio Lorraine; Stroncek David F

    2004-01-01

    Abstract Genes in the Leukocyte Antigen 6 (Ly-6) superfamily encode glycosyl-phosphatidylinositol (GPI) anchored glycoproteins (gp) with conserved domains of 70 to 100 amino acids and 8 to 10 cysteine residues. Murine Ly-6 genes encode important lymphocyte and hematopoietic stem cell antigens. Recently, a new member of the human Ly-6 gene superfamily has been described, CD177. CD177 is polymorphic and has at least two alleles, PRV-1 and NB1. CD177 was first described as PRV-1, a gene that is ...

  10. Follicle-restricted compartmentalization of transforming growth factor beta superfamily ligands in the feline ovary.

    Science.gov (United States)

    Bristol, Sarah K; Woodruff, Teresa K

    2004-03-01

    Ovarian follicular development, follicle selection, and the process of ovulation remain poorly understood in most species. Throughout reproductive life, follicle fate is balanced between growth and apoptosis. These opposing forces are controlled by numerous endocrine, paracrine, and autocrine factors, including the ligands represented by the transforming growth factor beta (TGFbeta) superfamily. TGFbeta, activin, inhibin, bone morphometric protein (BMP), and growth differentiation factor 9 (GDF-9) are present in the ovary of many animals; however, no comprehensive analysis of the localization of each ligand or its receptors and intracellular signaling molecules during folliculogenesis has been done. The domestic cat is an ideal model for studying ovarian follicle dynamics due to an abundance of all follicle populations, including primordial stage, and the amount of readily available tissue following routine animal spaying. Additionally, knowledge of the factors involved in feline follicular development could make an important impact on in vitro maturation/in vitro fertilization (IVM/IVF) success for endangered feline species. Thus, the presence and position of TGFbeta superfamily members within the feline ovary have been evaluated in all stages of follicular development by immunolocalization. The cat inhibin alpha subunit protein is present in all follicle stages but increases in intensity within the mural granulosa cells in large antral follicles. The inhibin betaA and betaB subunit proteins, in addition to the activin type I (ActRIB) and activin type II receptor (ActRIIB), are produced in primordial and primary follicle granulosa cells. Additionally, inhibin betaA subunit is detected in the theca cells from secondary through large antral follicle size classes. GDF-9 is restricted to the oocyte of preantral and antral follicles, whereas the type II BMP receptor (BMP-RII) protein is predominantly localized to primordial- and primary-stage follicles. TGFbeta1, 2

  11. Ensembler: Enabling High-Throughput Molecular Simulations at the Superfamily Scale.

    Directory of Open Access Journals (Sweden)

    Daniel L Parton

    2016-06-01

    Full Text Available The rapidly expanding body of available genomic and protein structural data provides a rich resource for understanding protein dynamics with biomolecular simulation. While computational infrastructure has grown rapidly, simulations on an omics scale are not yet widespread, primarily because software infrastructure to enable simulations at this scale has not kept pace. It should now be possible to study protein dynamics across entire (superfamilies, exploiting both available structural biology data and conformational similarities across homologous proteins. Here, we present a new tool for enabling high-throughput simulation in the genomics era. Ensembler takes any set of sequences-from a single sequence to an entire superfamily-and shepherds them through various stages of modeling and refinement to produce simulation-ready structures. This includes comparative modeling to all relevant PDB structures (which may span multiple conformational states of interest, reconstruction of missing loops, addition of missing atoms, culling of nearly identical structures, assignment of appropriate protonation states, solvation in explicit solvent, and refinement and filtering with molecular simulation to ensure stable simulation. The output of this pipeline is an ensemble of structures ready for subsequent molecular simulations using computer clusters, supercomputers, or distributed computing projects like Folding@home. Ensembler thus automates much of the time-consuming process of preparing protein models suitable for simulation, while allowing scalability up to entire superfamilies. A particular advantage of this approach can be found in the construction of kinetic models of conformational dynamics-such as Markov state models (MSMs-which benefit from a diverse array of initial configurations that span the accessible conformational states to aid sampling. We demonstrate the power of this approach by constructing models for all catalytic domains in the human

  12. Ensembler: Enabling High-Throughput Molecular Simulations at the Superfamily Scale.

    Science.gov (United States)

    Parton, Daniel L; Grinaway, Patrick B; Hanson, Sonya M; Beauchamp, Kyle A; Chodera, John D

    2016-06-01

    The rapidly expanding body of available genomic and protein structural data provides a rich resource for understanding protein dynamics with biomolecular simulation. While computational infrastructure has grown rapidly, simulations on an omics scale are not yet widespread, primarily because software infrastructure to enable simulations at this scale has not kept pace. It should now be possible to study protein dynamics across entire (super)families, exploiting both available structural biology data and conformational similarities across homologous proteins. Here, we present a new tool for enabling high-throughput simulation in the genomics era. Ensembler takes any set of sequences-from a single sequence to an entire superfamily-and shepherds them through various stages of modeling and refinement to produce simulation-ready structures. This includes comparative modeling to all relevant PDB structures (which may span multiple conformational states of interest), reconstruction of missing loops, addition of missing atoms, culling of nearly identical structures, assignment of appropriate protonation states, solvation in explicit solvent, and refinement and filtering with molecular simulation to ensure stable simulation. The output of this pipeline is an ensemble of structures ready for subsequent molecular simulations using computer clusters, supercomputers, or distributed computing projects like Folding@home. Ensembler thus automates much of the time-consuming process of preparing protein models suitable for simulation, while allowing scalability up to entire superfamilies. A particular advantage of this approach can be found in the construction of kinetic models of conformational dynamics-such as Markov state models (MSMs)-which benefit from a diverse array of initial configurations that span the accessible conformational states to aid sampling. We demonstrate the power of this approach by constructing models for all catalytic domains in the human tyrosine kinase

  13. Evolution of Enzymatic Activities in the Enolase Superfamily: L-Fuconate Dehydratase from Xanthomonas campestris

    Energy Technology Data Exchange (ETDEWEB)

    Yew,W.; Fedorov, A.; Fedorov, E.; Rakus, J.; Pierce, R.; Almo, S.; Gerlt, J.

    2006-01-01

    Many members of the mechanistically diverse enolase superfamily have unknown functions. In this report the authors use both genome (operon) context and screening of a library of acid sugars to assign the L-fuconate dehydratase (FucD) function to a member of the mandelate racemase (MR) subgroup of the superfamily encoded by the Xanthomonas campestris pv. campestris str. ATCC 33913 genome (GI: 21233491). Orthologues of FucD are found in both bacteria and eukaryotes, the latter including the rTS beta protein in Homo sapiens that has been implicated in regulating thymidylate synthase activity. As suggested by sequence alignments and confirmed by high-resolution structures in the presence of active site ligands, FucD and MR share the same active site motif of functional groups: three carboxylate ligands for the essential Mg2+ located at the ends of th third, fourth, and fifth-strands in the (/)7-barrel domain (Asp 248, Glu 274, and Glu 301, respectively), a Lys-x-Lys motif at the end of the second-strand (Lys 218 and Lys 220), a His-Asp dyad at the end of the seventh and sixth-strands (His 351 and Asp 324, respectively), and a Glue at the end of the eighth-strand (Glu 382). The mechanism of the FucD reaction involves initial abstraction of the 2-proton by Lys 220, acid catalysis of the vinylogous-elimination of the 3-OH group by His 351, and stereospecific ketonization of the resulting 2-keto-3-deoxy-L-fuconate product. Screening of the library of acid sugars revealed substrate and functional promiscuity: In addition to L-fuconate, FucD also catalyzes the dehydration of L-galactonate, D-arabinonate, D-altronate, L-talonate, and D-ribonate. The dehydrations of L-fuconate, L-galactonate, and D-arabinonate are initiated by abstraction of the 2-protons by Lys 220. The dehydrations of L-talonate and D-ribonate are initiated by abstraction of the 2-protons by His 351; however, protonation of the enediolate intermediates by the conjugate acid of Lys 220 yields L

  14. Intramolecular electron transfer in Pseudomonas aeruginosa cd(1) nitrite reductase

    DEFF Research Database (Denmark)

    Farver, Ole; Brunori, Maurizio; Cutruzzolà, Francesca;

    2009-01-01

    The cd(1) nitrite reductases, which catalyze the reduction of nitrite to nitric oxide, are homodimers of 60 kDa subunits, each containing one heme-c and one heme-d(1). Heme-c is the electron entry site, whereas heme-d(1) constitutes the catalytic center. The 3D structure of Pseudomonas aeruginosa...... nitrite reductase has been determined in both fully oxidized and reduced states. Intramolecular electron transfer (ET), between c and d(1) hemes is an essential step in the catalytic cycle. In earlier studies of the Pseudomonas stutzeri enzyme, we observed that a marked negative cooperativity is...... controlling this internal ET step. In this study we have investigated the internal ET in the wild-type and His369Ala mutant of P. aeruginosa nitrite reductases and have observed similar cooperativity to that of the Pseudomonas stutzeri enzyme. Heme-c was initially reduced, in an essentially diffusion...

  15. Expression and site-directed mutagenesis of human dihydrofolate reductase

    International Nuclear Information System (INIS)

    A procaryotic high-level expression vector for human dihydrofolate reductase has been constructed and the protein characterized as a first step toward structure-function studies of this enzyme. A vector bearing the tac promoter, four synthetic oligodeoxynucleotides, and a restriction fragment from the dihydrofolate reductase cDNA were ligated in a manner which optimized the transcriptional and translational frequency of the enzyme mRNA. The reductase, comprising ca. 17% of the total soluble protein in the host bacteria, was purified to apparent homogeneity as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and characterized by amino acid composition, partial amino acid sequence, and steady-sate kinetic analysis. This expression vector has been used as a template for double-stranded plasmid DNA site-specific mutagenesis. Functional studies on a Cys-6 → Ser-6 mutant enzyme support the contention that Cys-6 is obligatory for organomercurial activation of human dihydrofolate reductase. The Ser-6 mutant enzyme was not activated to any extent following a 24-h incubation with p-(hydroxymercuri)benzoate and nicotinamide adenine dinucleotide phosphate (reduced) (NADPH), whereas the k/sub cat/ for Cys-6 reductase increased 2-fold under identical conditions. The specific activities of the Cys-6 and Ser-6 enzymes were virtually identical as determined by methotrexate titration as were the K/sub m/ values for both dihydrofolate and NADPH. The Ser-6 mutant showed a decreased temperature stability and was more sensitive to inactivation by α-chymotrypsin when compared to the wild-type enzyme. These results suggest that the Ser-6 mutant reductase is conformationally altered relative to the Cys-6 native enzyme

  16. Effect of vanadium on nitrate reductase activity in tomato leaves

    OpenAIRE

    J. Buczek

    2015-01-01

    The activity of nitrate reductase in cell-free extracts from tomato leaves is completely inhibited by 100 μM NaVO3 or VOCl2. In experiments in vivo vanadium ions inhibit the activity of the enzyme in 50 to 60 per cent. Addition of l mM vanadium to the medium on which tomato seedlings are grown causes after 24 h almost complete inhibition of nitrate reductase activity in cell-free extracts of the enzyme. Inhibition with vanadium may be abolished in experiments in vitro if the extract is treate...

  17. The intramolecular electron transfer between copper sites of nitrite reductase

    DEFF Research Database (Denmark)

    Farver, O; Eady, R R; Abraham, Z H;

    1998-01-01

    The intramolecular electron transfer (ET) between the type 1 Cu(I) and the type 2 Cu(II) sites of Alcaligenes xylosoxidans dissimilatory nitrite reductase (AxNiR) has been studied in order to compare it with the analogous process taking place in ascorbate oxidase (AO). This internal process is......(I) and the trinuclear copper centre in ascorbate oxidase, and the characteristics of the internal ET processes of these enzymes are compared. The data are consistent with the faster ET observed in nitrite reductase arising from a more advantageous entropy of activation when compared with ascorbate...

  18. Structure of the periplasmic adaptor protein from a major facilitator superfamily (MFS) multidrug efflux pump.

    Science.gov (United States)

    Hinchliffe, Philip; Greene, Nicholas P; Paterson, Neil G; Crow, Allister; Hughes, Colin; Koronakis, Vassilis

    2014-08-25

    Periplasmic adaptor proteins are key components of bacterial tripartite efflux pumps. The 2.85 Å resolution structure of an MFS (major facilitator superfamily) pump adaptor, Aquifex aeolicus EmrA, shows linearly arranged α-helical coiled-coil, lipoyl, and β-barrel domains, but lacks the fourth membrane-proximal domain shown in other pumps to interact with the inner membrane transporter. The adaptor α-hairpin, which binds outer membrane TolC, is exceptionally long at 127 Å, and the β-barrel contains a conserved disordered loop. The structure extends the view of adaptors as flexible, modular components that mediate diverse pump assembly, and suggests that in MFS tripartite pumps a hexamer of adaptors could provide a periplasmic seal. PMID:24996185

  19. Characterization of putative multidrug resistance transporters of the major facilitator-superfamily expressed in Salmonella Typhi

    DEFF Research Database (Denmark)

    Shaheen, Aqsa; Ismat, Fouzia; Iqbal, Mazhar;

    2015-01-01

    Multidrug resistance mediated by efflux pumps is a well-known phenomenon in infectious bacteria. Although much work has been carried out to characterize multidrug efflux pumps in Gram-negative and Gram-positive bacteria, such information is still lacking for many deadly pathogens. The aim of this...... study was to gain insight into the substrate specificity of previously uncharacterized transporters of Salmonella Typhi to identify their role in the development of multidrug resistance. S. Typhi genes encoding putative members of the major facilitator superfamily were cloned and expressed in the drug......-hypersensitive Escherichia coli strain KAM42, and tested for transport of 25 antibacterial compounds, including representative antibiotics of various classes, antiseptics, dyes and detergents. Of the 15 tested putative transporters, STY0901, STY2458 and STY4874 exhibited a drug-resistance phenotype. Among these, STY4874...

  20. Effect of New O-Superfamily Conotoxin on Voltage-Activated Currents of Hippocampal Neurons

    Institute of Scientific and Technical Information of China (English)

    李湛; 何湘平; 戴秋云; 黄培堂; 谢佐平

    2004-01-01

    The effects of a new O-superfamily conotoxin, SO3, on sodium current (/Na), transient A-type potassium currents (/A), and delayed rectified potassium currents (/K), were examined in cultured rat hippocampal neurons using the whole-cell patch clamp technique. Addition of SO3 caused a concentration-dependent,rapidly developing, and reversible inhibition of voltage-activated currents. The IC50 values for the blockage of /Na, /A, and /K were calculated as 0.49, 33.9, and 7.6 μmol/L, respectively. The determined Hill coefficients were 1.7, 0.6, and 1.2, respectively. These results indicate that SO3 can selectively inhibit neuronal sodium and potassium currents.

  1. Artificial electron donors for nitrate and nitrite reductases usable as mediators in amperometric biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Strehlitz, B. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany)); Gruendig, B. (Institut fuer Chemo- und Biosensorik, Muenster-Roxel (Germany)); Vorlop, K.D. (Bundesforschungsanstalt fuer Landwirtschaft, Braunschweig (Germany). Inst. fuer Technologie); Bartholmes, P. (Witten-Herdecke Univ., Witten (Germany). Inst. fuer Biochemie); Kotte, H. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany)); Stottmeister, U. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany))

    1994-07-01

    Various nitrate and nitrite reductases are capable of accepting electrons from artificial donors. Combining these redox active donors with an amperometric redox electrode which is covered with an immobilized layer of such a nitrate or nitrite reductase, new enzyme sensors can be created for the detection of nitrate or nitrite, respectively. A range of suitable electron donors for nitrate reductases and nitrite reductase from different sources have been selected and characterized by electrochemical methods. (orig.)

  2. Evolutionary history and stress regulation of the lectin superfamily in higher plants

    Directory of Open Access Journals (Sweden)

    Ramachandran Srinivasan

    2010-03-01

    Full Text Available Abstract Background Lectins are a class of carbohydrate-binding proteins. They play roles in various biological processes. However, little is known about their evolutionary history and their functions in plant stress regulation. The availability of full genome sequences from various plant species makes it possible to perform a whole-genome exploration for further understanding their biological functions. Results Higher plant genomes encode large numbers of lectin proteins. Based on their domain structures and phylogenetic analyses, a new classification system has been proposed. In this system, 12 different families have been classified and four of them consist of recently identified plant lectin members. Further analyses show that some of lectin families exhibit species-specific expansion and rapid birth-and-death evolution. Tandem and segmental duplications have been regarded as the major mechanisms to drive lectin expansion although retrogenes also significantly contributed to the birth of new lectin genes in soybean and rice. Evidence shows that lectin genes have been involved in biotic/abiotic stress regulations and tandem/segmental duplications may be regarded as drivers for plants to adapt various environmental stresses through duplication followed by expression divergence. Each member of this gene superfamily may play specialized roles in a specific stress condition and function as a regulator of various environmental factors such as cold, drought and high salinity as well as biotic stresses. Conclusions Our studies provide a new outline of the plant lectin gene superfamily and advance the understanding of plant lectin genes in lineage-specific expansion and their functions in biotic/abiotic stress-related developmental processes.

  3. The structure of hookworm platelet inhibitor (HPI), a CAP superfamily member from Ancylostoma caninum.

    Science.gov (United States)

    Ma, Dongying; Francischetti, Ivo M B; Ribeiro, Jose M C; Andersen, John F

    2015-06-01

    Secreted protein components of hookworm species include a number of representatives of the cysteine-rich/antigen 5/pathogenesis-related 1 (CAP) protein family known as Ancylostoma-secreted proteins (ASPs). Some of these have been considered as candidate antigens for the development of vaccines against hookworms. The functions of most CAP superfamily members are poorly understood, but one form, the hookworm platelet inhibitor (HPI), has been isolated as a putative antagonist of the platelet integrins αIIbβ3 and α2β1. Here, the crystal structure of HPI is described and its structural features are examined in relation to its possible function. The HPI structure is similar to those of other ASPs and shows incomplete conservation of the sequence motifs CAP1 and CAP2 that are considered to be diagnostic of CAP superfamily members. The asymmetric unit of the HPI crystal contains a dimer with an extensive interaction interface, but chromatographic measurements indicate that it is primarily monomeric in solution. In the dimeric structure, the putative active-site cleft areas from both monomers are united into a single negatively charged depression. A potential Lys-Gly-Asp disintegrin-like motif was identified in the sequence of HPI, but is not positioned at the apex of a tight turn, making it unlikely that it interacts with the integrin. Recombinant HPI produced in Escherichia coli was found not to inhibit the adhesion of human platelets to collagen or fibrinogen, despite having a native structure as shown by X-ray diffraction. This result corroborates previous analyses of recombinant HPI and suggests that it might require post-translational modification or have a different biological function. PMID:26057788

  4. Homology between O-linked GlcNAc transferases and proteins of the glycogen phosphorylase superfamily.

    Science.gov (United States)

    Wrabl, J O; Grishin, N V

    2001-11-30

    The O-linked GlcNAc transferases (OGTs) are a recently characterized group of largely eukaryotic enzymes that add a single beta-N-acetylglucosamine moiety to specific serine or threonine hydroxyls. In humans, this process may be part of a sugar regulation mechanism or cellular signaling pathway that is involved in many important diseases, such as diabetes, cancer, and neurodegeneration. However, no structural information about the human OGT exists, except for the identification of tetratricopeptide repeats (TPR) at the N terminus. The locations of substrate binding sites are unknown and the structural basis for this enzyme's function is not clear. Here, remote homology is reported between the OGTs and a large group of diverse sugar processing enzymes, including proteins with known structure such as glycogen phosphorylase, UDP-GlcNAc 2-epimerase, and the glycosyl transferase MurG. This relationship, in conjunction with amino acid similarity spanning the entire length of the sequence, implies that the fold of the human OGT consists of two Rossmann-like domains C-terminal to the TPR region. A conserved motif in the second Rossmann domain points to the UDP-GlcNAc donor binding site. This conclusion is supported by a combination of statistically significant PSI-BLAST hits, consensus secondary structure predictions, and a fold recognition hit to MurG. Additionally, iterative PSI-BLAST database searches reveal that proteins homologous to the OGTs form a large and diverse superfamily that is termed GPGTF (glycogen phosphorylase/glycosyl transferase). Up to one-third of the 51 functional families in the CAZY database, a glycosyl transferase classification scheme based on catalytic residue and sequence homology considerations, can be unified through this common predicted fold. GPGTF homologs constitute a substantial fraction of known proteins: 0.4% of all non-redundant sequences and about 1% of proteins in the Escherichia coli genome are found to belong to the GPGTF

  5. Inhibition of Albendazole and Oxfendazole on the Activity of Fumaric Reductase in Cysticercus cellulosae

    Institute of Scientific and Technical Information of China (English)

    GAO Xue-jun; LI Qing-zhang; LI Xia

    2004-01-01

    The activity of fumaric reductase in Cysticercus cellulosae tissue homogenate with albendazole and oxfendazole individually was detected. Results showed that the two kinds of drugs both could inhabite the activity of fumaric reductase. The results indicate that the mechanism of action of benzimidazole carbamate drugs is probably inhabiting the complex of fumaric reductase noncompetently, thus lead to the exhaostion of energy and death.

  6. Cloning, crystallization and preliminary X-ray study of XC1258, a CN-hydrolase superfamily protein from Xanthomonas campestris

    International Nuclear Information System (INIS)

    A CN-hydrolase superfamily protein from the plant pathogen X. campestris has been overexpressed in E. coli, purified and crystallized. CN-hydrolase superfamily proteins are involved in a wide variety of non-peptide carbon–nitrogen hydrolysis reactions, producing some important natural products such as auxin, biotin, precursors of antibiotics etc. These reactions all involve attack on a cyano or carbonyl carbon by a conserved novel catalytic triad Glu-Lys-Cys through a thiol acylenzyme intermediate. However, classification into the CN-hydrolase superfamily based on sequence similarity alone is not straightforward and further structural data are necessary to improve this categorization. Here, the cloning, expression, crystallization and preliminary X-ray analysis of XC1258, a CN-hydrolase superfamily protein from the plant pathogen Xanthomonas campestris (Xcc), are reported. The SeMet-substituted XC1258 crystals diffracted to a resolution of 1.73 Å. They are orthorhombic and belong to space group P21212, with unit-cell parameters a = 143.8, b = 154.63, c = 51.3 Å, respectively

  7. The Glutathione-S-Transferase, Cytochrome P450 and Carboxyl/Cholinesterase Gene Superfamilies in Predatory Mite Metaseiulus occidentalis

    Science.gov (United States)

    Hoy, Marjorie A.

    2016-01-01

    Pesticide-resistant populations of the predatory mite Metaseiulus (= Typhlodromus or Galendromus) occidentalis (Arthropoda: Chelicerata: Acari: Phytoseiidae) have been used in the biological control of pest mites such as phytophagous Tetranychus urticae. However, the pesticide resistance mechanisms in M. occidentalis remain largely unknown. In other arthropods, members of the glutathione-S-transferase (GST), cytochrome P450 (CYP) and carboxyl/cholinesterase (CCE) gene superfamilies are involved in the diverse biological pathways such as the metabolism of xenobiotics (e.g. pesticides) in addition to hormonal and chemosensory processes. In the current study, we report the identification and initial characterization of 123 genes in the GST, CYP and CCE superfamilies in the recently sequenced M. occidentalis genome. The gene count represents a reduction of 35% compared to T. urticae. The distribution of genes in the GST and CCE superfamilies in M. occidentalis differs significantly from those of insects and resembles that of T. urticae. Specifically, we report the presence of the Mu class GSTs, and the J’ and J” clade CCEs that, within the Arthropoda, appear unique to Acari. Interestingly, the majority of CCEs in the J’ and J” clades contain a catalytic triad, suggesting that they are catalytically active. They likely represent two Acari-specific CCE clades that may participate in detoxification of xenobiotics. The current study of genes in these superfamilies provides preliminary insights into the potential molecular components that may be involved in pesticide metabolism as well as hormonal/chemosensory processes in the agriculturally important M. occidentalis. PMID:27467523

  8. The extracellular Leucine-Rich Repeat superfamily; a comparative survey and analysis of evolutionary relationships and expression patterns

    OpenAIRE

    Miller Suzanne FC; Okafuji Tatsuya; O'Keeffe Sean; Hokamp Karsten; Alsbury Samantha; Walshe Karen; Dolan Jackie; Tear Guy; Mitchell Kevin J

    2009-01-01

    Abstract Correction to Dolan J, Walshe K, Alsbury S, Hokamp K, O'Keeffe S, Okafuji T, Miller SF, Tear G, Mitchell KJ: The extracellular leucine-rich repeat superfamily; a comparative survey and analysis of evolutionary relationships and expression patterns. BMC Genomics 2007, 8:320.

  9. The extracellular Leucine-Rich Repeat superfamily; a comparative survey and analysis of evolutionary relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    Miller Suzanne FC

    2009-05-01

    Full Text Available Abstract Correction to Dolan J, Walshe K, Alsbury S, Hokamp K, O'Keeffe S, Okafuji T, Miller SF, Tear G, Mitchell KJ: The extracellular leucine-rich repeat superfamily; a comparative survey and analysis of evolutionary relationships and expression patterns. BMC Genomics 2007, 8:320.

  10. Sepiapterin reductase deficiency an autosomal recessive DOPA-responsive dystonia

    NARCIS (Netherlands)

    N.G. Abeling; M. Duran; H.D. Bakker; L. Stroomer; B. Thony; N. Blau; J. Booij; B.T. Poll-The

    2006-01-01

    The diagnosis of a 14-year-old girl with a new homoallelic mutation in the sepiapterin reductase (SR) gene is reported. Initially she presented at the age of 2 with hypotonia and mild cognitive developmental delay, and was diagnosed as having mild methylmalonic aciduria, which was recently identifie

  11. Thioredoxin and NADP-thioredoxin reductase from cultured carrot cells

    Science.gov (United States)

    Johnson, T. C.; Cao, R. Q.; Kung, J. E.; Buchanan, B. B.

    1987-01-01

    Dark-grown carrot (Daucus carota L.) tissue cultures were found to contain both protein components of the NADP/thioredoxin system--NADP-thioredoxin reductase and the thioredoxin characteristic of heterotrophic systems, thioredoxin h. Thioredoxin h was purified to apparent homogeneity and, like typical bacterial counterparts, was a 12-kdalton (kDa) acidic protein capable of activating chloroplast NADP-malate dehydrogenase (EC 1.1.1.82) more effectively than fructose-1,6-bisphosphatase (EC 3.1.3.11). NADP-thioredoxin reductase (EC 1.6.4.5) was partially purified and found to be an arsenite-sensitive enzyme composed of two 34-kDa subunits. Carrot NADP-thioredoxin reductase resembled more closely its counterpart from bacteria rather than animal cells in acceptor (thioredoxin) specificity. Upon greening of the cells, the content of NADP-thioredoxin-reductase activity, and, to a lesser extent, thioredoxin h decreased. The results confirm the presence of a heterotrophic-type thioredoxin system in plant cells and raise the question of its physiological function.

  12. Bidirectional catalysis by copper-containing nitrite reductase

    NARCIS (Netherlands)

    Wijma, HJ; Canters, GW; de Vries, S; Verbeet, MP

    2004-01-01

    The copper-containing nitrite reductase from Alcaligenes faecalis S-6 was found to catalyze the oxidation of nitric oxide to nitrite, the reverse of its physiological reaction. Thermodynamic and kinetic constants with the physiological electron donor pseudoazurin were determined for both directions

  13. Thioredoxin reductase from s. Coelicolor as a drug target

    Czech Academy of Sciences Publication Activity Database

    Koháryová, M.; Brynda, Jiří; Řezáčová, Pavlína; Kollárová, M.

    2015-01-01

    Roč. 282, Suppl 1 (2015), s. 396. ISSN 1742-464X. [Congress of the Federation of European Biochemical Societies (FEBS) - The Biochemical Basis of Life /40./. 04.07.2015-09.07.2015, Berlin] Institutional support: RVO:61388963 ; RVO:68378050 Keywords : thioredoxin reductase * protein structure * drugs Subject RIV: CE - Biochemistry

  14. Isolation and expression of the Pneumocystis carinii dihydrofolate reductase gene

    DEFF Research Database (Denmark)

    Edman, J C; Edman, U; Cao, Mi-Mi;

    1989-01-01

    Pneumocystis carinii dihydrofolate reductase (DHFR; 5,6,7,8-tetrahydrofolate: NADP+ oxidoreductase, EC 1.5.1.3) cDNA sequences have been isolated by their ability to confer trimethoprim resistance to Escherichia coli. Consistent with the recent conclusion that P. carinii is a member of the Fungi...

  15. Fatty Acyl-CoA Reductase 1 Deficiency

    Directory of Open Access Journals (Sweden)

    Charles N Swisher

    2015-01-01

    Full Text Available Investigators from Erlangen, Germany; Calgary, CA; and Kafranbel, Syria, identified mutations in the gene, fatty acyl-CoA reductase 1 (FAR1 deficiency, adding to three other genes involved in plasmalogen biosynthesis, in two families affected by severe intellectual disability, early-onset epilepsy, microcephaly, congenital cataracts, growth retardation, and spasticity.

  16. Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases and their relationship to isoflavone reductases

    Science.gov (United States)

    Min, Tongpil; Kasahara, Hiroyuki; Bedgar, Diana L.; Youn, Buhyun; Lawrence, Paulraj K.; Gang, David R.; Halls, Steven C.; Park, HaJeung; Hilsenbeck, Jacqueline L.; Davin, Laurence B.; Lewis, Norman G.; Kang, ChulHee

    2003-01-01

    Despite the importance of plant lignans and isoflavonoids in human health protection (e.g. for both treatment and prevention of onset of various cancers) as well as in plant biology (e.g. in defense functions and in heartwood development), systematic studies on the enzymes involved in their biosynthesis have only recently begun. In this investigation, three NADPH-dependent aromatic alcohol reductases were comprehensively studied, namely pinoresinol-lariciresinol reductase (PLR), phenylcoumaran benzylic ether reductase (PCBER), and isoflavone reductase (IFR), which are involved in central steps to the various important bioactive lignans and isoflavonoids. Of particular interest was in determining how differing regio- and enantiospecificities are achieved with the different enzymes, despite each apparently going through similar enone intermediates. Initially, the three-dimensional x-ray crystal structures of both PLR_Tp1 and PCBER_Pt1 were solved and refined to 2.5 and 2.2 A resolutions, respectively. Not only do they share high gene sequence similarity, but their structures are similar, having a continuous alpha/beta NADPH-binding domain and a smaller substrate-binding domain. IFR (whose crystal structure is not yet obtained) was also compared (modeled) with PLR and PCBER and was deduced to have the same overall basic structure. The basis for the distinct enantio-specific and regio-specific reactions of PCBER, PLR, and IFR, as well as the reaction mechanism and participating residues involved (as identified by site-directed mutagenesis), are discussed.

  17. Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Xiang, D.; Xu, C; Kumaran, D; Brown, A; Sauder, M; Burley, S; Swaminathan, S; Raushel, F

    2009-01-01

    Two proteins from the amidohydrolase superfamily of enzymes were cloned, expressed, and purified to homogeneity. The first protein, Cc0300, was from Caulobacter crescentus CB-15 (Cc0300), while the second one (Sgx9355e) was derived from an environmental DNA sequence originally isolated from the Sargasso Sea (gi|44371129). The catalytic functions and the substrate profiles for the two enzymes were determined with the aid of combinatorial dipeptide libraries. Both enzymes were shown to catalyze the hydrolysis of l-Xaa-l-Xaa dipeptides in which the amino acid at the N-terminus was relatively unimportant. These enzymes were specific for hydrophobic amino acids at the C-terminus. With Cc0300, substrates terminating in isoleucine, leucine, phenylalanine, tyrosine, valine, methionine, and tryptophan were hydrolyzed. The same specificity was observed with Sgx9355e, but this protein was also able to hydrolyze peptides terminating in threonine. Both enzymes were able to hydrolyze N-acetyl and N-formyl derivatives of the hydrophobic amino acids and tripeptides. The best substrates identified for Cc0300 were l-Ala-l-Leu with kcat and kcat/Km values of 37 s-1 and 1.1 x 105 M-1 s-1, respectively, and N-formyl-l-Tyr with kcat and kcat/Km values of 33 s-1 and 3.9 x 105 M-1 s-1, respectively. The best substrate identified for Sgx9355e was l-Ala-l-Phe with kcat and kcat/Km values of 0.41 s-1 and 5.8 x 103 M-1 s-1. The three-dimensional structure of Sgx9355e was determined to a resolution of 2.33 Angstroms with l-methionine bound in the active site. The a-carboxylate of the methionine is ion-paired to His-237 and also hydrogen bonded to the backbone amide groups of Val-201 and Leu-202. The a-amino group of the bound methionine interacts with Asp-328. The structural determinants for substrate recognition were identified and compared with other enzymes in this superfamily that hydrolyze dipeptides with different specificities.

  18. The Role of Immunoglobulin Superfamily Cell Adhesion Molecules in Cancer Metastasis

    Directory of Open Access Journals (Sweden)

    Chee Wai Wong

    2012-01-01

    Full Text Available Metastasis is a major clinical problem and results in a poor prognosis for most cancers. The metastatic pathway describes the process by which cancer cells give rise to a metastatic lesion in a new tissue or organ. It consists of interconnecting steps all of which must be successfully completed to result in a metastasis. Cell-cell adhesion is a key aspect of many of these steps. Adhesion molecules belonging to the immunoglobulin superfamily (Ig-SF commonly play a central role in cell-cell adhesion, and a number of these molecules have been associated with cancer progression and a metastatic phenotype. Surprisingly, the contribution of Ig-SF members to metastasis has not received the attention afforded other cell adhesion molecules (CAMs such as the integrins. Here we examine the steps in the metastatic pathway focusing on how the Ig-SF members, melanoma cell adhesion molecule (MCAM, L1CAM, neural CAM (NCAM, leukocyte CAM (ALCAM, intercellular CAM-1 (ICAM-1 and platelet endothelial CAM-1 (PECAM-1 could play a role. Although much remains to be understood, this review aims to raise the profile of Ig-SF members in metastasis formation and prompt further research that could lead to useful clinical outcomes.

  19. Evolution of the B3 DNA binding superfamily: new insights into REM family gene diversification.

    Directory of Open Access Journals (Sweden)

    Elisson A C Romanel

    Full Text Available BACKGROUND: The B3 DNA binding domain includes five families: auxin response factor (ARF, abscisic acid-insensitive3 (ABI3, high level expression of sugar inducible (HSI, related to ABI3/VP1 (RAV and reproductive meristem (REM. The release of the complete genomes of the angiosperm eudicots Arabidopsis thaliana and Populus trichocarpa, the monocot Orysa sativa, the bryophyte Physcomitrella patens,the green algae Chlamydomonas reinhardtii and Volvox carteri and the red algae Cyanidioschyzon melorae provided an exceptional opportunity to study the evolution of this superfamily. METHODOLOGY: In order to better understand the origin and the diversification of B3 domains in plants, we combined comparative phylogenetic analysis with exon/intron structure and duplication events. In addition, we investigated the conservation and divergence of the B3 domain during the origin and evolution of each family. CONCLUSIONS: Our data indicate that showed that the B3 containing genes have undergone extensive duplication events, and that the REM family B3 domain has a highly diverged DNA binding. Our results also indicate that the founding member of the B3 gene family is likely to be similar to the ABI3/HSI genes found in C. reinhardtii and V. carteri. Among the B3 families, ABI3, HSI, RAV and ARF are most structurally conserved, whereas the REM family has experienced a rapid divergence. These results are discussed in light of their functional and evolutionary roles in plant development.

  20. DUF538 protein superfamily is predicted to be chlorophyll hydrolyzing enzymes in plants.

    Science.gov (United States)

    Gholizadeh, Ashraf

    2016-01-01

    The possible hydrolytic activity towards chlorophyll molecules was predicted for DUF538 protein superfamily in plants. It was examined by using computational as well as experimental tools including in vitro chlorophyll degradation, antioxidant compounds production and in vivo real-time gene expression tests. Comparison of the computational data with the experimental results indicated that DUF538 proteins might be chlorophyll hydrolyzing enzyme (most probably carboxyesterase) which degrade chlorophyll molecules (66 % per 12 hrs) to produce new compounds (1.8 fold per 12 hrs) with antioxidant properties. The relevance of DUF538 gene expression level with the chlorophyll contents (2.8 fold increase per chlorophyll content of 50 %) of the drought-stressed leaves showed that chlorophyll degradation by DUF538 is most probably induced in response to stress stimuli. Despite membranous chlorophyll catabolic pathways, DUF538-dependent reactions is predicted to be occurred in the cytosol of the under stressed plants. We addressed as to whether chlorophyll breakdown to antioxidant compounds by DUF538 is a defense mechanism of plants against stress stimuli, in vivo? This question is going to be investigated in our next research project. PMID:27186021

  1. New species and records of mites of the superfamily Sarcoptoidea (Acariformes: Psoroptidia) from mammals in Brazil.

    Science.gov (United States)

    Bochkov, Andre V; Valim, Michel P

    2016-01-01

    Sixteen species of the superfamily Sarcoptoidea (Acariformes: Psoroptidia) belonging to 10 genera of the families Atopomelidae, Listrophoridae, Chirodiscidae, and Listropsoralgidae are recorded in Brazil. Among them, three species, Prolistrophorus hylaeamys sp. nov. from Hylaeamys laticeps (Lund, 1840) (Cricetidae: Sigmodontinae) from Minas Gerais, Lynxacarus serrafreirei sp. nov. from Galictis cuja (Molina, 1782) (Carnivora: Mustelidae) from Rio de Janeiro (Listrophoridae), and Didelphoecius micoureus sp. nov. (Atopomelidae) from Micoureus paraguayanus (Tate, 1931) (Didelphimorphia: Didelphidae) from Minas Gerais are described as new for science. Three species of the family Listrophoridae, Prolistrophorus bidentatus Fain et Lukoschus, 1984 from Akodon cursor (Winge, 1887) (Rodentia: Cricetidae) (new host), Prolistrophorus ctenomys Fain, 1970 from Ctenomys torquatus Lichtenstein, 1830 (Rodentia: Ctenomyidae) (new host), and Leporacarus sylvilagi Fain, Whitaker et Lukoschus, 1981 from Sylvilagus brasiliensis (Linnaeus, 1758) (Lagomorpha: Leporidae) (new host) -from Minas Gerais and Rio Grande do Sul, and one species of the family Chirodiscidae, Parakosa tadarida McDaniel and Lawrence, 1962 from Molossus molossus (Pallas, 1766) (Chiroptera: Molossidae) are recorded for the first time in Brazil. The previously unknown female of Didelphoecius validus Fain, Zanatta-Coutinho et Fonseca, 1996 (Atopomelidae) from Metachirus nudicaudatus (Geoffroy, 1803) (Didelphimorphia: Didelphidae) from Minas Gerais is described. All data on host-parasite associations of sarcoptoids in Brazil are summarized. Totally, 61 sarcoptoid species of 8 families are recorded in Brazil. PMID:26751869

  2. Phylogenetic relationships among hadal amphipods of the Superfamily Lysianassoidea: Implications for taxonomy and biogeography

    Science.gov (United States)

    Ritchie, H.; Jamieson, A. J.; Piertney, S. B.

    2015-11-01

    Amphipods of the superfamily Lysianassoidea are ubiquitous at hadal depths (>6000 m) and therefore are an ideal model group for investigating levels of endemism and the drivers of speciation in deep ocean trenches. The taxonomic classification of hadal amphipods is typically based on conventional morphological traits but it has been suggested that convergent evolution, phenotypic plasticity, intra-specific variability and ontogenetic variation may obscure the ability to robustly diagnose taxa and define species. Here we use phylogenetic analysis of DNA sequence variation at two mitochondrial (COI and 16S rDNA) and one nuclear (18S rDNA) regions at to examine the evolutionary relationships among 25 putative amphipod species representing 14 genera and 11 families that were sampled from across seven hadal trenches. We identify several instances where species, genera and families do not resolve monophyletic clades, highlighting incongruence between the current taxonomic classification and the molecular phylogeny for this group. Our data also help extend and resolve the known biogeographic distributions for the different species, such as identifying the co-occurrence of Hirondellea dubia and Hirondellea gigas in the Mariana trench.

  3. The Janus kinase family and signaling through members of the cytokine receptor superfamily

    Energy Technology Data Exchange (ETDEWEB)

    Ihle, J.N. [St. Jude Children`s Research Hospital, Memphis, TN (United States)

    1994-12-31

    Many cytokines initiate cellular responses through their interaction with members of the cytokine receptor superfamily which contain no catalytic domains in their cytoplasmic domains. Irrespective, ligand binding induces tyrosine phosphorylation, which requires a membrane proximal region of the cytoplasmic domain. Recent studies have shown that members of the Janus kinase (JAK) family of protein tyrosine kinases associate with the membrane proximal region, are rapidly tyrosine phosphorylated following ligand binding and their in vitro kinase activity is activated. The JAKs are 130-kDa proteins which lack SH2/SH3 domains and contain two kinase domains, an active domain and a second kinase-like domain. Individual receptors associate with, or require, one or more of the three known family members including JAK1, JAK2, and tyk2. Substrates of the JAKs include the 91-kDa and 113-kDa proteins of the interferon-stimulated transcription complex ISGF3. These proteins, when tyrosine phosphorylated, migrate to the nucleus and participate in the activation of gene transcription. Recent evidence suggests that the 91- and 113-kDa proteins are members of a large family of genes that are potential substrates of JAK family members and may regulate a variety of genes involved in cell growth, differentiation or function. 42 refs.

  4. Relative Stabilities of Conserved and Non-Conserved Structures in the OB-Fold Superfamily

    Directory of Open Access Journals (Sweden)

    Andrei T. Alexandrescu

    2009-05-01

    Full Text Available The OB-fold is a diverse structure superfamily based on a β-barrel motif that is often supplemented with additional non-conserved secondary structures. Previous deletion mutagenesis and NMR hydrogen exchange studies of three OB-fold proteins showed that the structural stabilities of sites within the conserved β-barrels were larger than sites in non-conserved segments. In this work we examined a database of 80 representative domain structures currently classified as OB-folds, to establish the basis of this effect. Residue-specific values were obtained for the number of Cα-Cα distance contacts, sequence hydrophobicities, crystallographic B-factors, and theoretical B-factors calculated from a Gaussian Network Model. All four parameters point to a larger average flexibility for the non-conserved structures compared to the conserved β-barrels. The theoretical B-factors and contact densities show the highest sensitivity.Our results suggest a model of protein structure evolution in which novel structural features develop at the periphery of conserved motifs. Core residues are more resistant to structural changes during evolution since their substitution would disrupt a larger number of interactions. Similar factors are likely to account for the differences in stability to unfolding between conserved and non-conserved structures.

  5. Identification of the GTPase superfamily in Mycoplasma synoviae and Mycoplasma hyopneumoniae

    Directory of Open Access Journals (Sweden)

    Clayton Luiz Borges

    2007-01-01

    Full Text Available Mycoplasmas are the smallest known prokaryotes with self-replication ability. They are obligate parasites, taking up many molecules of their hosts and acting as pathogens in men, animals, birds and plants. Mycoplasma hyopneumoniae is the infective agent of swine mycoplasmosis and Mycoplasma synoviae is responsible for subclinical upper respiratory infections that may result in airsacculitis and synovitis in chickens and turkeys. These highly infectious organisms present a worldwide distribution and are responsible for major economic problems. Proteins of the GTPase superfamily occur in all domains of life, regulating functions such as protein synthesis, cell cycle and differentiation. Despite their functional diversity, all GTPases are believed to have evolved from a single common ancestor. In this work we have identified mycoplasma GTPases by searching the complete genome databases of Mycoplasma synoviae and Mycoplasma hyopneumoniae, J (non-pathogenic and 7448 (pathogenic strains. Fifteen ORFs encoding predicted GTPases were found in M. synoviae and in the two strains of M. hyopneumoniae. Searches for conserved G domains in GTPases were performed and the sequences were classified into families. The GTPase phylogenetic analysis showed that the subfamilies were well resolved into clades. The presence of GTPases in the three strains suggests the importance of GTPases in 'minimalist' genomes.

  6. The P450 superfamily: update on new sequences, gene mapping, and recommended nomenclature.

    Science.gov (United States)

    Nebert, D W; Nelson, D R; Coon, M J; Estabrook, R W; Feyereisen, R; Fujii-Kuriyama, Y; Gonzalez, F J; Guengerich, F P; Gunsalus, I C; Johnson, E F

    1991-01-01

    We provide here a list of 154 P450 genes and seven putative pseudogenes that have been characterized as of October 20, 1990. These genes have been described in a total of 23 eukaryotes (including nine mammalian and one plant species) and six prokaryotes. Of 27 gene families so far described, 10 exist in all mammals. These 10 families comprise 18 subfamilies, of which 16 and 14 have been mapped in the human and mouse genomes, respectively; to date, each subfamily appears to represent a cluster of tightly linked genes. We propose here a modest revision of the initially proposed (Nebert et al., DNA 6, 1-11, 1987) and updated (Nebert et al., DNA 8, 1-13, 1989) nomenclature system based on evolution of the superfamily. For the gene we recommend that the italicized root symbol CYP for human (Cyp for mouse), representing cytochrome P450, be followed by an Arabic number denoting the family, a letter designating the subfamily (when two or more exist), and an Arabic numeral representing the individual gene within the subfamily. A hyphen should precede the final number in mouse genes. We suggest that the human nomenclature system be used for other species. This system is consistent with our earlier proposed nomenclature for P450 of all eukaryotes and prokaryotes, except that we are discouraging the future use of cumbersome Roman numerals. PMID:1991046

  7. Function, Structure, and Evolution of the Major Facilitator Superfamily: The LacY Manifesto

    Directory of Open Access Journals (Sweden)

    M. Gregor Madej

    2014-01-01

    Full Text Available The major facilitator superfamily (MFS is a diverse group of secondary transporters with members found in all kingdoms of life. A paradigm for MFS is the lactose permease (LacY of Escherichia coli, which couples the stoichiometric translocation of a galactopyranoside and an H+ across the cytoplasmic membrane. LacY has been the test bed for the development of many methods applied for the analysis of transport proteins. X-ray structures of an inward-facing conformation and the most recent structure of an almost occluded conformation confirm many conclusions from previous studies. Although structure models are critical, they are insufficient to explain the catalysis of transport. The clues to understanding transport are based on the principles of enzyme kinetics. Secondary transport is a dynamic process—static snapshots of X-ray crystallography describe it only partially. However, without structural information, the underlying chemistry is virtually impossible to conclude. A large body of biochemical/biophysical data derived from systematic studies of site-directed mutants in LacY suggests residues critically involved in the catalysis, and a working model for the symport mechanism that involves alternating access of the binding site is presented. The general concepts derived from the bacterial LacY are examined for their relevance to other MFS transporters.

  8. Reciprocal interactions between cell adhesion molecules of the immunoglobulin superfamily and the cytoskeleton in neurons

    Directory of Open Access Journals (Sweden)

    Vladimir eSytnyk

    2016-02-01

    Full Text Available Cell adhesion molecules of the immunoglobulin superfamily (IgSF including the neural cell adhesion molecule (NCAM and members of the L1 family of neuronal cell adhesion molecules play important functions in the developing nervous system by regulating formation, growth and branching of neurites and establishment of the synaptic contacts between neurons. In the mature brain, members of IgSF regulate synapse composition, function and plasticity required for learning and memory. The intracellular domains of IgSF cell adhesion molecules interact with the components of the cytoskeleton including the submembrane actin-spectrin meshwork, actin microfilaments, and microtubules. In this review, we summarize current data indicating that interactions between IgSF cell adhesion molecules and the cytoskeleton are reciprocal, and that while IgSF cell adhesion molecules regulate the assembly of the cytoskeleton, the cytoskeleton plays an important role in regulation of the functions of IgSF cell adhesion molecules. Reciprocal interactions between NCAM and L1 family members and the cytoskeleton and their role in neuronal differentiation and synapse formation are discussed in detail.

  9. Reciprocal Interactions between Cell Adhesion Molecules of the Immunoglobulin Superfamily and the Cytoskeleton in Neurons.

    Science.gov (United States)

    Leshchyns'ka, Iryna; Sytnyk, Vladimir

    2016-01-01

    Cell adhesion molecules of the immunoglobulin superfamily (IgSF) including the neural cell adhesion molecule (NCAM) and members of the L1 family of neuronal cell adhesion molecules play important functions in the developing nervous system by regulating formation, growth and branching of neurites, and establishment of the synaptic contacts between neurons. In the mature brain, members of IgSF regulate synapse composition, function, and plasticity required for learning and memory. The intracellular domains of IgSF cell adhesion molecules interact with the components of the cytoskeleton including the submembrane actin-spectrin meshwork, actin microfilaments, and microtubules. In this review, we summarize current data indicating that interactions between IgSF cell adhesion molecules and the cytoskeleton are reciprocal, and that while IgSF cell adhesion molecules regulate the assembly of the cytoskeleton, the cytoskeleton plays an important role in regulation of the functions of IgSF cell adhesion molecules. Reciprocal interactions between NCAM and L1 family members and the cytoskeleton and their role in neuronal differentiation and synapse formation are discussed in detail. PMID:26909348

  10. Glutathione Transferases Superfamily: Cold-Inducible Expression of Distinct GST Genes in Brassica oleracea.

    Science.gov (United States)

    Vijayakumar, Harshavardhanan; Thamilarasan, Senthil Kumar; Shanmugam, Ashokraj; Natarajan, Sathishkumar; Jung, Hee-Jeong; Park, Jong-In; Kim, HyeRan; Chung, Mi-Young; Nou, Ill-Sup

    2016-01-01

    Plants, as sessile organisms, can suffer serious growth and developmental consequences under cold stress conditions. Glutathione transferases (GSTs, EC 2.5.1.18) are ubiquitous and multifunctional conjugating proteins, which play a major role in stress responses by preventing oxidative damage by reactive oxygen species (ROS). Currently, understanding of their function(s) during different biochemical and signaling pathways under cold stress condition remain unclear. In this study, using combined computational strategy, we identified 65 Brassica oleracea glutathione transferases (BoGST) and characterized them based on evolutionary analysis into 11 classes. Inter-species and intra-species duplication was evident between BoGSTs and Arabidopsis GSTs. Based on localization analyses, we propose possible pathways in which GST genes are involved during cold stress. Further, expression analysis of the predicted putative functions for GST genes were investigated in two cold contrasting genotypes (cold tolerance and susceptible) under cold condition, most of these genes were highly expressed at 6 h and 1 h in the cold tolerant (CT) and cold susceptible (CS) lines, respectively. Overall, BoGSTU19, BoGSTU24, BoGSTF10 are candidate genes highly expressed in B. oleracea. Further investigation of GST superfamily in B. oleracea will aid in understanding complex mechanism underlying cold tolerance in plants. PMID:27472324

  11. Rice phospholipase A superfamily: organization, phylogenetic and expression analysis during abiotic stresses and development.

    Directory of Open Access Journals (Sweden)

    Amarjeet Singh

    Full Text Available BACKGROUND: Phospholipase A (PLA is an important group of enzymes responsible for phospholipid hydrolysis in lipid signaling. PLAs have been implicated in abiotic stress signaling and developmental events in various plants species. Genome-wide analysis of PLA superfamily has been carried out in dicot plant Arabidopsis. A comprehensive genome-wide analysis of PLAs has not been presented yet in crop plant rice. METHODOLOGY/PRINCIPAL FINDINGS: A comprehensive bioinformatics analysis identified a total of 31 PLA encoding genes in the rice genome, which are divided into three classes; phospholipase A(1 (PLA(1, patatin like phospholipases (pPLA and low molecular weight secretory phospholipase A(2 (sPLA(2 based on their sequences and phylogeny. A subset of 10 rice PLAs exhibited chromosomal duplication, emphasizing the role of duplication in the expansion of this gene family in rice. Microarray expression profiling revealed a number of PLA members expressing differentially and significantly under abiotic stresses and reproductive development. Comparative expression analysis with Arabidopsis PLAs revealed a high degree of functional conservation between the orthologs in two plant species, which also indicated the vital role of PLAs in stress signaling and plant development across different plant species. Moreover, sub-cellular localization of a few candidates suggests their differential localization and functional role in the lipid signaling. CONCLUSION/SIGNIFICANCE: The comprehensive analysis and expression profiling would provide a critical platform for the functional characterization of the candidate PLA genes in crop plants.

  12. A superfamily of metalloenzymes unifies phosphopentomutase and cofactor-independent phosphoglycerate mutase with alkaline phosphatases and sulfatases.

    Science.gov (United States)

    Galperin, M. Y.; Bairoch, A.; Koonin, E. V.

    1998-01-01

    Sequence analysis of the probable archaeal phosphoglycerate mutase resulted in the identification of a superfamily of metalloenzymes with similar metal-binding sites and predicted conserved structural fold. This superfamily unites alkaline phosphatase, N-acetylgalactosamine-4-sulfatase, and cerebroside sulfatase, enzymes with known three-dimensional structures, with phosphopentomutase, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase, phosphoglycerol transferase, phosphonate monoesterase, streptomycin-6-phosphate phosphatase, alkaline phosphodiesterase/nucleotide pyrophosphatase PC-1, and several closely related sulfatases. In addition to the metal-binding motifs, all these enzymes contain a set of conserved amino acid residues that are likely to be required for the enzymatic activity. Mutational changes in the vicinity of these residues in several sulfatases cause mucopolysaccharidosis (Hunter, Maroteaux-Lamy, Morquio, and Sanfilippo syndromes) and metachromatic leucodystrophy. PMID:10082381

  13. Structure of TTHA1623, a novel metallo-β-lactamase superfamily protein from Thermus thermophilus HB8

    International Nuclear Information System (INIS)

    The crystal structures of TTHA1623 from T. thermophilus HB8 in an iron-bound and a zinc-bound form have been determined to 2.8 and 2.2 Å resolution, respectively. TTHA1623 is a metallo-β-lactamase superfamily protein from the extremely thermophilic bacterium Thermus thermophilus HB8. Homologues of TTHA1623 exist in a wide range of bacteria and archaea and one eukaryote, Giardia lamblia, but their function remains unknown. To analyze the structural properties of TTHA1623, the crystal structures of its iron-bound and zinc-bound forms have been determined to 2.8 and 2.2 Å resolution, respectively. TTHA1623 possesses an αββα-fold similar to that of other metallo-β-lactamase superfamily proteins with glyoxalase II-type metal coordination. However, TTHA1623 exhibits a putative substrate-binding pocket with a unique shape

  14. A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements.

    OpenAIRE

    Baes, M.; Gulick, T; Choi, H. S.; Martinoli, M G; Simha, D; Moore, D D

    1994-01-01

    We have identified and characterized a new orphan member of the nuclear hormone receptor superfamily, called MB67, which is predominantly expressed in liver. MB67 binds and transactivates the retinoic acid response elements that control expression of the retinoic acid receptor beta 2 and alcohol dehydrogenase 3 genes, both of which consist of a direct repeat hexamers related to the consensus AGGTCA, separated by 5 bp. MB67 binds these elements as a heterodimer with the 9-cis-retinoic acid rec...

  15. Tumor necrosis factor receptor superfamily costimulation couples T cell receptor signal strength to thymic regulatory T cell differentiation

    OpenAIRE

    Mahmud, Shawn A.; Manlove, Luke S.; Schmitz, Heather M.; Xing, Yan; Wang, Yanyan; Owen, David L.; Schenkel, Jason M.; Boomer, Jonathan S; Jonathan M Green; Yagita, Hideo; Chi, Hongbo; Hogquist, Kristin A.; Farrar, Michael A.

    2014-01-01

    Regulatory T (Treg) cells express tumor necrosis factor receptor superfamily (TNFRSF) members, but their role in thymic Treg development is undefined. We demonstrate that Treg progenitors highly express the TNFRSF members GITR, OX40, and TNFR2. Expression of these receptors correlates directly with T cell receptor (TCR) signal strength, and requires CD28 and the kinase TAK1. Neutralizing TNFSF ligands markedly reduced Treg development. Conversely, TNFRSF agonists enhanced Treg differentiation...

  16. Rapid Identification of Aldose Reductase Inhibitory Compounds from Perilla frutescens

    OpenAIRE

    Soon Sung Lim; Ji Hun Paek; Kuk Hyun Shin; Young-Hee Kang; Jae-Yong Lee

    2013-01-01

    The ethyl acetate (EtOAc) soluble fraction of methanol extracts of Perilla frutescens (P. frutescens) inhibits aldose reductase (AR), the key enzyme in the polyol pathway. Our investigation of inhibitory compounds from the EtOAc soluble fraction of P. frutescens was followed by identification of the inhibitory compounds by a combination of HPLC microfractionation and a 96-well enzyme assay. This allowed the biological activities to be efficiently matched with selected HPLC peaks. Structural a...

  17. Determination of plasma gluthatione reductase enzyme activity in osteoporotic women

    OpenAIRE

    Sadeghi N; Oveisi M.R.; Jannat B.; Hajimahmoodi M; Jamshidi A.R; Sajadian Z.

    2008-01-01

    Background: Osteoporosis is a disease of high prevalence with increased bone loss. Free radicals have been proved to be involved in bone resorption. Glutathione reductase (GR) plays an essential role in cell defense against reactive oxygen metabolites by sustaining the reduced status of an important antioxidant, glutathione. In the present study GR activity of plasma as an antioxidant enzyme in relation to Bone Mineral Density (BMD) was investigated.Material and Method: GR activity was measur...

  18. Glutathione reductase: solvent equilibrium and kinetic isotope effects

    International Nuclear Information System (INIS)

    Glutathione reductase catalyzes the NADPH-dependent reduction of oxidized glutathione (GSSG). The kinetic mechanism is ping-pong, and we have investigated the rate-limiting nature of proton-transfer steps in the reactions catalyzed by the spinach, yeast, and human erythrocyte glutathione reductases using a combination of alternate substrate and solvent kinetic isotope effects. With NADPH or GSSG as the variable substrate, at a fixed, saturating concentration of the other substrate, solvent kinetic isotope effects were observed on V but not V/K. Plots of Vm vs mole fraction of D2O (proton inventories) were linear in both cases for the yeast, spinach, and human erythrocyte enzymes. When solvent kinetic isotope effect studies were performed with DTNB instead of GSSG as an alternate substrate, a solvent kinetic isotope effect of 1.0 was observed. Solvent kinetic isotope effect measurements were also performed on the asymmetric disulfides GSSNB and GSSNP by using human erythrocyte glutathione reductase. The Km values for GSSNB and GSSNP were 70 microM and 13 microM, respectively, and V values were 62 and 57% of the one calculated for GSSG, respectively. Both of these substrates yield solvent kinetic isotope effects greater than 1.0 on both V and V/K and linear proton inventories, indicating that a single proton-transfer step is still rate limiting. These data are discussed in relationship to the chemical mechanism of GSSG reduction and the identity of the proton-transfer step whose rate is sensitive to solvent isotopic composition. Finally, the solvent equilibrium isotope effect measured with yeast glutathione reductase is 4.98, which allows us to calculate a fractionation factor for the thiol moiety of GSH of 0.456

  19. Internal electron transfer within mitochondrial succinate-cytochrome C reductase

    International Nuclear Information System (INIS)

    Internal electron transfer within succinate-cytochrome C reductase from pigeon breast muscle mitochondria was followed by the pulse radiolytic technique. The electron equivalent is transferred from an unknown donor to b type cytochrome(s), in a first order process with a rate constant of: 660 +- 150s-1. This process might be the rate determining step of electron transfer in mitochondria, since it is similar in rate to the turnover number of the mitochondrial respiratory chain

  20. The Association between Gene-Environment Interactions and Diseases Involving the Human GST Superfamily with SNP Variants

    Directory of Open Access Journals (Sweden)

    Antoinesha L. Hollman

    2016-03-01

    Full Text Available Exposure to environmental hazards has been associated with diseases in humans. The identification of single nucleotide polymorphisms (SNPs in human populations exposed to different environmental hazards, is vital for detecting the genetic risks of some important human diseases. Several studies in this field have been conducted on glutathione S-transferases (GSTs, a phase II detoxification superfamily, to investigate its role in the occurrence of diseases. Human GSTs consist of cytosolic and microsomal superfamilies that are further divided into subfamilies. Based on scientific search engines and a review of the literature, we have found a large amount of published articles on human GST super- and subfamilies that have greatly assisted in our efforts to examine their role in health and disease. Because of its polymorphic variations in relation to environmental hazards such as air pollutants, cigarette smoke, pesticides, heavy metals, carcinogens, pharmaceutical drugs, and xenobiotics, GST is considered as a significant biomarker. This review examines the studies on gene-environment interactions related to various diseases with respect to single nucleotide polymorphisms (SNPs found in the GST superfamily. Overall, it can be concluded that interactions between GST genes and environmental factors play an important role in human diseases.

  1. The Association between Gene-Environment Interactions and Diseases Involving the Human GST Superfamily with SNP Variants.

    Science.gov (United States)

    Hollman, Antoinesha L; Tchounwou, Paul B; Huang, Hung-Chung

    2016-04-01

    Exposure to environmental hazards has been associated with diseases in humans. The identification of single nucleotide polymorphisms (SNPs) in human populations exposed to different environmental hazards, is vital for detecting the genetic risks of some important human diseases. Several studies in this field have been conducted on glutathione S-transferases (GSTs), a phase II detoxification superfamily, to investigate its role in the occurrence of diseases. Human GSTs consist of cytosolic and microsomal superfamilies that are further divided into subfamilies. Based on scientific search engines and a review of the literature, we have found a large amount of published articles on human GST super- and subfamilies that have greatly assisted in our efforts to examine their role in health and disease. Because of its polymorphic variations in relation to environmental hazards such as air pollutants, cigarette smoke, pesticides, heavy metals, carcinogens, pharmaceutical drugs, and xenobiotics, GST is considered as a significant biomarker. This review examines the studies on gene-environment interactions related to various diseases with respect to single nucleotide polymorphisms (SNPs) found in the GST superfamily. Overall, it can be concluded that interactions between GST genes and environmental factors play an important role in human diseases. PMID:27043589

  2. The Structure of a Sugar Transporter of the Glucose EIIC Superfamily Provides Insight into the Elevator Mechanism of Membrane Transport.

    Science.gov (United States)

    McCoy, Jason G; Ren, Zhenning; Stanevich, Vitali; Lee, Jumin; Mitra, Sharmistha; Levin, Elena J; Poget, Sebastien; Quick, Matthias; Im, Wonpil; Zhou, Ming

    2016-06-01

    The phosphoenolpyruvate:carbohydrate phosphotransferase systems are found in bacteria, where they play central roles in sugar uptake and regulation of cellular uptake processes. Little is known about how the membrane-embedded components (EIICs) selectively mediate the passage of carbohydrates across the membrane. Here we report the functional characterization and 2.55-Å resolution structure of a maltose transporter, bcMalT, belonging to the glucose superfamily of EIIC transporters. bcMalT crystallized in an outward-facing occluded conformation, in contrast to the structure of another glucose superfamily EIIC, bcChbC, which crystallized in an inward-facing occluded conformation. The structures differ in the position of a structurally conserved substrate-binding domain that is suggested to play a central role in sugar transport. In addition, molecular dynamics simulations suggest a potential pathway for substrate entry from the periplasm into the bcMalT substrate-binding site. These results provide a mechanistic framework for understanding substrate recognition and translocation for the glucose superfamily EIIC transporters. PMID:27161976

  3. Phosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductase

    Science.gov (United States)

    Lay, Angelina J.; Jiang, Xing-Mai; Kisker, Oliver; Flynn, Evelyn; Underwood, Anne; Condron, Rosemary; Hogg, Philip J.

    2000-12-01

    Disulphide bonds in secreted proteins are considered to be inert because of the oxidizing nature of the extracellular milieu. An exception to this rule is a reductase secreted by tumour cells that reduces disulphide bonds in the serine proteinase plasmin. Reduction of plasmin initiates proteolytic cleavage in the kringle 5 domain and release of the tumour blood vessel inhibitor angiostatin. New blood vessel formation or angiogenesis is critical for tumour expansion and metastasis. Here we show that the plasmin reductase isolated from conditioned medium of fibrosarcoma cells is the glycolytic enzyme phosphoglycerate kinase. Recombinant phosphoglycerate kinase had the same specific activity as the fibrosarcoma-derived protein. Plasma of mice bearing fibrosarcoma tumours contained several-fold more phosphoglycerate kinase, as compared with mice without tumours. Administration of phosphoglycerate kinase to tumour-bearing mice caused an increase in plasma levels of angiostatin, and a decrease in tumour vascularity and rate of tumour growth. Our findings indicate that phosphoglycerate kinase not only functions in glycolysis but is secreted by tumour cells and participates in the angiogenic process as a disulphide reductase.

  4. Cloning and sequence of the human adrenodoxin reductase gene

    International Nuclear Information System (INIS)

    Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

  5. Identification of proteins targeted by the thioredoxin superfamily in Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Nicole Sturm

    2009-04-01

    Full Text Available The malarial parasite Plasmodium falciparum possesses a functional thioredoxin and glutathione system comprising the dithiol-containing redox proteins thioredoxin (Trx and glutaredoxin (Grx, as well as plasmoredoxin (Plrx, which is exclusively found in Plasmodium species. All three proteins belong to the thioredoxin superfamily and share a conserved Cys-X-X-Cys motif at the active site. Only a few of their target proteins, which are likely to be involved in redox reactions, are currently known. The aim of the present study was to extend our knowledge of the Trx-, Grx-, and Plrx-interactome in Plasmodium. Based on the reaction mechanism, we generated active site mutants of Trx and Grx lacking the resolving cysteine residue. These mutants were bound to affinity columns to trap target proteins from P. falciparum cell extracts after formation of intermolecular disulfide bonds. Covalently linked proteins were eluted with dithiothreitol and analyzed by mass spectrometry. For Trx and Grx, we were able to isolate 17 putatively redox-regulated proteins each. Furthermore, the approach was successfully established for Plrx, leading to the identification of 21 potential target proteins. In addition to confirming known interaction partners, we captured potential target proteins involved in various processes including protein biosynthesis, energy metabolism, and signal transduction. The identification of three enzymes involved in S-adenosylmethionine (SAM metabolism furthermore suggests that redox control is required to balance the metabolic fluxes of SAM between methyl-group transfer reactions and polyamine synthesis. To substantiate our data, the binding of the redoxins to S-adenosyl-L-homocysteine hydrolase and ornithine aminotransferase (OAT were verified using BIAcore surface plasmon resonance. In enzymatic assays, Trx was furthermore shown to enhance the activity of OAT. Our approach led to the discovery of several putatively redox-regulated proteins

  6. Up-regulation of tumor necrosis factor superfamily genes in early phases of photoreceptor degeneration.

    Directory of Open Access Journals (Sweden)

    Sem Genini

    Full Text Available We used quantitative real-time PCR to examine the expression of 112 genes related to retinal function and/or belonging to known pro-apoptotic, cell survival, and autophagy pathways during photoreceptor degeneration in three early-onset canine models of human photoreceptor degeneration, rod cone dysplasia 1 (rcd1, X-linked progressive retinal atrophy 2 (xlpra2, and early retinal degeneration (erd, caused respectively, by mutations in PDE6B, RPGRORF15, and STK38L. Notably, we found that expression and timing of differentially expressed (DE genes correlated with the cell death kinetics. Gene expression profiles of rcd1 and xlpra2 were similar; however rcd1 was more severe as demonstrated by the results of the TUNEL and ONL thickness analyses, a greater number of genes that were DE, and the identification of altered expression that occurred at earlier time points. Both diseases differed from erd, where a smaller number of genes were DE. Our studies did not highlight the potential involvement of mitochondrial or autophagy pathways, but all three diseases were accompanied by the down-regulation of photoreceptor genes, and up-regulation of several genes that belong to the TNF superfamily, the extrinsic apoptotic pathway, and pro-survival pathways. These proteins were expressed by different retinal cells, including horizontal, amacrine, ON bipolar, and Müller cells, and suggest an interplay between the dying photoreceptors and inner retinal cells. Western blot and immunohistochemistry results supported the transcriptional regulation for selected proteins. This study highlights a potential role for signaling through the extrinsic apoptotic pathway in early cell death events and suggests that retinal cells other than photoreceptors might play a primary or bystander role in the degenerative process.

  7. Functional Identification of Incorrectly Annotated Prolidases from the Amidohydrolase Superfamily of Enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Xiang, D.; Patskovsky, Y; Xu, C; Meyer, A; Sauder, J; Burley, S; Almo, S; Raushel, F

    2009-01-01

    The substrate profiles for two proteins from Caulobacter crescentus CB15 (Cc2672 and Cc3125) and one protein (Sgx9359b) derived from a DNA sequence (gi|44368820) isolated from the Sargasso Sea were determined using combinatorial libraries of dipeptides and N-acyl derivatives of amino acids. These proteins are members of the amidohydrolase superfamily and are currently misannotated in NCBI as catalyzing the hydrolysis of l-Xaa-l-Pro dipeptides. Cc2672 was shown to catalyze the hydrolysis of l-Xaa-l-Arg/Lys dipeptides and the N-acetyl and N-formyl derivatives of lysine and arginine. This enzyme will also hydrolyze longer peptides that terminate in either lysine or arginine. The N-methyl phosphonate derivative of l-lysine was a potent competitive inhibitor of Cc2672 with a Ki value of 120 nM. Cc3125 was shown to catalyze the hydrolysis of l-Xaa-l-Arg/Lys dipeptides but will not hydrolyze tripeptides or the N-formyl and N-acetyl derivatives of lysine or arginine. The substrate profile for Sgx9359b is similar to that of Cc2672 except that compounds with a C-terminal lysine are not recognized as substrates. The X-ray structure of Sgx9359b was determined to a resolution of 2.3 Angstroms. The protein folds as a (e/a)8-barrel and self-associates to form a homooctamer. The active site is composed of a binuclear metal center similar to that found in phosphotriesterase and dihydroorotase. In one crystal form, arginine was bound adventitiously to the eight active sites within the octamer. The orientation of the arginine in the active site identified the structural determinants for recognition of the a-carboxylate and the positively charged side chains of arginine-containing substrates. This information was used to identify 18 other bacterial sequences that possess identical or similar substrate profiles.

  8. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily.

    Science.gov (United States)

    Matsunaga, James; Barocchi, Michele A; Croda, Julio; Young, Tracy A; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A; Reis, Mitermayer G; Riley, Lee W; Haake, David A; Ko, Albert I

    2003-08-01

    Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudogene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019

  9. New insights into family relationships within the avian superfamily Sylvioidea (Passeriformes based on seven molecular markers

    Directory of Open Access Journals (Sweden)

    Fregin Silke

    2012-08-01

    Full Text Available Abstract Background The circumscription of the avian superfamily Sylvioidea is a matter of long ongoing debate. While the overall inclusiveness has now been mostly agreed on and 20 families recognised, the phylogenetic relationships among the families are largely unknown. We here present a phylogenetic hypothesis for Sylvioidea based on one mitochondrial and six nuclear markers, in total ~6.3 kbp, for 79 ingroup species representing all currently recognised families and some species with uncertain affinities, making this the most comprehensive analysis of this taxon. Results The resolution, especially of the deeper nodes, is much improved compared to previous studies. However, many relationships among families remain uncertain and are in need of verification. Most families themselves are very well supported based on the total data set and also by indels. Our data do not support the inclusion of Hylia in Cettiidae, but do not strongly reject a close relationship with Cettiidae either. The genera Scotocerca and Erythrocercus are closely related to Cettiidae, but separated by relatively long internodes. The families Paridae, Remizidae and Stenostiridae clustered among the outgroup taxa and not within Sylvioidea. Conclusions Although the phylogenetic position of Hylia is uncertain, we tentatively support the recognition of the family Hyliidae Bannerman, 1923 for this genus and Pholidornis. We propose new family names for the genera Scotocerca and Erythrocercus, Scotocercidae and Erythrocercidae, respectively, rather than including these in Cettiidae, and we formally propose the name Macrosphenidae, which has been in informal use for some time. We recommend that Paridae, Remizidae and Stenostiridae are not included in Sylvioidea. We also briefly discuss the problems of providing a morphological diagnosis when proposing a new family-group name (or genus-group name based on a clade.

  10. Comparative genomic analysis of mitochondrial protein-coding genes in Veneroida clams: Analysis of superfamily-specific genomic and evolutionary features.

    Science.gov (United States)

    Hwang, Jae Yeon; Lee, Chang-Kyu; Kim, Heebal; Nam, Bo-Hye; An, Cheul Min; Park, Jung Youn; Park, Kyu-Hyun; Huh, Chul-Sung; Kim, Eun Bae

    2015-12-01

    Veneroida is the largest order of bivalves, and these clams are commercially important in Asian countries. Although numerous studies have focused on the genomic characters of individual species or genera in Veneroida, superfamily-specific genomic characters have not been determined. In this study, we performed a comparative genomic analysis of 12 mitochondrial protein coding genes (PCGs) from 25 clams in six Veneroida superfamilies to determine genomic and evolutionary features of each superfamily. Length and distribution of nucleotides encoding the PCGs were too variable to define superfamily-specific genomic characters. Phylogenetic analysis revealed that PCGs are suitable for classification of species in three superfamilies: Cardioidea, Mactroidea, and Veneroidea. However, one species classified in Tellinoidea, Sinonovacula constricta, was evolutionarily closer to Solenoidea clams than Tellinoidea clams. dN/dS analysis showed that positively selected sites in NADH dehydrogenase subunit, nd4 and subunit of ATP synthase, atp6 were present in Mactroidea. Differences in selected sites in the nd4 and atp6 could be caused by superfamily-level differences in sodium transport or ATP synthesis functions, respectively. These differences in selected sites in NADH may have conferred these animals, which have low motility and do not generally move, with increased flexibility to maintain homeostasis in the face of osmotic pressure. Our study provides insight into evolutionary traits as well as facilitates identification of veneroids. PMID:26343338

  11. Immunological comparison of the NADH:nitrate reductase from different cucumber tissues

    OpenAIRE

    Jolanta Marciniak; Grażyna Kłobus; Józef Buczek; Tadeusz Stefaniak; Jarosław Mazur

    2014-01-01

    Soluble nitrate reductase from cucumber roots (Cucumis sativus L.) was isolated and purified with blue-Sepharose 4B. Specific antibodies against the NR protein were raised by immunization of a goat. Using polyclonal antibodies anti-NR properties of the nitrate reductase from various cucumber tissues were examined. Experiments showed difference in immuno-logical properties of nitrate reductase (NR) from cotyledon roots and leaves.

  12. Immunological comparison of the NADH:nitrate reductase from different cucumber tissues

    Directory of Open Access Journals (Sweden)

    Jolanta Marciniak

    2014-02-01

    Full Text Available Soluble nitrate reductase from cucumber roots (Cucumis sativus L. was isolated and purified with blue-Sepharose 4B. Specific antibodies against the NR protein were raised by immunization of a goat. Using polyclonal antibodies anti-NR properties of the nitrate reductase from various cucumber tissues were examined. Experiments showed difference in immuno-logical properties of nitrate reductase (NR from cotyledon roots and leaves.

  13. Identification and characterization of trans-3-hydroxy-l-proline dehydratase and Δ1-pyrroline-2-carboxylate reductase involved in trans-3-hydroxy-l-proline metabolism of bacteria

    Directory of Open Access Journals (Sweden)

    Seiya Watanabe

    2014-01-01

    Full Text Available trans-4-Hydroxy-l-proline (T4LHyp and trans-3-hydroxy-l-proline (T3LHyp occur mainly in collagen. A few bacteria can convert T4LHyp to α-ketoglutarate, and we previously revealed a hypothetical pathway consisting of four enzymes at the molecular level (J Biol Chem (2007 282, 6685–6695; J Biol Chem (2012 287, 32674–32688. Here, we first found that Azospirillum brasilense has the ability to grow not only on T4LHyp but also T3LHyp as a sole carbon source. In A. brasilense cells, T3LHyp dehydratase and NAD(PH-dependent Δ1-pyrroline-2-carboxylate (Pyr2C reductase activities were induced by T3LHyp (and d-proline and d-lysine but not T4LHyp, and no effect of T3LHyp was observed on the expression of T4LHyp metabolizing enzymes: a hypothetical pathway of T3LHyp → Pyr2C → l-proline was proposed. Bacterial T3LHyp dehydratase, encoded to LhpH gene, was homologous with the mammalian enzyme. On the other hand, Pyr2C reductase encoded to LhpI gene was a novel member of ornithine cyclodeaminase/μ-crystallin superfamily, differing from known bacterial protein. Furthermore, the LhpI enzymes of A. brasilense and another bacterium showed several different properties, including substrate and coenzyme specificities. T3LHyp was converted to proline by the purified LhpH and LhpI proteins. Furthermore, disruption of LhpI gene from A. brasilense led to loss of growth on T3LHyp, d-proline and d-lysine, indicating that this gene has dual metabolic functions as a reductase for Pyr2C and Δ1-piperidine-2-carboxylate in these pathways, and that the T3LHyp pathway is not linked to T4LHyp and l-proline metabolism.

  14. Histochemical Localization of Glutathione Dependent NBT-Reductase in Mouse Skin

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective Localization of the glutathione dependent Nitroblue tetrazolium (NBT) reductase in fresh frozen sections of mouse skin and possible dependence of NBT reductase on tissue thiol levels has been investigated. Methods The fresh frozen tissue sections (8m thickness) were prepared and incubated in medium containing NBT, reduced glutathione (GSH) and phosphate buffer. The staining for GSH was performed with mercury orange. Results  The activity of the NBT-reductase in mouse skin has been found to be localized in the areas rich in glutathione and actively proliferating area of the skin. Conclusion The activity of the NBT-reductase seems to be dependent on the glutathione contents.

  15. Structure of a short-chain dehydrogenase/reductase (SDR) within a genomic island from a clinical strain of Acinetobacter baumannii

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Bhumika S., E-mail: bhumika.shah@mq.edu.au; Tetu, Sasha G. [Macquarie University, Research Park Drive, Sydney, NSW 2109 (Australia); Harrop, Stephen J. [University of New South Wales, Sydney, NSW 2052 (Australia); Paulsen, Ian T.; Mabbutt, Bridget C. [Macquarie University, Research Park Drive, Sydney, NSW 2109 (Australia)

    2014-09-25

    The structure of a short-chain dehydrogenase encoded within genomic islands of A. baumannii strains has been solved to 2.4 Å resolution. This classical SDR incorporates a flexible helical subdomain. The NADP-binding site and catalytic side chains are identified. Over 15% of the genome of an Australian clinical isolate of Acinetobacter baumannii occurs within genomic islands. An uncharacterized protein encoded within one island feature common to this and other International Clone II strains has been studied by X-ray crystallography. The 2.4 Å resolution structure of SDR-WM99c reveals it to be a new member of the classical short-chain dehydrogenase/reductase (SDR) superfamily. The enzyme contains a nucleotide-binding domain and, like many other SDRs, is tetrameric in form. The active site contains a catalytic tetrad (Asn117, Ser146, Tyr159 and Lys163) and water molecules occupying the presumed NADP cofactor-binding pocket. An adjacent cleft is capped by a relatively mobile helical subdomain, which is well positioned to control substrate access.

  16. Structure of a short-chain dehydrogenase/reductase (SDR) within a genomic island from a clinical strain of Acinetobacter baumannii

    International Nuclear Information System (INIS)

    The structure of a short-chain dehydrogenase encoded within genomic islands of A. baumannii strains has been solved to 2.4 Å resolution. This classical SDR incorporates a flexible helical subdomain. The NADP-binding site and catalytic side chains are identified. Over 15% of the genome of an Australian clinical isolate of Acinetobacter baumannii occurs within genomic islands. An uncharacterized protein encoded within one island feature common to this and other International Clone II strains has been studied by X-ray crystallography. The 2.4 Å resolution structure of SDR-WM99c reveals it to be a new member of the classical short-chain dehydrogenase/reductase (SDR) superfamily. The enzyme contains a nucleotide-binding domain and, like many other SDRs, is tetrameric in form. The active site contains a catalytic tetrad (Asn117, Ser146, Tyr159 and Lys163) and water molecules occupying the presumed NADP cofactor-binding pocket. An adjacent cleft is capped by a relatively mobile helical subdomain, which is well positioned to control substrate access

  17. Functional Identification and Structure Determination of Two Novel Prolidases from cog1228 in the Amidohydrolase Superfamily

    Energy Technology Data Exchange (ETDEWEB)

    Xiang, Dao Feng; Patskovsky, Yury; Xu, Chengfu; Fedorov, Alexander A.; Fedorov, Elena V.; Sisco, Abby A.; Sauder, J. Michael; Burley, Stephen K.; Almo, Steven C.; Raushel, Frank M. (Einstein); (TAM); (Lilly)

    2010-12-07

    Two uncharacterized enzymes from the amidohydrolase superfamily belonging to cog1228 were cloned, expressed, and purified to homogeneity. The two proteins, Sgx9260c (gi|44242006) and Sgx9260b (gi|44479596), were derived from environmental DNA samples originating from the Sargasso Sea. The catalytic function and substrate profiles for Sgx9260c and Sgx9260b were determined using a comprehensive library of dipeptides and N-acyl derivative of L-amino acids. Sgx9260c catalyzes the hydrolysis of Gly-L-Pro, L-Ala-L-Pro, and N-acyl derivatives of L-Pro. The best substrate identified to date is N-acetyl-L-Pro with a value of k{sub cat}/K{sub m} of 3 x 10{sup 5} M{sup -1} s{sup -1}. Sgx9260b catalyzes the hydrolysis of L-hydrophobic L-Pro dipeptides and N-acyl derivatives of L-Pro. The best substrate identified to date is N-propionyl-L-Pro with a value of k{sub cat}/K{sub m} of 1 x 10{sup 5} M{sup -1} s{sup -1}. Three-dimensional structures of both proteins were determined by X-ray diffraction methods (PDB codes 3MKV and 3FEQ). These proteins fold as distorted ({beta}/{alpha})8-barrels with two divalent cations in the active site. The structure of Sgx9260c was also determined as a complex with the N-methylphosphonate derivative of L-Pro (PDB code 3N2C). In this structure the phosphonate moiety bridges the binuclear metal center, and one oxygen atom interacts with His-140. The {alpha}-carboxylate of the inhibitor interacts with Tyr-231. The proline side chain occupies a small substrate binding cavity formed by residues contributed from the loop that follows {beta}-strand 7 within the ({beta}/{alpha})8-barrel. A total of 38 other proteins from cog1228 are predicted to have the same substrate profile based on conservation of the substrate binding residues. The structure of an evolutionarily related protein, Cc2672 from Caulobacter crecentus, was determined as a complex with the N-methylphosphonate derivative of L-arginine (PDB code 3MTW).

  18. Biochemistry and Crystal Structure of Ectoine Synthase: A Metal-Containing Member of the Cupin Superfamily.

    Directory of Open Access Journals (Sweden)

    Nils Widderich

    Full Text Available Ectoine is a compatible solute and chemical chaperone widely used by members of the Bacteria and a few Archaea to fend-off the detrimental effects of high external osmolarity on cellular physiology and growth. Ectoine synthase (EctC catalyzes the last step in ectoine production and mediates the ring closure of the substrate N-gamma-acetyl-L-2,4-diaminobutyric acid through a water elimination reaction. However, the crystal structure of ectoine synthase is not known and a clear understanding of how its fold contributes to enzyme activity is thus lacking. Using the ectoine synthase from the cold-adapted marine bacterium Sphingopyxis alaskensis (Sa, we report here both a detailed biochemical characterization of the EctC enzyme and the high-resolution crystal structure of its apo-form. Structural analysis classified the (SaEctC protein as a member of the cupin superfamily. EctC forms a dimer with a head-to-tail arrangement, both in solution and in the crystal structure. The interface of the dimer assembly is shaped through backbone-contacts and weak hydrophobic interactions mediated by two beta-sheets within each monomer. We show for the first time that ectoine synthase harbors a catalytically important metal co-factor; metal depletion and reconstitution experiments suggest that EctC is probably an iron-dependent enzyme. We found that EctC not only effectively converts its natural substrate N-gamma-acetyl-L-2,4-diaminobutyric acid into ectoine through a cyclocondensation reaction, but that it can also use the isomer N-alpha-acetyl-L-2,4-diaminobutyric acid as its substrate, albeit with substantially reduced catalytic efficiency. Structure-guided site-directed mutagenesis experiments targeting amino acid residues that are evolutionarily highly conserved among the extended EctC protein family, including those forming the presumptive iron-binding site, were conducted to functionally analyze the properties of the resulting EctC variants. An assessment of

  19. Discovery of a distinct superfamily of Kunitz-type toxin (KTT from tarantulas.

    Directory of Open Access Journals (Sweden)

    Chun-Hua Yuan

    Full Text Available BACKGROUND: Kuntiz-type toxins (KTTs have been found in the venom of animals such as snake, cone snail and sea anemone. The main ancestral function of Kunitz-type proteins was the inhibition of a diverse array of serine proteases, while toxic activities (such as ion-channel blocking were developed under a variety of Darwinian selection pressures. How new functions were grafted onto an old protein scaffold and what effect Darwinian selection pressures had on KTT evolution remains a puzzle. PRINCIPAL FINDINGS: Here we report the presence of a new superfamily of ktts in spiders (TARANTULAS: Ornithoctonus huwena and Ornithoctonus hainana, which share low sequence similarity to known KTTs and is clustered in a distinct clade in the phylogenetic tree of KTT evolution. The representative molecule of spider KTTs, HWTX-XI, purified from the venom of O. huwena, is a bi-functional protein which is a very potent trypsin inhibitor (about 30-fold more strong than BPTI as well as a weak Kv1.1 potassium channel blocker. Structural analysis of HWTX-XI in 3-D by NMR together with comparative function analysis of 18 expressed mutants of this toxin revealed two separate sites, corresponding to these two activities, located on the two ends of the cone-shape molecule of HWTX-XI. Comparison of non-synonymous/synonymous mutation ratios (omega for each site in spider and snake KTTs, as well as PBTI like body Kunitz proteins revealed high Darwinian selection pressure on the binding sites for Kv channels and serine proteases in snake, while only on the proteases in spider and none detected in body proteins, suggesting different rates and patterns of evolution among them. The results also revealed a series of key events in the history of spider KTT evolution, including the formation of a novel KTT family (named sub-Kuntiz-type toxins derived from the ancestral native KTTs with the loss of the second disulfide bridge accompanied by several dramatic sequence modifications

  20. Biochemistry and Crystal Structure of Ectoine Synthase: A Metal-Containing Member of the Cupin Superfamily.

    Science.gov (United States)

    Widderich, Nils; Kobus, Stefanie; Höppner, Astrid; Riclea, Ramona; Seubert, Andreas; Dickschat, Jeroen S; Heider, Johann; Smits, Sander H J; Bremer, Erhard

    2016-01-01

    Ectoine is a compatible solute and chemical chaperone widely used by members of the Bacteria and a few Archaea to fend-off the detrimental effects of high external osmolarity on cellular physiology and growth. Ectoine synthase (EctC) catalyzes the last step in ectoine production and mediates the ring closure of the substrate N-gamma-acetyl-L-2,4-diaminobutyric acid through a water elimination reaction. However, the crystal structure of ectoine synthase is not known and a clear understanding of how its fold contributes to enzyme activity is thus lacking. Using the ectoine synthase from the cold-adapted marine bacterium Sphingopyxis alaskensis (Sa), we report here both a detailed biochemical characterization of the EctC enzyme and the high-resolution crystal structure of its apo-form. Structural analysis classified the (Sa)EctC protein as a member of the cupin superfamily. EctC forms a dimer with a head-to-tail arrangement, both in solution and in the crystal structure. The interface of the dimer assembly is shaped through backbone-contacts and weak hydrophobic interactions mediated by two beta-sheets within each monomer. We show for the first time that ectoine synthase harbors a catalytically important metal co-factor; metal depletion and reconstitution experiments suggest that EctC is probably an iron-dependent enzyme. We found that EctC not only effectively converts its natural substrate N-gamma-acetyl-L-2,4-diaminobutyric acid into ectoine through a cyclocondensation reaction, but that it can also use the isomer N-alpha-acetyl-L-2,4-diaminobutyric acid as its substrate, albeit with substantially reduced catalytic efficiency. Structure-guided site-directed mutagenesis experiments targeting amino acid residues that are evolutionarily highly conserved among the extended EctC protein family, including those forming the presumptive iron-binding site, were conducted to functionally analyze the properties of the resulting EctC variants. An assessment of enzyme activity

  1. The effect of copper and gallium compounds on ribonucleotide reductase

    Energy Technology Data Exchange (ETDEWEB)

    Narasimhan, J.

    1992-01-01

    The mode of action of copper complexes (CuL and CuKTS) and gallium compounds (gallium nitrate and citrate) in cytotoxicity was studied. The effects of these agents on the enzyme ribonucleotide reductase was investigated by monitoring the tyrosyl free radical present in the active site of the enzyme through electron spin resonance (ESR) spectroscopy. Ribonucleotide reductase, a key enzyme in cellular proliferation, consists of two subunits. M1, a dimer of molecular weight 170,000 contains the substrate and effector binding sites. M2, a dimer of molecular weight 88,000, contains non-heme iron and tyrosyl free radical essential for the activity of the enzyme. In studies using copper complexes, the cellular oxidative chemistry was examined by ESR studies on adduct formation with membranes, and oxidation of thiols. Membrane thiols were oxidized through the reduction of the ESR signal of the thiol adduct and the analysis of sulfhydryl content. Using the radiolabel [sup 59]Fe, the inhibitory action of copper thiosemicarbazones on cellular iron uptake was shown. The inhibitory action of CuL on ribonucleotide reductase was shown by the quenching of the tyrosyl free radical on the M2 subunit. The hypothesis that gallium directly interacts with the M2 subunit of the enzyme and displaces the iron from it was proven. The tyrosyl free radical signal from cell lysates was inhibited by the direct addition of gallium compounds. Gallium content in the cells was measured by a fluorimetric method, to ensure the presence of sufficient amounts of gallium to compete with the iron in the M2 subunit. The enzyme activity, measured by the conversion of [sup 14]C-CDP to the labeled deoxy CDP, was inhibited by the addition of gallium nitrate in a cell free assay system. The immunoprecipitation studies of the [sup 59]Fe labeled M2 protein using the monoclonal antibody directed against this subunit suggested that gallium releases iron from the M2 subunit.

  2. biliverdin. Is there a role for biliverdin reductase?

    Directory of Open Access Journals (Sweden)

    AndreasDaiber

    2012-03-01

    Full Text Available Reactive oxygen species (ROS and signaling events are involved in the pathogenesis of endothelial dysfunction and represent a major contribution to vascular regulation. Molecular signaling is highly dependent on reactive oxygen species. But depending on the amount of ROS production it might have toxic or protective effects. Despite a large number of negative outcomes in large clinical trials (e.g. HOPE, HOPE-TOO, antioxidant molecules and agents are important players to influence the critical balance between production and elimination of RONS. However, chronic systemic antioxidant therapy lacks clinical efficacy, probably by interfering with important physiological redox signaling pathways. Therefore, it may be a much more promising attempt to induce intrinsic antioxidant pathways in order to increase the antioxidants not systemically but at the place of oxidative stress and complications. Among others, heme oxygenase (HO has been shown to be important for attenuating the overall production of ROS in a broad range of disease states through its ability to degrade heme and to produce carbon monoxide (CO, biliverdin/bilirubin, and the release of free iron with subsequent ferritin induction. With the present review we would like to highlight the important antioxidant role of the heme oxygenase system and especially discuss the contribution of the biliverdin, bilirubin and biliverdin reductase to these beneficial effects. The bilierdin reductase was reported to confer an antioxidant redox amplification cycle by which low, physiological bilirubin concentrations confer potent antioxidant protection via recycling of biliverdin from oxidized bilirubin by the biliverdin reductase, linking this sink for oxidants to the NADPH pool. To date the existence and role of this antioxidant redox cycle is still under debate and we present and discuss the pros and cons as well as our own findings on this topic.

  3. Autoimmunity in Membranous Nephropathy Targets Aldose Reductase and SOD2

    OpenAIRE

    Prunotto, Marco; Carnevali, Maria Luisa; Candiano, Giovanni; Murtas, Corrado; Bruschi, Maurizio; Corradini, Emilia; Trivelli, Antonella; Magnasco, Alberto; Petretto, Andrea; Santucci, Laura; Mattei, Silvia; Gatti, Rita; Scolari, Francesco; Kador, Peter; Allegri, Landino

    2010-01-01

    Glomerular targets of autoimmunity in human membranous nephropathy are poorly understood. Here, we used a combined proteomic approach to identify specific antibodies against podocyte proteins in both serum and glomeruli of patients with membranous nephropathy (MN). We detected specific anti–aldose reductase (AR) and anti–manganese superoxide dismutase (SOD2) IgG4 in sera of patients with MN. We also eluted high titers of anti-AR and anti-SOD2 IgG4 from microdissected glomeruli of three biopsi...

  4. Applications of Carboxylic Acid Reductases in Oleaginous Microbes

    Energy Technology Data Exchange (ETDEWEB)

    Resch, Michael G.; Linger, Jeffrey; McGeehan, John; Tyo, Keith; Beckham, Gregg

    2016-04-24

    Carboxylic acid reductases (CARs) are recently emerging reductive enzymes for the direct production of aldehydes from biologically-produced carboxylic acids. Recent work has demonstrated that these powerful enzymes are able to reduce a very broad range of volatile- to long-chain fatty acids as well as aromatic acids. Here, we express four CAR enzymes from different fungal origins to test their activity against fatty acids commonly produced in oleaginous microbes. These in vitro results will inform metabolic engineering strategies to conduct mild biological reduction of carboxylic acids in situ, which is conventionally done via hydrotreating catalysis at high temperatures and hydrogen pressures.

  5. Mediated electrochemistry of dimethyl sulfoxide reductase promoted by carbon nanotubes

    Institute of Scientific and Technical Information of China (English)

    BERNHARDT; Paul; V

    2010-01-01

    Mediated electrochemistry of dimethyl sulfoxide reductase from Rhodobacter capsulatus (DMSOR) which is immobilized on a bare glassy carbon (GC) electrode and a carbon nanotube (CNT)-modified GC electrode was studied using the Co complex (trans-6,13-dimethyl-1,4,8,11-tetraazacyclotetradecane-6,13-diamine)cobalt(III) ([Co(trans-diammac)] +) as a mediator.The cyclic voltammograms of different electrodes were carried out at different substrate (DMSO) concentrations.The results demonstrated that the catalytic current was increased by employing CNT as a promoter.

  6. Vibrio harveyi Nitroreductase Is Also a Chromate Reductase

    OpenAIRE

    Kwak, Young Hak; Lee, Dong Seok; Kim, Han Bok

    2003-01-01

    The chromate reductase purified from Pseudomonas ambigua was found to be homologous with several nitroreductases. Escherichia coli DH5α and Vibrio harveyi KCTC 2720 nitroreductases were chosen for the present study, and their chromate-reducing activities were determined. A fusion between glutathione S-transferase (GST) and E. coli DH5α NfsA (GST-EcNfsA), a fusion between GST and E. coli DH5α NfsB (GST-EcNfsB), and a fusion between GST and V. harveyi KCTC 2720 NfsA (GST-VhNfsA) were prepared f...

  7. Pulse radiolysis studies on superoxide reductase from Treponema pallidum.

    OpenAIRE

    Nivière, V; Lombard, M.; Fontecave, M.; Houée-Levin, C

    2001-01-01

    Superoxide reductases (SORs) are small metalloenzymes, which catalyze reduction of O2*- to H2O2. The reaction of the enzyme from Treponema pallidum with superoxide was studied by pulse radiolysis methods. The first step is an extremely fast bi-molecular reaction of the ferrous center with O2, with a rate constant of 6 x 10 (8) M(-1) s(-1). A first intermediate is formed which is converted to a second one with a slower rate constant of 4800 s(-1). This latter value is 10 times higher than the ...

  8. Methylenetetrahydrofolate reductase (MTHFR) deficiency presenting as a rash.

    LENUS (Irish Health Repository)

    Crushell, Ellen

    2012-09-01

    We report on the case of a 2-year-old girl recently diagnosed with Methylenetetrahydrofolate reductase (MTHFR) deficiency who originally presented in the neonatal period with a distinctive rash. At 11 weeks of age she developed seizures, she had acquired microcephaly and developmental delay. The rash deteriorated dramatically following commencement of phenobarbitone; both rash and seizures abated following empiric introduction of pyridoxine and folinic acid as treatment of possible vitamin responsive seizures. We postulate that phenobarbitone in combination with MTHFR deficiency may have caused her rash to deteriorate and subsequent folinic acid was helpful in treating the rash and preventing further acute neurological decline as commonly associated with this condition.

  9. Genome-wide analysis of the expansin gene superfamily reveals grapevine-specific structural and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Silvia Dal Santo

    Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the

  10. Sulforaphane promotes murine hair growth by accelerating the degradation of dihydrotestosterone.

    Science.gov (United States)

    Sasaki, Mari; Shinozaki, Shohei; Shimokado, Kentaro

    2016-03-25

    Dihydrotestosterone (DHT) causes the regression of human hair follicles in the parietal scalp, leading to androgenic alopecia (AGA). Sulforaphane (SFN) increases the expression of DHT degrading enzymes, such as 3α-hydroxysteroid dehydrogenases (3α-HSDs), and, therefore, SFN treatment may improve AGA. To determine the effects of SFN on hair growth, we administered SFN (10 mg/kg BW, IP) or vehicle (DMSO) to ob/ob mice for six weeks and examined hair regeneration and the plasma levels of testosterone and DHT. We also tested the effects of SFN on the expression of two forms of 3α-HSD, aldo-keto reductase 1c21 and dehydrogenase/reductase (SDR family) member 9, both in vitro and in vivo. SNF significantly enhanced hair regeneration in ob/ob mice. The mice treated with SFN showed lower plasma levels of testosterone and DHT than those treated with vehicle. SFN increased the mRNA and protein levels of the two forms of 3α-HSD in the liver of the mice and in cultured murine hepatocyte Hepa1c1c7 cells. These results suggest that SFN treatment increases the amount of 3α-HSDs in the liver, accelerates the degradation of blood DHT, and subsequently blocks the suppression of hair growth by DHT. PMID:26923074

  11. Characterization of Emodin as a Therapeutic Agent for Diabetic Cataract.

    Science.gov (United States)

    Chang, Kun-Che; Li, Linfeng; Sanborn, Theresa M; Shieh, Biehuoy; Lenhart, Patricia; Ammar, David; LaBarbera, Daniel V; Petrash, J Mark

    2016-05-27

    Aldose reductase (AR) in the lens plays an important role in the pathogenesis of diabetic cataract (DC) by contributing to osmotic and oxidative stress associated with accelerated glucose metabolism through the polyol pathway. Therefore, inhibition of AR in the lens may hold the key to prevent DC formation. Emodin, a bioactive compound isolated from plants, has been implicated as a therapy for diabetes. However, its inhibitory activity against AR remains unclear. Our results showed that emodin has good selectively inhibitory activity against AR (IC50 = 2.69 ± 0.90 μM) but not other aldo-keto reductases and is stable at 37 °C for at least 7 days. Enzyme kinetic studies demonstrated an uncompetitive inhibition against AR with a corresponding inhibition constant of 2.113 ± 0.095 μM. In in vivo studies, oral administration of emodin reduced the incidence and severity of morphological markers of cataract in lenses of AR transgenic mice. Computational modeling of the AR-NADP(+)-emodin ternary complex indicated that the 3-hydroxy group of emodin plays an essential role by interacting with Ser302 through hydrogen bonding in the specificity pocket of AR. All the findings above provide encouraging evidence for emodin as a potential therapeutic agent to prevent cataract in diabetic patients. PMID:27140653

  12. Use of RNA Interference by In Utero Electroporation to Study Cortical Development: The Example of the Doublecortin Superfamily

    Directory of Open Access Journals (Sweden)

    Raanan Greenman

    2012-11-01

    Full Text Available The way we study cortical development has undergone a revolution in the last few years following the ability to use shRNA in the developing brain of the rodent embryo. The first gene to be knocked-down in the developing brain was doublecortin (Dcx. Here we will review knockdown experiments in the developing brain and compare them with knockout experiments, thus highlighting the advantages and disadvantages using the different systems. Our review will focus on experiments relating to the doublecortin superfamily of proteins.

  13. The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum

    Directory of Open Access Journals (Sweden)

    Sattelle David B

    2007-09-01

    Full Text Available Abstract Background Members of the cys-loop ligand-gated ion channel (cys-loop LGIC superfamily mediate chemical neurotransmission and are studied extensively as potential targets of drugs used to treat neurological disorders such as Alzheimer's disease. Insect cys-loop LGICs are also of interest as they are targets of highly successful insecticides. The red flour beetle, Tribolium castaneum, is a major pest of stored agricultural products and is also an important model organism for studying development. Results As part of the T. castaneum genome sequencing effort, we have characterized the beetle cys-loop LGIC superfamily which is the third insect superfamily to be described after those of Drosophila melanogaster and Apis mellifera, and also the largest consisting of 24 genes. As with Drosophila and Apis, Tribolium possesses ion channels gated by acetylcholine, γ-amino butyric acid (GABA, glutamate and histamine as well as orthologs of the Drosophila pH-sensitive chloride channel subunit (pHCl, CG8916 and CG12344. Similar to Drosophila and Apis, Tribolium cys-loop LGIC diversity is broadened by alternative splicing although the beetle orthologs of RDL and GluCl possess more variants of exon 3. Also, RNA A-to-I editing was observed in two Tribolium nicotinic acetylcholine receptor subunits, Tcasα6 and Tcasβ1. Editing in Tcasα6 is evolutionarily conserved with D. melanogaster, A. mellifera and Heliothis virescens, whereas Tcasβ1 is edited at a site so far only observed in the beetle. Conclusion Our findings reveal that in diverse insect species the cys-loop LGIC superfamily has remained compact with only minor changes in gene numbers. However, alternative splicing, RNA editing and the presence of divergent subunits broadens the cys-loop LGIC proteome and generates species-specific receptor isoforms. These findings on Tribolium castaneum enhance our understanding of cys-loop LGIC functional genomics and provide a useful basis for the

  14. Cupincin: A Unique Protease Purified from Rice (Oryza sativa L.) Bran Is a New Member of the Cupin Superfamily

    OpenAIRE

    Sreedhar, Roopesh; Kaul Tiku, Purnima

    2016-01-01

    Cupin superfamily is one of the most diverse super families. This study reports the purification and characterization of a novel cupin domain containing protease from rice bran for the first time. Hypothetical protein OsI_13867 was identified and named as cupincin. Cupincin was purified to 4.4 folds with a recovery of 4.9%. Cupincin had an optimum pH and temperature of pH 4.0 and 60°C respectively. Cupincin was found to be a homotrimer, consisting of three distinct subunits with apparent mole...

  15. Molecular phylogeny of the kelch-repeat superfamily reveals an expansion of BTB/kelch proteins in animals

    Directory of Open Access Journals (Sweden)

    Adams Josephine C

    2003-09-01

    Full Text Available Abstract Background The kelch motif is an ancient and evolutionarily-widespread sequence motif of 44–56 amino acids in length. It occurs as five to seven repeats that form a β-propeller tertiary structure. Over 28 kelch-repeat proteins have been sequenced and functionally characterised from diverse organisms spanning from viruses, plants and fungi to mammals and it is evident from expressed sequence tag, domain and genome databases that many additional hypothetical proteins contain kelch-repeats. In general, kelch-repeat β-propellers are involved in protein-protein interactions, however the modest sequence identity between kelch motifs, the diversity of domain architectures, and the partial information on this protein family in any single species, all present difficulties to developing a coherent view of the kelch-repeat domain and the kelch-repeat protein superfamily. To understand the complexity of this superfamily of proteins, we have analysed by bioinformatics the complement of kelch-repeat proteins encoded in the human genome and have made comparisons to the kelch-repeat proteins encoded in other sequenced genomes. Results We identified 71 kelch-repeat proteins encoded in the human genome, whereas 5 or 8 members were identified in yeasts and around 18 in C. elegans, D. melanogaster and A. gambiae. Multiple domain architectures were identified in each organism, including previously unrecognised forms. The vast majority of kelch-repeat domains are predicted to form six-bladed β-propellers. The most prevalent domain architecture in the metazoan animal genomes studied was the BTB/kelch domain organisation and we uncovered 3 subgroups of human BTB/kelch proteins. Sequence analysis of the kelch-repeat domains of the most robustly-related subgroups identified differences in β-propeller organisation that could provide direction for experimental study of protein-binding characteristics. Conclusion The kelch-repeat superfamily constitutes a

  16. Evaluation of 5α-reductase inhibitory activity of certain herbs useful as antiandrogens.

    Science.gov (United States)

    Nahata, A; Dixit, V K

    2014-08-01

    This study demonstrates 5α-reductase inhibitory activity of certain herbs useful in the management of androgenic disorders. Ganoderma lucidum (Curtis) P. Karst (GL), Urtica dioica Linn. (UD), Caesalpinia bonducella Fleming. (CB), Tribulus terrestris Linn. (TT), Pedalium murex Linn. (PM), Sphaeranthus indicus Linn. (SI), Cuscuta reflexa Roxb. (CR), Citrullus colocynthis Schrad. (CC), Benincasa hispida Cogn. (BH), Phyllanthus niruri Linn. (PN) and Echinops echinatus Linn. (EE) were included in the study. Petroleum ether, ethanol and aqueous extracts of these herbs were tested for their 5α-reductase inhibitory activity against the standard 5α-reductase inhibitor, finasteride. A biochemical method to determine the activity of 5α-reductase was used to evaluate the inhibition of different extracts to the enzyme. The optical density (OD) value of each sample was measured continuously with ultraviolet spectrophotometer for the reason that the substrate NADPH has a specific absorbance at 340 nm. As the enzyme 5α-reductase uses NADPH as a substrate, so in the presence of 5α-reductase inhibitor, the NADPH concentration will increase with the function of time. This method thus implicates the activity of 5α-reductase. The method proved to be extremely useful to screen the herbs for their 5α-reductase inhibitory potential. GL, UD, BH, SI and CR came out to be promising candidates for further exploring their antiandrogenic properties. PMID:23710567

  17. Determination of the specific activities of methionine sulfoxide reductase A and B by capillary electrophoresis

    Science.gov (United States)

    A capillary electrophoresis (CE) method for the determination of methionine sulfoxide reductase A and methionine sulfoxide reductase B activities in mouse liver is described. The method is based on detection of the 4-(dimethylamino)azobenzene-4’-sulfonyl derivative of L-methionine (dabsyl Met), the ...

  18. Sucrose mimics the light induction of Arabidopsis nitrate reductase gene transcription

    DEFF Research Database (Denmark)

    Cheng, Chi-Lien; Acedo, Gregoria N; Kristensen, Michael;

    1992-01-01

    Nitrate reductase, the first enzyme in nitrate assimilation, is located at the crossroad of two energy-consuming pathways: nitrate assimilation and carbon fixation. Light, which regulates the expression of many higher-plant carbon fixation genes, also regulates nitrate reductase gene expression. ...

  19. Functions of Flavin Reductase and Quinone Reductase in 2,4,6-Trichlorophenol Degradation by Cupriavidus necator JMP134▿

    OpenAIRE

    Belchik, Sara Mae; Xun, Luying

    2007-01-01

    The tcpRXABCYD operon of Cupriavidus necator JMP134 is involved in the degradation of 2,4,6-trichlorophenol (2,4,6-TCP), a toxic pollutant. TcpA is a reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenase that converts 2,4,6-TCP to 6-chlorohydroxyquinone. It has been implied via genetic analysis that TcpX acts as an FAD reductase to supply TcpA with FADH2, whereas the function of TcpB in 2,4,6-TCP degradation is still unclear. In order to provide direct biochemical evidence for t...

  20. MEK2 regulates ribonucleotide reductase activity through functional interaction with ribonucleotide reductase small subunit p53R2

    OpenAIRE

    Piao, Chunmei; Youn, Cha-Kyung; Jin, Min; Yoon, Sang Pil; Chang, In-Youb; Lee, Jung Hee; You, Ho Jin

    2012-01-01

    The p53R2 protein, a newly identified member of the ribonucleotide reductase family that provides nucleotides for DNA damage repair, is directly regulated by p53. We show that p53R2 is also regulated by a MEK2 (ERK kinase 2/MAP kinase kinase 2)-dependent pathway. Increased MEK1/2 phosphorylation by serum stimulation coincided with an increase in the RNR activity in U2OS and H1299 cells. The inhibition of MEK2 activity, either by treatment with a MEK inhibitor or by transfection with MEK2 siRN...

  1. The effect of ionic and non-ionic surfactants on the growth, nitrate reductase and nitrite reductase activities of Spirodela polyrrhiza (L. Schleiden

    Directory of Open Access Journals (Sweden)

    Józef Buczek

    2014-02-01

    Full Text Available Inclusion into the medium of 5 mg•dm-3 of non-ionic (ENF or ionic (DBST surfactant caused 50-60% inhibition of nitrite reductase MR activity in S. polyrrhiza. At the same time, increased accumulation of NO2- in the plant tissues and lowering of the total and soluble protein contents were found. DBST also lowered the nitrate reductase (NR activity and the dry mass of the plants.

  2. Co-Expression of Monodehydroascorbate Reductase and Dehydroascorbate Reductase from Brassica rapa Effectively Confers Tolerance to Freezing-Induced Oxidative Stress

    OpenAIRE

    Shin, Sun-Young; Kim, Myung-Hee; Kim, Yul-Ho; Park, Hyang-Mi; Yoon, Ho-Sung

    2013-01-01

    Plants are exposed to various environmental stresses and have therefore developed antioxidant enzymes and molecules to protect their cellular components against toxicity derived from reactive oxygen species (ROS). Ascorbate is a very important antioxidant molecule in plants, and monodehydroascorbate reductase (MDHAR; EC 1.6.5.4) and dehydroascorbate reductase (DHAR; EC 1.8.5.1) are essential to regeneration of ascorbate for maintenance of ROS scavenging ability. The MDHAR and DHAR genes from ...

  3. Optimisation of nitrate reductase enzyme activity to synthesise silver nanoparticles.

    Science.gov (United States)

    Khodashenas, Bahareh; Ghorbani, Hamid Reza

    2016-06-01

    Today, the synthesis of silver nanoparticles (Ag NPs) is very common since it has many applications in different areas. The synthesis of these nanoparticles is done by means of physical, chemical, or biological methods. However, due to its inexpensive and environmentally friendly features, the biological method is more preferable. In the present study, using nitrate reductase enzyme available in the Escherichia coli (E. coli) bacterium, the biosynthesis of Ag NPs was investigated. In addition, the activity of the nitrate reductase enzyme was optimised by changing its cultural conditions, and the effects of silver nitrate (AgNO3) concentration and enzyme amount on nanoparticles synthesis were studied. Finally, the produced nanoparticles were studied using ultraviolet -visible (UV-Vis) spectrophotometer, dynamic light scattering technique, and transmission electron microscopy. UV-Visible spectrophotometric study showed the characteristic peak for Ag NPs at wavelength 405-420 nm for 1 mM metal precursor solution (AgNO3) with 1, 5, 10, and 20 cc supernatant and 435 nm for 0.01M AgNO3 with 20 cc supernatant. In this study, it was found that there is a direct relationship between the AgNO3 concentration and the size of produced Ag NPs. PMID:27256897

  4. Azotobacter vinelandii NADPH:ferredoxin reductase cloning, sequencing, and overexpression.

    Science.gov (United States)

    Isas, J M; Yannone, S M; Burgess, B K

    1995-09-01

    Azotobacter vinelandii ferredoxin I (AvFdI) controls the expression of another protein that was originally designated Protein X. Recently we reported that Protein X is a NADPH-specific flavoprotein that binds specifically to FdI (Isas, J.M., and Burgess, B.K. (1994) J. Biol. Chem. 269, 19404-19409). The gene encoding this protein has now been cloned and sequenced. Protein X is 33% identical and has an overall 53% similarity with the fpr gene product from Escherichia coli that encodes NADPH:ferredoxin reductase. On the basis of this similarity and the similarity of the physical properties of the two proteins, we now designate Protein X as A. vinelandii NADPH:ferredoxin reductase and its gene as the fpr gene. The protein has been overexpressed in its native background in A. vinelandii by using the broad host range multicopy plasmid, pKT230. In addition to being regulated by FdI, the fpr gene product is overexpressed when A. vinelandii is grown under N2-fixing conditions even though the fpr gene is not preceded by a nif specific promoter. By analogy to what is known about fpr expression in E. coli, we propose that FdI may exert its regulatory effect on fpr by interacting with the SoxRS regulon. PMID:7673160

  5. Nitrate metabolism in tobacco leaves overexpressing Arabidopsis nitrite reductase.

    Science.gov (United States)

    Davenport, Susie; Le Lay, Pascaline; Sanchez-Tamburrrino, Juan Pablo

    2015-12-01

    Primary nitrogen assimilation in plants includes the reduction of nitrite to ammonium in the chloroplasts by the enzyme nitrite reductase (NiR EC:1.7.7.1) or in the plastids of non-photosynthetic organs. Here we report on a study overexpressing the Arabidopsis thaliana NiR (AtNiR) gene in tobacco plants under the control of a constitutive promoter (CERV - Carnation Etched Ring Virus). The aim was to overexpress AtNiR in an attempt to alter the level of residual nitrite in the leaf which can act as precursor to the formation of nitrosamines. The impact of increasing the activity of AtNiR produced an increase in leaf protein and a stay-green phenotype in the primary transformed AtNiR population. Investigation of the T1 homozygous population demonstrated elevated nitrate reductase (NR) activity, reductions in leaf nitrite and nitrate and the amino acids proline, glutamine and glutamate. Chlorophyl content of the transgenic lines was increased, as evidenced by the stay-green phenotype. This reveals the importance of NiR in primary nitrogen assimilation and how modification of this key enzyme affects both the nitrogen and carbon metabolism of tobacco plants. PMID:26447683

  6. Pinpointing a Mechanistic Switch Between Ketoreduction and "Ene" Reduction in Short-Chain Dehydrogenases/Reductases.

    Science.gov (United States)

    Lygidakis, Antonios; Karuppiah, Vijaykumar; Hoeven, Robin; Ní Cheallaigh, Aisling; Leys, David; Gardiner, John M; Toogood, Helen S; Scrutton, Nigel S

    2016-08-01

    Three enzymes of the Mentha essential oil biosynthetic pathway are highly homologous, namely the ketoreductases (-)-menthone:(-)-menthol reductase and (-)-menthone:(+)-neomenthol reductase, and the "ene" reductase isopiperitenone reductase. We identified a rare catalytic residue substitution in the last two, and performed comparative crystal structure analyses and residue-swapping mutagenesis to investigate whether this determines the reaction outcome. The result was a complete loss of native activity and a switch between ene reduction and ketoreduction. This suggests the importance of a catalytic glutamate vs. tyrosine residue in determining the outcome of the reduction of α,β-unsaturated alkenes, due to the substrate occupying different binding conformations, and possibly also to the relative acidities of the two residues. This simple switch in mechanism by a single amino acid substitution could potentially generate a large number of de novo ene reductases. PMID:27411040

  7. Trypanothione Reductase: A Viable Chemotherapeutic Target for Antitrypanosomal and Antileishmanial Drug Design

    Directory of Open Access Journals (Sweden)

    M. Omar F. Khan

    2007-01-01

    Full Text Available Trypanosomiasis and leishmaniasis are two debilitating disease groups caused by parasites of Trypanosoma and Leishmania spp. and affecting millions of people worldwide. A brief outline of the potential targets for rational drug design against these diseases are presented, with an emphasis placed on the enzyme trypanothione reductase. Trypanothione reductase was identified as unique to parasites and proposed to be an effective target against trypanosomiasis and leishmaniasis. The biochemical basis of selecting this enzyme as a target, with reference to the simile and contrast to human analogous enzyme glutathione reductase, and the structural aspects of its active site are presented. The process of designing selective inhibitors for the enzyme trypanothione reductase has been discussed. An overview of the different chemical classes of inhibitors of trypanothione reductase with their inhibitory activities against the parasites and their prospects as future chemotherapeutic agents are briefl y revealed.

  8. Crystal structure and potential physiological role of zebra fish thioesterase superfamily member 2 (fTHEM2)

    International Nuclear Information System (INIS)

    Thioesterase superfamily member 2 (THEM2) is an essential protein for mammalian cell proliferation. It belongs to the hotdog-fold thioesterase superfamily and catalyzes hydrolysis of thioester bonds of acyl-CoA in vitro, while its in vivo function remains unrevealed. In this study, Zebra fish was selected as a model organism to facilitate the investigations on THEM2. First, we solved the crystal structure of recombinant fTHEM2 at the resolution of 1.80 Å, which displayed a similar scaffolding as hTHEM2. Second, functional studies demonstrated that fTHEM2 is capable of hydrolyzing palmitoyl-CoA in vitro. In addition, injection of morpholino against fTHEM2 at one-cell stage resulted in distorted early embryo development, including delayed cell division, retarded development and increased death rate. The above findings validated our hypothesis that fTHEM2 could serve as an ideal surrogate for studying the physiological functions of THEM2. - Highlights: • The crystal structure of recombinant fTHEM2 is presented. • fTHEM2 is capable of hydrolyzing palmitoyl-CoA. • The influence of fTHEM2 on early embryo development is demonstrated

  9. Crystal structure and potential physiological role of zebra fish thioesterase superfamily member 2 (fTHEM2).

    Science.gov (United States)

    Yu, Shanshan; Li, Han; Gao, Feng; Zhou, Ying

    2015-08-01

    Thioesterase superfamily member 2 (THEM2) is an essential protein for mammalian cell proliferation. It belongs to the hotdog-fold thioesterase superfamily and catalyzes hydrolysis of thioester bonds of acyl-CoA in vitro, while its in vivo function remains unrevealed. In this study, Zebra fish was selected as a model organism to facilitate the investigations on THEM2. First, we solved the crystal structure of recombinant fTHEM2 at the resolution of 1.80 Å, which displayed a similar scaffolding as hTHEM2. Second, functional studies demonstrated that fTHEM2 is capable of hydrolyzing palmitoyl-CoA in vitro. In addition, injection of morpholino against fTHEM2 at one-cell stage resulted in distorted early embryo development, including delayed cell division, retarded development and increased death rate. The above findings validated our hypothesis that fTHEM2 could serve as an ideal surrogate for studying the physiological functions of THEM2. PMID:26067557

  10. Evolutionary expansion of the amidohydrolase superfamily in bacteria in response to the synthetic compounds molinate and diuron.

    Science.gov (United States)

    Sugrue, Elena; Fraser, Nicholas J; Hopkins, Davis H; Carr, Paul D; Khurana, Jeevan L; Oakeshott, John G; Scott, Colin; Jackson, Colin J

    2015-04-01

    The amidohydrolase superfamily has remarkable functional diversity, with considerable structural and functional annotation of known sequences. In microbes, the recent evolution of several members of this family to catalyze the breakdown of environmental xenobiotics is not well understood. An evolutionary transition from binuclear to mononuclear metal ion coordination at the active sites of these enzymes could produce large functional changes such as those observed in nature, but there are few clear examples available to support this hypothesis. To investigate the role of binuclear-mononuclear active-site transitions in the evolution of new function in this superfamily, we have characterized two recently evolved enzymes that catalyze the hydrolysis of the synthetic herbicides molinate (MolA) and phenylurea (PuhB). In this work, the crystal structures, mutagenesis, metal ion analysis, and enzyme kinetics of both MolA and PuhB establish that these enzymes utilize a mononuclear active site. However, bioinformatics and structural comparisons reveal that the closest putative ancestor of these enzymes had a binuclear active site, indicating that a binuclear-mononuclear transition has occurred. These proteins may represent examples of evolution modifying the characteristics of existing catalysts to satisfy new requirements, specifically, metal ion rearrangement leading to large leaps in activity that would not otherwise be possible. PMID:25636851

  11. CD177: A member of the Ly-6 gene superfamily involved with neutrophil proliferation and polycythemia vera

    Directory of Open Access Journals (Sweden)

    Bettinotti Maria

    2004-03-01

    Full Text Available Abstract Genes in the Leukocyte Antigen 6 (Ly-6 superfamily encode glycosyl-phosphatidylinositol (GPI anchored glycoproteins (gp with conserved domains of 70 to 100 amino acids and 8 to 10 cysteine residues. Murine Ly-6 genes encode important lymphocyte and hematopoietic stem cell antigens. Recently, a new member of the human Ly-6 gene superfamily has been described, CD177. CD177 is polymorphic and has at least two alleles, PRV-1 and NB1. CD177 was first described as PRV-1, a gene that is overexpressed in neutrophils from approximately 95% of patients with polycythemia vera and from about half of patients with essential thrombocythemia. CD177 encodes NB1 gp, a 58–64 kD GPI gp that is expressed by neutrophils and neutrophil precursors. NB1 gp carries Human Neutrophil Antigen (HNA-2a. Investigators working to identify the gene encoding NB1 gp called the CD177 allele they described NB1. NB1 gp is unusual in that neutrophils from some healthy people lack the NB1 gp completely and in most people NB1 gp is expressed by a subpopulation of neutrophils. The function of NB1 gp and the role of CD177 in the pathogenesis and clinical course of polycythemia vera and essential thrombocythemia are not yet known. However, measuring neutrophil CD177 mRNA levels has become an important marker for diagnosing the myeloproliferative disorders polycythemia vera and essential thrombocythemia.

  12. Crystal structure and potential physiological role of zebra fish thioesterase superfamily member 2 (fTHEM2)

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Shanshan; Li, Han; Gao, Feng; Zhou, Ying, E-mail: zhouying@moon.ibp.ac.cn

    2015-08-07

    Thioesterase superfamily member 2 (THEM2) is an essential protein for mammalian cell proliferation. It belongs to the hotdog-fold thioesterase superfamily and catalyzes hydrolysis of thioester bonds of acyl-CoA in vitro, while its in vivo function remains unrevealed. In this study, Zebra fish was selected as a model organism to facilitate the investigations on THEM2. First, we solved the crystal structure of recombinant fTHEM2 at the resolution of 1.80 Å, which displayed a similar scaffolding as hTHEM2. Second, functional studies demonstrated that fTHEM2 is capable of hydrolyzing palmitoyl-CoA in vitro. In addition, injection of morpholino against fTHEM2 at one-cell stage resulted in distorted early embryo development, including delayed cell division, retarded development and increased death rate. The above findings validated our hypothesis that fTHEM2 could serve as an ideal surrogate for studying the physiological functions of THEM2. - Highlights: • The crystal structure of recombinant fTHEM2 is presented. • fTHEM2 is capable of hydrolyzing palmitoyl-CoA. • The influence of fTHEM2 on early embryo development is demonstrated.

  13. Melanophore migration and survival during zebrafish adult pigment stripe development require the immunoglobulin superfamily adhesion molecule Igsf11.

    Directory of Open Access Journals (Sweden)

    Dae Seok Eom

    Full Text Available The zebrafish adult pigment pattern has emerged as a useful model for understanding the development and evolution of adult form as well as pattern-forming mechanisms more generally. In this species, a series of horizontal melanophore stripes arises during the larval-to-adult transformation, but the genetic and cellular bases for stripe formation remain largely unknown. Here, we show that the seurat mutant phenotype, consisting of an irregular spotted pattern, arises from lesions in the gene encoding Immunoglobulin superfamily member 11 (Igsf11. We find that Igsf11 is expressed by melanophores and their precursors, and we demonstrate by cell transplantation and genetic rescue that igsf11 functions autonomously to this lineage in promoting adult stripe development. Further analyses of cell behaviors in vitro, in vivo, and in explant cultures ex vivo demonstrate that Igsf11 mediates adhesive interactions and that mutants for igsf11 exhibit defects in both the migration and survival of melanophores and their precursors. These findings identify the first in vivo requirements for igsf11 as well as the first instance of an immunoglobulin superfamily member functioning in pigment cell development and patterning. Our results provide new insights into adult pigment pattern morphogenesis and how cellular interactions mediate pattern formation.

  14. Evolution of plant virus movement proteins from the 30K superfamily and of their homologs integrated in plant genomes

    International Nuclear Information System (INIS)

    Homologs of Tobacco mosaic virus 30K cell-to-cell movement protein are encoded by diverse plant viruses. Mechanisms of action and evolutionary origins of these proteins remain obscure. We expand the picture of conservation and evolution of the 30K proteins, producing sequence alignment of the 30K superfamily with the broadest phylogenetic coverage thus far and illuminating structural features of the core all-beta fold of these proteins. Integrated copies of pararetrovirus 30K movement genes are prevalent in euphyllophytes, with at least one copy intact in nearly every examined species, and mRNAs detected for most of them. Sequence analysis suggests repeated integrations, pseudogenizations, and positive selection in those provirus genes. An unannotated 30K-superfamily gene in Arabidopsis thaliana genome is likely expressed as a fusion with the At1g37113 transcript. This molecular background of endopararetrovirus gene products in plants may change our view of virus infection and pathogenesis, and perhaps of cellular homeostasis in the hosts. - Highlights: • Sequence region shared by plant virus “30K” movement proteins has an all-beta fold. • Most euphyllophyte genomes contain integrated copies of pararetroviruses. • These integrated virus genomes often include intact movement protein genes. • Molecular evidence suggests that these “30K” genes may be selected for function

  15. IMGT unique numbering for MHC groove G-DOMAIN and MHC superfamily (MhcSF) G-LIKE-DOMAIN

    DEFF Research Database (Denmark)

    Lefranc, Marie-Paule; Duprat, E.; Kaas, Quentin;

    2005-01-01

    unique numbering leads, for the first time, to the standardized description of the mutations, allelic polymorphisms, two-dimensional (2D) representations and three-dimensional (3D) structures of the G-DOMAINs and G-LIKE-DOMAINs in any species, and therefore, is highly valuable for their comparative...... immune system (RPI) of human and other vertebrates. The NUMEROTATION concept of IMGT-ONTOLOGY has allowed to define a unique numbering for the variable domains (V-DOMAINs) and constant domains (C-DOMAINs) of the IG and TR, which has been extended to the V-LIKE-DOMAINs and C-LIKE-DOMAINs of the...... immunoglobulin superfamily (IgSF) proteins other than the IG and TR (Dev Comp Immunol 27:55-77, 2003; 29:185-203, 2005). In this paper, we describe the IMGT unique numbering for the groove domains (G-DOMAINs) of the MHC and for the G-LIKE-DOMAINs of the MHC superfamily (MhcSF) proteins other than MHC. This IMGT...

  16. Evolution of plant virus movement proteins from the 30K superfamily and of their homologs integrated in plant genomes

    Energy Technology Data Exchange (ETDEWEB)

    Mushegian, Arcady R., E-mail: mushegian2@gmail.com [Division of Molecular and Cellular Biosciences, National Science Foundation, 4201 Wilson Boulevard, Arlington, VA 22230 (United States); Elena, Santiago F., E-mail: sfelena@ibmcp.upv.es [Instituto de Biología Molecular y Celular de Plantas, CSIC-UPV, 46022 València (Spain); The Santa Fe Institute, Santa Fe, NM 87501 (United States)

    2015-02-15

    Homologs of Tobacco mosaic virus 30K cell-to-cell movement protein are encoded by diverse plant viruses. Mechanisms of action and evolutionary origins of these proteins remain obscure. We expand the picture of conservation and evolution of the 30K proteins, producing sequence alignment of the 30K superfamily with the broadest phylogenetic coverage thus far and illuminating structural features of the core all-beta fold of these proteins. Integrated copies of pararetrovirus 30K movement genes are prevalent in euphyllophytes, with at least one copy intact in nearly every examined species, and mRNAs detected for most of them. Sequence analysis suggests repeated integrations, pseudogenizations, and positive selection in those provirus genes. An unannotated 30K-superfamily gene in Arabidopsis thaliana genome is likely expressed as a fusion with the At1g37113 transcript. This molecular background of endopararetrovirus gene products in plants may change our view of virus infection and pathogenesis, and perhaps of cellular homeostasis in the hosts. - Highlights: • Sequence region shared by plant virus “30K” movement proteins has an all-beta fold. • Most euphyllophyte genomes contain integrated copies of pararetroviruses. • These integrated virus genomes often include intact movement protein genes. • Molecular evidence suggests that these “30K” genes may be selected for function.

  17. Functional complementation of a nitrate reductase defective mutant of a green alga Dunaliella viridis by introducing the nitrate reductase gene.

    Science.gov (United States)

    Sun, Yu; Gao, Xiaoshu; Li, Qiyun; Zhang, Qingqi; Xu, Zhengkai

    2006-08-01

    Nitrate reductase (NR) catalyzes NAD (P) H dependent reduction of nitrate to nitrite. Transformation systems have been established in several species of green algae by nitrate reductase gene functional complementation. In this report, an endogenous NR cDNA (3.4 kb) and a genomic fragment (14.6 kb) containing the NR gene (DvNIA1) were isolated from the D. viridis cDNA and genomic libraries respectively. Southern blot and Northern blot analyses showed that this gene exists as a single copy in D. viridis and is induced by nitrate. To obtain a NR defective mutant as a recipient strain, D. viridis cells were treated with a chemical mutagen and then cultured on a chlorate-containing plate to enrich chlorate tolerant mutants. Southern analysis showed that one isolate, B14, had a deletion in the DvNIA1 gene region. Using electroporation conditions determined in this laboratory, plasmid pDVNR containing the intact DvNIA1 gene has been electroporated into the defective mutant B14. Strains retaining a nitrate assimilation phenotype were obtained from nitrate plates after spreading the electroporated cells. In some individual strains, transcription of the introduced gene was detected. NR activity in these strains was slightly higher than that in the defective B14 cell, but excretion of nitrite into culture media was almost as high as that of the wild-type cell. Possible episomal presence of the introduced DNA in D. viridis is discussed. PMID:16797881

  18. Vibrio harveyi Nitroreductase Is Also a Chromate Reductase

    Science.gov (United States)

    Kwak, Young Hak; Lee, Dong Seok; Kim, Han Bok

    2003-01-01

    The chromate reductase purified from Pseudomonas ambigua was found to be homologous with several nitroreductases. Escherichia coli DH5α and Vibrio harveyi KCTC 2720 nitroreductases were chosen for the present study, and their chromate-reducing activities were determined. A fusion between glutathione S-transferase (GST) and E. coli DH5α NfsA (GST-EcNfsA), a fusion between GST and E. coli DH5α NfsB (GST-EcNfsB), and a fusion between GST and V. harveyi KCTC 2720 NfsA (GST-VhNfsA) were prepared for their overproduction and easy purification. GST-EcNfsA, GST-EcNFsB, and GST-VhNFsA efficiently reduced nitrofurazone and 2,4,6-trinitrotoluene (TNT) as their nitro substrates. The Km values for GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA for chromate reduction were 11.8, 23.5, and 5.4 μM, respectively. The Vmax values for GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA were 3.8, 3.9, and 10.7 nmol/min/mg of protein, respectively. GST-VhNfsA was the most effective of the three chromate reductases, as determined by each Vmax/Km value. The optimal temperatures of GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA for chromate reduction were 55, 30, and 30°C, respectively. Thus, it is confirmed that nitroreductase can also act as a chromate reductase. Nitroreductases may be used in chromate remediation. GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA have a molecular mass of 50 kDa and exist as a monomer in solution. Thin-layer chromatography showed that GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA contain FMN as a cofactor. GST-VhNfsA reduced Cr(VI) to Cr(III). Cr(III) was much less toxic to E. coli than Cr(VI). PMID:12902220

  19. Structure of a bacterial homologue of vitamin K epoxide reductase

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weikai; Schulman, Sol; Dutton, Rachel J.; Boyd, Dana; Beckwith, Jon; Rapoport, Tom A. (Harvard-Med); (HHMI)

    2010-03-19

    Vitamin K epoxide reductase (VKOR) generates vitamin K hydroquinone to sustain {gamma}-carboxylation of many blood coagulation factors. Here, we report the 3.6 {angstrom} crystal structure of a bacterial homologue of VKOR from Synechococcus sp. The structure shows VKOR in complex with its naturally fused redox partner, a thioredoxin-like domain, and corresponds to an arrested state of electron transfer. The catalytic core of VKOR is a four transmembrane helix bundle that surrounds a quinone, connected through an additional transmembrane segment with the periplasmic thioredoxin-like domain. We propose a pathway for how VKOR uses electrons from cysteines of newly synthesized proteins to reduce a quinone, a mechanism confirmed by in vitro reconstitution of vitamin K-dependent disulphide bridge formation. Our results have implications for the mechanism of the mammalian VKOR and explain how mutations can cause resistance to the VKOR inhibitor warfarin, the most commonly used oral anticoagulant.

  20. Aspects of Ribonucleotide Reductase Regulation and Genome Stability

    DEFF Research Database (Denmark)

    Nielsen, Helena Berner Nedergaard

    In all living cells, synthesis of the DNA building blocks, deoxyribonucleoside triphosphates (dNTPs), is tightly regulated to ensure a precise DNA replication to maintain genomic stability. Ribonucleotide reductase (RNR) is the enzyme responsible for reducing ribonucleotides to their deoxy forms....... RNR consists of two subunits: R1 and R2, both of which are essential. The activity of RNR is strictly regulated to control the dNTP pool, both by allosteric feedback control and transcriptional and translational controls. Four inhibitory proteins of RNR have been identified in yeast: Spd1 in fission...... yeast, and Sml1, Hug1, and Dif1 in budding yeast. An elevated, as well as a reduced dNTP pool is shown to lead to an increase in spontaneous mutation rates, hence regulation of RNR is very important in order to maintain genomic stability. No human inhibitory proteins have yet been identified to regulate...

  1. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria;

    2008-01-01

    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences. The...... present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism and......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  2. Crystal structure of isoflavone reductase from alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Wang, Xiaoqiang; He, Xianzhi; Lin, Jianqiao; Shao, Hui; Chang, Zhenzhan; Dixon, Richard A

    2006-05-19

    Isoflavonoids play important roles in plant defense and exhibit a range of mammalian health-promoting activities. Isoflavone reductase (IFR) specifically recognizes isoflavones and catalyzes a stereospecific NADPH-dependent reduction to (3R)-isoflavanone. The crystal structure of Medicago sativa IFR with deletion of residues 39-47 has been determined at 1.6A resolution. Structural analysis, molecular modeling and docking, and comparison with the structures of other NADPH-dependent enzymes, defined the putative binding sites for co-factor and substrate and potential key residues for enzyme activity and substrate specificity. Further mutagenesis has confirmed the role of Lys144 as a catalytic residue. This study provides a structural basis for understanding the enzymatic mechanism and substrate specificity of IFRs as well as the functions of IFR-like proteins. PMID:16600295

  3. Pulse radiolysis studies on superoxide reductase from Treponema pallidum

    CERN Document Server

    Nivière, V; Fontecave, M; Houée-Levin, C

    2015-01-01

    Superoxide reductases (SORs) are small metalloenzymes, which catalyze reduction of O2*- to H2O2. The reaction of the enzyme from Treponema pallidum with superoxide was studied by pulse radiolysis methods. The first step is an extremely fast bi-molecular reaction of the ferrous center with O2, with a rate constant of 6 x 10 (8) M(-1) s(-1). A first intermediate is formed which is converted to a second one with a slower rate constant of 4800 s(-1). This latter value is 10 times higher than the corresponding one previously reported in the case of SOR from Desulfoarculus baarsii. The reconstituted spectra for the two intermediates are consistent with formation of transient iron-peroxide species.

  4. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria; Hansen, Thomas; Wang, August G; Djurovic, Srdjan; Rønningen, Kjersti S; Andreassen, Ole A; Agartz, Ingrid; Werge, Thomas; Terenius, Lars; Hall, Håkan

    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences. The...... present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism and......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  5. Isolation and characterization of nitric oxide reductase from Paracoccus halodenitrificans.

    Science.gov (United States)

    Sakurai, N; Sakurai, T

    1997-11-11

    Nitric oxide reductase was isolated from the membrane fraction of a denitrifying bacterium, Paracoccus halodenitrificans, in the presence of n-dodecyl beta-D-maltoside. A relatively simple and effective procedure to purify NO reductase using DEAE-Toyopearl and hydroxyapatite (ceramic) chromatographies has been developed. The enzyme consisted of two subunits with molecular masses of 20 and 42 kDa associated with the c-type heme and two b-type hemes, respectively. The optical and magnetic circular dichroism (MCD) spectra of the oxidized (as isolated) and reduced enzymes indicated that the heme c is in the low-spin state and the hemes b are in the high- and low-spin states. The EPR spectrum also showed the presence of the split high-spin component (g perpendicular = 6.6, 6.0) and two low spin components (gz,y,x = 2.96, 2.26, 1.46, gz = 3.59). Although the presence of an extra iron was suggested from atomic absorption spectroscopy, a non-heme iron could not be detected by colorimetric titrations using ferene and 2-(5-nitro-2-pyridylazo)- 5-(N-propyl-N-sulfopropylamino)phenolate (PAPS). One of the extra signals at g = 4.3 and 2.00 might come from a non-heme iron, while they may originate from an adventitious iron and a certain nonmetallic radical, respectively. When CO acted on the reduced enzyme, both of the low-spin hemes were not affected, and when NO acted on the reduced enzyme, the optical and MCD spectra were of a mixture of the oxidized and reduced enzymes. Consequently, the reduction of NO was supposed to take place at the high-spin heme b. The heme c and the low-spin heme b centers were considered to function as electron mediators during the intermolecular and intramolecular processes. PMID:9374857

  6. Fatty acyl-CoA reductases of birds

    Directory of Open Access Journals (Sweden)

    Hellenbrand Janine

    2011-12-01

    Full Text Available Abstract Background Birds clean and lubricate their feathers with waxes that are produced in the uropygial gland, a holocrine gland located on their back above the tail. The type and the composition of the secreted wax esters are dependent on the bird species, for instance the wax ester secretion of goose contains branched-chain fatty acids and unbranched fatty alcohols, whereas that of barn owl contains fatty acids and alcohols both of which are branched. Alcohol-forming fatty acyl-CoA reductases (FAR catalyze the reduction of activated acyl groups to fatty alcohols that can be esterified with acyl-CoA thioesters forming wax esters. Results cDNA sequences encoding fatty acyl-CoA reductases were cloned from the uropygial glands of barn owl (Tyto alba, domestic chicken (Gallus gallus domesticus and domestic goose (Anser anser domesticus. Heterologous expression in Saccharomyces cerevisiae showed that they encode membrane associated enzymes which catalyze a NADPH dependent reduction of acyl-CoA thioesters to fatty alcohols. By feeding studies of transgenic yeast cultures and in vitro enzyme assays with membrane fractions of transgenic yeast cells two groups of isozymes with different properties were identified, termed FAR1 and FAR2. The FAR1 group mainly synthesized 1-hexadecanol and accepted substrates in the range between 14 and 18 carbon atoms, whereas the FAR2 group preferred stearoyl-CoA and accepted substrates between 16 and 20 carbon atoms. Expression studies with tissues of domestic chicken indicated that FAR transcripts were not restricted to the uropygial gland. Conclusion The data of our study suggest that the identified and characterized avian FAR isozymes, FAR1 and FAR2, can be involved in wax ester biosynthesis and in other pathways like ether lipid synthesis.

  7. Evidence for a hexaheteromeric methylenetetrahydrofolate reductase in Moorella thermoacetica.

    Science.gov (United States)

    Mock, Johanna; Wang, Shuning; Huang, Haiyan; Kahnt, Jörg; Thauer, Rudolf K

    2014-09-01

    Moorella thermoacetica can grow with H₂ and CO₂, forming acetic acid from 2 CO₂ via the Wood-Ljungdahl pathway. All enzymes involved in this pathway have been characterized to date, except for methylenetetrahydrofolate reductase (MetF). We report here that the M. thermoacetica gene that putatively encodes this enzyme, metF, is part of a transcription unit also containing the genes hdrCBA, mvhD, and metV. MetF copurified with the other five proteins encoded in the unit in a hexaheteromeric complex with an apparent molecular mass in the 320-kDa range. The 40-fold-enriched preparation contained per mg protein 3.1 nmol flavin adenine dinucleotide (FAD), 3.4 nmol flavin mononucleotide (FMN), and 110 nmol iron, almost as predicted from the primary structure of the six subunits. It catalyzed the reduction of methylenetetrahydrofolate with reduced benzyl viologen but not with NAD(P)H in either the absence or presence of oxidized ferredoxin. It also catalyzed the reversible reduction of benzyl viologen with NADH (diaphorase activity). Heterologous expression of the metF gene in Escherichia coli revealed that the subunit MetF contains one FMN rather than FAD. MetF exhibited 70-fold-higher methylenetetrahydrofolate reductase activity with benzyl viologen when produced together with MetV, which in part shows sequence similarity to MetF. Heterologously produced HdrA contained 2 FADs and had NAD-specific diaphorase activity. Our results suggested that the physiological electron donor for methylenetetrahydrofolate reduction in M. thermoacetica is NADH and that the exergonic reduction of methylenetetrahydrofolate with NADH is coupled via flavin-based electron bifurcation with the endergonic reduction of an electron acceptor, whose identity remains unknown. PMID:25002540

  8. The TULIP superfamily of eukaryotic lipid-binding proteins as a mediator of lipid sensing and transport.

    Science.gov (United States)

    Alva, Vikram; Lupas, Andrei N

    2016-08-01

    The tubular lipid-binding (TULIP) superfamily has emerged in recent years as a major mediator of lipid sensing and transport in eukaryotes. It currently encompasses three protein families, SMP-like, BPI-like, and Takeout-like, which share a common fold. This fold consists of a long helix wrapped in a highly curved anti-parallel β-sheet, enclosing a central, lipophilic cavity. The SMP-like proteins, which include subunits of the ERMES complex and the extended synaptotagmins (E-Syts), appear to be mainly located at membrane contacts sites (MCSs) between organelles, mediating inter-organelle lipid exchange. The BPI-like proteins, which include the bactericidal/permeability-increasing protein (BPI), the LPS (lipopolysaccharide)-binding protein (LBP), the cholesteryl ester transfer protein (CETP), and the phospholipid transfer protein (PLTP), are either involved in innate immunity against bacteria through their ability to sense lipopolysaccharides, as is the case for BPI and LBP, or in lipid exchange between lipoprotein particles, as is the case for CETP and PLTP. The Takeout-like proteins, which are comprised of insect juvenile hormone-binding proteins and arthropod allergens, transport, where known, lipid hormones to target tissues during insect development. In all cases, the activity of these proteins is underpinned by their ability to bind large, hydrophobic ligands in their central cavity and segregate them away from the aqueous environment. Furthermore, where they are involved in lipid exchange, recent structural studies have highlighted their ability to establish lipophilic, tubular channels, either between organelles in the case of SMP domains or between lipoprotein particles in the case of CETP. Here, we review the current knowledge on the structure, versatile functions, and evolution of the TULIP superfamily. We propose a deep evolutionary split in this superfamily, predating the Last Eukaryotic Common Ancestor, between the SMP-like proteins, which act on

  9. Computational Identification of the Paralogs and Orthologs of Human Cytochrome P450 Superfamily and the Implication in Drug Discovery

    Directory of Open Access Journals (Sweden)

    Shu-Ting Pan

    2016-06-01

    Full Text Available The human cytochrome P450 (CYP superfamily consisting of 57 functional genes is the most important group of Phase I drug metabolizing enzymes that oxidize a large number of xenobiotics and endogenous compounds, including therapeutic drugs and environmental toxicants. The CYP superfamily has been shown to expand itself through gene duplication, and some of them become pseudogenes due to gene mutations. Orthologs and paralogs are homologous genes resulting from speciation or duplication, respectively. To explore the evolutionary and functional relationships of human CYPs, we conducted this bioinformatic study to identify their corresponding paralogs, homologs, and orthologs. The functional implications and implications in drug discovery and evolutionary biology were then discussed. GeneCards and Ensembl were used to identify the paralogs of human CYPs. We have used a panel of online databases to identify the orthologs of human CYP genes: NCBI, Ensembl Compara, GeneCards, OMA (“Orthologous MAtrix” Browser, PATHER, TreeFam, EggNOG, and Roundup. The results show that each human CYP has various numbers of paralogs and orthologs using GeneCards and Ensembl. For example, the paralogs of CYP2A6 include CYP2A7, 2A13, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 2F1, 2J2, 2R1, 2S1, 2U1, and 2W1; CYP11A1 has 6 paralogs including CYP11B1, 11B2, 24A1, 27A1, 27B1, and 27C1; CYP51A1 has only three paralogs: CYP26A1, 26B1, and 26C1; while CYP20A1 has no paralog. The majority of human CYPs are well conserved from plants, amphibians, fishes, or mammals to humans due to their important functions in physiology and xenobiotic disposition. The data from different approaches are also cross-validated and validated when experimental data are available. These findings facilitate our understanding of the evolutionary relationships and functional implications of the human CYP superfamily in drug discovery.

  10. Nitrite and nitrous oxide reductase regulation by nitrogen oxides in Rhodobacter sphaeroides f. sp. denitrificans IL106.

    Science.gov (United States)

    Sabaty, M; Schwintner, C; Cahors, S; Richaud, P; Verméglio, A

    1999-10-01

    We have cloned the nap locus encoding the periplasmic nitrate reductase in Rhodobacter sphaeroides f. sp. denitrificans IL106. A mutant with this enzyme deleted is unable to grow under denitrifying conditions. Biochemical analysis of this mutant shows that in contrast to the wild-type strain, the level of synthesis of the nitrite and N(2)O reductases is not increased by the addition of nitrate. Growth under denitrifying conditions and induction of N oxide reductase synthesis are both restored by the presence of a plasmid containing the genes encoding the nitrate reductase. This demonstrates that R. sphaeroides f. sp. denitrificans IL106 does not possess an efficient membrane-bound nitrate reductase and that nitrate is not the direct inducer for the nitrite and N(2)O reductases in this species. In contrast, we show that nitrite induces the synthesis of the nitrate reductase. PMID:10498715

  11. The use of 5-alpha reductase inhibitors for the prevention of prostate cancer.

    Science.gov (United States)

    Yu, Eun-mi; El-Ayass, Walid; Aragon-Ching, Jeanny B

    2010-07-01

    The use of 5-alpha-reductase inhibitors has been studied not only in benign prostatic hyperplasia, but as a chemopreventive strategy in prostate cancer. Both finasteride and dutasteride, 5 alpha-reductase inhibitors (5ARI), have been shown to decrease the risk of prostate cancer. The results of the REDUCE trial using the dual alpha-reductase isoenzyme inhibitor dutasteride, has recently been published by Andriole et al. in the New England Journal of Medicine. Certain considerations regarding its use and applicability to men with high risk of developing prostate cancer are herein discussed. PMID:20574153

  12. Characterization and regulation of Leishmania major 3-hydroxy-3-methylglutaryl-CoA reductase

    DEFF Research Database (Denmark)

    Montalvetti, A; Pena Diaz, Javier; Hurtado, R;

    2000-01-01

    In eukaryotes the enzyme 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase catalyses the synthesis of mevalonic acid, a common precursor to all isoprenoid compounds. Here we report the isolation and overexpression of the gene coding for HMG-CoA reductase from Leishmania major. The protein from...... Leishmania lacks the membrane domain characteristic of eukaryotic cells but exhibits sequence similarity with eukaryotic reductases. Highly purified protein was achieved by ammonium sulphate precipitation followed by chromatography on hydroxyapatite. Kinetic parameters were determined for the protozoan...

  13. Virtual screening of plant derived compounds for aldose reductase inhibition using molecular docking.

    Science.gov (United States)

    Muppalaneni, Naresh Babu; Rao, Allam Appa

    2012-01-01

    The role of the aldose reductase in type 2 diabetes is widely described. Therefore, it is of interest to identify plant derived compounds to inhibit its activity. We studied the protein-ligand interaction of 267 compounds from different parts of seven plants (Allium sativum, Coriandrum sativum, Dacus carota, Murrayyakoneigii, Eucalyptus, Calendula officinalis and Lycopersicon esculentum) with aldose reductase as the target protein. Molecular docking and re-scoring of top ten compounds (using GOLD, AutoDock Vina, eHiTS, PatchDock and MEDock) followed by rank-sum technique identified compound allium38 with high binding affinity for aldose reductase. PMID:23275691

  14. Steroidal pyrazolines evaluated as aromatase and quinone reductase-2 inhibitors for chemoprevention of cancer.

    Science.gov (United States)

    Abdalla, Mohamed M; Al-Omar, Mohamed A; Bhat, Mashooq A; Amr, Abdel-Galil E; Al-Mohizea, Abdullah M

    2012-05-01

    The aromatase and quinone reductase-2 inhibition of synthesized heterocyclic pyrazole derivatives fused with steroidal structure for chemoprevention of cancer is reported herein. All compounds were interestingly less toxic than the reference drug (Cyproterone(®)). The aromatase inhibitory activities of these compounds were much more potent than the lead compound resveratrol, which has an IC(50) of 80 μM. In addition, all the compounds displayed potent quinone reductase-2 inhibition. Initially the acute toxicity of the compounds was assayed via the determination of their LD(50). The aromatase and quinone reductase-2 inhibitors resulting from this study have potential value in the treatment and prevention of cancer. PMID:22361454

  15. Radiation Damage and Racemic Protein Crystallography Reveal the Unique Structure of the GASA/Snakin Protein Superfamily.

    Science.gov (United States)

    Yeung, Ho; Squire, Christopher J; Yosaatmadja, Yuliana; Panjikar, Santosh; López, Gemma; Molina, Antonio; Baker, Edward N; Harris, Paul W R; Brimble, Margaret A

    2016-07-01

    Proteins from the GASA/snakin superfamily are common in plant proteomes and have diverse functions, including hormonal crosstalk, development, and defense. One 63-residue member of this family, snakin-1, an antimicrobial protein from potatoes, has previously been chemically synthesized in a fully active form. Herein the 1.5 Å structure of snakin-1, determined by a novel combination of racemic protein crystallization and radiation-damage-induced phasing (RIP), is reported. Racemic crystals of snakin-1 and quasi-racemic crystals incorporating an unnatural 4-iodophenylalanine residue were prepared from chemically synthesized d- and l-proteins. Breakage of the C-I bonds in the quasi-racemic crystals facilitated structure determination by RIP. The crystal structure reveals a unique protein fold with six disulfide crosslinks, presenting a distinct electrostatic surface that may target the protein to microbial cell surfaces. PMID:27145301

  16. Genetic polymorphisms in glutathione S-transferase (GST) superfamily and arsenic metabolism in residents of the Red River Delta, Vietnam

    International Nuclear Information System (INIS)

    To elucidate the role of genetic factors in arsenic metabolism, we investigated associations of genetic polymorphisms in the members of glutathione S-transferase (GST) superfamily with the arsenic concentrations in hair and urine, and urinary arsenic profile in residents in the Red River Delta, Vietnam. Genotyping was conducted for GST ω1 (GSTO1) Ala140Asp, Glu155del, Glu208Lys, Thr217Asn, and Ala236Val, GST ω2 (GSTO2) Asn142Asp, GST π1 (GSTP1) Ile105Val, GST μ1 (GSTM1) wild/null, and GST θ1 (GSTT1) wild/null. There were no mutation alleles for GSTO1 Glu208Lys, Thr217Asn, and Ala236Val in this population. GSTO1 Glu155del hetero type showed higher urinary concentration of AsV than the wild homo type. Higher percentage of DMAV in urine of GSTM1 wild type was observed compared with that of the null type. Strong correlations between GSTP1 Ile105Val and arsenic exposure level and profile were observed in this study. Especially, heterozygote of GSTP1 Ile105Val had a higher metabolic capacity from inorganic arsenic to monomethyl arsenic, while the opposite trend was observed for ability of metabolism from AsV to AsIII. Furthermore, other factors including sex, age, body mass index, arsenic level in drinking water, and genotypes of As (+ 3 oxidation state) methyltransferase (AS3MT) were also significantly co-associated with arsenic level and profile in the Vietnamese. To our knowledge, this is the first study indicating the associations of genetic factors of GST superfamily with arsenic metabolism in a Vietnamese population.

  17. A novel inhibitor of α9α10 nicotinic acetylcholine receptors from Conus vexillum delineates a new conotoxin superfamily.

    Directory of Open Access Journals (Sweden)

    Sulan Luo

    Full Text Available Conotoxins (CTxs selectively target a range of ion channels and receptors, making them widely used tools for probing nervous system function. Conotoxins have been previously grouped into superfamilies according to signal sequence and into families based on their cysteine framework and biological target. Here we describe the cloning and characterization of a new conotoxin, from Conus vexillum, named αB-conotoxin VxXXIVA. The peptide does not belong to any previously described conotoxin superfamily and its arrangement of Cys residues is unique among conopeptides. Moreover, in contrast to previously characterized conopeptide toxins, which are expressed initially as prepropeptide precursors with a signal sequence, a ''pro'' region, and the toxin-encoding region, the precursor sequence of αB-VxXXIVA lacks a ''pro'' region. The predicted 40-residue mature peptide, which contains four Cys, was synthesized in each of the three possible disulfide arrangements. Investigation of the mechanism of action of αB-VxXXIVA revealed that the peptide is a nicotinic acetylcholine receptor (nAChR antagonist with greatest potency against the α9α10 subtype. (1H nuclear magnetic resonance (NMR spectra indicated that all three αB-VxXXIVA isomers were poorly structured in aqueous solution. This was consistent with circular dichroism (CD results which showed that the peptides were unstructured in buffer, but adopted partially helical conformations in aqueous trifluoroethanol (TFE solution. The α9α10 nAChR is an important target for the development of analgesics and cancer chemotherapeutics, and αB-VxXXIVA represents a novel ligand with which to probe the structure and function of this protein.

  18. Tumor necrosis factor receptor superfamily member 9 is upregulated in the endothelium and tumor cells in melanoma brain metastasis

    Directory of Open Access Journals (Sweden)

    Patrick N Harter

    2014-12-01

    Full Text Available Aim: The cytokine receptor tumor necrosis factor receptor superfamily member 9 (TNFRSF9 is mainly considered to be a co-stimulatory activation marker in hematopoietic cells. Several preclinical models have shown a dramatic beneficial effect of treatment approaches targeting TNFRSF9 with agonistic antibodies. However, preliminary clinical phase I/II studies were stopped after the occurrence of several severe deleterious side effects. In a previous study, it was demonstrated that TNFRSF9 was strongly expressed by reactive astrocytes in primary central nervous system (CNS tumors, but was largely absent from tumor or inflammatory cells. The aim of the present study was to address the cellular source of TNFRSF9 expression in the setting of human melanoma brain metastasis, a highly immunogenic tumor with a prominent tropism to the CNS. Methods: Melanoma brain metastasis was analyzed in a cohort of 78 patients by immunohistochemistry for TNFRSF9 and its expression was correlated with clinicopathological parameters including sex, age, survival, tumor size, number of tumor spots, and BRAF V600E expression status. Results: Tumor necrosis factor receptor superfamily member 9 was frequently expressed independently on both melanoma and endothelial cells. In addition, TNFRSF9 was also present on smooth muscle cells of larger vessels and on a subset of lymphomonocytic tumor infiltrates. No association between TNFRSF9 expression and patient survival or other clinicopathological parameters was seen. Of note, several cases showed a gradual increase in TNFRSF9 expression on tumor cells with increasing distance from blood vessels, an observation that might be linked to hypoxia-driven TNFRSF9 expression in tumor cells. Conclusion: The findings indicate that the cellular source of TNFRSF9 in melanoma brain metastasis largely exceeds the lymphomonocytic pool, and therefore further careful (re- assessment of potential TNFRSF9 functions in cell types other than

  19. Analysis of the Active-Site Mechanism of Tyrosyl-DNA Phosphodiesterase I: A Member of the Phospholipase D Superfamily

    Energy Technology Data Exchange (ETDEWEB)

    Gajewski, Stefan; Comeaux, Evan Q.; Jafari, Nauzanene; Bharatham, Nagakumar; Bashford, Donald; White, Stephen W.; van Waardenburg, Robert C.A.M. (UAB); (SJCH)

    2012-03-15

    Tyrosyl-DNA phosphodiesterase I (Tdp1) is a member of the phospholipase D superfamily that hydrolyzes 3'-phospho-DNA adducts via two conserved catalytic histidines - one acting as the lead nucleophile and the second acting as a general acid/base. Substitution of the second histidine specifically to arginine contributes to the neurodegenerative disease spinocerebellar ataxia with axonal neuropathy (SCAN1). We investigated the catalytic role of this histidine in the yeast protein (His432) using a combination of X-ray crystallography, biochemistry, yeast genetics, and theoretical chemistry. The structures of wild-type Tdp1 and His432Arg both show a phosphorylated form of the nucleophilic histidine that is not observed in the structure of His432Asn. The phosphohistidine is stabilized in the His432Arg structure by the guanidinium group that also restricts the access of nucleophilic water molecule to the Tdp1-DNA intermediate. Biochemical analyses confirm that His432Arg forms an observable and unique Tdp1-DNA adduct during catalysis. Substitution of His432 by Lys does not affect catalytic activity or yeast phenotype, but substitutions with Asn, Gln, Leu, Ala, Ser, and Thr all result in severely compromised enzymes and DNA topoisomerase I-camptothecin dependent lethality. Surprisingly, His432Asn did not show a stable covalent Tdp1-DNA intermediate that suggests another catalytic defect. Theoretical calculations revealed that the defect resides in the nucleophilic histidine and that the pK{sub a} of this histidine is crucially dependent on the second histidine and on the incoming phosphate of the substrate. This represents a unique example of substrate-activated catalysis that applies to the entire phospholipase D superfamily.

  20. Mm19, a Mycoplasma meleagridis Major Surface Nuclease that Is Related to the RE_AlwI Superfamily of Endonucleases.

    Science.gov (United States)

    Yacoub, Elhem; Ben Abdelmoumen Mardassi, Boutheina

    2016-01-01

    Mycoplasma meleagridis infection is widespread in turkeys, causing poor growth and feathering, airsacculitis, osteodystrophy, and reduction in hatchability. Like most mycoplasma species, M. meleagridis is characterized by its inability to synthesize purine and pyrimidine nucleotides de novo. Consistent with this intrinsic deficiency, we here report the cloning, expression, and characterization of a M. meleagridis gene sequence encoding a major surface nuclease, referred to as Mm19. Mm19 consists of a 1941-bp ORF encoding a 646-amino-acid polypeptide with a predicted molecular mass of 74,825 kDa. BLASTP analysis revealed a significant match with the catalytic/dimerization domain of type II restriction enzymes of the RE_AlwI superfamily. This finding is consistent with the genomic location of Mm19 sequence, which dispalys characteristics of a typical type II restriction-modification locus. Like intact M. meleagridis cells, the E. coli-expressed Mm19 fusion product was found to exhibit a nuclease activity against plasmid DNA, double-stranded DNA, single-stranded DNA, and RNA. The Mm19-associated nuclease activity was consistently enhanced with Mg2+ divalent cations, a hallmark of type II restriction enzymes. A rabbit hyperimmune antiserum raised against the bacterially expressed Mm19 strongly reacted with M. meleagridis intact cells and fully neutralized the surface-bound nuclease activity. Collectively, the results show that M. meleagridis expresses a strong surface-bound nuclease activity, which is the product of a single gene sequence that is related to the RE_AlwI superfamily of endonucleases. PMID:27010566

  1. Structure of the human CD97 gene: Exon shuffling has generated a new type of seven-span transmembrane molecule related to the secretin receptor superfamily

    Energy Technology Data Exchange (ETDEWEB)

    Hamann, J.; Van Lier, R.A.W. [Univ. of Amsterdam (Netherlands); Hartmann, E. [Max-Delbrueck-Centre for Molecular Medicine, Berlin-Buch (Germany)

    1996-02-15

    This article reports on the structure and genetic mapping of the human CD97 gene, a homologue to the secretin receptor superfamily of cell surface proteins. The detailed organization of the gene, which maps to the short arm of chromosome 19, is given. 18 refs., 1 fig., 1 tab.

  2. PASS2 database for the structure-based sequence alignment of distantly related SCOP domain superfamilies: update to version 5 and added features.

    Science.gov (United States)

    Gandhimathi, Arumugam; Ghosh, Pritha; Hariharaputran, Sridhar; Mathew, Oommen K; Sowdhamini, R

    2016-01-01

    Structure-based sequence alignment is an essential step in assessing and analysing the relationship of distantly related proteins. PASS2 is a database that records such alignments for protein domain superfamilies and has been constantly updated periodically. This update of the PASS2 version, named as PASS2.5, directly corresponds to the SCOPe 2.04 release. All SCOPe structural domains that share less than 40% sequence identity, as defined by the ASTRAL compendium of protein structures, are included. The current version includes 1977 superfamilies and has been assembled utilizing the structure-based sequence alignment protocol. Such an alignment is obtained initially through MATT, followed by a refinement through the COMPARER program. The JOY program has been used for structural annotations of such alignments. In this update, we have automated the protocol and focused on inclusion of new features such as mapping of GO terms, absolutely conserved residues among the domains in a superfamily and inclusion of PDBs, that are absent in SCOPe 2.04, using the HMM profiles from the alignments of the superfamily members and are provided as a separate list. We have also implemented a more user-friendly manner of data presentation and options for downloading more features. PASS2.5 version is available at http://caps.ncbs.res.in/pass2/. PMID:26553811

  3. Bcmfs1, a novel major facilitator superfamily transporter from Botrytis cinerea, provides tolerance towards the natural toxic compounds camptothecin and cercosporin and towards fungicides

    NARCIS (Netherlands)

    Hayashi, K.; Schoonbeek, H.; Waard, De M.A.

    2002-01-01

    Bcmfs1, a novel major facilitator superfamily gene from Botrytis cinerea, was cloned, and replacement and overexpression mutants were constructed to study its function. Replacement mutants showed increased sensitivity to the natural toxic compounds camptothecin and cercosporin, produced by the plant

  4. Association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and age of onset in schizophrenia

    DEFF Research Database (Denmark)

    Vares, Maria; Saetre, Peter; Deng, Hong;

    2010-01-01

    Different lines of evidence indicate that methylenetetrahydrofolate reductase (MTHFR) functional gene polymorphisms, causative in aberrant folate-homocysteine metabolism, are associated with increased vulnerability to several heritable developmental disorders. Opposing views are expressed...

  5. Histochemical Localization of Glutathione Dependent NBT—Reductase in Mouse Skin

    Institute of Scientific and Technical Information of China (English)

    YOESHWERSHUKLA

    2001-01-01

    Objective:Localization of the glutathione dependent Nitroblue tetrazolium(NBT) reductase in fresh frozen sections of mouse skin and possible dependence of NBT reductase on tissue thiol levels has been investigated.Methods:The fresh frozen tissue sections(8m thickness)were prepared and incuated in medium containing NBT,reduced glutathione(GSH) and Phosphate uffer,The staining for GSH was performed with mercury orange.Results:The activity of the NBT-reductase in mouse skin has een found to be localized in the areas rich in glutatione and actively proliferating area of the skin.Conclusion:The activity of the NBT-reductase seems to be dependent on the glutatione contents.

  6. Redesigning alcohol dehydrogenases/reductases for more efficient biosynthesis of enantiopure isomers.

    Science.gov (United States)

    Zhang, Rongzhen; Xu, Yan; Xiao, Rong

    2015-12-01

    Alcohol dehydrogenases/reductases predominantly catalyze the asymmetric biosynthesis of optically pure stereoisomers because of their unique chiral constitutions. The enantioselectivities of alcohol dehydrogenases/reductases are substrate- and cofactor-dependent, and therefore they usually catalyze specific reactions with high enantioselectivity under physiological conditions; this may not be suitable for asymmetric biosynthesis with non-natural substrates or non-natural cofactors, and under nonphysiological conditions. It is therefore necessary to modify alcohol dehydrogenases/reductases using various redesigning tools such as directed evolution and rational design, and their combinations, as well as engineering enzyme modules for more efficient production of "non-natural" products. In this article, progress in these aspects of alcohol dehydrogenase/reductase design is reviewed, and future challenges are discussed. PMID:26320091

  7. 5α-reductase inhibitors, antiviral and anti-tumor activities of some steroidal cyanopyridinone derivatives.

    Science.gov (United States)

    Al-Mohizea, Abdullah M; Al-Omar, Mohamed A; Abdalla, Mohamed M; Amr, Abdel-Galil E

    2012-01-01

    We herein report the 5α-reductase inhibitors, antiviral and anti-tumor activities of some synthesized heterocyclic cyanopyridone and cyanothiopyridone derivatives fused with steroidal structure. Initially the acute toxicity of the compounds was assayed via the determination of their LD(50). All the compounds, except 3b, were interestingly less toxic than the reference drug (Prednisolone(®)). Seventeen heterocyclic derivatives containing a cyanopyridone or cyanothiopyridone rings fused to a steroidal moiety were synthesized and screened for their 5α-reductase inhibitors, antiviral and anti-tumor activities comparable to that of Anastrozole, Bicalutamide, Efavirenz, Capravirine, Ribavirin, Oseltamivir and Amantadine as the reference drugs. Some of the compounds exhibited better 5α-reductase inhibitors, antiviral and anti-tumor activities than the reference drugs. The detailed 5α-reductase inhibitors, antiviral and anti-tumor activities of the synthesized compounds were reported. PMID:22057085

  8. Comparison of the Stereospecificity and Immunoreactivity of NADH-Ferricyanide Reductases in Plant Membranes

    OpenAIRE

    Fredlund, Kenneth M.; Struglics, André; Widell, Susanne; ASKERLUND, Per; Kader, Jean-Claude; Møller, Ian M.

    1994-01-01

    The substrate stereospecificity of NADH-ferricyanide reductase activities in the inner mitochondrial membrane and peroxisomal membrane of potato (Solanum tuberosum L.) tubers, spinach (Spinacea oleracea L.) leaf plasma membrane, and red beetroot (Beta vulgaris L.) tonoplast were all specific for the [beta]-hydrogen of NADH, whereas the reductases in wheat root (Triticum aestivum L.) endoplasmic reticulum and potato tuber outer mitochondrial membrane were both [alpha]-hydrogen specific. In all...

  9. Nucleotide sequence of a cyanobacterial nifH gene coding for nitrogenase reductase

    OpenAIRE

    Mevarech, Moshe; Rice, Douglas; Haselkorn, Robert

    1980-01-01

    The nucleotide sequence of nifH, the structural gene for nitrogenase reductase (component II or Fe protein of nitrogenase) from the cyanobacterium Anabaena 7120 has been determined. Also reported are 194 bases of the 5′-flanking sequence and 170 bases of the 3′-flanking sequence. The predicted amino acid sequence was compared with that determined for the complete nitrogenase reductase of Clostridium pasteurianum and the cysteine-containing peptides of the protein from Azotobacter vinelandii. ...

  10. Overexpression of Soybean Isoflavone Reductase (GmIFR) Enhances Resistance to Phytophthora sojae in Soybean

    OpenAIRE

    Cheng, Qun; Li, Ninghui; Dong, Lidong; Zhang, Dayong; Fan, Sujie; Jiang, Liangyu; Wang, Xin; Xu, Pengfei; Zhang, Shuzhen

    2015-01-01

    Isoflavone reductase (IFR) is an enzyme involved in the biosynthetic pathway of isoflavonoid phytoalexin in plants. IFRs are unique to the plant kingdom and are considered to have crucial roles in plant response to various biotic and abiotic environmental stresses. Here, we report the characterization of a novel member of the soybean isoflavone reductase gene family GmIFR. Overexpression of GmIFR transgenic soybean exhibited enhanced resistance to Phytophthora sojae. Following stress treatmen...

  11. Design and synthesis of hepatoselective, pyrrole-based HMG-CoA reductase inhibitors.

    Science.gov (United States)

    Pfefferkorn, Jeffrey A; Song, Yuntao; Sun, Kuai-Lin; Miller, Steven R; Trivedi, Bharat K; Choi, Chulho; Sorenson, Roderick J; Bratton, Larry D; Unangst, Paul C; Larsen, Scott D; Poel, Toni-Jo; Cheng, Xue-Min; Lee, Chitase; Erasga, Noe; Auerbach, Bruce; Askew, Valerie; Dillon, Lisa; Hanselman, Jeffrey C; Lin, Zhiwu; Lu, Gina; Robertson, Andrew; Olsen, Karl; Mertz, Thomas; Sekerke, Catherine; Pavlovsky, Alexander; Harris, Melissa S; Bainbridge, Graeme; Caspers, Nicole; Chen, Huifen; Eberstadt, Matthias

    2007-08-15

    This manuscript describes the design and synthesis of a series of pyrrole-based inhibitors of HMG-CoA reductase for the treatment of hypercholesterolemia. Analogs were optimized using structure-based design and physical property considerations resulting in the identification of 44, a hepatoselective HMG-CoA reductase inhibitor with excellent acute and chronic efficacy in a pre-clinical animal models. PMID:17574412

  12. Protein Method for Investigating Mercuric Reductase Gene Expression in Aquatic Environments

    OpenAIRE

    Ogunseitan, O A

    1998-01-01

    A colorimetric assay for NADPH-dependent, mercuric ion-specific oxidoreductase activity was developed to facilitate the investigation of mercuric reductase gene expression in polluted aquatic ecosystems. Protein molecules extracted directly from unseeded freshwater and samples seeded with Pseudomonas aeruginosa PU21(Rip64) were quantitatively assayed for mercuric reductase activity in microtiter plates by stoichiometric coupling of mercuric ion reduction to a colorimetric redox chain through ...

  13. Molecular pharmacology and antitumor activity of palmarumycin based inhibitors of thioredoxin reductase.

    OpenAIRE

    Powis, Garth; Wipf, Peter; Lynch, Stephen M.; Birmingham, Anne; Kirkpatrick, D. Lynn

    2006-01-01

    The cytosolic thioredoxin (Trx) redox system comprising Trx-1 and the NADPH dependent thioredoxin reductase -1 reductase (TrxR-1) is an important regulator of cell growth and survival. Trx-1 is overexpressed in many human tumors where it is associated with increased cell proliferation, decreased apoptosis and decreased patient survival. We hypothesized that TrxR-1 provides a target to inhibit the activity of overexpressed Trx-1 for the development of novel anticancer agents. We found that the...

  14. Soil acidity as affecting micronutrients concentration, nitrato reductase enzyme activity and yield in upland rice plants

    OpenAIRE

    Edemar Moro; Carlos Alexandre Costa Crusciol; Heitor Cantarella; Adriano Stephan Nascente; Adriana Lima Moro; Fernando Broetto

    2013-01-01

    The lowest grain yield of rice under no-tillage system (NTS) in relation to the conventional system may be due to the predominance nitrate in the soil and the low nitrate reductase activity. Another reason may be caused by micronutrient deficiency because of superficially soil acidity corrections. Therefore, the objective of this study was to evaluate the changes caused by soil pH in the N forms in the soil, micronutrients concentration in rice plants, nitrate reductase activity, yield of ric...

  15. INHIBITORY ACTIVITY OF FLAVONOIDS ON THE LENS ALDOSE REDUCTASE OF HEALTHY AND DIABETIC RATS

    OpenAIRE

    M.T. Goodarzi; Zal, F; M. Malakooti; M. R. Safari S. Sadeghian

    2006-01-01

    Aldose reductase is a critical enzyme in the polyol pathway that plays an important role in diabetes mellitus. Inhibition of the activity of this enzyme can prevent cataract in diabetic patients’lenses. In this study the inhibitory effect of two flavonoids, quercetin and naringin, in the activity of aldose reductase in streptozotocin-induced diabetic and healthy rats were investigated. Thirty male rats were divided in six groups. The first, second and third group were healthy rats that receiv...

  16. Glutathione Reductase/Glutathione Is Responsible for Cytotoxic Elemental Sulfur Tolerance via Polysulfide Shuttle in Fungi*

    OpenAIRE

    Sato, Ikuo; Shimatani, Kanami; Fujita, Kensaku; Abe, Tsuyoshi; Shimizu, Motoyuki; Fujii, Tatsuya; Hoshino, Takayuki; Takaya, Naoki

    2011-01-01

    Fungi that can reduce elemental sulfur to sulfide are widely distributed, but the mechanism and physiological significance of the reaction have been poorly characterized. Here, we purified elemental sulfur-reductase (SR) and cloned its gene from the elemental sulfur-reducing fungus Fusarium oxysporum. We found that NADPH-glutathione reductase (GR) reduces elemental sulfur via glutathione as an intermediate. A loss-of-function mutant of the SR/GR gene generated less sulfide from elemental sulf...

  17. Expression of the mouse dihydrofolate reductase complementary deoxyribonucleic acid in simian virus 40 vectors.

    OpenAIRE

    Subramani, S.; Mulligan, R.; Berg, P

    1981-01-01

    A mouse complementary deoxyribonucleic acid segment coding for the enzyme dihydrofolate reductase has been cloned in two general classes of vectors containing simian virus 40 deoxyribonucleic acid: (i) those that can be propagated as virions in permissive cells and (ii) those that can be introduced into and maintained stably in various mammalian cells. Both types of vectors express the mouse dihydrofolate reductase by using signals supplied by simian virus 40 deoxyribonucleic acid sequences. ...

  18. Interaction of Product Analogs with the Active Site of Rhodobacter sphaeroides Dimethylsulfoxide Reductase

    OpenAIRE

    George, Graham N.; Nelson, Kimberly Johnson; Harris, Hugh H.; Doonan, Christian J.; Rajagopalan, K V

    2007-01-01

    We report a structural characterization using X-ray absorption spectroscopy of Rhodobacter sphaeroides dimethylsulfoxide (DMSO) reductase reduced with trimethylarsine, and show that this is structurally analogous to the physiologically relevant dimethylsulfide-reduced DMSO reductase. Our data unambiguously indicate that these species should be regarded as formal MoIV species, and indicate a classical coordination complex of trimethylarsine oxide, with no special structural distortions. The si...

  19. In Silico Docking studies of Aldose Reductase Inhibitory activity of selected Flavonoids

    OpenAIRE

    Muthuswamy Umamaheswari; C. S. Aji; Kuppusamy Asokkumar; Thirumalaisamy Sivashanmugam; Varadharajan Subhadradevi; Puliyath Jagannath; Arumugam Madeswaran

    2012-01-01

    New drugs for the inhibition of the enzyme aldose reductase are in development and they have to be screened before being considered for preclinical and clinical evaluation. The current study deals with the evaluation of the cyclooxygenase inhibitory activity of flavonoids using in silico docking studies. In this perspective, flavonoids like Farobin-A, Gericudranin- B, Glaziovianin-A, Rutin, and Xanthotoxin were selected. Epalrestat, a known aldose reductase inhibitor was used as the standard....

  20. Virtual screening of plant derived compounds for aldose reductase inhibition using molecular docking

    OpenAIRE

    Muppalaneni, Naresh Babu; Rao, Allam Appa

    2012-01-01

    The role of the aldose reductase in type 2 diabetes is widely described. Therefore, it is of interest to identify plant derived compounds to inhibit its activity. We studied the protein-ligand interaction of 267 compounds from different parts of seven plants (Allium sativum, Coriandrum sativum, Dacus carota, Murrayyakoneigii, Eucalyptus, Calendula officinalis and Lycopersicon esculentum) with aldose reductase as the target protein. Molecular docking and re-scoring of top ten compounds (using ...

  1. Cooperative function of antioxidant and redox systems against oxidative stress in male reproductive tissues

    Institute of Scientific and Technical Information of China (English)

    JunichiFujii; YoshihitoIuchi; ShingoMatsuki; TatsuyaIshii

    2003-01-01

    Reactive oxygen species (ROS) are produced under oxidative stress, such as high oxygen concentration and during the metabolic consumption of oxygen molecules. Male reproductive tissues appear to be continuously exposed to ROS produced by active metabolism. In addition, spermatozoa must pass through a high oxygen environ-ment during the mating process. Thus, to maintain viable reproductive ability, a protective mechanism against oxida-tive stress is of importance. Here, we overview our current understanding of the cooperative function of antioxidative and redox systems that are involved in male fertility. Superoxide dismutase and glutathione peroxidase are major enzymes that scavenge harmful ROS in male reproductive organs. In turn, glutathione and thioredoxin systems constitute the main redox systems that repair oxidized and damaged molecules and also play a role in regulating a variety of cellular functions. While glutathione functions as an antioxidant by donating electrons to glutathione peroxidase and thioredoxin donates electrons to peroxiredoxin as a counterpart of glutathione peroxidase. In addition,aldo-keto reductases, which detoxify carbonyl compounds produced by oxidative stress, are present at high levels in the epithelia of the genital tract and Sertoli cells of the testis. Since these systems are involved in cross-talk, a comprehensive understanding will be required to maintain the physiological functions of male reproductive system.( Asian J Andro12003 Sep; 5: 231-242)

  2. DIFFERENTIAL PROTEOME ANALYSIS OF THE MALE AND FEMALE ANTENNAE FROM Holotrichia parallela.

    Science.gov (United States)

    Zhang, Ju-Hong; Wang, Shang; Yang, Shuang; Yi, Jiankun; Liu, Yan; Xi, Jing-Hui

    2016-08-01

    To understand the olfactory mechanisms of Holotrichia parallela antennae in detecting volatile compounds in the environment, protein profiles of H. parallela antennae were analyzed using two-dimensional electrophoresis followed by mass spectrometry and bioinformatics analyses. Approximately 1,100 protein spots in silver staining gel were detected. Quantitative image analysis revealed that in total 47 protein spots showed significant changes in different genders of adult antennae. Thirty-five differentially expressed proteins were identified by Matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF/TOF) tandem mass spectrometer, among which 65.7% are involved in carbohydrate and energy metabolism, antioxidant system, transport, and amino acid/nucleotide metabolism. Some proteins identified here have not been reported previously in insect antennae. Identified male-biased proteins included odorant-binding protein 4, pheromone-binding protein-related protein 2, odorant-binding protein 14, prophenoloxidase-I, acyl-CoA dehydrogenase, aldo-keto reductase-like, carbamoyl phosphate synthetase, etc. whereas some proteins are female biased, such as antennae-rich cytochrome P450, aldehyde dehydrogenase, and putative glutamine synthetase. Alterations in the levels of some proteins were further confirmed by real time polymerase chain reaction (RT-PCR). The proteomic resources displayed here are valuable for the discovery of proteins from H. parallela antennae. PMID:27396371

  3. Facile fabrication of CdSe/CdS quantum dots and their application on the screening of colorectal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Hongfeng; Dong, Quanjin, E-mail: qjdong1508@163.com [Zhejiang Provincial People’s Hospital, Department of Colorectal Surgery (China); Hu, Li [Nanjing University of Science and Technology, School of Environmental and Biological Engineering (China); Tu, Shiliang; Chai, Rui; Dai, Qiaoqiong [Zhejiang Provincial People’s Hospital, Department of Colorectal Surgery (China)

    2015-11-15

    In this paper, a facile aqueous route to water-soluble CdSe/CdS quantum dots (QDs) under mild conditions has been developed. The samples were characterized by means of transmission electron microscopy, energy-dispersive X-ray spectroscopy, and photoluminescence (PL) spectroscopy. The PL property of the QDs can be controlled by adjusting the reaction time. The CdSe/CdS QDs after 48-h reaction with size of 5 nm have the strongest PL intensity located at 553 nm, and the highest quantum yield of 19.9 %. The obtained QDs were applied for the colorectal cancer screening. The QDs could be conjugated with antibody of aldo-keto reductase family 1, member B10 (AKR1B10) for the detection of AKR1B10. The AKR1B10 in PBS/5 % serum solution with concentration of 1 ng/mL could be well calibrated, and the limit of detection could be lower than 0.05 ng/mL.

  4. Methyl Jasmonate: Putative Mechanisms of Action on Cancer Cells Cycle, Metabolism, and Apoptosis

    Directory of Open Access Journals (Sweden)

    Italo Mario Cesari

    2014-01-01

    Full Text Available Methyl jasmonate (MJ, an oxylipid that induces defense-related mechanisms in plants, has been shown to be active against cancer cells both in vitro and in vivo, without affecting normal cells. Here we review most of the described MJ activities in an attempt to get an integrated view and better understanding of its multifaceted modes of action. MJ (1 arrests cell cycle, inhibiting cell growth and proliferation, (2 causes cell death through the intrinsic/extrinsic proapoptotic, p53-independent apoptotic, and nonapoptotic (necrosis pathways, (3 detaches hexokinase from the voltage-dependent anion channel, dissociating glycolytic and mitochondrial functions, decreasing the mitochondrial membrane potential, favoring cytochrome c release and ATP depletion, activating pro-apoptotic, and inactivating antiapoptotic proteins, (4 induces reactive oxygen species mediated responses, (5 stimulates MAPK-stress signaling and redifferentiation in leukemia cells, (6 inhibits overexpressed proinflammatory enzymes in cancer cells such as aldo-keto reductase 1 and 5-lipoxygenase, and (7 inhibits cell migration and shows antiangiogenic and antimetastatic activities. Finally, MJ may act as a chemosensitizer to some chemotherapics helping to overcome drug resistant. The complete lack of toxicity to normal cells and the rapidity by which MJ causes damage to cancer cells turn MJ into a promising anticancer agent that can be used alone or in combination with other agents.

  5. Oxidative Stress and Carbonyl Lesions in Ulcerative Colitis and Associated Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Zhiqi Wang

    2016-01-01

    Full Text Available Oxidative stress has long been known as a pathogenic factor of ulcerative colitis (UC and colitis-associated colorectal cancer (CAC, but the effects of secondary carbonyl lesions receive less emphasis. In inflammatory conditions, reactive oxygen species (ROS, such as superoxide anion free radical (O2∙-, hydrogen peroxide (H2O2, and hydroxyl radical (HO∙, are produced at high levels and accumulated to cause oxidative stress (OS. In oxidative status, accumulated ROS can cause protein dysfunction and DNA damage, leading to gene mutations and cell death. Accumulated ROS could also act as chemical messengers to activate signaling pathways, such as NF-κB and p38 MAPK, to affect cell proliferation, differentiation, and apoptosis. More importantly, electrophilic carbonyl compounds produced by lipid peroxidation may function as secondary pathogenic factors, causing further protein and membrane lesions. This may in turn exaggerate oxidative stress, forming a vicious cycle. Electrophilic carbonyls could also cause DNA mutations and breaks, driving malignant progression of UC. The secondary lesions caused by carbonyl compounds may be exceptionally important in the case of host carbonyl defensive system deficit, such as aldo-keto reductase 1B10 deficiency. This review article updates the current understanding of oxidative stress and carbonyl lesions in the development and progression of UC and CAC.

  6. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    Science.gov (United States)

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both. © 2015 Japanese Society of Animal Science. PMID:26388291

  7. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses

    Science.gov (United States)

    Meena, Seema; Kumar, Sarma R.; Venkata Rao, D. K.; Dwivedi, Varun; Shilpashree, H. B.; Rastogi, Shubhra; Shasany, Ajit K.; Nagegowda, Dinesh A.

    2016-01-01

    Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768

  8. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses.

    Science.gov (United States)

    Meena, Seema; Kumar, Sarma R; Venkata Rao, D K; Dwivedi, Varun; Shilpashree, H B; Rastogi, Shubhra; Shasany, Ajit K; Nagegowda, Dinesh A

    2016-01-01

    Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768

  9. The role of glutathione reductase and related enzymes on cellular redox homoeostasis network.

    Science.gov (United States)

    Couto, Narciso; Wood, Jennifer; Barber, Jill

    2016-06-01

    In this review article we examine the role of glutathione reductase in the regulation, modulation and maintenance of cellular redox homoeostasis. Glutathione reductase is responsible for maintaining the supply of reduced glutathione; one of the most abundant reducing thiols in the majority of cells. In its reduced form, glutathione plays key roles in the cellular control of reactive oxygen species. Reactive oxygen species act as intracellular and extracellular signalling molecules and complex cross talk between levels of reactive oxygen species, levels of oxidised and reduced glutathione and other thiols, and antioxidant enzymes such as glutathione reductase determine the most suitable conditions for redox control within a cell or for activation of programmed cell death. Additionally, we discuss the translation and expression of glutathione reductase in a number of organisms including yeast and humans. In yeast and human cells, a single gene expresses more than one form of glutathione reductase, destined for residence in the cytoplasm or for translocation to different organelles; in plants, however, two genes encoding this protein have been described. In general, insects and kinetoplastids (a group of protozoa, including Plasmodia and Trypanosoma) do not express glutathione reductase or glutathione biosynthetic enzymes. Instead, they express either the thioredoxin system or the trypanothione system. The thioredoxin system is also present in organisms that have the glutathione system and there may be overlapping functions with cross-talk between the two systems. Finally we evaluate therapeutic targets to overcome oxidative stress associated cellular disorders. PMID:26923386

  10. INHIBITION OF TYPE I 5α-REDUCTASE BY MEDICINAL PLANT EXTRACTS

    Directory of Open Access Journals (Sweden)

    Patil Vijaya

    2011-03-01

    Full Text Available Type I 5α-reductase has been implicated in skin disorders such as acne, hirsutism and male pattern baldness and its inhibition offers a potential treatment for these disorders. The aim of this study was to investigate the inhibition of type I 5α-reductase activity by extracts from Indian medicinal plants. Plant extracts were screened and selected based on their ability to inhibit Propionibacterium acnes and Staphylococcus epidermidis. Since type I 5α-reductase metabolises testosterone to Δ4-androstene-3, 17-dione, the activity of enzyme was determined using RIA for testosterone and Δ4-androstene-3, 17-dione. It was found that methanolic extract of Embelia ribes was a potent inhibitor of type I 5α-reductase (IC50:100μg/mL. Extracts of Vitex negundo, Terminalia chebula, and Terminalia bellerica which also inhibited type I 5α-reductase (IC50: 200-390 μg /mL. Therefore herbal formulation of these plant extracts may be used in the treatment of skin disorders involving type I 5α-reductase.

  11. Nitrate reductase activity and its relationship with applied nitrogen in soybean

    International Nuclear Information System (INIS)

    Field experiments were conducted to study the nitrate reductase activity and its relationship to nitrogen by using frame tests (pot without bottom), sand culture and 15N-urea at transplanting in soybean variety Suinong 14. Results showed that the activity of nitrate reductase in leaf changed as a signal peak curve with the soybean growth, lower in vegetative growth phase, higher in reproductive growth period and reached the peak in blooming period, then decreased gradually. Nitrogen application showed obvious effect on the nitrate reductase activity. The activities of nitrate reductase in leaves followed the order of N135 > N90 > N45 > N0 in vegetative growth stage, no clear regularity was found during the whole reproductive growth period. The activities of nitrate reductase in leaves were accorded with the order of upper leaves > mid leaves > lower leaves, and it was very significant differences (P15N labeling method during beginning seed stage and full seed stage shown that 15N abundance in various organs at different node position also followed the same order, suggesting that high level of nitrate reductase activity at upper leaves of soybean promoted the assimilation of NO3-. (authors)

  12. Isobutyraldehyde production from Escherichia coli by removing aldehyde reductase activity

    Directory of Open Access Journals (Sweden)

    Rodriguez Gabriel M

    2012-06-01

    Full Text Available Abstract Background Increasing global demand and reliance on petroleum-derived chemicals will necessitate alternative sources for chemical feedstocks. Currently, 99% of chemical feedstocks are derived from petroleum and natural gas. Renewable methods for producing important chemical feedstocks largely remain unaddressed. Synthetic biology enables the renewable production of various chemicals from microorganisms by constructing unique metabolic pathways. Here, we engineer Escherichia coli for the production of isobutyraldehyde, which can be readily converted to various hydrocarbons currently derived from petroleum such as isobutyric acid, acetal, oxime and imine using existing chemical catalysis. Isobutyraldehyde can be readily stripped from cultures during production, which reduces toxic effects of isobutyraldehyde. Results We adopted the isobutanol pathway previously constructed in E. coli, neglecting the last step in the pathway where isobutyraldehyde is converted to isobutanol. However, this strain still overwhelmingly produced isobutanol (1.5 g/L/OD600 (isobutanol vs 0.14 g/L/OD600 (isobutyraldehyde. Next, we deleted yqhD which encodes a broad-substrate range aldehyde reductase known to be active toward isobutyraldehyde. This strain produced isobutanol and isobutyraldehyde at a near 1:1 ratio, indicating further native isobutyraldehyde reductase (IBR activity in E. coli. To further eliminate isobutanol formation, we set out to identify and remove the remaining IBRs from the E. coli genome. We identified 7 annotated genes coding for IBRs that could be active toward isobutyraldehyde: adhP, eutG, yiaY, yjgB, betA, fucO, eutE. Individual deletions of the genes yielded only marginal improvements. Therefore, we sequentially deleted all seven of the genes and assessed production. The combined deletions greatly increased isobutyraldehyde production (1.5 g/L/OD600 and decreased isobutanol production (0.4 g/L/OD600. By assessing production by

  13. Characterization of two alkyl hydroperoxide reductase C homologs alkyl hydroperoxide reductase C_H1 and alkyl hydroperoxide reductase C_H2 in Bacillus subtilis

    Institute of Scientific and Technical Information of China (English)

    Mee-Kyung; Cha; Yoo-Jeen; Bae; Kyu-Jeong; Kim; Byung-Joon; Park; Il-Han; Kim

    2015-01-01

    AIM: To identify alkyl hydroperoxide reductase subunit C(AhpC) homologs in Bacillus subtilis(B. subtilis) and to characterize their structural and biochemical properties. AhpC is responsible for the detoxification of reactive oxygen species in bacteria.METHODS: Two AhpC homologs(AhpC_H1 and AhpC_H2) were identified by searching the B. subtilis database; these were then cloned and expressed in Escherichia coli. AhpC mutants carrying substitutions of catalytically important Cys residues(C37S, C47 S, C166 S, C37/47 S, C37/166 S, C47/166 S, and C37/47/166 S for AhpC_H1; C52 S, C169 S, and C52/169 S for AhpC_H2) were obtained by site-directed mutagenesis and purified, and their structure-function relationship was analyzed. The B. subtilis ahp C genes were disrupted by the short flanking homology method, and the phenotypes of the resulting AhpC-deficient bacteria were examined.RESULTS: Comparative characterization of AhpC homologs indicates that AhpC_H1 contains an extra C37, which forms a disulfide bond with the peroxidatic C47, and behaves like an atypical 2-Cys AhpC, while AhpC_H2 functions like a typical 2-Cys AhpC. Tryptic digestion analysis demonstrated the presence of intramolecular Cys37-Cys47 linkage, which could be reduced by thioredoxin, resulting in the association of the dimer into higher-molecular-mass complexes. Peroxidase activity analysis of Cys→Ser mutants indicated that three Cys residues were involved in the catalysis. AhpC_H1 was resistant to inactivation by peroxide substrates, but had lower activity at physiological H2O2 concentrations compared to AhpC_H2, suggesting that in B. subtilis, the enzymes may be physiologically functional at different substrate concentrations. The exposure to organic peroxides induced AhpC_H1 expression, while AhpC_H1-deficient mutants exhibited growth retardation in the stationary phase, suggesting the role of AhpC_H1 as an antioxidant scavenger of lipid hydroperoxides and a stress-response factor in B. subtilis

  14. Binding of Natural and Synthetic Polyphenols to Human Dihydrofolate Reductase

    Directory of Open Access Journals (Sweden)

    José Neptuno Rodríguez-López

    2009-12-01

    Full Text Available Dihydrofolate reductase (DHFR is the subject of intensive investigation since it appears to be the primary target enzyme for antifolate drugs. Fluorescence quenching experiments show that the ester bond-containing tea polyphenols (--epigallocatechin gallate (EGCG and (--epicatechin gallate (ECG are potent inhibitors of DHFR with dissociation constants (KD of 0.9 and 1.8 μM, respectively, while polyphenols lacking the ester bound gallate moiety [e.g., (--epigallocatechin (EGC and (--epicatechin (EC] did not bind to this enzyme. To avoid stability and bioavailability problems associated with tea catechins we synthesized a methylated derivative of ECG (3-O-(3,4,5-trimethoxybenzoyl-(--epicatechin; TMECG, which effectively binds to DHFR (KD = 2.1 μM. In alkaline solution, TMECG generates a stable quinone methide product that strongly binds to the enzyme with a KD of 8.2 nM. Quercetin glucuronides also bind to DHFR but its effective binding was highly dependent of the sugar residue, with quercetin-3-xyloside being the stronger inhibitor of the enzyme with a KD of 0.6 μM. The finding that natural polyphenols are good inhibitors of human DHFR could explain the epidemiological data on their prophylactic effects for certain forms of cancer and open a possibility for the use of natural and synthetic polyphenols in cancer chemotherapy.

  15. Rapid identification of aldose reductase inhibitory compounds from Perilla frutescens.

    Science.gov (United States)

    Paek, Ji Hun; Shin, Kuk Hyun; Kang, Young-Hee; Lee, Jae-Yong; Lim, Soon Sung

    2013-01-01

    The ethyl acetate (EtOAc) soluble fraction of methanol extracts of Perilla frutescens (P. frutescens) inhibits aldose reductase (AR), the key enzyme in the polyol pathway. Our investigation of inhibitory compounds from the EtOAc soluble fraction of P. frutescens was followed by identification of the inhibitory compounds by a combination of HPLC microfractionation and a 96-well enzyme assay. This allowed the biological activities to be efficiently matched with selected HPLC peaks. Structural analyses of the active compounds were performed by LC-MS(n). The main AR inhibiting compounds were tentatively identified as chlorogenic acid and rosmarinic acid by LC-MS(n). A two-step high speed counter current chromatography (HSCCC) isolation method was developed with a solvent system of n-hexane-ethyl acetate-methanol-water at 1.5:5:1:5, v/v and 3:7:5:5, v/v. The chemical structures of the isolated compounds were determined by (1)H- and (13)C-nuclear magnetic resonance spectrometry (NMR). The main compounds inhibiting AR in the EtOAc fraction of methanol extracts of P. frutescens were identified as chlorogenic acid (2) (IC50 = 3.16 μ M), rosmarinic acid (4) (IC50 = 2.77 μ M), luteolin (5) (IC50 = 6.34 μ M), and methyl rosmarinic acid (6) (IC50 = 4.03 μ M). PMID:24308003

  16. Expression analysis of dihydroflavonol 4-reductase genes in Petunia hybrida.

    Science.gov (United States)

    Chu, Y X; Chen, H R; Wu, A Z; Cai, R; Pan, J S

    2015-01-01

    Dihydroflavonol 4-reductase (DFR) genes from Rosa chinensis (Asn type) and Calibrachoa hybrida (Asp type), driven by a CaMV 35S promoter, were integrated into the petunia (Petunia hybrida) cultivar 9702. Exogenous DFR gene expression characteristics were similar to flower-color changes, and effects on anthocyanin concentration were observed in both types of DFR gene transformants. Expression analysis showed that exogenous DFR genes were expressed in all of the tissues, but the expression levels were significantly different. However, both of them exhibited a high expression level in petals that were starting to open. The introgression of DFR genes may significantly change DFR enzyme activity. Anthocyanin ultra-performance liquid chromatography results showed that anthocyanin concentrations changed according to DFR enzyme activity. Therefore, the change in flower color was probably the result of a DFR enzyme change. Pelargonidin 3-O-glucoside was found in two different transgenic petunias, indicating that both CaDFR and RoDFR could catalyze dihydrokaempferol. Our results also suggest that transgenic petunias with DFR gene of Asp type could biosynthesize pelargonidin 3-O-glucoside. PMID:25966276

  17. 5alpha-reductase: history and clinical importance.

    Science.gov (United States)

    Marks, Leonard S

    2004-01-01

    The treatment of men with symptomatic benign prostatic hyperplasia (BPH) has shifted dramatically from surgery to drug therapy over the past decade. The revolution in BPH treatment began with the discovery of congenital 5alpha-reductase (5AR) deficiency, leading to the appreciation of 2 different androgenic hormones: testosterone, which mediates overt masculinization in the adult male, and dihydrotestosterone (DHT), which mediates prostatic growth, acne, facial beard, and male pattern baldness. Inhibition of DHT in adults results in prostatic shrinkage and symptomatic relief in many men, without the side effects seen with conventional androgen-deprivation therapy. The 5AR inhibitor drugs (finasteride and the dual inhibitor, dutasteride) are able to ablate the accumulation of intraprostatic DHT, the mechanism most responsible for prostate growth and maintenance. Not only may these drugs relieve symptoms, but they may also alter the natural history of the BPH process. Future indications for the 5ARI drugs could include chemoprevention of prostate cancer, prophylaxis of BPH-related complications, and treatment of BPH-associated hematuria. PMID:16985920

  18. Regulation and degradation of HMGCo-A reductase.

    Science.gov (United States)

    Panda, T; Devi, V Amutha

    2004-12-01

    The enzyme, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) controls the biosynthesis of cholesterol. Hypercholesterolemia and atherosclerosis are critical health risk factors. One way of controlling these risk factors is to manipulate regulation as well as degradation of HMGR. At present, a class of compounds called statins, which are HMGR inhibitors, are used for the treatment of hypercholesterolemia. However, statins suffer major setbacks as their use produces more adverse reactions than the desirable one of inhibiting the enzyme. Genetically engineered forms of HMGR are also studied in primitive life forms like bacteria, but detailed investigation of this enzyme in human systems is certainly required. Extensive studies have been made on the regulatory aspects of this enzyme, but no breakthrough is conspicuous in the clinical background to find an alternative treatment for hypercholesterolemia. The immediate need is to find an alternate way of regulating degradation of the enzyme. This review presents the importance of regulation and degradation of the HMGR enzyme in different systems to gain possible insight into alternative schemes for regulating this enzyme and, if these exist, the feasibility of extending them same to studies in mammalian systems. A high degree of similarity exists between mammalian and yeast HMGR. Detailed studies reported on the regulation and degradation of the yeast enzyme also throw more light on the mammalian system, leading to a better understanding of ways of controlling hypercholesterolemia. PMID:15558272

  19. Methylenetetrahydrofolate Reductase Genotypes, Dietary Habits and Susceptibility to Stomach Cancer

    Institute of Scientific and Technical Information of China (English)

    ChangmingGao; TakezakiToshiro; JianzhongWu; JianhuoDing; YantingLiu; SupingLi; PingSu; XuHu; TianliongXu; HamajimaNobuyuki; TajimaKazuo

    2004-01-01

    OBJECTIVE To study the relation among methylenetetrahydrofolate reductase (MTHFR) C677T genotypes, dietary habits and the risk of stomach cancer (SC).METHODS A case-control study was conducted with 107 cases of SC and 200 population-based controls in Chuzhou district, Huaian, Jiangsu province, China. The epidemiological data were collected, and DNA of peripheral blood leukocytes was obtained from all of the subjects..MTHFR genotypes were detected by PCR-RFLP. RESULTS (1) The prevalence of the MTHFR C/T or T/T genotypes was found to be significantly different between controls (68.5%) and SC cases (79.4%,P=0.0416), the increased risk had an adjusted OR of 1.79 (95%C1:1.01-3.19). (2) Among subjects who had a low intake of garlic or Chinese onion, MTHFR C/T or T/T genotypes significantly increased the risk of developing SC. Among non-tea drinkers or among subjects who had a frequent intakeof meat, the carriers of the MTHFR C/T or T/T genotypes had a higher risk of SC than individuals with the C/C type MTHFR. CONCLUSION The polymorphism of MTHFR C677T was associated with increased risk of developing SC, and that individuals with differing genotypes may have different susceptibilities to SC, based on their exposure level to environmental factors.

  20. Ribonucleotide reductase and cancer: biological mechanisms and targeted therapies.

    Science.gov (United States)

    Aye, Y; Li, M; Long, M J C; Weiss, R S

    2015-04-16

    Accurate DNA replication and repair is essential for proper development, growth and tumor-free survival in all multicellular organisms. A key requirement for the maintenance of genomic integrity is the availability of adequate and balanced pools of deoxyribonucleoside triphosphates (dNTPs), the building blocks of DNA. Notably, dNTP pool alterations lead to genomic instability and have been linked to multiple human diseases, including mitochondrial disorders, susceptibility to viral infection and cancer. In this review, we discuss how a key regulator of dNTP biosynthesis in mammals, the enzyme ribonucleotide reductase (RNR), impacts cancer susceptibility and serves as a target for anti-cancer therapies. Because RNR-regulated dNTP production can influence DNA replication fidelity while also supporting genome-protecting DNA repair, RNR has complex and stage-specific roles in carcinogenesis. Nevertheless, cancer cells are dependent on RNR for de novo dNTP biosynthesis. Therefore, elevated RNR expression is a characteristic of many cancers, and an array of mechanistically distinct RNR inhibitors serve as effective agents for cancer treatment. The dNTP metabolism machinery, including RNR, has been exploited for therapeutic benefit for decades and remains an important target for cancer drug development. PMID:24909171

  1. Alkyl hydroperoxide reductase: a candidate Helicobacter pylori vaccine.

    Science.gov (United States)

    O'Riordan, Avril A; Morales, Veronica Athie; Mulligan, Linda; Faheem, Nazia; Windle, Henry J; Kelleher, Dermot P

    2012-06-01

    Helicobacter pylori (H. pylori) is the most important etiological agent of chronic active gastritis, peptic ulcer disease and gastric cancer. The aim of this study was to evaluate the efficacy of alkyl hydroperoxide reductase (AhpC) and mannosylated AhpC (mAhpC) as candidate vaccines in the C57BL/6J mouse model of H. pylori infection. Recombinant AhpC was cloned, over-expressed and purified in an unmodified form and was also engineered to incorporate N and C-terminal mannose residues when expressed in the yeast Pichia pastoris. Mice were immunized systemically and mucosally with AhpC and systemically with mAhpC prior to challenge with H. pylori. Serum IgG responses to AhpC were determined and quantitative culture was used to determine the efficacy of vaccination strategies. Systemic prophylactic immunization with AhpC/alum and mAhpC/alum conferred protection against infection in 55% and 77.3% of mice, respectively. Mucosal immunization with AhpC/cholera toxin did not protect against infection and elicited low levels of serum IgG in comparison with systemic immunization. These data support the use of AhpC as a potential vaccine candidate against H. pylori infection. PMID:22512976

  2. Loss of quinone reductase 2 function selectively facilitates learning behaviors.

    Science.gov (United States)

    Benoit, Charles-Etienne; Bastianetto, Stephane; Brouillette, Jonathan; Tse, YiuChung; Boutin, Jean A; Delagrange, Philippe; Wong, TakPan; Sarret, Philippe; Quirion, Rémi

    2010-09-22

    High levels of reactive oxygen species (ROS) are associated with deficits in learning and memory with age as well as in Alzheimer's disease. Using DNA microarray, we demonstrated the overexpression of quinone reductase 2 (QR2) in the hippocampus in two models of learning deficits, namely the aged memory impaired rats and the scopolamine-induced amnesia model. QR2 is a cytosolic flavoprotein that catalyzes the reduction of its substrate and enhances the production of damaging activated quinone and ROS. QR2-like immunostaining is enriched in cerebral structures associated with learning behaviors, such as the hippocampal formation and the temporofrontal cortex of rat, mouse, and human brains. In cultured rat embryonic hippocampal neurons, selective inhibitors of QR2, namely S26695 and S29434, protected against menadione-induced cell death by reversing its proapoptotic action. S26695 (8 mg/kg) also significantly inhibited scopolamine-induced amnesia. Interestingly, adult QR2 knock-out mice demonstrated enhanced learning abilities in various tasks, including Morris water maze, object recognition, and rotarod performance test. Other behaviors related to anxiety (elevated plus maze), depression (forced swim), and schizophrenia (prepulse inhibition) were not affected in QR2-deficient mice. Together, these data suggest a role for QR2 in cognitive behaviors with QR2 inhibitors possibly representing a novel therapeutic strategy toward the treatment of learning deficits especially observed in the aged brain. PMID:20861374

  3. Determination of Nitrate Reductase Assay Depending on the Microbial Growth

    International Nuclear Information System (INIS)

    A rapid micro-dilution assay for determination of the antimicrobial susceptibility of different bacterial isolates was developed. This assay is based on the ability of the most of viable organisms to reduce nitrates. The MIC or MBC could be determined by nitrate reductase (NR) only after 30 to 90 min of incubation depending on the behaviour of microbial growth. Bacterial viability is detected by a positive nitrite reduction rather than visible turbidity. The nitrate reduction assay was compared with standard micro-assay using 250 isolates of different taxa against 10 antibiotics belonging to different classes. An excellent agreement of 82.5 % was found between the two methods and only 17.5 % of 1794 trials showed difference in the determined MIC by tow-dilution interval above or below the MIC determined by the turbidimetric method under the same test conditions. However, the nitrate reduction assay was more rapid and sensitive in detecting viable bacteria and so, established an accurate estimate of the minimal inhibitory concentration (MIC) or the minimal bacterial concentration (MBC). The nitrate reduction assay offers the additional advantage that it could be used to determine the MBC without having to subculture the broth. 232 cases of resistance were detected by NR and 4 different media were tested for susceptibility test. The bacterial isolates were exposed to ultra violet (UV) light for different period

  4. Aldose reductase inhibition improves nerve conduction velocity in diabetic patients.

    Science.gov (United States)

    Judzewitsch, R G; Jaspan, J B; Polonsky, K S; Weinberg, C R; Halter, J B; Halar, E; Pfeifer, M A; Vukadinovic, C; Bernstein, L; Schneider, M; Liang, K Y; Gabbay, K H; Rubenstein, A H; Porte, D

    1983-01-20

    To assess the potential role of polyol-pathway activity in diabetic neuropathy, we measured the effects of sorbinil--a potent inhibitor of the key polyol-pathway enzyme aldose reductase--on nerve conduction velocity in 39 stable diabetics in a randomized, double-blind, cross-over trial. During nine weeks of treatment with sorbinil (250 mg per day), nerve conduction velocity was greater than during a nine-week placebo period for all three nerves tested: the peroneal motor nerve (mean increase [+/- S.E.M.], 0.70 +/- 0.24 m per second, P less than 0.008), the median motor nerve (mean increase, 0.66 +/- 0.27, P less than 0.005), and the median sensory nerve (mean increase, 1.16 +/- 0.50, P less than 0.035). Conduction velocity for all three nerves declined significantly within three weeks after cessation of the drug. These effects of sorbinil were not related to glycemic control, which was constant during the study. Although the effect of sorbinil in improving nerve conduction velocity in diabetics was small, the findings suggest that polyol-pathway activity contributes to slowed nerve conduction in diabetics. The clinical applicability of these observations remains to be determined, but they encourage further exploration of this approach to the treatment or prevention of diabetic neuropathy. PMID:6401351

  5. Glyoxalase 1 and glutathione reductase 1 regulate anxiety in mice.

    Science.gov (United States)

    Hovatta, Iiris; Tennant, Richard S; Helton, Robert; Marr, Robert A; Singer, Oded; Redwine, Jeffrey M; Ellison, Julie A; Schadt, Eric E; Verma, Inder M; Lockhart, David J; Barlow, Carrolee

    2005-12-01

    Anxiety and fear are normal emotional responses to threatening situations. In human anxiety disorders--such as panic disorder, obsessive-compulsive disorder, post-traumatic stress disorder, social phobia, specific phobias and generalized anxiety disorder--these responses are exaggerated. The molecular mechanisms involved in the regulation of normal and pathological anxiety are mostly unknown. However, the availability of different inbred strains of mice offers an excellent model system in which to study the genetics of certain behavioural phenotypes. Here we report, using a combination of behavioural analysis of six inbred mouse strains with quantitative gene expression profiling of several brain regions, the identification of 17 genes with expression patterns that correlate with anxiety-like behavioural phenotypes. To determine if two of the genes, glyoxalase 1 and glutathione reductase 1, have a causal role in the genesis of anxiety, we performed genetic manipulation using lentivirus-mediated gene transfer. Local overexpression of these genes in the mouse brain resulted in increased anxiety-like behaviour, while local inhibition of glyoxalase 1 expression by RNA interference decreased the anxiety-like behaviour. Both of these genes are involved in oxidative stress metabolism, linking this pathway with anxiety-related behaviour. PMID:16244648

  6. Feed-forward control of prostate growth: dihydrotestosterone induces expression of its own biosynthetic enzyme, steroid 5 alpha-reductase.

    OpenAIRE

    George, F W; Russell, D.W.; Wilson, J. D.

    1991-01-01

    Dihydrotestosterone, the primary mediator of prostate growth, is synthesized in target tissues from the circulating androgen testosterone through the action of steroid 5 alpha-reductase (EC 1.3.99.5). The expression of 5 alpha-reductase and the level of 5 alpha-reductase messenger RNA in rat ventral prostate are regulated by androgens. To determine whether this control is mediated by dihydrotestosterone or testosterone, we investigated the effect of finasteride, a potent inhibitor of steroid ...

  7. Nitrite and Nitrous Oxide Reductase Regulation by Nitrogen Oxides in Rhodobacter sphaeroides f. sp. denitrificans IL106

    OpenAIRE

    Sabaty, Monique; Schwintner, Carole; Cahors, Sandrine; Richaud, Pierre; Verméglio, Andre

    1999-01-01

    We have cloned the nap locus encoding the periplasmic nitrate reductase in Rhodobacter sphaeroides f. sp. denitrificans IL106. A mutant with this enzyme deleted is unable to grow under denitrifying conditions. Biochemical analysis of this mutant shows that in contrast to the wild-type strain, the level of synthesis of the nitrite and N2O reductases is not increased by the addition of nitrate. Growth under denitrifying conditions and induction of N oxide reductase synthesis are both restored b...

  8. Methylenetetrahydrofolate reductase gene polymorphism in Indian stroke patients

    Directory of Open Access Journals (Sweden)

    Kalita J

    2006-01-01

    Full Text Available Background and Aims: In view of the prevailing controversy about the role of Methylenetetrahydrofolate reductase (MTHFR C677T mutation in stroke and paucity of studies from India, this study has been undertaken to evaluate MTHFR C677T gene polymorphism in consecutive ischemic stroke patients and correlate these with folic acid, homocysteine (Hcy and conventional risk factors. Settings and Design: Ischemic stroke patients prospectively evaluated in a tertiary care teaching hospital. Materials and Methods: Computerized tomography proven ischemic stroke patients were prospectively evaluated including clinical, family history of stroke, dietary habits and addictions. Their fasting and postprandial blood sugar, lipid profile, vitamin B12, folic acid and MTHFR gene analysis were done. Statistical Analysis: MTHFR gene polymorphism was correlated with serum folic acid, Vitamin B12 and Hcy levels; family history of stroke in first-degree relatives; and dietary habits; employing Chi-square test. Results: There were 58 patients with ischemic stroke, whose mean age was 50 (4-79 years; among them, 10 were females. MTHFR gene polymorphism was present in 19 (32.8% patients, 3 were homozygous and 16 were heterozygous. Both serum folate and B12 levels were low in 29 (50% patients and Hcy in 48 (83%. Hypertension was present in 28 (48% patients, diabetes in 12 (21%, hyperlipidemia in 52 (90%, smoking in 17 (29%, obesity in 1 (1.7% and family history of stroke in first-degree relatives in 13 (22.4%. There was no significant relationship of MTHFR gene polymorphism with folic acid, B12, Hcy levels, dietary habits and number of risk factors. Vitamin B12 level was low in vegetarians ( P Conclusion: MTHFR gene polymorphism was found in one-third of patients with ischemic stroke and was insignificantly associated with higher frequency of elevated Hcy.

  9. Metabolism of bupropion by carbonyl reductases in liver and intestine.

    Science.gov (United States)

    Connarn, Jamie N; Zhang, Xinyuan; Babiskin, Andrew; Sun, Duxin

    2015-07-01

    Bupropion's metabolism and the formation of hydroxybupropion in the liver by cytochrome P450 2B6 (CYP2B6) has been extensively studied; however, the metabolism and formation of erythro/threohydrobupropion in the liver and intestine by carbonyl reductases (CR) has not been well characterized. The purpose of this investigation was to compare the relative contribution of the two metabolism pathways of bupropion (by CYP2B6 and CR) in the subcellular fractions of liver and intestine and to identify the CRs responsible for erythro/threohydrobupropion formation in the liver and the intestine. The results showed that the liver microsome generated the highest amount of hydroxybupropion (Vmax = 131 pmol/min per milligram, Km = 87 μM). In addition, liver microsome and S9 fractions formed similar levels of threohydrobupropion by CR (Vmax = 98-99 pmol/min per milligram and Km = 186-265 μM). Interestingly, the liver has similar capability to form hydroxybupropion (by CYP2B6) and threohydrobupropion (by CR). In contrast, none of the intestinal fractions generate hydroxybupropion, suggesting that the intestine does not have CYP2B6 available for metabolism of bupropion. However, intestinal S9 fraction formed threohydrobupropion to the extent of 25% of the amount of threohydrobupropion formed by liver S9 fraction. Enzyme inhibition and Western blots identified that 11β-dehydrogenase isozyme 1 in the liver microsome fraction is mainly responsible for the formation of threohydrobupropion, and in the intestine AKR7 may be responsible for the same metabolite formation. These quantitative comparisons of bupropion metabolism by CR in the liver and intestine may provide new insight into its efficacy and side effects with respect to these metabolites. PMID:25904761

  10. A super-family of transcriptional activators regulates bacteriophage packaging and lysis in Gram-positive bacteria.

    Science.gov (United States)

    Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Iñigo; Novick, Richard P; Christie, Gail E; Penadés, José R

    2013-08-01

    The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138

  11. Proteome scale census of major facilitator superfamily transporters in Trichoderma reesei using protein sequence and structure based classification enhanced ranking.

    Science.gov (United States)

    Chaudhary, Nitika; Kumari, Indu; Sandhu, Padmani; Ahmed, Mushtaq; Akhter, Yusuf

    2016-07-01

    Trichoderma spp. have been acknowledged as potent bio-control agents against microbial pathogens and also as plant growth promoters. Various secondary metabolites are attributed for these beneficial activities. Major facilitator superfamily (MFS) includes the large proportion of efflux-pumps which are linked with membrane transport of these secondary metabolites. We have carried out a proteome-wide identification of MFS transporters using protein sequence and structure based hierarchical method in Trichoderma reesei. 448 proteins out of 9115 were detected to carry transmembrane helices. MFS specific intragenic gene duplication and its context with transport function have been presented. Finally, using homology based techniques, domains and motifs of MFS families have been identified and utilized to classify them. From query dataset of 448 transmembrane proteins, 148 proteins are identified as potential MFS transporters. Sugar porter, drug: H(+) antiporter-1, monocarboxylate porter and anion: cation symporter emerged as major MFS families with 51, 35, 17 and 11 members respectively. Representative protein tertiary structures of these families are homology modeled for structure-function analysis. This study may help to understand the molecular basis of secretion and transport of agriculturally valuable secondary metabolites produced by these bio-control fungal agents which may be exploited in future for enhancing its biotechnological applications in eco-friendly sustainable development. PMID:27041239

  12. Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif

    Science.gov (United States)

    Hamilton, Mark P.; Rajapakshe, Kimal; Hartig, Sean M.; Reva, Boris; McLellan, Michael D.; Kandoth, Cyriac; Ding, Li; Zack, Travis I.; Gunaratne, Preethi H.; Wheeler, David A.; Coarfa, Cristian; McGuire, Sean E.

    2013-11-01

    MicroRNAs modulate tumorigenesis through suppression of specific genes. As many tumour types rely on overlapping oncogenic pathways, a core set of microRNAs may exist, which consistently drives or suppresses tumorigenesis in many cancer types. Here we integrate The Cancer Genome Atlas (TCGA) pan-cancer data set with a microRNA target atlas composed of publicly available Argonaute Crosslinking Immunoprecipitation (AGO-CLIP) data to identify pan-tumour microRNA drivers of cancer. Through this analysis, we show a pan-cancer, coregulated oncogenic microRNA ‘superfamily’ consisting of the miR-17, miR-19, miR-130, miR-93, miR-18, miR-455 and miR-210 seed families, which cotargets critical tumour suppressors via a central GUGC core motif. We subsequently define mutations in microRNA target sites using the AGO-CLIP microRNA target atlas and TCGA exome-sequencing data. These combined analyses identify pan-cancer oncogenic cotargeting of the phosphoinositide 3-kinase, TGFβ and p53 pathways by the miR-17-19-130 superfamily members.

  13. New insights into potential functions for the protein 4.1superfamily of proteins in kidney epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Calinisan, Venice; Gravem, Dana; Chen, Ray Ping-Hsu; Brittin,Sachi; Mohandas, Narla; Lecomte, Marie-Christine; Gascard, Philippe

    2005-06-17

    Members of the protein 4.1 family of adapter proteins are expressed in a broad panel of tissues including various epithelia where they likely play an important role in maintenance of cell architecture and polarity and in control of cell proliferation. We have recently characterized the structure and distribution of three members of the protein 4.1 family, 4.1B, 4.1R and 4.1N, in mouse kidney. We describe here binding partners for renal 4.1 proteins, identified through the screening of a rat kidney yeast two-hybrid system cDNA library. The identification of putative protein 4.1-based complexes enables us to envision potential functions for 4.1 proteins in kidney: organization of signaling complexes, response to osmotic stress, protein trafficking, and control of cell proliferation. We discuss the relevance of these protein 4.1-based interactions in kidney physio-pathology in the context of their previously identified functions in other cells and tissues. Specifically, we will focus on renal 4.1 protein interactions with beta amyloid precursor protein (beta-APP), 14-3-3 proteins, and the cell swelling-activated chloride channel pICln. We also discuss the functional relevance of another member of the protein 4.1 superfamily, ezrin, in kidney physiopathology.

  14. Complement system proteins which interact with C3b or C4b A superfamily of structurally related proteins

    DEFF Research Database (Denmark)

    Reid, K B M; Bentley, D R; Campbell, R D;

    1986-01-01

    Recent cDNA sequencing data has allowed the prediction of the entire amino acid sequences of complement components factor B and C2, the complement control proteins factor H and C4b-binding protein and a partial sequence for the Cab/C4b receptor CR1. These proteins all contain internal repeating u......-glycoprotein 1, blood clotting factor XIII and interleukin-2 receptor. In this review Ken Reid and his colleagues propose that this could be a general feature of a superfamily of structurally related proteins.......Recent cDNA sequencing data has allowed the prediction of the entire amino acid sequences of complement components factor B and C2, the complement control proteins factor H and C4b-binding protein and a partial sequence for the Cab/C4b receptor CR1. These proteins all contain internal repeating......, while the precise number of units in CR1 is not known yet. These structurally homologous complement proteins are also functionally related as they all interact with C3b and C4b during activation of the cascade. The repeating units also occur in the functionally unrelated proteins subcomponent C1r, β2...

  15. The FTO (fat mass and obesity associated gene codes for a novel member of the non-heme dioxygenase superfamily

    Directory of Open Access Journals (Sweden)

    Andrade-Navarro Miguel A

    2007-11-01

    Full Text Available Abstract Background Genetic variants in the FTO (fat mass and obesity associated gene have been associated with an increased risk of obesity. However, the function of its protein product has not been experimentally studied and previously reported sequence similarity analyses suggested the absence of homologs in existing protein databases. Here, we present the first detailed computational analysis of the sequence and predicted structure of the protein encoded by FTO. Results We performed a sequence similarity search using the human FTO protein as query and then generated a profile using the multiple sequence alignment of the homologous sequences. Profile-to-sequence and profile-to-profile based comparisons identified remote homologs of the non-heme dioxygenase family. Conclusion Our analysis suggests that human FTO is a member of the non-heme dioxygenase (Fe(II- and 2-oxoglutarate-dependent dioxygenases superfamily. Amino acid conservation patterns support this hypothesis and indicate that both 2-oxoglutarate and iron should be important for FTO function. This computational prediction of the function of FTO should suggest further steps for its experimental characterization and help to formulate hypothesis about the mechanisms by which it relates to obesity in humans.

  16. Expression of 5α-Reductase Type 2 Gene in Human Testis, Epididymis and Vas Deferens

    Institute of Scientific and Technical Information of China (English)

    刘德瑜; 吴燕婉; 罗宏志; 张桂元

    2002-01-01

    Objectives To study the expression pattern of 5α-reductase type 2 gene in human malereproductive organsMethods The expression level of 5α-reductase type 2 gene inhuman testis, epididymisand vas deferens tissues was determined by in situ hybridization using Digoxin labeled5α-reductase type 2 cRNA probe.Results The brown granules of hybridizing signals distributed in the cytoplasm ofSertoli and Leydig cells of the testis, the principle cells of epididymis and the epithe-lial cells of vas deferens, but there was no positive signal in the nuclei of above-men-tioned cells. No positive signal was observed in germ cells, basement of the testis,interstium of epididymis and basement, as well as smooth muscle of vas deferens.Conclusion This study confirmed that the 5α-reductase type 2 gene expressed in Ser-toli, Leydig cells of the testis, and the principle cells of epididymis. The expressionpattern of the gene in these cells in human was similar to that of rat and monkey. Thepresence of 5a-reductase type 2 gene in epithelial cells of the vas deferens suggested itmight possess an important physiological role in human reproduction.

  17. Pseudomonas stutzeri N2O reductase contains CuA-type sites

    International Nuclear Information System (INIS)

    N2O reductase (N2O → N2) is the terminal enzyme in the energy-conserving denitrification pathway of soil and marine denitrifying bacteria. The protein is composed of two identical subunits and contains eight copper ions per enzyme molecule. The magnetic circular dichroism spectrum of resting (oxidized) N2O reductase is strikingly similar to the magnetic circular dichroism spectrum of the CuA site in mammalian cytochrome c oxidase and is unlike the magnetic circular dichroism spectra of all other biological copper chromophores obtained to data. Sulfur (or chlorine) scatterers are required to fit the copper extended x-ray absorption fine structure data of both the oxidized and reduced forms of N2O reductase. Satisfactory fits require a Cu-N or Cu-O interaction at 2.0 angstrom, a Cu-(S, Cl) interaction at 2.3 angstrom and an additional Cu-(S, Cl) interaction at ∼ 2.6 angstrom (oxidized) or ∼ 2.7 angstrom (reduced). Comparison of the N2O reductase sequence, determined by translating the structural NosZ gene, with cytochrome c oxidase subunit II sequences from several sources indicates that a Gly-Xaa-Xaa-Xaa-Xaa-Xaa-Cys-Ser-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xaa-His stretch if high conserved. This sequence contains three of the probable ligands in a CuA-type site Collectively these data establish that Pseudomonas stutzeri N2O reductase contains CuA-type sites

  18. INHIBITORY ACTIVITY OF FLAVONOIDS ON THE LENS ALDOSE REDUCTASE OF HEALTHY AND DIABETIC RATS

    Directory of Open Access Journals (Sweden)

    M. T. Goodarzi

    2006-05-01

    Full Text Available Aldose reductase is a critical enzyme in the polyol pathway that plays an important role in diabetes mellitus. Inhibition of the activity of this enzyme can prevent cataract in diabetic patients’lenses. In this study the inhibitory effect of two flavonoids, quercetin and naringin, in the activity of aldose reductase in streptozotocin-induced diabetic and healthy rats were investigated. Thirty male rats were divided in six groups. The first, second and third group were healthy rats that received water,quercetin and naringin, respectively. The fourth, fifth and sixth groups were streptozocin-induced diabetic rats that received water, quercetin and naringin, respectively. These rats were fed orally in a definite dose from each substance for 12 days. After this period rats were scarified and their lenses were separated and homogenized. The activity of aldose reductase was measured in each homogenized sample separately. The effect of feeding of these substances in blood sugar was also determined. Aldose reductase activity was reduced 73 and 69 percent in diabetic rats fed by quercetin and naringin, respectively, and the difference compared to control group was significant. In healthy rats this reduction was 63 and 59 percent, respectively, and the difference was significant compared to those who did not receive flavonoids. It was concluded that these substances were effective in reduction of aldose reductase activity in vivo and consequently could delay the progress of cataract.

  19. Current status of 5α-reductase inhibitors in the treatment of benign hyperplasia of prostate

    Directory of Open Access Journals (Sweden)

    Kumar Vijay

    2008-04-01

    Full Text Available Benign prostatic hyperplasia (BPH is a common problem in aging men, which is associated with lower urinary tract symptoms. This condition is dependent on the presence of androgens for its progression, and medical therapy is the first-line treatment for BPH patients with moderate-to-severe symptoms and includes the use of either alpha 1-adrenergic blockers or 5α-reductase inhibitors. Adrenergic blocking drugs reduce the dynamic component while the 5α-reductase inhibitors reduce the static component of bladder outlet obstruction in BPH. By inhibiting the generation of active form of testosterone, viz., dihydrotestosterone, the 5α-reductase inhibitors not only reduce the symptoms of BPH but also decrease the need for surgery and further progression of BPH. Besides, prolonged use of combination of 5α-reductase inhibitors and alpha 1-adrenergic blockers has been found to be more beneficial than either of the two drugs given alone. This review gives a brief account of rationale and efficacy of treatment by 5α-reductase inhibitors in the management of BPH.

  20. Structural and biochemical properties of cloned and expressed human and rat steroid 5α-reductases

    International Nuclear Information System (INIS)

    The microsomal enzyme steroid 5α-reductase is responsible for the conversion of testosterone into the more potent androgen dihydrotestosterone. In man, this steroid acts on a variety of androgen-responsive target tissues to mediate such diverse endocrine processes as male sexual differentiation in the fetus and prostatic growth in men. Here we describe the isolation, structure, and expression of a cDNA encoding the human steroid 5α-reductase. A rat cDNA was used as a hybridization probe to screen a human prostate cDNA library. A 2.1-kilobase cDNA was identified and DNA sequence analysis indicated that the human steroid 5α-reductase was a hydrophobic protein of 259 amino acids with a predicted molecular weight of 29,462. A comparison of the human and rat protein sequences revealed a 60% identity. Transfection of expression vectors containing the human and rat cDNAs into simian COS cells resulted in the synthesis of high levels of steroid 5α-reductase enzyme activity. Both enzymes expressed in COS cells showed similar substrate specificities for naturally occurring steroid hormones. However, synthetic 4-azasteroids demonstrated marked differences in their abilities to inhibit the human and rat steroid 5α-reductases

  1. The Expansion and Functional Diversification of the Mammalian Ribonuclease A Superfamily Epitomizes the Efficiency of Multigene Families at Generating Biological Novelty

    OpenAIRE

    Goo, Stephen M.; Cho, Soochin

    2013-01-01

    The ribonuclease (RNase) A superfamily is a vertebrate-specific gene family. Because of a massive expansion that occurred during the early mammalian evolution, extant mammals in general have much more RNase genes than nonmammalian vertebrates. Mammalian RNases have been associated with diverse physiological functions including digestion, cytotoxicity, angiogenesis, male reproduction, and host defense. However, it is still uncertain when their expansion occurred and how a wide array of functio...

  2. Thioesterase superfamily member 1 suppresses cold thermogenesis by limiting the oxidation of lipid droplet-derived fatty acids in brown adipose tissue

    OpenAIRE

    Okada, Kosuke; LeClair, Katherine B.; Zhang, Yongzhao; Li, Yingxia; Ozdemir, Cafer; Krisko, Tibor I.; Susan J. Hagen; Betensky, Rebecca A.; Banks, Alexander S.; David E. Cohen

    2016-01-01

    Objective: Non-shivering thermogenesis in brown adipose tissue (BAT) plays a central role in energy homeostasis. Thioesterase superfamily member 1 (Them1), a BAT-enriched long chain fatty acyl-CoA thioesterase, is upregulated by cold and downregulated by warm ambient temperatures. Them1−/− mice exhibit increased energy expenditure and resistance to diet-induced obesity and diabetes, but the mechanistic contribution of Them1 to the regulation of cold thermogenesis remains unknown. Methods: The...

  3. A Histone-Like Protein of Mycobacteria Possesses Ferritin Superfamily Protein-Like Activity and Protects against DNA Damage by Fenton Reaction

    OpenAIRE

    Takatsuka, Masaki; Osada-Oka, Mayuko; Satoh, Eisuke F.; Kitadokoro, Kengo; Nishiuchi, Yukiko; Niki, Mamiko; Inoue, Masayasu; Iwai, Kazuhiro; Arakawa, Tetsuo; SHIMOJI, Yoshihiro; Ogura, Hisashi; Kobayashi, Kazuo; Rambukkana, Anura; Matsumoto, Sohkichi

    2011-01-01

    Iron is an essential metal for living organisms but its level must be strictly controlled in cells, because ferrous ion induces toxicity by generating highly active reactive oxygen, hydroxyl radicals, through the Fenton reaction. In addition, ferric ion shows low solubility under physiological conditions. To overcome these obstacles living organisms possess Ferritin superfamily proteins that are distributed in all three domains of life: bacteria, archaea, and eukaryotes. These proteins minimi...

  4. MEK2 regulates ribonucleotide reductase activity through functional interaction with ribonucleotide reductase small subunit p53R2.

    Science.gov (United States)

    Piao, Chunmei; Youn, Cha-Kyung; Jin, Min; Yoon, Sang Pil; Chang, In-Youb; Lee, Jung Hee; You, Ho Jin

    2012-09-01

    The p53R2 protein, a newly identified member of the ribonucleotide reductase family that provides nucleotides for DNA damage repair, is directly regulated by p53. We show that p53R2 is also regulated by a MEK2 (ERK kinase 2/MAP kinase kinase 2)-dependent pathway. Increased MEK1/2 phosphorylation by serum stimulation coincided with an increase in the RNR activity in U2OS and H1299 cells. The inhibition of MEK2 activity, either by treatment with a MEK inhibitor or by transfection with MEK2 siRNA, dramatically decreased the serum-stimulated RNR activity. Moreover, p53R2 siRNA, but not R2 siRNA, significantly inhibits serum-stimulated RNR activity, indicating that p53R2 is specifically regulated by a MEK2-dependent pathway. Co-immunoprecipitation analyses revealed that the MEK2 segment comprising amino acids 65-171 is critical for p53R2-MEK2 interaction, and the binding domain of MEK2 is required for MEK2-mediated increased RNR activity. Phosphorylation of MEK1/2 was greatly augmented by ionizing radiation, and RNR activity was concurrently increased. Ionizing radiation-induced RNR activity was markedly attenuated by transfection of MEK2 or p53R2 siRNA, but not R2 siRNA. These data show that MEK2 is an endogenous regulator of p53R2 and suggest that MEK2 may associate with p53R2 and upregulate its activity. PMID:22895183

  5. Structural Analysis of Papain-Like NlpC/P60 Superfamily Enzymes with a Circularly Permuted Topology Reveals Potential Lipid Binding Sites

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Qingping; Rawlings, Neil D.; Chiu, Hsiu-Ju; Jaroszewski, Lukasz; Klock, Heath E.; Knuth, Mark W.; Miller, Mitchell D.; Elsliger, Marc-Andre; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A. (SG); (Wellcome)

    2012-07-11

    NlpC/P60 superfamily papain-like enzymes play important roles in all kingdoms of life. Two members of this superfamily, LRAT-like and YaeF/YiiX-like families, were predicted to contain a catalytic domain that is circularly permuted such that the catalytic cysteine is located near the C-terminus, instead of at the N-terminus. These permuted enzymes are widespread in virus, pathogenic bacteria, and eukaryotes. We determined the crystal structure of a member of the YaeF/YiiX-like family from Bacillus cereus in complex with lysine. The structure, which adopts a ligand-induced, 'closed' conformation, confirms the circular permutation of catalytic residues. A comparative analysis of other related protein structures within the NlpC/P60 superfamily is presented. Permutated NlpC/P60 enzymes contain a similar conserved core and arrangement of catalytic residues, including a Cys/His-containing triad and an additional conserved tyrosine. More surprisingly, permuted enzymes have a hydrophobic S1 binding pocket that is distinct from previously characterized enzymes in the family, indicative of novel substrate specificity. Further analysis of a structural homolog, YiiX (PDB 2if6) identified a fatty acid in the conserved hydrophobic pocket, thus providing additional insights into possible function of these novel enzymes.

  6. A Novel Two Domain-Fusion Protein in Cyanobacteria with Similarity to the CAB/ELIP/HLIP Superfamily: Evolutionary Implications and Regulation

    Institute of Scientific and Technical Information of China (English)

    Oliver Kilian; Anne Soisig Steunou; Arthur R.Grossman; Devaki Bhaya

    2008-01-01

    Vascular plants contain abundant, light-harvesting complexes in the thylakoid membrane that are non-covalently associated with chlorophylls and carotenoids. These light-harvesting chlorophyll a/b binding (LHC) proteins are members of an extended CAB/ELIP/HLIP superfamily of distantly related polypeptides, which have between one and four transmembrane helices (TMH). This superfamily includes the single TMH, high-light-inducible proteins (Hlips), found in cyanobacteria that are induced by various stress conditions, including high light, and are considered ancestral to the LHC proteins. The roles of, and evolutionary relationships between, these superfamily members are of particular interest,since they function in both light harvesting and photoprotection and may have evolved through tandem gene duplication and fusion events. We have investigated the Hlips (hli gene family) in the thermophilic unicellular cyanobacterium Synechococcus OS-B'. The five hli genes present on the genome of Synechococcus OS-B' are relatively similar, but transcript analyses indicate that there are different patterns of transcript accumulation when the cells are exposed to various growth conditions, suggesting that different Hlips may have specific functions. Hlip5 has an additional TMH at the N-terminus as a result of a novel fusion event. This additional TMH is very similar to a conserved hypothetical, single membrane-spanning polypeptide present in most cyanobacteria. The evolutionary significance of these results is discussed.

  7. A histone-like protein of mycobacteria possesses ferritin superfamily protein-like activity and protects against DNA damage by Fenton reaction.

    Science.gov (United States)

    Takatsuka, Masaki; Osada-Oka, Mayuko; Satoh, Eisuke F; Kitadokoro, Kengo; Nishiuchi, Yukiko; Niki, Mamiko; Inoue, Masayasu; Iwai, Kazuhiro; Arakawa, Tetsuo; Shimoji, Yoshihiro; Ogura, Hisashi; Kobayashi, Kazuo; Rambukkana, Anura; Matsumoto, Sohkichi

    2011-01-01

    Iron is an essential metal for living organisms but its level must be strictly controlled in cells, because ferrous ion induces toxicity by generating highly active reactive oxygen, hydroxyl radicals, through the Fenton reaction. In addition, ferric ion shows low solubility under physiological conditions. To overcome these obstacles living organisms possess Ferritin superfamily proteins that are distributed in all three domains of life: bacteria, archaea, and eukaryotes. These proteins minimize hydroxyl radical formation by ferroxidase activity that converts Fe(2+) into Fe(3+) and sequesters iron by storing it as a mineral inside a protein cage. In this study, we discovered that mycobacterial DNA-binding protein 1 (MDP1), a histone-like protein, has similar activity to ferritin superfamily proteins. MDP1 prevented the Fenton reaction and protects DNA by the ferroxidase activity. The K(m) values of the ferroxidase activity by MDP1 of Mycobacterium bovis bacillus Calmette-Guérin (BCG-3007c), Mycobacterium tuberculosis (Rv2986c), and Mycobacterium leprae (ML1683; ML-LBP) were 0.292, 0.252, and 0.129 mM, respectively. Furthermore, one MDP1 molecule directly captured 81.4±19.1 iron atoms, suggesting the role of this protein in iron storage. This study describes for the first time a ferroxidase-iron storage protein outside of the ferritin superfamily proteins and the protective role of this bacterial protein from DNA damage. PMID:21698192

  8. Discovery and characterization of a xylose reductase from Zymomonas mobilis ZM4.

    Science.gov (United States)

    Agrawal, Manoj; Chen, Rachel Ruizhen

    2011-11-01

    Formation of xylitol, a byproduct from xylose fermentation, is a major limiting factor in ethanol production from xylose in engineered Zymomonas strains, yet the postulated xylose reductase remains elusive. We report here the discovery of xylose reductase in Zymomonas mobilis and, for the first time, to associate the enzyme function with its gene. Besides xylose and xylulose, the enzyme was active towards benzaldehyde, furfural, 5-hydroxymethyl furfural, and acetaldehyde, exhibiting nearly 150-times higher affinity with benzaldehyde than xylose. The discovery of xylose reductase paves the way for further improvement of xylose fermentation in Z. mobilis. The enzyme may also be used to mitigate toxicity of furfural and other inhibitors from plant biomass. PMID:21720846

  9. Biochemical predetermination of the NO synthase and nitrite reductase components of the nitric oxide cycle.

    Science.gov (United States)

    Reutov, V P

    1999-05-01

    This review presents some aspects of a concept of cellular evolution bearing a relationship to nitrate--nitrite respiration, the endosymbiosis theory, and the origin of NO synthase and nitrite reductase activity in heme-containing proteins. Analysis of structural and functional unity of the NO synthase and nitrite reductase systems suggests that these systems did not arise without any relation to evolutionarily ancient energetic systems of cells. The use of symmetry principles reveals commonalities among many electron transport chains which in the language of physics is called "invariance". This work also comparatively analyzes the nitric oxide cycle and the known nitrogen cycle. The ideas about evolution of the NO synthase and nitrite reductase systems developed here are clearly compatible with the endosymbiotic theory and the hypothesis that nitrate--nitrite respiration was a precursor of oxygen-dependent respiration. PMID:10381613

  10. Crystallization and preliminary X-ray crystallographic studies of pig heart carbonyl reductase

    International Nuclear Information System (INIS)

    Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P42, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P41212, with unit-cell parameters a = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution

  11. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    Energy Technology Data Exchange (ETDEWEB)

    Beierlein, J.; Frey, K; Bolstad, D; Pelphrey, P; Joska, T; Smith, A; Priestley, N; Wright, D; Anderson, A

    2008-01-01

    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 A resolution. The structure reveals several features that can be exploited for further development of this lead series.

  12. Alpha 1-blockers vs 5 alpha-reductase inhibitors in benign prostatic hyperplasia. A comparative review

    DEFF Research Database (Denmark)

    Andersen, J T

    1995-01-01

    During recent years, pharmacological treatment of symptomatic benign prostatic hyperplasia (BPH) has become the primary treatment choice for an increasing number of patients. The 2 principal drug classes employed are alpha 1-blockers and 5 alpha-reductase inhibitors. Current information from...... patients who will respond well to alpha 1-blockers have yet to be identified, and data concerning the long term effects of these drugs are not yet available. 5 alpha-Reductase inhibitors have a slow onset of effect, but treatment leads to improvement in symptoms, reduction of the size of the prostate gland...... and improvement in objective parameters for bladder outflow obstruction. Approximately 30 to 50% of patients will respond to treatment with 5 alpha-reductase inhibitors. The definitive role of pharmacological treatment in symptomatic BPH remains to be established, although it seems that patients unfit...

  13. Characterisation of a desmosterol reductase involved in phytosterol dealkylation in the silkworm, Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Leonora F Ciufo

    Full Text Available Most species of invertebrate animals cannot synthesise sterols de novo and many that feed on plants dealkylate phytosterols (mostly C(29 and C(28 yielding cholesterol (C(27. The final step of this dealkylation pathway involves desmosterol reductase (DHCR24-catalysed reduction of desmosterol to cholesterol. We now report the molecular characterisation in the silkworm, Bombyx mori, of such a desmosterol reductase involved in production of cholesterol from phytosterol, rather than in de novo synthesis of cholesterol. Phylogenomic analysis of putative desmosterol reductases revealed the occurrence of various clades that allowed for the identification of a strong reductase candidate gene in Bombyx mori (BGIBMGA 005735. Following PCR-based cloning of the cDNA (1.6 kb and its heterologous expression in Saccharomyces cerevisae, the recombinant protein catalysed reduction of desmosterol to cholesterol in an NADH- and FAD-dependent reaction.Conceptual translation of the cDNA, that encodes a 58.9 kDa protein, and database searching, revealed that the enzyme belongs to an FAD-dependent oxidoreductase family. Western blotting revealed reductase protein expression exclusively in the microsomal subcellular fraction and primarily in the gut. The protein is peripherally associated with microsomal membranes. 2D-native gel and PAGE analysis revealed that the reductase is part of a large complex with molecular weight approximately 250 kDa. The protein occurs in midgut microsomes at a fairly constant level throughout development in the last two instars, but is drastically reduced during the wandering stage in preparation for metamorphosis. Putative Broad Complex transcription factor-binding sites detectable upstream of the DHCR24 gene may play a role in this down-regulation.

  14. Aldose reductase inhibition prevents metaplasia of airway epithelial cells.

    Directory of Open Access Journals (Sweden)

    Umesh C S Yadav

    Full Text Available BACKGROUND: Goblet cell metaplasia that causes mucus hypersecretion and obstruction in the airway lumen could be life threatening in asthma and chronic obstructive pulmonary disease patients. Inflammatory cytokines such as IL-13 mediate the transformation of airway ciliary epithelial cells to mucin-secreting goblet cells in acute as well as chronic airway inflammatory diseases. However, no effective and specific pharmacologic treatment is currently available. Here, we investigated the mechanisms by which aldose reductase (AR regulates the mucus cell metaplasia in vitro and in vivo. METHODOLOGY/FINDINGS: Metaplasia in primary human small airway epithelial cells (SAEC was induced by a Th2 cytokine, IL-13, without or with AR inhibitor, fidarestat. After 48 h of incubation with IL-13 a large number of SAEC were transformed into goblet cells as determined by periodic acid-schiff (PAS-staining and immunohistochemistry using antibodies against Mucin5AC. Further, IL-13 significantly increased the expression of Mucin5AC at mRNA and protein levels. These changes were significantly prevented by treatment of the SAEC with AR inhibitor. AR inhibition also decreased IL-13-induced expression of Muc5AC, Muc5B, and SPDEF, and phosphorylation of JAK-1, ERK1/2 and STAT-6. In a mouse model of ragweed pollen extract (RWE-induced allergic asthma treatment with fidarestat prevented the expression of IL-13, phosphorylation of STAT-6 and transformation of epithelial cells to goblet cells in the lung. Additionally, while the AR-null mice were resistant, wild-type mice showed goblet cell metaplasia after challenge with RWE. CONCLUSIONS: The results show that exposure of SAEC to IL-13 caused goblet cell metaplasia, which was significantly prevented by AR inhibition. Administration of fidarestat to mice prevented RWE-induced goblet cell metaplasia and AR null mice were largely resistant to allergen induced changes in the lung. Thus our results indicate that AR inhibitors

  15. GENERATION OF THE GLYCYL RADICAL OF THE ANAEROBIC ESCHERICHIA-COLI RIBONUCLEOTIDE REDUCTASE REQUIRES A SPECIFIC ACTIVATING ENZYME

    NARCIS (Netherlands)

    SUN, XY; ELIASSON, R; PONTIS, E; ANDERSSON, J; BUIST, G; SJOBERG, BM; REICHARD, P

    1995-01-01

    The anaerobic ribonucleotide reductase from Escherichia coli contains a glycyl radical as part of its polypeptide structure. The radical is generated by an enzyme system present in E. coli. The reductase is coded for by the nrdD gene located at 96 min. Immediately downstream, we now find an open rea

  16. Feedback regulation of cholesterol synthesis:sterol-accelerated ubiquitination and degradation of HMG CoA reductase

    Institute of Scientific and Technical Information of China (English)

    Russell A DeBose-Boyd

    2008-01-01

    3Hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase produces mevalonate,an important intermediate in the synthesis of cholesterol and essential nonsterol isoprenoids.The reductase is subject to an exorbitant amount of feedback control through multiple mechanisms that are mediated by sterol and nonsterol end-products of mevalonate metabolism.Here,Ⅰwill discuss recent advances that shed light on one mechanism for control of reductase,which involves rapid degradation of the enzyme.Accumulation of certain sterols triggers binding of reductase to endoplasmic reticulum (ER) membrane proteins called Insig-1 and Insig-2.Reductase-Insig binding results in recruitment of a membrane-associated ubiquitin ligase called gp78,which initiates ubiquitination of reductase.This ubiquitination is an obligatory reaction for recognition and degradation of reductase from ER membranes by cytosolic 26S proteasomes.Thus,sterol-accelerated degradation of reductase represents an example of how a general cellular process (ER-associated degradation) is used to control an important metabolic pathway (cholesterol synthesis).

  17. Multiple Types of 8-Vinyl Reductases for (Bacterio)Chlorophyll Biosynthesis Occur in Many Green Sulfur Bacteria ▿

    OpenAIRE

    Liu, Zhenfeng; Bryant, Donald A.

    2011-01-01

    Two 8-vinyl reductases, BciA and BciB, have been identified in chlorophototrophs. The bciA gene of Chlorobaculum tepidum was replaced with genes similar to bciB from other green sulfur bacteria. Pigment analyses of the complemented strains showed that the bciB homologs encode 8-vinyl reductases similar to those of cyanobacteria.

  18. Studies on some characteristics of nitrate reductase from sugar beet (Beta vulgaris L.)leaves

    Institute of Scientific and Technical Information of China (English)

    LiWenhua; YanGuiping; 等

    1994-01-01

    Some characteristics of nitrate reductase from sugar beet leaves shown in this paper were as follows:The nitrate reductase from sugar beet leaves required NADH as an electron donor.Accordingly,the nitrate reductase was classified as NADH-dependent(E.C.1.6.61).The Km value of the nitrate reductase for NADH and NO3- were 0.86m mol and 0.18μ mol respectively.The optimum pH in reaction mixture solution for nitrate reduction activity was 7.5.The effect of variable concentrations of inorganic phosphorus in the reaction buffer on nitrate reductase activity was investigated.When the inorganic phosphorus concentration was below 35m mol,the nitrate reductase activity was increased with increase of inorganic phosphorus concentration.Conversely,when the inorganic phosphorus concentration was over 35m mol,the nitrate reductase activity was inhibited.The nitrate reductase activity assayed in vitro was 3.2 and 5.6times of that assayed in vivo under the condition of exogenous and endogenous ground substance respectively.

  19. The role of 5'-adenylylsulfate reductase in the sulfur assimilation pathway of soybean: molecular cloning, kinetic characterization, and gene expression

    Science.gov (United States)

    Soybean seeds are a major source of protein, but contain low levels of sulfur-containing amino acids. With the objective of studying the sulfur assimilation pathway of soybean, a full-length cDNA clone for 5’-adenylylsulfate reductase (APS reductase) was isolated and characterized. The cDNA clone ...

  20. Inverse relationship between age-dependent erythrocyte activity of methaemoglobin reductase and prilocaine-induced methaemoglobinaemia during infancy

    DEFF Research Database (Denmark)

    Nilsson, A; Engberg, G; Henneberg, S; Danielson, K; De Verdier, C H

    1990-01-01

    concentrations of local anaesthetics were low (maximum values: prilocaine 78 ng ml-1, lignocaine 412 ng ml-1). The activity of erythrocyte MetHb reductase (cytochrome b5 reductase) was analysed. Data from a previously studied group of infants aged 3-12 months were included also. Enzyme activity did not reach...

  1. Mechanistic Diversity in the RuBisCO Superfamily: The Enolase in the Methionine Salvage Pathway in Geobacillus kaustophilus

    International Nuclear Information System (INIS)

    D-Ribulose 1,5-bisphosphate carboxylase/oxygenase (RuBisCO), the most abundant enzyme, is the paradigm member of the recently recognized mechanistically diverse RuBisCO superfamily. The RuBisCO reaction is initiated by abstraction of the proton from C3 of the D-ribulose 1,5-bisphosphate substrate by a carbamate oxygen of carboxylated Lys 201 (spinach enzyme). Heterofunctional homologues of RuBisCO found in species of Bacilli catalyze the tautomerization ('enolization') of 2,3-diketo-5-methylthiopentane 1-phosphate (DK-MTP 1-P) in the methionine salvage pathway in which 5-methylthio-D-ribose (MTR) derived from 5'-methylthioadenosine is converted to methionine (Ashida, H., Saito, Y., Kojima, C., Kobayashi, K., Ogasawara, N., and Yokota, A. (2003) A functional link between RuBisCO-like protein of Bacillus and photosynthetic RuBisCO, Science 302, 286-290]. The reaction catalyzed by this 'enolase' is accomplished by abstraction of a proton from C1 of the DK-MTP 1-P substrate to form the tautomerized product, a conjugated enol. Because the RuBisCO- and 'enolase'-catalyzed reactions differ in the regiochemistry of proton abstraction but are expected to share stabilization of an enolate anion intermediate by coordination to an active site Mg2+, we sought to establish structure-function relationships for the 'enolase' reaction so that the structural basis for the functional diversity could be established. We determined the stereochemical course of the reaction catalyzed by the 'enolases' from Bacillus subtilis and Geobacillus kaustophilus. Using stereospecifically deuterated samples of an alternate substrate derived from D-ribose (5-OH group instead of the 5-methylthio group in MTR) as well as of the natural DK-MTP 1-P substrate, we determined that the 'enolase'-catalyzed reaction involves abstraction of the 1-proS proton. We also determined the structure of the activated 'enolase' from G. kaustophilus (carboxylated on Lys 173) liganded with Mg2+ and 2,3-diketohexane 1

  2. Synthesis and degradation of nitrate reductase during the cell cycle of Chlorella sorokiniana

    Science.gov (United States)

    Velasco, P. J.; Tischner, R.; Huffaker, R. C.; Whitaker, J. R.

    1989-01-01

    Studies on the diurnal variations of nitrate reductase (NR) activity during the life cycle of synchronized Chlorella sorokiniana cells grown with a 7:5 light-dark cycle showed that the NADH:NR activity, as well as the NR partial activities NADH:cytochrome c reductase and reduced methyl viologen:NR, closely paralleled the appearance and disappearance of NR protein as shown by sodium dodecyl sulfate gel electrophoresis and immunoblots. Results of pulse-labeling experiments with [35S]methionine further confirmed that diurnal variations of the enzyme activities can be entirely accounted for by the concomitant synthesis and degradation of the NR protein.

  3. Affinity purifications of aldose reductase and xylitol dehydrogenase from the xylose-fermenting yeast Pachysolen tannophilus

    Energy Technology Data Exchange (ETDEWEB)

    Bolen, P.L.; Roth, K.A.; Freer, S.N.

    1986-10-01

    Although xylose is a major product of hydrolysis of lignocellulosic materials, few yeasts are able to convert it to ethanol. In Pachysolen tannophilus, one of the few xylose-fermenting yeasts found, aldose reductase and xylitol dehydrogenase were found to be key enzymes in the metabolic pathway for xylose fermentation. This paper presents a method for the rapid and simultaneous purification of both aldose reductase and xylitol dehydrogenase from P. tannophilus. Preliminary studies indicate that this method may be easily adapted to purify similar enzymes from other xylose-fermenting yeasts.

  4. Glyphosate inhibition of ferric reductase activity in iron deficient sunflower roots

    OpenAIRE

    Öztürk, Levent; Ozturk, Levent; Yazıcı, Mustafa Atilla; Yazici, Mustafa Atilla; Eker, Selim; Gökmen, Özay Özgür; Gokmen, Ozay Ozgur; Römheld, Volker; Romheld, Volker; ÇAKMAK, İsmail; Cakmak, Ismail

    2007-01-01

    Iron (Fe) deficiency is increasingly being observed in cropping systems with frequent glyphosate applications. A likely reason for this is that glyphosate interferes with root uptake of Fe by inhibiting ferric reductase in roots required for Fe acquisition by dicot and nongrass species. This study investigated the role of drift rates of glyphosate (0.32, 0.95 or 1.89 mM glyphosate corresponding to 1, 3 and 6% of the recommended herbicidal dose, respectively) on ferric reductase activity of...

  5. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans.

    Science.gov (United States)

    de Boer, A P; van der Oost, J; Reijnders, W N; Westerhoff, H V; Stouthamer, A H; van Spanning, R J

    1996-12-15

    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N., Reijnders, W. N. M., Kuenen, J. G., Stouthamer, A. H. & van Spanning, R. J. M. (1994) Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans, Antonie Leeu wenhoek 66, 111-127]. norC and norB encode the cytochrome-c-containing subunit II and cytochrome b-containing subunit I of nitric-oxide reductase (NO reductase), respectively. norQ encodes a protein with an ATP-binding motif and has high similarity to NirQ from Pseudomonas stutzeri and Pseudomonas aeruginosa and CbbQ from Pseudomonas hydrogenothermophila. norE encodes a protein with five putative transmembrane alpha-helices and has similarity to CoxIII, the third subunit of the aa3-type cytochrome-c oxidases. norF encodes a small protein with two putative transmembrane alpha-helices. Mutagenesis of norC, norB, norQ and norD resulted in cells unable to grow anaerobically. Nitrite reductase and NO reductase (with succinate or ascorbate as substrates) and nitrous oxide reductase (with succinate as substrate) activities were not detected in these mutant strains. Nitrite extrusion was detected in the medium, indicating that nitrate reductase was active. The norQ and norD mutant strains retained about 16% and 23% of the wild-type level of NorC, respectively. The norE and norF mutant strains had specific growth rates and NorC contents similar to those of the wild-type strain, but had reduced NOR and NIR activities, indicating that their gene products are involved in regulation of enzyme activity. Mutant strains containing the norCBQDEF region on the broad-host-range vector pEG400 were able to grow anaerobically, although at a lower specific growth rate and with lower

  6. Properties of a Thermostable Nitrate Reductase from the Hyperthermophilic Archaeon Pyrobaculum aerophilum

    OpenAIRE

    Afshar, Sepideh; Johnson, Eric; de Vries, Simon; Schröder, Imke

    2001-01-01

    The nitrate reductase of the hyperthermophilic archaeon Pyrobaculum aerophilum was purified 137-fold from the cytoplasmic membrane. Based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis, the enzyme complex consists of three subunits with apparent molecular weights of 130,000, 52,000, and 32,000. The enzyme contained molybdenum (0.8-mol/mol complex), iron (15.4-mol/mol complex) and cytochrome b (0.49-mol/mol complex) as cofactors. The P. aerophilum nitrate reductase disti...

  7. Imaging the activity of nitrate reductase by means of a scanning electrochemical microscope.

    Science.gov (United States)

    Zaumseil, J; Wittstock, G; Bahrs, S; Steinrücke, P

    2000-06-01

    Scanning electrochemical microscopy (SECM) was used to characterize immobilized nitrate reductase (NaR) from Pseudonomonas stutzeri (E.C. 1.7.99.4). Nitrate reductase with membrane fragment was embedded in a polyurethane hydrogel in a capillary and solubilized NaR without membrane fragment was covalently coupled to a diaminoethyl-cellulose-carbamitate film on glass. After systematic studies of possible mediators, SECM feedback imaging of both forms of immobilized NaR was accomplished with methylviologen as redox mediator. PMID:11225859

  8. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Alessandro S.; Ferrarezi, Thiago [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil); Catalano-Dupuy, Daniela L.; Ceccarelli, Eduardo A. [Facultad de Ciencias Bioquímicas y Farmacéuticas, Molecular Biology Division, Instituto de Biología Molecular y Celular de Rosario (IBR), CONICET, Universidad Nacional de Rosario, Suipacha 531, S2002LRK Rosario (Argentina); Polikarpov, Igor, E-mail: ipolikarpov@if.sc.usp.br [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil)

    2006-07-01

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP{sup +} reductase. Ferredoxin-NADP{sup +} reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source.

  9. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    International Nuclear Information System (INIS)

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP+ reductase. Ferredoxin-NADP+ reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source

  10. Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase

    OpenAIRE

    Trigoso, Yvonne D.; Russell C Evans; Karsten, William E.; Lilian Chooback

    2016-01-01

    The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to i...

  11. D-Ribulose 5-Phosphate 3-Epimerase: Functional and Structural Relationships to Members of the Ribulose-Phosphate Binding (beta/alpha)8-Barrel Superfamily

    International Nuclear Information System (INIS)

    The 'ribulose phosphate binding' superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common (β/α)8-barrel ancestor. The superfamily includes D-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-L-gulonate 6-phosphate decarboxylase (KGPDC), members of the OMPDC suprafamily, as well as enzymes involved in histidine and tryptophan biosynthesis that utilize phosphorylated metabolites as substrates. We now report studies of the functional and structural relationships of RPE to the members of the superfamily. As suggested by the results of crystallographic studies of the RPEs from rice and Plasmodium falciparum, the RPE from Streptococcus pyogenes is activated by Zn2+ which binds with a stoichiometry of one ion per polypeptide. Although wild type RPE has a high affinity for Zn2+ and inactive apoenzyme cannot be prepared, the affinity for Zn2+ is decreased by alanine substitutions for the two histidine residues that coordinate the Zn2+ ion (H34A and H67A); these mutant proteins can be prepared in an inactive, metal-free form and activated by exogenous Zn2+. The crystal structure of the RPE was solved at 1.8 Angstroms resolution in the presence of D-xylitol 5-phosphate, an inert analogue of the D-xylulose 5-phosphate substrate. This structure suggests that the 2,3-enediolate intermediate in the 1,1-proton transfer reaction is stabilized by bidentate coordination to the Zn2+ that also is liganded to His 34, Asp 36, His 67, and Asp 176; the carboxylate groups of the Asp residues are positioned also to function as the acid/base catalysts. Although the conformation of the bound analogue resembles those of ligands bound in the active sites of OMPDC and KGPDC, the identities of the active site residues that coordinate the essential Zn2+ and participate as acid/base catalysts are not conserved. We conclude that only the phosphate binding motif

  12. Genome-wide identification, evolution and expression analysis of nuclear receptor superfamily in Nile tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Cheng, Yun-Ying; Tao, Wen-Jing; Chen, Jin-Lin; Sun, Li-Na; Zhou, Lin-Yan; Song, Qiang; Wang, De-Shou

    2015-09-10

    The nuclear receptor (NR) superfamily, which is divided into 7 subfamilies, constitutes one of the largest classes of transcription factors. In this study, through comprehensive database search, we identified all NRs (including 4 novel members) from the tilapia (75), common carp (137), zebrafish (73), fugu (73), tetraodon (72), stickleback (70), medaka (69), coelacanth (55), spotted gar (51) and elephant shark (50). For 21 NRs, two duplicates were found in teleosts, while only one in tetrapods. These duplicates, except those of DAX1, SHP and GCNF found in the elephant shark, were derived from 3R (third round of genome duplication). The linkage duplication of 5 syntenic blocks (comprising 14 duplicated NR couples) in teleosts further supported their 3R origin. Based on transcriptome data from adult tilapia, 53 NRs were found to be expressed in more than one tissue (brain, head kidney, heart, liver, kidney, muscle, ovary and testis), and 4 were tissue-specific, indicating their essential roles in the corresponding tissue. Based on the XX and XY gonadal transcriptome data from four developmental stages, 65 NRs were detected in gonads, with 21, 31, 11 and 29 expressed sexual dimorphically at 5, 30, 90 and 180days after hatching, respectively. The expression of four selected genes was examined by in situ hybridization (ISH) and quantitative PCR (qPCR) to validate the spatial and temporal expression profiles of NRs. Comparative analyses of the expression profiles of duplicated NRs revealed divergence in gene expression as well as gene function. Our results demonstrated that NRs may play important roles in sex determination and gonadal development in teleosts. PMID:26024593

  13. Molecular phylogeny of the bivalve superfamily Galeommatoidea (Heterodonta, Veneroida reveals dynamic evolution of symbiotic lifestyle and interphylum host switching

    Directory of Open Access Journals (Sweden)

    Goto Ryutaro

    2012-09-01

    Full Text Available Abstract Background Galeommatoidea is a superfamily of bivalves that exhibits remarkably diverse lifestyles. Many members of this group live attached to the body surface or inside the burrows of other marine invertebrates, including crustaceans, holothurians, echinoids, cnidarians, sipunculans and echiurans. These symbiotic species exhibit high host specificity, commensal interactions with hosts, and extreme morphological and behavioral adaptations to symbiotic life. Host specialization to various animal groups has likely played an important role in the evolution and diversification of this bivalve group. However, the evolutionary pathway that led to their ecological diversity is not well understood, in part because of their reduced and/or highly modified morphologies that have confounded traditional taxonomy. This study elucidates the taxonomy of the Galeommatoidea and their evolutionary history of symbiotic lifestyle based on a molecular phylogenic analysis of 33 galeommatoidean and five putative galeommatoidean species belonging to 27 genera and three families using two nuclear ribosomal genes (18S and 28S ribosomal DNA and a nuclear (histone H3 and mitochondrial (cytochrome oxidase subunit I protein-coding genes. Results Molecular phylogeny recovered six well-supported major clades within Galeommatoidea. Symbiotic species were found in all major clades, whereas free-living species were grouped into two major clades. Species symbiotic with crustaceans, holothurians, sipunculans, and echiurans were each found in multiple major clades, suggesting that host specialization to these animal groups occurred repeatedly in Galeommatoidea. Conclusions Our results suggest that the evolutionary history of host association in Galeommatoidea has been remarkably dynamic, involving frequent host switches between different animal phyla. Such an unusual pattern of dynamic host switching is considered to have resulted from their commensalistic lifestyle, in

  14. Cupincin: A Unique Protease Purified from Rice (Oryza sativa L.) Bran Is a New Member of the Cupin Superfamily.

    Science.gov (United States)

    Sreedhar, Roopesh; Kaul Tiku, Purnima

    2016-01-01

    Cupin superfamily is one of the most diverse super families. This study reports the purification and characterization of a novel cupin domain containing protease from rice bran for the first time. Hypothetical protein OsI_13867 was identified and named as cupincin. Cupincin was purified to 4.4 folds with a recovery of 4.9%. Cupincin had an optimum pH and temperature of pH 4.0 and 60 °C respectively. Cupincin was found to be a homotrimer, consisting of three distinct subunits with apparent molecular masses of 33.45 kDa, 22.35 kDa and 16.67 kDa as determined by MALDI-TOF, whereas it eluted as a single unit with an apparent molecular mass of 135.33 ± 3.52 kDa in analytical gel filtration and migrated as a single band in native page, suggesting its homogeneity. Sequence identity of cupincin was deduced by determining the amino-terminal sequence of the polypeptide chains and by and de novo sequencing. For understanding the hydrolysing mechanism of cupincin, its three-dimensional model was developed. Structural analysis indicated that cupincin contains His313, His326 and Glu318 with zinc ion as the putative active site residues, inhibition of enzyme activity by 1,10-phenanthroline and atomic absorption spectroscopy confirmed the presence of zinc ion. The cleavage specificity of cupincin towards oxidized B-chain of insulin was highly specific; cleaving at the Leu15-Tyr16 position, the specificity was also determined using neurotensin as a substrate, where it cleaved only at the Glu1-Tyr2 position. Limited proteolysis of the protease suggests a specific function for cupincin. These results demonstrated cupincin as a completely new protease. PMID:27064905

  15. Cupincin: A Unique Protease Purified from Rice (Oryza sativa L. Bran Is a New Member of the Cupin Superfamily.

    Directory of Open Access Journals (Sweden)

    Roopesh Sreedhar

    Full Text Available Cupin superfamily is one of the most diverse super families. This study reports the purification and characterization of a novel cupin domain containing protease from rice bran for the first time. Hypothetical protein OsI_13867 was identified and named as cupincin. Cupincin was purified to 4.4 folds with a recovery of 4.9%. Cupincin had an optimum pH and temperature of pH 4.0 and 60 °C respectively. Cupincin was found to be a homotrimer, consisting of three distinct subunits with apparent molecular masses of 33.45 kDa, 22.35 kDa and 16.67 kDa as determined by MALDI-TOF, whereas it eluted as a single unit with an apparent molecular mass of 135.33 ± 3.52 kDa in analytical gel filtration and migrated as a single band in native page, suggesting its homogeneity. Sequence identity of cupincin was deduced by determining the amino-terminal sequence of the polypeptide chains and by and de novo sequencing. For understanding the hydrolysing mechanism of cupincin, its three-dimensional model was developed. Structural analysis indicated that cupincin contains His313, His326 and Glu318 with zinc ion as the putative active site residues, inhibition of enzyme activity by 1,10-phenanthroline and atomic absorption spectroscopy confirmed the presence of zinc ion. The cleavage specificity of cupincin towards oxidized B-chain of insulin was highly specific; cleaving at the Leu15-Tyr16 position, the specificity was also determined using neurotensin as a substrate, where it cleaved only at the Glu1-Tyr2 position. Limited proteolysis of the protease suggests a specific function for cupincin. These results demonstrated cupincin as a completely new protease.

  16. Cementogenesis and the induction of periodontal tissue regeneration by the osteogenic proteins of the transforming growth factor-beta superfamily.

    Science.gov (United States)

    Ripamonti, U; Petit, J-C; Teare, J

    2009-04-01

    The antiquity and severity of periodontal diseases are demonstrated by the hard evidence of alveolar bone loss in gnathic remains of the Pliocene/Pleistocene deposits of the Bloubank Valley at Sterkfontein, Swartkrans and Kromdrai in South Africa. Extant Homo has characterized and cloned a superfamily of proteins which include the bone morphogenetic proteins that regulate tooth morphogenesis at different stages of development as temporally and spatially connected events. The induction of cementogenesis, periodontal ligament and alveolar bone regeneration are regulated by the co-ordinated expression of bone morphogenetic proteins. Naturally derived and recombinant human bone morphogenetic proteins induce periodontal tissue regeneration in mammals. Morphological analyses on undecalcified sections cut at 3-6 mum on a series of mandibular molar Class II and III furcation defects induced in the non-human primate Papio ursinus show the induction of cementogenesis. Sharpey's fibers nucleate as a series of composite collagen bundles within the cementoid matrix in close relation to embedded cementocytes. Osteogenic protein-1 and bone morphogenetic protein-2 possess a structure-activity profile, as shown by the morphology of tissue regeneration, preferentially cementogenic and osteogenic, respectively. In Papio ursinus, transforming growth factor-beta(3) also induces cementogenesis, with Sharpey's fibers inserting into newly formed alveolar bone. Capillary sprouting and invasion determine the sequential insertion and alignment of individual collagenic bundles. The addition of responding stem cells prepared by finely mincing fragments of autogenous rectus abdominis muscle significantly enhances the induction of periodontal tissue regeneration when combined with transforming growth factor-beta(3) implanted in Class II and III furcation defects of Papio ursinus. PMID:18842117

  17. The viral transmembrane superfamily: possible divergence of Arenavirus and Filovirus glycoproteins from a common RNA virus ancestor

    Directory of Open Access Journals (Sweden)

    Buchmeier Michael J

    2001-02-01

    Full Text Available Abstract Background Recent studies of viral entry proteins from influenza, measles, human immunodeficiency virus, type 1 (HIV-1, and Ebola virus have shown, first with molecular modeling, and then X-ray crystallographic or other biophysical studies, that these disparate viruses share a coiled-coil type of entry protein. Results Structural models of the transmembrane glycoproteins (GP-2 of the Arenaviruses, lymphochoriomeningitis virus (LCMV and Lassa fever virus, are presented, based on consistent structural propensities despite variation in the amino acid sequence. The principal features of the model, a hydrophobic amino terminus, and two antiparallel helices separated by a glycosylated, antigenic apex, are common to a number of otherwise disparate families of enveloped RNA viruses. Within the first amphipathic helix, demonstrable by circular dichroism of a peptide fragment, there is a highly conserved heptad repeat pattern proposed to mediate multimerization by coiled-coil interactions. The amino terminal 18 amino acids are 28% identical and 50% highly similar to the corresponding region of Ebola, a member of the Filovirus family. Within the second, charged helix just prior to membrane insertion there is also high similarity over the central 18 amino acids in corresponding regions of Lassa and Ebola, which may be further related to the similar region of HIV-1 defining a potent antiviral peptide analogue. Conclusions These findings indicate a common pattern of structure and function among viral transmembrane fusion proteins from a number of virus families. Such a pattern may define a viral transmembrane superfamily that evolved from a common precursor eons ago.

  18. Pinpointing a Mechanistic Switch Between Ketoreduction and “Ene” Reduction in Short‐Chain Dehydrogenases/Reductases

    Science.gov (United States)

    Lygidakis, Antonios; Karuppiah, Vijaykumar; Hoeven, Robin; Ní Cheallaigh, Aisling; Leys, David; Gardiner, John M.; Toogood, Helen S.

    2016-01-01

    Abstract Three enzymes of the Mentha essential oil biosynthetic pathway are highly homologous, namely the ketoreductases (−)‐menthone:(−)‐menthol reductase and (−)‐menthone:(+)‐neomenthol reductase, and the “ene” reductase isopiperitenone reductase. We identified a rare catalytic residue substitution in the last two, and performed comparative crystal structure analyses and residue‐swapping mutagenesis to investigate whether this determines the reaction outcome. The result was a complete loss of native activity and a switch between ene reduction and ketoreduction. This suggests the importance of a catalytic glutamate vs. tyrosine residue in determining the outcome of the reduction of α,β‐unsaturated alkenes, due to the substrate occupying different binding conformations, and possibly also to the relative acidities of the two residues. This simple switch in mechanism by a single amino acid substitution could potentially generate a large number of de novo ene reductases. PMID:27411040

  19. Isolation, modification, and aldose reductase inhibitory activity of rosmarinic acid derivatives from the roots of Salvia grandifolia.

    Science.gov (United States)

    Kang, Jie; Tang, Yanbo; Liu, Quan; Guo, Nan; Zhang, Jian; Xiao, Zhiyan; Chen, Ruoyun; Shen, Zhufang

    2016-07-01

    To find aldose reductase inhibitors, two previously unreported compounds, grandifolias H and I, and five known compounds, including rosmarinic acid and rosmarinic acid derivatives, were isolated from the roots of Salvia grandifolia. A series of rosmarinic acid derivatives was obtained from rosmarinic acid using simple synthetic methods. The aldose reductase inhibitory activity of the isolated and synthesized compounds was assessed. Seven of the tested compounds showed moderate aldose reductase inhibition (IC50=0.06-0.30μM). The structure-activity relationship of aldose reductase inhibitory activity of rosmarinic acid derivatives was discussed for the first time. This study provided useful information that will facilitate the development of aldose reductase inhibitors. PMID:27233987

  20. Biochemical and structural analysis of Gox2181, a new member of the SDR superfamily from Gluconobacter oxydans.

    Science.gov (United States)

    Liu, Xu; Yuan, Zuanning; Adam Yuan, Y; Lin, Jinping; Wei, Dongzhi

    2011-11-18

    Gluconobacter oxydans enable to oxidize sugars and polyols incompletely to corresponding materials with potential industrial applications, containing around 75 putative dehydrogenases. One of these putative dehydrogenases, Gox2181, was cloned and expressed in Escherichia coli BL21 (DE3), and its X-ray crystal structure was determined to a resolution of 1.8 Å. Gox2181 formed a homo-tetramer in the crystal that was coincident with the apparent molecular mass determined in the solution. Gox2181 displayed α/β-folding patterns, the conserved catalytic tetrad of Asn119-Ser147-Tyr162-Lys166, and the NAD-binding pocket, which aligned well with the 'classical' type of short-chain dehydrogenase/reductase (SDR) enzymes. Gox2181 was denoted SDR51C based on the SDR nomenclature system. The purified recombinant Gox2181 was demonstrated to be NAD(H)-dependent and active towards a wide range of substrates, including sugar alcohols, secondary alcohols, ketones, and ketoses. Among the substrates tested, Gox2181 displayed preference for secondary hydroxyl or carbonyl groups, showing low K(m) values with d-arabitol and butanedione. PMID:22040731

  1. Protective role of glutathione reductase in paraquat induced neurotoxicity.

    Science.gov (United States)

    Djukic, Mirjana M; Jovanovic, Marina D; Ninkovic, Milica; Stevanovic, Ivana; Ilic, Katarina; Curcic, Marijana; Vekic, Jelena

    2012-08-30

    Paraquat (PQ), a widely used herbicide is a well-known free radical producing agent. The mechanistic pathways of PQ neurotoxicity were examined by assessing oxidative/nitrosative stress markers. Focus was on the role of glutathione (GSH) cycle and to examine whether the pre-treatment with enzyme glutathione reductase (GR) could protect the vulnerable brain regions (VBRs) against harmful oxidative effect of PQ. The study was conducted on Wistar rats, randomly divided in five groups: intact-control group, (n = 8) and four experimental groups (n = 24). All tested compounds were administered intrastriatally (i.s.) in one single dose. The following parameters of oxidative status were measured in the striatum, hippocampus and cortex, at 30 min, 24 h and 7 days post treatment: superoxide anion radical (O₂·⁻), nitrate (NO₃⁻), malondialdehyde (MDA), superoxide dismutase (SOD), total GSH (tGSH) and its oxidized, disulfide form (GSSG) and glutathione peroxidase (GPx). Results obtained from the intact and the sham operated groups were not statistically different, confirming that invasive i.s. route of administration would not influence the reliability of results. Also, similar pattern of changes were observed between ipsi- and contra- lateral side of examined VBRs, indicating rapid spatial spreading of oxidative stress. Mortality of the animals (10%), within 24h, along with symptoms of Parkinsonism, after awakening from anesthesia for 2-3 h, were observed in the PQ group, only. Increased levels of O₂·⁻, NO₃⁻ and MDA, increased ratio of GSSG/GSH and considerably high activity of GPx were measured at 30 min after the treatment. Cytotoxic effect of PQ was documented by drastic drop of all measured parameters and extremely high peak of the ratio GSSG/GSH at 24th hrs after the PQ i.s. injection. In the GR+PQ group, markedly low activity of GPx and low content of NO₃⁻ (in striatum and cortex) were measured during whole experiment, while increase value was

  2. Identification and characterization of an inborn error of metabolism caused by dihydrofolate reductase deficiency

    NARCIS (Netherlands)

    Banka, S.; Blom, H.J.; Walter, J.; Aziz, M.; Urquhart, J.; Clouthier, C.M.; Rice, G.I.; Brouwer, A.P.M. de; Hilton, E.; Vassallo, G.; Will, A.; Smith, D.E.; Smulders, Y.M.; Wevers, R.A.; Steinfeld, R.; Heales, S.; Crow, Y.J.; Pelletier, J.N.; Jones, S.; Newman, W.G.

    2011-01-01

    Dihydrofolate reductase (DHFR) is a critical enzyme in folate metabolism and an important target of antineoplastic, antimicrobial, and antiinflammatory drugs. We describe three individuals from two families with a recessive inborn error of metabolism, characterized by megaloblastic anemia and/or pan

  3. Direct demonstration of genetic alterations at the dihydrofolate reductase locus after gamma irradiation.

    OpenAIRE

    Graf, L. H.; Chasin, L A

    1982-01-01

    Gamma ray-induced mutants of Chinese hamster ovary cells lacking dihydrofolate reductase activity were screened for DNA sequence changes at the locus specifying this activity by using a cloned cDNA probe. Two of nine mutants screened displayed an altered restriction fragment pattern suggesting the occurrence of DNA deletions or rearrangements.

  4. Low activity of superoxide dismutase and high activity of glutathione reductase in erythrocytes from centenarians

    DEFF Research Database (Denmark)

    Andersen, Helle Raun; Jeune, B; Nybo, H;

    1998-01-01

    aged between 60 and 79 years. MEASUREMENTS: enzyme activities of superoxide dismutase (CuZn-SOD), glutathione peroxidase, catalase and glutathione reductase (GR) in erythrocytes. Functional capacity among the centenarians was evaluated by Katz' index of activities of daily living, the Physical...

  5. A soluble 3-hydroxy-3-methylglutaryl-CoA reductase in the protozoan Trypanosoma cruzi

    DEFF Research Database (Denmark)

    Pena Diaz, Javier; Montalvetti, A; Camacho, A;

    1997-01-01

    We report the isolation and characterization of a genomic clone containing the open reading frame sequence for 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase from Trypanosoma cruzi, the causative agent of Chagas' disease. The protozoan gene encoded for a smaller polypeptide than the rest of the...

  6. Novel bacterial sulfur oxygenase reductases from bioreactors treating gold-bearing concentrates

    DEFF Research Database (Denmark)

    Chen, Z-W; Liu, Y-Y; Wu, J-F;

    2007-01-01

    The microbial community and sulfur oxygenase reductases of metagenomic DNA from bioreactors treating gold-bearing concentrates were studied by 16S rRNA library, real-time polymerase chain reaction (RT-PCR), conventional cultivation, and molecular cloning. Results indicated that major bacterial sp...... SOR gene in bioleaching reactors and Acidithiobacillus species....

  7. A Rational Approach to Identify Inhibitors of Mycobacterium tuberculosis Enoyl Acyl Carrier Protein Reductase

    Czech Academy of Sciences Publication Activity Database

    Chhabria, M. T.; Parmar, K. B.; Brahmkshatriya, Pathik

    2013-01-01

    Roč. 19, č. 21 (2013), s. 3878-3883. ISSN 1381-6128 Institutional support: RVO:61388963 Keywords : mycobacterium tuberculosis * enoyl acyl carrier protein reductase * pharmacophore modeling * molecular docking * binding interactions Subject RIV: FR - Pharmacology ; Medidal Chemistry Impact factor: 3.288, year: 2013

  8. Relationships between nitrate uptake and nitrate reductase activity in Cucumis sativus L.

    Directory of Open Access Journals (Sweden)

    Grażyna Kłobus

    2014-02-01

    Full Text Available Anti-NR IgG fragments obtained after papain digestion of polyclonal antibodies gave the positive immunological reaction with both, a soluble and plasma membrane-bound nitrate reductase. Anti-NR antibody as well as IgG fragments almost totally inhibited the nitrate reductase activity in cytosol proving a crossreaction of antibody with the catalytic site of a soluble NR. Anti-NR IgG fragments, but not undigested polyclonal antibodies affected the activity of the nitrate reductase associated with plasma membranes. Discrepancy in the action of intact antibodies and fragments obtained after they digestion were interpreted as a consequence of same differences in the ability of those molecules to the penetration through the membrane. Undigested anti-NR antibody have no effect on the nitrate uptake by intact plants, as well as by the right-side plasma membrane vesicles. On the other hand, IgG fragments of polyclonal antibodies abolished almost totally the nitrate uptake in the case of intact seedlings, but have only slight effect on the N03 uptake in plasma membranes. On the basis of above findings, some relations between nitrate uptake and its assimilation inside the cell are suggested. Since IgG fragments only slightly changed the N03 absorption in vesicles whereas the activity of plasmalemma associated nitrate reductase was strongly repressed, we concluded that the PM-NR is not structurally involved in the nitrate transport through the membrane.

  9. Prevention of hemodynamic and vascular albumin filtration changes in diabetic rats by aldose reductase inhibitors

    International Nuclear Information System (INIS)

    This study investigated hemodynamic changes in diabetic rats and their relationship to changes in vascular albumin permeation and increased metabolism of glucose to sorbitol. The effects of 6 wk of streptozocin-induced diabetes and three structurally different inhibitors of aldose reductase were examined on (1) regional blood flow (assessed with 15-microns 85Sr-labeled microspheres) and vascular permeation by 125I-labeled bovine serum albumin (BSA) and (2) glomerular filtration rate (assessed by plasma clearance of 57Co-labeled EDTA) and urinary albumin excretion (determined by radial immunodiffusion assay). In diabetic rats, blood flow was significantly increased in ocular tissues (anterior uvea, posterior uvea, retina, and optic nerve), sciatic nerve, kidney, new granulation tissue, cecum, and brain. 125I-BSA permeation was increased in all of these tissues except brain. Glomerular filtration rate and 24-h urinary albumin excretion were increased 2- and 29-fold, respectively, in diabetic rats. All three aldose reductase inhibitors completely prevented or markedly reduced these hemodynamic and vascular filtration changes and increases in tissue sorbitol levels in the anterior uvea, posterior uvea, retina, sciatic nerve, and granulation tissue. These observations indicate that early diabetes-induced hemodynamic changes and increased vascular albumin permeation and urinary albumin excretion are aldose reductase-linked phenomena. Discordant effects of aldose reductase inhibitors on blood flow and vascular albumin permeation in some tissues suggest that increased vascular albumin permeation is not entirely attributable to hemodynamic change

  10. Purification and characterization of a novel carbonyl reductase isolated from Rhodococcus erythropolis.

    Science.gov (United States)

    Zelinski, T; Peters, J; Kula, M R

    1994-04-15

    During growth on n-tetradecane a novel NADH-dependent carbonyl reductase is induced in the Gram-positive bacterium Rhodococcus erythropolis (Peters, P., Zelinski, T. and Kula, M.R. (1992) Appl. Microbiol. Biotechnol. 38, 334-340). The enzyme has been purified to homogeneity using fractional pH precipitation, anion exchange chromatography and affinity chromatography. The isoelectric point of the oxidoreductase is 4.4. The apparent molecular mass of the native enzyme is 161 kDa, that of the subunits 40 kDa as determined by SDS gel electrophoresis. A tetrameric structure of the carbonyl reductase is consistent with these results. Important biochemical data concerning the application of the reductase are: a broad pH-optimum, temperature optimum at 40 degrees C and stability at room temperature for more than 5 days. The oxidoreductase accepted as substrate aliphatic and aromatic ketones, keto esters (esters of keto carboxylic acids) and halogenated carbonyl compounds and reduced them to the corresponding hydroxyl compounds with (S)-configuration with more than 98% enantiomeric excess. The NAD(+)-dependent oxidation of primary alcohols was not catalyzed by the carbonyl reductase, whereas secondary alcohols and hydroxy acid esters were oxidized to the corresponding carbonyl compounds at about 10-fold slower reaction rates compared to the reduction. PMID:7764739

  11. Design and synthesis of novel, conformationally restricted HMG-CoA reductase inhibitors.

    Science.gov (United States)

    Pfefferkorn, Jeffrey A; Choi, Chulho; Song, Yuntao; Trivedi, Bharat K; Larsen, Scott D; Askew, Valerie; Dillon, Lisa; Hanselman, Jeffrey C; Lin, Zhiwu; Lu, Gina; Robertson, Andrew; Sekerke, Catherine; Auerbach, Bruce; Pavlovsky, Alexander; Harris, Melissa S; Bainbridge, Graeme; Caspers, Nicole

    2007-08-15

    Using structure-based design, a novel series of conformationally restricted, pyrrole-based inhibitors of HMG-CoA reductase were discovered. Leading analogs demonstrated potent inhibition of cholesterol synthesis in both in vitro and in vivo models and may be useful for the treatment of hypercholesterolemia and related lipid disorders. PMID:17574411

  12. Cloning and expression of Candida guilliermondii xylose reductase gene (xyl1) in Pichia pastoris.

    Science.gov (United States)

    Handumrongkul, C; Ma, D P; Silva, J L

    1998-04-01

    A xylose reductase gene (xyl1) of Candida guilliermondii ATCC 20118 was cloned and characterized. The open reading frame of xyl1 contained 954 nucleotides encoding a protein of 317 amino acids with a predicted molecular mass of 36 kDa. The derived amino acid sequence of C. guilliermondii xylose reductase was 70.4% homologous to that of Pichia stipitis. The gene was placed under the control of an alcohol oxidase promoter (AOX1) and integrated into the genome of a methylotrophic yeast, Pichia pastoris. Methanol induced the expression of the 36-kDa xylose reductase in both intracellular and secreted expression systems. The expressed enzyme preferentially utilized NADPH as a cofactor and was functional both in vitro and in vivo. The different cofactor specificity between P. pastoris and C. guilliermondii xylose reductases might be due to the difference in the numbers of histidine residues and their locations between the two proteins. The recombinant was able to ferment xylose, and the maximum xylitol accumulation (7.8 g/l) was observed when the organism was grown under aerobic conditions. PMID:9615481

  13. HMG-coenzyme A reductase inhibition, type 2 diabetes, and bodyweight

    DEFF Research Database (Denmark)

    Swerdlow, Daniel I; Preiss, David; Kuchenbaecker, Karoline B;

    2015-01-01

    BACKGROUND: Statins increase the risk of new-onset type 2 diabetes mellitus. We aimed to assess whether this increase in risk is a consequence of inhibition of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), the intended drug target. METHODS: We used single nucleotide polymorphisms in the HMGCR...

  14. Thioredoxin reductase is a key factor in the oxidative stress response of Lactobacillus plantarum WCFS1

    NARCIS (Netherlands)

    Mariela Serrano, L.; Molenaar, D.; Wels, M.; Teusink, B.; Bron, P.A.; Vos, W.M. de; Smid, E.J.

    2007-01-01

    ABSTRACT: BACKGROUND: Thioredoxin (TRX) is a powerful disulfide oxido-reductase that catalyzes a wide spectrum of redox reactions in the cell. The aim of this study is to elucidate the role of the TRX system in the oxidative stress response in Lactobacillus plantarum WCFS1. RESULTS: We have identifi

  15. The 5,10-methylenetetrahydrofolate reductase C677T polymorphism interacts with smoking to increase homocysteine.

    NARCIS (Netherlands)

    Brown, K.S.; Kluijtmans, L.A.J.; Young, I.S.; Murray, L.; McMaster, D.; Woodside, J.; Yarnell, J.W.; Boreham, C.A.; McNulty, H.; Strain, J.J.; McPartlin, J.; Scott, J.M.; Mitchell, L.E.; Whitehead, A.S.

    2004-01-01

    Elevated homocysteine is a risk marker for several human pathologies. Risk factors for elevated homocysteine include low folate and homozygosity for the T allele of the 5,10-methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism. Because nitric oxide may inhibit folate catabolism and endothe

  16. REGULATION OF NITRATE REDUCTASE ACTIVITY IN RICE (ORYZA SATIVA L. BY GROWTH REGULATORS

    Directory of Open Access Journals (Sweden)

    S HEMALATHA

    2002-12-01

    Full Text Available The effect of three growth regulators, namely kinetin, 6 benzyl adenine, 2 chloro ethyl trimethyl ammonium chloride at three concentrations (10-6 M, 5 x 10-5 M 10-4 M was studied on the catalytic activity of nitrate reductase in green and etiolated seedlings. A concentration of 5 x 10-5 M was optimal for all the growth regulators treatments. All the growth regulators stimulated nitrate reductase activity effectively at 5 x 10-5M concentration in both etiolated and green seedlings and had an additive effect when supplemented by NO-3 up to 140% to 160%. The 99.2% and 93.4% inhibition of nitrate reductase activity resulted in development of etiolated and green seedlings, respectively when treated with eukaryotic 80S ribosome protein synthesis inhibitor cycloheximide. Prokaryotic 70S inhibitor chloromphenicol did not have any effect on measured parameters. Actinomycin D, a RNA synthesis inhibitor also inhibited the enzyme activity as 80s inhibitors (Green 80%, etiolated 98%. One may suggest from this that both DNA and protein synthesis are involved in the induction of nitrate reductase activity. The differential effect of aminoacids was observed on enzyme activity in combination with growth regulators.

  17. NADPH-dependent D-aldose reductases and xylose fermentation in Fusarium oxysporum

    DEFF Research Database (Denmark)

    Panagiotou, Gianni; Christakopoulos, P.

    2004-01-01

    Two aldose (xylose) reductases (ARI and ARII) from Fusarium oxysporum were purified and characterized. The native ARI was a monomer with M-r 41000, pI 5.2 and showed a 52-fold preference for NADPH over NADH, while ARII was homodimeric with a subunit of M-r 37000, pI 3.6 and a 60-fold preference...

  18. Sensing nitrite through a pseudoazurin-nitrite reductase electron transfer relay

    NARCIS (Netherlands)

    Astier, Y; Canters, GW; Davis, JJ; Hill, HAO; Verbeet, MP; Wijma, HJ

    2005-01-01

    Nitrite is converted to nitric oxide by haem or copper-containing enzymes in denitrifying bacteria during the process of denitrification. In designing an efficient biosensor, this enzymic turnover must be quantitatively assessed. The enzyme nitrite reductase from Alcaligenes faecalis contains a redo

  19. Allosteric control of internal electron transfer in cytochrome cd1 nitrite reductase

    DEFF Research Database (Denmark)

    Farver, Ole; Kroneck, Peter M H; Zumft, Walter G;

    2003-01-01

    Cytochrome cd1 nitrite reductase is a bifunctional multiheme enzyme catalyzing the one-electron reduction of nitrite to nitric oxide and the four-electron reduction of dioxygen to water. Kinetics and thermodynamics of the internal electron transfer process in the Pseudomonas stutzeri enzyme have...

  20. Kinetic properties and inhibition of Trypanosoma cruzi 3-hydroxy-3-methylglutaryl CoA reductase

    DEFF Research Database (Denmark)

    Hurtado-Guerrrero, Ramón; Pena Diaz, Javier; Montalvetti, Andrea; Ruiz-Pérez, Luis M; González-Pacanowska, Dolores

    2002-01-01

    A detailed kinetic analysis of the recombinant soluble enzyme 3-hydroxy-3-methylglutaryl CoA reductase (HMGR) from Trypanosoma cruzi has been performed. The enzyme catalyzes the normal anabolic reaction and the reductant is NADPH. It also catalyzes the oxidation of mevalonate but at a lower propo...

  1. In Silico Docking studies of Aldose Reductase Inhibitory activity of selected Flavonoids

    Directory of Open Access Journals (Sweden)

    Muthuswamy Umamaheswari

    2012-09-01

    Full Text Available New drugs for the inhibition of the enzyme aldose reductase are in development and they have to be screened before being considered for preclinical and clinical evaluation. The current study deals with the evaluation of the cyclooxygenase inhibitory activity of flavonoids using in silico docking studies. In this perspective, flavonoids like Farobin-A, Gericudranin- B, Glaziovianin-A, Rutin, and Xanthotoxin were selected. Epalrestat, a known aldose reductase inhibitor was used as the standard. Docking results showed that all the selected flavonoids showed binding energy ranging between -7.91 kcal/mol to - 5.08 kcal/mol when compared with that of the standard (-5.59 kcal/mol. Intermolecular energy (- 9.11 kcal/mol to -8.66 kcal/mol and inhibition constant (1.58 μM to 187.37 μM of the ligands also coincide with the binding energy. Xanthotoxin contributed better aldose reductase inhibitory activity because of its structural parameters. Further studies are required to develop potent aldose reductase inhibitors for the treatment of diabetes.

  2. EFFECT OF LINDANE ON INTESTINAL NITROREDUCTASE, AZO REDUCTASE, B-GLUCURONIDASE, DECHLORINASE AND DEHYDROCHLORINASE ACTIVITY

    Science.gov (United States)

    The effect of daily p.o. injections of 20 mg/kg lindane on nitroreductase, azo reductase, B-glucuronidase, dechlorinase and dehydrochlorinase enzyme activity in the rat intestinal tract vas investigated after 2 weeks and 5 weeks of treatment. Antibiotics were administered to half...

  3. Calorimetric and spectroscopic investigations of the thermal denaturation of wild type nitrite reductase

    NARCIS (Netherlands)

    Stirpe, A; Guzzi, R; Wijma, H; Verbeet, MP; Canters, GW; Sportelli, L

    2005-01-01

    Nitrite reductase (NiR) is a multicopper protein, with a trimeric structure containing two types of copper site: type I is present in each subunit whereas type 2 is localized at the subunits interface. The paper reports on the thermal behaviour of wild type NiR from Alcaligenes faecalis S-6. The tem

  4. Structural and transcriptional analysis of plant genes encoding the bifunctional lysine ketoglutarate reductase saccharopine dehydrogenase enzyme

    Science.gov (United States)

    The analysis of a wheat lysine ketoglutarate reductase – saccharopine dehydrogenase (LKR/SDH) gene and comparative structural and functional analyses among available plant genes provides new information on this important gene. Both the structure of the LKR/SDH gene and the immediately adjacent genes...

  5. Biliverdin Reductase-A correlates with inducible nitric oxide synthasein in atorvastatin treated aged canine brain

    Institute of Scientific and Technical Information of China (English)

    Fabio Di Domenico; Marzia Perluigi; Eugenio Barone

    2013-01-01

    Alzheimer’s disease is a neurodegenerative disorder characterized by progressive cognitive impairment and neuropathology. Recent preclinical and epidemiological studies proposed statins as a possible therapeutic drug for Alzheimer’s disease, but the exact mechanisms of action are stil unknown. Biliverdin reductase-A is a pleiotropic enzyme involved in cel ular stress responses. It not only transforms biliverdin-IX alpha into the antioxidant bilirubin-IX alpha but its serine/threonine/tyrosine kinase activity is able to modulate cel signaling networks. We previously reported the beneficial effects of atorvastatin treatment on biliverdin reductase-A and heme oxygenase-1 in the brains of a well characterized pre-clinical model of Alzheimer’s disease, aged beagles, together with observed improvement in cognition. Here we extend our knowledge of the effects of atorvastatin on inducible nitric oxide synthase in parietal cortex, cerebel um and liver of the same animals. We demonstrated that atorvastatin treatment (80 mg/day for 14.5 months) to aged beagles selectively increased inducible nitric oxide synthase in the parietal cortex but not in the cerebel um. In contrast, inducible nitric oxide synthase protein levels were significantly decreased in the liver. Significant positive correlations were found between biliverdin reductase-A and inducible nitric oxide synthase as wel as heme oxygenase-1 protein levels in the parietal cortex. The opposite was observed in the liver. Inducible nitric oxide synthase up-regulation in the parietal cortex was positively associated with improved biliverdin reductase-A functions, whereas the oxidative-induced impairment of biliverdin reductase-A in the liver negatively affected inducible nitric oxide synthase expression, thus suggesting a role for biliverdin reductase-A in atorvastatin-dependent inducible nitric oxide synthase changes. Interestingly, increased inducible nitric oxide synthase levels in the parietal cortex were not

  6. Annotating Enzymes of Uncertain Function: The Deacylation of d-Amino Acids by Members of the Amidohydrolase Superfamily

    Energy Technology Data Exchange (ETDEWEB)

    Cummings, J.; Fedorov, A; Xu, C; Brown, S; Fedorov, E; Babbitt, P; Almo, S; Raushel, F

    2009-01-01

    The catalytic activities of three members of the amidohydrolase superfamily were discovered using amino acid substrate libraries. Bb3285 from Bordetella bronchiseptica, Gox1177 from Gluconobacter oxidans, and Sco4986 from Streptomyces coelicolor are currently annotated as d-aminoacylases or N-acetyl-d-glutamate deacetylases. These three enzymes are 22-34% identical to one another in amino acid sequence. Substrate libraries containing nearly all combinations of N-formyl-d-Xaa, N-acetyl-d-Xaa, N-succinyl-d-Xaa, and l-Xaa-d-Xaa were used to establish the substrate profiles for these enzymes. It was demonstrated that Bb3285 is restricted to the hydrolysis of N-acyl-substituted derivatives of d-glutamate. The best substrates for this enzyme are N-formyl-d-glutamate (k{sub cat}/K{sub m} = 5.8 x 10{sup 6} M{sup -1} s{sup -1}), N-acetyl-d-glutamate (k{sub cat}/K{sub m} = 5.2 x 10{sup 6} M{sup -1} s{sup -1}), and l-methionine-d-glutamate (k{sub cat}/K{sub m} = 3.4 x 10{sup 5} M{sup -1} s{sup -1}). Gox1177 and Sco4986 preferentially hydrolyze N-acyl-substituted derivatives of hydrophobic d-amino acids. The best substrates for Gox1177 are N-acetyl-d-leucine (k{sub cat}/K{sub m} = 3.2 x 104 M{sup -1} s-1), N-acetyl-d-tryptophan (kcat/Km = 4.1 x 104 M-1 s-1), and l-tyrosine-d-leucine (kcat/Km = 1.5 x 104 M-1 s-1). A fourth protein, Bb2785 from B. bronchiseptica, did not have d-aminoacylase activity. The best substrates for Sco4986 are N-acetyl-d-phenylalanine and N-acetyl-d-tryptophan. The three-dimensional structures of Bb3285 in the presence of the product acetate or a potent mimic of the tetrahedral intermediate were determined by X-ray diffraction methods. The side chain of the d-glutamate moiety of the inhibitor is ion-paired to Arg-295, while the {alpha}-carboxylate is ion-paired with Lys-250 and Arg-376. These results have revealed the chemical and structural determinants for substrate specificity in this protein. Bioinformatic analyses of an additional {approx}250

  7. Annotating enzymes of uncertain function: the deacylation of D-amino acids by members of the amidohydrolase superfamily.

    Science.gov (United States)

    Cummings, Jennifer A; Fedorov, Alexander A; Xu, Chengfu; Brown, Shoshana; Fedorov, Elena; Babbitt, Patricia C; Almo, Steven C; Raushel, Frank M

    2009-07-14

    The catalytic activities of three members of the amidohydrolase superfamily were discovered using amino acid substrate libraries. Bb3285 from Bordetella bronchiseptica, Gox1177 from Gluconobacter oxidans, and Sco4986 from Streptomyces coelicolor are currently annotated as d-aminoacylases or N-acetyl-d-glutamate deacetylases. These three enzymes are 22-34% identical to one another in amino acid sequence. Substrate libraries containing nearly all combinations of N-formyl-d-Xaa, N-acetyl-d-Xaa, N-succinyl-d-Xaa, and l-Xaa-d-Xaa were used to establish the substrate profiles for these enzymes. It was demonstrated that Bb3285 is restricted to the hydrolysis of N-acyl-substituted derivatives of d-glutamate. The best substrates for this enzyme are N-formyl-d-glutamate (k(cat)/K(m) = 5.8 x 10(6) M(-1) s(-1)), N-acetyl-d-glutamate (k(cat)/K(m) = 5.2 x 10(6) M(-1) s(-1)), and l-methionine-d-glutamate (k(cat)/K(m) = 3.4 x 10(5) M(-1) s(-1)). Gox1177 and Sco4986 preferentially hydrolyze N-acyl-substituted derivatives of hydrophobic d-amino acids. The best substrates for Gox1177 are N-acetyl-d-leucine (k(cat)/K(m) = 3.2 x 10(4) M(-1) s(-1)), N-acetyl-d-tryptophan (k(cat)/K(m) = 4.1 x 10(4) M(-1) s(-1)), and l-tyrosine-d-leucine (k(cat)/K(m) = 1.5 x 10(4) M(-1) s(-1)). A fourth protein, Bb2785 from B. bronchiseptica, did not have d-aminoacylase activity. The best substrates for Sco4986 are N-acetyl-d-phenylalanine and N-acetyl-d-tryptophan. The three-dimensional structures of Bb3285 in the presence of the product acetate or a potent mimic of the tetrahedral intermediate were determined by X-ray diffraction methods. The side chain of the d-glutamate moiety of the inhibitor is ion-paired to Arg-295, while the alpha-carboxylate is ion-paired with Lys-250 and Arg-376. These results have revealed the chemical and structural determinants for substrate specificity in this protein. Bioinformatic analyses of an additional approximately 250 sequences identified as members of this group

  8. Biochemical and antitumor activity of trimidox, a new inhibitor of ribonucleotide reductase.

    Science.gov (United States)

    Szekeres, T; Gharehbaghi, K; Fritzer, M; Woody, M; Srivastava, A; van't Riet, B; Jayaram, H N; Elford, H L

    1994-01-01

    Trimidox (3,4,5-trihydroxybenzamidoxime), a newly synthesized analog of didox (N,3,4-trihydroxybenzamide) reduced the activity of ribonucleotide reductase (EC 1.17.4.1) in extracts of L1210 cells by 50% (50% growth-inhibitory concentration, IC50) at 5 microM, whereas hydroxyurea, the only ribonucleotide reductase inhibitor in clinical use, exhibited an IC50 of 500 microM. Ribonucleotide reductase activity was also measured in situ by incubating L1210 cells for 24 h with trimidox at 7.5 microM, a concentration that inhibits cell proliferation by 50% (IC50) or at 100 microM for 2 h; these concentrations resulted in a decrease in enzyme activity to 22% and 50% of the control value, respectively. Trimidox and hydroxyurea were cytotoxic to L1210 cells with IC50 values of 7.5 and 50 microM, respectively. Versus ribonucleotide reductase, trimidox and hydroxyurea yielded IC50 values of 12 and 87 microM, respectively. A dose-dependent increase in life span was observed in mice bearing intraperitoneally transplanted L1210 tumors. Trimidox treatment (200 mg/kg; q1dx9) significantly increased the life span of mice bearing L1210 leukemia (by 82% in male mice and 112% in female mice). The anti-tumor activity appeared more pronounced in female mice than in male mice. Viewed in concert, these findings suggest that trimidox is a new and potent inhibitor of ribonucleotide reductase and that it is a promising candidate for the chemotherapy of cancer in humans. PMID:8174204

  9. Respiratory detoxification of nitric oxide by the cytochrome c nitrite reductase of Escherichia coli.

    Science.gov (United States)

    Poock, Susannah R; Leach, Emily R; Moir, James W B; Cole, Jeffrey A; Richardson, David J

    2002-06-28

    Nitric oxide is a key element in host defense against invasive pathogens. The periplasmic cytochrome c nitrite reductase (NrfA) of Escherichia coli catalyzes the respiratory reduction of nitrite, but in vitro studies have shown that it can also reduce nitric oxide. The physiological significance of the latter reaction in vivo has never been assessed. In this study the reduction of nitric oxide by Escherichia coli was measured in strains active or deficient in periplasmic nitrite reduction. Nrf(+) cells, harvested from cultures grown anaerobically, possessed a nitric-oxide reductase activity with physiological electron donation of 60 nmol min(-1) x mg dry wt(-1), and an in vivo turnover number of NrfA of 390 NO* s(-1) was calculated. Nitric-oxide reductase activity could not be detected in Nrf(-) strains. Comparison of the anaerobic growth of Nrf(+) and Nrf(-) strains revealed a higher sensitivity to nitric oxide in the NrfA(-) strains. A higher sensitivity to the nitrosating agent S-nitroso-N-acetyl penicillamine (SNAP) was also observed in agar plate disk-diffusion assays. Oxygen respiration by E. coli was also more sensitive to nitric oxide in the Nrf(-) strains compared with the Nrf(+) parent strain. The results demonstrate that active periplasmic cytochrome c nitrite reductase can confer the capacity for nitric oxide reduction and detoxification on E. coli. Genomic analysis of many pathogenic enteric bacteria reveals the presence of nrf genes. The present study raises the possibility that this reflects an important role for the cytochrome c nitrite reductase in nitric oxide management in oxygen-limited environments. PMID:11960983

  10. Conversion of NfsA, the Major Escherichia coli Nitroreductase, to a Flavin Reductase with an Activity Similar to That of Frp, a Flavin Reductase in Vibrio harveyi, by a Single Amino Acid Substitution

    Science.gov (United States)

    Zenno, Shuhei; Kobori, Toshiro; Tanokura, Masaru; Saigo, Kaoru

    1998-01-01

    NfsA is the major oxygen-insensitive nitroreductase of Escherichia coli, similar in amino acid sequence to Frp, a flavin reductase of Vibrio harveyi. Here, we show that a single amino acid substitution at position 99, which may destroy three hydrogen bonds in the putative active center, transforms NfsA from a nitroreductase into a flavin reductase that is as active as the authentic Frp and a tartrazine reductase that is 30-fold more active than wild-type NfsA. PMID:9440535

  11. Involvement of nitrate reductase and pyoverdine in competitiveness of Pseudomonas fluorescens strain C7R12 in soil.

    Science.gov (United States)

    Mirleau, P; Philippot, L; Corberand, T; Lemanceau, P

    2001-06-01

    Involvement of nitrate reductase and pyoverdine in the competitiveness of the biocontrol strain Pseudomonas fluorescens C7R12 was determined, under gnotobiotic conditions, in two soil compartments (bulk and rhizosphere soil), with the soil being kept at two different values of matric potential (-1 and -10 kPa). Three mutants affected in the synthesis of either the nitrate reductase (Nar(-)), the pyoverdine (Pvd(-)), or both (Nar(-) Pvd(-)) were used. The Nar(-) and Nar(-) Pvd(-) mutants were obtained by site-directed mutagenesis of the wild-type strain and of the Pvd(-) mutant, respectively. The selective advantage given by nitrate reductase and pyoverdine to the wild-type strain was assessed by measuring the dynamic of each mutant-to-total-inoculant (wild-type strain plus mutant) ratio. All three mutants showed a lower competitiveness than the wild-type strain, indicating that both nitrate reductase and pyoverdine are involved in the fitness of P. fluorescens C7R12. The double mutant presented the lowest competitiveness. Overall, the competitive advantages given to C7R12 by nitrate reductase and pyoverdine were similar. However, the selective advantage given by nitrate reductase was more strongly expressed under conditions of lower aeration (-1 kPa). In contrast, the selective advantage given by nitrate reductase and pyoverdine did not differ in bulk and rhizosphere soil, indicating that these bacterial traits are not specifically involved in the rhizosphere competence but rather in the saprophytic ability of C7R12 in soil environments. PMID:11375173

  12. Domain swapping in the low-similarity isomerase/hydratase superfamily: the crystal structure of rat mitochondrial Delta3, Delta2-enoyl-CoA isomerase.

    Science.gov (United States)

    Hubbard, Paul A; Yu, Wenfeng; Schulz, Horst; Kim, Jung-Ja P

    2005-06-01

    Two monofunctional Delta(3), Delta(2)-enoyl-CoA isomerases, one in mitochondria (mECI) and the other in both mitochondria and peroxisomes (pECI), belong to the low-similarity isomerase/hydratase superfamily. Both enzymes catalyze the movement of a double bond from C3 to C2 of an unsaturated acyl-CoA substrate for re-entry into the beta-oxidation pathway. Mutagenesis has shown that Glu165 of rat mECI is involved in catalysis; however, the putative catalytic residue in yeast pECI, Glu158, is not conserved in mECI. To elucidate whether Glu165 of mECI is correctly positioned for catalysis, the crystal structure of rat mECI has been solved. Crystal packing suggests the enzyme is trimeric, in contrast to other members of the superfamily, which appear crystallographically to be dimers of trimers. The polypeptide fold of mECI, like pECI, belongs to a subset of this superfamily in which the C-terminal domain of a given monomer interacts with its own N-terminal domain. This differs from that of crotonase and 1,4-dihydroxy-2-naphtoyl-CoA synthase, whose C-terminal domains are involved in domain swapping with an adjacent monomer. The structure confirms Glu165 as the putative catalytic acid/base, positioned to abstract the pro-R proton from C2 and reprotonate at C4 of the acyl chain. The large tunnel-shaped active site cavity observed in the mECI structure explains the relative substrate promiscuity in acyl-chain length and stereochemistry. Comparison with the crystal structure of pECI suggests the catalytic residues from both enzymes are spatially conserved but not in their primary structures, providing a powerful reminder of how catalytic residues cannot be determined solely by sequence alignments. PMID:15883186

  13. Characterization of a gonad-specific transforming growth factor-beta superfamily member differentially expressed during the reproductive cycle of the oyster Crassostrea gigas

    OpenAIRE

    Fleury, Elodie; Fabioux, Caroline; Lelong, C.; Favrel, P; Huvet, Arnaud

    2008-01-01

    Through differential screening between oyster families selected for high and low summer survival, we have characterized a new transforming growth factor-beta (TGF-beta) superfamily member. This novel factor, named oyster-gonadal-TGF beta-like (og-TGF beta-like), is synthesized as a 307 amino acid precursor and displays 6 of the 7 characteristic cysteine residues of the C-terminal, mature peptide. Sequence comparison revealed that og-TGF beta-like has a low percentage of identity with other kn...

  14. Type II restriction endonuclease R.Eco29kI is a member of the GIY-YIG nuclease superfamily

    Directory of Open Access Journals (Sweden)

    Feder Marcin

    2007-07-01

    Full Text Available Abstract Background The majority of experimentally determined crystal structures of Type II restriction endonucleases (REases exhibit a common PD-(D/EXK fold. Crystal structures have been also determined for single representatives of two other folds: PLD (R.BfiI and half-pipe (R.PabI, and bioinformatics analyses supported by mutagenesis suggested that some REases belong to the HNH fold. Our previous bioinformatic analysis suggested that REase R.Eco29kI shares sequence similarities with one more unrelated nuclease superfamily, GIY-YIG, however so far no experimental data were available to support this prediction. The determination of a crystal structure of the GIY-YIG domain of homing endonuclease I-TevI provided a template for modeling of R.Eco29kI and prompted us to validate the model experimentally. Results Using protein fold-recognition methods we generated a new alignment between R.Eco29kI and I-TevI, which suggested a reassignment of one of the putative catalytic residues. A theoretical model of R.Eco29kI was constructed to illustrate its predicted three-dimensional fold and organization of the active site, comprising amino acid residues Y49, Y76, R104, H108, E142, and N154. A series of mutants was constructed to generate amino acid substitutions of selected residues (Y49A, R104A, H108F, E142A and N154L and the mutant proteins were examined for their ability to bind the DNA containing the Eco29kI site 5'-CCGCGG-3' and to catalyze the cleavage reaction. Experimental data reveal that residues Y49, R104, E142, H108, and N154 are important for the nuclease activity of R.Eco29kI, while H108 and N154 are also important for specific DNA binding by this enzyme. Conclusion Substitutions of residues Y49, R104, H108, E142 and N154 predicted by the model to be a part of the active site lead to mutant proteins with strong defects in the REase activity. These results are in very good agreement with the structural model presented in this work and with our

  15. Glutathione Reductase of Vacuole. Comparison of Glutathione Reductase Activity of Vacuole and Tissue Extract of Red Beet Root (Beta vulgaris L.

    Directory of Open Access Journals (Sweden)

    E.V. Pradedova

    2016-02-01

    Full Text Available Glutathione reductase (GR, EC 1.8.1.7 is the enzyme that reduces oxidized glutathione (GSSG and thus regulates the redox state of glutathione (GSH/GSSG. GR has been studied in most plants. This enzyme has been identified in chloroplasts and cytosol, so these cellular compartments are considered to be the main place of the enzyme localization. In the same time, just a little is known about GR vacuoles. There are no conclusive evidences to prove the presence or absence of this enzyme in the vacuoles. GR activity was found in the vacuoles of red beet root cells (Beta vulgaris L.. The level of activity, the optimum pH and isoenzyme composition of GR were compared in the vacuoles and tissue extract of beet root. Vacuolar GR activity was quite high, it was 1.5-2 times higher than the activity of the tissue extract. Enzyme pH optimum of all the objects were identical. pH-optimum depend on the pyridine nucleotide nature: pH 7.0-8.0 was an optimal range with NADPH; pH 5.0 – with NADH. GR activity of the vacuoles and tissue extracts decreased in the presence of a noncompetitive inhibitor 1-chloro-2.4-dinitrobenzene (CDNB, indicating the specificity of this enzymatic reaction. Two bands with glutathione reductase activity have been identified in the vacuoles and tissue extracts using zymography method to determine the enzymatic activity in PAAG after electrophoresis of proteins. Belonging to the GR isoforms of these bands was confirmed by enzyme immunoassay (Western blotting. The electric mobility of isoforms of the study objects did not differ significantly. It is concluded that the biochemical characteristics of vacuolar glutathione reductase were substantially identical to the biochemical characteristics of other localization GR.

  16. Glutathione Reductase of Vacuole. Comparison of Glutathione Reductase Activity of Vacuole and Tissue Extract of Red Beet Root (Beta vulgaris L.)

    OpenAIRE

    E.V. Pradedova; O.D. Nimaeva; Salyaev, R. K.

    2016-01-01

    Glutathione reductase (GR, EC 1.8.1.7) is the enzyme that reduces oxidized glutathione (GSSG) and thus regulates the redox state of glutathione (GSH/GSSG). GR has been studied in most plants. This enzyme has been identified in chloroplasts and cytosol, so these cellular compartments are considered to be the main place of the enzyme localization. In the same time, just a little is known about GR vacuoles. There are no conclusive evidences to prove the presence or absence of this enzyme in the ...

  17. Synthesis and accumulation of aromatic aldehydes in an engineered strain of Escherichia coli.

    Science.gov (United States)

    Kunjapur, Aditya M; Tarasova, Yekaterina; Prather, Kristala L J

    2014-08-20

    Aromatic aldehydes are useful in numerous applications, especially as flavors, fragrances, and pharmaceutical precursors. However, microbial synthesis of aldehydes is hindered by rapid, endogenous, and redundant conversion of aldehydes to their corresponding alcohols. We report the construction of an Escherichia coli K-12 MG1655 strain with reduced aromatic aldehyde reduction (RARE) that serves as a platform for aromatic aldehyde biosynthesis. Six genes with reported activity on the model substrate benzaldehyde were rationally targeted for deletion: three genes that encode aldo-keto reductases and three genes that encode alcohol dehydrogenases. Upon expression of a recombinant carboxylic acid reductase in the RARE strain and addition of benzoate during growth, benzaldehyde remained in the culture after 24 h, with less than 12% conversion of benzaldehyde to benzyl alcohol. Although individual overexpression results demonstrated that all six genes could contribute to benzaldehyde reduction in vivo, additional experiments featuring subset deletion strains revealed that two of the gene deletions were dispensable under the conditions tested. The engineered strain was next investigated for the production of vanillin from vanillate and succeeded in preventing formation of the byproduct vanillyl alcohol. A pathway for the biosynthesis of vanillin directly from glucose was introduced and resulted in a 55-fold improvement in vanillin titer when using the RARE strain versus the wild-type strain. Finally, synthesis of the chiral pharmaceutical intermediate L-phenylacetylcarbinol (L-PAC) was demonstrated from benzaldehyde and glucose upon expression of a recombinant mutant pyruvate decarboxylase in the RARE strain. Beyond allowing accumulation of aromatic aldehydes as end products in E. coli, the RARE strain expands the classes of chemicals that can be produced microbially via aldehyde intermediates. PMID:25076127

  18. The Molecular Biology, Biochemistry, and Physiology of Human Steroidogenesis and Its Disorders

    Science.gov (United States)

    Auchus, Richard J.

    2011-01-01

    Steroidogenesis entails processes by which cholesterol is converted to biologically active steroid hormones. Whereas most endocrine texts discuss adrenal, ovarian, testicular, placental, and other steroidogenic processes in a gland-specific fashion, steroidogenesis is better understood as a single process that is repeated in each gland with cell-type-specific variations on a single theme. Thus, understanding steroidogenesis is rooted in an understanding of the biochemistry of the various steroidogenic enzymes and cofactors and the genes that encode them. The first and rate-limiting step in steroidogenesis is the conversion of cholesterol to pregnenolone by a single enzyme, P450scc (CYP11A1), but this enzymatically complex step is subject to multiple regulatory mechanisms, yielding finely tuned quantitative regulation. Qualitative regulation determining the type of steroid to be produced is mediated by many enzymes and cofactors. Steroidogenic enzymes fall into two groups: cytochrome P450 enzymes and hydroxysteroid dehydrogenases. A cytochrome P450 may be either type 1 (in mitochondria) or type 2 (in endoplasmic reticulum), and a hydroxysteroid dehydrogenase may belong to either the aldo-keto reductase or short-chain dehydrogenase/reductase families. The activities of these enzymes are modulated by posttranslational modifications and by cofactors, especially electron-donating redox partners. The elucidation of the precise roles of these various enzymes and cofactors has been greatly facilitated by identifying the genetic bases of rare disorders of steroidogenesis. Some enzymes not principally involved in steroidogenesis may also catalyze extraglandular steroidogenesis, modulating the phenotype expected to result from some mutations. Understanding steroidogenesis is of fundamental importance to understanding disorders of sexual differentiation, reproduction, fertility, hypertension, obesity, and physiological homeostasis. PMID:21051590

  19. Role of DNA Methylation on the Expression of the Anthracycline Metabolizing Enzyme AKR7A2 in Human Heart.

    Science.gov (United States)

    Hoefer, Carrie C; Quiñones-Lombraña, Adolfo; Blair, Rachael Hageman; Blanco, Javier G

    2016-04-01

    The intracardiac synthesis of anthracycline alcohol metabolites by aldo-keto reductases (AKRs) contributes to the pathogenesis of anthracycline-related cardiotoxicity. AKR7A2 is the most abundant anthracycline reductase in hearts from donors with and without Down syndrome (DS), and its expression varies between individuals (≈tenfold). We investigated whether DNA methylation impacts AKR7A2 expression in hearts from donors with (n = 11) and without DS (n = 30). Linear models were used to test for associations between methylation status and cardiac AKR7A2 expression. In hearts from donors without DS, DNA methylation status at CpG site -865 correlated with AKR7A2 mRNA (Pearson's regression coefficient, r = -0.4051, P = 0.0264) and AKR7A2 protein expression (r = -0.5818, P = 0.0071). In heart tissue from donors with DS, DNA methylation status at CpG site -232 correlated with AKR7A2 protein expression (r = 0.8659, P = 0.0025). Multiple linear regression modeling revealed that methylation at several CpG sites is associated with the synthesis of cardiotoxic daunorubicinol. AKR7A2 methylation status in lymphoblastoid cell lines from donors with and without DS was examined to explore potential parallelisms between cardiac tissue and lymphoid cells. These results suggest that DNA methylation impacts AKR7A2 expression and the synthesis of cardiotoxic daunorubicinol. PMID:25962911

  20. Three-dimensional modeling of the I-TevI homing endonuclease catalytic domain, a GIY-YIG superfamily member, using NMR restraints and Monte Carlo dynamics.

    Science.gov (United States)

    Bujnicki, J M; Rotkiewicz, P; Kolinski, A; Rychlewski, L

    2001-10-01

    Using a recent version of the SICHO algorithm for in silico protein folding, we made a blind prediction of the tertiary structure of the N-terminal, independently folded, catalytic domain (CD) of the I-TevI homing endonuclease, a representative of the GIY-YIG superfamily of homing endonucleases. The secondary structure of the I-TevI CD has been determined using NMR spectroscopy, but computational sequence analysis failed to detect any protein of known tertiary structure related to the GIY-YIG nucleases (Kowalski et al., Nucleic Acids Res., 1999, 27, 2115-2125). To provide further insight into the structure-function relationships of all GIY-YIG superfamily members, including the recently described subfamily of type II restriction enzymes (Bujnicki et al., Trends Biochem. Sci., 2000, 26, 9-11), we incorporated the experimentally determined and predicted secondary and tertiary restraints in a reduced (side chain only) protein model, which was minimized by Monte Carlo dynamics and simulated annealing. The subsequently elaborated full atomic model of the I-TevI CD allows the available experimental data to be put into a structural context and suggests that the GIY-YIG domain may dimerize in order to bring together the conserved residues of the active site. PMID:11739889

  1. D-Ribulose 5-Phosphate 3-Epimerase: Functional and Structural Relationships to Members of the Ribulose-Phosphate Binding (beta/alpha)8-Barrel Superfamily

    Energy Technology Data Exchange (ETDEWEB)

    Akana,J.; Federov, A.; Federov, E.; Novak, W.; Babbitt, P.; Almo, S.; Gerlt, J.

    2006-01-01

    The 'ribulose phosphate binding' superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common ({beta}/{alpha}){sub 8}-barrel ancestor. The superfamily includes D-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-L-gulonate 6-phosphate decarboxylase (KGPDC), members of the OMPDC suprafamily, as well as enzymes involved in histidine and tryptophan biosynthesis that utilize phosphorylated metabolites as substrates. We now report studies of the functional and structural relationships of RPE to the members of the superfamily. As suggested by the results of crystallographic studies of the RPEs from rice and Plasmodium falciparum, the RPE from Streptococcus pyogenes is activated by Zn{sup 2+} which binds with a stoichiometry of one ion per polypeptide. Although wild type RPE has a high affinity for Zn{sup 2+} and inactive apoenzyme cannot be prepared, the affinity for Zn{sup 2+} is decreased by alanine substitutions for the two histidine residues that coordinate the Zn{sup 2+} ion (H34A and H67A); these mutant proteins can be prepared in an inactive, metal-free form and activated by exogenous Zn{sup 2+}. The crystal structure of the RPE was solved at 1.8 Angstroms resolution in the presence of D-xylitol 5-phosphate, an inert analogue of the D-xylulose 5-phosphate substrate. This structure suggests that the 2,3-enediolate intermediate in the 1,1-proton transfer reaction is stabilized by bidentate coordination to the Zn{sup 2+} that also is liganded to His 34, Asp 36, His 67, and Asp 176; the carboxylate groups of the Asp residues are positioned also to function as the acid/base catalysts. Although the conformation of the bound analogue resembles those of ligands bound in the active sites of OMPDC and KGPDC, the identities of the active site residues that coordinate the essential Zn{sup 2+} and participate as acid/base catalysts

  2. Regulation of Escherichia coli fumarate reductase (frdABCD) operon expression by respiratory electron acceptors and the fnr gene product.

    OpenAIRE

    Jones, H. M.; Gunsalus, R P

    1987-01-01

    The fumarate reductase enzyme complex, encoded by the frdABCD operon, allows Escherichia coli to utilize fumarate as a terminal electron acceptor for anaerobic oxidative phosphorylation. To analyze the expression of fumarate reductase, protein and operon fusions were constructed between the frdA and the lacZ genes and introduced onto the E. coli chromosome at the lambda attachment site. Expression of beta-galactosidase from either fusion was increased 10-fold during anaerobic versus aerobic c...

  3. Involvement of Nitrate Reductase and Pyoverdine in Competitiveness of Pseudomonas fluorescens Strain C7R12 in Soil

    OpenAIRE

    Mirleau, Pascal; Philippot, Laurent; Corberand, Thérèse; Lemanceau, Philippe

    2001-01-01

    Involvement of nitrate reductase and pyoverdine in the competitiveness of the biocontrol strain Pseudomonas fluorescens C7R12 was determined, under gnotobiotic conditions, in two soil compartments (bulk and rhizosphere soil), with the soil being kept at two different values of matric potential (−1 and −10 kPa). Three mutants affected in the synthesis of either the nitrate reductase (Nar−), the pyoverdine (Pvd−), or both (Nar− Pvd−) were used. The Nar− and Nar− Pvd− mutants were obtained by si...

  4. Cancer metabolism and oxidative stress: Insights into carcinogenesis and chemotherapy via the non-dihydrofolate reductase effects of methotrexate

    OpenAIRE

    Joshua A. Hess; Mohamad K. Khasawneh

    2015-01-01

    Methotrexate has been in use as an anti-cancer agent for over 60 years. Though inhibition of dihydrofolate reductase is its best known mechanisms of action, its non-dihydrofolate reductase dependent mechanisms disrupt metabolic pathways resulting in a depletion of NAD(P)H and increasing oxidative stress. These mechanisms highlight a novel dependence of cancer cells on their metabolic abnormalities to buffer oxidative stress and chemotherapeutic agents interfere with these cellular abilities. ...

  5. A novel twist on molecular interactions between thioredoxin and nicotinamide adenine dinucleotide phosphate-dependent thioredoxin reductase

    DEFF Research Database (Denmark)

    Kirkensgaard, Kristine Groth; Hägglund, Per; Shahpiri, Azar;

    2013-01-01

    The ubiquitous disulfide reductase thioredoxin (Trx) regulates several important biological processes such as seed germination in plants. Oxidized cytosolic Trx is regenerated by nicotinamide adenine dinucleotide phosphate (NADPH)-dependent thioredoxin reductase (NTR) in a multistep transfer of r....... Overall, the findings suggest that NTR:Trx interactions in different biological systems are fine-tuned by multiple intermolecular contacts. Proteins 2014; 82:607-619. (c) 2013 Wiley Periodicals, Inc....

  6. Boletus edulis Nitrite Reductase Reduces Nitrite Content of Pickles and Mitigates Intoxication in Nitrite-intoxicated Mice

    OpenAIRE

    Weiwei Zhang; Guoting Tian; Shanshan Feng; Jack Ho Wong; Yongchang Zhao; Xiao Chen; Hexiang Wang; Tzi Bun Ng

    2015-01-01

    Pickles are popular in China and exhibits health-promoting effects. However, nitrite produced during fermentation adversely affects health due to formation of methemoglobin and conversion to carcinogenic nitrosamine. Fruiting bodies of the mushroom Boletus edulis were capable of inhibiting nitrite production during pickle fermentation. A 90-kDa nitrite reductase (NiR), demonstrating peptide sequence homology to fungal nitrite reductase, was isolated from B. edulis fruiting bodies. The optimum...

  7. Loss of the tyrosyl radical in mouse ribonucleotide reductase by (-)-epicatechin

    International Nuclear Information System (INIS)

    The flavonoid (-)-epicatechin was previously demonstrated to interfere with tyrosine nitration by peroxynitrite [Biochem. Biophys. Res. Commun. 285 (2001) 782]. This effect was hypothesized to be based upon an interaction of epicatechin with a transiently generated tyrosyl radical. In the present study, using electron paramagnetic resonance, we demonstrate that (-)-epicatechin is capable of destabilizing the tyrosyl radical of the mouse ribonucleotide reductase R2 component. First-order rate constants for the disappearance of tyrosyl radical signals were 1 x 10-4 and 2 x 10-4 s-1for epicatechin and hydroxyurea, a well-known tyrosyl radical scavenger, respectively. In keeping with scavenging the ribonucleotide reductase tyrosyl radical, cellular production of deoxyribonucleotides and DNA synthesis were impaired by (-)-epicatechin in normal human keratinocytes and in human squamous carcinoma cells

  8. Positive pleiotropic effects of HMG-CoA reductase inhibitor on vitiligo

    Directory of Open Access Journals (Sweden)

    Jobin Jean

    2004-05-01

    Full Text Available Abstract Background HMG-CoA reductase inhibitors (statins are commonly used in medicine to control blood lipid disorder. Large clinical trials have demonstrated that statins greatly reduces cardiovascular-related morbidity and mortality in patients with and without coronary artery disease. Also, the use of HMG-CoA reductase inhibitors has been reported to have immunosuppressive effects. Case presentation We describe an unusual case of regression of vitiligo in a patient treated with high dose simvastatin. The relation between simvastatin and regression of vitiligo in this case report may be related to the autoimmune pathophysiology of the disease. Conclusion This unexpected beneficial impact provides another scientific credence to the hypothesis that immune mechanisms play a role in the development of vitiligo and that the use of statins as immuno-modulator could be of use not only for treatment relative to organ transplant but in other pathologies such as vitiligo.

  9. Purification, crystallization and preliminary X-ray crystallographic analysis of xylose reductase from Candida tropicalis

    International Nuclear Information System (INIS)

    The crystallization of xylose reductase from C. tropicalis is reported. Xylose reductase (XR), which requires NADPH as a co-substrate, catalyzes the reduction of d-xylose to xylitol, which is the first step in the metabolism of d-xylose. The detailed three-dimensional structure of XR will provide a better understanding of the biological significance of XR in the efficient production of xylitol from biomass. XR of molecular mass 36.6 kDa from Candida tropicalis was crystallized using the hanging-drop vapour-diffusion method. According to X-ray diffraction data from C. tropicalis XR crystals at 2.91 Å resolution, the unit cell belongs to space group P31 or P32. Preliminary analysis indicated the presence of four XR molecules in the asymmetric unit, with 68.0% solvent content

  10. Expression Analysis of Dihydroflavonol 4-Reductase Genes Involved in Anthocyanin Biosynthesis in Purple Grains of Wheat

    Institute of Scientific and Technical Information of China (English)

    Mao-Sen LIU; Fang WANG; Yu-Xiu DONG; Xian-Sheng ZHANG

    2005-01-01

    The grain color of wheat (Triticum aestivum L.) is an important characteristic in crop production.Dihydroflavonol 4-reductase genes (DFR) encode the key enzyme dihydroflavonol 4-reductase, which is involved in the pigmentation of plant tissues. To investigate the molecular mechanism of anthocyanin deposition in grains of wheat, we determined the expression of the wheat DFR gene in purple grains of cultivar Heimai 76. The results showed that DFR transcripts were localized in the seed coat of purple grains rather than in the pericarp, whereas anthocyanins were accumulated in both tissues of purple grains,suggesting that anthocyanin deposition was mainly regulated at the transcriptional level. Overexpression of the TaDFR-A gene in Arabidopsis showed that TaDFR-A was responsible for the pigmentation of Arabidopsis plant tissues, indicating TaDFR-A gene has the same role in Arabidopsis.

  11. Discovery of pyrrole-based hepatoselective ligands as potent inhibitors of HMG-CoA reductase.

    Science.gov (United States)

    Bratton, Larry D; Auerbach, Bruce; Choi, Chulho; Dillon, Lisa; Hanselman, Jeffrey C; Larsen, Scott D; Lu, Gina; Olsen, Karl; Pfefferkorn, Jeffrey A; Robertson, Andrew; Sekerke, Catherine; Trivedi, Bharat K; Unangst, Paul C

    2007-08-15

    In an effort to identify hepatoselective inhibitors of HMG-CoA reductase, two series of pyrroles were synthesized and evaluated. Efforts were made to modify (3R,5R)-7-[3-(4-fluorophenyl)-1-isopropyl-4-phenyl-5-phenylcarbamoyl-1H-pyrrol-2-yl]-3,5-dihydroxy-heptanoic acid sodium salt 30 in order to reduce its lipophilicity and therefore increase hepatoselectivity. Two strategies that were explored were replacement of the lipophilic 3-phenyl substituent with either a polar function (pyridyl series) or with lower alkyl substituents (lower alkyl series) and attachment of additional polar moieties at the 2-position of the pyrrole ring. One compound was identified to be both highly hepatoselective and active in vivo. We report the discovery, synthesis, and optimization of substituted pyrrole-based hepatoselective ligands as potent inhibitors of HMG-CoA reductase for reducing low density lipoprotein cholesterol (LDL-c) in the treatment of hypercholesterolemia. PMID:17560788

  12. The properties of monoclonal antibody against sepiapterin reductase from fat body of the silkworm, Bombyx mori.

    Science.gov (United States)

    Iino, T; Sawada, H; Gyure, W L; Tsusué, M

    1992-12-01

    A specific monoclonal antibody prepared for the 29-kDa a subunit of silkworm fat body sepiapterin reductase (SPR) was able to recognize the subunit in crude extract of fat body after SDS treatment. Although SPR from the silkworm fat body has biochemical properties similar to those reported for SPR from mammalian sources, especially rat erythrocytes, the antibody failed to recognize the 28-kDa subunit of rat erythrocyte SPR. This result indicates that SPR from silkworm fat body has a different amino-acid sequence from that of the rat erythrocyte enzyme. Sepiapterin reductase activity has not been found in crude extract of fat body from the silkworm mutant lemon. Although the antibody recognized only 29-kDa protein in the crude extract of silkworm fat body from normal strain after SDS-treatment, the antibody recognized only an approximately 80-kDa protein in the crude extract of the lemon mutant after SDS-treatment. PMID:1292509

  13. 5alpha-Reductase inhibitor treatment of prostatic diseases: background and practical implications.

    Science.gov (United States)

    Dörsam, J; Altwein, J

    2009-01-01

    This literature review discusses the theoretical background of 5alpha-reductase inhibitor (5ARI) treatment and the resulting clinical implications. A Medline-based search for peer-reviewed articles addressing 5ARIs, benign prostatic hyperplasia and prostate cancer was performed. The 5ARIs Finasteride and Dutasteride, which specifically inhibit the production of dihydrotestosterone by acting as competitive inhibitors of 5alpha-reductase, are clinically well tolerated and represent an effective treatment option for benign prostatic obstruction. Finasteride is the first compound which has a proven efficacy in chemoprevention of prostate cancer. The aim of this review was to elucidate, if there are sufficient data available to point out clinically relevant differences between the drugs. Both compounds achieve a significant reduction of prostate volume, an improvement of symptoms and a lower risk of acute urinary retention. Whether the different pharmacokinetic and pharmacodynamic properties of Finasteride and Dutasteride are of clinical importance cannot be judged at this time. PMID:19030020

  14. Mechanism of biological denitrification inhibition: procyanidins induce an allosteric transition of the membrane-bound nitrate reductase through membrane alteration.

    Science.gov (United States)

    Bardon, Clément; Poly, Franck; Piola, Florence; Pancton, Muriel; Comte, Gilles; Meiffren, Guillaume; Haichar, Feth El Zahar

    2016-05-01

    Recently, it has been shown that procyanidins fromFallopiaspp. inhibit bacterial denitrification, a phenomenon called biological denitrification inhibition (BDI). However, the mechanisms involved in such a process remain unknown. Here, we investigate the mechanisms of BDI involving procyanidins, using the model strainPseudomonas brassicacearumNFM 421. The aerobic and anaerobic (denitrification) respiration, cell permeability and cell viability ofP. brassicacearumwere determined as a function of procyanidin concentration. The effect of procyanidins on the bacterial membrane was observed using transmission electronic microscopy. Bacterial growth, denitrification, NO3- and NO2-reductase activity, and the expression of subunits of NO3- (encoded by the genenarG) and NO2-reductase (encoded by the genenirS) under NO3or NO2were measured with and without procyanidins. Procyanidins inhibited the denitrification process without affecting aerobic respiration at low concentrations. Procyanidins also disturbed cell membranes without affecting cell viability. They specifically inhibited NO3- but not NO2-reductase.Pseudomonas brassicacearumresponded to procyanidins by over-expression of the membrane-bound NO3-reductase subunit (encoded by the genenarG). Our results suggest that procyanidins can specifically inhibit membrane-bound NO3-reductase inducing enzymatic conformational changes through membrane disturbance and thatP. brassicacearumresponds by over-expressing membrane-bound NO3-reductase. Our results lead the way to a better understanding of BDI. PMID:26906096

  15. The prenyltransferase UBIAD1 is the target of geranylgeraniol in degradation of HMG CoA reductase.

    Science.gov (United States)

    Schumacher, Marc M; Elsabrouty, Rania; Seemann, Joachim; Jo, Youngah; DeBose-Boyd, Russell A

    2015-01-01

    Schnyder corneal dystrophy (SCD) is an autosomal dominant disorder in humans characterized by abnormal accumulation of cholesterol in the cornea. SCD-associated mutations have been identified in the gene encoding UBIAD1, a prenyltransferase that synthesizes vitamin K2. Here, we show that sterols stimulate binding of UBIAD1 to the cholesterol biosynthetic enzyme HMG CoA reductase, which is subject to sterol-accelerated, endoplasmic reticulum (ER)-associated degradation augmented by the nonsterol isoprenoid geranylgeraniol through an unknown mechanism. Geranylgeraniol inhibits binding of UBIAD1 to reductase, allowing its degradation and promoting transport of UBIAD1 from the ER to the Golgi. CRISPR-CAS9-mediated knockout of UBIAD1 relieves the geranylgeraniol requirement for reductase degradation. SCD-associated mutations in UBIAD1 block its displacement from reductase in the presence of geranylgeraniol, thereby preventing degradation of reductase. The current results identify UBIAD1 as the elusive target of geranylgeraniol in reductase degradation, the inhibition of which may contribute to accumulation of cholesterol in SCD. PMID:25742604

  16. Nitrate reductase, nitrite reductase, glutamine synthetase, and glutamate synthase expression and activity in response to different nitrogen sources in nitrogen-starved wheat seedlings.

    Science.gov (United States)

    Balotf, Sadegh; Kavoosi, Gholamreza; Kholdebarin, Bahman

    2016-03-01

    The objective of this study was to examine the expression and activity of nitrate reductase (NR, EC 1.7.1.1), nitrite reductase (NiR, EC 1.7.2.2), glutamine synthetase (GS, EC 6.3.1.2), and glutamate synthase (GOGAT, EC 1.4.7.1) in response to potassium nitrate, ammonium chloride, and ammonium nitrate in nitrogen-starved wheat seedlings. Plants were grown in standard nutrient solution for 17 days and then subjected to nitrogen starvation for 7 days. The starved plants were supplied with potassium nitrate ammonium nitrate and ammonium chloride (50 mM) for 4 days and the leaves were harvested. The relative expression of NR, NiR, GS, and GOGAT as well as the enzyme activities were investigated. Nitrogen starvation caused a significant decrease both in transcript levels and in NR, NiR, GS, and GOGAT activities. Potassium nitrate and ammonium nitrate treatments restored NR, NiR, GS, and GOGAT expressions and activities. Ammonium chloride increased only the expressions and activities of GS and GOGAT in a dose-dependent manner. The results of our study highlight the differential effects between the type and the amount of nitrogen salts on NR, NiR, GS, and GOGAT activities in wheat seedlings while potassium nitrate being more effective. PMID:25676153

  17. Metal complexes with 2-acetylpyridine-N(4)-orthochlorophenylthiosemicarbazone: cytotoxicity and effect on the enzymatic activity of thioredoxin reductase and glutathione reductase.

    Science.gov (United States)

    Parrilha, Gabrieli L; Ferraz, Karina S O; Lessa, Josane A; de Oliveira, Kely Navakoski; Rodrigues, Bernardo L; Ramos, Jonas P; Souza-Fagundes, Elaine M; Ott, Ingo; Beraldo, Heloisa

    2014-09-12

    Metal complexes with 2-acetylpyridine-N(4)-orthochlorophenylthiosemicarbazone (H2Ac4oClPh) were assayed for their cytotoxicity against MCF-7 breast adenocarcinoma and HT-29 colon carcinoma cells. The thiosemicarbazone and most of the complexes were highly cytotoxic. H2Ac4oClPh and its gallium(III) and tin(IV) complexes did not show any inhibitory activity against thioredoxin reductase (TrxR) and glutathione reductase (GR). The palladium(II), platinum(II) and bismuth(III) complexes inhibited TrxR at micromolar concentrations but not GR. The antimony(III) and gold(III) complexes strongly inhibited TrxR at submicromolar doses with GR inhibition at higher concentrations. The selectivity of these complexes for TrxR suggests metal binding to a selenol residue in the active site of the enzyme. TrxR inhibition is likely a contributing factor to the mode of action of the gold and antimony derivatives. PMID:25058344

  18. Theoretical Calculations of the Catalytic Triad in Short-Chain Alcohol Dehydrogenases/Reductases

    OpenAIRE

    Gani, Osman A B S M; Adekoya, Olayiwola A; Giurato, Laura; Spyrakis, Francesca; Cozzini, Pietro; Guccione, Salvatore; Winberg, Jan-Olof; Sylte, Ingebrigt

    2007-01-01

    Three highly conserved active site residues (Ser, Tyr, and Lys) of the family of short-chain alcohol dehydrogenases/reductases (SDRs) were demonstrated to be essential for catalytic activity and have been denoted the catalytic triad of SDRs. In this study computational methods were adopted to study the ionization properties of these amino acids in SDRs from Drosophila melanogaster and Drosophila lebanonensis. Three enzyme models, with different ionization scenarios of the catalytic triad that...

  19. Sulfate reduction in higher plants: Molecular evidence for a novel 5′-adenylylsulfate reductase

    OpenAIRE

    SETYA, AMIT; Murillo, Michael; Leustek, Thomas

    1996-01-01

    Sulfate-assimilating organisms reduce inorganic sulfate for Cys biosynthesis. There are two leading hypotheses for the mechanism of sulfate reduction in higher plants. In one, adenosine 5′-phosphosulfate (APS) (5′-adenylylsulfate) sulfotransferase carries out reductive transfer of sulfate from APS to reduced glutathione. Alternatively, the mechanism may be similar to that in bacteria in which the enzyme, 3′-phosphoadenosine-5′-phosphosulfate (PAPS) reductase, catalyzes...

  20. Methylenetetrahydrofolate reductase homozygous mutation in a young boy with cerebellar infarction

    OpenAIRE

    Alberto Spalice; Francesca Del Balzo; Francesco Massimo Perla; Enrico Properzi; Carla Carducci; Italo Antonozzi; Paola Iannetti

    2009-01-01

    Posterior circulation vascular occlusive disease in children is a rare and uncommonly reported event. Among the numerous risk factors, the methylenetetrahydrofolate reductase (MTHFR) mutation is considered to be a common genetic cause of thrombosis in adults and children. Recently, a link between the MTHFR mutation and cerebrovascular disorders was reported in children. Diffusion tensor imaging (DTI) is a great improvement on magnetic resonance imaging (MRI), making the in vivo anatomical and...

  1. Lemierre's syndrome with double heterozygote status in the methylenetetrahydrofolate reductase gene

    Institute of Scientific and Technical Information of China (English)

    Mostafa Behpour-Oskooee; Abdollah Karimi; Shirin Sayyahfar

    2014-01-01

    Background: There are some risk factors being more vulnerable to Lemierre's syndrome such as a hypercoagulable state. Methods: We report a rare case of Lemierre's syndrome with ethmoid and maxillary sinusitis, bilateral mastoiditis, and sigmoid sinus thrombosis. Results: Genetic study revealed a double heterozygote status in the methylenetetrahydrofolate reductase gene including C677T and A1298C. Conclusion: It is suggested to screen patients with Lemierre's syndrome for a hypercoagulable state to consider anticoagulant therapy.

  2. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.

    OpenAIRE

    Endo, T.; Uratani, B; Freese, E.

    1983-01-01

    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic ch...

  3. The stability of the three transmembrane and the four transmembrane human vitamin K epoxide reductase models

    Science.gov (United States)

    Wu, Sangwook

    2016-04-01

    The three transmembrane and the four transmembrane helix models are suggested for human vitamin K epoxide reductase (VKOR). In this study, we investigate the stability of the human three transmembrane/four transmembrane VKOR models by employing a coarse-grained normal mode analysis and molecular dynamics simulation. Based on the analysis of the mobility of each transmembrane domain, we suggest that the three transmembrane human VKOR model is more stable than the four transmembrane human VKOR model.

  4. Dimethyl sulfoxide reductase activity by anaerobically grown Escherichia coli HB101.

    OpenAIRE

    Bilous, P T; Weiner, J H

    1985-01-01

    Escherichia coli grew anaerobically on a minimal medium with glycerol as the carbon and energy source and dimethyl sulfoxide (DMSO) as the terminal electron acceptor. DMSO reductase activity, measured with an artificial electron donor (reduced benzyl viologen), was preferentially associated with the membrane fraction (77 +/- 10% total cellular activity). A Km for DMSO reduction of 170 +/- 60 microM was determined for the membrane-bound activity. Methyl viologen, reduced flavin mononucleotide,...

  5. Nitrate reductase and acid phosphatase activities as affected by inorganic phosphate in corn roots

    OpenAIRE

    Marie Kummerova; Józef Buczek

    2014-01-01

    The deficieny of inorganic phosphate in nutrient solution reduces by about 50 per cent NO3- absorption in corn seedlings, it decreases both in vitro and in vivo nitrate reductase (NR) activity, as well the potential and actual NR level and has a very weak effect on NR induction. Acid phosphatases activities increase in corn roots when the plants are grown in nutrient solution without phosphorus. We suggest that inorganic phosphate is required mainly for maintenance of NR activity rather, than...

  6. Induction of Glutathione Synthesis and Glutathione Reductase Activity by Abiotic Stresses in Maize and Wheat

    OpenAIRE

    Gabor Kocsy; Gabriella Szalai; Gabor Galiba

    2002-01-01

    The effect of different abiotic stresses (extreme temperatures and osmotic stress) on the synthesis of glutathione and hydroxymethylglutathione, on the ratio of the reduced to oxidised forms of these thiols (GSH/GSSG, hmGSH/hmGSSG), and on the glutathione reductase (GR) activity was studied in maize and wheat genotypes having different sensitivity to low temperature stress. Cold treatment induced a greater increase in total glutathione (TG) content and in GR activity in tolerant genotypes of ...

  7. Thioredoxin reductase-1 (TxnRd1) mediates curcumin-induced radiosensitization of squamous carcinoma cells

    OpenAIRE

    Javvadi, Prashanthi; Hertan, Lauren; Kosoff, Rachelle; Datta, Tatini; Kolev, Johann; Mick, Rosemarie; Tuttle, Stephen W; Koumenis, Constantinos

    2010-01-01

    Curcumin, a plant polyphenol, is a widely studied chemopreventive agent with demonstrated antitumor activities in preclinical studies and low toxicity profiles in multiple clinical trials against human malignancies. We previously demonstrated that curcumin radiosensitizes cervical tumor cells without increasing the cytotoxic effects of radiation on normal human fibroblasts. Here we report that an inhibitory activity of curcumin on the anti-oxidant enzyme Thioredoxin Reductase-1 (TxnRd1) is re...

  8. Tissue distribution and ontogeny of steroid 5 alpha-reductase isozyme expression.

    OpenAIRE

    Thigpen, A E; Silver, R I; Guileyardo, J M; Casey, M L; McConnell, J D; Russell, D W

    1993-01-01

    The synthesis of dihydrotestosterone is catalyzed by steroid 5 alpha-reductase isozymes, designated types 1 and 2. Mutation of type 2 results in male pseudohermaphroditism, in which the external genitalia are phenotypically female at birth. Two striking and unexplained features of this disorder are that external genitalia of affected males undergo virilization during puberty and that these individuals have less temporal hair regression. The tissue-specific and developmental expression pattern...

  9. Dicarbonyl L-Xylulose Reductase (DCXR), a “Moonlighting Protein” in the Bovine Epididymis

    OpenAIRE

    Akintayo, Ayodélé; Légaré, Christine; Sullivan, Robert

    2015-01-01

    During maturation and the acquisition of their fertilization potential, male germ cells are subjected to various sequential modifications that occur in the epididymis. Protein addition, reorganization or withdrawal, comprise some of these modifications. Dicarbonyl L-xylulose reductase (DCXR), a multifunctional protein involved in various enzymatic and protein interaction processes in different physiological systems, is one of the proteins added to spermatozoa in the epididymis. DCXR is a well...

  10. Methionine synthase reductase deficiency results in adverse reproductive outcomes and congenital heart defects in mice

    OpenAIRE

    Deng, Liyuan; Elmore, C. Lee; Lawrance, Andrea K.; Matthews, Rowena G.; Rozen, Rima

    2008-01-01

    Low dietary folate and polymorphisms in genes of folate metabolism can influence risk for pregnancy complications and birth defects. Methionine synthase reductase (MTRR) is required for activation of methionine synthase, a folate- and vitamin B12-dependent enzyme. A polymorphism in MTRR (p.I22M), present in the homozygous state in 25% of many populations, may increase risk for neural tube defects. To examine the impact of MTRR deficiency on early development and congenital heart defects, we u...

  11. Developmental expression of Xenopus short-chain dehydrogenase/reductase 3

    OpenAIRE

    Kam, Richard Kin Ting; Chen, Yonglong; Chan, Sun On; Chan, Wood Yee; Dawid, Igor B.; Hui ZHAO

    2010-01-01

    During early embryonic development, the retinoic acid signaling pathway coordinates with other signaling pathways to regulate body axis patterning and organogenesis. The production of retinoic acid requires two enzymatic reactions, the first of which is the oxidization of vitamin A (all-trans-retinol) to all-trans-retinal, mediated in part by the short-chain dehydrogenase/reductase. Through DNA microarrays, we have identified a gene in Xenopus laevis, which shares a high sequence similarity t...

  12. Differential expression of 5-alpha reductase isozymes in the prostate and its clinical implications

    OpenAIRE

    Kai Wang; Dong-Dong Fan; Song Jin; Nian-Zeng Xing; Yi-Nong Niu

    2014-01-01

    The development of human benign or malignant prostatic diseases is closely associated with androgens, primarily testosterone (T) and dihydrotestosterone (DHT). T is converted to DHT by 5-alpha reductase (5-AR) isozymes. Differential expression of 5-AR isozymes is observed in both human benign and malignant prostatic tissues. 5-AR inhibitors (5-ARI) are commonly used for the treatment of benign prostatic hyperplasia (BPH) and were once promoted as chemopreventive agents for prostate cancer (PC...

  13. Battling Prostate Cancer with 5-Alpha-Reductase Inhibitors: a Pyrrhic Victory?

    OpenAIRE

    Hoffman, Richard M.; Richard G. Roberts; Barry, Michael J.

    2011-01-01

    Given the relatively small impact of prostate cancer screening on cancer mortality, experts are now suggesting that chemoprevention with 5-alpha-reductase inhibitors (5-ARI) may be a more effective strategy for cancer control. Two large placebo-controlled randomized trials found that men receiving 5-ARI were about 25% less likely than controls to be detected with cancer. However, most cancers were detected on routine biopsies required by study protocols. The benefit from receiving 5-ARI was m...

  14. Clinical Effects of Discontinuing 5-Alpha Reductase Inhibitor in Patients With Benign Prostatic Hyperplasia

    OpenAIRE

    Kim, Won; Jung, Jae Hung; Kang, Tae Wook; Song, Jae Mann; Chung, Hyun Chul

    2014-01-01

    Purpose To assess changes in lower urinary tract symptoms (LUTS), prostate volume, and serum prostate-specific antigen (PSA) after discontinuation of 5-alpha reductase inhibitor (5ARI) combination therapy in patients with benign prostatic hyperplasia (BPH). Materials and Methods From December 2003 to December 2012, data were collected retrospectively from 81 men more than 40 years of age with moderate to severe BPH symptoms (International Prostate Symptom Score [IPSS]≥8). The men were classif...

  15. Targeting 5α-reductase for prostate cancer prevention and treatment

    OpenAIRE

    Nacusi, Lucas P.; Tindall, Donald J.

    2011-01-01

    Testosterone is the most abundant circulating androgen, and can be converted to dihydrotestosterone (DHT), a more potent androgen, by the 5α-reductase enzymes in target tissues. Current treatments for prostate cancer consist of reducing androgen levels by chemical or surgical castration or pure antiandrogen therapy that directly targets the androgen receptor (AR). Although these therapies reduce tumor burden and AR activity, the cancer inevitably recurs within 18–30 months. An approach target...

  16. 5-α reductase inhibitors and prostate cancer prevention: where do we turn now?

    OpenAIRE

    Hamilton Robert J; Freedland Stephen J

    2011-01-01

    Abstract With the lifetime risk of being diagnosed with prostate cancer so great, an effective chemopreventive agent could have a profound impact on the lives of men. Despite decades of searching for such an agent, physicians still do not have an approved drug to offer their patients. In this article, we outline current strategies for preventing prostate cancer in general, with a focus on the 5-α-reductase inhibitors (5-ARIs) finasteride and dutasteride. We discuss the two landmark randomized...

  17. Purification and Characterization of (Per)Chlorate Reductase from the Chlorate-Respiring Strain GR-1

    OpenAIRE

    Kengen, Servé W. M.; Rikken, Geoffrey B.; Hagen, Wilfred R.; van Ginkel, Cees G.; Stams, Alfons J. M.

    1999-01-01

    Strain GR-1 is one of several recently isolated bacterial species that are able to respire by using chlorate or perchlorate as the terminal electron acceptor. The organism performs a complete reduction of chlorate or perchlorate to chloride and oxygen, with the intermediate formation of chlorite. This study describes the purification and characterization of the key enzyme of the reductive pathway, the chlorate and perchlorate reductase. A single enzyme was found to catalyze both the chlorate-...

  18. Characterization of the Arsenate Respiratory Reductase from Shewanella sp. Strain ANA-3

    OpenAIRE

    Malasarn, Davin; Keeffe, Jennifer R.; Newman, Dianne K.

    2008-01-01

    Microbial arsenate respiration contributes to the mobilization of arsenic from the solid to the soluble phase in various locales worldwide. To begin to predict the extent to which As(V) respiration impacts arsenic geochemical cycling, we characterized the expression and activity of the Shewanella sp. strain ANA-3 arsenate respiratory reductase (ARR), the key enzyme involved in this metabolism. ARR is expressed at the beginning of the exponential phase and persists throughout the stationary ph...

  19. A Fluorimetric Readout Reporting the Kinetics of Nucleotide-Induced Human Ribonucleotide Reductase Oligomerization

    OpenAIRE

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A.; Aye, Yimon

    2014-01-01

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typicall...

  20. Novel octaheme cytochrome c tetrathionate reductase (OTR) from Shewanella oneidensis MR-1

    OpenAIRE

    Wu, Fei

    2010-01-01

    Octa-heme cytochrome c tetrathionate reductase (OTR) from Shewanella oneidensis MR-1 is a periplasmic protein and shows several extraordinary structural features around its active-site heme. OTR has been found able to catalyse the in vitro reduction of tetrathionate, nitrite, hydroxylamine and hydrogen peroxide. However the physiological function of this novel protein remains unknown. The subject of this thesis is the in vitro catalytic mechanism and the in vivo function of OTR...